Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 191 in window, 7893286 - 7893313, 28 bps 
B D                     Human  gcccctaattgctaagaagaatcctaag
B D                     Chimp  gcccctaattgctaagaagaatcctaag
B D                   Gorilla  gcccctaattgctaagaagaatcctaag
B D                 Orangutan  gcccctaattgctaagaagaatcctaag
B D                    Gibbon  gcccctaattgctaagaagaatcctaag
B D                    Rhesus  gcccctgattgctaagaagaatcctaag
B D       Crab-eating macaque  gcccctgattgctaagaagaatcctaag
B D                    Baboon  gcccctgattgctaagaagaatcctaag
B D              Green monkey  gcccctgattgctaagaagaatcctaag
B D                  Marmoset  gcccctaattgctaagaagaatcctaag
B D           Squirrel monkey  gcccctaattgctaagaagaatcctaag
B D                  Bushbaby  gcctctaattgctaagaagaatcctaag
           Chinese tree shrew  gcccctaattgctaagaagaatcctaag
B D                  Squirrel  gcccctaattgctaagaagaatcctaag
       Lesser Egyptian jerboa  gcccttgattgctaagaagaaccctaag
                 Prairie vole  gcccctaattgctaagaagaatcccaag
B D           Chinese hamster  gcccctaattgctaagaagaatcctaag
               Golden hamster  acccctgattgctaagaagaatcctaag
B D                     Mouse  gcccctaattgctaagaagaatcctaag
B D                       Rat  gcccttaattgctaagaagaatcctaag
B D            Naked mole-rat  gcccctaattgctaagaagaatcctaag
B D                Guinea pig  gcccctgattgctaagaagaaccctaag
                   Chinchilla  gcccctgattgcaaagaagaatcctaag
             Brush-tailed rat  gcccctgattgctaagaagaatcctaag
B D                    Rabbit  gcccctgatcgctaagaagaatcctaag
B D                      Pika  gcccctaattgctaagaagaatccgaag
B D                       Pig  gcccctgattgctaagaagaatcctaag
B D                    Alpaca  gcccctgatagctaagaagaatcctaag
               Bactrian camel  gcccctgatagctaagaagaatcctaag
B D                   Dolphin  gcccctgattgctaagaagaatcctaag
                 Killer whale  gcccctgattgctaagaagaatcctaag
             Tibetan antelope  gcccctgattgctaagaagaatcctaag
B D                       Cow  gcccctcattgctaagaagaatcctaag
B D                     Sheep  gcccctgattgctaagaagaatcctaag
                Domestic goat  gcccctgattgctaagaagaatcctaag
B D                     Horse  gcccctaattgctaagaagaatcctaag
B D          White rhinoceros  gcccctaattgctaagaagaatcctaag
B D                       Cat  gcccctgattgcgaagaagaatcctaag
B D                       Dog  gcccctgattgcaaagaagaatcctaag
B D                   Ferret   gcccctgatcgcgaagaagaatcctaag
B D                     Panda  gcccctgattgcgaagaagaatcctaag
               Pacific walrus  gcccctgattgcgaagaagaatcctaag
             Black flying-fox  gcccctaattgctaagaagaatcctaag
B D                   Megabat  gcccctaattgctaagaagaatcctaag
                Big brown bat  gcccctaattgctaagaagaatcctaag
         David's myotis (bat)  gcccctaattgctaagaagaatcctaag
B D                  Microbat  gcccctgattgctaagaagaatcctaag
B D                  Hedgehog  gcccctaattgctaagaagaatcccaag
B D                     Shrew  gcccctaattgctaagaagaatcctaag
              Star-nosed mole  gcccctaattgctaagaagaaccctaag
B D                  Elephant  gcctctaattgctaagaagaatcctaag
          Cape elephant shrew  gcccttgattgctaagaagaatcccaag
B D                   Manatee  gcccctaattgctaagaagaatcctaag
             Cape golden mole  gcccctgatcgctaagaagaatcctaag
B D                    Tenrec  gcccctcattgctaagaagaatccgaag
                     Aardvark  gcccctaattgctaagaaaaatcctaag
B D                 Armadillo  gcccctaattgctaagaagaatcctaag
B D                   Opossum  gcctctaattgctaagaagaatcccaag
B D           Tasmanian devil  gcccctgattgctaagaagaaccccaag
B D                   Wallaby  gcccctaatcgctaagaagaaccccaag
B D                  Platypus  gcctctcatcgccaagaagaacccaaag
  D               Rock pigeon  gcctctgatcgccaagaagaaccccaag
  D              Saker falcon  gcctctgatcgccaagaagaaccccaag
  D          Peregrine falcon  gcctctgatcgccaagaagaaccccaag
  D       Collared flycatcher  gcctctgattgccaagaagaaccccaag
  D    White-throated sparrow  gcctctgattgccaagaagaaccccaag
B D       Medium ground finch  gcccctgatcgccaagaagaaccccaag
B D               Zebra finch  gcctctgattgccaagaagaaccccaag
           Tibetan ground jay  gcccctgattgccaagaagaaccccaag
B D                Budgerigar  gcctctgattgccaagaagaaccccaag
  D                    Parrot  gccgctcattgcagccaagaaccctaaa
  D             Scarlet macaw  gcctctgatagccaagaagaaccccaag
  D              Mallard duck  gcctctgatcgccaagaagaaccccaag
B D                   Chicken  gcctctgattgccaagaagaaccccaag
B D                    Turkey  gcctctgattgccaagaagaaccccaag
B D        American alligator  gccattgatcgccaagaagaaccccaag
  D           Green seaturtle  gcctctcattgccaagaagaatcccaaa
  D            Painted turtle  gcctctcattgccaaaaagaaccccaag
  D  Chinese softshell turtle  gcctctcattgccaaaaagaaccccaag
  D    Spiny softshell turtle  gcctctcattgccaaaaagaaccccaag
B D                    Lizard  gcctcttattgccaaaaagaaccccaag
B D             X. tropicalis  gcctctcattgctaagaagaatcccaag
B D                Coelacanth  gcctctcatcgccaagaagaatccgaag
B D                 Tetraodon  gcccatgatcgccaagaagaaccccaag
B D                      Fugu  gcccatgattgcaaagaagaatcccaag
       Yellowbelly pufferfish  gcctttaattgcagctaagaatcccaaa
B D              Nile tilapia  gccgatgatcgccaagaagaaccctaag
          Princess of Burundi  gccgatgatcgccaagaagaaccctaag
        Burton's mouthbreeder  gccgatgatcgccaagaagaaccctaag
                  Zebra mbuna  gccgatgatcgccaagaagaaccctaag
          Pundamilia nyererei  gcctctcattgccaagaagaacccgaag
B D                    Medaka  gccaatgatcgccaagaagaaccccaag
           Southern platyfish  gccgatgatagccaagaagaacccgaag
B D               Stickleback  gccgatgatcgccaggaagaatcctaag
B D              Atlantic cod  gccgctcatcgccgctaagaaccccaag
B D                 Zebrafish  gcccatgattgctaagaagaaccctaaa
     Mexican tetra (cavefish)  gcctatgatagctaagaagaaccccaag
                  Spotted gar  gcccatgatcgccaaaaagaaccccaaa
                Weddell seal  ============================

Inserts between block 1 and 2 in window
  D            Scarlet macaw 1944bp

Alignment block 2 of 191 in window, 7893314 - 7893357, 44 bps 
B D                     Human  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                     Chimp  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                   Gorilla  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                 Orangutan  atcccaatgtccaagatgatgaccatccttggggccaaatggag
B D                    Gibbon  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                    Rhesus  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D       Crab-eating macaque  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                    Baboon  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D              Green monkey  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                  Marmoset  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D           Squirrel monkey  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                  Bushbaby  atcccaatgtctaagatgatgaccatccttggggctaagtggag
           Chinese tree shrew  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                  Squirrel  atcccaatgtctaagatgatgaccatccttggggccaagtggag
       Lesser Egyptian jerboa  atcccaatgtctaagatgatgaccatccttggggccaagtggag
                 Prairie vole  atcccaatgtcgaagatgatgaccatcctgggggccaagtggag
B D           Chinese hamster  atcccgatgtcaaagatgatgaccatcctgggggccaagtggag
               Golden hamster  atcccgatgtcgaagatgatgaccatcctgggggccaagtggag
B D                     Mouse  atcccgatgtcaaagatgatgaccatcctgggggccaagtggag
B D                       Rat  atcccgatgtcgaagatgatgaccatcctgggggccaagtggag
B D            Naked mole-rat  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                Guinea pig  atcccaatgtctaagatgatgaccatccttggggccaagtggag
                   Chinchilla  atcccaatgtctaagatgatgaccattcttggggccaagtggag
             Brush-tailed rat  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                    Rabbit  atcccaatgtccaagatgatgaccatccttggggccaagtggag
B D                      Pika  atcccgatgtctaaaatgatgaccattcttggggccaaatggag
B D                       Pig  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                    Alpaca  atcccaatgtcaaagatgatgaccatccttggggccaagtggag
               Bactrian camel  atcccaatgtcgaagatgatgaccatccttggggccaagtggag
B D                   Dolphin  atcccaatgtctaagatgatgaccatccttggggccaagtggag
                 Killer whale  atcccaatgtctaagatgatgaccatccttggggccaagtggag
             Tibetan antelope  atcccaatgtctaagatgatgaccattctcggggccaagtggag
B D                       Cow  atcccaatgtctaagatgatgaccattctcggggccaagtggag
B D                     Sheep  atcccaatgtctaagatgatgaccattctcggggccaagtggag
                Domestic goat  atcccaatgtctaagatgatgaccattctcggggccaagtggag
B D                     Horse  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D          White rhinoceros  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                       Cat  atcccgatgtctaagatgatgaccatccttggggccaagtggag
B D                       Dog  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                   Ferret   atcccaatgtctaagatgatgaccatcctcggggccaagtggag
B D                     Panda  atcccgatgtctaagatgatgaccatcctcggggccaagtggag
               Pacific walrus  atcccgatgtctaagatgatgaccatccttggggccaagtggag
             Black flying-fox  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                   Megabat  atcccaatgtctaagatgatgaccatccttggggccaagtggag
                Big brown bat  atcccaatgtctaagatgatgaccatccttggggccaagtggag
         David's myotis (bat)  atcccaatgtcgaagatgatgaccatccttggggccaagtggag
B D                  Microbat  atcccaatgtcgaagatgatgaccatccttggggccaagtggag
B D                  Hedgehog  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                     Shrew  atcccaatgtctaagatgatgactatccttggggccaaatggag
              Star-nosed mole  atcccaatgtccaagatgatgaccatcctcggggccaaatggag
B D                  Elephant  atcccaatgtctaaaatgatgaccatccttggggccaagtggag
          Cape elephant shrew  atcccaatgtctaaaatgatgaccatccttggggccaagtggag
B D                   Manatee  atcccaatgtctaagatgatgaccatccttggggccaagtggag
             Cape golden mole  atcccaatgtctaagatgatgaccatccttggagccaagtggag
B D                    Tenrec  atcccgatgtccaagatgatgaccatccttggggccaagtggag
                     Aardvark  atcccaatgtctaagatgatgaccatccttggggccaagtggag
B D                 Armadillo  atcccaatgtctaagatgatgaccatccttggggccaaatggag
B D                   Opossum  attccaatgtctaagatgatgacaatcctaggggctaagtggcg
B D           Tasmanian devil  attccaatgtctaagatgatgacaatcttaggggccaaatggcg
B D                   Wallaby  attccaatgtctaaaatgatgacaatcctaggggccaagtggcg
B D                  Platypus  atccccatgtccaagatgatgacggtgctcggggccaagtggcg
  D               Rock pigeon  atccccatgtccaagatgatgaccatcctgggcgccaagtggcg
  D              Saker falcon  atccccatgtccaagatgatgactgtgctcggtgccaagtggcg
  D          Peregrine falcon  atccccatgtccaagatgatgactgtgctcggtgccaagtggcg
  D       Collared flycatcher  atccccatgtccaagatgatgacagtgctcggtgccaagtggcg
  D    White-throated sparrow  atccccatgtccaagatgatgaccgtgctgggtgccaagtggcg
B D       Medium ground finch  atccccatgtccaagatgatgaccatcctgggggccaagtggag
B D               Zebra finch  atccccatgtccaagatgatgacggtgctcggtgccaagtggcg
           Tibetan ground jay  atccccatgtccaagatgatgacggtgctcggcgccaagtggcg
B D                Budgerigar  atccccatgtccaagatgatgacggtgctgggtgccaagtggcg
  D                    Parrot  atagcagtgtcaaagatgatgatggtactgggagccaaatggag
  D             Scarlet macaw  atagcagtgtcgaagatgatgatggtactgggagccaaatggag
  D              Mallard duck  atccccatgtccaagatgatgactgtgcttggggccaagtggcg
B D                   Chicken  atccccatgtccaagatgatgacagtgcttggtgccaagtggcg
B D                    Turkey  atccccatgtccaagatgatgactgtgcttggtgccaagtggcg
B D        American alligator  atccccatgtcaaagatgatgaccatcctaggcgccaagtggcg
  D           Green seaturtle  atccccatgtccaagatgatgacggtgcttggtgccaaatggcg
  D            Painted turtle  atccccatgtccaagatgatgaccatcctgggagccaagtggcg
  D  Chinese softshell turtle  atccccatgtccaagatgatgaccatccttggagccaagtggcg
  D    Spiny softshell turtle  atccccatgtccaagatgatgaccatccttggagccaagtggcg
B D                    Lizard  attccaatgtccaaaatgatgaccatcatgggagccaaatggcg
B D             X. tropicalis  attcccatgtccaagatgatgaccattctaggtgccaagtggag
B D                Coelacanth  attcccatgtccaagatgatgaccatcctcggtgccaagtggcg
B D                 Tetraodon  atccccatgtccaagatgatgaccatcttgggggtcaagtggag
B D                      Fugu  atccccatgtcaaagatgatgaccatcctgggggtgaagtggag
       Yellowbelly pufferfish  attgctgtatctaagatgatgacattaatgatggccaagtggag
B D              Nile tilapia  atccccatgtcaaagatgatgaccatcctgggggtcaagtggag
          Princess of Burundi  atccccatgtcaaagatgatgaccatcctgggggtcaagtggag
        Burton's mouthbreeder  atccccatgtcaaagatgatgaccatcctgggggtcaagtggag
                  Zebra mbuna  atccccatgtcaaagatgatgaccatcctgggggtcaagtggag
          Pundamilia nyererei  attcccatgtcaaagatgatgacagtgttaggggccaagtggcg
B D                    Medaka  atccccatgtcaaaaatgatgaccatcctgggggtcaaatggag
           Southern platyfish  atccccatgtcgaagatgatgaccatcctgggggccaagtggag
B D               Stickleback  atccccatgtcgaagatgatgaccatcctgggggccaagtggag
B D              Atlantic cod  atcgccgtgtctaagatgatgaccttgatgatggccaagtggcg
B D                 Zebrafish  atccccatgtccaagatgatgaccattcttggggccaaatggcg
     Mexican tetra (cavefish)  atccctatgtctaaaatgatgaccatcctgggagcgaaatggag
                  Spotted gar  atccccatgtccaagatgatgaccatcctaggtgccaagtggcg
                Weddell seal  ============================================

Alignment block 3 of 191 in window, 7893358 - 7893359, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ag
           Chinese tree shrew  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  ag
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  ag
B D                     Mouse  ag
B D                       Rat  ag
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  ag
B D                      Pika  ag
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                     Panda  ag
               Pacific walrus  ag
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ag
B D                     Shrew  ag
              Star-nosed mole  ag
B D                  Elephant  ag
          Cape elephant shrew  ag
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  ag
                     Aardvark  ag
B D                 Armadillo  ag
B D                   Opossum  ag
B D           Tasmanian devil  ag
B D                   Wallaby  ag
B D                  Platypus  ag
  D               Rock pigeon  cg
  D              Saker falcon  gg
  D          Peregrine falcon  gg
  D       Collared flycatcher  ag
  D    White-throated sparrow  ag
B D       Medium ground finch  gg
B D               Zebra finch  ag
           Tibetan ground jay  ag
B D                Budgerigar  tg
  D                    Parrot  ag
  D             Scarlet macaw  ag
  D              Mallard duck  ag
B D                   Chicken  ag
B D                    Turkey  ag
B D        American alligator  tg
  D           Green seaturtle  ag
  D            Painted turtle  gg
  D  Chinese softshell turtle  gg
  D    Spiny softshell turtle  gg
B D                    Lizard  gg
B D             X. tropicalis  gg
B D                Coelacanth  cg
B D                 Tetraodon  ag
B D                      Fugu  ag
       Yellowbelly pufferfish  ag
B D              Nile tilapia  gg
          Princess of Burundi  gg
        Burton's mouthbreeder  gg
                  Zebra mbuna  gg
          Pundamilia nyererei  gg
B D                    Medaka  gg
           Southern platyfish  gg
B D               Stickleback  gg
B D              Atlantic cod  cg
B D                 Zebrafish  gg
     Mexican tetra (cavefish)  ag
                  Spotted gar  tg
B D                   Ferret   NN
                Weddell seal  ==

Inserts between block 3 and 4 in window
  D   Spiny softshell turtle 55374bp

Alignment block 4 of 191 in window, 7893360 - 7893363, 4 bps 
B D                     Human  agtt
B D                     Chimp  agtt
B D                   Gorilla  agtt
B D                 Orangutan  agtt
B D                    Gibbon  agtt
B D                    Rhesus  agtt
B D       Crab-eating macaque  agtt
B D                    Baboon  agtt
B D              Green monkey  agtt
B D                  Marmoset  aatt
B D           Squirrel monkey  aatt
B D                  Bushbaby  agtt
           Chinese tree shrew  agtt
B D                  Squirrel  agtt
       Lesser Egyptian jerboa  agtt
                 Prairie vole  agtt
B D           Chinese hamster  agtt
               Golden hamster  agtt
B D                     Mouse  agtt
B D                       Rat  agtt
B D            Naked mole-rat  agtt
B D                Guinea pig  agtt
                   Chinchilla  agtt
             Brush-tailed rat  aatt
B D                    Rabbit  agtt
B D                      Pika  agtt
B D                       Pig  agtt
B D                    Alpaca  agtt
               Bactrian camel  agtt
B D                   Dolphin  agtt
                 Killer whale  agtt
             Tibetan antelope  agtt
B D                       Cow  agtt
B D                     Sheep  agtt
                Domestic goat  agtt
B D                     Horse  agtt
B D          White rhinoceros  agtt
B D                       Cat  agtt
B D                       Dog  agtt
B D                     Panda  agtt
               Pacific walrus  agtt
             Black flying-fox  agtt
B D                   Megabat  agtt
                Big brown bat  agtt
         David's myotis (bat)  agtt
B D                  Microbat  agtt
B D                  Hedgehog  agtt
B D                     Shrew  agtt
              Star-nosed mole  agtt
B D                  Elephant  agtt
          Cape elephant shrew  agtt
B D                   Manatee  agtt
             Cape golden mole  agtt
B D                    Tenrec  aatt
                     Aardvark  agtt
B D                 Armadillo  agtt
B D                   Opossum  aatt
B D           Tasmanian devil  aatt
B D                   Wallaby  aatt
B D                  Platypus  agtt
  D               Rock pigeon  agtt
  D              Saker falcon  agtt
  D          Peregrine falcon  agtt
  D       Collared flycatcher  agtt
  D    White-throated sparrow  agtt
B D       Medium ground finch  agtt
B D               Zebra finch  agtt
           Tibetan ground jay  agtt
B D                Budgerigar  agtt
  D                    Parrot  agtt
  D             Scarlet macaw  agtt
  D              Mallard duck  agtt
B D                   Chicken  agtt
B D                    Turkey  agtt
B D        American alligator  agtt
  D           Green seaturtle  aatt
  D            Painted turtle  agtt
  D  Chinese softshell turtle  agtt
  D    Spiny softshell turtle  aatt
B D                    Lizard  aatt
B D             X. tropicalis  aatt
B D                Coelacanth  agtt
B D                 Tetraodon  agtt
B D                      Fugu  agtt
       Yellowbelly pufferfish  agtt
B D              Nile tilapia  agtt
          Princess of Burundi  agtt
        Burton's mouthbreeder  agtt
                  Zebra mbuna  agtt
          Pundamilia nyererei  agtt
B D                    Medaka  aatt
           Southern platyfish  agtt
B D               Stickleback  ag-t
B D              Atlantic cod  agtt
B D                 Zebrafish  agtt
     Mexican tetra (cavefish)  agtt
                  Spotted gar  aatt
B D                   Ferret   NNNN
                Weddell seal  ====

Inserts between block 4 and 5 in window
  D              Rock pigeon 88bp

Alignment block 5 of 191 in window, 7893364 - 7893393, 30 bps 
B D                     Human  cagtgccaa-caaccccttcaagg----------------------------------------------
B D                     Chimp  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                   Gorilla  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                 Orangutan  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                    Gibbon  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                    Rhesus  cagcgccaa-caaccccttcaagg----------------------------------------------
B D       Crab-eating macaque  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                    Baboon  cagcgccaa-caaccccttcaagg----------------------------------------------
B D              Green monkey  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                  Marmoset  cagcgccaa-caaccccttcaagg----------------------------------------------
B D           Squirrel monkey  cagcgcgaa-caaccccttcaagg----------------------------------------------
B D                  Bushbaby  cagcgccaa-caaccccttcaagg----------------------------------------------
           Chinese tree shrew  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                  Squirrel  cagcgccaa-caacccctttaagg----------------------------------------------
       Lesser Egyptian jerboa  cagcgccaa-caaccccttcaagg----------------------------------------------
                 Prairie vole  cagcgccaa-taaccccttcaaag----------------------------------------------
B D           Chinese hamster  cagcgccaa-taaccccttcaaag----------------------------------------------
               Golden hamster  cagcgccaa-taaccccttcaaag----------------------------------------------
B D                     Mouse  cagtgccaa-taaccccttcaaag----------------------------------------------
B D                       Rat  cagcgccaa-taaccccttcaaag----------------------------------------------
B D            Naked mole-rat  cagcgccaa-caaccccttcaaag----------------------------------------------
B D                Guinea pig  cagcgctaa-caaccccttcaaag----------------------------------------------
                   Chinchilla  cagcgcaaa-caaccccttcaaag----------------------------------------------
             Brush-tailed rat  cagcgctaa-caaccccttcaaag----------------------------------------------
B D                    Rabbit  cagcgccaa-taaccccttcaagg----------------------------------------------
B D                      Pika  cagcgctaa-caaccccttcaaag----------------------------------------------
B D                       Pig  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                    Alpaca  cagcgccaa-caaccccttcaagg----------------------------------------------
               Bactrian camel  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                   Dolphin  cagcgccaa-caaccccttcaagg----------------------------------------------
                 Killer whale  cagcgccaa-caaccccttcaagg----------------------------------------------
             Tibetan antelope  cagtgccaa-caaccccttcaagg----------------------------------------------
B D                       Cow  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                     Sheep  cagcgccaa-caaccccttcaagg----------------------------------------------
                Domestic goat  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                     Horse  cagcgccaa-caaccccttcaagg----------------------------------------------
B D          White rhinoceros  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                       Cat  cagtgccaa-caaccccttcaagg----------------------------------------------
B D                       Dog  cagtgccaa-caaccccttcaagg----------------------------------------------
B D                     Panda  cagtgccaa-cagcccctgcaggt----------------------------------------------
               Pacific walrus  cagtgccaa-caaccccttcaagg----------------------------------------------
             Black flying-fox  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                   Megabat  cagcgccaa-taaccccttcaagg----------------------------------------------
                Big brown bat  cagtgccaa-taaccccttcaagg----------------------------------------------
         David's myotis (bat)  cagtgccaa-taaccccttcaagg----------------------------------------------
B D                  Microbat  cagtgccaa-taaccccttcaagg----------------------------------------------
B D                  Hedgehog  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                     Shrew  cagcgccaa-taaccctttcaagg----------------------------------------------
              Star-nosed mole  cagcgccaa-caatcccttcaagg----------------------------------------------
B D                  Elephant  cagcgccaa-caaccccttcaagg----------------------------------------------
          Cape elephant shrew  cagcgccaa-taacccttttaagg----------------------------------------------
B D                   Manatee  cagcgccaa-caaccccttcaagg----------------------------------------------
             Cape golden mole  cagcgccaa-taaccccttcaagg----------------------------------------------
B D                    Tenrec  cagcgccaa-caaccccttcaagg----------------------------------------------
                     Aardvark  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                 Armadillo  cagcgcaaa-caaccccttcaagg----------------------------------------------
B D                   Opossum  cagtgccaa-caacccttttaaag----------------------------------------------
B D           Tasmanian devil  cagtgccaa-caacccttttaagg----------------------------------------------
B D                   Wallaby  cagtgccaa-caacccttttaagg----------------------------------------------
B D                  Platypus  cagtgccaa-caacccgtttaagg----------------------------------------------
  D               Rock pigeon  tagcacaaa-caaccccttcaagg----------------------------------------------
  D              Saker falcon  cagtgccaa-caacccattcaagg----------------------------------------------
  D          Peregrine falcon  cagtgccaa-caacccattcaagg----------------------------------------------
  D       Collared flycatcher  cagtgccaa-caaccccttcaagg----------------------------------------------
  D    White-throated sparrow  cagtgccaa-caaccccttcaagg----------------------------------------------
B D       Medium ground finch  cagcgccaa-caaccccttcaagg----------------------------------------------
B D               Zebra finch  cagcgccaa-caaccccttcaagg----------------------------------------------
           Tibetan ground jay  cagtgccaa-caaccccttcaagg----------------------------------------------
B D                Budgerigar  cagcgccaa-caacccgttcaaag----------------------------------------------
  D                    Parrot  cagcacaaa-caaccccttcaaag----------------------------------------------
  D             Scarlet macaw  cagcacaaa-caaccccttcaaag----------------------------------------------
  D              Mallard duck  cagcgccaa-caaccccttcaagg----------------------------------------------
B D                   Chicken  cagtgccaa-caacccattcaagg----------------------------------------------
B D                    Turkey  cagtgccaa-caacccgttcaagg----------------------------------------------
B D        American alligator  cagcgccaa-caaccccttcaagg----------------------------------------------
  D           Green seaturtle  cagcgccaa-caacccgttcaaag----------------------------------------------
  D            Painted turtle  cagcgccaa-caaccccttcaagg----------------------------------------------
  D  Chinese softshell turtle  aggagaggactacatgttgtgcta----------------------------------------------
  D    Spiny softshell turtle  cagtgccaaacaaccggttcaagg----------------------------------------------
B D                    Lizard  cagtgccaa-caaccccttcaaag----------------------------------------------
B D             X. tropicalis  cagcgcaaa-caatcctttcaaat----------------------------------------------
B D                Coelacanth  cagcgccaa-caacccgtttaaag----------------------------------------------
B D                 Tetraodon  cagctctaa-taaccccttcaagg----------------------------------------------
B D                      Fugu  cagctccaa-caaccccttcaagg----------------------------------------------
       Yellowbelly pufferfish  cagtaccaa-caatcctcttaaggtatttcagatgaaccaggttggagctctcagatttggcgagttgct
B D              Nile tilapia  tagctctaa-caaccccttcaagg----------------------------------------------
          Princess of Burundi  tagctctaa-caaccccttcaagg----------------------------------------------
        Burton's mouthbreeder  tagctctaa-caaccccttcaagg----------------------------------------------
                  Zebra mbuna  tagctctaa-caaccccttcaagg----------------------------------------------
          Pundamilia nyererei  cagtgccaa-caacccgttcaaag----------------------------------------------
B D                    Medaka  cagttcaaa-taaccctttcaaag----------------------------------------------
           Southern platyfish  cagctccaa-caaccccttcaaag----------------------------------------------
B D               Stickleback  cagctc-aa-caaccccttcaagg----------------------------------------------
B D              Atlantic cod  cagcaccaa-caacccgctcaagg----------------------------------------------
B D                 Zebrafish  cagctccaa-taatccattcaagg----------------------------------------------
     Mexican tetra (cavefish)  tagctccaa-taaccccttcaaag----------------------------------------------
                  Spotted gar  cagtgccaa-caaccccttcaagg----------------------------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ======================================================================

                        Human  ------------------------gg-------------------------------tcagc
                        Chimp  ------------------------gg-------------------------------tcagc
                      Gorilla  ------------------------gg-------------------------------tcagc
                    Orangutan  ------------------------gg-------------------------------tcagc
                       Gibbon  ------------------------gg-------------------------------tcagc
                       Rhesus  ------------------------gg-------------------------------tcagc
          Crab-eating macaque  ------------------------gg-------------------------------tcagc
                       Baboon  ------------------------gg-------------------------------tcagc
                 Green monkey  ------------------------gg-------------------------------tcagc
                     Marmoset  ------------------------gg-------------------------------tcagc
              Squirrel monkey  ------------------------gg-------------------------------tcagc
                     Bushbaby  ------------------------gg-------------------------------tcagc
           Chinese tree shrew  ------------------------gg-------------------------------ccagc
                     Squirrel  ------------------------gg-------------------------------tcagc
       Lesser Egyptian jerboa  ------------------------gg-------------------------------tcagc
                 Prairie vole  ------------------------gg-------------------------------tcagc
              Chinese hamster  ------------------------gg-------------------------------tcagc
               Golden hamster  ------------------------gg-------------------------------tcagc
                        Mouse  ------------------------gg-------------------------------tcggc
                          Rat  ------------------------gg-------------------------------tcagc
               Naked mole-rat  ------------------------gg-------------------------------tcagc
                   Guinea pig  ------------------------gg-------------------------------tcagc
                   Chinchilla  ------------------------gg-------------------------------tcagc
             Brush-tailed rat  ------------------------gg-------------------------------tcagc
                       Rabbit  ------------------------gg-------------------------------tcagc
                         Pika  ------------------------gg-------------------------------tcagc
                          Pig  ------------------------gg-------------------------------tcagc
                       Alpaca  ------------------------gg-------------------------------tcggc
               Bactrian camel  ------------------------gg-------------------------------tcggc
                      Dolphin  ------------------------gg-------------------------------tcggc
                 Killer whale  ------------------------gg-------------------------------tcggc
             Tibetan antelope  ------------------------gg-------------------------------tcggc
                          Cow  ------------------------gg-------------------------------tcggc
                        Sheep  ------------------------gg------------------------------------
                Domestic goat  ------------------------gg-------------------------------tcggc
                        Horse  ------------------------gg-------------------------------tcagc
             White rhinoceros  ------------------------gg-------------------------------tcagc
                          Cat  ------------------------gg-------------------------------tcggc
                          Dog  ------------------------gg-------------------------------tcggc
                        Panda  ------------------------gg-------------------------------ccggc
               Pacific walrus  ------------------------gg-------------------------------tcggc
             Black flying-fox  ------------------------gg-------------------------------tcggc
                      Megabat  ------------------------gg-------------------------------tcggc
                Big brown bat  ------------------------gg-------------------------------tcagc
         David's myotis (bat)  ------------------------gg-------------------------------tcggc
                     Microbat  ------------------------gg-------------------------------tcggc
                     Hedgehog  ------------------------gg-------------------------------tcagc
                        Shrew  ------------------------gg-------------------------------tcagc
              Star-nosed mole  ------------------------gg-------------------------------tcagc
                     Elephant  ------------------------gg-------------------------------tcagc
          Cape elephant shrew  ------------------------gg-------------------------------tcagc
                      Manatee  ------------------------gg-------------------------------tcagc
             Cape golden mole  ------------------------gg-------------------------------tcagc
                       Tenrec  ------------------------gg-------------------------------tcggc
                     Aardvark  ------------------------gg-------------------------------tcagc
                    Armadillo  ------------------------gg-------------------------------tcagc
                      Opossum  ------------------------gt-------------------------------tcagc
              Tasmanian devil  ------------------------gt-------------------------------tctgc
                      Wallaby  ------------------------gt-------------------------------tcagc
                     Platypus  ------------------------gg-------------------------------agctc
                  Rock pigeon  ------------------------ga-----agttc--------------------------
                 Saker falcon  ------------------------gc------------------------------------
             Peregrine falcon  ------------------------gc------------------------------------
          Collared flycatcher  ------------------------gc------------------------------------
       White-throated sparrow  ------------------------gc------------------------------------
          Medium ground finch  ------------------------gctcggc-------------------------------
                  Zebra finch  ------------------------gc------------------------------------
           Tibetan ground jay  ------------------------gc------------------------------------
                   Budgerigar  ------------------------gc-----agctc--------------------------
                       Parrot  ------------------------ga-----agttcagg-----------------------
                Scarlet macaw  ------------------------ga-----agttcagg-----------------------
                 Mallard duck  ------------------------gc------------------------------------
                      Chicken  ------------------------gc------------------------------------
                       Turkey  ------------------------gc------------------------------------
           American alligator  ------------------------gc-------------tcagc------------------
              Green seaturtle  ------------------------gc------------------agctcggc----------
               Painted turtle  ---------------------------------------------gctcggc----------
     Chinese softshell turtle  ------------------------gc------------------caattgtg----------
       Spiny softshell turtle  ------------------------gc------------------agttcggc----------
                       Lizard  ------------------------gg--------------------------tcaac-----
                X. tropicalis  ------------------------cc-------------------------------tcacc
                   Coelacanth  ------------------------gg-------------------------------gcggc
                    Tetraodon  ------------------------ga-------------------------------aacgc
                         Fugu  ------------------------gc-------------------------------aacgc
       Yellowbelly pufferfish  gtggcgcgtgtctcagtgctgcgtgc-------------------------------tgtgt
                 Nile tilapia  ------------------------gc-------------------------------aacgc
          Princess of Burundi  ------------------------gc-------------------------------aacgc
        Burton's mouthbreeder  ------------------------gc-------------------------------aacgc
                  Zebra mbuna  ------------------------gc-------------------------------aacgc
          Pundamilia nyererei  ------------------------gt-------------------------------gcatc
                       Medaka  ------------------------gc-------------------------------aatgc
           Southern platyfish  ------------------------gc-------------------------------aacgc
                  Stickleback  ------------------------gc-------------------------------aacgc
                 Atlantic cod  ------------------------ta-------------------------------acgcc
                    Zebrafish  ------------------------gt-------------------------------tcggc
     Mexican tetra (cavefish)  ------------------------gt-------------------------------tctgc
                  Spotted gar  ------------------------gg-------------------------------tctgc
                      Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Weddell seal  ==============================================================

Inserts between block 5 and 6 in window
  D              Rock pigeon 3bp
B D      Medium ground finch 497bp
B D               Coelacanth 3bp

Alignment block 6 of 191 in window, 7893394 - 7893409, 16 bps 
B D                     Human  agct-g----ctgtgg---------------cg------gcg
B D                     Chimp  agct-g----ctgtgg---------------cg------gcg
B D                   Gorilla  agct-g----ctgtgg---------------cg------gcg
B D                 Orangutan  agct-g----ctgtgg---------------cg------gcg
B D                    Gibbon  agct-g----ctgtgg---------------cg------gcg
B D                    Rhesus  agct-g----ctgtgg---------------cg------gcg
B D       Crab-eating macaque  agct-g----ctgtgg---------------cg------gcg
B D                    Baboon  agct-g----ctgtgg---------------cg------gcg
B D              Green monkey  agct-g----ctgtgg---------------cg------gcg
B D                  Marmoset  agct-g----ctgtgg---------------cg------gca
B D           Squirrel monkey  agct-g----ctgtgg---------------cg------gca
B D                  Bushbaby  agct-g----ctgtgg---------------ca------gca
           Chinese tree shrew  agct-g----ccgtgg---------------cg------ggg
B D                  Squirrel  agct-g----ctgtgg---------------ct------gcg
       Lesser Egyptian jerboa  agct-g----ctgtgg---------------cg------gcg
                 Prairie vole  agct-g----ctgtgg---------------cg------gcg
B D           Chinese hamster  agct-g----ctgtgg---------------cg------gga
               Golden hamster  agct-g----ctgtgg---------------cg------gcg
B D                     Mouse  agct-g----ccgtgg---------------cg------gcg
B D                       Rat  agct-g----ctgtgg---------------cg------gca
B D            Naked mole-rat  agct-g----ctgtgg---------------ct------gca
B D                Guinea pig  agct-g----ctgtgg---------------ca------gcg
                   Chinchilla  agct-g----ctgtgg---------------cg------gca
             Brush-tailed rat  agct-g----ctgtgg---------------ca------gca
B D                    Rabbit  agct-g----ctgtgg---------------cg------gcg
B D                      Pika  agct-g----ctgtgg---------------cg------gca
B D                       Pig  agct-g----ctgtgg---------------ca------gca
B D                    Alpaca  agct-g----ctgtgg---------------cg------gcg
               Bactrian camel  agctgg----ccgtgg---------------cg------gcg
B D                   Dolphin  agct-g----ctgtgg---------------cg------gca
                 Killer whale  agct-g----ctgtgg---------------ca------gca
             Tibetan antelope  ggct-g----ctgtggggggcnnnnnnnnnncg------gcg
B D                       Cow  ggct-g----ctgtgg---------------ca------gcg
                Domestic goat  ggct-g----ctgtgg---------------ca------gca
B D                     Horse  agct-g----ctgttg---------------cg------gcc
B D          White rhinoceros  agct-g----ctgttg---------------cg------gca
B D                       Cat  agct-g----ccgtgg---------------cg------gcg
B D                       Dog  agct-g----ctgtgg---------------cg------gcg
B D                     Panda  agcc-g----ctgtgg---------------cg------tcg
               Pacific walrus  ggct-g----ctgtgg---------------cg------gct
             Black flying-fox  agct-g----ctgtag---------------cg------gca
B D                   Megabat  agct-g----ctgtag---------------cg------gca
                Big brown bat  agca-g----ctgtgg---------------ca------gca
         David's myotis (bat)  agca-g----ctgtgg---------------ca------gca
B D                  Microbat  agca-g----ctgtgg---------------ca------gca
B D                  Hedgehog  agct-g----ctgtgg---------------cg------gca
B D                     Shrew  agct-g----ctgtgg---------------ca------gca
              Star-nosed mole  agct-g----ctgtgg---------------cg------gcg
B D                  Elephant  agct-g----ctgtgg---------------cg------gcg
          Cape elephant shrew  agct-g----ctgtag---------------cg------gca
B D                   Manatee  agct-g----ctgtgg---------------cg------gca
             Cape golden mole  agct-g----ctgtag---------------ca------gcg
B D                    Tenrec  agct-g----ctgtgg---------------cg------gcg
                     Aardvark  agct-g----ctgtgg---------------ca------gcg
B D                 Armadillo  agct-g----ctgtgg---------------cg------gcg
B D                   Opossum  agca-g----cagtgg---------------ca------gct
B D           Tasmanian devil  agca-g----ctgtgg---------------ca------gcc
B D                   Wallaby  agca-g----ctgtag---------------ca------gcc
B D                  Platypus  ggcc-g----ctgcgg---------------ct------gct
  D               Rock pigeon  tgca-t----ctgtgg---------------ca------gct
  D              Saker falcon  agct-c--------gg---------------ca------gca
  D          Peregrine falcon  agct-c--------gg---------------ca------gca
  D       Collared flycatcher  agct-c--------gg---------------cg------gcg
  D    White-throated sparrow  agct-c--------gg---------------cg------gcg
B D       Medium ground finch  agct-c--------gg---------------cg------gcg
B D               Zebra finch  agct-c--------gg---------------cg------gcg
           Tibetan ground jay  agct-c--------gg---------------cg------gcg
B D                Budgerigar  --------------gg---------------ca------gcc
  D                    Parrot  tgca-t----ctgtgg---------------cg------gct
  D             Scarlet macaw  tgca-t----ctgtgg---------------ca------gct
  D              Mallard duck  agct-c--------ag---------------cg------gct
B D                   Chicken  agct-c--------gg---------------cg------gcg
B D                    Turkey  agct-c--------gg---------------ca------gca
B D        American alligator  tgct-g----ccgtag---------------cc------gcc
  D           Green seaturtle  -----------cgcgg---------------ca------gcc
  D            Painted turtle  -----------agcgg---------------ct------gtg
  D  Chinese softshell turtle  -----------agctg---------------ga------gaa
  D    Spiny softshell turtle  -----------tgctg---------------ca------gca
B D                    Lizard  agca-g----ctgtgg---------------ct------gcc
B D             X. tropicalis  tgca-g----cggtgg---------------cg------gcc
B D                Coelacanth  ggcg-g----cagtgg---------------cg------gcg
B D                 Tetraodon  cgca-g----ccgttg---------------cc------gcg
B D                      Fugu  tgca-g----ccgtcg---------------cg------gcg
       Yellowbelly pufferfish  tgca-gggctctgcca---------------cggctaatgcg
B D              Nile tilapia  cgca-g----ctgtgg---------------cg------gcg
          Princess of Burundi  tgca-g----ctgtgg---------------cg------gcg
        Burton's mouthbreeder  tgca-g----ctgtgg---------------cg------gcg
                  Zebra mbuna  tgca-g----ctgtgg---------------cg------gcg
          Pundamilia nyererei  tgcc-a----ccgctg---------------tg------gcc
B D                    Medaka  tgct-g----ctgtgg---------------cg------gcg
           Southern platyfish  cgct-g----ccgtcg---------------ca------gcc
B D               Stickleback  cgct-g----ccgtcg---------------cg------gcg
B D              Atlantic cod  tcct-g----ccctgc---------------gt------gcg
B D                 Zebrafish  agca-g----ccgtcg---------------ct------gca
     Mexican tetra (cavefish)  tgcc-a----ctgttg---------------ct------gct
                  Spotted gar  tgcc-g----ctgtgg---------------ct------gct
B D                     Sheep  ------------------------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ==========================================

Inserts between block 6 and 7 in window
B D             Atlantic cod 620bp

Alignment block 7 of 191 in window, 7893410 - 7893416, 7 bps 
B D                     Human  gcagcgg
B D                     Chimp  gcagcgg
B D                   Gorilla  gcagcgg
B D                 Orangutan  gcagcgg
B D                    Gibbon  gcagcgg
B D                    Rhesus  gcagcgg
B D       Crab-eating macaque  gcagcgg
B D                    Baboon  gcagcgg
B D              Green monkey  gcagcgg
B D                  Marmoset  gcagcag
B D           Squirrel monkey  gcagcag
B D                  Bushbaby  gcagcag
           Chinese tree shrew  ggggggg
B D                  Squirrel  gcagcag
       Lesser Egyptian jerboa  gcggcgg
                 Prairie vole  gcggcgg
B D           Chinese hamster  ggagcag
               Golden hamster  gcagcag
B D                     Mouse  gcagcgg
B D                       Rat  gcggcag
B D            Naked mole-rat  gcagcag
B D                Guinea pig  gcggcag
                   Chinchilla  gcagcag
             Brush-tailed rat  gcggcag
B D                    Rabbit  gcggcgg
B D                      Pika  gcggcgg
B D                       Pig  gcagcag
B D                    Alpaca  gcggcgg
               Bactrian camel  gcggcag
B D                   Dolphin  gcggcgg
                 Killer whale  gcggcgg
             Tibetan antelope  gcagctg
B D                       Cow  gcagcgg
                Domestic goat  gcagcgg
B D                     Horse  gcagcgg
B D          White rhinoceros  gcagcgg
B D                       Cat  gccgcgg
B D                       Dog  gcggcgg
B D                     Panda  gcggcgg
               Pacific walrus  gcagcgg
             Black flying-fox  gcggccg
B D                   Megabat  gcggccg
                Big brown bat  gcagcgg
         David's myotis (bat)  gcagcgg
B D                  Microbat  gcagcgg
B D                  Hedgehog  gcagcag
B D                     Shrew  gcagcag
              Star-nosed mole  gcggcag
B D                  Elephant  gcggcag
          Cape elephant shrew  gcagcag
B D                   Manatee  gcagcag
             Cape golden mole  gcagcgg
B D                    Tenrec  gcagcgg
                     Aardvark  gccgcag
B D                 Armadillo  gcggcgg
B D                   Opossum  gcagcag
B D           Tasmanian devil  gcagcag
B D                   Wallaby  gcagctg
B D                  Platypus  gcggccg
  D               Rock pigeon  gctgcag
  D              Saker falcon  gcggcag
  D          Peregrine falcon  gcggcag
  D       Collared flycatcher  gcggctg
  D    White-throated sparrow  gcggccg
B D       Medium ground finch  gcggccg
B D               Zebra finch  gcggcgg
           Tibetan ground jay  gcggctg
B D                Budgerigar  gcggccg
  D                    Parrot  gctgcgg
  D             Scarlet macaw  gctgcag
  D              Mallard duck  gcagccg
B D                   Chicken  gcagcag
B D                    Turkey  gcagcag
B D        American alligator  gcagccg
  D           Green seaturtle  gcagggg
  D            Painted turtle  gcggcgg
  D  Chinese softshell turtle  agaatta
  D    Spiny softshell turtle  gcagctc
B D                    Lizard  gctgcag
B D             X. tropicalis  gtggcag
B D                Coelacanth  gcggcgg
B D                 Tetraodon  gcggccg
B D                      Fugu  gccgctg
       Yellowbelly pufferfish  gccctgg
B D              Nile tilapia  gcggctg
          Princess of Burundi  gcggctg
        Burton's mouthbreeder  gcggctg
                  Zebra mbuna  gcggctg
          Pundamilia nyererei  gccgctg
B D                    Medaka  gcagctg
           Southern platyfish  gctgctg
B D               Stickleback  gcggccg
B D                 Zebrafish  gctgctg
     Mexican tetra (cavefish)  gctgccg
                  Spotted gar  gctgccg
B D                     Sheep  -------
B D                   Ferret   NNNNNNN
                Weddell seal  =======
B D              Atlantic cod  =======

Inserts between block 7 and 8 in window
         Pundamilia nyererei 624bp

Alignment block 8 of 191 in window, 7893417 - 7893417, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  n
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  t
B D                       Cow  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                     Panda  c
               Pacific walrus  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D                  Platypus  t
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
  D           Green seaturtle  g
  D            Painted turtle  c
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  c
B D                    Lizard  c
B D             X. tropicalis  c
B D                Coelacanth  c
B D                 Tetraodon  c
B D                      Fugu  c
       Yellowbelly pufferfish  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
B D                    Medaka  c
           Southern platyfish  c
B D               Stickleback  c
B D                 Zebrafish  c
     Mexican tetra (cavefish)  c
                  Spotted gar  c
B D                     Sheep  -
B D                   Ferret   N
                Weddell seal  =
B D              Atlantic cod  =

Alignment block 9 of 191 in window, 7893418 - 7893429, 12 bps 
B D                     Human  agcag-------------------cagcagc
B D                     Chimp  agcag-------------------cagcagc
B D                   Gorilla  agcag-------------------cagcagc
B D                 Orangutan  agcgg-------------------cagcagc
B D                    Gibbon  agcag-------------------cagcagc
B D                    Rhesus  agcag-------------------cagcagc
B D       Crab-eating macaque  agcag-------------------cagcagc
B D                    Baboon  agcag-------------------cagcagc
B D              Green monkey  agcag-------------------cagcagc
B D                  Marmoset  agcag-------------------cagcagc
B D           Squirrel monkey  agcag-------------------cagcagc
B D                  Bushbaby  agcag-------------------cagcagc
B D                  Squirrel  agcag-------------------cagcagc
       Lesser Egyptian jerboa  ggcgg-------------------cggcggc
                 Prairie vole  agcgg-------------------cggcagc
               Golden hamster  ggcgg-------------------cggcagc
B D                     Mouse  agcag-------------------cagcagc
B D                       Rat  ggcag-------------------cagcagc
B D            Naked mole-rat  cgcag-------------------cagcagc
B D                Guinea pig  agcag-------------------cagcagc
                   Chinchilla  agcgg-------------------ccgcagc
             Brush-tailed rat  agcgg-------------------cagcagc
B D                    Rabbit  ggcgg-------------------cagcagc
B D                      Pika  agcag-------------------cagcggc
B D                       Pig  cgccg-------------------cagccgc
B D                    Alpaca  ggcgg-------------------cggccgc
               Bactrian camel  ggcag-------------------cggccgc
B D                   Dolphin  agcgg-------------------cggccgc
                 Killer whale  agcgg-------------------cggccgc
             Tibetan antelope  agct---------------------------
B D                       Cow  agcag-------------------cggcggc
                Domestic goat  ggcgg-------------------ggg----
B D                     Horse  cgcag-------------------cggccgc
B D          White rhinoceros  agcag-------------------cagccgc
B D                       Cat  ggcgg-------------------cggccgc
B D                       Dog  agcag-------------------cggccgc
B D                     Panda  cgcag-------------------cggctgc
               Pacific walrus  cgcgg-------------------cggctgc
             Black flying-fox  ggcag-------------------cagccgc
B D                   Megabat  ggcag-------------------cagccgc
                Big brown bat  tgcag-------------------cagccgc
         David's myotis (bat)  tgcag-------------------cagccgc
B D                  Microbat  tgcag-------------------cagccgc
B D                  Hedgehog  agcag-------------------ctgctgc
B D                     Shrew  agcag-------------------cggctgc
              Star-nosed mole  agcgg-------------------cggctgc
B D                  Elephant  ggcgg-------------------cagcagc
          Cape elephant shrew  agcag-------------------cggccgc
B D                   Manatee  ggcag-------------------cagcagc
             Cape golden mole  agcag-------------------cagcagc
B D                    Tenrec  agcgg-------------------cggcggc
                     Aardvark  agcgg-------------------cagcagc
B D                 Armadillo  cgcag-------------------cagcagc
B D                   Opossum  agcag-------------------ctgcggc
B D           Tasmanian devil  agcag-------------------ctgcagc
B D                   Wallaby  agcag-------------------cagcagc
B D                  Platypus  agcag-------------------cggcagt
  D               Rock pigeon  ggcag-------------------ctgttgc
  D              Saker falcon  agcgg-------------------ccattgc
  D          Peregrine falcon  agcgg-------------------ccattgc
  D       Collared flycatcher  ggcgg-------------------ctgtggc
  D    White-throated sparrow  ggccg-------------------ctgtggc
B D       Medium ground finch  ggccg-------------------ctgt---
B D               Zebra finch  ggcag-------------------ccgtggc
           Tibetan ground jay  ggcag-------------------ctgttgc
B D                Budgerigar  cgcgg-------------------ccattgc
  D                    Parrot  tgcag-------------------ctgttgc
  D             Scarlet macaw  tgcag-------------------ctgttgc
  D              Mallard duck  ggcag-------------------ccgtcgc
B D                   Chicken  ggcag-------------------ccgtggc
B D                    Turkey  agcag-------------------ctgtggc
B D        American alligator  tgccg-------------------cagccgc
  D           Green seaturtle  ggtggggggggggggcggggaaaacggccaa
  D            Painted turtle  ggcagcggcggcgg----------cagctgc
  D  Chinese softshell turtle  cacag-------------------cctctgc
  D    Spiny softshell turtle  agtgg-------------------cggcagc
B D                    Lizard  cgctg-------------------ctgccgc
B D             X. tropicalis  ggcag-------------------ccgcggc
B D                Coelacanth  ggcag-------------------cagcagt
B D                 Tetraodon  ggccg-------------------ctgccat
B D                      Fugu  agctg-------------------cggcgat
       Yellowbelly pufferfish  ggctg-------------------ccaatgt
B D              Nile tilapia  tgccg-------------------ctgccat
          Princess of Burundi  tgccg-------------------ctgccat
        Burton's mouthbreeder  tgccg-------------------ctgccat
                  Zebra mbuna  ggccg-------------------ctgccat
          Pundamilia nyererei  cgccg-------------------ctgccat
B D                    Medaka  cgccg-------------------ctgctat
           Southern platyfish  cgccg-------------------ccgccat
B D               Stickleback  ggccg-------------------cagcaat
B D                 Zebrafish  cgctg-------------------cggctgc
     Mexican tetra (cavefish)  cgcgg-------------------ccgcagc
                  Spotted gar  cgccg-------------------ctgctgc
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  -------------------------------
          Chinese tree shrew  -------------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ===============================
B D              Atlantic cod  ===============================

Inserts between block 9 and 10 in window
B D                 Marmoset 833bp
B D      Medium ground finch 20bp

Alignment block 10 of 191 in window, 7893430 - 7893435, 6 bps 
B D                     Human  agctgt
B D                     Chimp  agctgt
B D                   Gorilla  agctgt
B D                 Orangutan  agctgt
B D                    Gibbon  agctgt
B D                    Rhesus  agctgt
B D       Crab-eating macaque  agctgt
B D                    Baboon  agctgt
B D              Green monkey  agctgt
B D                  Marmoset  agctgt
B D           Squirrel monkey  agctgt
B D                  Bushbaby  agctgt
B D                  Squirrel  agctgt
       Lesser Egyptian jerboa  ggctgt
                 Prairie vole  agctgt
               Golden hamster  agctgt
B D                     Mouse  agctgt
B D                       Rat  agctgt
B D            Naked mole-rat  agctgt
B D                Guinea pig  agctgt
                   Chinchilla  agctgt
             Brush-tailed rat  agctgt
B D                    Rabbit  agccgt
B D                      Pika  ggctgt
B D                       Pig  agctgt
B D                    Alpaca  agctgt
               Bactrian camel  agctgt
B D                   Dolphin  agctgt
                 Killer whale  agctgt
B D                       Cow  agctgt
B D                     Horse  agctgt
B D          White rhinoceros  agctgt
B D                       Cat  agctgt
B D                       Dog  agctgt
B D                     Panda  ggctgt
               Pacific walrus  ggcagt
             Black flying-fox  agctgt
B D                   Megabat  agctgt
                Big brown bat  agctgt
         David's myotis (bat)  agctgt
B D                  Microbat  agctgt
B D                  Hedgehog  agctgt
B D                     Shrew  agctgt
              Star-nosed mole  agctgt
B D                  Elephant  agctgt
          Cape elephant shrew  agctgt
B D                   Manatee  agctgt
             Cape golden mole  agccgt
B D                    Tenrec  agctgt
                     Aardvark  agctgt
B D                 Armadillo  agctgt
B D                   Opossum  agctgt
B D           Tasmanian devil  agctgt
B D                   Wallaby  agctgt
  D               Rock pigeon  ---agt
  D              Saker falcon  ---tgc
  D          Peregrine falcon  ---tgc
  D       Collared flycatcher  ---tgc
  D    White-throated sparrow  ---tgc
B D               Zebra finch  ---tgc
           Tibetan ground jay  ---tgc
B D                Budgerigar  ---tgc
  D                    Parrot  ---agt
  D             Scarlet macaw  ---agt
  D              Mallard duck  ---tgc
B D                   Chicken  ---tgc
B D                    Turkey  ---tgc
B D        American alligator  ---tgc
  D           Green seaturtle  ---tgt
  D            Painted turtle  ---cgt
  D  Chinese softshell turtle  ---agt
  D    Spiny softshell turtle  ---tgt
B D                    Lizard  ---tgc
B D             X. tropicalis  ggcagt
B D                Coelacanth  ggccgt
B D                 Tetraodon  cgccgt
B D                      Fugu  cgccgt
       Yellowbelly pufferfish  ggctgc
B D              Nile tilapia  cgctgt
          Princess of Burundi  cgctgt
        Burton's mouthbreeder  cgctgt
                  Zebra mbuna  cgctgt
          Pundamilia nyererei  cgctgt
B D                    Medaka  cgctgt
           Southern platyfish  cgctgt
B D               Stickleback  cgccgt
B D                 Zebrafish  agccgt
     Mexican tetra (cavefish)  agccgt
                  Spotted gar  cgccgt
B D           Chinese hamster  NNNNNN
            Tibetan antelope  ------
               Domestic goat  ------
B D                     Sheep  ------
          Chinese tree shrew  ------
B D                   Ferret   NNNNNN
                Weddell seal  ======
B D              Atlantic cod  ======
B D                  Platypus  ------
B D       Medium ground finch  ======

Inserts between block 10 and 11 in window
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 3bp
B D                  Chicken 3bp
B D                   Turkey 3bp
B D       American alligator 3bp
B D                   Lizard 3bp

Alignment block 11 of 191 in window, 7893436 - 7893440, 5 bps 
B D                     Human  agctg
B D                     Chimp  agctg
B D                   Gorilla  agctg
B D                 Orangutan  agctg
B D                    Gibbon  agctg
B D                    Rhesus  agctg
B D       Crab-eating macaque  agctg
B D                    Baboon  agctg
B D              Green monkey  agctg
B D                  Marmoset  agctg
B D           Squirrel monkey  agctg
B D                  Bushbaby  agccg
B D                  Squirrel  ggctg
       Lesser Egyptian jerboa  agctg
                 Prairie vole  agccg
               Golden hamster  agccg
B D                     Mouse  ggctg
B D                       Rat  agctg
B D            Naked mole-rat  agctg
B D                Guinea pig  agccg
                   Chinchilla  ggctg
             Brush-tailed rat  agctg
B D                    Rabbit  agctg
B D                      Pika  ggctg
B D                       Pig  agctg
B D                    Alpaca  agctg
               Bactrian camel  agctg
B D                   Dolphin  agctg
                 Killer whale  agctg
             Tibetan antelope  ----g
B D                       Cow  agctg
                Domestic goat  ----g
B D                     Horse  agctg
B D          White rhinoceros  agctg
B D                       Cat  ggctg
B D                       Dog  ggctg
B D                     Panda  ggccg
               Pacific walrus  ggccg
             Black flying-fox  agctg
B D                   Megabat  agctg
                Big brown bat  agctg
         David's myotis (bat)  agctg
B D                  Microbat  agctg
B D                  Hedgehog  agctg
B D                     Shrew  agctg
              Star-nosed mole  ggctg
B D                  Elephant  agctg
          Cape elephant shrew  agctg
B D                   Manatee  agctg
             Cape golden mole  agctg
B D                    Tenrec  agctg
                     Aardvark  agctg
B D                 Armadillo  agctg
B D                   Opossum  agctg
B D           Tasmanian devil  agctg
B D                   Wallaby  agccg
B D                  Platypus  ---gg
B D        American alligator  tgccg
  D           Green seaturtle  ----a
  D            Painted turtle  ----g
  D  Chinese softshell turtle  ----g
  D    Spiny softshell turtle  ----a
B D                    Lizard  agctg
B D             X. tropicalis  tgcag
B D                Coelacanth  ggcag
B D                 Tetraodon  cgccg
B D                      Fugu  cgctg
       Yellowbelly pufferfish  agctg
B D              Nile tilapia  tgccg
          Princess of Burundi  tgccg
        Burton's mouthbreeder  tgccg
                  Zebra mbuna  tgccg
          Pundamilia nyererei  tgccg
B D                    Medaka  tgccg
           Southern platyfish  cgccg
B D               Stickleback  cgccg
B D                 Zebrafish  tgccg
     Mexican tetra (cavefish)  tgccg
                  Spotted gar  tgccg
B D           Chinese hamster  NNNNN
B D                     Sheep  -----
          Chinese tree shrew  -----
B D                   Ferret   NNNNN
                Weddell seal  =====
B D                    Turkey  =====
  D              Mallard duck  =====
  D             Scarlet macaw  =====
  D                    Parrot  =====
B D                Budgerigar  =====
  D          Peregrine falcon  -----
  D               Rock pigeon  -----
B D                   Chicken  =====
B D              Atlantic cod  =====
  D       Collared flycatcher  -----
B D               Zebra finch  -----
  D              Saker falcon  -----
B D       Medium ground finch  =====
  D    White-throated sparrow  -----
          Tibetan ground jay  -----

Inserts between block 11 and 12 in window
  D          Green seaturtle 4bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 1504bp
  D   Spiny softshell turtle 2bp

Alignment block 12 of 191 in window, 7893441 - 7893450, 10 bps 
B D                     Human  agca-----g---------------------------gtgtc
B D                     Chimp  agca-----g---------------------------gtgtc
B D                   Gorilla  agca-----g---------------------------gtgtc
B D                 Orangutan  agca-----g---------------------------gtgtc
B D                    Gibbon  agca-----g---------------------------gtgtc
B D                    Rhesus  agca-----g---------------------------gtgtc
B D       Crab-eating macaque  agca-----g---------------------------gtgtc
B D                    Baboon  agca-----g---------------------------gtgtc
B D              Green monkey  agca-----g---------------------------gtgtc
B D                  Marmoset  agca-----g---------------------------gtgtc
B D           Squirrel monkey  agca-----g---------------------------gtgtc
B D                  Bushbaby  agca-----g---------------------------gtgtc
B D                  Squirrel  agca-----g---------------------------gtgtc
       Lesser Egyptian jerboa  agca-----a---------------------------gtgtc
                 Prairie vole  agca-----g---------------------------gtgtc
               Golden hamster  agca-----g---------------------------gtgtc
B D                     Mouse  agca-----g---------------------------gtgtc
B D                       Rat  agca-----g---------------------------gtgtc
B D            Naked mole-rat  agca-----g---------------------------gtgtc
B D                Guinea pig  agca-----g---------------------------gtgtc
                   Chinchilla  agca-----g---------------------------gtgtc
             Brush-tailed rat  agca-----g---------------------------gtgtc
B D                    Rabbit  agca-----g---------------------------gtgtc
B D                      Pika  agca-----g---------------------------gtgtc
B D                       Pig  agca-----g---------------------------gtgtc
B D                    Alpaca  agca-----g---------------------------gtgtc
               Bactrian camel  agca-----g---------------------------gtgtc
B D                   Dolphin  agca-----g---------------------------gtgtc
                 Killer whale  agca-----g---------------------------gtgtc
             Tibetan antelope  agca-----g---------------------------gtgtc
B D                       Cow  agca-----g---------------------------gtgtc
                Domestic goat  gggg-----g---------------------------gcggc
B D                     Horse  agca-----g---------------------------gtgtc
B D          White rhinoceros  agca-----g---------------------------gtgtc
B D                       Cat  agca-----g---------------------------gtgtc
B D                       Dog  agca-----g---------------------------gtgtc
B D                     Panda  agca-----g---------------------------gtgtc
               Pacific walrus  agca-----g---------------------------gtgtc
             Black flying-fox  agca-----g---------------------------gtgtc
B D                   Megabat  agca-----g---------------------------gtgtc
                Big brown bat  agca-----g---------------------------gtgtc
         David's myotis (bat)  agca-----g---------------------------gtgtc
B D                  Microbat  agca-----g---------------------------gtgtc
B D                  Hedgehog  aaca-----g---------------------------gtgtc
B D                     Shrew  agca-----g---------------------------gtgtc
              Star-nosed mole  agca-----g---------------------------gtgtc
B D                  Elephant  agca-----g---------------------------gtgtc
          Cape elephant shrew  agca-----g---------------------------gtgtc
B D                   Manatee  agca-----g---------------------------gtgtc
             Cape golden mole  agca-----g---------------------------gtgtc
B D                    Tenrec  agca-----g---------------------------gtgtc
                     Aardvark  agca-----g---------------------------gtgtc
B D                 Armadillo  agca-----g---------------------------gtgtc
B D                   Opossum  agca-----g---------------------------gtatc
B D           Tasmanian devil  aaca-----g---------------------------gtgtc
B D                   Wallaby  aaca-----g---------------------------gtgtc
B D                  Platypus  agac-----g---------------------------gtcac
  D               Rock pigeon  ---------a---------------------------gtgga
B D                Budgerigar  ---------------------------------------tgt
  D                    Parrot  ---------------------------------------gga
  D             Scarlet macaw  ---------------------------------------gga
  D              Mallard duck  ---------a---------------------------gtgga
B D                   Chicken  ---------a---------------------------gtgga
B D                    Turkey  ---------a---------------------------gtgga
B D        American alligator  agca-----g---------------------------gtgtc
  D           Green seaturtle  aactgcagtg---------------------------gcggc
  D            Painted turtle  agcag--gtg---------------------------tcggc
  D  Chinese softshell turtle  agca----tg---------------------------gtggc
  D    Spiny softshell turtle  aaca--------------------------------------
B D                    Lizard  -----aacaa---------------------------gtgtc
B D             X. tropicalis  agca-----a---------------------------gtaac
B D                Coelacanth  agca-----g---------------------------gtgac
B D                 Tetraodon  agca-----g---------------------------gtctc
B D                      Fugu  agca-----g---------------------------gtctc
       Yellowbelly pufferfish  tgga-----gaacatggtggccaccgggacggaaggagcctc
B D              Nile tilapia  agca-----g---------------------------gtctc
          Princess of Burundi  agca-----g---------------------------gtctc
        Burton's mouthbreeder  agca-----g---------------------------gtctc
                  Zebra mbuna  agca-----g---------------------------gtctc
          Pundamilia nyererei  agca-----g---------------------------gtctc
B D                    Medaka  agca-----g---------------------------gtctc
           Southern platyfish  agca-----g---------------------------gtctc
B D               Stickleback  agca-----g---------------------------gtcac
B D                 Zebrafish  agca-----g---------------------------gtctc
     Mexican tetra (cavefish)  agca-----g---------------------------gtctc
                  Spotted gar  agca-----g---------------------------gtctc
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  ------------------------------------------
          Chinese tree shrew  ------------------------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ==========================================
  D          Peregrine falcon  ------------------------------------------
B D              Atlantic cod  ==========================================
  D       Collared flycatcher  ------------------------------------------
B D               Zebra finch  ------------------------------------------
  D              Saker falcon  ------------------------------------------
B D       Medium ground finch  ==========================================
  D    White-throated sparrow  ------------------------------------------
          Tibetan ground jay  ------------------------------------------

Inserts between block 12 and 13 in window
B D                Tetraodon 3bp
B D                     Fugu 3bp
      Yellowbelly pufferfish 3bp
B D             Nile tilapia 3bp
         Princess of Burundi 3bp
       Burton's mouthbreeder 3bp
                 Zebra mbuna 3bp
         Pundamilia nyererei 3bp
B D                   Medaka 3bp
          Southern platyfish 411bp
B D              Stickleback 3bp

Alignment block 13 of 191 in window, 7893451 - 7893452, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  ag
                 Prairie vole  ag
               Golden hamster  ag
B D                     Mouse  ag
B D                       Rat  ag
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  ag
B D                      Pika  ag
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
                Domestic goat  gg
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                     Panda  ag
               Pacific walrus  ag
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ag
B D                     Shrew  ag
              Star-nosed mole  ag
B D                  Elephant  ag
          Cape elephant shrew  ag
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  ag
                     Aardvark  ag
B D                 Armadillo  ag
B D                   Opossum  at
B D           Tasmanian devil  at
B D                   Wallaby  at
B D                  Platypus  ca
  D               Rock pigeon  ga
  D              Saker falcon  ag
  D          Peregrine falcon  ag
  D    White-throated sparrow  gg
B D               Zebra finch  gg
           Tibetan ground jay  ag
B D                Budgerigar  gg
  D                    Parrot  ga
  D             Scarlet macaw  ga
  D              Mallard duck  ga
B D                   Chicken  ga
B D                    Turkey  ga
B D        American alligator  gg
  D           Green seaturtle  ag
  D            Painted turtle  cg
  D  Chinese softshell turtle  ta
B D                    Lizard  gg
B D             X. tropicalis  tc
B D                Coelacanth  tg
B D                 Tetraodon  ag
B D                      Fugu  ag
       Yellowbelly pufferfish  aa
B D              Nile tilapia  ag
          Princess of Burundi  ag
        Burton's mouthbreeder  ag
                  Zebra mbuna  ag
          Pundamilia nyererei  ag
B D                    Medaka  ag
B D               Stickleback  cg
B D                 Zebrafish  cg
     Mexican tetra (cavefish)  tg
                  Spotted gar  cg
B D           Chinese hamster  NN
B D                     Sheep  --
          Chinese tree shrew  --
B D                   Ferret   NN
                Weddell seal  ==
  D    Spiny softshell turtle  --
          Southern platyfish  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  --
B D       Medium ground finch  ==

Inserts between block 13 and 14 in window
B D                Zebrafish 3bp
    Mexican tetra (cavefish) 3bp
                 Spotted gar 3bp

Alignment block 14 of 191 in window, 7893453 - 7893459, 7 bps 
B D                     Human  ---ctg------------------------------------c------tgt
B D                     Chimp  ---ctg------------------------------------c------tgt
B D                   Gorilla  ---ctg------------------------------------c------tgt
B D                 Orangutan  ---ctg------------------------------------c------tgt
B D                    Gibbon  ---ctg------------------------------------c------tgt
B D                    Rhesus  ---ctg------------------------------------c------tgt
B D       Crab-eating macaque  ---ctg------------------------------------c------tgt
B D                    Baboon  ---ctg------------------------------------c------tgt
B D              Green monkey  ---ctg------------------------------------c------tgt
B D                  Marmoset  ---ctg------------------------------------c------tgt
B D           Squirrel monkey  ---ctg------------------------------------c------tgt
B D                  Bushbaby  ---ctg------------------------------------c------tgt
B D                  Squirrel  ---ctg------------------------------------c------tgt
       Lesser Egyptian jerboa  ---cta------------------------------------c------tgt
                 Prairie vole  ---ctg------------------------------------c------tgt
               Golden hamster  ---ctg------------------------------------c------tgt
B D                     Mouse  ---ctg------------------------------------c------tgt
B D                       Rat  ---ctg------------------------------------c------tgt
B D            Naked mole-rat  ---ctg------------------------------------c------tgt
B D                Guinea pig  ---ctg------------------------------------c------tgt
                   Chinchilla  ---ctg------------------------------------c------tgt
             Brush-tailed rat  ---ctg------------------------------------c------tgt
B D                    Rabbit  ---ctg------------------------------------c------tgt
B D                      Pika  ---ctg------------------------------------c------cgt
B D                       Pig  ---ctg------------------------------------c------cgt
B D                    Alpaca  ---ctg------------------------------------c------tgt
               Bactrian camel  ---ctg------------------------------------c------tgt
B D                   Dolphin  ---cag------------------------------------c------tgt
                 Killer whale  ---cag------------------------------------c------tgt
             Tibetan antelope  ---ccg------------------------------------c------tgt
B D                       Cow  ---ccg------------------------------------c------tgt
                Domestic goat  ---c----------------------------------------------gg
B D                     Horse  ---ctg------------------------------------c------tgt
B D          White rhinoceros  ---ctg------------------------------------c------tgt
B D                       Cat  ---ctg------------------------------------c------cgt
B D                       Dog  ---ctg------------------------------------c------tgt
B D                     Panda  ---ctg------------------------------------c------tgt
               Pacific walrus  ---ctg------------------------------------c------tgt
             Black flying-fox  ---ctg------------------------------------c------tgt
B D                   Megabat  ---ctg------------------------------------c------tgt
                Big brown bat  ---ctg------------------------------------c------tgt
         David's myotis (bat)  ---ctg------------------------------------c------tgt
B D                  Microbat  ---ctg------------------------------------c------tgt
B D                  Hedgehog  ---ctg------------------------------------c------tgt
B D                     Shrew  ---ctg------------------------------------c------tgt
              Star-nosed mole  ---ctg------------------------------------c------tgt
B D                  Elephant  ---ctg------------------------------------c------tgt
          Cape elephant shrew  ---ctg------------------------------------c------tgt
B D                   Manatee  ---ctg------------------------------------c------tgt
             Cape golden mole  ---ctg------------------------------------c------tgt
B D                    Tenrec  ---tgg------------------------------------c------tgt
                     Aardvark  ---ctg------------------------------------c------cgt
B D                 Armadillo  ---ctg------------------------------------c------tgt
B D                   Opossum  ---cgg------------------------------------c------tgt
B D           Tasmanian devil  ---ctg------------------------------------c------tgt
B D                   Wallaby  ---ctg------------------------------------c------tgt
B D                  Platypus  ---ttg------------------------------------c------ccc
  D               Rock pigeon  ---gta------------------------------------t---------
  D              Saker falcon  ---ctg------------------------------------t---------
  D          Peregrine falcon  ---ctg------------------------------------t---------
  D    White-throated sparrow  ---ctg------------------------------------t---------
B D               Zebra finch  ---ctg------------------------------------t---------
           Tibetan ground jay  ---ctg------------------------------------t---------
B D                Budgerigar  ---aga------------------------------------c---------
  D                    Parrot  ---gta------------------------------------t---------
  D             Scarlet macaw  ---gta------------------------------------t---------
  D              Mallard duck  ---ccg------------------------------------t---------
B D                   Chicken  ---ctg------------------------------------t---------
B D                    Turkey  ---ctg------------------------------------t---------
B D        American alligator  ---ctg------------------------------------ccgt------
  D           Green seaturtle  ---ccg------------------------------------t---------
  D            Painted turtle  ---ccg------------------------------------t---------
  D  Chinese softshell turtle  ---atg------------------------------------t---------
B D                    Lizard  ---ctg------------------------------------c---agt---
B D             X. tropicalis  ---ctg------------------------------------t---------
B D                Coelacanth  ---cgg------------------------------------t---------
B D                 Tetraodon  cgaccg------------------------------------c---------
B D                      Fugu  cgaccg------------------------------------c---------
       Yellowbelly pufferfish  ctgccgttgctgcttcagccgcccc--tgctgctcctgctgtt---------
B D              Nile tilapia  cgaccg------------------------------------c---------
          Princess of Burundi  cgaccg------------------------------------c---------
        Burton's mouthbreeder  cgaccg------------------------------------c---------
                  Zebra mbuna  cgaccg------------------------------------c---------
          Pundamilia nyererei  cgaccg------------------------------------c---------
B D                    Medaka  ccactg------------------------------------c---------
B D               Stickleback  ccagcg------------------------------------c---------
B D              Atlantic cod  ctcccg---ttccttcccccgtcccggtggtggtggcgccgcc---------
B D                 Zebrafish  caacag------------------------------------c---------
     Mexican tetra (cavefish)  caactg------------------------------------c---------
                  Spotted gar  cgacgc------------------------------------c---------
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  ----------------------------------------------------
          Chinese tree shrew  ----------------------------------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ====================================================
  D    Spiny softshell turtle  ----------------------------------------------------
          Southern platyfish  ====================================================
  D       Collared flycatcher  ----------------------------------------------------
B D       Medium ground finch  ====================================================

Inserts between block 14 and 15 in window
  D              Rock pigeon 151bp
  D             Mallard duck 12bp
B D                  Chicken 12bp
B D                   Turkey 12bp

Alignment block 15 of 191 in window, 7893460 - 7893473, 14 bps 
B D                     Human  ctcgtcg-------gccac---cc
B D                     Chimp  ctcgtcg-------gccac---cc
B D                   Gorilla  ctcgtca-------gccac---cc
B D                 Orangutan  ctcgtcg-------gccac---cc
B D                    Gibbon  ctcatcg-------gccac---cc
B D                    Rhesus  ctcatcg-------gccac---cc
B D       Crab-eating macaque  ctcatcg-------gccac---cc
B D                    Baboon  ctcatcg-------gccac---cc
B D              Green monkey  ctcatcg-------gccac---cc
B D                  Marmoset  ctcatca-------gccac---cc
B D           Squirrel monkey  ctcatcg-------gccac---cc
B D                  Bushbaby  ctcctca-------gccac---cc
           Chinese tree shrew  ----------------cac---cc
B D                  Squirrel  ctcctca-------gccac---cc
       Lesser Egyptian jerboa  ctcatca-------gctgc---cc
                 Prairie vole  ctcccca-------gccac---cc
               Golden hamster  ctcccca-------gccac---cc
B D                     Mouse  ctcctca-------gccac---cc
B D                       Rat  ctcctca-------gccac---cc
B D            Naked mole-rat  ctcgtcc-------gccac---cc
B D                Guinea pig  ctcaccg-------gccac---cc
                   Chinchilla  ctcatcg-------gccac---cc
             Brush-tailed rat  ctcatcg-------gccac---cc
B D                    Rabbit  ctcatcg-------gctac---cc
B D                      Pika  ctcatca-------gctac---cc
B D                       Pig  ctcgtca-------gccac---cc
B D                    Alpaca  ctcgtcg-------gccac---cc
               Bactrian camel  ctcgtcg-------gccac---cc
B D                   Dolphin  ctcatcg-------gccac---cc
                 Killer whale  ctcatcg-------gccac---cc
             Tibetan antelope  ctcctcg-------gccac---cc
B D                       Cow  ctcctcg-------gccac---cc
                Domestic goat  gtcctcg-------gccac---cc
B D                     Horse  ctcgtcg-------gccac---cc
B D          White rhinoceros  ctcatcg-------gctac---cc
B D                       Cat  ctcatcg-------accgc---cc
B D                       Dog  gtcatcg-------gctgc---cc
B D                     Panda  gtcatcg-------gccgc---cc
               Pacific walrus  gtcatcg-------gccgc---cc
             Black flying-fox  ctcatca-------gccac---cc
B D                   Megabat  ctcatca-------gccac---cc
                Big brown bat  ctcatcg-------gccac---cc
         David's myotis (bat)  ctcatcg-------gccac---cc
B D                  Microbat  ctcatcg-------gccac---cc
B D                  Hedgehog  ctcatca-------gccac---cc
B D                     Shrew  gtcatca-------accac---cc
              Star-nosed mole  ctcatcg-------gctac---cc
B D                  Elephant  ctcatcg-------gccac---cc
          Cape elephant shrew  ctcatca-------gccac---cc
B D                   Manatee  ctcatcg-------gccac---cc
             Cape golden mole  ctcatct-------gccac---cc
B D                    Tenrec  ctcatcg-------gccac---cc
                     Aardvark  ctcatca-------gccac---cc
B D                 Armadillo  ctcatcg-------gccac---cc
B D                   Opossum  ttcatct-------gtcac---ca
B D           Tasmanian devil  ttcatcg-------atcac---ca
B D                   Wallaby  ttcatcc-------atcgc---ta
B D                  Platypus  cccactg-------gccat-----
  D              Saker falcon  ------g-------gagac---cg
  D          Peregrine falcon  ------g-------gagac---cg
  D       Collared flycatcher  ---------------agcc---cc
  D    White-throated sparrow  ------g-------gagac---cg
B D               Zebra finch  ------g-------gagac---cg
           Tibetan ground jay  ------g-------gagac---tg
B D                Budgerigar  ------a-------gtcac---cg
  D                    Parrot  ------g-------gtgacaaatg
  D             Scarlet macaw  ------g-------gtgacaaatg
  D              Mallard duck  ---acca-------ctggc---tg
B D                   Chicken  ---acag-------ctgcc---tg
B D                    Turkey  ---accg-------ctggc---tg
B D        American alligator  ----------------ggc---cg
  D           Green seaturtle  ------gg-aaacagtcac---ca
  D            Painted turtle  ------ct-cagccgtgac---ta
  D  Chinese softshell turtle  ------g-------gatgc---tg
  D    Spiny softshell turtle  --------------gttac---ca
B D                    Lizard  -------ggcagctgtcac---cg
B D             X. tropicalis  ------g-------gccct---cc
B D                Coelacanth  ggcgtcg-------a---------
B D                 Tetraodon  gtcg--------------------
B D                      Fugu  gctg--------------------
       Yellowbelly pufferfish  gctg--------------------
B D              Nile tilapia  ctca--------------------
          Princess of Burundi  ctca--------------------
        Burton's mouthbreeder  ctca--------------------
                  Zebra mbuna  ctca--------------------
          Pundamilia nyererei  ctca--------------------
B D                    Medaka  ctcg--------------------
B D               Stickleback  cttg--------------------
B D              Atlantic cod  gccg--------------------
B D                 Zebrafish  ctcg--------------------
     Mexican tetra (cavefish)  ctcc--------------------
                  Spotted gar  gtca--------------------
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  ------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ========================
          Southern platyfish  ========================
  D               Rock pigeon  ========================
B D       Medium ground finch  ========================

Inserts between block 15 and 16 in window
  D             Saker falcon 8bp
  D         Peregrine falcon 8bp
  D      Collared flycatcher 45bp
  D   White-throated sparrow 3bp
B D              Zebra finch 3bp
          Tibetan ground jay 11bp
B D               Budgerigar 8bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 5bp
B D                  Chicken 5bp
B D                   Turkey 5bp
B D       American alligator 2bp

Alignment block 16 of 191 in window, 7893474 - 7893474, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                     Panda  c
               Pacific walrus  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  g
B D           Tasmanian devil  a
B D                   Wallaby  g
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
  D           Green seaturtle  t
  D            Painted turtle  c
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                    Lizard  c
B D             X. tropicalis  c
B D           Chinese hamster  N
B D                     Sheep  -
B D                   Ferret   N
                Weddell seal  =
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D               Stickleback  -
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D                    Medaka  -
B D                Coelacanth  -
                 Spotted gar  -
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Southern platyfish  =
    Mexican tetra (cavefish)  -
  D          Peregrine falcon  =
B D                 Zebrafish  -
  D               Rock pigeon  =
B D              Nile tilapia  -
B D                 Tetraodon  -
B D              Atlantic cod  -
B D                  Platypus  -
  D              Saker falcon  =
B D        American alligator  =
          Tibetan ground jay  =

Inserts between block 16 and 17 in window
B D                   Lizard 2bp

Alignment block 17 of 191 in window, 7893475 - 7893476, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  tg
           Chinese tree shrew  ca
B D                  Squirrel  ca
       Lesser Egyptian jerboa  ca
                 Prairie vole  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  ca
B D                Guinea pig  ca
                   Chinchilla  ca
             Brush-tailed rat  ca
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  aa
B D                    Alpaca  ca
               Bactrian camel  ca
B D                   Dolphin  ca
                 Killer whale  ca
             Tibetan antelope  ca
B D                       Cow  ca
                Domestic goat  ca
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Cat  cg
B D                       Dog  ag
B D                     Panda  ca
               Pacific walrus  cg
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  ca
         David's myotis (bat)  ca
B D                  Microbat  ca
B D                  Hedgehog  ca
B D                     Shrew  ca
              Star-nosed mole  ta
B D                  Elephant  ca
          Cape elephant shrew  ca
B D                   Manatee  ta
             Cape golden mole  ta
B D                    Tenrec  ca
                     Aardvark  ca
B D                 Armadillo  ca
B D                   Opossum  ta
B D           Tasmanian devil  ta
B D                   Wallaby  ta
B D             X. tropicalis  ca
B D           Chinese hamster  NN
B D                     Sheep  --
B D                   Ferret   NN
                Weddell seal  ==
      Yellowbelly pufferfish  --
B D                      Fugu  --
B D               Stickleback  --
         Pundamilia nyererei  --
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  --
B D                    Medaka  --
B D                Coelacanth  --
B D                    Turkey  --
                 Spotted gar  --
  D              Mallard duck  --
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D    Spiny softshell turtle  --
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  --
  D          Peregrine falcon  ==
B D                 Zebrafish  --
  D               Rock pigeon  ==
B D              Nile tilapia  --
  D            Painted turtle  --
B D                 Tetraodon  --
B D                   Chicken  --
B D              Atlantic cod  --
B D                  Platypus  --
  D       Collared flycatcher  --
  D  Chinese softshell turtle  --
B D               Zebra finch  --
  D              Saker falcon  ==
  D           Green seaturtle  --
B D       Medium ground finch  --
B D        American alligator  ==
  D    White-throated sparrow  --
          Tibetan ground jay  ==

Alignment block 18 of 191 in window, 7893477 - 7893502, 26 bps 
B D                     Human  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                     Chimp  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                   Gorilla  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                 Orangutan  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                    Gibbon  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                    Rhesus  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D       Crab-eating macaque  tagcaccctccgga---cc-ccctgccc------------------------------------------
B D                    Baboon  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D              Green monkey  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                  Marmoset  tagcaccctctgga---cc-ccccgccc------------------------------------------
B D           Squirrel monkey  tagcaccctccgga---cc-ccccgccc------------------------------------------
B D                  Bushbaby  tagcaccttccgga---cc-ccccaccc------------------------------------------
           Chinese tree shrew  tagcaccttctgga---cc-ccccaccc------------------------------------------
B D                  Squirrel  tagcaccttctgga---cc-ccctgccc------------------------------------------
       Lesser Egyptian jerboa  taactccttctgga---cc-ctcttccc------------------------------------------
                 Prairie vole  tagcaccatctggaccccc-ccctgccc------------------------------------------
B D           Chinese hamster  tatccccctctggaccccc-ccctgccc------------------------------------------
               Golden hamster  tagcgccatctggaccccc-ccctgccc------------------------------------------
B D                     Mouse  tagcaccatctggaccccc-ccctgccc------------------------------------------
B D                       Rat  tagcaccatctggaccccc-ccctgccc------------------------------------------
B D            Naked mole-rat  tagcaccttccgga---cc-ccccaccc------------------------------------------
B D                Guinea pig  tagcaccttctgga---cc-ccctgccc------------------------------------------
                   Chinchilla  tagcaccttccgga---cc-ccccaccc------------------------------------------
             Brush-tailed rat  tagcatcttctgga---cc-ccccaccc------------------------------------------
B D                    Rabbit  tagcaccttccgga---cc-ccccaccc------------------------------------------
B D                      Pika  ttgcaccttccgga---cc-ccctcccc------------------------------------------
B D                       Pig  tagcaccttccgga---cc-ccccgccc------------------------------------------
B D                    Alpaca  ttgcaccttccgga---cc-ccccgccc------------------------------------------
               Bactrian camel  ttgcaccttccgga---tc-ccccgccc------------------------------------------
B D                   Dolphin  tagcaccttccgga---cc-ccctgccc------------------------------------------
                 Killer whale  tagcaccttccgga---cc-ccccgccc------------------------------------------
             Tibetan antelope  tagcaccttccgga---cc-ccctgccc------------------------------------------
B D                       Cow  tagcaccctccgga---cc-ccccaccc------------------------------------------
B D                     Sheep  ------cttccgga---cc-ccctgccc------------------------------------------
                Domestic goat  tagcaccttccgga---cc-ccctgccc------------------------------------------
B D                     Horse  tagcaccttccgga---cc-ccc-gccc------------------------------------------
B D          White rhinoceros  tttcaccttccgga---cc-ccctgccc------------------------------------------
B D                       Cat  tagcaccttccgga---cc-ccccaccc------------------------------------------
B D                       Dog  tagcaccttccgga---cc-ccccaccc------------------------------------------
B D                     Panda  tagcaccttccgga---cc-ccccaccc------------------------------------------
               Pacific walrus  tagcaccttccgga---cc-ccccaccc------------------------------------------
             Black flying-fox  tagcaccttctgga---ac-ccccaccc------------------------------------------
B D                   Megabat  tagcaccttctgga---ac-ccccaccc------------------------------------------
                Big brown bat  tagcaccttccgga---tc-ccctgccc------------------------------------------
         David's myotis (bat)  tagcaccttccgga---tc-ccctgccc------------------------------------------
B D                  Microbat  tagcaccttccgga---tc-ccctgccc------------------------------------------
B D                  Hedgehog  tagcaccttccgga---cc-ccccaccc------------------------------------------
B D                     Shrew  tagcaccttccgga---cc-ccctaccc------------------------------------------
              Star-nosed mole  cgcccccttccgga---ac-ccctgccc------------------------------------------
B D                  Elephant  tagcaccttccgga---cc-ccctgccc------------------------------------------
          Cape elephant shrew  tagcaccttccgga---cc-ctccatcc------------------------------------------
B D                   Manatee  tagcaccttccgga---cc-ccccgtcc------------------------------------------
             Cape golden mole  tagcaccttccgga---cc-ccccaccc------------------------------------------
B D                    Tenrec  tagcaccttccgga---cc-tcccatcc------------------------------------------
                     Aardvark  tggcaccttccgga---cc-ccccaccc------------------------------------------
B D                 Armadillo  taataccttccgga---cc-cccagccc------------------------------------------
B D                   Opossum  cagctcctccaggg---cc-t-------------------------------------------------
B D           Tasmanian devil  cagttcctcctggg---cc-t-------------------------------------------------
B D                   Wallaby  cagttccccctggg---cc-t-------------------------------------------------
B D                  Platypus  ---caccctccag---------------------------------------------------------
  D               Rock pigeon  -catcgcgcccggg---ct-ggccgtca------------------------------------------
  D              Saker falcon  -----accccaccg---ct-tgctgcca------------------------------------------
  D          Peregrine falcon  -----accccaccg---ct-tgctgcca------------------------------------------
  D       Collared flycatcher  -ccccccccccccc---cc-cccccccc------------------------------------------
  D    White-throated sparrow  -cacctccccgggg---ct-ccccgcca------------------------------------------
B D       Medium ground finch  -catctccccctcc---ct-ccccgcca------------------------------------------
B D               Zebra finch  -catcgccccggcg---ct-ccccgcca------------------------------------------
           Tibetan ground jay  --------ccggcg---ct-ccctgcca------------------------------------------
B D                Budgerigar  -----------ccg---ct-ccctgcca------------------------------------------
  D                    Parrot  -----------atg---ctgtcctgcca------------------------------------------
  D             Scarlet macaw  -----------atg---ctgtcctgcca------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----tgcacctcag---ct-ttctgtca------------------------------------------
  D            Painted turtle  ----cgagccg-----------------------------------------------------------
  D  Chinese softshell turtle  ----cctgcctcag---cc-ccctgctg------------------------------------------
  D    Spiny softshell turtle  ----cacaccccag---ct-ttccctta------------------------------------------
B D                    Lizard  cacctgagccactg---ca-accttcaa------------------------------------------
B D             X. tropicalis  ctacagcaaccgtt---ac-tccggcat------------------------------------------
B D                Coelacanth  ---------ctgga---cc-cccctccg------------------------------------------
B D                 Tetraodon  ---------cccga---ga-tgccgccg------------------------------------------
B D                      Fugu  ---------cccga---gc-tcccgttg------------------------------------------
       Yellowbelly pufferfish  ---------ccgtt---gc-ccccgttgtgccc-------------------------------------
B D              Nile tilapia  ---------cctga---ac-cgccacct------------------------------------------
          Princess of Burundi  ---------cccga---ac-cgccacct------------------------------------------
        Burton's mouthbreeder  ---------cctga---ac-cgccacct------------------------------------------
                  Zebra mbuna  ---------cctga---ac-cgccacct------------------------------------------
          Pundamilia nyererei  ---------cctga---ac-cgccacct------------------------------------------
B D                    Medaka  ---------ccgga---gc-cgccgcct------------------------------------------
B D               Stickleback  ---------cccga---gc-ggccccgg-----cccccaccccggcggcgg-------------------
B D              Atlantic cod  ---------ccgcc---gc-cgccacca-----------------------ccaccccctcctgcggtc-
B D                 Zebrafish  ---------cccga---ac-ctccacct-----------------------------------------c
     Mexican tetra (cavefish)  ---------cctga---ac-cccctcct-----------------------------------------c
                  Spotted gar  ---------cccga---gc-aaccgcct------------------------------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
          Southern platyfish  ======================================================================
B D                   Chicken  ----------------------------------------------------------------------

                        Human  --------------tt
                        Chimp  --------------tt
                      Gorilla  --------------tt
                    Orangutan  --------------tt
                       Gibbon  --------------tt
                       Rhesus  --------------tt
          Crab-eating macaque  --------------tt
                       Baboon  --------------tt
                 Green monkey  --------------tt
                     Marmoset  --------------tt
              Squirrel monkey  --------------tt
                     Bushbaby  --------------tt
           Chinese tree shrew  --------------tt
                     Squirrel  --------------tt
       Lesser Egyptian jerboa  --------------tt
                 Prairie vole  --------------tc
              Chinese hamster  --------------tt
               Golden hamster  --------------tt
                        Mouse  --------------tt
                          Rat  --------------tt
               Naked mole-rat  --------------tt
                   Guinea pig  --------------tt
                   Chinchilla  --------------tt
             Brush-tailed rat  --------------tt
                       Rabbit  --------------tt
                         Pika  --------------tc
                          Pig  --------------tt
                       Alpaca  --------------tt
               Bactrian camel  --------------tt
                      Dolphin  --------------tt
                 Killer whale  --------------tt
             Tibetan antelope  --------------tt
                          Cow  --------------tt
                        Sheep  --------------tt
                Domestic goat  --------------tt
                        Horse  --------------tt
             White rhinoceros  --------------tt
                          Cat  --------------tt
                          Dog  --------------tc
                        Panda  --------------tc
               Pacific walrus  --------------tc
             Black flying-fox  --------------tt
                      Megabat  --------------tt
                Big brown bat  --------------tt
         David's myotis (bat)  --------------tt
                     Microbat  --------------tt
                     Hedgehog  --------------tt
                        Shrew  --------------tt
              Star-nosed mole  --------------tc
                     Elephant  --------------tt
          Cape elephant shrew  --------------tc
                      Manatee  --------------tg
             Cape golden mole  --------------tt
                       Tenrec  --------------tt
                     Aardvark  --------------tt
                    Armadillo  --------------tt
                      Opossum  ----------------
              Tasmanian devil  ----------------
                      Wallaby  ----------------
                     Platypus  ----------------
                  Rock pigeon  --------------gc
                 Saker falcon  --------------gc
             Peregrine falcon  --------------gc
          Collared flycatcher  --------------cc
       White-throated sparrow  --------------gc
          Medium ground finch  --------------gc
                  Zebra finch  --------------gc
           Tibetan ground jay  --------------gc
                   Budgerigar  -------------gcc
                       Parrot  ------------caac
                Scarlet macaw  ------------caac
           American alligator  ------------gtgg
              Green seaturtle  --------------gc
               Painted turtle  ----------------
     Chinese softshell turtle  --------------a-
       Spiny softshell turtle  --------------gc
                       Lizard  --------------ct
                X. tropicalis  --------------tg
                   Coelacanth  --------------ct
                    Tetraodon  ----------------
                         Fugu  ----------------
       Yellowbelly pufferfish  ----------------
                 Nile tilapia  ----------------
          Princess of Burundi  ----------------
        Burton's mouthbreeder  ----------------
                  Zebra mbuna  ----------------
          Pundamilia nyererei  ----------------
                       Medaka  ----------------
                  Stickleback  ----------------
                 Atlantic cod  ----------------
                    Zebrafish  aaccacctccac----
     Mexican tetra (cavefish)  agccacccccgc----
                  Spotted gar  ----------------
                      Ferret   NNNNNNNNNNNNNNNN
                 Weddell seal  ================
                       Turkey  ----------------
                 Mallard duck  ----------------
           Southern platyfish  ================
                      Chicken  ----------------

Inserts between block 18 and 19 in window
B D                    Horse 1432bp
B D               Coelacanth 5bp
B D              Stickleback 3bp

Alignment block 19 of 191 in window, 7893503 - 7893518, 16 bps 
B D                     Human  ccaccaccccctgct---------g
B D                     Chimp  ccaccaccccctgct---------g
B D                   Gorilla  ccaccaccccctgct---------g
B D                 Orangutan  ccaccaccccctgct---------g
B D                    Gibbon  ccaccaccccctgct---------g
B D                    Rhesus  ccaccaccccctgct---------g
B D       Crab-eating macaque  ccaccaccccctgct---------g
B D                    Baboon  ccaccaccccctgct---------g
B D              Green monkey  ccaccaccccctgct---------g
B D                  Marmoset  ccaccaccccctgct---------g
B D           Squirrel monkey  ccaccaccccctgct---------g
B D                  Bushbaby  cccccaccctctgct---------g
           Chinese tree shrew  ccaccaccccctgct---------g
B D                  Squirrel  ccaccaccccctgct---------g
       Lesser Egyptian jerboa  ccactaccccctgct---------g
                 Prairie vole  ccaccaccccctgct---------c
B D           Chinese hamster  ccaccaccccctgct---------c
               Golden hamster  ccaccaccccctgct---------c
B D                     Mouse  ccaccaccccctgct---------c
B D                       Rat  ccaccaccccctgct---------c
B D            Naked mole-rat  ccaccaccccctgct---------g
B D                Guinea pig  ccaccaccccctgct---------g
                   Chinchilla  ccaccaccccctgct---------g
             Brush-tailed rat  ccaccactccctgct---------g
B D                    Rabbit  ccaccaccccctgct---------g
B D                      Pika  ccaccaccccctgct---------g
B D                       Pig  ccaccaccccctgct---------g
B D                    Alpaca  ccaccaccccctgct---------g
               Bactrian camel  ccaccaccccctgct---------g
B D                   Dolphin  ccaccaccccctgct---------g
                 Killer whale  ccaccaccccctgct---------g
             Tibetan antelope  ccaccaccccctgct---------g
B D                       Cow  ccaccaccccctgct---------g
B D                     Sheep  ccaccaccccctgct---------g
                Domestic goat  ccaccaccccctgct---------g
B D          White rhinoceros  ccaccaccccctgct---------g
B D                       Cat  ccagcacctccttct---------g
B D                       Dog  ccaccacctccttct---------g
B D                     Panda  ccaccacctccttct---------g
               Pacific walrus  ccactgcctcctgcc---------g
             Black flying-fox  ccagccccccctgct---------g
B D                   Megabat  ccagccccccctgct---------g
                Big brown bat  ccactcccacctgct---------g
         David's myotis (bat)  ccactcccacctgct---------g
B D                  Microbat  ccactcccacctgct---------g
B D                  Hedgehog  ccaccacctcctgct---------g
B D                     Shrew  ccaccacccccagct---------g
              Star-nosed mole  ctgccaccccctgct---------g
B D                  Elephant  ccaccaccccctgct---------g
          Cape elephant shrew  ccaccaacccctatt---------g
B D                   Manatee  ccaccaccccctgct---------g
             Cape golden mole  ccaccaccccctgct---------g
B D                    Tenrec  ccaccaccccctgct---------g
                     Aardvark  ccaccaccccctact---------g
B D                 Armadillo  ccaccaccccctgct---------g
B D                   Opossum  ccaccacctcctg------------
B D           Tasmanian devil  ctaccacctcctg------------
B D                   Wallaby  ccaccacctcctg------------
B D                  Platypus  ---------caggcg---------g
  D               Rock pigeon  ccccagccgtccccc----------
  D              Saker falcon  ccccagcaggctgcc----------
  D          Peregrine falcon  ccccagcaggctgcc----------
  D       Collared flycatcher  ccccccccccccccc----------
  D    White-throated sparrow  ccccagccctctgcc----------
B D       Medium ground finch  ccccagccctctgcc----------
B D               Zebra finch  ccccagcactctgcc----------
           Tibetan ground jay  ccccagcactctgcc----------
B D                Budgerigar  ccccacca----gcc----------
  D                    Parrot  cccctgta----gat----------
  D             Scarlet macaw  ctcctgta----gat----------
  D              Mallard duck  -ctcagcagtctgct----------
B D                   Chicken  -cccagcagcctgcc----------
B D                    Turkey  -cccagcagcctgcc----------
B D        American alligator  cccccgaa----ccc----------
  D           Green seaturtle  cctcagcagtctgct----------
  D  Chinese softshell turtle  ---------tgtgccac--------
  D    Spiny softshell turtle  catc-----tgcgccgcccatggc-
B D                    Lizard  ctgctgcaaacacc-----------
B D             X. tropicalis  cca----------------------
B D                Coelacanth  gcagcagcaacag------------
B D                     Horse  =========================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  =========================
      Yellowbelly pufferfish  -------------------------
B D                      Fugu  -------------------------
B D               Stickleback  =========================
         Pundamilia nyererei  -------------------------
                 Zebra mbuna  -------------------------
       Burton's mouthbreeder  -------------------------
         Princess of Burundi  -------------------------
B D                    Medaka  -------------------------
                 Spotted gar  -------------------------
          Southern platyfish  =========================
    Mexican tetra (cavefish)  -------------------------
B D                 Zebrafish  -------------------------
B D              Nile tilapia  -------------------------
  D            Painted turtle  -------------------------
B D                 Tetraodon  -------------------------
B D              Atlantic cod  -------------------------

Inserts between block 19 and 20 in window
  D          Green seaturtle 7773bp
  D   Spiny softshell turtle 2bp
B D                   Lizard 4bp

Alignment block 20 of 191 in window, 7893519 - 7893526, 8 bps 
B D                     Human  ctgatatc
B D                     Chimp  ctgatatc
B D                   Gorilla  ctgatatc
B D                 Orangutan  ctgatatc
B D                    Gibbon  ctgatatc
B D                    Rhesus  ctgatatc
B D       Crab-eating macaque  ctgatatc
B D                    Baboon  ctgatatc
B D              Green monkey  ctgatatc
B D                  Marmoset  ctgatatc
B D           Squirrel monkey  ctgatatc
B D                  Bushbaby  ctgatatc
           Chinese tree shrew  ctgatacc
B D                  Squirrel  ctgatatc
       Lesser Egyptian jerboa  ctgacacc
                 Prairie vole  ctgaaatc
B D           Chinese hamster  ctgaaatc
               Golden hamster  ctgaaatc
B D                     Mouse  ctgaaatc
B D                       Rat  ctgaaatc
B D            Naked mole-rat  ctgatata
B D                Guinea pig  ctgatata
                   Chinchilla  ctgatata
             Brush-tailed rat  ctgatata
B D                    Rabbit  ttgatatc
B D                      Pika  ttgatatc
B D                       Pig  ctgatatc
B D                    Alpaca  ctgatatc
               Bactrian camel  ctgatatc
B D                   Dolphin  ctgatatc
                 Killer whale  ctgatatc
             Tibetan antelope  ctgatatc
B D                       Cow  ctgatatc
B D                     Sheep  ctgatatc
                Domestic goat  ctgatatc
B D          White rhinoceros  ctgataac
B D                       Cat  ctgatacc
B D                       Dog  ctgatacc
B D                     Panda  ccgatacc
               Pacific walrus  ---atgcc
                 Weddell seal  ccgatgcc
             Black flying-fox  ttgatatc
B D                   Megabat  ttgatatc
                Big brown bat  ctgatatc
         David's myotis (bat)  ctgatatc
B D                  Microbat  ctgatatc
B D                  Hedgehog  ctgatatc
B D                     Shrew  ctgatatc
              Star-nosed mole  ccgatatc
B D                  Elephant  ctgatacc
          Cape elephant shrew  ctgacttc
B D                   Manatee  ctgatatc
             Cape golden mole  ctgatatc
B D                    Tenrec  ctgatatc
                     Aardvark  ctgatatc
B D                 Armadillo  ctgatatc
B D                   Opossum  ctgatctc
B D           Tasmanian devil  ctgatgtc
B D                   Wallaby  ctgatgtc
B D                  Platypus  ------ct
B D                Coelacanth  cag-----
B D                     Horse  ========
B D                   Ferret   NNNNNNNN
      Yellowbelly pufferfish  --------
B D                      Fugu  --------
B D               Stickleback  ========
         Pundamilia nyererei  --------
                 Zebra mbuna  --------
       Burton's mouthbreeder  --------
         Princess of Burundi  --------
B D                    Medaka  --------
B D                    Turkey  --------
                 Spotted gar  --------
  D              Mallard duck  --------
  D             Scarlet macaw  --------
  D                    Parrot  --------
B D                Budgerigar  --------
  D    Spiny softshell turtle  ========
B D                    Lizard  ========
          Southern platyfish  ========
    Mexican tetra (cavefish)  --------
  D          Peregrine falcon  --------
B D                 Zebrafish  --------
  D               Rock pigeon  --------
B D              Nile tilapia  --------
  D            Painted turtle  --------
B D                 Tetraodon  --------
B D                   Chicken  --------
B D              Atlantic cod  --------
  D       Collared flycatcher  --------
  D  Chinese softshell turtle  --------
B D               Zebra finch  --------
  D              Saker falcon  --------
B D             X. tropicalis  --------
  D           Green seaturtle  ========
B D       Medium ground finch  --------
B D        American alligator  --------
  D    White-throated sparrow  --------
          Tibetan ground jay  --------

Alignment block 21 of 191 in window, 7893527 - 7893540, 14 bps 
B D                     Human  cagc---------ccccacccat
B D                     Chimp  cagc---------ccccacccat
B D                   Gorilla  cagc---------ccccacccat
B D                 Orangutan  cagc---------ccccacccat
B D                    Gibbon  cagc---------ccccacccat
B D                    Rhesus  cagc---------ccccacccat
B D       Crab-eating macaque  cagc---------ccccacccat
B D                    Baboon  cagc---------ccccacccat
B D              Green monkey  cagc---------ccccacccat
B D                  Marmoset  cagc---------ccccacccat
B D           Squirrel monkey  cagc---------ccccacccat
B D                  Bushbaby  cagc---------ccccacctat
           Chinese tree shrew  cagc---------ccccacccat
B D                  Squirrel  cagc---------ccccacccat
       Lesser Egyptian jerboa  cggc---------ccctgcccat
                 Prairie vole  cagc---------ccccacctat
B D           Chinese hamster  cagc---------ccccacctat
               Golden hamster  cagc---------ccccacccat
B D                     Mouse  cagc---------ccccacccat
B D                       Rat  cagc---------ccccacccat
B D            Naked mole-rat  cagc---------ccccactcat
B D                Guinea pig  cagc---------ccccacccat
                   Chinchilla  cagc---------ccccacccat
             Brush-tailed rat  cagc---------ccccacccat
B D                    Rabbit  cagc---------ccccacccat
B D                      Pika  cagc---------caccacccat
B D                       Pig  cagc---------ccccacccat
B D                    Alpaca  cagc---------ccctacccat
               Bactrian camel  cagc---------ccctacccat
B D                   Dolphin  cagc---------ccccacccat
                 Killer whale  cagc---------ccccacccat
             Tibetan antelope  cagc---------ccccacccat
B D                       Cow  cagc---------ccccacccat
B D                     Sheep  cagc---------ccccacccat
                Domestic goat  cagc---------ccccacccat
B D          White rhinoceros  cagc---------ccccacccat
B D                       Cat  cagc---------ccccacccat
B D                       Dog  cagc---------ccccacccat
B D                     Panda  cagc---------ccccacccat
               Pacific walrus  cagc---------ccccacccat
                 Weddell seal  cagc---------ccccacccgt
             Black flying-fox  cagc---------ccccacccat
B D                   Megabat  cagc---------ccccacccat
                Big brown bat  caac---------ccccacccat
         David's myotis (bat)  caac---------ccccacccat
B D                  Microbat  caac---------ccccacccat
B D                  Hedgehog  cacc---------tcccacctat
B D                     Shrew  cagc---------ccccacccat
              Star-nosed mole  cagc---------ccccacccat
B D                  Elephant  cagc---------ccccacccat
          Cape elephant shrew  cagc---------ccccacccat
B D                   Manatee  cagc---------ccccacccat
             Cape golden mole  cagc---------ccccacccat
B D                    Tenrec  cagt---------ccccacctat
                     Aardvark  cagc---------ccccacctat
B D                 Armadillo  cagc---------ccccacccat
B D                   Opossum  cagc---------ctccacctat
B D           Tasmanian devil  cagc---------ctccacctat
B D                   Wallaby  cagc---------ccccacctat
B D                  Platypus  cagc---------cggtgcccat
  D               Rock pigeon  ctgc---------cccccgttgt
  D              Saker falcon  ttgc---------ccactgtcgt
  D          Peregrine falcon  ttgc---------ccactgtcat
  D       Collared flycatcher  cccc---------cccccccccc
  D    White-throated sparrow  ctgc---------ccaccgtcat
B D       Medium ground finch  ctgc---------ccaccgtcat
B D               Zebra finch  ctgc---------ccgctgtcgt
           Tibetan ground jay  ctgc---------ccaccgtcat
B D                Budgerigar  ttgc---------cccccgtcat
  D                    Parrot  gtgc---------cac------t
  D             Scarlet macaw  gtgc---------cac------t
  D              Mallard duck  ttgc---------ccgctgtcat
B D                   Chicken  ttgc---------cccctgtcat
B D                    Turkey  ctgc---------cccctgtcat
B D        American alligator  cagc---------ccccacccgt
  D           Green seaturtle  cagc---------ccgctcccat
  D            Painted turtle  cagc---------ccgctcccat
  D  Chinese softshell turtle  ----------------------t
  D    Spiny softshell turtle  ----------------------t
B D                    Lizard  cagc---------ctcttccaat
B D             X. tropicalis  ---------------------at
B D                Coelacanth  ccgc---------ctccccccat
B D                 Tetraodon  cagc---------cgccccccat
B D                      Fugu  cagc---------cgccccctat
       Yellowbelly pufferfish  cagcctgccccggcgcctccgct
B D              Nile tilapia  cagc---------ctccacctat
          Princess of Burundi  cagc---------ctccacctgt
        Burton's mouthbreeder  cagc---------ctccacctgt
                  Zebra mbuna  cagc---------ctccacctgt
          Pundamilia nyererei  cagc---------ctccacctgt
B D                    Medaka  caac---------cgccaccaat
           Southern platyfish  cagc---------cgccgcccat
B D               Stickleback  cttc---------caccgccaat
B D              Atlantic cod  ---------cccgccccaccgct
B D                 Zebrafish  ----------------------t
     Mexican tetra (cavefish)  ----------------------t
                  Spotted gar  cagc---------cccctcccct
B D                     Horse  =======================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 21 and 22 in window
B D            X. tropicalis 1bp

Alignment block 22 of 191 in window, 7893541 - 7893542, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  ca
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  cc
B D                  Squirrel  cc
       Lesser Egyptian jerboa  cc
                 Prairie vole  ca
B D           Chinese hamster  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  cc
B D                Guinea pig  cc
                   Chinchilla  cc
             Brush-tailed rat  cc
B D                    Rabbit  cc
B D                      Pika  cc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                  Hedgehog  cc
B D                     Shrew  cc
              Star-nosed mole  cc
B D                  Elephant  cc
          Cape elephant shrew  cc
B D                   Manatee  cc
             Cape golden mole  cc
B D                    Tenrec  cc
                     Aardvark  cc
B D                 Armadillo  cc
B D                   Opossum  cc
B D           Tasmanian devil  cc
B D                   Wallaby  cc
B D                  Platypus  cc
  D               Rock pigeon  ca
  D              Saker falcon  ca
  D          Peregrine falcon  ca
  D       Collared flycatcher  c-
  D    White-throated sparrow  ca
B D       Medium ground finch  ca
B D               Zebra finch  ca
           Tibetan ground jay  ca
B D                Budgerigar  ca
  D                    Parrot  ta
  D             Scarlet macaw  ca
  D              Mallard duck  ca
B D                   Chicken  ca
B D                    Turkey  ca
B D        American alligator  cc
  D           Green seaturtle  cc
  D            Painted turtle  cc
  D  Chinese softshell turtle  cc
  D    Spiny softshell turtle  ca
B D                    Lizard  cc
B D             X. tropicalis  c-
B D                Coelacanth  cc
B D                 Tetraodon  cc
B D                      Fugu  cc
       Yellowbelly pufferfish  cc
B D              Nile tilapia  ta
          Princess of Burundi  ta
        Burton's mouthbreeder  ta
                  Zebra mbuna  ta
          Pundamilia nyererei  ta
B D                    Medaka  ca
           Southern platyfish  ta
B D               Stickleback  ca
B D              Atlantic cod  cc
B D                 Zebrafish  ac
     Mexican tetra (cavefish)  tc
                  Spotted gar  gc
B D                     Horse  ==

Inserts between block 22 and 23 in window
  D      Collared flycatcher 613bp

Alignment block 23 of 191 in window, 7893543 - 7893571, 29 bps 
B D                     Human  gaagagccaaaaccaaagagggcaaaggt
B D                     Chimp  gaagagccaaaaccaaagagggcaaaggt
B D                   Gorilla  gaagagccaaaaccaaagagggcaaaggt
B D                 Orangutan  gaagagccaaaaccaaagagggcaaaggt
B D                    Gibbon  gaagagccaaaaccaaagagggcaaaggt
B D                    Rhesus  gaagagccaaaaccaaagagggcaaaggt
B D       Crab-eating macaque  gaagagccaaaaccaaagagggcaaaggt
B D                    Baboon  gaagagccaaaaccaaagagggcaaaggt
B D              Green monkey  gaagagccaaaaccaaagagggcaaaggt
B D                  Marmoset  gaagagccaaaaccaaagagggcaaaggt
B D           Squirrel monkey  gaagagccaaaaccaaagagggcaaaggt
B D                  Bushbaby  gaagagccaaaaccaaagagggcaaaggt
           Chinese tree shrew  gaagagccaaaaccaaagagggcaaaggt
B D                  Squirrel  gaagagccaaaaccaaagagggcaaaggt
       Lesser Egyptian jerboa  gcagagccaaaaccaaagagggcaaaggt
                 Prairie vole  gaagagccaaaaccaaagagggcaaaggt
B D           Chinese hamster  gaagagccaaaaccaaagagggcaaaggt
               Golden hamster  gaagagccaaaaccaaagagggcaaaggt
B D                     Mouse  gaagagccaaaaccaaagagggcaaaggt
B D                       Rat  gaagagccaaaaccaaagagggcaaaggt
B D            Naked mole-rat  gaagagccaaaaccaaagagggcaaaggt
B D                Guinea pig  gaagagccaaaaccaaagagggcaaaggt
                   Chinchilla  gaagagccaaaaccaaagagggcaaaggt
             Brush-tailed rat  gaagagccaaaaccaaagagggcaaaggt
B D                    Rabbit  gaagagccaaaaccaaagagggcaaaggt
B D                      Pika  gaagagccaagaccaaagagggcaaaggt
B D                       Pig  gaagagccaaaaccaaagagggcaaaggt
B D                    Alpaca  gaagagccaaaaccaaagagggcaaaggt
               Bactrian camel  gaagagccaaaaccaaagagggcaaaggt
B D                   Dolphin  gaagagccaaaaccaaagagggcaaaggt
                 Killer whale  gaagagccaaaaccaaagagggcaaaggt
             Tibetan antelope  gaagagccaaaaccaaagagggcaaaggt
B D                       Cow  gaagagccaaaaccaaagagggcaaaggt
B D                     Sheep  gaagagccaaaaccaaagagggcaaaggt
                Domestic goat  gaagagccaaaaccaaagagggcaaaggt
B D          White rhinoceros  gaagagccaaaaccaaagagggcaaaggt
B D                       Cat  gaagagccaaaaccaaagagggcaaaggt
B D                       Dog  gaagagccaaaaccaaagagggcaaaggt
B D                   Ferret   gaagagccaaaaccaaagagggcaaaggt
B D                     Panda  gaagagccaaaaccaaagagggcaaaggt
               Pacific walrus  gaagagccaaaaccaaagagggcaaaggt
                 Weddell seal  gcagagccaaaaccaaagagggcaaaggt
             Black flying-fox  gaagagccaaaaccaaagagggcaaaggt
B D                   Megabat  gaagagccaaaaccaaagagggcaaaggt
                Big brown bat  gaagagccaaaaccaaagagggcaaaggt
         David's myotis (bat)  gaagagccaaaaccaaagagggcaaaggt
B D                  Microbat  gaagagccaaaaccaaagagggcaaaggt
B D                  Hedgehog  gaagagccaaaaccaaagagggaaaaggt
B D                     Shrew  gaagagccaaaaccaaagaaggcaaaggt
              Star-nosed mole  gacgcgccaaaaccaaagagggcaaaggt
B D                  Elephant  gaagagccaaaaccaaagagggcaaaggt
          Cape elephant shrew  gaagagccaaaaccaaagagggcaaaggt
B D                   Manatee  gaagagccaaaaccaaagagggcaaaggt
             Cape golden mole  gaagagccaaaaccaaagagggcaaaggt
B D                    Tenrec  gaagagccaaaaccaaagagggcaaaggt
                     Aardvark  gaagagccaaaaccaaagagggcaaaggt
B D                 Armadillo  gaagagccaaaaccaaagagggtaaaggt
B D                   Opossum  gaagagccaaaaccaaagaaggcaaaggt
B D           Tasmanian devil  gaagagccaaaaccaaagaaggcaaaggt
B D                   Wallaby  gaagagccaaaaccaaagaaggcaaaggt
B D                  Platypus  ggaaggccaaaaccaaggagggcaaaggt
  D               Rock pigeon  ggaaggccaagaccaaggagggcaagggt
  D              Saker falcon  ggaaggccaagaccaaggagggcaagggt
  D          Peregrine falcon  ggaaggccaagaccaaggagggcaagggt
  D       Collared flycatcher  ggaaagccaaaaccaaggaggggaagggt
  D    White-throated sparrow  ggaaggccaagaccaaggagggaaagggt
B D       Medium ground finch  ggaaggccaagaccaaggagggaaagggt
B D               Zebra finch  ggaaggccaagaccaaggagggcaagggt
           Tibetan ground jay  ggaaggccaagaccaaggaggggaagggt
B D                Budgerigar  ggaaggcaaagaccaaggagggcaagggt
  D                    Parrot  ggaaagccaagacaaaggagggcaaaggt
  D             Scarlet macaw  ggaaagccaagacaaaggagggtaaaggt
  D              Mallard duck  ggaaagctaaaaccaaggagggcaagggt
B D                   Chicken  ggaaagcaaaaaccaaggaaggcaagggt
B D                    Turkey  ggaaagcaaaaaccaaggaaggcaagggt
B D        American alligator  gcaaagccaagaccaaagagggcaaaggt
  D           Green seaturtle  gcaaagccaaaaccaaagaagggaaaggt
  D            Painted turtle  gcaaagccaaaaccaaagaagggaaaggt
  D  Chinese softshell turtle  gtaaggccaagaccaaggagggcaaaggt
  D    Spiny softshell turtle  ggaaagctaaaaccaaggagggcaaaggt
B D                    Lizard  gcaaagccaaaaccaaagaaggtaaaggt
B D             X. tropicalis  gcagagccaagactaaggagggaaagggt
B D                Coelacanth  gcaaagccaagacaaaagaggggaaaggt
B D                 Tetraodon  ggaaagccaagaccaaagagggcaaaggt
B D                      Fugu  ggaaagccaagacaaaagagggcaaaggt
       Yellowbelly pufferfish  gcaaggccaagactaaagagggcaaaggt
B D              Nile tilapia  gaaaagccaagacaaaagagggcaaaggt
          Princess of Burundi  gaaaagccaagacaaaagagggcaaaggt
        Burton's mouthbreeder  gaaaagccaagacaaaagagggcaaaggt
                  Zebra mbuna  gaaaagccaagacaaaagagggcaaaggt
          Pundamilia nyererei  gaaaagccaagacaaaagagggcaaaggt
B D                    Medaka  gaaaggcgaagacgaaagaaggaaaaggt
           Southern platyfish  gaaaggccaagacgaaagagggcaaaggt
B D               Stickleback  gaaaggccaagagg---------------
B D              Atlantic cod  gcaaagccaagaccaaagagggcaaaggt
B D                 Zebrafish  gcaaggccaagaccaaagagggcaaaggt
     Mexican tetra (cavefish)  gcaaggccaagaccaaagaagggaaaggt
                  Spotted gar  gcaaggccaagaccaaagaaggcaaaggt
B D                     Horse  =============================

Inserts between block 23 and 24 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
B D                   Lizard 1bp
B D                Tetraodon 1bp
B D                     Fugu 78bp
      Yellowbelly pufferfish 2bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 2158bp
          Southern platyfish 1bp
B D              Stickleback 2bp
B D             Atlantic cod 1bp

Alignment block 24 of 191 in window, 7893572 - 7893572, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  a
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
B D             X. tropicalis  a
B D                Coelacanth  g
                  Spotted gar  a
B D                     Horse  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                    Turkey  -
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  -
  D          Peregrine falcon  -
B D                 Zebrafish  -
  D               Rock pigeon  -
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  -
B D              Atlantic cod  =
  D       Collared flycatcher  -
  D  Chinese softshell turtle  =
B D               Zebra finch  -
  D              Saker falcon  -
  D           Green seaturtle  =
B D       Medium ground finch  -
B D        American alligator  -
  D    White-throated sparrow  -
          Tibetan ground jay  -

Inserts between block 24 and 25 in window
                 Spotted gar 307bp

Alignment block 25 of 191 in window, 7893573 - 7893574, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  gg
B D                  Squirrel  gg
       Lesser Egyptian jerboa  gg
                 Prairie vole  gg
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                    Rabbit  gg
B D                      Pika  gg
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                   Ferret   ag
B D                     Panda  ag
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ag
B D                     Shrew  ag
              Star-nosed mole  tg
B D                  Elephant  ag
          Cape elephant shrew  ag
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  ag
                     Aardvark  ag
B D                 Armadillo  ag
B D                   Opossum  aa
B D           Tasmanian devil  aa
B D                   Wallaby  aa
B D                  Platypus  ag
  D               Rock pigeon  ag
  D              Saker falcon  ag
  D          Peregrine falcon  ag
  D       Collared flycatcher  gg
  D    White-throated sparrow  gg
B D       Medium ground finch  gg
B D               Zebra finch  gg
           Tibetan ground jay  gg
B D                Budgerigar  ag
  D                    Parrot  ga
  D             Scarlet macaw  ga
  D              Mallard duck  ag
B D                   Chicken  ag
B D                    Turkey  ag
B D        American alligator  aa
  D           Green seaturtle  ag
  D            Painted turtle  ag
  D  Chinese softshell turtle  ag
B D                    Lizard  ag
B D             X. tropicalis  ag
B D                Coelacanth  gg
B D                 Tetraodon  a-
       Yellowbelly pufferfish  a-
B D              Nile tilapia  t-
          Princess of Burundi  t-
        Burton's mouthbreeder  t-
                  Zebra mbuna  t-
          Pundamilia nyererei  t-
           Southern platyfish  a-
B D               Stickleback  a-
B D              Atlantic cod  a-
B D                     Horse  ==
B D                      Fugu  ==
B D                    Medaka  ==
                 Spotted gar  ==
  D    Spiny softshell turtle  ==
    Mexican tetra (cavefish)  --
B D                 Zebrafish  --

Inserts between block 25 and 26 in window
  D              Rock pigeon 2703bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1291bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2979bp
          Tibetan ground jay 3502bp
B D               Budgerigar 1777bp
  D                   Parrot 912bp
  D            Scarlet macaw 3110bp
  D             Mallard duck 2446bp
B D                  Chicken 3bp
B D                   Turkey 3bp
B D       American alligator 1bp
  D          Green seaturtle 6bp
  D           Painted turtle 6bp
  D Chinese softshell turtle 6568bp
B D                   Lizard 972bp
B D            X. tropicalis 731bp
B D               Coelacanth 1bp

Alignment block 26 of 191 in window, 7893575 - 7893575, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                     Mouse  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  a
B D                   Wallaby  g
B D                  Platypus  t
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
B D                    Lizard  g
B D                 Tetraodon  g
       Yellowbelly pufferfish  g
B D              Nile tilapia  g
          Princess of Burundi  g
        Burton's mouthbreeder  g
                  Zebra mbuna  g
          Pundamilia nyererei  g
           Southern platyfish  g
B D               Stickleback  g
B D              Atlantic cod  g
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
B D                       Rat  -
              Golden hamster  -
B D           Chinese hamster  -
                Prairie vole  -
B D                     Horse  =
B D                  Squirrel  -
B D                      Pika  -
B D                    Rabbit  -
      Lesser Egyptian jerboa  -
B D                      Fugu  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D    Spiny softshell turtle  =
  D          Peregrine falcon  =
  D               Rock pigeon  =
B D                   Chicken  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
          Tibetan ground jay  =

Inserts between block 26 and 27 in window
B D                Tetraodon 4bp
      Yellowbelly pufferfish 87bp
          Southern platyfish 10bp
B D             Atlantic cod 429bp
B D                Zebrafish 3bp
    Mexican tetra (cavefish) 3bp

Alignment block 27 of 191 in window, 7893576 - 7893576, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  g
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   c
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  g
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D        American alligator  a
  D           Green seaturtle  g
  D            Painted turtle  g
B D                    Lizard  a
B D                Coelacanth  a
B D               Stickleback  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  g
B D                     Horse  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D                    Medaka  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D    Spiny softshell turtle  =
          Southern platyfish  =
  D          Peregrine falcon  =
  D               Rock pigeon  =
B D              Nile tilapia  -
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
          Tibetan ground jay  =

Inserts between block 27 and 28 in window
B D                 Platypus 5667bp
B D       American alligator 419bp
B D                   Lizard 4bp
B D               Coelacanth 1002bp

Alignment block 28 of 191 in window, 7893577 - 7893577, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   c
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D        American alligator  g
  D           Green seaturtle  a
  D            Painted turtle  g
B D                    Lizard  g
B D               Stickleback  g
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
B D                     Horse  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D    Spiny softshell turtle  =
          Southern platyfish  =
  D          Peregrine falcon  =
  D               Rock pigeon  =
B D              Nile tilapia  -
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
          Tibetan ground jay  =

Inserts between block 28 and 29 in window
B D                 Hedgehog 3bp
             Star-nosed mole 5bp
B D              Stickleback 5bp
    Mexican tetra (cavefish) 616bp

Alignment block 29 of 191 in window, 7893578 - 7893582, 5 bps 
B D                     Human  ct-c----tc---
B D                     Chimp  ct-c----tc---
B D                   Gorilla  ct-c----tc---
B D                 Orangutan  ct-c----tc---
B D                    Gibbon  ct-c----tc---
B D                    Rhesus  ct-c----tc---
B D       Crab-eating macaque  ct-c----tc---
B D                    Baboon  ct-c----tc---
B D              Green monkey  ct-c----tc---
B D                  Marmoset  ct-c----tc---
B D           Squirrel monkey  at-c----tc---
B D                  Bushbaby  cc-cctcttc---
           Chinese tree shrew  cc-c----tc---
B D                  Squirrel  at-g-cactt---
       Lesser Egyptian jerboa  cc-c-tcttc---
                 Prairie vole  cc-c-tcatc---
B D           Chinese hamster  cc-c-tcttc---
               Golden hamster  cc-c-tcttc---
B D                     Mouse  cc-c-tcttc---
B D                       Rat  cc-t-tcttc---
B D            Naked mole-rat  ct-c---ttc---
B D                Guinea pig  ct-c---ttc---
                   Chinchilla  ct-c-tcttc---
             Brush-tailed rat  ct-c-ttttc---
B D                    Rabbit  gc-c-tcttc---
B D                      Pika  gt-t-t-------
B D                       Pig  ac-c----tc---
B D                    Alpaca  cc-c----tc---
               Bactrian camel  cc-c----tc---
B D                   Dolphin  cc-c----tc---
                 Killer whale  cc-c----tc---
             Tibetan antelope  cc-t----tc---
B D                       Cow  tc-t----tc---
B D                     Sheep  cc-t----tc---
                Domestic goat  cc-t----tc---
B D          White rhinoceros  cc-c----tc---
B D                       Cat  ct-c----tt---
B D                       Dog  at-c----tc---
B D                   Ferret   cc-c----cc---
B D                     Panda  cc-c----tc---
               Pacific walrus  cc-c----tc---
                 Weddell seal  cc-c----tc---
             Black flying-fox  cc-c----tg---
B D                   Megabat  cc-c----tg---
                Big brown bat  cc-c----tc---
         David's myotis (bat)  cc-c----tc---
B D                  Microbat  cc-c----tc---
B D                  Hedgehog  ct-t----tc---
B D                     Shrew  cc-a----tc---
              Star-nosed mole  cc-t----tc---
B D                  Elephant  tc-c----tc---
          Cape elephant shrew  ga-c----tc---
B D                   Manatee  tc-c----tc---
             Cape golden mole  tg-g----tc---
B D                    Tenrec  --------tc---
                     Aardvark  ac-c----tc---
B D                 Armadillo  cc-c----tc---
B D                   Opossum  ctcc----tc---
B D           Tasmanian devil  tt-c----tc---
B D                   Wallaby  ttcc----tt---
B D                  Platypus  ct-c----gg---
  D    White-throated sparrow  c------------
B D       Medium ground finch  c------------
B D        American alligator  c------------
  D           Green seaturtle  t------------
  D            Painted turtle  t------------
B D                    Lizard  c------------
B D                 Tetraodon  --------tccat
B D              Nile tilapia  --------tagtc
          Princess of Burundi  --------tcgtc
        Burton's mouthbreeder  --------tcgtc
                  Zebra mbuna  --------tcgtc
          Pundamilia nyererei  --------tcgtc
B D                    Medaka  ---------attt
           Southern platyfish  ---------agat
B D               Stickleback  --------aggt-
B D                 Zebrafish  -----------at
B D                     Horse  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D             Scarlet macaw  =============
  D                    Parrot  =============
B D                Budgerigar  =============
  D    Spiny softshell turtle  =============
    Mexican tetra (cavefish)  =============
  D          Peregrine falcon  =============
  D               Rock pigeon  =============
B D                   Chicken  =============
B D              Atlantic cod  =============
  D       Collared flycatcher  =============
  D  Chinese softshell turtle  =============
B D               Zebra finch  =============
  D              Saker falcon  =============
B D             X. tropicalis  =============
          Tibetan ground jay  =============

Inserts between block 29 and 30 in window
         Cape elephant shrew 2bp
  D   White-throated sparrow 2177bp
B D      Medium ground finch 5bp
  D          Green seaturtle 9bp
  D           Painted turtle 9bp
B D                   Lizard 3bp

Alignment block 30 of 191 in window, 7893583 - 7893584, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  tt
B D                  Squirrel  at
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
               Golden hamster  tt
B D                     Mouse  tt
B D                       Rat  tt
B D            Naked mole-rat  tt
B D                Guinea pig  ct
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  tt
B D                       Pig  tt
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D          White rhinoceros  tt
B D                       Cat  cg
B D                       Dog  tg
B D                   Ferret   gc
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tc
B D                  Microbat  tt
B D                  Hedgehog  t-
B D                     Shrew  c-
              Star-nosed mole  c-
B D                  Elephant  cc
B D                   Manatee  ct
             Cape golden mole  ct
B D                    Tenrec  tt
                     Aardvark  ct
B D                 Armadillo  ct
B D                   Opossum  c-
B D           Tasmanian devil  c-
B D                   Wallaby  c-
B D                  Platypus  ct
  D              Saker falcon  tg
  D          Peregrine falcon  tg
  D           Green seaturtle  gc
  D            Painted turtle  gc
B D                 Tetraodon  tt
B D              Nile tilapia  tt
          Princess of Burundi  tt
        Burton's mouthbreeder  tt
                  Zebra mbuna  tt
          Pundamilia nyererei  tt
B D                    Medaka  tt
           Southern platyfish  ct
B D                 Zebrafish  tt
         Cape elephant shrew  ==
B D                     Horse  ==
B D                      Pika  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  --
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D    Spiny softshell turtle  ==
B D                    Lizard  ==
    Mexican tetra (cavefish)  ==
  D               Rock pigeon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
B D             X. tropicalis  ==
B D       Medium ground finch  ==
B D        American alligator  --
  D    White-throated sparrow  ==
          Tibetan ground jay  ==

Inserts between block 30 and 31 in window
B D                Zebrafish 676bp

Alignment block 31 of 191 in window, 7893585 - 7893586, 2 bps 
B D                     Human  c---------------c
B D                     Chimp  c---------------c
B D                   Gorilla  c---------------c
B D                 Orangutan  c---------------c
B D                    Gibbon  c---------------c
B D                    Rhesus  c---------------c
B D       Crab-eating macaque  c---------------c
B D                    Baboon  c---------------c
B D              Green monkey  c---------------c
B D                  Marmoset  c---------------c
B D           Squirrel monkey  c---------------c
B D                  Bushbaby  c---------------c
           Chinese tree shrew  c---------------t
B D                  Squirrel  t---------------c
       Lesser Egyptian jerboa  c---------------t
                 Prairie vole  c---------------c
B D           Chinese hamster  c---------------c
               Golden hamster  c---------------c
B D                     Mouse  c---------------c
B D                       Rat  c---------------c
B D            Naked mole-rat  c---------------c
B D                Guinea pig  c---------------c
                   Chinchilla  c---------------t
             Brush-tailed rat  c---------------c
B D                    Rabbit  g---------------c
B D                       Pig  g---------------c
B D                    Alpaca  g---------------t
               Bactrian camel  g---------------t
B D                   Dolphin  g---------------t
                 Killer whale  g---------------t
             Tibetan antelope  g---------------g
B D                       Cow  g---------------g
B D                     Sheep  g---------------g
                Domestic goat  g---------------g
B D          White rhinoceros  c---------------t
B D                       Cat  c---------------t
B D                       Dog  g---------------t
B D                   Ferret   c---------------c
B D                     Panda  c---------------t
               Pacific walrus  c---------------t
                 Weddell seal  c---------------t
             Black flying-fox  t---------------g
B D                   Megabat  t---------------g
                Big brown bat  t---------------g
         David's myotis (bat)  t---------------g
B D                  Microbat  t---------------g
B D                  Elephant  c---------------t
B D                   Manatee  c---------------t
             Cape golden mole  c---------------t
B D                    Tenrec  c---------------t
                     Aardvark  c---------------t
B D                 Armadillo  c---------------t
B D                  Platypus  t---------------t
  D              Saker falcon  c---------------c
  D          Peregrine falcon  c---------------c
B D                   Chicken  c---------------c
B D                    Turkey  c---------------c
B D        American alligator  c---------------a
  D           Green seaturtle  t---------------t
  D            Painted turtle  t---------------t
B D                 Tetraodon  t---------------t
B D              Nile tilapia  c---------------c
          Princess of Burundi  c---------------c
        Burton's mouthbreeder  c---------------c
                  Zebra mbuna  c---------------c
          Pundamilia nyererei  c---------------c
B D                    Medaka  taagaggaatgcccaat
           Southern platyfish  t---------------c
B D                 Zebrafish  c---------------t
B D                  Hedgehog  -----------------
         Cape elephant shrew  =================
B D                     Shrew  -----------------
B D                     Horse  =================
             Star-nosed mole  -----------------
B D                      Pika  -----------------