Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 154 in window, 63810263 - 63810267, 5 bps 
B D                     Human  t-----------tttt
B D                     Chimp  t-----------tttt
B D                   Gorilla  t-----------tttt
B D                 Orangutan  --------------tt
B D                    Gibbon  tgttttgttttgtttt
B D                    Rhesus  tgtttttgttt-tttt
B D       Crab-eating macaque  tgtttttgttt-tttt
B D                    Baboon  tgttttt-ttt-gttt
B D              Green monkey  ttttttttttt-tttt
B D                  Marmoset  ----------------
B D           Squirrel monkey  ----------------
                 Prairie vole  --------------tg
B D           Tasmanian devil  tgtgg-----------
B D                    Tenrec  ================
B D                  Hedgehog  ----------------
B D                Guinea pig  ================
B D                       Rat  ================
B D                     Mouse  ================
              Golden hamster  ----------------
B D           Chinese hamster  ----------------
B D                  Elephant  ----------------
            Tibetan antelope  ----------------
         Cape elephant shrew  ----------------
B D                     Shrew  ================
        David's myotis (bat)  ================
B D                     Horse  ----------------
               Domestic goat  ----------------
B D                     Sheep  ----------------
B D                       Cow  ================
B D                    Alpaca  ----------------
             Star-nosed mole  ----------------
B D                  Squirrel  ----------------
B D                      Pika  ----------------
B D                    Rabbit  ================
B D                 Armadillo  ================
B D                   Manatee  ----------------
                  Chinchilla  ================
      Lesser Egyptian jerboa  ----------------
B D          White rhinoceros  ----------------
            Brush-tailed rat  ================
          Chinese tree shrew  ----------------
              Pacific walrus  ----------------
B D                       Dog  ================
B D                       Cat  ----------------
B D                  Microbat  ================
B D                  Bushbaby  ----------------
               Big brown bat  ----------------
B D            Naked mole-rat  ================
                Killer whale  ================
              Bactrian camel  ----------------
B D                     Panda  ----------------
            Black flying-fox  ----------------
B D                   Ferret   ----------------
            Cape golden mole  ================
B D                   Dolphin  ================
                Weddell seal  ----------------
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
                    Aardvark  ----------------
B D               Stickleback  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ----------------
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D                    Medaka  ================
B D                Coelacanth  ================
B D                    Turkey  ================
                 Spotted gar  ================
  D              Mallard duck  ================
  D             Scarlet macaw  ================
  D                    Parrot  ----------------
B D                Budgerigar  ================
B D                   Wallaby  ================
  D    Spiny softshell turtle  ================
B D                    Lizard  ================
          Southern platyfish  ================
    Mexican tetra (cavefish)  ================
  D          Peregrine falcon  ================
B D                 Zebrafish  ================
  D               Rock pigeon  ================
B D                   Lamprey  ================
B D              Nile tilapia  ================
  D            Painted turtle  ================
B D                 Tetraodon  ================
B D                   Chicken  ================
B D              Atlantic cod  ================
B D                  Platypus  ================
  D       Collared flycatcher  ================
  D  Chinese softshell turtle  ================
B D               Zebra finch  ================
  D              Saker falcon  ================
B D             X. tropicalis  ================
  D           Green seaturtle  ================
B D       Medium ground finch  ================
B D                   Opossum  ================
B D        American alligator  ================
  D    White-throated sparrow  ================
          Tibetan ground jay  ================
B D                   Megabat  ----------------
B D                       Pig  ================

Alignment block 2 of 154 in window, 63810268 - 63810268, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  g
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
                 Prairie vole  t
              Star-nosed mole  t
B D           Tasmanian devil  t
B D                    Tenrec  =
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  -
B D           Chinese hamster  -
B D                  Elephant  -
            Tibetan antelope  -
         Cape elephant shrew  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
B D                  Squirrel  -
B D                      Pika  -
B D                    Rabbit  =
B D                 Armadillo  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  -
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
            Black flying-fox  -
B D                   Ferret   -
            Cape golden mole  =
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                  Marmoset  -
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  -
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  -
B D                       Pig  =

Inserts between block 2 and 3 in window
                Prairie vole 11bp
             Star-nosed mole 1bp

Alignment block 3 of 154 in window, 63810269 - 63810271, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttc
B D              Green monkey  ttt
       Lesser Egyptian jerboa  ttt
B D            Naked mole-rat  ttt
             Brush-tailed rat  ttt
              Star-nosed mole  ttc
B D           Tasmanian devil  ctt
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ---
B D           Chinese hamster  ---
                Prairie vole  ===
B D                  Elephant  ---
            Tibetan antelope  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
B D                  Squirrel  ---
B D                      Pika  ---
B D                    Rabbit  ===
B D                 Armadillo  ===
B D                   Manatee  ---
                  Chinchilla  ===
B D          White rhinoceros  ---
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ===
B D                  Bushbaby  ---
               Big brown bat  ---
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
            Black flying-fox  ---
B D                   Ferret   ---
            Cape golden mole  ===
B D                   Dolphin  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                Budgerigar  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                  Marmoset  ---
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ---
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ===

Alignment block 4 of 154 in window, 63810272 - 63810275, 4 bps 
B D                     Human  tggt
B D                     Chimp  tggt
B D                   Gorilla  tggt
B D                 Orangutan  tggg
B D                    Gibbon  tggt
B D                    Rhesus  cggt
B D       Crab-eating macaque  cggt
B D                    Baboon  cggt
B D              Green monkey  tgtt
       Lesser Egyptian jerboa  taa-
                 Prairie vole  -ga-
B D            Naked mole-rat  tgg-
             Brush-tailed rat  ggg-
              Star-nosed mole  tga-
             Cape golden mole  tggt
B D           Tasmanian devil  tggt
B D                    Tenrec  ====
B D                  Hedgehog  ----
B D                Guinea pig  ====
B D                       Rat  ====
B D                     Mouse  ====
              Golden hamster  ----
B D           Chinese hamster  ----
B D                  Elephant  ----
            Tibetan antelope  ----
         Cape elephant shrew  ----
B D                     Shrew  ====
        David's myotis (bat)  ====
B D                     Horse  ----
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
B D                    Alpaca  ----
B D                  Squirrel  ----
B D                      Pika  ----
B D                    Rabbit  ====
B D                 Armadillo  ====
B D                   Manatee  ----
                  Chinchilla  ====
B D          White rhinoceros  ----
          Chinese tree shrew  ----
              Pacific walrus  ----
B D                       Dog  ====
B D                       Cat  ----
B D                  Microbat  ====
B D                  Bushbaby  ----
               Big brown bat  ----
                Killer whale  ====
              Bactrian camel  ----
B D                     Panda  ----
            Black flying-fox  ----
B D                   Ferret   ----
B D                   Dolphin  ====
                Weddell seal  ----
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
                    Aardvark  ----
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ----
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                    Medaka  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ----
B D                Budgerigar  ====
B D                   Wallaby  ====
  D    Spiny softshell turtle  ====
B D                    Lizard  ====
          Southern platyfish  ====
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D                   Lamprey  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D                  Marmoset  ----
B D                   Chicken  ====
B D              Atlantic cod  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D           Squirrel monkey  ----
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D                   Opossum  ====
B D        American alligator  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D                   Megabat  ----
B D                       Pig  ====

Inserts between block 4 and 5 in window
B D                  Gorilla 76bp
B D                Orangutan 4bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D           Naked mole-rat 1bp
            Brush-tailed rat 1bp

Alignment block 5 of 154 in window, 63810276 - 63810276, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  g
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D            Naked mole-rat  g
             Brush-tailed rat  g
              Star-nosed mole  a
             Cape golden mole  a
B D           Tasmanian devil  g
B D                    Tenrec  =
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  -
B D           Chinese hamster  -
B D                  Elephant  -
            Tibetan antelope  -
         Cape elephant shrew  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
B D                  Squirrel  -
B D                      Pika  -
B D                    Rabbit  =
B D                 Armadillo  =
B D                   Manatee  -
                  Chinchilla  =
B D          White rhinoceros  -
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  -
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
            Black flying-fox  -
B D                   Ferret   -
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D                   Gorilla  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  -
B D                       Pig  =

Inserts between block 5 and 6 in window
            Cape golden mole 2bp

Alignment block 6 of 154 in window, 63810277 - 63810279, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ttt
B D           Squirrel monkey  ttt
       Lesser Egyptian jerboa  tt-
                 Prairie vole  tt-
B D            Naked mole-rat  tt-
             Brush-tailed rat  tt-
             Tibetan antelope  tct
B D                   Ferret   tct
              Star-nosed mole  ttt
             Cape golden mole  t--
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ---
B D           Chinese hamster  ---
B D                  Elephant  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
B D                  Squirrel  ---
B D                      Pika  ---
B D                    Rabbit  ===
B D                 Armadillo  ===
B D                   Manatee  ---
                  Chinchilla  ===
B D          White rhinoceros  ---
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ===
B D                  Bushbaby  ---
               Big brown bat  ---
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
            Black flying-fox  ---
B D                   Dolphin  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                Budgerigar  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D                   Gorilla  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ===
B D           Tasmanian devil  ---

Inserts between block 6 and 7 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D           Naked mole-rat 23bp

Alignment block 7 of 154 in window, 63810280 - 63810286, 7 bps 
B D                     Human  ttagtag
B D                     Chimp  ttagtag
B D                 Orangutan  ttagtag
B D                    Gibbon  ttagtag
B D                    Rhesus  ttagtag
B D       Crab-eating macaque  ttagtag
B D                    Baboon  ttagtag
B D              Green monkey  ttagtag
B D                  Marmoset  ttagtag
B D           Squirrel monkey  ttagtag
       Lesser Egyptian jerboa  --catgt
                 Prairie vole  --cattc
             Brush-tailed rat  -tcataa
B D                      Pika  ---agac
             Tibetan antelope  t-tgtag
B D                   Ferret   ttagtag
             Black flying-fox  --ggtgg
B D                   Megabat  --ggtgg
              Star-nosed mole  c------
             Cape golden mole  gcagtag
B D                    Tenrec  =======
B D                  Hedgehog  -------
B D                Guinea pig  =======
B D                       Rat  =======
B D                     Mouse  =======
              Golden hamster  -------
B D           Chinese hamster  -------
B D                  Elephant  -------
         Cape elephant shrew  -------
B D                     Shrew  =======
        David's myotis (bat)  =======
B D                     Horse  -------
               Domestic goat  -------
B D                     Sheep  -------
B D                       Cow  =======
B D                    Alpaca  -------
B D                  Squirrel  -------
B D                    Rabbit  =======
B D                 Armadillo  =======
B D                   Manatee  -------
                  Chinchilla  =======
B D          White rhinoceros  -------
          Chinese tree shrew  -------
              Pacific walrus  -------
B D                       Dog  =======
B D                       Cat  -------
B D                  Microbat  =======
B D                  Bushbaby  -------
               Big brown bat  -------
B D            Naked mole-rat  =======
                Killer whale  =======
              Bactrian camel  -------
B D                     Panda  -------
B D                   Dolphin  =======
                Weddell seal  -------
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
                    Aardvark  -------
B D               Stickleback  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  -------
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                    Medaka  =======
B D                Coelacanth  =======
B D                    Turkey  =======
                 Spotted gar  =======
  D              Mallard duck  =======
  D             Scarlet macaw  =======
  D                    Parrot  -------
B D                Budgerigar  =======
B D                   Wallaby  =======
  D    Spiny softshell turtle  =======
B D                    Lizard  =======
          Southern platyfish  =======
    Mexican tetra (cavefish)  =======
  D          Peregrine falcon  =======
B D                 Zebrafish  =======
  D               Rock pigeon  =======
B D                   Lamprey  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D                   Chicken  =======
B D              Atlantic cod  =======
B D                  Platypus  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
B D               Zebra finch  =======
  D              Saker falcon  =======
B D             X. tropicalis  =======
  D           Green seaturtle  =======
B D       Medium ground finch  =======
B D                   Opossum  =======
B D                   Gorilla  =======
B D        American alligator  =======
  D    White-throated sparrow  =======
          Tibetan ground jay  =======
B D                       Pig  =======
B D           Tasmanian devil  -------

Alignment block 8 of 154 in window, 63810287 - 63810294, 8 bps 
B D                     Human  aga-----tagct
B D                     Chimp  aga-----tagct
B D                 Orangutan  aga-----tagct
B D                    Gibbon  aga-----tagcc
B D                    Rhesus  aga-----gagct
B D       Crab-eating macaque  aga-----gagct
B D                    Baboon  aga-----gagct
B D              Green monkey  aga-----gagcc
B D                  Marmoset  aga-----tagcc
B D           Squirrel monkey  aga-----tagcc
       Lesser Egyptian jerboa  tga----------
                 Prairie vole  tga-----atg--
             Brush-tailed rat  gga-----atgat
B D                      Pika  ag-----------
             Tibetan antelope  aaa----------
B D                   Ferret   ttataact-----
             Black flying-fox  aga----------
B D                   Megabat  aga----------
B D                    Tenrec  =============
B D                  Hedgehog  -------------
B D                Guinea pig  =============
B D                       Rat  =============
B D                     Mouse  =============
              Golden hamster  -------------
B D           Chinese hamster  -------------
B D                  Elephant  -------------
         Cape elephant shrew  -------------
B D                     Shrew  =============
        David's myotis (bat)  =============
B D                     Horse  -------------
               Domestic goat  -------------
B D                     Sheep  -------------
B D                       Cow  =============
B D                    Alpaca  -------------
             Star-nosed mole  -------------
B D                  Squirrel  -------------
B D                    Rabbit  =============
B D                 Armadillo  =============
B D                   Manatee  -------------
                  Chinchilla  =============
B D          White rhinoceros  -------------
          Chinese tree shrew  -------------
              Pacific walrus  -------------
B D                       Dog  =============
B D                       Cat  -------------
B D                  Microbat  =============
B D                  Bushbaby  -------------
               Big brown bat  -------------
B D            Naked mole-rat  =============
                Killer whale  =============
              Bactrian camel  -------------
B D                     Panda  -------------
            Cape golden mole  -------------
B D                   Dolphin  =============
                Weddell seal  -------------
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
                    Aardvark  -------------
B D               Stickleback  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  -------------
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D                    Medaka  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D             Scarlet macaw  =============
  D                    Parrot  -------------
B D                Budgerigar  =============
B D                   Wallaby  =============
  D    Spiny softshell turtle  =============
B D                    Lizard  =============
          Southern platyfish  =============
    Mexican tetra (cavefish)  =============
  D          Peregrine falcon  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
B D                   Lamprey  =============
B D              Nile tilapia  =============
  D            Painted turtle  =============
B D                 Tetraodon  =============
B D                   Chicken  =============
B D              Atlantic cod  =============
B D                  Platypus  =============
  D       Collared flycatcher  =============
  D  Chinese softshell turtle  =============
B D               Zebra finch  =============
  D              Saker falcon  =============
B D             X. tropicalis  =============
  D           Green seaturtle  =============
B D       Medium ground finch  =============
B D                   Opossum  =============
B D                   Gorilla  =============
B D        American alligator  =============
  D    White-throated sparrow  =============
          Tibetan ground jay  =============
B D                       Pig  =============
B D           Tasmanian devil  -------------

Inserts between block 8 and 9 in window
B D                     Pika 3bp
            Tibetan antelope 5bp

Alignment block 9 of 154 in window, 63810295 - 63810297, 3 bps 
B D                     Human  gtg
B D                     Chimp  gtg
B D                 Orangutan  gcg
B D                    Gibbon  gca
B D                    Rhesus  gcg
B D       Crab-eating macaque  gcg
B D                    Baboon  gcg
B D              Green monkey  gcg
B D                  Marmoset  acg
B D           Squirrel monkey  act
             Brush-tailed rat  atg
             Tibetan antelope  ttg
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ---
B D           Chinese hamster  ---
                Prairie vole  ---
B D                  Elephant  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
             Star-nosed mole  ---
B D                  Squirrel  ---
B D                      Pika  ===
B D                    Rabbit  ===
B D                 Armadillo  ===
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ---
B D          White rhinoceros  ---
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ===
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
            Black flying-fox  ---
B D                   Ferret   ---
            Cape golden mole  ---
B D                   Dolphin  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                Budgerigar  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D                   Gorilla  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ===
B D           Tasmanian devil  ---

Alignment block 10 of 154 in window, 63810298 - 63810300, 3 bps 
B D                     Human  ttg
B D                     Chimp  ttg
B D                 Orangutan  ttg
B D                    Gibbon  ttg
B D                    Rhesus  ttg
B D       Crab-eating macaque  ttg
B D                    Baboon  ttg
B D              Green monkey  ttg
B D                  Marmoset  ttg
B D           Squirrel monkey  ttg
             Brush-tailed rat  tt-
             Tibetan antelope  ctg
                     Aardvark  tta
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ---
B D           Chinese hamster  ---
                Prairie vole  ---
B D                  Elephant  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
             Star-nosed mole  ---
B D                  Squirrel  ---
B D                      Pika  ===
B D                    Rabbit  ===
B D                 Armadillo  ===
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ---
B D          White rhinoceros  ---
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ===
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
            Black flying-fox  ---
B D                   Ferret   ---
            Cape golden mole  ---
B D                   Dolphin  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                Budgerigar  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D                   Gorilla  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ===
B D           Tasmanian devil  ---

Alignment block 11 of 154 in window, 63810301 - 63810319, 19 bps 
B D                     Human  accaggctg----cgaactcctg
B D                     Chimp  accaggctg----caaactcctg
B D                 Orangutan  accaggctg----tgaactcctg
B D                    Gibbon  accaggctg----caaactcctg
B D                    Rhesus  accaggttg----caaactcctg
B D       Crab-eating macaque  accaggttg----caaactcctg
B D                    Baboon  accaggttg----caaactcctg
B D              Green monkey  accaggttg----caaactcctg
B D                  Marmoset  gccaggctgttctcaaactcctg
B D           Squirrel monkey  gccgggctgttctcaaacttctg
                     Aardvark  acca-------------------
B D                    Tenrec  =======================
B D                  Hedgehog  -----------------------
B D                Guinea pig  =======================
B D                       Rat  =======================
B D                     Mouse  =======================
              Golden hamster  -----------------------
B D           Chinese hamster  -----------------------
                Prairie vole  -----------------------
B D                  Elephant  -----------------------
            Tibetan antelope  -----------------------
         Cape elephant shrew  -----------------------
B D                     Shrew  =======================
        David's myotis (bat)  =======================
B D                     Horse  -----------------------
               Domestic goat  -----------------------
B D                     Sheep  -----------------------
B D                       Cow  =======================
B D                    Alpaca  -----------------------
             Star-nosed mole  -----------------------
B D                  Squirrel  -----------------------
B D                      Pika  =======================
B D                    Rabbit  =======================
B D                 Armadillo  =======================
B D                   Manatee  -----------------------
                  Chinchilla  =======================
      Lesser Egyptian jerboa  -----------------------
B D          White rhinoceros  -----------------------
            Brush-tailed rat  -----------------------
          Chinese tree shrew  -----------------------
              Pacific walrus  -----------------------
B D                       Dog  =======================
B D                       Cat  -----------------------
B D                  Microbat  =======================
B D                  Bushbaby  -----------------------
               Big brown bat  -----------------------
B D            Naked mole-rat  =======================
                Killer whale  =======================
              Bactrian camel  -----------------------
B D                     Panda  -----------------------
            Black flying-fox  -----------------------
B D                   Ferret   -----------------------
            Cape golden mole  -----------------------
B D                   Dolphin  =======================
                Weddell seal  -----------------------
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D               Stickleback  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  -----------------------
       Burton's mouthbreeder  =======================
         Princess of Burundi  =======================
B D                    Medaka  =======================
B D                Coelacanth  =======================
B D                    Turkey  =======================
                 Spotted gar  =======================
  D              Mallard duck  =======================
  D             Scarlet macaw  =======================
  D                    Parrot  -----------------------
B D                Budgerigar  =======================
B D                   Wallaby  =======================
  D    Spiny softshell turtle  =======================
B D                    Lizard  =======================
          Southern platyfish  =======================
    Mexican tetra (cavefish)  =======================
  D          Peregrine falcon  =======================
B D                 Zebrafish  =======================
  D               Rock pigeon  =======================
B D                   Lamprey  =======================
B D              Nile tilapia  =======================
  D            Painted turtle  =======================
B D                 Tetraodon  =======================
B D                   Chicken  =======================
B D              Atlantic cod  =======================
B D                  Platypus  =======================
  D       Collared flycatcher  =======================
  D  Chinese softshell turtle  =======================
B D               Zebra finch  =======================
  D              Saker falcon  =======================
B D             X. tropicalis  =======================
  D           Green seaturtle  =======================
B D       Medium ground finch  =======================
B D                   Opossum  =======================
B D                   Gorilla  =======================
B D        American alligator  =======================
  D    White-throated sparrow  =======================
          Tibetan ground jay  =======================
B D                   Megabat  -----------------------
B D                       Pig  =======================
B D           Tasmanian devil  -----------------------

Alignment block 12 of 154 in window, 63810320 - 63810330, 11 bps 
B D                     Human  acctcaa--------gtga
B D                     Chimp  acctcaa--------gtga
B D                 Orangutan  acctcaa--------gtga
B D                    Gibbon  acctcaa--------gtga
B D                    Rhesus  accttaagtgctccggtga
B D       Crab-eating macaque  accttaagtgatccggtga
B D                    Baboon  accttaagtgatccggtga
B D              Green monkey  accttaagtgatccggtga
B D                  Marmoset  acctcaa--------gtga
B D           Squirrel monkey  acctcaa--------gtga
B D                  Hedgehog  atatgaa--------gtga
              Star-nosed mole  acactga--------atga
B D           Tasmanian devil  ---tcaa--------gcat
B D                    Tenrec  ===================
B D                Guinea pig  ===================
B D                       Rat  ===================
B D                     Mouse  ===================
              Golden hamster  -------------------
B D           Chinese hamster  -------------------
                Prairie vole  -------------------
B D                  Elephant  -------------------
            Tibetan antelope  -------------------
         Cape elephant shrew  -------------------
B D                     Shrew  ===================
        David's myotis (bat)  ===================
B D                     Horse  -------------------
               Domestic goat  -------------------
B D                     Sheep  -------------------
B D                       Cow  ===================
B D                    Alpaca  -------------------
B D                  Squirrel  -------------------
B D                      Pika  ===================
B D                    Rabbit  ===================
B D                 Armadillo  ===================
B D                   Manatee  -------------------
                  Chinchilla  ===================
      Lesser Egyptian jerboa  -------------------
B D          White rhinoceros  -------------------
            Brush-tailed rat  -------------------
          Chinese tree shrew  -------------------
              Pacific walrus  -------------------
B D                       Dog  ===================
B D                       Cat  -------------------
B D                  Microbat  ===================
B D                  Bushbaby  -------------------
               Big brown bat  -------------------
B D            Naked mole-rat  ===================
                Killer whale  ===================
              Bactrian camel  -------------------
B D                     Panda  -------------------
            Black flying-fox  -------------------
B D                   Ferret   -------------------
            Cape golden mole  -------------------
B D                   Dolphin  ===================
                Weddell seal  -------------------
      Yellowbelly pufferfish  ===================
B D                      Fugu  ===================
                    Aardvark  -------------------
B D               Stickleback  ===================
         Pundamilia nyererei  ===================
                 Zebra mbuna  -------------------
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D                    Medaka  ===================
B D                Coelacanth  ===================
B D                    Turkey  ===================
                 Spotted gar  ===================
  D              Mallard duck  ===================
  D             Scarlet macaw  ===================
  D                    Parrot  -------------------
B D                Budgerigar  ===================
B D                   Wallaby  ===================
  D    Spiny softshell turtle  ===================
B D                    Lizard  ===================
          Southern platyfish  ===================
    Mexican tetra (cavefish)  ===================
  D          Peregrine falcon  ===================
B D                 Zebrafish  ===================
  D               Rock pigeon  ===================
B D                   Lamprey  ===================
B D              Nile tilapia  ===================
  D            Painted turtle  ===================
B D                 Tetraodon  ===================
B D                   Chicken  ===================
B D              Atlantic cod  ===================
B D                  Platypus  ===================
  D       Collared flycatcher  ===================
  D  Chinese softshell turtle  ===================
B D               Zebra finch  ===================
  D              Saker falcon  ===================
B D             X. tropicalis  ===================
  D           Green seaturtle  ===================
B D       Medium ground finch  ===================
B D                   Opossum  ===================
B D                   Gorilla  ===================
B D        American alligator  ===================
  D    White-throated sparrow  ===================
          Tibetan ground jay  ===================
B D                   Megabat  -------------------
B D                       Pig  ===================

Alignment block 13 of 154 in window, 63810331 - 63810334, 4 bps 
B D                     Human  tccg
B D                     Chimp  tcct
B D                 Orangutan  tccg
B D                    Gibbon  tccg
B D                    Rhesus  tcca
B D       Crab-eating macaque  tcca
B D                    Baboon  tccg
B D              Green monkey  tccg
B D                  Marmoset  ttcg
B D           Squirrel monkey  tttg
              Star-nosed mole  tac-
B D           Tasmanian devil  tttg
B D                    Tenrec  ====
B D                  Hedgehog  ----
B D                Guinea pig  ====
B D                       Rat  ====
B D                     Mouse  ====
              Golden hamster  ----
B D           Chinese hamster  ----
                Prairie vole  ----
B D                  Elephant  ----
            Tibetan antelope  ----
         Cape elephant shrew  ----
B D                     Shrew  ====
        David's myotis (bat)  ====
B D                     Horse  ----
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
B D                    Alpaca  ----
B D                  Squirrel  ----
B D                      Pika  ====
B D                    Rabbit  ====
B D                 Armadillo  ====
B D                   Manatee  ----
                  Chinchilla  ====
      Lesser Egyptian jerboa  ----
B D          White rhinoceros  ----
            Brush-tailed rat  ----
          Chinese tree shrew  ----
              Pacific walrus  ----
B D                       Dog  ====
B D                       Cat  ----
B D                  Microbat  ====
B D                  Bushbaby  ----
               Big brown bat  ----
B D            Naked mole-rat  ====
                Killer whale  ====
              Bactrian camel  ----
B D                     Panda  ----
            Black flying-fox  ----
B D                   Ferret   ----
            Cape golden mole  ----
B D                   Dolphin  ====
                Weddell seal  ----
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
                    Aardvark  ----
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ----
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                    Medaka  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ----
B D                Budgerigar  ====
B D                   Wallaby  ====
  D    Spiny softshell turtle  ====
B D                    Lizard  ====
          Southern platyfish  ====
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D                   Lamprey  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
B D              Atlantic cod  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D                   Opossum  ====
B D                   Gorilla  ====
B D        American alligator  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D                   Megabat  ----
B D                       Pig  ====

Alignment block 14 of 154 in window, 63810335 - 63810338, 4 bps 
B D                     Human  cctg
B D                     Chimp  cctg
B D                 Orangutan  cctg
B D                    Gibbon  cctg
B D                    Rhesus  cctg
B D       Crab-eating macaque  cctg
B D                    Baboon  cctg
B D              Green monkey  cctg
B D                  Marmoset  cccg
B D           Squirrel monkey  cccg
             Black flying-fox  ---g
B D                   Megabat  ---g
B D                  Microbat  ctta
              Star-nosed mole  ---a
B D           Tasmanian devil  cttg
B D                    Tenrec  ====
B D                  Hedgehog  ----
B D                Guinea pig  ====
B D                       Rat  ====
B D                     Mouse  ====
              Golden hamster  ----
B D           Chinese hamster  ----
                Prairie vole  ----
B D                  Elephant  ----
            Tibetan antelope  ----
         Cape elephant shrew  ----
B D                     Shrew  ====
        David's myotis (bat)  ====
B D                     Horse  ----
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
B D                    Alpaca  ----
B D                  Squirrel  ----
B D                      Pika  ====
B D                    Rabbit  ====
B D                 Armadillo  ====
B D                   Manatee  ----
                  Chinchilla  ====
      Lesser Egyptian jerboa  ----
B D          White rhinoceros  ----
            Brush-tailed rat  ----
          Chinese tree shrew  ----
              Pacific walrus  ----
B D                       Dog  ====
B D                       Cat  ----
B D                  Bushbaby  ----
               Big brown bat  ----
B D            Naked mole-rat  ====
                Killer whale  ====
              Bactrian camel  ----
B D                     Panda  ----
B D                   Ferret   ----
            Cape golden mole  ----
B D                   Dolphin  ====
                Weddell seal  ----
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
                    Aardvark  ----
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ----
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                    Medaka  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ----
B D                Budgerigar  ====
B D                   Wallaby  ====
  D    Spiny softshell turtle  ====
B D                    Lizard  ====
          Southern platyfish  ====
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D                   Lamprey  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
B D              Atlantic cod  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D                   Opossum  ====
B D                   Gorilla  ====
B D        American alligator  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D                       Pig  ====

Inserts between block 14 and 15 in window
B D          Tasmanian devil 40bp

Alignment block 15 of 154 in window, 63810339 - 63810348, 10 bps 
B D                     Human  cttcggcctc
B D                     Chimp  cttcggcctc
B D                 Orangutan  cttcggcctc
B D                    Gibbon  cttcagcctc
B D                    Rhesus  cttcggcctc
B D       Crab-eating macaque  cttcggcctc
B D                    Baboon  cttcggcctc
B D              Green monkey  cttcggcctc
B D                  Marmoset  cctcagcctc
B D           Squirrel monkey  cctcagcctc
             Black flying-fox  tttcattctg
B D                   Megabat  tttcattctg
B D                  Microbat  tttctccccc
              Star-nosed mole  aatc------
B D                    Tenrec  ==========
B D                  Hedgehog  ----------
B D                Guinea pig  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
              Golden hamster  ----------
B D           Chinese hamster  ----------
                Prairie vole  ----------
B D                  Elephant  ----------
            Tibetan antelope  ----------
         Cape elephant shrew  ----------
B D                     Shrew  ==========
        David's myotis (bat)  ==========
B D                     Horse  ----------
               Domestic goat  ----------
B D                     Sheep  ----------
B D                       Cow  ==========
B D                    Alpaca  ----------
B D                  Squirrel  ----------
B D                      Pika  ==========
B D                    Rabbit  ==========
B D                 Armadillo  ==========
B D                   Manatee  ----------
                  Chinchilla  ==========
      Lesser Egyptian jerboa  ----------
B D          White rhinoceros  ----------
            Brush-tailed rat  ----------
          Chinese tree shrew  ----------
              Pacific walrus  ----------
B D                       Dog  ==========
B D                       Cat  ----------
B D                  Bushbaby  ----------
               Big brown bat  ----------
B D            Naked mole-rat  ==========
                Killer whale  ==========
              Bactrian camel  ----------
B D                     Panda  ----------
B D                   Ferret   ----------
            Cape golden mole  ----------
B D                   Dolphin  ==========
                Weddell seal  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
                    Aardvark  ----------
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ----------
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D             Scarlet macaw  ==========
  D                    Parrot  ----------
B D                Budgerigar  ==========
B D                   Wallaby  ==========
  D    Spiny softshell turtle  ==========
B D                    Lizard  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D                   Lamprey  ==========
B D              Nile tilapia  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
B D                  Platypus  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D               Zebra finch  ==========
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
B D                   Gorilla  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D                       Pig  ==========
B D           Tasmanian devil  ==========

Alignment block 16 of 154 in window, 63810349 - 63810350, 2 bps 
B D                     Human  cg
B D                     Chimp  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
             Black flying-fox  -a
B D                   Megabat  -a
B D                  Microbat  -c
B D                    Tenrec  ==
B D                  Hedgehog  --
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  --
B D           Chinese hamster  --
                Prairie vole  --
B D                  Elephant  --
            Tibetan antelope  --
         Cape elephant shrew  --
B D                     Shrew  ==
        David's myotis (bat)  ==
B D                     Horse  --
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  --
B D                  Squirrel  --
B D                      Pika  ==
B D                    Rabbit  ==
B D                 Armadillo  ==
B D                   Manatee  --
                  Chinchilla  ==
      Lesser Egyptian jerboa  --
B D          White rhinoceros  --
            Brush-tailed rat  --
          Chinese tree shrew  --
              Pacific walrus  --
B D                       Dog  ==
B D                       Cat  --
B D                  Bushbaby  --
               Big brown bat  --
B D            Naked mole-rat  ==
                Killer whale  ==
              Bactrian camel  --
B D                     Panda  --
B D                   Ferret   --
            Cape golden mole  --
B D                   Dolphin  ==
                Weddell seal  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  --
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  --
B D                Budgerigar  ==
B D                   Wallaby  ==
  D    Spiny softshell turtle  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D                   Gorilla  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D                       Pig  ==
B D           Tasmanian devil  ==

Inserts between block 16 and 17 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Microbat 1bp

Alignment block 17 of 154 in window, 63810351 - 63810356, 6 bps 
B D                     Human  aaagtg
B D                     Chimp  aaagtg
B D                   Gorilla  aaagtg
B D                 Orangutan  aaagtg
B D                    Gibbon  aaagtg
B D                    Rhesus  agagtg
B D       Crab-eating macaque  agagtg
B D                    Baboon  agagtg
B D              Green monkey  agagtg
B D                  Marmoset  aaagta
B D           Squirrel monkey  aaagta
B D                      Pika  aaagtt
             Black flying-fox  ----tg
B D                   Megabat  ----tg
B D                  Microbat  ----c-
B D                    Tenrec  ======
B D                  Hedgehog  ------
B D                Guinea pig  ======
B D                       Rat  ======
B D                     Mouse  ======
              Golden hamster  ------
B D           Chinese hamster  ------
                Prairie vole  ------
B D                  Elephant  ------
            Tibetan antelope  ------
         Cape elephant shrew  ------
B D                     Shrew  ======
        David's myotis (bat)  ======
B D                     Horse  ------
               Domestic goat  ------
B D                     Sheep  ------
B D                       Cow  ======
B D                    Alpaca  ------
             Star-nosed mole  ------
B D                  Squirrel  ------
B D                    Rabbit  ======
B D                 Armadillo  ======
B D                   Manatee  ------
                  Chinchilla  ======
      Lesser Egyptian jerboa  ------
B D          White rhinoceros  ------
            Brush-tailed rat  ------
          Chinese tree shrew  ------
              Pacific walrus  ------
B D                       Dog  ======
B D                       Cat  ------
B D                  Bushbaby  ------
               Big brown bat  ------
B D            Naked mole-rat  ======
                Killer whale  ======
              Bactrian camel  ------
B D                     Panda  ------
B D                   Ferret   ------
            Cape golden mole  ------
B D                   Dolphin  ======
                Weddell seal  ------
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
                    Aardvark  ------
B D               Stickleback  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ------
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                    Medaka  ======
B D                Coelacanth  ======
B D                    Turkey  ======
                 Spotted gar  ======
  D              Mallard duck  ======
  D             Scarlet macaw  ======
  D                    Parrot  ------
B D                Budgerigar  ======
B D                   Wallaby  ======
  D    Spiny softshell turtle  ======
B D                    Lizard  ======
          Southern platyfish  ======
    Mexican tetra (cavefish)  ======
  D          Peregrine falcon  ======
B D                 Zebrafish  ======
  D               Rock pigeon  ======
B D                   Lamprey  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D                   Chicken  ======
B D              Atlantic cod  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
B D               Zebra finch  ======
  D              Saker falcon  ======
B D             X. tropicalis  ======
  D           Green seaturtle  ======
B D       Medium ground finch  ======
B D                   Opossum  ======
B D        American alligator  ======
  D    White-throated sparrow  ======
          Tibetan ground jay  ======
B D                       Pig  ======
B D           Tasmanian devil  ======

Alignment block 18 of 154 in window, 63810357 - 63810359, 3 bps 
B D                     Human  cta
B D                     Chimp  cta
B D                   Gorilla  cta
B D                 Orangutan  cta
B D                    Gibbon  cta
B D                    Rhesus  cta
B D       Crab-eating macaque  cta
B D                    Baboon  cta
B D              Green monkey  cta
B D                  Marmoset  cta
B D           Squirrel monkey  ctt
               Pacific walrus  cta
                 Weddell seal  cta
             Black flying-fox  tta
B D                   Megabat  tta
              Star-nosed mole  tca
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ---
B D           Chinese hamster  ---
                Prairie vole  ---
B D                  Elephant  ---
            Tibetan antelope  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
B D                  Squirrel  ---
B D                      Pika  ---
B D                    Rabbit  ===
B D                 Armadillo  ===
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ---
B D          White rhinoceros  ---
            Brush-tailed rat  ---
          Chinese tree shrew  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ---
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
B D                   Ferret   ---
            Cape golden mole  ---
B D                   Dolphin  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                Budgerigar  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                       Pig  ===
B D           Tasmanian devil  ===

Inserts between block 18 and 19 in window
             Star-nosed mole 7bp

Alignment block 19 of 154 in window, 63810360 - 63810375, 16 bps 
B D                     Human  ggatta------caggcatgag
B D                     Chimp  ggatta------caggcatgag
B D                   Gorilla  ggatta------caggcatgaa
B D                 Orangutan  ggatta------caggcatgag
B D                    Gibbon  ggatta------caggcatgag
B D                    Rhesus  ggatta------caggcatgag
B D       Crab-eating macaque  ggatta------caggcatgag
B D                    Baboon  ggatta------caggcatgag
B D              Green monkey  ggatta------caggcatgag
B D                  Marmoset  ggatta------caggcatgag
B D           Squirrel monkey  ggatta------caggcatgag
       Lesser Egyptian jerboa  -------------atgt-----
             Brush-tailed rat  ---tta------aa--------
B D                      Pika  ---------------gga-gtt
B D                       Pig  ggagcataggca----------
               Pacific walrus  gga-------------------
                 Weddell seal  gga-------------------
             Black flying-fox  ggtcta----------------
B D                   Megabat  ggtcta----------------
              Star-nosed mole  ag--------------------
B D                    Tenrec  ======================
B D                  Hedgehog  ----------------------
B D                Guinea pig  ======================
B D                       Rat  ======================
B D                     Mouse  ======================
              Golden hamster  ----------------------
B D           Chinese hamster  ----------------------
                Prairie vole  ----------------------
B D                  Elephant  ----------------------
            Tibetan antelope  ----------------------
         Cape elephant shrew  ----------------------
B D                     Shrew  ======================
        David's myotis (bat)  ======================
B D                     Horse  ----------------------
               Domestic goat  ----------------------
B D                     Sheep  ----------------------
B D                       Cow  ======================
B D                    Alpaca  ----------------------
B D                  Squirrel  ----------------------
B D                    Rabbit  ======================
B D                 Armadillo  ======================
B D                   Manatee  ----------------------
                  Chinchilla  ======================
B D          White rhinoceros  ----------------------
          Chinese tree shrew  ----------------------
B D                       Dog  ======================
B D                       Cat  ----------------------
B D                  Microbat  ----------------------
B D                  Bushbaby  ----------------------
               Big brown bat  ----------------------
B D            Naked mole-rat  ======================
                Killer whale  ======================
              Bactrian camel  ----------------------
B D                     Panda  ----------------------
B D                   Ferret   ----------------------
            Cape golden mole  ----------------------
B D                   Dolphin  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
                    Aardvark  ----------------------
B D               Stickleback  ======================
         Pundamilia nyererei  ======================
                 Zebra mbuna  ----------------------
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D                    Medaka  ======================
B D                Coelacanth  ======================
B D                    Turkey  ======================
                 Spotted gar  ======================
  D              Mallard duck  ======================
  D             Scarlet macaw  ======================
  D                    Parrot  ----------------------
B D                Budgerigar  ======================
B D                   Wallaby  ======================
  D    Spiny softshell turtle  ======================
B D                    Lizard  ======================
          Southern platyfish  ======================
    Mexican tetra (cavefish)  ======================
  D          Peregrine falcon  ======================
B D                 Zebrafish  ======================
  D               Rock pigeon  ======================
B D                   Lamprey  ======================
B D              Nile tilapia  ======================
  D            Painted turtle  ======================
B D                 Tetraodon  ======================
B D                   Chicken  ======================
B D              Atlantic cod  ======================
B D                  Platypus  ======================
  D       Collared flycatcher  ======================
  D  Chinese softshell turtle  ======================
B D               Zebra finch  ======================
  D              Saker falcon  ======================
B D             X. tropicalis  ======================
  D           Green seaturtle  ======================
B D       Medium ground finch  ======================
B D                   Opossum  ======================
B D        American alligator  ======================
  D    White-throated sparrow  ======================
          Tibetan ground jay  ======================
B D           Tasmanian devil  ======================

Inserts between block 19 and 20 in window
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 20 of 154 in window, 63810376 - 63810381, 6 bps 
B D                     Human  ccactg
B D                     Chimp  ccactg
B D                   Gorilla  ccactg
B D                 Orangutan  ccactg
B D                    Gibbon  tcactg
B D                    Rhesus  ccactg
B D       Crab-eating macaque  ccactg
B D                    Baboon  ccactg
B D              Green monkey  ccactg
B D                  Marmoset  ccaccg
B D           Squirrel monkey  ccaccg
B D                      Pika  tcatat
          Cape elephant shrew  ccacta
B D                    Tenrec  ======
B D                  Hedgehog  ------
B D                Guinea pig  ======
B D                       Rat  ======
B D                     Mouse  ======
              Golden hamster  ------
B D           Chinese hamster  ------
                Prairie vole  ------
B D                  Elephant  ------
            Tibetan antelope  ------
B D                     Shrew  ======
        David's myotis (bat)  ======
B D                     Horse  ------
               Domestic goat  ------
B D                     Sheep  ------
B D                       Cow  ======
B D                    Alpaca  ------
             Star-nosed mole  ------
B D                  Squirrel  ------
B D                    Rabbit  ======
B D                 Armadillo  ======
B D                   Manatee  ------
                  Chinchilla  ======
      Lesser Egyptian jerboa  ------
B D          White rhinoceros  ------
            Brush-tailed rat  ------
          Chinese tree shrew  ------
              Pacific walrus  ------
B D                       Dog  ======
B D                       Cat  ------
B D                  Microbat  ------
B D                  Bushbaby  ------
               Big brown bat  ------
B D            Naked mole-rat  ======
                Killer whale  ======
              Bactrian camel  ------
B D                     Panda  ------
            Black flying-fox  ======
B D                   Ferret   ------
            Cape golden mole  ------
B D                   Dolphin  ======
                Weddell seal  ------
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
                    Aardvark  ------
B D               Stickleback  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ------
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                    Medaka  ======
B D                Coelacanth  ======
B D                    Turkey  ======
                 Spotted gar  ======
  D              Mallard duck  ======
  D             Scarlet macaw  ======
  D                    Parrot  ------
B D                Budgerigar  ======
B D                   Wallaby  ======
  D    Spiny softshell turtle  ======
B D                    Lizard  ======
          Southern platyfish  ======
    Mexican tetra (cavefish)  ======
  D          Peregrine falcon  ======
B D                 Zebrafish  ======
  D               Rock pigeon  ======
B D                   Lamprey  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D                   Chicken  ======
B D              Atlantic cod  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
B D               Zebra finch  ======
  D              Saker falcon  ======
B D             X. tropicalis  ======
  D           Green seaturtle  ======
B D       Medium ground finch  ======
B D                   Opossum  ======
B D        American alligator  ======
  D    White-throated sparrow  ======
          Tibetan ground jay  ======
B D                   Megabat  ======
B D                       Pig  ------
B D           Tasmanian devil  ======

Alignment block 21 of 154 in window, 63810382 - 63810382, 1 bps 
B D                     Human  t
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                      Pika  t
B D                       Dog  t
          Cape elephant shrew  t
B D                    Tenrec  =
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  -
B D           Chinese hamster  -
                Prairie vole  -
B D                  Elephant  -
            Tibetan antelope  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                    Rabbit  =
B D                 Armadillo  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  -
B D          White rhinoceros  -
            Brush-tailed rat  -
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
            Black flying-fox  =
B D                   Ferret   -
            Cape golden mole  -
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  -
B D           Tasmanian devil  =

Alignment block 22 of 154 in window, 63810383 - 63810384, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                      Pika  ga
B D                       Dog  cc
          Cape elephant shrew  gt
B D                    Tenrec  at
B D                  Hedgehog  --
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  --
B D           Chinese hamster  --
                Prairie vole  --
B D                  Elephant  --
            Tibetan antelope  --
B D                     Shrew  ==
        David's myotis (bat)  ==
B D                     Horse  --
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  --
B D                  Squirrel  --
B D                    Rabbit  ==
B D                 Armadillo  ==
B D                   Manatee  --
                  Chinchilla  ==
      Lesser Egyptian jerboa  --
B D          White rhinoceros  --
            Brush-tailed rat  --
          Chinese tree shrew  --
              Pacific walrus  --
B D                       Cat  --
B D                  Microbat  --
B D                  Bushbaby  --
               Big brown bat  --
B D            Naked mole-rat  ==
                Killer whale  ==
              Bactrian camel  --
B D                     Panda  --
            Black flying-fox  ==
B D                   Ferret   --
            Cape golden mole  --
B D                   Dolphin  ==
                Weddell seal  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  --
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  --
B D                Budgerigar  ==
B D                   Wallaby  ==
  D    Spiny softshell turtle  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D                   Megabat  ==
B D                       Pig  --
B D           Tasmanian devil  ==

Inserts between block 22 and 23 in window
B D                     Pika 10bp

Alignment block 23 of 154 in window, 63810385 - 63810385, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
                 Prairie vole  c
B D                     Mouse  c
B D                       Dog  c
          Cape elephant shrew  c
B D                    Tenrec  a
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
              Golden hamster  -
B D           Chinese hamster  -
B D                  Elephant  -
            Tibetan antelope  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                 Armadillo  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  -
B D          White rhinoceros  -
            Brush-tailed rat  -
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
            Black flying-fox  =
B D                   Ferret   -
            Cape golden mole  -
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  -
B D           Tasmanian devil  =

Alignment block 24 of 154 in window, 63810386 - 63810386, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  t
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  t
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D                     Mouse  t
B D                      Pika  c
B D                       Dog  a
B D                   Manatee  t
B D                    Tenrec  t
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
              Golden hamster  -
B D           Chinese hamster  -
B D                  Elephant  -
            Tibetan antelope  -
         Cape elephant shrew  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                    Rabbit  =
B D                 Armadillo  =
                  Chinchilla  =
B D          White rhinoceros  -
            Brush-tailed rat  -
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
            Black flying-fox  =
B D                   Ferret   -
            Cape golden mole  -
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  -
B D           Tasmanian devil  =

Alignment block 25 of 154 in window, 63810387 - 63810389, 3 bps 
B D                     Human  ggc
B D                     Chimp  ggc
B D                   Gorilla  ggc
B D                 Orangutan  ggc
B D                    Gibbon  ggc
B D                    Rhesus  ggc
B D       Crab-eating macaque  ggc
B D                    Baboon  agc
B D              Green monkey  ggc
B D                  Marmoset  ggc
B D           Squirrel monkey  ggc
       Lesser Egyptian jerboa  atg
                 Prairie vole  gtc
B D                     Mouse  atc
B D                      Pika  agg
B D                       Dog  ggc
B D                   Manatee  gtc
B D                    Tenrec  gtc
B D                Budgerigar  gtc
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
              Golden hamster  ---
B D           Chinese hamster  ---
B D                  Elephant  ---
            Tibetan antelope  ---
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
             Star-nosed mole  ---
B D                  Squirrel  ---
B D                    Rabbit  ===
B D                 Armadillo  ===
                  Chinchilla  ===
B D          White rhinoceros  ---
            Brush-tailed rat  ---
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Cat  ---
B D                  Microbat  ---
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
            Black flying-fox  ===
B D                   Ferret   ---
            Cape golden mole  ---
B D                   Dolphin  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ===
B D                       Pig  ---
B D           Tasmanian devil  ===

Alignment block 26 of 154 in window, 63810390 - 63810391, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
       Lesser Egyptian jerboa  tc
                 Prairie vole  ta
B D           Chinese hamster  -a
B D                     Mouse  ta
B D                      Pika  aa
B D          White rhinoceros  ct
B D                       Dog  ct
          Cape elephant shrew  ca
B D                   Manatee  ca
B D                    Tenrec  ca
B D                Budgerigar  ct
B D                  Hedgehog  --
B D                Guinea pig  ==
B D                       Rat  ==
              Golden hamster  --
B D                  Elephant  --
            Tibetan antelope  --
B D                     Shrew  ==
        David's myotis (bat)  ==
B D                     Horse  --
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  --
B D                  Squirrel  --
B D                    Rabbit  ==
B D                 Armadillo  ==
                  Chinchilla  ==
            Brush-tailed rat  --
          Chinese tree shrew  --
              Pacific walrus  --
B D                       Cat  --
B D                  Microbat  --
B D                  Bushbaby  --
               Big brown bat  --
B D            Naked mole-rat  ==
                Killer whale  ==
              Bactrian camel  --
B D                     Panda  --
            Black flying-fox  ==
B D                   Ferret   --
            Cape golden mole  --
B D                   Dolphin  ==
                Weddell seal  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  --
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  --
B D                   Wallaby  ==
  D    Spiny softshell turtle  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D                   Megabat  ==
B D                       Pig  --
B D           Tasmanian devil  ==

Inserts between block 26 and 27 in window
B D                     Pika 1bp

Alignment block 27 of 154 in window, 63810392 - 63810392, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
       Lesser Egyptian jerboa  a
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  g
B D          White rhinoceros  g
B D                       Dog  g
          Cape elephant shrew  g
B D                   Manatee  c
B D                    Tenrec  g
B D                Budgerigar  g
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
              Golden hamster  -
B D                  Elephant  -
            Tibetan antelope  -
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                 Armadillo  =
                  Chinchilla  =
            Brush-tailed rat  -
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
            Black flying-fox  =
B D                   Ferret   -
            Cape golden mole  -
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  -
B D           Tasmanian devil  =

Inserts between block 27 and 28 in window
B D         White rhinoceros 1bp
B D                      Dog 1bp
B D               Budgerigar 2bp

Alignment block 28 of 154 in window, 63810393 - 63810394, 2 bps 
B D                     Human  gg-
B D                     Chimp  gg-
B D                   Gorilla  gg-
B D                 Orangutan  gg-
B D                    Gibbon  gg-
B D                    Rhesus  gg-
B D       Crab-eating macaque  gg-
B D                    Baboon  gg-
B D              Green monkey  gg-
B D                  Marmoset  ca-
B D           Squirrel monkey  ca-
       Lesser Egyptian jerboa  ga-
                 Prairie vole  ga-
B D           Chinese hamster  ga-
B D                     Mouse  ga-
B D            Naked mole-rat  ga-
             Brush-tailed rat  ga-
B D                       Dog  ga-
             Black flying-fox  aa-
B D                   Megabat  aa-
B D                     Shrew  ga-
          Cape elephant shrew  ga-
B D                   Manatee  ga-
B D                    Tenrec  ga-
B D                   Lamprey  -gt
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
              Golden hamster  ---
B D                  Elephant  ---
            Tibetan antelope  ---
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
B D                    Alpaca  ---
             Star-nosed mole  ---
B D                  Squirrel  ---
B D                      Pika  ===
B D                    Rabbit  ===
B D                 Armadillo  ===
                  Chinchilla  ===
B D          White rhinoceros  ===
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Cat  ---
B D                  Microbat  ---
B D                  Bushbaby  ---
               Big brown bat  ---
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ---
B D                   Ferret   ---
            Cape golden mole  ---
B D                   Dolphin  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ---
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ---
B D                Budgerigar  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                       Pig  ---
B D           Tasmanian devil  ===

Inserts between block 28 and 29 in window
B D                   Tenrec 1bp

Alignment block 29 of 154 in window, 63810395 - 63810395, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  c
B D                     Mouse  g
B D            Naked mole-rat  g
             Brush-tailed rat  g
B D                       Pig  a
B D          White rhinoceros  g
B D                       Dog  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
B D                     Shrew  g
          Cape elephant shrew  g
B D                   Manatee  g
B D                Budgerigar  g
B D                   Lamprey  g
B D                    Tenrec  =
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
              Golden hamster  -
B D                  Elephant  -
            Tibetan antelope  -
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                 Armadillo  =
                  Chinchilla  =
          Chinese tree shrew  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
B D                   Ferret   -
            Cape golden mole  -
B D                   Dolphin  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                   Wallaby  =
  D    Spiny softshell turtle  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 29 and 30 in window
B D               Budgerigar 1bp

Alignment block 30 of 154 in window, 63810396 - 63810396, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D            Naked mole-rat  t
             Brush-tailed rat  t
B D                       Pig  t
B D          White rhinoceros  t
B D                       Dog  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                     Shrew  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
B D                   Opossum  t
  D    Spiny softshell turtle  t
B D                   Lamprey  t
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
              Golden hamster  -
B D                  Elephant  -
            Tibetan antelope  -
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                 Armadillo  =
                  Chinchilla  =
          Chinese tree shrew  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
B D                   Ferret   -
B D                   Dolphin  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Alignment block 31 of 154 in window, 63810397 - 63810397, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D                     Mouse  t
B D            Naked mole-rat  t
             Brush-tailed rat  t
B D                      Pika  t
B D                       Pig  t
B D          White rhinoceros  t
B D                       Dog  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                     Shrew  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  c
B D                   Opossum  t
B D                Budgerigar  t
  D           Green seaturtle  t
  D    Spiny softshell turtle  t
B D                   Lamprey  t
B D                  Hedgehog  -
B D                Guinea pig  =
B D                       Rat  =
              Golden hamster  -
B D           Chinese hamster  -
B D                  Elephant  -
            Tibetan antelope  -
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  -
B D                  Squirrel  -
B D                    Rabbit  =
B D                 Armadillo  =
                  Chinchilla  =
          Chinese tree shrew  -
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
                Killer whale  =
              Bactrian camel  -
B D                     Panda  -
B D                   Ferret   -
B D                   Dolphin  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  -
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  -
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
B D       Medium ground finch  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 31 and 32 in window
B D               Budgerigar 1bp

Alignment block 32 of 154 in window, 63810398 - 63810399, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
       Lesser Egyptian jerboa  tc
                 Prairie vole  tc
B D                     Mouse  tc
B D            Naked mole-rat  tt
             Brush-tailed rat  tt
B D                    Rabbit  -c
B D                      Pika  tc
B D                       Pig  ct
B D          White rhinoceros  tc
B D                       Dog  tc
               Pacific walrus  tc
                 Weddell seal  tc
             Black flying-fox  aa
B D                   Megabat  aa
B D                     Shrew  tc
          Cape elephant shrew  ta
B D                   Manatee  tc
             Cape golden mole  tc
B D                    Tenrec  ta
B D                   Opossum  at
B D                Budgerigar  c-
  D           Green seaturtle  t-
  D            Painted turtle  t-
  D    Spiny softshell turtle  t-
B D                   Lamprey  tg
B D                  Hedgehog  --
B D                Guinea pig  ==
B D                       Rat  ==
              Golden hamster  --
B D           Chinese hamster  --
B D                  Elephant  --
            Tibetan antelope  --
        David's myotis (bat)  ==
B D                     Horse  --
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  --
B D                  Squirrel  --
B D                 Armadillo  ==
                  Chinchilla  ==
          Chinese tree shrew  --
B D                       Cat  --
B D                  Microbat  --
B D                  Bushbaby  --
               Big brown bat  --
                Killer whale  ==
              Bactrian camel  --
B D                     Panda  --
B D                   Ferret   --
B D                   Dolphin  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  --
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  --
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  --
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D