Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 714 in window, 180602193 - 180602214, 22 bps 
B D                     Human  ggctcaagtagcggac---------acggaa------------
B D                     Chimp  ggctcaagtagcggac---------acggaa------------
B D                   Gorilla  ggctcaagtagcggac---------acggaa------------
B D                 Orangutan  ggctcaagtagcggac---------acggaa------------
B D                    Gibbon  ggttcaaatagcggat---------acggaa------------
B D                    Rhesus  ggctcaagtagcggac---------acggaa------------
B D       Crab-eating macaque  ggctcaagtagcggac---------acggaa------------
B D                    Baboon  ggctcaagtagaggac---------acggaa------------
B D              Green monkey  ggctcaagtagcggac---------acggaa------------
B D                  Marmoset  ggcgcaggtagctgac---------acggaa------------
B D           Squirrel monkey  ggcgcagggagctgac---------gcggaa------------
B D                  Bushbaby  ggctcgagaagtgggc---------gcgaaa------------
           Chinese tree shrew  gactcaagtggtgggc---------acggag------------
B D                  Squirrel  ggctcaagcagtagac---------acggaa------------
       Lesser Egyptian jerboa  ggctcg---------------------gctg------------
                 Prairie vole  ggctcg---------------------ggag------------
               Golden hamster  ggctcg---------------------ggag------------
B D                     Mouse  ggctcg---------------------gacg------------
B D                       Rat  ggctcg---------------------aaag------------
B D            Naked mole-rat  ggctcatgtagtgggc---------acggaa------------
B D                Guinea pig  atctcatgaagtgagc---------atagag------------
                   Chinchilla  agctcatgtagcgggc---------gtagaa------------
             Brush-tailed rat  tgctcatgtagtgggt---------acagaa------------
B D                    Rabbit  -gctcaagtagcggac---------acgggg------------
B D                       Pig  ggctgaagtagtgggc---------ccagaa------------
B D                    Alpaca  ggctgaagtagagggt---------acggaa------------
               Bactrian camel  ggctgaagtagagggt---------acggaa------------
B D                   Dolphin  ggctgaagtagtgggc---------acggga------------
                 Killer whale  ggctgaagtagtgggc---------acggga------------
             Tibetan antelope  gcctgaagtagtgggc---------accgaa------------
B D                       Cow  gcctgaagtagtgggc---------gctgaa------------
B D                     Sheep  gcctgaagttgtgggc---------accgaa------------
                Domestic goat  gcctgaagtagtgggc---------accgaa------------
B D                     Horse  ggctgaagtagtgggc---------acagaa------------
B D          White rhinoceros  gtctgaagtagtgggc---------acagaa------------
B D                       Cat  agctgaagtagtgagc---------accgaa------------
B D                       Dog  agctgaagtagtgggt---------gcgcgg------------
B D                   Ferret   ggctgaagtagtgggt---------acggag------------
B D                     Panda  ggctgaagtagtgcgt---------acgaaa------------
               Pacific walrus  ggatgaagtagtgggt---------acggaa------------
                 Weddell seal  ggatgaagtagtgggt---------acggaa------------
             Black flying-fox  cgctaaggtaggaggc---------acggaa------------
B D                   Megabat  cgctaaggtagggggc---------acggaa------------
                Big brown bat  ggctcaaggagcgggc---------acggg-------------
         David's myotis (bat)  ggctcgagtagtgggc---------gcggg-------------
B D                  Microbat  ggcgcgagtagtgggc---------gcggg-------------
B D                  Hedgehog  gtctggagcggtgagc---------tcgcaa------------
              Star-nosed mole  ----ggagtagtgagc---------cgggca------------
B D                  Elephant  gactgaagtagcgggc---------actgaa------------
          Cape elephant shrew  gactcgcgtgccgggc---------gcggaa------------
B D                   Manatee  gactgaagtagtgggc---------acggaa------------
             Cape golden mole  gactgaagtagtgacc---------actgac------------
B D                    Tenrec  cgctgaagtagcgggt---------gcgggg------------
                     Aardvark  gactgaagtagtgggc---------acggaa------------
B D                 Armadillo  g-ctgaagtagtggac---------tcgaaa------------
B D                   Opossum  ggccgaagcgacgaag----------tagga------------
B D           Tasmanian devil  ggccggcgcagaggcggccgccgcgccggga------------
B D                   Wallaby  ggccggcgcggagacg------gcggcggga------------
           Tibetan ground jay  -------------------------tcggagaacgtagcggtg
B D                Budgerigar  -------------------------tcgcccagctca--tgca
  D  Chinese softshell turtle  ggctcctttcct--cc---------tcggag-gcgggatgata
B D                     Shrew  ===========================================
B D                      Pika  ===========================================
  D               Rock pigeon  ===========================================
  D    White-throated sparrow  ===========================================
  D            Painted turtle  ===========================================
B D               Zebra finch  ===========================================
  D       Collared flycatcher  ===========================================
  D           Green seaturtle  ===========================================
  D              Mallard duck  ===========================================
B D                    Turkey  ===========================================
B D                   Chicken  ===========================================
B D        American alligator  ===========================================
B D           Chinese hamster  ===========================================

Inserts between block 1 and 2 in window
      Lesser Egyptian jerboa 6bp
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 3bp
                    Aardvark 2bp
B D                Armadillo 1bp
B D                  Opossum 7bp
B D          Tasmanian devil 13bp
B D                  Wallaby 7bp

Alignment block 2 of 714 in window, 180602215 - 180602222, 8 bps 
B D                     Human  cag------------------ggaac-
B D                     Chimp  ccg------------------gggac-
B D                   Gorilla  ccg------------------gggac-
B D                 Orangutan  ccg------------------gggac-
B D                    Gibbon  ccg------------------gggac-
B D                    Rhesus  ccg------------------ggaac-
B D       Crab-eating macaque  ccg------------------ggaac-
B D                    Baboon  ccg------------------gggac-
B D              Green monkey  ccg------------------gggac-
B D                  Marmoset  ccc------------------gggac-
B D           Squirrel monkey  ccc------------------ggggc-
B D                  Bushbaby  cca------------------ggggc-
           Chinese tree shrew  cgg------------------gaggc-
B D                  Squirrel  ctg------------------ggtcc-
       Lesser Egyptian jerboa  tgg------------------gaccc-
                 Prairie vole  ccg------------------gattc-
               Golden hamster  ccg------------------ggtcc-
B D                     Mouse  ccg------------------gagcc-
B D                       Rat  ccg------------------gaccc-
B D            Naked mole-rat  cag------------------ggggc-
B D                Guinea pig  cgg------------------gggct-
                   Chinchilla  cgg------------------gggcc-
             Brush-tailed rat  cag------------------------
B D                    Rabbit  caa------------------aatac-
B D                      Pika  cag------------------ggcgc-
B D                       Pig  cag------------------tggac-
B D                    Alpaca  cgg------------------gaggc-
               Bactrian camel  cgg------------------gaggc-
B D                   Dolphin  cgg------------------ggggc-
                 Killer whale  cgg------------------ggggc-
             Tibetan antelope  ccg------------------ggggc-
B D                       Cow  ccg------------------ggg---
B D                     Sheep  ccg------------------ggggc-
                Domestic goat  ccg------------------ggggc-
B D                     Horse  cgg---------------g--gaggc-
B D          White rhinoceros  cgt---------------g--ggggc-
B D                       Cat  cgg--ggtgggggcggggg--gcacc-
B D                       Dog  gga-----ggcggggcggt--gggcc-
B D                   Ferret   cgg------------------ggtac-
B D                     Panda  gggggggggggggtggggg--ggggc-
               Pacific walrus  cgg---------------c--ggggc-
                 Weddell seal  cgg------------------ggggc-
             Black flying-fox  ccg---------------a--agggc-
B D                   Megabat  ccg---------------a--agggc-
B D                  Hedgehog  agg------------------gaggt-
              Star-nosed mole  agg------------------ggtgc-
B D                  Elephant  gga------------------ggagt-
          Cape elephant shrew  ---------------------agagt-
B D                   Manatee  gga------------------ggagt-
             Cape golden mole  aga------------------gcaat-
B D                    Tenrec  gga------------------ggagt-
                     Aardvark  gga------------------gaagt-
B D                 Armadillo  gga------------------tgaat-
B D                   Opossum  ---------------gagga-ggagt-
B D           Tasmanian devil  ---------------aagg--ggcgt-
B D                   Wallaby  ---------------cagc--ggcgc-
           Tibetan ground jay  -------------------ccggaccc
B D                Budgerigar  -------------------ctttgctt
  D  Chinese softshell turtle  -------------------atgggttc
B D                     Shrew  ===========================
  D               Rock pigeon  ===========================
  D    White-throated sparrow  ===========================
  D            Painted turtle  ===========================
               Big brown bat  ---------------------------
B D                  Microbat  ---------------------------
        David's myotis (bat)  ---------------------------
B D               Zebra finch  ===========================
  D       Collared flycatcher  ===========================
  D           Green seaturtle  ===========================
  D              Mallard duck  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
B D        American alligator  ===========================
B D           Chinese hamster  ===========================

Inserts between block 2 and 3 in window
B D                  Wallaby 1bp
          Tibetan ground jay 7bp
B D               Budgerigar 5bp
  D Chinese softshell turtle 11bp

Alignment block 3 of 714 in window, 180602223 - 180602231, 9 bps 
B D                     Human  tatcagcc-c
B D                     Chimp  tatcagcc-c
B D                   Gorilla  tatcggcc-c
B D                 Orangutan  tatcagcc-c
B D                    Gibbon  tatcagcc-c
B D                    Rhesus  catcagcc-c
B D       Crab-eating macaque  catcagcc-c
B D                    Baboon  catcagcc-c
B D              Green monkey  catcagcc-c
B D                  Marmoset  ggtcagcc-c
B D           Squirrel monkey  ggtcagcg-c
B D                  Bushbaby  tagtggcc-c
           Chinese tree shrew  agggagcc-c
B D                  Squirrel  tagcagtc-c
       Lesser Egyptian jerboa  gggcct----
                 Prairie vole  tggcgg----
               Golden hamster  tggcgg----
B D                     Mouse  tggcgg----
B D                       Rat  tggcgg----
B D            Naked mole-rat  tagcagcc-c
B D                Guinea pig  tagcagcc-c
                   Chinchilla  tcgctgcc-c
B D                    Rabbit  tagcagc---
B D                      Pika  ggctggcc-g
B D                       Pig  aggcagcc-c
B D                    Alpaca  tggcagcc-c
               Bactrian camel  tggcagcc-c
B D                   Dolphin  tggcaacc-c
                 Killer whale  tggcaacg-c
             Tibetan antelope  cagcagcc-c
B D                       Cow  -----ggc-t
B D                     Sheep  tagcagcc-c
                Domestic goat  tagcagcc-c
B D                     Horse  cagcagcc-c
B D          White rhinoceros  tagcagcc-c
B D                       Cat  tagcagcc-c
B D                       Dog  cggcagcc-c
B D                   Ferret   tagcggtc-c
B D                     Panda  tagcagcc-c
               Pacific walrus  caggagcc-c
                 Weddell seal  cagcagcc-c
             Black flying-fox  taggagcc-c
B D                   Megabat  taggggcc-c
B D                  Hedgehog  cggcagct-c
              Star-nosed mole  tgccaccc-c
B D                  Elephant  tagcagcc-g
          Cape elephant shrew  tagctgcctg
B D                   Manatee  tggcagcc-g
             Cape golden mole  taacagct-g
B D                    Tenrec  cagcgctt-g
                     Aardvark  tagcagcc-a
B D                 Armadillo  tagcagcc-a
B D                   Opossum  agaaagag-g
B D           Tasmanian devil  gaggagag-c
B D                   Wallaby  gaggcgag-c
           Tibetan ground jay  ---ccccg-g
B D                Budgerigar  ---taccg-t
B D                   Chicken  tgctcacc-c
  D  Chinese softshell turtle  tactcccc-c
B D                     Shrew  ==========
  D               Rock pigeon  ==========
  D    White-throated sparrow  ==========
  D            Painted turtle  ==========
               Big brown bat  ----------
B D                  Microbat  ----------
        David's myotis (bat)  ----------
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========
  D           Green seaturtle  ==========
  D              Mallard duck  ==========
B D                    Turkey  ==========
B D        American alligator  ==========
B D           Chinese hamster  ==========
            Brush-tailed rat  ----------

Inserts between block 3 and 4 in window
B D                  Opossum 7bp
B D          Tasmanian devil 8bp
B D                  Wallaby 8bp

Alignment block 4 of 714 in window, 180602232 - 180602235, 4 bps 
B D                     Human  g---tcg
B D                     Chimp  g---tcg
B D                   Gorilla  g---tcg
B D                 Orangutan  a---ttg
B D                    Gibbon  a---tcg
B D                    Rhesus  g---tca
B D       Crab-eating macaque  g---tca
B D                    Baboon  g---tca
B D              Green monkey  g---tca
B D                  Marmoset  g---tca
B D           Squirrel monkey  g---tcg
B D                  Bushbaby  a---tcg
B D                  Squirrel  a---ccg
B D            Naked mole-rat  a---cct
B D                Guinea pig  a---cct
                   Chinchilla  a---ctt
B D                    Rabbit  g---cc-
B D                      Pika  g---cct
B D                       Pig  a---ttg
B D                    Alpaca  a---tca
               Bactrian camel  a---tca
B D                   Dolphin  ----ccg
                 Killer whale  ----ccg
             Tibetan antelope  a---ctg
B D                       Cow  g---ctg
B D                     Sheep  a---ctg
                Domestic goat  a---ctg
B D                     Horse  a---ccg
B D          White rhinoceros  a---ccg
B D                       Cat  a---cct
B D                       Dog  a---cgc
B D                   Ferret   a---cct
B D                     Panda  a---cct
               Pacific walrus  a---cct
                 Weddell seal  a---cct
             Black flying-fox  a---ccg
B D                   Megabat  a---ccg
                Big brown bat  ------g
         David's myotis (bat)  ------g
B D                  Microbat  ------g
B D                  Hedgehog  a---cgg
              Star-nosed mole  gcccctg
B D                  Elephant  ---accg
          Cape elephant shrew  ---gcct
B D                   Manatee  ---actg
             Cape golden mole  ---actg
B D                    Tenrec  ---cacg
                     Aardvark  ---actg
B D                 Armadillo  ---gccg
B D                   Opossum  g---ctg
B D           Tasmanian devil  g---ccg
B D                   Wallaby  g---ccg
           Tibetan ground jay  ---ttcg
B D                Budgerigar  ---gtca
B D                   Chicken  ---ttc-
  D  Chinese softshell turtle  ---ggca
B D                Coelacanth  ---gtta
B D                     Shrew  =======
  D               Rock pigeon  =======
  D    White-throated sparrow  =======
  D            Painted turtle  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======
  D           Green seaturtle  =======
  D              Mallard duck  =======
B D                    Turkey  =======
B D        American alligator  =======
                Prairie vole  -------
              Golden hamster  -------
B D                       Rat  -------
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  -------
B D                     Mouse  -------
            Brush-tailed rat  -------
          Chinese tree shrew  NNNNNNN

Inserts between block 4 and 5 in window
          Tibetan ground jay 4bp
B D               Budgerigar 6bp
B D                  Chicken 1bp

Alignment block 5 of 714 in window, 180602236 - 180602249, 14 bps 
B D                     Human  gcc------tccgggccc-tg---------------------
B D                     Chimp  gcc------tccgggccc-ta---------------------
B D                   Gorilla  gcc------tccgggccc-tg---------------------
B D                 Orangutan  gcc------tccgggcct-tg---------------------
B D                    Gibbon  gcc------tccgggccc-tg---------------------
B D                    Rhesus  gcc------tccgggccc-tg---------------------
B D       Crab-eating macaque  gcc------tccgggccc-tg---------------------
B D                    Baboon  gcc------tccgggccc-tg---------------------
B D              Green monkey  gcc------tccgggccc-tg---------------------
B D                  Marmoset  gtc------gccgggcct--g---------------------
B D           Squirrel monkey  gcc------gccgggccc--g---------------------
B D                  Bushbaby  gcc------gtcgagccc-ag---------------------
B D                  Squirrel  gct------ctcggaccc--c---------------------
B D            Naked mole-rat  gcg------gccaggccc--t---------------------
B D                Guinea pig  gtc------gtcgggcct--g---------------------
                   Chinchilla  gcc------ggcgggcct--g---------------------
             Brush-tailed rat  gcc------gtcggacct--g---------------------
B D                    Rabbit  -cc------ggaagcccc--g---------------------
B D                      Pika  gcc------gcggggccc--g---------------------
B D                       Pig  gtt------gttgggccc-ag---------------------
B D                    Alpaca  gtcattgg-actgggccc-gg---------------------
               Bactrian camel  gtc------actgggccc-gg---------------------
B D                   Dolphin  gtc------gttgggccc-gt---------------------
                 Killer whale  gtc------gttgggccc-gt---------------------
             Tibetan antelope  gcc------tttggtcac-ga---------------------
B D                       Cow  gcc------tttggtcac-ga---------------------
B D                     Sheep  gcc------tttggtcac-ga---------------------
                Domestic goat  gcc------tttggtcac-ga---------------------
B D                     Horse  atc------gttgggctc-ag---------------------
B D          White rhinoceros  gtc------gttgggccc-ag---------------------
B D                       Cat  gtt------actgggtcc-ag---------------------
B D                       Dog  gtc------gcggggtcc-gg---------------------
B D                   Ferret   gtc------gttgggtcc-ag---------------------
B D                     Panda  gtc------gttgggtcc-ag---------------------
               Pacific walrus  gtc------gttgggtcc-ag---------------------
                 Weddell seal  gtc------gttgggtcc-ag---------------------
             Black flying-fox  gta------tttgagccc-cg---------------------
B D                   Megabat  gta------tttgagccc-cg---------------------
                Big brown bat  gtc------gtggagccc-tg---------------------
         David's myotis (bat)  gtc------gtggagccc-tg---------------------
B D                  Microbat  gtc------gtggagccc-tg---------------------
B D                  Hedgehog  gcc------gtcggaccc-agtatcacccccgccgttccccc
              Star-nosed mole  ggc------gttgggcct-ag---------------------
B D                  Elephant  gcc------ttcggctcc-ag---------------------
          Cape elephant shrew  tct------ttcgagtcc-cg---------------------
B D                   Manatee  gcc------ttcgggtcc-ag---------------------
             Cape golden mole  tcc------ttcgggtct-ag---------------------
B D                    Tenrec  gcc------gccaggccc-ca---------------------
                     Aardvark  gcc------ttcctgtcc-ag---------------------
B D                 Armadillo  gct------ctcaggtcc-ag---------------------
B D                   Opossum  gga------ccggagccgcag---------------------
B D           Tasmanian devil  gggcctggcccggggcccggg---------------------
B D                   Wallaby  ggg------ccggggcctggg---------------------
           Tibetan ground jay  cgt------gacaccccc-gg---------------------
B D                Budgerigar  ggt------tccagttcc-gg---------------------
B D                   Chicken  gct------tccggtccc-gg---------------------
  D            Painted turtle  gct------tccggttgc-tgcgctgtgtg------------
  D  Chinese softshell turtle  gct------tccggttgc-tgggttgcgcg------------
B D                Coelacanth  gca------tgggggcag-cg---------------------
B D                     Shrew  ==========================================
  D               Rock pigeon  ==========================================
  D    White-throated sparrow  ==========================================
B D               Zebra finch  ==========================================
  D       Collared flycatcher  ==========================================
  D           Green seaturtle  ==========================================
  D              Mallard duck  ==========================================
B D                    Turkey  ==========================================
B D        American alligator  ==========================================
                Prairie vole  ------------------------------------------
              Golden hamster  ------------------------------------------
B D                       Rat  ------------------------------------------
B D           Chinese hamster  ==========================================
      Lesser Egyptian jerboa  ------------------------------------------
B D                     Mouse  ------------------------------------------
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 5 and 6 in window
          Tibetan ground jay 12bp
B D               Budgerigar 14bp
B D                  Chicken 11bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp

Alignment block 6 of 714 in window, 180602250 - 180602258, 9 bps 
B D                     Human  cat---t-c-tcta
B D                     Chimp  cag---t-c-tcta
B D                   Gorilla  cag---t-c-tcta
B D                 Orangutan  cag---t-c-tcta
B D                    Gibbon  cag---t-c-tcta
B D                    Rhesus  cag---t-c-tcta
B D       Crab-eating macaque  cag---t-c-tcta
B D                    Baboon  cag---t-c-tcta
B D              Green monkey  cag---t-c-tcta
B D                  Marmoset  cag---t-c-tctg
B D           Squirrel monkey  cgg---t-c-cccg
B D                  Bushbaby  cag---t-c-tctg
B D                  Squirrel  gca---g-cctctc
       Lesser Egyptian jerboa  ----------cgtc
                 Prairie vole  ----------gctg
               Golden hamster  ----------gctc
B D                     Mouse  ----------gctc
B D                       Rat  ----------gctc
B D            Naked mole-rat  cac---t-c-tcta
B D                Guinea pig  caa---t-c-acta
                   Chinchilla  cag---t-c-tcta
             Brush-tailed rat  cgg---c-c-tcgc
B D                    Rabbit  caggtcc-c-tgca
B D                      Pika  gggctct-c-cgca
B D                       Pig  ccg---t-c-tctc
B D                    Alpaca  caa---t-c-ttca
               Bactrian camel  caa---t-c-ttca
B D                   Dolphin  cag---t-c-tcta
                 Killer whale  cag---t-c-tcta
             Tibetan antelope  cag---t-c-tcta
B D                       Cow  cag---t-c-tcta
B D                     Sheep  cag---t-c-tcta
                Domestic goat  cag---t-c-tcta
B D                     Horse  taa---t-c-tcta
B D          White rhinoceros  taa---t-c-tcta
B D                       Cat  caa---t-c-tctg
B D                       Dog  caa---t-c-tcta
B D                   Ferret   cag---c-c-tcta
B D                     Panda  caa---t-c-tcta
               Pacific walrus  caa---t-c-tcta
                 Weddell seal  caa---t-c-tcta
             Black flying-fox  cag---t-c-tcta
B D                   Megabat  cag---t-c-tcta
                Big brown bat  cac---t-c-tctc
         David's myotis (bat)  cac---a-c-tcca
B D                  Microbat  cac---g-c-tcca
B D                  Hedgehog  acc---c-c-acca
              Star-nosed mole  aaa---t-c-gcta
B D                  Elephant  caa---g-t-tcca
          Cape elephant shrew  cca---a-a-tcta
B D                   Manatee  caa---g-t-tcta
             Cape golden mole  tga---a-t-tcta
B D                    Tenrec  caa---g-c-tccg
                     Aardvark  caa---g-t-tcta
B D                 Armadillo  tga---a-c-tcta
B D                   Opossum  ctg---cgg-gcgc
B D           Tasmanian devil  cgg---c-t-ccgc
B D                   Wallaby  ccg---c-t-ccgc
B D                Coelacanth  cgc---t-t-tcc-
     Mexican tetra (cavefish)  caa---t-t-actg
B D                     Shrew  ==============
  D               Rock pigeon  ==============
  D    White-throated sparrow  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D                Budgerigar  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D        American alligator  ==============
B D           Chinese hamster  ==============
          Chinese tree shrew  NNNNNNNNNNNNNN

Alignment block 7 of 714 in window, 180602259 - 180602260, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                  Bushbaby  gt
B D                  Squirrel  ac
       Lesser Egyptian jerboa  gc
                 Prairie vole  gc
               Golden hamster  gc
B D                     Mouse  gc
B D                       Rat  gc
B D            Naked mole-rat  gt
B D                Guinea pig  gt
                   Chinchilla  gt
             Brush-tailed rat  gt
B D                    Rabbit  gc
B D                      Pika  gc
B D                       Pig  ac
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  gc
                 Killer whale  gc
             Tibetan antelope  gc
B D                       Cow  gc
B D                     Sheep  gc
                Domestic goat  gc
B D                     Horse  gc
B D          White rhinoceros  gc
B D                       Cat  gc
B D                       Dog  gc
B D                   Ferret   ac
B D                     Panda  gc
               Pacific walrus  gc
                 Weddell seal  gc
             Black flying-fox  gc
B D                   Megabat  gc
                Big brown bat  ac
         David's myotis (bat)  gc
B D                  Microbat  gc
B D                  Hedgehog  gc
              Star-nosed mole  gc
B D                  Elephant  gc
          Cape elephant shrew  gc
B D                   Manatee  gc
             Cape golden mole  gc
B D                    Tenrec  gc
                     Aardvark  gc
B D                 Armadillo  gc
B D                   Opossum  gc
B D           Tasmanian devil  gc
B D                   Wallaby  gc
  D               Rock pigeon  gc
           Tibetan ground jay  ac
B D                Budgerigar  gt
B D                   Chicken  gt
  D            Painted turtle  gt
  D  Chinese softshell turtle  gc
B D                    Lizard  gc
B D                Coelacanth  gt
     Mexican tetra (cavefish)  ac
B D                     Shrew  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                    Turkey  ==
B D        American alligator  ==
B D           Chinese hamster  ==
          Chinese tree shrew  NN

Inserts between block 7 and 8 in window
  D              Rock pigeon 1bp
          Tibetan ground jay 417bp
B D               Budgerigar 3bp
  D           Painted turtle 13bp
  D Chinese softshell turtle 13bp

Alignment block 8 of 714 in window, 180602261 - 180602261, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D                Coelacanth  c
     Mexican tetra (cavefish)  c
B D                   Lamprey  c
B D                     Shrew  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D            Painted turtle  =
B D                    Lizard  -
B D               Zebra finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  -
          Tibetan ground jay  =
B D        American alligator  =
B D           Chinese hamster  =
          Chinese tree shrew  N

Alignment block 9 of 714 in window, 180602262 - 180602323, 62 bps 
B D                     Human  atggaccgggaccttttgcggcagtcgctaaattgccacgggtcgtctttgctctctctact
B D                     Chimp  atggaccgggaccttctgcggcagtcgctaaattgccacgggtcgtctttgctgtctctact
B D                   Gorilla  atggaccgggaccttctgcggcagtcgctaaattgtcacgggtcgtctttgctctctctact
B D                 Orangutan  atggatcgggaccttctgcggcagtcgctaaattgccacgggtcgtctttgctctctctact
B D                    Gibbon  atggaccgggaccttctgcggcagtcgctaaattgccacgggtcgtctttgctctctctgct
B D                    Rhesus  atggaccgggaccttctgcggcagtcgctaaattgccatgggtcttctttgctctctctact
B D       Crab-eating macaque  atggaccgggaccttctgcggcagtcgctaaattgccatgggtcttctttgctctctctact
B D                    Baboon  atggaccgggaccttctgcggcagtcgctaaattgccatgggtcttctttgctctctctact
B D              Green monkey  atggaccgggaccttctgcggcagtcgctaaattgccatgggtcttctttgctctctctact
B D                  Marmoset  atggaccgtgaccttctgcggcagtcgctgaattgccacgggtcgtctttgctctcgcttct
B D           Squirrel monkey  atggaccgtgaccttctgcggcagtcactgaattgccacgggtcgtctttgctctcgctgct
B D                  Bushbaby  atggaccgggaccttctgcggcagtcgctgaattgccacggctcgtctttactctccctact
B D                  Squirrel  atggaccgggatcttctacgtcagtcgctgaattgccacgggtcgtcattgctctccctact
       Lesser Egyptian jerboa  atggaccgggacctgctgcggcagtcgctgaactgccacgggccgtcgctgctgtccctgct
                 Prairie vole  atggaccgcgacttgctgcgacagtcgctgggctgtcacggcccggcactactgtcgctgct
               Golden hamster  atggaccgcgatttgctgcggcagtcgctgggctgtcacggtccggcgctgctgtcgctgct
B D                     Mouse  atggaccgcgacttgctgcggcagtcgctgggctgccacggcccggccctgctgtcgctgct
B D                       Rat  atggaccgcgacttgctgcggcagtcgctgggctgtcacggcccggcgctgctgtcgctgct
B D            Naked mole-rat  atggaccgggaccttctgcggcagtccctgaattgccacgggccgtcattgctctccctact
B D                Guinea pig  atggaccgggaccttttgcggcagtccctgaactgccacgggtcgtcattgctcttcctact
                   Chinchilla  atggaccgggacctcctgcggcagtccctgaactgccacgggccgtccctgctctttctact
             Brush-tailed rat  atggaccgggaccttctgcggcagtccctgaattgccacgggccgtccttgctcttcctcct
B D                    Rabbit  atggaccgggaccttctgcggcagtcgctgaattgccatggcccgtccttgctctccctgct
B D                      Pika  atggaccgggacctcctgcggcagtcgctcaactgccacgggccgtcgctgctgtccttgct
B D                       Pig  atggaccgggaccttctgcggcagtcactgaatttccacgggccttcattgctctccctgct
B D                    Alpaca  atggaccgggaccttctgcggcagtcactgaatttccacgggccgtcattgctctccctgct
               Bactrian camel  atggaccgggaccttctgcggcagtcactgaatttccacgggccgtcattgctctccctgct
B D                   Dolphin  atggaccgggaccttatgcgtcagtcactgaatttccacgggccgtcattgctctccctgct
                 Killer whale  atggaccgggaccttatgcggcagtcactgaatttccacgggccgtcattgctctccctgct
             Tibetan antelope  atggaccgagacctcttgcggcagtcactaaatttccacggcccgtctttgctctccctgct
B D                       Cow  atggaccgagacctcttgcggcagtcactaaatttccacggcccgtctttgctgtcgctgct
B D                     Sheep  atggaccgagacctcttgcggcagtcactaaatttccacggcccgtctttgctctccctgct
                Domestic goat  atggaccgagacctcttgcggcagtcactaaatttccacggcccgtctttgctctccctgct
B D                     Horse  atggaccgggacctcctgcggcagtccctgaattaccacgggccgtcattgctgtccctgct
B D          White rhinoceros  atggaccgggaccttctgcggcagtcactgaattaccacgggccgtcattgctctccctgct
B D                       Cat  atggaccgggaccttcttcggcagtcattgaattaccacgggccgtcattgctctcccttct
B D                       Dog  atggaccgggaccttctgcggcagtccctgaactaccacgggccgtcactgctctccctgct
B D                   Ferret   atggaccgggaccttctgcggcagtcactgaactaccacgggccgtccctgctatccctgct
B D                     Panda  atggaccgggaccttctgcggcagtcgctgaactaccatgggccgtcattgctctccctgct
               Pacific walrus  atggaccgggaccttctgcggcagtcactgaactaccatgggccgtcattgctctccctgct
                 Weddell seal  atggaccgggacctaatgcggcagtcactgaactaccatgggccgtcattgctctccctgct
             Black flying-fox  atggaccgagaccttctgcggcagtcactgaattaccacgggccgtcattgctctccctgct
B D                   Megabat  atggaccgagaccttctgcggcagtcactgaattaccacgggccgtcattgctctccctgct
                Big brown bat  atggaccgcgaccttctgcggcagtcgctgaattaccacgggccgtccttgctgtccttgct
         David's myotis (bat)  atggaccgcgaccttctgcggcagtcgctcaattaccacgggccgtccttgctgtccttgct
B D                  Microbat  atggaccgcgaccttctgcggcagtcgctgaattaccacgggccgtccttgctgtcctggct
B D                  Hedgehog  atggaccgggatcttctccggcagtccctcaattatcacgggccgtcattactgtctctgct
              Star-nosed mole  atggaccgggatcttctccggcagtcattgaattaccacgggccgtcattgctctccctgct
B D                  Elephant  atggaccgggaccttctgcgacagtcgctcaactgccatgggccgtctctgctctccctgct
          Cape elephant shrew  atggaccgcgaccttctgcggcagtcgctcaattgccacgggccatcgttgctctctctgct
B D                   Manatee  atggaccgggaccttctgcgacagtcgctgaattgccatgggccgtcgctgctctccctgct
             Cape golden mole  atggaccgggatcttctgcggcagtcactgaattaccacgggccttcgttgctctccttgct
B D                    Tenrec  atggaccgggaccttctgcggcagtcgctgaattgccacggcccgtcgctgctctcccttct
                     Aardvark  atggaccgggaccttttgcggcagtcgctgaattgccacgggccttcgttgctctccatgct
B D                 Armadillo  atggaccgggaccttctgcggcagtcgctgaattgccacgggccatcgttgctgtccctgct
B D                   Opossum  atggaccgcgacctgctgcggcagtccctgagctgccatgggcccacgctcctgtccctgct
B D           Tasmanian devil  atggaccgcgacctcctgcggcagtcgctgggctgccacgggccctctctcctgtccctgct
B D                   Wallaby  atggaccgcgacctgctgcggcagtccttgggctgccacgggccctcgctcctgtccctgct
  D               Rock pigeon  atggaccgggagttgctgcgccaggcgctgagctaccatggccccacgctgctctcgctgct
  D    White-throated sparrow  atggatcgggagctgctccggcaggcgctgaactaccacggcccggcgctgctgtcgctgct
           Tibetan ground jay  atggatcgggagctgctccggcaggcgctgaaccaccacggtcccgcgctgctgtcgctgct
B D                Budgerigar  atggaccgggagctgctgcgtcaggtgctcaactaccatggtcctgagctgctctcgctgct
  D                    Parrot  atggaccgggagctgctgcgtcaggtgctcagctaccatggtcctgagctgctctcgctgct
  D             Scarlet macaw  atggaccgggagctgctgcgtcaggtgctcaactaccatggtcctgagctgctctcgctgct
B D                   Chicken  atggagcgggagttgctgcgccaggtgttgagctaccatggcccttcgctcctcgccttgct
B D        American alligator  atggaccgggacgtgctgcgccaggcgctgagcgtgcacgggccggcgctgctggccctgct
  D            Painted turtle  atggagcgggacctgctccgccaggcgctgggtttccatggccccgcgctgctctccctgct
  D  Chinese softshell turtle  atggagcgggacctgctgcgccaggcgctgggtttccatgggcccccgctgctcgccttgct
B D                    Lizard  atggagcgggacctcctccggcaggcgctcggcttccacggccccgcgctcctgccgctgct
B D                Coelacanth  atgaaccgagatctcctgcggcaggccttggggtaccacgggcccagtttgttttcgcttct
           Southern platyfish  atggacagagacttgttgcggcagtgcctggtccgccatggcgagacgctgttcaacaaact
B D               Stickleback  atggacagagaccttttgaggcagtgtctgacctatcacggagaatcctttttcaacaagct
     Mexican tetra (cavefish)  atggatagagatttactcaggcagtcggtgtcataccatggacagagcctgttttccctttt
                  Spotted gar  atggacagcgagctattgcggcagtcggtgtcttatcacggacacaacctgttctccctttt
B D                   Lamprey  atggaccaggcacagctgcagcgctgcgtggagcaccacggtcccacgttgctcgcgatgct
B D                     Shrew  ==============================================================
B D               Zebra finch  ==============================================================
  D       Collared flycatcher  ==============================================================
  D           Green seaturtle  ==============================================================
  D              Mallard duck  ==============================================================
B D                    Turkey  ==============================================================
B D           Chinese hamster  ==============================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 9 and 10 in window
B D          Tasmanian devil 860bp
  D              Rock pigeon 168bp

Alignment block 10 of 714 in window, 180602324 - 180602353, 30 bps 
B D                     Human  tcggagcgaacagcaggacaatccacactt--------
B D                     Chimp  tcggagcgaacagcaggacaatccacactt--------
B D                   Gorilla  tcggagcgaacagcaggacaatccacactt--------
B D                 Orangutan  tcggagcgaacagcaggacaatccacactt--------
B D                    Gibbon  tcggagcgaacagcaggacaatccacactt--------
B D                    Rhesus  ccggagcgaacagcaggataatccacactt--------
B D       Crab-eating macaque  ccggagcgaacagcaggataatccacactt--------
B D                    Baboon  ccggagcgaacagcaggataatccacactt--------
B D              Green monkey  ccggagcgaacagcaggataatccacactt--------
B D                  Marmoset  tcggagcgagcagcaggacaatccgcactt--------
B D           Squirrel monkey  gcggagcgagcagcaggacaacccgcactt--------
B D                  Bushbaby  ccggagcgaacagcaggacaatccacactt--------
B D                  Squirrel  gcggaacgaacagcaggacaatccgcactt--------
       Lesser Egyptian jerboa  gcggaacgaacaacaggacaacccgcactt--------
                 Prairie vole  gcggagcgagcagcaagacaacccgcactt--------
               Golden hamster  gcggagcgagcagcaagacaacccgcactt--------
B D                     Mouse  gcggagtgaacagcaggacaacccgcactt--------
B D                       Rat  gcggagtgagcagcaagacaacccgcactt--------
B D            Naked mole-rat  ccggagtgaacagcaggacaatccgaactt--------
B D                Guinea pig  ccggagtgaacagcaggacaatccgcactt--------
                   Chinchilla  ccggagcgagcagcaggacaacccgcactt--------
             Brush-tailed rat  ccggagtgagcagcaggacaacccgcactt--------
B D                    Rabbit  gcggagcgaacagcaggacaatccgcactt--------
B D                      Pika  tcgcagcgagcagcaggacaacccgcactt--------
B D                       Pig  ccggagcgaacagcaggacaatccgcactt--------
B D                    Alpaca  ccgcagcgaacagcaggacaattcgcactt--------
               Bactrian camel  tcgcagcgaacagcaggacaattcgcactt--------
B D                   Dolphin  caggagcgaacagcaggacaatccgcactt--------
                 Killer whale  caggagcgaacagcaggacaatccgcactt--------
             Tibetan antelope  ccggagcgaacagcaggacaacccgcactt--------
B D                       Cow  ccggagcgaacagcaggacaacccgcactt--------
B D                     Sheep  ccggagcgaacagcaggacaacccgcactt--------
                Domestic goat  ccggagcgaacagcaggacaacccgcactt--------
B D                     Horse  ccggagcgaacagcaggacaatccgcactt--------
B D          White rhinoceros  ccggagcgaacagcaggacaatccgcactt--------
B D                       Cat  ccggagcgaacagcaagacaacccgcactt--------
B D                       Dog  gcggagcgagcagcaggacaacccacactt--------
B D                   Ferret   ccgcagcgaacagcaggacaatccgcactt--------
B D                     Panda  ccggagcgaacagcaggacaatccgcactt--------
               Pacific walrus  ccggagcgaacagcaggacaatccacactt--------
                 Weddell seal  ccggagcgaacagcaggacaatccgcactt--------
             Black flying-fox  ccggagcgaacagcaggacaatccgcattt--------
B D                   Megabat  ccggagcgaacagcaagacaatccgcattt--------
                Big brown bat  ccgtagcgaacagctggacaatcctcactt--------
         David's myotis (bat)  ccgtagcgaacagcaggacaacccgcactt--------
B D                  Microbat  ccgtagcgaacagcaggacaacccgcactt--------
B D                  Hedgehog  ccggaccgaacagcaagataacccgcactt--------
              Star-nosed mole  ccggagcgaacagcaggacaatccgcactt--------
B D                  Elephant  ccggagtgaacagcaggacaatccgcactt--------
          Cape elephant shrew  gcggaacgaacagcaggacaacccgcactt--------
B D                   Manatee  ccggaacgagcagcaggacaatccgcactt--------
             Cape golden mole  caggaacgaacaacaggacaacccgcattt--------
B D                    Tenrec  ccggagcgagcagcacgacaatccgcactt--------
                     Aardvark  ccggaacgaacagcaggacaatccgcactt--------
B D                 Armadillo  ccggagcgaacaacaggacaatccgcactt--------
B D                   Opossum  ccgcagcgagcagcaagacaacccgcactt--------
B D                   Wallaby  ccgcagcgagcagcaggacaacccgcactt--------
  D    White-throated sparrow  ccgcgccgagcagcatgacaaccccgactt--------
           Tibetan ground jay  ccgcgccgagcagcacgacaaccccgactt--------
B D                Budgerigar  ccgcgccgagcagcaggacaaccctgactt--------
  D                    Parrot  ccgcgccgagcagcaggacaaccctgactt--------
  D             Scarlet macaw  ccgcgccgagcagcaggacaaccccgactt--------
B D                   Chicken  ccgttccgagcagcacgataaccctgactt--------
B D        American alligator  ccgcgccgagcagcccgacagccccgactt--------
  D            Painted turtle  ccgcaccgagcagcacgataaccccgactt--------
  D  Chinese softshell turtle  gcgaaccgagcagaacgacaaccccgactt--------
B D                    Lizard  ccgagccgagcagcacgacaaccccggctt--------
B D                Coelacanth  gaagtgcgagcagcatgagaatcccgactt--------
           Southern platyfish  gaaatgtgagcaaacggaaaacccagactt--------
B D               Stickleback  gaaatgtgaacaaacggaaaacccagactt--------
     Mexican tetra (cavefish)  aaaatgtgaacagagtgaaaatccagactt--------
                  Spotted gar  gaaatgcgaacagctcgaaaacccgggttt--------
B D                   Lamprey  ccaggcggagcaggatgagaacatcgatgtcgccgcga
B D                     Shrew  ======================================
B D           Tasmanian devil  ======================================
  D               Rock pigeon  ======================================
B D               Zebra finch  ======================================
  D       Collared flycatcher  ======================================
  D           Green seaturtle  ======================================
  D              Mallard duck  ======================================
B D                    Turkey  ======================================
B D           Chinese hamster  ======================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 10 and 11 in window
    Mexican tetra (cavefish) 1165bp
                 Spotted gar 3868bp

Alignment block 11 of 714 in window, 180602354 - 180602355, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
B D                  Squirrel  cc
       Lesser Egyptian jerboa  cc
                 Prairie vole  cc
               Golden hamster  cc
B D                     Mouse  cc
B D                       Rat  cc
B D            Naked mole-rat  cc
B D                Guinea pig  cc
                   Chinchilla  cc
             Brush-tailed rat  cc
B D                    Rabbit  cc
B D                      Pika  cc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                  Hedgehog  cc
              Star-nosed mole  cc
B D                  Elephant  cc
          Cape elephant shrew  cc
B D                   Manatee  cc
             Cape golden mole  cc
B D                    Tenrec  cc
                     Aardvark  cc
B D                 Armadillo  cc
B D                   Opossum  cc
B D                   Wallaby  cc
  D    White-throated sparrow  cc
           Tibetan ground jay  cc
B D                Budgerigar  cc
  D                    Parrot  cc
  D             Scarlet macaw  cc
B D                   Chicken  cc
B D        American alligator  cc
  D            Painted turtle  cc
  D  Chinese softshell turtle  cc
B D                    Lizard  cc
B D                Coelacanth  cc
           Southern platyfish  cc
B D               Stickleback  cc
B D                   Lamprey  tc
B D                     Shrew  ==
                 Spotted gar  ==
    Mexican tetra (cavefish)  ==
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                    Turkey  ==
B D           Chinese hamster  ==
          Chinese tree shrew  NN

Inserts between block 11 and 12 in window
          Southern platyfish 2628bp
B D              Stickleback 1499bp

Alignment block 12 of 714 in window, 180602356 - 180602356, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D                   Wallaby  g
  D    White-throated sparrow  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
B D                   Chicken  g
B D        American alligator  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
B D                    Lizard  g
B D                Coelacanth  a
B D                   Lamprey  a
B D                     Shrew  =
B D               Stickleback  =
                 Spotted gar  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
B D               Zebra finch  =
  D       Collared flycatcher  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                    Turkey  =
B D           Chinese hamster  =
          Chinese tree shrew  N

Inserts between block 12 and 13 in window
B D                  Wallaby 990bp

Alignment block 13 of 714 in window, 180602357 - 180602380, 24 bps 
B D                     Human  tagcctcctggggtcggcc------gccga
B D                     Chimp  tagcctcctggggtcggcc------gccga
B D                   Gorilla  tagcctcctggggtcggcc------gccga
B D                 Orangutan  gagcctcctggggtcggcc------gccga
B D                    Gibbon  gagcctcctggggtcggcc------gccga
B D                    Rhesus  gagcctcctggggtcggcc------gccga
B D       Crab-eating macaque  gagcctcctggggtcggcc------gccga
B D                    Baboon  aagcctcctggggtcggcc------gccga
B D              Green monkey  gagcctcctgggatcggcc------gccga
B D                  Marmoset  gagcctcctggggtcggcc------gcgga
B D           Squirrel monkey  gagcctcctggggtcggcc------gctga
B D                  Bushbaby  gagcctcctggggtcggcg------gccga
B D                  Squirrel  gagcctcctagggtcggca------tccga
       Lesser Egyptian jerboa  gagtctgctggggacggcc------gccga
                 Prairie vole  gagcctcctagggacggca------gccga
               Golden hamster  gagcctgctgggcacggcg------gctga
B D                     Mouse  gagcctgctgggcacggcg------gccga
B D                       Rat  gagcctgctgggcacgacg------gccga
B D            Naked mole-rat  gagcctcctggggtcggcc------gtgga
B D                Guinea pig  gagcctcctggggtcggcg------tctga
                   Chinchilla  gagcctcctggggtcggcg------gcgga
             Brush-tailed rat  gagcctcctggggtcggcg------gcgga
B D                    Rabbit  gagcctcctggggtcggcg------gccga
B D                      Pika  gagcctgctggggtcagcg------ggcga
B D                       Pig  gagcctcctgggctcggtg------gcaga
B D                    Alpaca  gagtctcctggggtcggtg------gccga
               Bactrian camel  gagtctcctggggtcggtg------gccga
B D                   Dolphin  gagcctcctggggtcggtg------gtcga
                 Killer whale  gagcctcctggggtcggtg------gtcga
             Tibetan antelope  gagcctcctggggtcggtc------gccga
B D                       Cow  gagcctcctggggtcggtg------gccga
B D                     Sheep  gagcctcctggggtcggtg------gccga
                Domestic goat  gagcctcctggggtcggtg------gccga
B D                     Horse  gagtctcctggggtcgggg------gccga
B D          White rhinoceros  gagcctcctgggttcggcg------gccga
B D                       Cat  gagcctcctggggtccgca------gccga
B D                       Dog  gagcctcctggggtcggcg------gccga
B D                   Ferret   gagcctcctggggtcggcg------gccga
B D                     Panda  gagcctcctggggtcagcg------gctga
               Pacific walrus  gagcctcctagggtcggcg------gccga
                 Weddell seal  gagcctcctagggtcggcg------gtcga
             Black flying-fox  gagccttctaggatcggcg------gccga
B D                   Megabat  gagccttctaggatccgcg------gccga
                Big brown bat  gagcctcctggggtcggcg------gccga
         David's myotis (bat)  gagcctcctggggtcggcg------gccga
B D                  Microbat  gagcctcctggggtcggcg------gccga
B D                  Hedgehog  gagcctcctgggggcggcc---------ga
              Star-nosed mole  gagcttgttggggtctgccgggttggcgga
B D                  Elephant  cagccttctggggtcggcg------gcgga
          Cape elephant shrew  gagtctcctggggtcggtg------gcgga
B D                   Manatee  gagcctcctggggtcggcg------gctga
             Cape golden mole  aagcctcctggggtcggcg------gctga
B D                    Tenrec  gagcctcctgggctcggcg------gccga
                     Aardvark  gacccttctagggtcggcg------acgga
B D                 Armadillo  gagcctgctagggtcggtg------gctga
B D                   Opossum  gggtctcctaggcccggcc------gcgga
  D    White-throated sparrow  cgggctgct-------gcc------gccg-
           Tibetan ground jay  cgggctgct-------gcc------gccg-
B D                Budgerigar  cgggctgct-------gcc------gccg-
  D                    Parrot  cgggctgct-------gcc------gccg-
  D             Scarlet macaw  cgggctgct-------gcc------gccg-
B D                   Chicken  cgggctgct-------gcc------gccc-
B D        American alligator  cggtctcct-------gcc------gccc-
  D            Painted turtle  gggcctcct-------gcc------tcc--
  D  Chinese softshell turtle  gggcctcct-------gcc------ccc--
B D                    Lizard  cggcctcct-------gcc------tccg-
B D                Coelacanth  agctctgtcgggagaggtc------tccaa
B D                   Lamprey  ctgcccccgaggcccggtg------a----
B D                     Shrew  ==============================
B D               Stickleback  ==============================
                 Spotted gar  ==============================
          Southern platyfish  ==============================
    Mexican tetra (cavefish)  ==============================
B D           Tasmanian devil  ==============================
  D               Rock pigeon  ==============================
B D               Zebra finch  ==============================
  D       Collared flycatcher  ==============================
  D           Green seaturtle  ==============================
  D              Mallard duck  ==============================
B D                    Turkey  ==============================
B D                   Wallaby  ==============================
B D           Chinese hamster  ==============================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 13 and 14 in window
B D               Coelacanth 2106bp

Alignment block 14 of 714 in window, 180602381 - 180602397, 17 bps 
B D                     Human  gccagcccggggcccgc-
B D                     Chimp  gccagcccggggcccgc-
B D                   Gorilla  gccagcccggggcccgc-
B D                 Orangutan  gccagcccggggcccgc-
B D                    Gibbon  gccagcccggggcccgc-
B D                    Rhesus  gccaacccggggcccgc-
B D       Crab-eating macaque  gccaacccggggcccgc-
B D                    Baboon  gccaacccggggcccgc-
B D              Green monkey  gccaacccggggcccgc-
B D                  Marmoset  cccagtccggggccccc-
B D           Squirrel monkey  gccagcccggggcccgc-
B D                  Bushbaby  gcccacccggggcccgc-
B D                  Squirrel  gcccgcccgcggcccgc-
       Lesser Egyptian jerboa  gcctgcccggggccccg-
                 Prairie vole  gcccccccgcggcgcgg-
               Golden hamster  gccagcccgcggcgcgg-
B D                     Mouse  gccagcccgcggcgcgg-
B D                       Rat  gccagcccgcggcgcgg-
B D            Naked mole-rat  gcctgctcgcggtccgc-
B D                Guinea pig  gcccgctcggggtccgc-
                   Chinchilla  gcccgctcggggtccgc-
             Brush-tailed rat  gcccgctcggggtcctc-
B D                    Rabbit  gcctgcccggggcccgc-
B D                      Pika  gtcggctcggggcccgc-
B D                       Pig  gcctccgcggggcccgc-
B D                    Alpaca  acctgcccggggcccgc-
               Bactrian camel  acctgcccggggcccgc-
B D                   Dolphin  gcctgcccggggcccgg-
                 Killer whale  gcctgcccggggcccgc-
             Tibetan antelope  ccctgcccggggcccgc-
B D                       Cow  ccctgcccggggcccgc-
B D                     Sheep  ccctgcccggggcccgc-
                Domestic goat  ccctgcccggggccc---
B D                     Horse  gcctgcccggggcccgc-
B D          White rhinoceros  gcctgcccggggcccgc-
B D                       Cat  gcccgcccggggcccgc-
B D                       Dog  gccgggccggggtccgc-
B D                   Ferret   gcctgcccggggaccgg-
B D                     Panda  gcctgctcggggacagc-
               Pacific walrus  gcctgcccggggcccgc-
                 Weddell seal  gcctgcccggggcccgc-
             Black flying-fox  gcctgcccggggcccga-
B D                   Megabat  gcctgcccggggcccga-
                Big brown bat  gcctgcccggggcccgc-
         David's myotis (bat)  gcctgcccggggcccgc-
B D                  Microbat  gcctgcccggggcccgc-
B D                  Hedgehog  gcccgcgcggggcccgc-
              Star-nosed mole  gcctgcccggggcccgc-
B D                  Elephant  gcctgcccggggcccgg-
          Cape elephant shrew  gcctgcgcggggcccgc-
B D                   Manatee  gcctgcccggggcccgc-
             Cape golden mole  gcctgcccggggcccgc-
B D                    Tenrec  gcctgcccggggcccgc-
                     Aardvark  gcctgccccgggcccgc-
B D                 Armadillo  gcctcttcggggcccgc-
B D                   Opossum  cacggcccgcggggcgc-
  D    White-throated sparrow  ------cccggggccgc-
           Tibetan ground jay  ------cccggggccgc-
B D                Budgerigar  ------ccggggaccgt-
  D                    Parrot  ------ccggggaccgt-
  D             Scarlet macaw  ------ccggggaccgt-
B D                   Chicken  ------ccggggaccgt-
B D        American alligator  ------tccgggcctgg-
  D            Painted turtle  -------cgggggcccc-
  D  Chinese softshell turtle  -------cgggggaccc-
B D                    Lizard  ------ggagggccagg-
B D                   Lamprey  -gctgccacgtgcctgtc
B D                     Shrew  ==================
B D               Stickleback  ==================
                 Spotted gar  ==================
B D                Coelacanth  ==================
          Southern platyfish  ==================
    Mexican tetra (cavefish)  ==================
B D           Tasmanian devil  ==================
  D               Rock pigeon  ==================
B D               Zebra finch  ==================
  D       Collared flycatcher  ==================
  D           Green seaturtle  ==================
  D              Mallard duck  ==================
B D                    Turkey  ==================
B D                   Wallaby  ==================
B D           Chinese hamster  ==================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNN

Inserts between block 14 and 15 in window
  D   White-throated sparrow 13bp
          Tibetan ground jay 13bp
B D               Budgerigar 23bp
  D                   Parrot 23bp
  D            Scarlet macaw 684bp
B D                  Chicken 25bp
B D       American alligator 27bp
  D           Painted turtle 15bp
  D Chinese softshell turtle 8bp
B D                   Lizard 15bp

Alignment block 15 of 714 in window, 180602398 - 180602407, 10 bps 
B D                     Human  cgccc---cag--------ca
B D                     Chimp  agccc---cag--------ca
B D                   Gorilla  cgtcc---cag--------ca
B D                 Orangutan  cgccc---cag--------ca
B D                    Gibbon  cgccc---cag--------ca
B D                    Rhesus  cgccc---cag--------ca
B D       Crab-eating macaque  cgccc---cag--------ca
B D                    Baboon  cgccc---cag--------ca
B D              Green monkey  cgccc---cag--------ca
B D                  Marmoset  cgccg---cag--------ca
B D           Squirrel monkey  cggcg---cag--------ca
B D                  Bushbaby  cgccc---cac--------ct
B D                  Squirrel  cgccc---cag----ca----
       Lesser Egyptian jerboa  cgccg---cag--ca------
                 Prairie vole  cacct---cctca--------
               Golden hamster  cgcct---c------------
B D                     Mouse  cgcct---cct----------
B D                       Rat  cgccg---cct----------
B D            Naked mole-rat  cggcc---ctg------ca--
B D                Guinea pig  cgccc---cag------ca--
                   Chinchilla  cgccg---cag------ca--
             Brush-tailed rat  agccc---cag------cc--
B D                    Rabbit  cgctc---cag----------
B D                      Pika  cgctg---ccg----------
B D                       Pig  caccc---cag--------ca
B D                    Alpaca  cgtcc---cag--------ca
               Bactrian camel  cgtcc---cag--------ca
B D                   Dolphin  cgccc---cag--------ca
                 Killer whale  cgccc---cag--------ca
             Tibetan antelope  cgggc---cag--------ca
B D                       Cow  cgggc---cag--------ca
B D                     Sheep  cgggc---cag--------ca
B D                     Horse  cgccc---cag--------ca
B D          White rhinoceros  cgccc---cag--------ca
B D                       Cat  cgccc---cag--------ca
B D                       Dog  cgcct---cag--------ca
B D                   Ferret   cgctc---cag--------ca
B D                     Panda  cgccc---cag--------ca
               Pacific walrus  cgccc---cag--------ca
                 Weddell seal  cgccc---cag--------ca
             Black flying-fox  cgtcc---cag--------ca
B D                   Megabat  cgtcc---cag--------ca
                Big brown bat  cgccc---cag--------ca
         David's myotis (bat)  cgccc---cag--------cc
B D                  Microbat  cgtcc---cag--------cc
B D                  Hedgehog  agccc---ccg--------cc
              Star-nosed mole  ctctc---cag--------ca
B D                  Elephant  cgtcc---cag--------ca
          Cape elephant shrew  cgccc---cat--------ca
B D                   Manatee  cgccc--------------ca
             Cape golden mole  cgccc---cag--------ca
B D                    Tenrec  cgctc---cag--------ca
                     Aardvark  cgccc---cag--------ca
B D                 Armadillo  cgtcccaacag--------ca
B D                   Opossum  c--------------------
  D    White-throated sparrow  cgcg-----------------
           Tibetan ground jay  cgcg-----------------
B D                Budgerigar  cgca-----------------
  D                    Parrot  cgca-----------------
B D                   Chicken  cgc------------------
B D        American alligator  cgag-----------------
  D            Painted turtle  cggg-----------------
B D                   Lamprey  tgccc---gtg--------ta
B D                     Shrew  =====================
B D               Stickleback  =====================
                 Spotted gar  =====================
B D                Coelacanth  =====================
          Southern platyfish  =====================
    Mexican tetra (cavefish)  =====================
B D           Tasmanian devil  =====================
  D               Rock pigeon  =====================
  D             Scarlet macaw  =====================
B D                    Lizard  =====================
B D               Zebra finch  =====================
  D       Collared flycatcher  =====================
  D  Chinese softshell turtle  =====================
  D           Green seaturtle  =====================
  D              Mallard duck  =====================
B D                    Turkey  =====================
B D                   Wallaby  =====================
               Domestic goat  ---------------------
B D           Chinese hamster  =====================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNN

Inserts between block 15 and 16 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 381bp
              Golden hamster 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
  D   White-throated sparrow 7bp
          Tibetan ground jay 7bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
B D                  Chicken 2bp
B D       American alligator 2bp
  D           Painted turtle 13bp

Alignment block 16 of 714 in window, 180602408 - 180602409, 2 bps 
B D                     Human  cc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  gc
B D              Green monkey  ac
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gc
B D                  Squirrel  gc
       Lesser Egyptian jerboa  -c
               Golden hamster  -c
B D                     Mouse  -c
B D                       Rat  -c
B D            Naked mole-rat  gc
B D                Guinea pig  tc
                   Chinchilla  gc
             Brush-tailed rat  gc
B D                    Rabbit  cc
B D                      Pika  gc
B D                       Pig  gc
B D                    Alpaca  gc
               Bactrian camel  gc
B D                   Dolphin  gc
                 Killer whale  gc
             Tibetan antelope  gc
B D                       Cow  gc
B D                     Sheep  gc
B D                     Horse  gc
B D          White rhinoceros  gc
B D                       Cat  gc
B D                       Dog  gc
B D                   Ferret   gc
B D                     Panda  gc
               Pacific walrus  gc
                 Weddell seal  gc
             Black flying-fox  gc
B D                   Megabat  gc
                Big brown bat  gc
         David's myotis (bat)  gc
B D                  Microbat  gc
B D                  Hedgehog  gc
              Star-nosed mole  gc
B D                   Opossum  cc
  D    White-throated sparrow  gc
           Tibetan ground jay  gc
B D                Budgerigar  ac
  D                    Parrot  gc
B D                   Chicken  gc
B D        American alligator  gc
  D            Painted turtle  gc
  D  Chinese softshell turtle  gc
B D                    Lizard  ac
B D                   Lamprey  tc
B D                     Shrew  ==
B D               Stickleback  ==
                 Spotted gar  ==
B D                Coelacanth  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
  D             Scarlet macaw  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                    Turkey  ==
B D                   Wallaby  ==
                Prairie vole  ==
B D                    Tenrec  --
               Domestic goat  --
B D                 Armadillo  --
         Cape elephant shrew  --
                    Aardvark  --
            Cape golden mole  --
B D           Chinese hamster  ==
B D                   Manatee  --
B D                  Elephant  --
          Chinese tree shrew  NN

Inserts between block 16 and 17 in window
B D                  Lamprey 2784bp

Alignment block 17 of 714 in window, 180602410 - 180602419, 10 bps 
B D                     Human  cgttgcaggg
B D                     Chimp  agttgcaggg
B D                   Gorilla  cgttgcaggg
B D                 Orangutan  cgttgcaggg
B D                    Gibbon  cgttgcaggg
B D                    Rhesus  cgttgcaggg
B D       Crab-eating macaque  cgttgcaggg
B D                    Baboon  cgttgcaggg
B D              Green monkey  cgttgcaggg
B D                  Marmoset  cgttgcaggg
B D           Squirrel monkey  cgtcgcaggg
B D                  Bushbaby  agttacaggg
B D                  Squirrel  acttacaggg
       Lesser Egyptian jerboa  acgtcccggg
               Golden hamster  agggagctgc
B D                     Mouse  cgggagccgg
B D                       Rat  ccggagccgg
B D            Naked mole-rat  atttacaggg
B D                Guinea pig  acttacaggg
                   Chinchilla  atttacaggg
             Brush-tailed rat  acgtacaggg
B D                    Rabbit  agttacaggg
B D                      Pika  cgctgccggg
B D                       Pig  agttacaggg
B D                    Alpaca  agttacaggg
               Bactrian camel  agttacaggg
B D                   Dolphin  agttacaggg
                 Killer whale  agttacaggg
             Tibetan antelope  agttcccggg
B D                       Cow  agttaccggg
B D                     Sheep  agttcccggg
B D                     Horse  agttacaggg
B D          White rhinoceros  agttacaggg
B D                       Cat  agttacaggg
B D                       Dog  agttacaggg
B D                   Ferret   agttacaggg
B D                     Panda  agttactggg
               Pacific walrus  agttacaggg
                 Weddell seal  agttaccggg
             Black flying-fox  cgttacaggg
B D                   Megabat  cgttacaggg
                Big brown bat  ccgtgccagg
         David's myotis (bat)  cggggccagg
B D                  Microbat  cggggccagg
B D                  Hedgehog  cggcgcaggg
              Star-nosed mole  agattcaggg
B D                  Elephant  -gctacaggg
          Cape elephant shrew  -gttacagag
B D                   Manatee  -gttacaggg
             Cape golden mole  -gttacaggg
B D                    Tenrec  -gttcccggg
                     Aardvark  -gttacaggg
B D                 Armadillo  -gttacaggg
B D                   Opossum  cgctgctggc
  D    White-throated sparrow  cggccgc---
           Tibetan ground jay  cggccgc---
B D                Budgerigar  cggcagc---
  D                    Parrot  cggcagc---
B D                   Chicken  cgtccgc---
B D        American alligator  cgcccgc---
  D            Painted turtle  cgcccgc---
  D  Chinese softshell turtle  tgcccgc---
B D                    Lizard  cgccagt---
B D                     Shrew  ==========
B D               Stickleback  ==========
                 Spotted gar  ==========
B D                Coelacanth  ==========
B D                   Lamprey  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D           Tasmanian devil  ==========
  D               Rock pigeon  ==========
  D             Scarlet macaw  ==========
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========
  D           Green seaturtle  ==========
  D              Mallard duck  ==========
B D                    Turkey  ==========
B D                   Wallaby  ==========
                Prairie vole  ==========
               Domestic goat  ----------
B D           Chinese hamster  ==========
          Chinese tree shrew  NNNNNNNNNN

Alignment block 18 of 714 in window, 180602420 - 180602434, 15 bps 
B D                     Human  caggt-aa-------------------------tgagac----g--------t
B D                     Chimp  caggt-aa-------------------------tgagac----g--------t
B D                   Gorilla  caggt-aa-------------------------tgagac----g--------t
B D                 Orangutan  caggt-aa-------------------------tgagac----g--------t
B D                    Gibbon  caggt-aa-------------------------tgagac----g--------t
B D                    Rhesus  caggtaaa-------------------------tgcaac----g--------t
B D       Crab-eating macaque  caggt-aa-------------------------tgcaac----g--------t
B D                    Baboon  caggt-aa-------------------------tgcgac----g--------t
B D              Green monkey  caggt-aa-------------------------tgcgac----g--------t
B D                  Marmoset  caggt-aa-------------------------ggagac----g--------t
B D                  Bushbaby  caggt-aa-------------------------cgagat----g--------g
B D                  Squirrel  caggt-aa-------------------------tggtgc----t--------g
       Lesser Egyptian jerboa  caggt-ga-------------------------c-------------------
               Golden hamster  caggt-a----------------------------------------------
B D                     Mouse  caggt-a----------------------------------------------
B D                       Rat  caggt-a----------------------------------------------
B D            Naked mole-rat  caggt-aa-------------------------taggac----g-------gg
B D                Guinea pig  caggt-aa-------------------------tgggac----a--------g
                   Chinchilla  caggt-aa-------------------------tgggac----a---------
             Brush-tailed rat  caggt-aa-------------------------tgggac----a--------g
B D                    Rabbit  caggt-aa-------------------------ggggac----t---------
B D                      Pika  caggt-ga-------------------------gcggac----g---------
B D                       Pig  caggt-aa-------------------------tgggat----a--------g
B D                    Alpaca  caggt-aa-------------------------tgggac----g--------g
               Bactrian camel  caggt-aa-------------------------tgggac----g--------g
B D                   Dolphin  caggt-aa-------------------------tgggac----g--------g
                 Killer whale  caggt-aa-------------------------tgggac----g--------g
             Tibetan antelope  caggt-aa-------------------------tgggac----g--------g
B D                       Cow  caggt-aa-------------------------tgggac----g--------g
B D                     Sheep  caggt-aa-------------------------tggcac---gg--------g
B D                     Horse  caggt-aa-------------------------tgggac----g--------g
B D          White rhinoceros  caggt-aa-------------------------tgggac----g--------g
B D                       Cat  caggt-aa-------------------------tggtac----g--------g
B D                       Dog  caggt-ag-------------------------ggggac----g--------g
B D                   Ferret   caggt-aa-------------------------tgggacggagg--------g
B D                     Panda  caggt-aa-------------------------tgggac----g--------g
               Pacific walrus  caggt-aa-------------------------tgggac----g--------g
                 Weddell seal  caggt-aa-------------------------tgggac----g--------g
             Black flying-fox  caggt-aa-------------------------tgggac----c--------g
B D                   Megabat  caggt-aa-------------------------tgggac----c--------g
                Big brown bat  caggt-aa-------------------------ggagac----c--------g
         David's myotis (bat)  ccggt-aa-------------------------ggaaat----c--------t
B D                  Microbat  caggt-aa-------------------------ggaaat----c--------g
B D                  Hedgehog  caggt-ga-----gaggacgcg-----------ggacgc----c--------g
              Star-nosed mole  caggt-aa-------------------------gggctt----t--------g
B D                  Elephant  caggt-aa---------------------------ctgc----a-------cg
          Cape elephant shrew  caggt-aa---------------------------atgc----a--------g
B D                   Manatee  caggt-aa---------------------------gtgc----a--------g
             Cape golden mole  caggt-aa---------------------------atgc----a--------a
B D                    Tenrec  caggt-ga---------------------------atgc----c--------g
                     Aardvark  caggt-aa---------------------------attc----a--------g
B D                 Armadillo  caggt-aa----------------------------tgc----g--------a
B D                   Opossum  taggt-aa-------------------------t---------g--------g
  D    White-throated sparrow  ctggt-ga-------------------------ggggcg----c---------
           Tibetan ground jay  ctggt-ga-------------------------ggggcg----c---------
B D                Budgerigar  ctggt-aa-------------------------gga-----------------
  D                    Parrot  ctggt-aa-------------------------ggggcg----g---------
B D                   Chicken  ctggt-ga-------------------------gggatc----a---------
B D        American alligator  caggt-ga-------------------------gggcgg----gg--------
  D            Painted turtle  caggt-aa-------------------------ggagcc----g---------
  D  Chinese softshell turtle  caggt-ga-------------------------ggagcc----g-t-------
B D                    Lizard  ccggt-gagttgggaaggccctcagccgggaagggggcg----g--ggcct--
B D                     Shrew  =====================================================
B D               Stickleback  =====================================================
                 Spotted gar  =====================================================
B D                Coelacanth  =====================================================
B D                   Lamprey  =====================================================
          Southern platyfish  =====================================================
    Mexican tetra (cavefish)  =====================================================
B D           Tasmanian devil  =====================================================
  D               Rock pigeon  =====================================================
  D             Scarlet macaw  =====================================================
B D               Zebra finch  =====================================================
  D       Collared flycatcher  =====================================================
  D           Green seaturtle  =====================================================
  D              Mallard duck  =====================================================
B D                    Turkey  =====================================================
B D                   Wallaby  =====================================================
                Prairie vole  =====================================================
               Domestic goat  -----------------------------------------------------
B D           Chinese hamster  =====================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  -----------------------------------------------------

Inserts between block 18 and 19 in window
  D                   Parrot 250bp
B D                  Chicken 1bp
B D                   Lizard 1bp

Alignment block 19 of 714 in window, 180602435 - 180602467, 33 bps 
B D                     Human  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D                     Chimp  tg--------------------------------gtgc----c---a-------cggcg-----------
B D                   Gorilla  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D                 Orangutan  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D                    Gibbon  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D                    Rhesus  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D       Crab-eating macaque  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D                    Baboon  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D              Green monkey  tg--------------------------------gtgc----c---a-------ctgcg-----------
B D                  Marmoset  tg--------------------------------gtgc----c---g-------ctgcg-----------
B D                  Bushbaby  cg--------------------------------gcgg----c---g-------ctgcg-----------
B D                  Squirrel  ct--------------------------------gcgc----c---g-------ctgtg-----------
       Lesser Egyptian jerboa  ---------------------------------------------------------tg-----------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  ct--------------------------------gcgc----c---g-------cttcg-----------
B D                Guinea pig  ct--------------------------------gcgccgctc---g-------ctgcg-----------
                   Chinchilla  --------------------------------------------------------gcg-----------
             Brush-tailed rat  cc--------------------------------gcgc----c---g-------ccgcg-----------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
B D                       Pig  gg--------------------------------gcgc----c---g-------ctgcg-----------
B D                    Alpaca  cg--------------------------------gcgc----c---g-------ctgcg-----------
               Bactrian camel  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D                   Dolphin  cg--------------------------------gcgc----c---g-------ctgcg-----------
                 Killer whale  cg--------------------------------gcgc----c---g-------ctgcg-----------
             Tibetan antelope  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D                       Cow  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D                     Sheep  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D                     Horse  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D          White rhinoceros  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D                       Cat  cg--------------------------------ccgc----c---t-------ctgtg-----------
B D                       Dog  cg--------------------------------gcgc----c---g-------ctgcg-----------
B D                   Ferret   ct--------------------------------gcgc----c---g-------ctgcg-----------
B D                     Panda  cg--------------------------------gcgc----c---g-------ctgcg-----------
               Pacific walrus  cg--------------------------------gtgc----t---g-------ctgcg-----------
                 Weddell seal  cg--------------------------------gtgc----c---g-------ctgcg-----------
             Black flying-fox  cg--------------------------------gcga----c---g-------ctgcg-----------
B D                   Megabat  cg--------------------------------gcga----c---g-------ctgcg-----------
                Big brown bat  cg--------------------------------gcga----c---g-------ctccc-----------
         David's myotis (bat)  cg--------------------------------ccga----c---g-------ctccc-----------
B D                  Microbat  cg--------------------------------gcga----c---g-------ctccc-----------
B D                  Hedgehog  cgctgctgcaggcggaggggaccgggacgcgacctcgc----g---c-------ctgcctggtacaggcg
              Star-nosed mole  cg--------------------------------tctc----g---g-------ctgcc-----------
B D                  Elephant  tg--------------------------------gggc----t-------------gcg-----------
          Cape elephant shrew  cg--------------------------------atgc----c-------------ccg-----------
B D                   Manatee  cg--------------------------------gcgc----c---t-------ctgcg-----------
             Cape golden mole  ca--------------------------------tcgc----c---a-------ctaca-----------
B D                    Tenrec  cg--------------------------------gcgc-------------------cc-----------
                     Aardvark  tc--------------------------------gcac----c---g-------cgacg-----------
B D                 Armadillo  ca--------------------------------gcgc----cgccg-------ctgca-----------
B D                   Opossum  cg--------------------------------tcgt----c---g-------cag-g-----------
  D    White-throated sparrow  ------------------------------------------------------cgggg-----------
           Tibetan ground jay  ------------------------------------------------------cgggg-----------
B D                Budgerigar  --------------------------------------------------------gtg-----------
B D                   Chicken  ----------------------------------------------gggcggttgaggg-----------
B D        American alligator  ---------------------------------------------------------gg-----------
  D            Painted turtle  ---------------------------------------------------------gg-----------
  D  Chinese softshell turtle  ---------------------------------------------------------gt-----------
B D                    Lizard  -----------------------------------------------------tagggt-----------
B D                     Shrew  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                   Lamprey  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                    Turkey  ======================================================================
B D                   Wallaby  ======================================================================
                Prairie vole  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  ---------------ccac--ggaa------g--agg-----ggacg----cag
                        Chimp  ---------------ccac--ggaa------g--agg-----ggacg----cag
                      Gorilla  ---------------ccac--ggaa------g--agg-----ggacg----cag
                    Orangutan  ---------------ccac--ggga------g--agg-----ggacg----cag
                       Gibbon  ---------------ccac--ggga------g--agg-----ggacg----cag
                       Rhesus  ---------------tcac--ggga------g--agg-----ggacg----cag
          Crab-eating macaque  ---------------tcac--ggga------g--agg-----ggacg----cag
                       Baboon  ---------------tcac--ggga------g--agg-----ggacg----cag
                 Green monkey  ---------------tcac--ggga------g--agg-----ggacg----cag
                     Marmoset  ---------------caac--ggga------g--agg-----ggtcg----cag
                     Bushbaby  ---------------ggtc--gggg------g--aag-----ggacg----cag
                     Squirrel  ---------------agac--tggg------g--tgg-----ggacgccttcca
       Lesser Egyptian jerboa  ---------------aggc---ggc------t--gcg-----ggccg----ggg
               Golden hamster  ----------------------------------cgg-----ggacg----tca
                        Mouse  -------------------------------t--cgg-----ggccg----tga
                          Rat  -------------------------------t--ggg-----ggtcg----taa
               Naked mole-rat  ---------------agac--gggg------a--agg-----gggcc----cag
                   Guinea pig  ---------------agac--gggg------a--agg-----ggacc----cag
                   Chinchilla  ---------------agac--gggg------a--agg-----ggacc----cag
             Brush-tailed rat  ---------------aaac---tgg------a--agg-----ggccc----cgg
                       Rabbit  -------------------------------g--cgg-----cgcca----ctg
                         Pika  -------------------------------g--tgg-----gcgcc----ctg
                          Pig  ---------------agac--gggg------a--aag-----gg-ga----cag
                       Alpaca  ---------------agac--gggg------g--agg-----ggatg----cag
               Bactrian camel  ---------------agac--gggg------g--agg-----ggacg----cag
                      Dolphin  ---------------agac--gggg------g--agg-----ggagg----cag
                 Killer whale  ---------------agac--gggg------g--agg-----ggagg----cag
             Tibetan antelope  ---------------agac--ggga------g--agg-----ggacg----cag
                          Cow  ---------------agac--ggga------g--aga-----ggact----cag
                        Sheep  ---------------agac--ggga------g--agg-----ggagg----cag
                        Horse  ---------------agac--gggg------g--agg-----ggacg----cag
             White rhinoceros  ---------------agac--gggg------g--agg-----ggacg----cag
                          Cat  ---------------aggc--gggg------g--agg-----ggacg----cag
                          Dog  ---------------agac--gggg------g--agg-----ggacg----cag
                      Ferret   ---------------agac--cggg------g--agg-----ggacg----cag
                        Panda  ---------------agac--gggg------g--aag-----ggacg----ccg
               Pacific walrus  ---------------agac--gggg------g--agg-----ggacg----cag
                 Weddell seal  ---------------agac---ggg------g--agg-----ggacg----cag
             Black flying-fox  ---------------agac--gggg------g--agg-----ggacg----cag
                      Megabat  ---------------agac--gggg------g--agg-----ggacg----cag
                Big brown bat  ---------------cgac--gggg------g--agg-----ggacc----cgg
         David's myotis (bat)  ---------------aggc--gggg------g--agg-----ggacc----cag
                     Microbat  ---------------aggc--gggg------g--agg-----ggacc----cag
                     Hedgehog  agcattgttgggggtggat--ggag------g--ggg-----gaatg----cag
              Star-nosed mole  ---------------aaac--gggg------g--agc-----gaact----cag
                     Elephant  ---------------ggac--cggg------g---cg-----ggacg----cac
          Cape elephant shrew  ---------------gagc--agac------accccc-----ggggg----ctc
                      Manatee  ---------------ggag--cggg------g---cg-----ggacg----cac
             Cape golden mole  ---------------agac--tggg------g--agg-----ggacg----cac
                       Tenrec  ---------------acac--tggg------g--cgg-----ggacg----cgc
                     Aardvark  ---------------agactttgtg------a---gg-----ggacg----cac
                    Armadillo  ---------------agat--ggga------a---aa-----ggaca----tag
                      Opossum  ---------------gggt--gggg------g--agg-----gggca----ccg
       White-throated sparrow  ---------------cagc--ggcc------g--ggc-----gggcc----gtg
           Tibetan ground jay  ---------------cagc--ggcc------g--ggc-----gggcc----gtg
                   Budgerigar  ---------------ccgg--ggca------g--tgc-----ggatg----ggg
                      Chicken  ---------------cggc--ggga------g--agcctggaggggc----gcg
           American alligator  ---------------gggg--gcac------g--cgc-----gggcc----cgg
               Painted turtle  ---------------cagg--ggga------g--gag-----gga-g----ctg
     Chinese softshell turtle  ---------------cagg--ggga------g--gcg-----ggagg----cag
                       Lizard  ---------------gggc--gggacatctgg--aga-----ggggc----ggg
                        Shrew  ======================================================
                  Stickleback  ======================================================
                  Spotted gar  ======================================================
                   Coelacanth  ======================================================
                      Lamprey  ======================================================
           Southern platyfish  ======================================================
     Mexican tetra (cavefish)  ======================================================
              Tasmanian devil  ======================================================
                  Rock pigeon  ======================================================
                Scarlet macaw  ======================================================
                       Parrot  ======================================================
                  Zebra finch  ======================================================
          Collared flycatcher  ======================================================
              Green seaturtle  ======================================================
                 Mallard duck  ======================================================
                       Turkey  ======================================================
                      Wallaby  ======================================================
                 Prairie vole  ======================================================
                Domestic goat  ------------------------------------------------------
              Chinese hamster  ======================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  ------------------------------------------------------

Inserts between block 19 and 20 in window
  D   White-throated sparrow 8bp
          Tibetan ground jay 14bp
B D               Budgerigar 7bp
B D                  Chicken 3bp
B D                   Lizard 1bp

Alignment block 20 of 714 in window, 180602468 - 180602468, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D                  Bushbaby  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  g
B D                Guinea pig  c
                   Chinchilla  t
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  t
              Star-nosed mole  a
             Cape golden mole  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
  D    White-throated sparrow  c
B D                Budgerigar  c
B D                   Chicken  c
B D        American alligator  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
B D                    Lizard  c
B D                     Shrew  =
B D               Stickleback  =
                 Spotted gar  =
B D                Coelacanth  =
B D                   Lamprey  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D               Zebra finch  =
  D       Collared flycatcher  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                    Turkey  =
          Tibetan ground jay  =
B D                   Wallaby  =
                Prairie vole  =
B D                    Tenrec  -
               Domestic goat  -
         Cape elephant shrew  -
B D           Chinese hamster  =
B D                   Manatee  -
B D                  Elephant  -
          Chinese tree shrew  N
B D           Squirrel monkey  -

Inserts between block 20 and 21 in window
  D   White-throated sparrow 18bp

Alignment block 21 of 714 in window, 180602469 - 180602472, 4 bps 
B D                     Human  ------tc-tg
B D                     Chimp  ------tc-tg
B D                   Gorilla  ------tc-tg
B D                 Orangutan  ------tc-tg
B D                    Gibbon  ------tc-tg
B D                    Rhesus  ------tc-tg
B D       Crab-eating macaque  ------tc-tg
B D                    Baboon  ------tc-tg
B D              Green monkey  ------tc-tg
B D                  Marmoset  ------tc-tg
B D                  Bushbaby  ------tc-gg
B D                  Squirrel  ------tc-gg
       Lesser Egyptian jerboa  ------cc-gg
               Golden hamster  ------ct-gg
B D                     Mouse  ------cc-gg
B D                       Rat  ------cc-gg
B D            Naked mole-rat  ------ca-gg
B D                Guinea pig  -------c-cg
                   Chinchilla  ------gc-gg
             Brush-tailed rat  -------c-gg
B D                    Rabbit  -------c-g-
B D                      Pika  -------t-gc
B D                       Pig  ------tc-gg
B D                    Alpaca  ------tc-tt
               Bactrian camel  ------tc-tt
B D                   Dolphin  ------tg-cg
                 Killer whale  ------tg-cg
             Tibetan antelope  ------tc-cg
B D                       Cow  ------tc-cg
B D                     Sheep  ------tc-cg
B D                     Horse  ------tc-gg
B D          White rhinoceros  ------tc-gg
B D                       Cat  ------tc-ag
B D                       Dog  ------ttggg
B D                   Ferret   ------tc-gg
B D                     Panda  ------t--gg
               Pacific walrus  ------tc-gg
                 Weddell seal  ------tc-gg
             Black flying-fox  ------tc-tg
B D                   Megabat  ------tc-tg
                Big brown bat  ------tc-gg
         David's myotis (bat)  ------cc-gg
B D                  Microbat  ------cc-gg
B D                  Hedgehog  ------tg-ta
              Star-nosed mole  ------tc-tg
             Cape golden mole  ------tc-ag
                     Aardvark  ------tc-gg
B D                 Armadillo  ------tg-gg
B D                   Opossum  ------ta-cc
B D                Budgerigar  ----tg-----
B D                   Chicken  -----g-----
B D        American alligator  --ctcg-----
  D            Painted turtle  ----tg-----
  D  Chinese softshell turtle  ----tg-----
B D                    Lizard  ttttta-----
B D                     Shrew  ===========
B D               Stickleback  ===========
                 Spotted gar  ===========
B D                Coelacanth  ===========
B D                   Lamprey  ===========
          Southern platyfish  ===========
    Mexican tetra (cavefish)  ===========
B D           Tasmanian devil  ===========
  D               Rock pigeon  ===========
  D    White-throated sparrow  ===========
  D             Scarlet macaw  ===========
  D                    Parrot  ===========
B D               Zebra finch  ===========
  D       Collared flycatcher  ===========
  D           Green seaturtle  ===========
  D              Mallard duck  ===========
B D                    Turkey  ===========
          Tibetan ground jay  ===========
B D                   Wallaby  ===========
                Prairie vole  ===========
B D                    Tenrec  -----------
               Domestic goat  -----------
         Cape elephant shrew  -----------
B D           Chinese hamster  ===========
B D                   Manatee  -----------
B D                  Elephant  -----------
          Chinese tree shrew  NNNNNNNNNNN
B D           Squirrel monkey  -----------

Inserts between block 21 and 22 in window
B D               Budgerigar 43bp
B D                  Chicken 3bp
B D       American alligator 3bp
  D           Painted turtle 3bp
  D Chinese softshell turtle 3bp
B D                   Lizard 4bp

Alignment block 22 of 714 in window, 180602473 - 180602484, 12 bps 
B D                     Human  gcagccacta---cc----------
B D                     Chimp  gcagccacta---cc----------
B D                   Gorilla  gcagccagta---cc----------
B D                 Orangutan  gcagccacta---cc----------
B D                    Gibbon  gcagccacta---cc----------
B D                    Rhesus  gaagccacta---cc----------
B D       Crab-eating macaque  gaagccacta---cc----------
B D                    Baboon  gcagccacta---cc----------
B D              Green monkey  gaagccacta---cc----------
B D                  Marmoset  gctgccactc---ct----------
B D                  Bushbaby  gct-ccact----cc----------
B D                  Squirrel  gc--tct--gctccc----------
       Lesser Egyptian jerboa  gg--tgg--g---ga----------
               Golden hamster  gc--cgg--g---cc----------
B D                     Mouse  gc--cgg------------------
B D                       Rat  gc--ctg--g---cc----------
B D            Naked mole-rat  gc--cctcag---c-----------
B D                Guinea pig  gg--cctcag---cc----------
                   Chinchilla  gc--ccgcag---cc----------
             Brush-tailed rat  gc--ccgcag---cc----------
B D                    Rabbit  ---------c---tc----------
B D                      Pika  gt--gtgctc---gc----------
B D                       Pig  ggttccactg---cc----------
B D                    Alpaca  ggctccacta---cc----------
               Bactrian camel  ggctccacta---cc----------
B D                   Dolphin  ggctccacta---cc----------
                 Killer whale  ggctccacta---cc----------
             Tibetan antelope  ggcttcatta---cc----------
B D                       Cow  ggcttcatga---cc----------
B D                     Sheep  ggcttcatta---cc----------
B D                     Horse  ggcctcgtta---cc----------
B D          White rhinoceros  ggctccactg---cc----------
B D                       Cat  ggccccacta---cc----------
B D                       Dog  ggccccgctg---gc----------
B D                   Ferret   ggccccagtg---ct----------
B D                     Panda  ggccccacta---cc----------
               Pacific walrus  ggccccatta---ct----------
                 Weddell seal  ggccccatta---cc----------
             Black flying-fox  ggccccgcta---cc----------
B D                   Megabat  ggccccgct----cc----------
                Big brown bat  ggctccgctg---cc----------
         David's myotis (bat)  ggctccgcgg---cc----------
B D                  Microbat  ggctccgcgg---cc----------
B D                  Hedgehog  gacgccacaa---ct----------
              Star-nosed mole  cactctgcta---cc----------
B D                  Elephant  -----ctcgg---ct----------
          Cape elephant shrew  -----ctccg---ct----------
B D                   Manatee  -----ctcgg---ct----------
             Cape golden mole  ggctcctgtg---cc----------
                     Aardvark  ggccccgtcg---tc----------
B D                 Armadillo  ggctccccta---cg----------
B D                   Opossum  ctctgcaccc---cc----------
B D                   Chicken  -------------tcagctcgttct
B D        American alligator  -------------gcggctccacat
  D            Painted turtle  -------------ccg-------cc
  D  Chinese softshell turtle  -------------cctccccctccc
B D                    Lizard  ----------------ggcggggct
B D                     Shrew  =========================
B D               Stickleback  =========================
                 Spotted gar  =========================
B D                Coelacanth  =========================
B D                   Lamprey  =========================
          Southern platyfish  =========================
    Mexican tetra (cavefish)  =========================
B D           Tasmanian devil  =========================
  D               Rock pigeon  =========================
  D    White-throated sparrow  =========================
  D             Scarlet macaw  =========================
  D                    Parrot  =========================
B D               Zebra finch  =========================
  D       Collared flycatcher  =========================
  D           Green seaturtle  =========================
  D              Mallard duck  =========================
B D                Budgerigar  =========================
B D                    Turkey  =========================
          Tibetan ground jay  =========================
B D                   Wallaby  =========================
                Prairie vole  =========================
B D                    Tenrec  -------------------------
               Domestic goat  -------------------------
B D           Chinese hamster  =========================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  -------------------------

Inserts between block 22 and 23 in window
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                 Hedgehog 359bp

Alignment block 23 of 714 in window, 180602485 - 180602518, 34 bps 
B D                     Human  gcagcc-------ccggg----tttg-------cgtct-----ag-----aggaag-tg-gagc------
B D                     Chimp  gcagcc-------ccggg----tttg-------cgtct-----ag-----aggaag-tg-gagc------
B D                   Gorilla  gcagcc-------ccggg----tttg-------cgtct-----ag-----aggaag-tg-gagc------
B D                 Orangutan  gcagcc-------ccggg----ttta-------cgtct-----ag-----aggaag-tg-gagc------
B D                    Gibbon  gcagcc-------ccggg----tttg-------cgtct-----ag-----aggaag-tg-gagc------
B D                    Rhesus  gcagcc-------ccgag----tctg-------cgtct-----ag-----aggaag-tg-gagg------
B D       Crab-eating macaque  gcagcc-------ccgag----tctg-------cgtct-----ag-----aggaag-tg-gagg------
B D                    Baboon  gcagcc-------ccgag----tctg-------cgtct-----ag-----aggaag-tg-gagc------
B D              Green monkey  gcagcc-------ccgag----tctg-------cgtct-----ag-----aggaag-tg-gagc------
B D                  Marmoset  gccgcc-------caggg----actg-------cgtct-----cg-----agcaag-tg-gaac------
B D                  Bushbaby  acagcc-------tggcg----gccc-------cttcc-----ag--------aag-tg-aa--------
B D                  Squirrel  gcagcc-------ccggg-----ctg-------cacct-----aa-----aagaag-cg-gagc------
       Lesser Egyptian jerboa  gcggag-------cgggg-----aag----------ga-----ag-----ggga----------------
               Golden hamster  gtggcg-------ctggg-----ccg----------gc-----tg-----gaga----------------
B D                     Mouse  --ggcg-------cgggg-----cgg----------ac-----ag-----gaggga-cc-gagc------
B D                       Rat  gcggcg-------cgggg-----cgg----------ac-----tg-----aagagc-gg-gagc------
B D            Naked mole-rat  ------------------------tg-------cgcct-----ag-----aaacag-cc-gagc------
B D                Guinea pig  gctgtc-------caggg-----ttg-------cacct-----ag-----aagcag-cc-gagc------
                   Chinchilla  gccgcg-------caggg-----ctg-------cgcct-----ag-----ccgcag-gc-gagc------
             Brush-tailed rat  gccgcc-------ccgga-----ctg-------cgcct-----ggaagccccgcgc-gc-gagt------
B D                    Rabbit  gggagt-------cgggg-----agg--------ccgc-----tg-----gaggct-cc-agg-------
B D                      Pika  gcgggt-------acggg-----cggcgtgtcccccat-----cg-----cgggct-gc-gggc------
B D                       Pig  gcagtc-------gggcg----cctg-------agcct-----tc-----taggag-cg-gagc------
B D                    Alpaca  gcagcg-----------t----cctg-------agtcc-----tg-----aaggag-cc-gagc------
               Bactrian camel  gcagcg-----------t----cctg-------agtcc-----tg-----aaggag-cc-gagc------
B D                   Dolphin  gcagtc-------gggcg----gctg-------agtcc-----tg-----aaggag-ca-gagc------
                 Killer whale  gcagtt-------gggcg----gctg-------agtcc-----tg-----aaggag-ca-gagc------
             Tibetan antelope  gcagtc-------cggct----gct-----------------------------------gagc------
B D                       Cow  gcagtc-------cggct----gct-----------------------------------gagc------
B D                     Sheep  gcagtc-------cggct----cct-----------------------------------gagc------
                Domestic goat  -cagtc-------cggct----gct-----------------------------------gagc------
B D                     Horse  gcagcc-------gggcg----gctg-------agttc-----ag-----aagcag-cg-gggc------
B D          White rhinoceros  gcaccc-------gggcg----gctg-------cgtcc-----ag-----aaggag-cg-gggc------
B D                       Cat  gccgcc-------gggtg----gctg-------agtcc-----tg-----gaggag-ca-gagc------
B D                       Dog  gccgcc-------gggtg----gc-g-------agtgg-----ag-----aaggcg-ca-gggc------
B D                   Ferret   gcagcc-------gggtg----actg-------agtcg-----ag-----aacgag-ca-gagc------
B D                     Panda  gccgcc-------gggtg----gctg-------agtcg-----ag-----aacgag-ca-gagc------
               Pacific walrus  gccgcc-------gggtg----gctg-------attcg-----gg-----aaggag-ca-gagc------
                 Weddell seal  gccgcc-------gggtg----gctg-------aatcg-----gg-----aaggag-ca-gagc------
             Black flying-fox  gcagcc-------gggcg----ggtg-------agtcc-----ag-----cgtggc-cgtgagc------
B D                   Megabat  gcagcc-------gggcg----ggtg-------agtcc-----ag-----cgtggc-cgtgagc------
                Big brown bat  tcagcc-------gggcc----gagg-------agtcc-----ag-----aaggagccg-gagc------
         David's myotis (bat)  gcagcc-------gggcc----gccg-------agtcc-----ag-----aaggag-cg-gagc------
B D                  Microbat  gcagcc-------gggcc----gccg-------agtcc-----ag-----aaggag-cg-gagc------
              Star-nosed mole  gcggcg-------gggca----actg-------agcca-----gg-----aat----cg-gagc------
B D                  Elephant  ccagtgccgagccggc------gctg-------ctccc-----gg-----gggtcg-cg-agca------
          Cape elephant shrew  acagcg-------ggc-g----gctg-------cttcc-----gg-----gag-ag-cg-ggct------
B D                   Manatee  gcgctg-------ggc-gtcgcgccg-------cctgc-----gt-----tgtgag-cg-ggtc------
             Cape golden mole  gcagcg-------tggcg----gctg-------cttcc-----gg-----gaggag-ca-gagc------
B D                    Tenrec  ----cg-------tga-g----gctg-------ctccc-----cg-----ggacgg-cg-gcgc------
                     Aardvark  gcagcc-------tggca----gccg-------tttct-----gg-----gaggag-cg-gagc------
B D                 Armadillo  gcagcc-------ggg------agtg-------cttcc-----gg-----gaggag-ag-gaac------
B D                   Opossum  -------------------------------------------aa-----agggag-ag-gtat------
B D                   Chicken  ---------------------------------cctcc-----ct-----cagggc-cg-ag--------
B D        American alligator  ---------------------------------ggccc-----cg-----ccgggc-ct-ggccgccgcc
  D            Painted turtle  ---------------------------------ccaca-----cc-----ccagct-cg-ggtcg-----
  D  Chinese softshell turtle  ---------------------------------cctcacgcatct-----cccgct-ca-ggccgcctc-
B D                    Lizard  ---------------------------------tcttg-----cg-----ccaagg-ga-aatctttctc
B D                     Shrew  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
B D                   Lamprey  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  -----------------
                        Chimp  -----------------
                      Gorilla  -----------------
                    Orangutan  -----------------
                       Gibbon  -----------------
                       Rhesus  -----------------
          Crab-eating macaque  -----------------
                       Baboon  -----------------
                 Green monkey  -----------------
                     Marmoset  -----------------
                     Bushbaby  -----------------
                     Squirrel  -----------------
       Lesser Egyptian jerboa  -----------------
               Golden hamster  -----------------
                        Mouse  -----------------
                          Rat  -----------------
               Naked mole-rat  -----------------
                   Guinea pig  -----------------
                   Chinchilla  -----------------
             Brush-tailed rat  -----------------
                       Rabbit  -----------------
                         Pika  -----------------
                          Pig  -----------------
                       Alpaca  -----------------
               Bactrian camel  -----------------
                      Dolphin  -----------------
                 Killer whale  -----------------
             Tibetan antelope  -----------------
                          Cow  -----------------
                        Sheep  -----------------
                Domestic goat  -----------------
                        Horse  -----------------
             White rhinoceros  -----------------
                          Cat  -----------------
                          Dog  -----------------
                      Ferret   -----------------
                        Panda  -----------------
               Pacific walrus  -----------------
                 Weddell seal  -----------------
             Black flying-fox  -----------------
                      Megabat  -----------------
                Big brown bat  -----------------
         David's myotis (bat)  -----------------
                     Microbat  -----------------
              Star-nosed mole  -----------------
                     Elephant  -----------------
          Cape elephant shrew  -----------------
                      Manatee  -----------------
             Cape golden mole  -----------------
                       Tenrec  -----------------
                     Aardvark  -----------------
                    Armadillo  -----------------
                      Opossum  -----------------
                      Chicken  ----gaagatgcggagc
           American alligator  tcctggggatttggagc
               Painted turtle  ---------------gc
     Chinese softshell turtle  ---------tggggagg
                       Lizard  tttagtgtggtcgaagg
                        Shrew  =================
                  Stickleback  =================
                  Spotted gar  =================
                     Hedgehog  =================
                   Coelacanth  =================
                      Lamprey  =================
           Southern platyfish  =================
     Mexican tetra (cavefish)  =================
              Tasmanian devil  =================
                  Rock pigeon  =================
       White-throated sparrow  =================
                Scarlet macaw  =================
                       Parrot  =================
                  Zebra finch  =================
          Collared flycatcher  =================
              Green seaturtle  =================
                 Mallard duck  =================
                   Budgerigar  =================
                       Turkey  =================
           Tibetan ground jay  =================
                      Wallaby  =================
                 Prairie vole  =================
              Chinese hamster  =================
           Chinese tree shrew  NNNNNNNNNNNNNNNNN
              Squirrel monkey  -----------------

Inserts between block 23 and 24 in window
B D                  Opossum 11bp
B D                  Chicken 1bp
B D       American alligator 9bp
B D                   Lizard 4bp

Alignment block 24 of 714 in window, 180602519 - 180602536, 18 bps 
B D                     Human  cgcggccgtgag-------cacagg
B D                     Chimp  cgcggccatgag-------cacagg
B D                   Gorilla  cgcggccgtgag-------cacagg
B D                 Orangutan  cgcggccgtgag-------cacagg
B D                    Gibbon  cg------tgag-------cacagg
B D                    Rhesus  cgcggccatgag-------cacagg
B D       Crab-eating macaque  cgcggccatgag-------cacagg
B D                    Baboon  cgcggccgtgag-------cacagg
B D              Green monkey  cgcggccgggag-------cacagg
B D                  Marmoset  cgcggccgtgag-------caccgg
           Chinese tree shrew  cgcggctgggcg-------ccc---
B D                  Squirrel  cgtggc--------------acgtg
B D                     Mouse  cccggg--------------gtgtg
B D                       Rat  cctggg--------------gtgtg
B D            Naked mole-rat  tgggcc--------------acgtg
B D                Guinea pig  cgggcc--------------acgtg
                   Chinchilla  cgggcc--------------gcgag
B D                    Rabbit  --------------------accgc
B D                      Pika  agagtgtccccc-------cacggg
B D                       Pig  ggt-gttgtgag-------cgcgtg
B D                    Alpaca  ggtggccgtgag-------cacgtg
               Bactrian camel  ggtggccatgag-------cacgtt
B D                   Dolphin  cgaggccgtgag-------cccgtg
                 Killer whale  cgaggccgtgag-------cccgtg
             Tibetan antelope  cgaggctgtgag-------cacgtg
B D                       Cow  cgaggctgtgtg-------cacatg
B D                     Sheep  cgaggctgtgag-------cacgtg
                Domestic goat  cgaggctgtgag-------cacgtg
B D                     Horse  cgcggccgtgag-------cacgtg
B D          White rhinoceros  cgtggccgtgag-------cacgtg
B D                       Cat  agcggccgcgaa-------cacgtg
B D                       Dog  cgcggccgcgag-------------
B D                   Ferret   cgcggccgcgag-------cacgtg
B D                     Panda  cgcggccccgag-------cacgtg
               Pacific walrus  cgcggccgcgag-------cacgtg
                 Weddell seal  cgcggcagcgag-------cacgtg
             Black flying-fox  --------------------acgtg
B D                   Megabat  --------------------acgtg
                Big brown bat  ---------------------cttg
         David's myotis (bat)  ---------------------cgtg
B D                  Microbat  ---------------------cgtg
              Star-nosed mole  ctagg-agtgag-------cgcgtg
B D                  Elephant  --------cgag------------a
          Cape elephant shrew  --------cggg------------a
B D                   Manatee  ----------gg------------g
             Cape golden mole  --------cgag---------gttg
B D                    Tenrec  --------cgag---------ggcg
                     Aardvark  --------tggg---------gttg
B D                 Armadillo  --------gtggccatgtgcaccta
B D                   Opossum  cctggacatccg-------cactgg
B D        American alligator  cgcggtttggag---------cttc
  D            Painted turtle  ccccgcccgggg---------tttg
  D  Chinese softshell turtle  ccccacctgggg-------gactgg
B D                    Lizard  catggccgggat-------cacagg
B D                     Shrew  =========================
B D               Stickleback  =========================
                 Spotted gar  =========================
B D                  Hedgehog  =========================
B D                Coelacanth  =========================
B D                   Lamprey  =========================
          Southern platyfish  =========================
    Mexican tetra (cavefish)  =========================
B D           Tasmanian devil  =========================
  D               Rock pigeon  =========================
  D    White-throated sparrow  =========================
  D             Scarlet macaw  =========================
  D                    Parrot  =========================
B D               Zebra finch  =========================
  D       Collared flycatcher  =========================
  D           Green seaturtle  =========================
  D              Mallard duck  =========================
B D                Budgerigar  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
          Tibetan ground jay  =========================
B D                   Wallaby  =========================
                Prairie vole  =========================
              Golden hamster  -------------------------
B D           Chinese hamster  =========================
      Lesser Egyptian jerboa  -------------------------
            Brush-tailed rat  -------------------------
B D                  Bushbaby  -------------------------
B D           Squirrel monkey  -------------------------

Inserts between block 24 and 25 in window
B D                  Opossum 3092bp

Alignment block 25 of 714 in window, 180602537 - 180602577, 41 bps 
B D                     Human  acg-----------------a-tcgcg------cgctgg--t------gtcttggg--------------
B D                     Chimp  agg-----------------a-tcgcg------cgctgg--t------gtcttggg--------------
B D                   Gorilla  acg-----------------a-tcgcg------cgctgg--t------gtcttggg--------------
B D                 Orangutan  agg-----------------a-tcgcg------tgctgg--t------gtcttggg--------------
B D                    Gibbon  agg-----------------a-tcgcg------cgctgg--t------gtcttggg--------------
B D                    Rhesus  agg-----------------a-tcgcg------cgctgg--t------gccttggg--------------
B D       Crab-eating macaque  agg-----------------a-tcgcg------cgctgg--t------gccttggg--------------
B D                    Baboon  agg-----------------a-tcgcg------cgctgg--t------gccttggg--------------
B D              Green monkey  agg-----------------a-tcgcg------cgctgg--t------gccttggg--------------
B D                  Marmoset  agg-----------------a-tcgc--------gctgg--t------gcctcggg--------------
B D                  Bushbaby  -------------------------cg------tgctgg--t------gccccggg--------------
           Chinese tree shrew  -------------------------cg------tgccgc--c------gcccgcgt--------------
B D                  Squirrel  ag------------------a-ctggc-----tagctgg--t------gcagagtg--------------
       Lesser Egyptian jerboa  -------------------------------------------------------c--------------
               Golden hamster  --------------------------------------g--c------accggctc--------------
B D                     Mouse  tg------------------a-c------------cagg--c------actggctc--------------
B D                       Rat  tg------------------a-c------------cagg--c------actggctc--------------
B D            Naked mole-rat  agg-----------------a-ctgcc-----tcgctgg--t------gctgaggg--------------
B D                Guinea pig  agg-----------------a-ctgcc-----tcgctgg--t------gcagaggg--------------
                   Chinchilla  agc-----------------a-ctgcc-----tcgctgg--t------gcggaggg--------------
             Brush-tailed rat  ----------------------ccgcc-----tcgctgg--c------gcaggggg--------------
B D                    Rabbit  ggc-----------------a-ccgcg-----cccacgg--g------gcggaagg--------------
B D                      Pika  ggc-----------------g-gcgtgt----cccccga--c------gcagggtc--------------
B D                       Pig  gtg-----------------a-ttgtg-----gcgctgg--t------tccgaggg--------------
B D                    Alpaca  agg-----------------a-ctgcg-----gcgctgg--t------tcggaggg--------------
               Bactrian camel  agg-----------------a-ctgcg-----gcgctgg--t------tcggaggg--------------
B D                   Dolphin  aga-----------------a-ctgcg-----gcgctag--t------tccgaggg--------------
                 Killer whale  aga-----------------a-ctgcg-----gcgctag--t------tccgaggg--------------
             Tibetan antelope  agg-----------------a-ctgcg-----gcgcagg--t------tttgaggg--------------
B D                       Cow  agg-----------------a-ctacg-----gcgccgg--t------ttcgaggg--------------
B D                     Sheep  agg-----------------a-ctgcg-----gcgcagg--t------ttcgaggg--------------
                Domestic goat  agg-----------------a-ctgcg-----gcgcagg--t------ttcgaggg--------------
B D                     Horse  agg-----------------a-ctgcg-----gcgccgg--t------gcggaggg--------------
B D          White rhinoceros  agg-----------------a-ctgcg-----gcgctgg--t------gcggaggg--------------
B D                       Cat  agg-----------------a-ttgcc-----ccgcagg--t------gccgaggg--------------
B D                       Dog  ----------------------ccgcg-----g-------------------------------------
B D                   Ferret   agg-----------------atttgcg-----gagctgc--t------gcagaggg--------------
B D                     Panda  agg-----------------c-ttgcg-----gcgctgg--t------gcagaggg--------------
               Pacific walrus  agg-----------------a-ttgcg-----gcgctgg--t------g-ggaggg--------------
                 Weddell seal  agg-----------------a-ttgcg-----gcgctgg--t------g-ggaggg--------------
             Black flying-fox  agg-----------------a-ttgcg-----gcgctgg--t------acagaggg--------------
B D                   Megabat  agg-----------------a-ctgcg-----gcgctga--t------acagaggg--------------
                Big brown bat  gag-----------------a----tg-----gcgctgg--t------gcggaggg--------------
         David's myotis (bat)  gag-----------------a----ca-----gcgctgggtg------gcggaggg--------------
B D                  Microbat  gag-----------------a----ct-----gcgctgggtg------gcggaggg--------------
              Star-nosed mole  agg-----------------t-ctgct-----gcgctgc--t------gcagaggg--------------
B D                  Elephant  agt-----------------g-c-----------------------------------------------
          Cape elephant shrew  agg-----------------g-ccgcg--------c---------------ggccg--------------
B D                   Manatee  agt-----------------g-ccgcg--------ccgg---------gcggagtg--------------
             Cape golden mole  aga---cgtgaagag----tg-ccgcg--------cgcg--ttcgcgcgagatgtg--------------
B D                    Tenrec  agg-----------------g-ccccg---------------------gggacgcg--------------
                     Aardvark  agtgcgtgtcaagagtgcctg-ccgtg--------cggg--t------gttcactg--------------
B D                 Armadillo  aga-----------------g-ctgtg-----gcactgg--t------gctgaggg--------------
B D        American alligator  ---------------------------ccccgccctt----t------ccctgtgggccccg--------
  D            Painted turtle  ---------------------------ttctgtcggtga--c------cgccgggg--------------
  D  Chinese softshell turtle  ---------------------------gtcagtcgatgg--c------gtcagaggggcccgcagccctt
B D                    Lizard  ---------------------------gctgttggatgt--t------ttccggg---------------
B D                     Shrew  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
B D                   Lamprey  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  ---ctgggt---ggac----------gg-------gg--g---gc
                        Chimp  ---ctgggt---g-ac----------gg-------gg--g---ac
                      Gorilla  ---ctgggt---ggac----------gg-------gg--g---gc
                    Orangutan  ---ctgggt---ggac----------gg-------gg--g---gc
                       Gibbon  ---ctgggt---ggac----------tg-------gg--g---gc
                       Rhesus  ---ctgggt---ggag----------gg-------ag--g---gc
          Crab-eating macaque  ---ctgggt---ggag----------gg-------ag--g---gc
                       Baboon  ---ctgggt---ggag----------gg-------ag--g---gc
                 Green monkey  ---ctgggt---ggag----------gg-------ag--g---gc
                     Marmoset  ---ctgagt---ggactg--------tg-------gg--g---ac
                     Bushbaby  ---ctgagc---cgag----------ag-------cg--gtctgc
           Chinese tree shrew  ---ccagcc---gaag----------ag-------ggtcg---gc
                     Squirrel  ---ctgagt---gaaa----------ga-------ag--g---tt
       Lesser Egyptian jerboa  ---gaggcg---gca------------g-----ccgg--------
               Golden hamster  ---ctggca---gaga----------ga-----ccgg--g---gt
                        Mouse  ---cgggct---gaat----------gg-----ccgg--g---at
                          Rat  ---ctggct---gaat----------gg-----ccgg--g---tt
               Naked mole-rat  ---ctgagt---ggag----------ga-------gg--g---tc
                   Guinea pig  ---ccgagtggaggag----------ga-------gg--g---tc
                   Chinchilla  ---ctgggt---gcag----------ga-------gg--g---tc
             Brush-tailed rat  ---ctgagc---ggag----------gc-------gg--g---tc
                       Rabbit  ---ccgacg---g-------------ga-------ag--a---tg
                         Pika  ---cacacg---gcatgtccccccacgc-------gg--g---cg
                          Pig  ---cagtgt---ggag----------ga-------gg--g---tt
                       Alpaca  ---caggat---ggag----------ga-------gg--g---gt
               Bactrian camel  ---caggat---ggag----------ga-------gg--g---gt
                      Dolphin  ---caggat---ggag----------ga-------gg--g---tg
                 Killer whale  ---caggat---ggag----------ga-------gg--g---tg
             Tibetan antelope  ---cagggt---gcag----------ga-------gg--g---ta
                          Cow  ---cgggag---ggag----------ga-------gg--g---ta
                        Sheep  ---cagggt---gcag----------ga-------gg--g---ta
                Domestic goat  ---cagggt---gcag----------ga-------gg--g---ta
                        Horse  ---ctagaa---ggag----------ga-------gg--g---tc
             White rhinoceros  ---ctggat---ggag----------ga-------gg--g---tc
                          Cat  ---ctgaat---ggcg----------ga-------gg--g---tc
                          Dog  ---------------------------a-------gg--g---tc
                      Ferret   ---cgggtt---ggag----------aa-------gg--c---tc
                        Panda  ---ctggtt---ggtg----------ga-------gg--g---tt
               Pacific walrus  ---ctggta---ggag----------ga-------gg--g---tc
                 Weddell seal  ---ctggta---ggag----------ga-------gg--g---tc
             Black flying-fox  ---ctggat------g----------ga-------gg--g---tc
                      Megabat  ---ctggat------g----------ga-------gg--g---tc
                Big brown bat  ---ctggat---ggcg----------ga-------gg--g---tg
         David's myotis (bat)  ---tccgat---ggcg----------ga-------gg--g---cc
                     Microbat  ---tccgat---ggcg----------ga-------tg--g---cc
              Star-nosed mole  ---t-ggat---gcgg----------ga-------gg--g---tc
                     Elephant  --------g---ggcg----------ga-------gg--g---tc
          Cape elephant shrew  ---c---tg---ggcg----------gg-------ac--g---ca
                      Manatee  ---c---gg---ggcg----------ga-------gg--c---gc
             Cape golden mole  ---cagact---ggag----------ga-------gc--g---tc
                       Tenrec  ---c-----------------------------------------
                     Aardvark  ---cggcgt---ggag----------ga-------gc--g---tc
                    Armadillo  ---aggggt---ggag----------ga-------gg--a---tt
           American alligator  ---cgggaa---gggt----------gc-----------------
               Painted turtle  ---tcagag---ggac----------cc-----------------
     Chinese softshell turtle  cccccaaac---gggg----------gc-----------------
                       Lizard  ---ctgtac---ggcc----------atgttgc------------
                        Shrew  =============================================
                  Stickleback  =============================================
                  Spotted gar  =============================================
                     Hedgehog  =============================================
                   Coelacanth  =============================================
                      Lamprey  =============================================
           Southern platyfish  =============================================
     Mexican tetra (cavefish)  =============================================
              Tasmanian devil  =============================================
                  Rock pigeon  =============================================
       White-throated sparrow  =============================================
                Scarlet macaw  =============================================
                       Parrot  =============================================
                  Zebra finch  =============================================
          Collared flycatcher  =============================================
              Green seaturtle  =============================================
                 Mallard duck  =============================================
                   Budgerigar  =============================================
                       Turkey  =============================================
                      Chicken  =============================================
           Tibetan ground jay  =============================================
                      Wallaby  =============================================
                      Opossum  =============================================
                 Prairie vole  =============================================
              Chinese hamster  =============================================
              Squirrel monkey  ---------------------------------------------

Inserts between block 25 and 26 in window
B D                 Squirrel 1bp
              Golden hamster 14bp
B D                    Mouse 14bp
B D                      Rat 6bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                   Lizard 2063bp

Alignment block 26 of 714 in window, 180602578 - 180602578, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  a
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  t
B D                   Ferret   g
B D                     Panda  c
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
                     Aardvark  g
B D                 Armadillo  g
B D        American alligator  g
  D            Painted turtle  g
  D  Chinese softshell turtle  c
B D                     Shrew  =
B D               Stickleback  =
                 Spotted gar  =
B D                  Hedgehog  =
B D                Coelacanth  =
B D                   Lamprey  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                    Lizard  =
B D               Zebra finch  =
  D       Collared flycatcher  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D                   Wallaby  =
B D                   Opossum  =
                Prairie vole  =
B D                    Tenrec  -
B D           Chinese hamster  =
B D           Squirrel monkey  -

Inserts between block 26 and 27 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D       American alligator 1354bp
  D           Painted turtle 12bp
  D Chinese softshell turtle 17bp

Alignment block 27 of 714 in window, 180602579 - 180602593, 15 bps 
B D                     Human  ct------cc---tg----------------ggtt--g---------------------------tgca
B D                     Chimp  ct------cc---tg----------------ggtt--g---------------------------tgca
B D                   Gorilla  ct------cc---tg----------------ggtt--g---------------------------tgca
B D                 Orangutan  ct------cc---tg----------------ggtt--g---------------------------tgca
B D                    Gibbon  ct------cc---tg----------------gggt--g---------------------------tgca
B D                    Rhesus  ct------ct---tg----------------aggt--g---------------------------tgca
B D       Crab-eating macaque  ct------ct---tg----------------aggt--g---------------------------tgca
B D                    Baboon  ct------ct---tg----------------aggt--g---------------------------tgca
B D              Green monkey  ct------ct---tg----------------aggt--g---------------------------tgca
B D                  Marmoset  cc------cc---tg----------------gtgt--g---------------------------tgca
B D                  Bushbaby  ca------cc---ta-----gc---------gcgt--g---------------------------tgca
           Chinese tree shrew  cc------cc---tg----------------gtgtggg---------------------------tgca
B D                  Squirrel  cg------ca---cc----------------aggt--ttgtg-----------------------tgca
       Lesser Egyptian jerboa  cc------cg---tg----------------gggc--t---------------------------gtcg
               Golden hamster  ct------gg---cg----------------tagc--t---------------------------ttca
B D                     Mouse  cc------gc---ca----------------aagc--ttccctgctcccgtt-------------tcca
B D                       Rat  ct------tt---ca----------------gagc--ttccctgctcccatttctaagtagtacgtcca
B D            Naked mole-rat  cg------cc---cc---aggt---------gggt--g---------------------------tgca
B D                Guinea pig  cg------cc---cc-aggtgt---------gtgt--g---------------------------tgca
                   Chinchilla  cg------ct---ccggtgcgt---------gcgt--g---------------------------cgcg
             Brush-tailed rat  ag------ac---cc----------------gtga--g---------------------------cgcg
B D                    Rabbit  cg------cc---cc----------------tggt--g---------------------------cggg
B D                      Pika  cggagtgtgc---cc----------------cagt--g---------------------------tggg
B D                       Pig  ca------ct---cc---tggt---------gtga--g---------------------------ggca
B D                    Alpaca  cc------ct---cc---tggt---------gtga--g---------------------------ggca
               Bactrian camel  cc------ct---cc---tggt---------gtga--g---------------------------ggca
B D                   Dolphin  ca------ct---cc---tggt---------gtga--g---------------------------ggca
                 Killer whale  ca------ct---cc---tggt---------gtga--g---------------------------ggca
             Tibetan antelope  tt------ct---cc---cta----------atgt--g---------------------------ggca
B D                       Cow  tt------ct---cc---ctg----------atgt--g---------------------------ggca
B D                     Sheep  tt------ct---cc---cta----------atgt--g---------------------------ggca
                Domestic goat  tt------ct---cc---cta----------atgt--g---------------------------ggca
B D                     Horse  ct------ct---cc---gggt---------gtga------------------------------ggca
B D          White rhinoceros  ct------ct---c-----ggt---------gtga--g---------------------------ggca
B D                       Cat  cg------ct---gc---gggt---------gtga--g---------------------------ggaa
B D                       Dog  cg------cc---c-----ggt---------gcga--g---------------------------ggca
B D                   Ferret   ct------ct---ct---ggga---------gtga--g---------------------------ggaa
B D                     Panda  cg------ct---ct---gggt---------gtga--g---------------------------ggga
               Pacific walrus  cg------ct---cc---gggt---------gtga--g---------------------------cgaa
                 Weddell seal  cg------ct---cc---gggt---------gtga--g---------------------------cgaa
             Black flying-fox  cg------ct---cc---tg-----------ttga--g---------------------------ggca
B D                   Megabat  cg------ct---cc---tg-----------ttga--g---------------------------ggca
                Big brown bat  ag-----------------------------tcga--g---------------------------ggtc
         David's myotis (bat)  cg------cg---tc---tggtgtc-----ctcga--g---------------------------ggtc
B D                  Microbat  cg------cg---tc---tggagtc-----ctcga--g---------------------------ggtc
              Star-nosed mole  cg------tt---cc---cggt---------gtcg--g---------------------------ggcg
B D                  Elephant  cg------c----tc---gg-g---------gctg--t---------------------------ggaa
          Cape elephant shrew  gg------cg---tc---cg-t---------gcgg--a---------------------------cgac
B D                   Manatee  cg------cgcaccc---gg-t---------gtgg-------------------------------gaa
             Cape golden mole  cg------ca---cc---tg-----------gtgt--g---------------------------ggaa
B D                    Tenrec  cg------cg---cc---gg-c---------gggc--g---------------------------tgta
                     Aardvark  tg------tac--ct---ag-t---------atgt--g---------------------------ggaa
B D                 Armadillo  ct------ca---tt---ggat---------gtgt--g---------------------------ggaa
  D            Painted turtle  ------------------------ccgccacaact--g---------------------------ggca
  D  Chinese softshell turtle  ------------------------ctgctgcagct--g---------------------------ctca
B D                     Shrew  =====================================================================
B D               Stickleback  =====================================================================
                 Spotted gar  =====================================================================
B D                  Hedgehog  =====================================================================
B D                Coelacanth  =====================================================================
B D                   Lamprey  =====================================================================
          Southern platyfish  =====================================================================
    Mexican tetra (cavefish)  =====================================================================
B D           Tasmanian devil  =====================================================================
  D               Rock pigeon  =====================================================================
  D    White-throated sparrow  =====================================================================
  D             Scarlet macaw  =====================================================================
  D                    Parrot  =====================================================================
B D                    Lizard  =====================================================================
B D               Zebra finch  =====================================================================
  D       Collared flycatcher  =====================================================================
  D           Green seaturtle  =====================================================================
  D              Mallard duck  =====================================================================
B D                Budgerigar  =====================================================================
B D                    Turkey  =====================================================================
B D                   Chicken  =====================================================================
          Tibetan ground jay  =====================================================================
B D                   Wallaby  =====================================================================
B D        American alligator  =====================================================================
B D                   Opossum  =====================================================================
                Prairie vole  =====================================================================
B D           Chinese hamster  =====================================================================
B D           Squirrel monkey  ---------------------------------------------------------------------

Inserts between block 27 and 28 in window
  D           Painted turtle 23bp
  D Chinese softshell turtle 1840bp

Alignment block 28 of 714 in window, 180602594 - 180602643, 50 bps 
B D                     Human  at--gcgggatgcggg-ct----gaac---tt--ttt--ctc-tg------------gc-actgc-ttg-
B D                     Chimp  at--gcgggatgcggg-ct----gaac---tt--ttt--ctc-tg------------gc-gctgc-ttg-
B D                   Gorilla  at--gcgggatgcggg-ct----gaac---tt--ttt--ctc-tg------------gc-gctgc-ttg-
B D                 Orangutan  at--gcgggatgcggg-ct----gaac---tt--ttt--ctc-tg------------gc-gctgc-ttg-
B D                    Gibbon  gt--gcgggatgcggg-ct----gaac---tt--ttt--gtc-tg------------gc-gctgc-ttg-
B D                    Rhesus  at--gcggtttgcggg-gt----gaac---tt--ttt--cta-tg------------gc-actgt-ttg-
B D       Crab-eating macaque  at--gcggtttgcggg-gt----gaac---tt--ttt--cta-tg------------gc-actgc-ttg-
B D                    Baboon  at--gcggtttgcggg-gt----gaac---tt--ttt--cta-tg------------gc-actgc-ttg-
B D              Green monkey  at--gcggtttgcggg-ct----gaac---tt--ttt--cta-tg------------gc-gctgc-ttg-
B D                  Marmoset  at--gccgggtgcgcg-ct----gaac---tt--ttt--ct-----------------------------
B D                  Bushbaby  at--gcgggatgcggg-tt----caac---tt--ttt--ctc-tg------------gt-gctgc-tta-
           Chinese tree shrew  gt--gcgggatgcggg-ca----aaac---tt--ttt--ctg-tg------------ac-actgc-ctg-
B D                  Squirrel  ag--gagg-----att-tc----gagc---tgaactt--tct-gg------------ta-ctgct-aga-
       Lesser Egyptian jerboa  g---------------------------------------------------------------------
               Golden hamster  aa-----------gct-tc------cc---cg--ccc--cca-tt------------tc-caagt-ggc-
B D                     Mouse  ga--gagaac-gggct-ta----aaac---tt--ctt--ccg-ga------------ac-tcagt-ggg-
B D                       Rat  ga--gagaat-gggct-tc----aaac---tt--ctt--ccg-ga------------ac-tcagt-ggg-
B D            Naked mole-rat  ct--gcggattgcgggcta----aagt---cg--ttg--gca-ct------------gc-tcagc-cag-
B D                Guinea pig  ac--gcagactgggc--ta----aact---cg--ctg--gca-ct------------gc-tcaac-cag-
                   Chinchilla  tc--gctggctgaact-tc----aacc--tcg--ctg--gcg-ct------------gc-tccgc-ccg-
             Brush-tailed rat  ac--gcggacggcgag-cg----aacc---cg--ccg--gcg-at------------ga-tcggc-cgg-
B D                    Rabbit  tc--tccg----------c----gggc---tg--ccc--tct-ga------------ac-tttgt-----
B D                      Pika  gt--ccag---------cc----agag---tg--tcc--ccc-gacgcagggtccacac-gccgt-----
B D                       Pig  a-------gatgggga-ct----gaac---tt--tttaaatc-tg------------gt-actgc-cta-
B D                    Alpaca  gt--gcgggatgcggg-ct----gaat---tt--tttaaatc-tg------------gt-agtg--cgta
               Bactrian camel  at--gcgggatgcggg-ct----gaat---tt--tttaaatc-tg------------gt-agtg--cgt-
B D                   Dolphin  at--gcaggatgcggg-ct----gaac---tt--tttaaatc-tg------------gt-actgcacta-
                 Killer whale  at--gcaggatgcggg-ct----gaac---tt--tttaaatc-tg------------gt-actgcacta-
             Tibetan antelope  gt--gcgggatgtggg-tt----gaac----t--tttaaatc-ta------------gt-actg--cca-
B D                       Cow  at--gcgggatgtggg-tt----gaac----t--tttaaatc-ta------------gt-actg--cca-
B D                     Sheep  at--gcgggatgtggg-tt----gaac----t--tttaaatc-ta------------gt-actg--cca-
                Domestic goat  ac--gcgggatgtggg-tt----gaac----t--tttaaatc-ta------------gt-actg--cca-
B D                     Horse  gt--gcgggatgcggg-ct----gaac---aa--ctt--ctc-tg------------gt-actgc-cta-
B D          White rhinoceros  at--gcgggatgcagg-ct----gaac----t--ttt--ctc-tg------------gt-attgc-cta-
B D                       Cat  ag--gcgggaagcgga-ct----gaac---tt--ttt--ctt-cc------------gt-gcggg-cta-
B D                       Dog  gg--ggaggatgaggg-cc----gaac---ct--ttt--ctg-tg------------gt-actgc-c---
B D                   Ferret   ag--gggggatgtggg-ct----gaact--tt--ttt--ctt-cg------------gt-actgc-gta-
B D                     Panda  ag--gggggatatggg-ct----gaac---tt--ttt--ctt-tg------------gt-actgc-cta-
               Pacific walrus  agc-gggggatgtggg-ct----gaac---tt--ttt--ctt-tg------------gt-acagc-c---
                 Weddell seal  agc-gggggatgtggg-ca----gaac---tt--ttt--ctt-tg------------gt-actgc-c---
             Black flying-fox  tt--gcgggatgcgag-atgcgggatgatatt--ttt--ctc-tg------------ataattgc-cta-
B D                   Megabat  tt--gcgggatgcggg-atgcaggatgatctt--ttt--ctc-tg------------ataattgc-cta-
                Big brown bat  ct--gcggaatgcggg-ct----gagcttcta--ttt--ccc-tg------------gtaatggc-cta-
         David's myotis (bat)  cc--gcggaaggcggg-ct----aaacttgta--ttt--ccc-tg------------gaaattgc-cca-
B D                  Microbat  cc--gcggaaggcggg-ct----gaacttgta--ttt--ccc-tg------------gaaattgc-cca-
              Star-nosed mole  at---------gcggg-cg----aaac---tt--ttt--gtc------------------actgc-ctt-
B D                  Elephant  gg--gcgtgaggccgg-tt----gcct---tg--ttc--tcc--g------------gc-a---------
          Cape elephant shrew  gg--gcgggctgcggg-ct----caag---tt--ttc--tgc--g------------gc-a-agc-ctg-
B D                   Manatee  at--gctggacgccgt-cg----aaac---tt--ttc--ttc----------------------------
             Cape golden mole  ac--gcgggatgcggg-ct----taac---tt--ttt--gtc-tg------------gt-attac-caa-
B D                    Tenrec  gc--gcgagctccggt-cc----caac---tt--tgc--cgc-tg------------gc-gtggc-ctg-
                     Aardvark  ac--ggaggatgtggt-ct----aaac---tt--ttt--tctctt------------gc-actgt-tta-
B D                 Armadillo  at--gctggttgcgat-ct----gaac---tt--ttt--tccctg------------gc-actgt-cta-
  D            Painted turtle  --ctctaggactcggg-ca----gagt---ct--cag--ccc----------------------------
B D                     Shrew  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
B D                   Lamprey  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  gtagaggcgc
                        Chimp  gtagaggcgc
                      Gorilla  gtagaggcgc
                    Orangutan  gtagaggcgc
                       Gibbon  gtagaggcgc
                       Rhesus  ctagaggcgc
          Crab-eating macaque  ctagaggcgc
                       Baboon  ctagaggcgc
                 Green monkey  ctagaggggc
                     Marmoset  ---------c
                     Bushbaby  gctgagacgc
           Chinese tree shrew  tgccagacgc
                     Squirrel  tcga------
       Lesser Egyptian jerboa  ----------
               Golden hamster  ga--------
                        Mouse  taaa------
                          Rat  taaa------
               Naked mole-rat  acgc------
                   Guinea pig  gcgc------
                   Chinchilla  gcgc------
             Brush-tailed rat  gcgc------
                       Rabbit  ----------
                         Pika  ----------
                          Pig  ccggaggcgc
                       Alpaca  gcaaagatgc
               Bactrian camel  gcaaagatgc
                      Dolphin  ccagaggcgc
                 Killer whale  ccagaggcgc
             Tibetan antelope  ccagaggcgc
                          Cow  ccagaggcgc
                        Sheep  ccagaggcgc
                Domestic goat  ccagaggcgc
                        Horse  gcggtggtgc
             White rhinoceros  gcagtggcac
                          Cat  gcggaggcac
                          Dog  --tgaggcgc
                      Ferret   gcagaggtac
                        Panda  gtagaggctt
               Pacific walrus  ----------
                 Weddell seal  ----------
             Black flying-fox  acagagtcgc
                      Megabat  acagagtcgc
                Big brown bat  gcagaggtgc
         David's myotis (bat)  gcagaggcgc
                     Microbat  gcagaggcgc
              Star-nosed mole  gcagcgatac
                     Elephant  -ctgc-----
          Cape elephant shrew  gctgcagcat
                      Manatee  -ccgctgcc-
             Cape golden mole  gcgaaatc-t
                       Tenrec  gccgcgtcac
                     Aardvark  cctgtggcgc
                    Armadillo  gccgtggcgc
               Painted turtle  ----------
                        Shrew  ==========
                  Stickleback  ==========
                  Spotted gar  ==========
                     Hedgehog  ==========
                   Coelacanth  ==========
                      Lamprey  ==========
           Southern platyfish  ==========
     Mexican tetra (cavefish)  ==========
              Tasmanian devil  ==========
                  Rock pigeon  ==========
       White-throated sparrow  ==========
                Scarlet macaw  ==========
                       Parrot  ==========
                       Lizard  ==========
                  Zebra finch  ==========
          Collared flycatcher  ==========
     Chinese softshell turtle  ==========
              Green seaturtle  ==========
                 Mallard duck  ==========
                   Budgerigar  ==========
                       Turkey  ==========
                      Chicken  ==========
           Tibetan ground jay  ==========
                      Wallaby  ==========
           American alligator  ==========
                      Opossum  ==========
                 Prairie vole  ==========
              Chinese hamster  ==========
              Squirrel monkey  ----------

Inserts between block 28 and 29 in window
B D                 Squirrel 5bp
              Golden hamster 28bp
B D                    Mouse 321bp
B D                      Rat 39bp

Alignment block 29 of 714 in window, 180602644 - 180602660, 17 bps 
B D                     Human  agattccttagc-ta---aaa-
B D                     Chimp  agattccttagc-ta---aaa-
B D                   Gorilla  agattccttagc-ta---aaa-
B D                 Orangutan  agattccttagc-t----aaa-
B D                    Gibbon  agattccttagc-t----aaa-
B D                    Rhesus  agattccttagc-t----aaa-
B D       Crab-eating macaque  agattccttagc-t----aaa-
B D                    Baboon  agattccttagc-t----aaa-
B D              Green monkey  agatttcttagc-t----aaa-
B D                  Marmoset  agattccttagc-t----aaa-
B D                  Bushbaby  ggattctaaatt-t----aaa-
           Chinese tree shrew  gg-ttctctacc-t----gta-
B D                  Squirrel  ggattccttagt-t----ata-
               Golden hamster  tcacttgcca------------
B D                       Rat  ggattcacaag---------g-
B D            Naked mole-rat  agattccttacc-t----aaa-
B D                Guinea pig  ggattcctt----------aa-
                   Chinchilla  tgatttcttaac-t----aaa-
             Brush-tailed rat  gcgttctttgac-t----aga-
B D                       Pig  tgattctttagt-a----aaa-
B D                    Alpaca  ggattctttagc-t----aaa-
               Bactrian camel  ggattctttagc-t----aaa-
B D                   Dolphin  ggattctttagc-t----aaa-
                 Killer whale  ggattctttagc-t----aaa-
             Tibetan antelope  ggattctttagc-t----aaa-
B D                       Cow  ggattctttagc------aaa-
B D                     Sheep  ggattctttagc-t----aaa-
                Domestic goat  ggattctttagc-t----aaa-
B D                     Horse  ggattctttagctt----aaa-
B D          White rhinoceros  ggattctttagc-t----aaa-
B D                       Cat  ggagtctttatc-c----aaa-
B D                       Dog  tgagtcgttagc-c----aac-
B D                   Ferret   ggaatctttagc-c----aga-
B D                     Panda  ggagtttttagc-c----aaa-
               Pacific walrus  --------tagc-c----aaa-
                 Weddell seal  --------tagc-c----aaa-
             Black flying-fox  agattctttagc-t----aaa-
B D                   Megabat  agattctttagc-t----aaa-
                Big brown bat  agagtctttagc-ta---aaa-
         David's myotis (bat)  gggttctcgagc-t----aaa-
B D                  Microbat  gggttcttgagc-t----aaa-
              Star-nosed mole  gggttccttagc-t----aga-
B D                  Elephant  ------------------ca--
          Cape elephant shrew  agcttcttcgac-ccct-ca--
B D                   Manatee  ------------------aa--
             Cape golden mole  ggcattg----t-c----cc--
B D                    Tenrec  ggggtcgctcac-t----cc--
                     Aardvark  ggaatttttaac-c----ta--
B D                 Armadillo  ggagtctgtggc-c----ga--
  D            Painted turtle  -agctccctcgc-ccctgagag
B D                     Shrew  ======================
B D               Stickleback  ======================
                 Spotted gar  ======================
B D                  Hedgehog  ======================
B D                Coelacanth  ======================
B D                   Lamprey  ======================
          Southern platyfish  ======================
    Mexican tetra (cavefish)  ======================
B D                      Pika  ----------------------
B D                    Rabbit  ----------------------
B D           Tasmanian devil  ======================
  D               Rock pigeon  ======================
  D    White-throated sparrow  ======================
  D             Scarlet macaw  ======================
  D                    Parrot  ======================
B D                    Lizard  ======================
B D               Zebra finch  ======================
  D       Collared flycatcher  ======================
  D  Chinese softshell turtle  ======================
  D           Green seaturtle  ======================
  D              Mallard duck  ======================
B D                Budgerigar  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
          Tibetan ground jay  ======================
B D                   Wallaby  ======================
B D        American alligator  ======================
B D                   Opossum  ======================
                Prairie vole  ======================
B D           Chinese hamster  ======================
      Lesser Egyptian jerboa  ----------------------
B D                     Mouse  ======================
B D           Squirrel monkey  ----------------------

Inserts between block 29 and 30 in window
B D                 Bushbaby 24bp
          Chinese tree shrew 1bp

Alignment block 30 of 714 in window, 180602661 - 180602680, 20 bps 
B D                     Human  atccct-tga-----gc------t----ttcc--tatc-------------------------
B D                     Chimp  atccct-tga-----gc------t----ttcc--tatc-------------------------
B D                   Gorilla  atccct-tga-----gc------t----ttcc--tatc-------------------------
B D                 Orangutan  atccct-tga-----gc------t----ttcc--tctc-------------------------
B D                    Gibbon  atccct-tga-----gc------t----ttcc--tatc-------------------------
B D                    Rhesus  atcccg-tga-----gc------t----ttcg--tatc-------------------------
B D       Crab-eating macaque  atccct-tga-----gc------t----ttcg--tatc-------------------------
B D                    Baboon  atccct-tga-----gc------t----ttcg--tatc-------------------------
B D              Green monkey  atccgt-taa-----ac------t----ttcg--tatc-------------------------
B D                  Marmoset  attcct-tag-----gc------g----ttcg--tatc-------------------------
           Chinese tree shrew  -ggcct-cag-----gg------t----tttg--taat-------------------------
B D                  Squirrel  atctct-agg-----gc------t----ttcc--tatc-------------------------
       Lesser Egyptian jerboa  -------agc-----------------------------------------------------
               Golden hamster  ---tca-agc-----tt----cct----gacc--tgag-------------------------
B D                       Rat  atttcc-agc-----gt------t----gtcc--ta---------------------------
B D            Naked mole-rat  ggcccc-tgg-----gctttcaat----ttca--tctc-------------------------
B D                Guinea pig  gtccct-tga-----gc-----------ttta--tatc-------------------------
                   Chinchilla  gtcccc-tgg-----gc------t----ttta--tctc-------------------------
             Brush-tailed rat  gtcccc-tgg-----gc------t----ttta--tccc-------------------------
B D                    Rabbit  ggcact-tta-----gc------t----ttgg--cgtc-------------------------
B D                      Pika  gtctcc-ccacgcaggc------tgcacccag--cggc-------------------------
B D                       Pig  tccccc-ggg-----gc------t----tctg--tatc-------------------------
B D                    Alpaca  atccct-cgg-----g------------tgttcctatt-------------------------
               Bactrian camel  atccct-cgg-----g------------tgttcctatt-------------------------
B D                   Dolphin  atccct-tgg-----gc------t----tgtgtatctg-------------------------
                 Killer whale  atccct-tgg-----gc------t----tgtgtatctg-------------------------
             Tibetan antelope  atcttt-ggg-----gc------t----tgtgtatatc-------------------------
B D                       Cow  atcctt-tgg-----gc------t----tctgtatata-------------------------
B D                     Sheep  atcttt-ggg-----gc------t----tgtgtatatc-------------------------
                Domestic goat  atcttt-ggg-----gc------t----tgtgtatatc-------------------------
B D                     Horse  acccct-tgt-----gc------t----ttcg--tatc-------------------------
B D          White rhinoceros  acccct-ggg-----gc------t----ttcg--tatc-------------------------
B D                       Cat  atccct-tgg-----gc------t----t--t--cttc-------------------------
B D                       Dog  agccct-tgg-----gc------t----tcgt--catc-------------------------
B D                   Ferret   atccct-tgg-----gc------t----tcgt--tatc-------------------------
B D                     Panda  atccct-tag-----gc------t----tcgt--tatc-------------------------
               Pacific walrus  attcct-tag-----gc------t----tcgt--tatc-------------------------
                 Weddell seal  atccct-tag-----gt------t----tcgg--tatc-------------------------
             Black flying-fox  atcctt-tgg-----gc------t----tttg--tatc-------------------------
B D                   Megabat  atcctt-tgg-----gc------t----tttg--tatc-------------------------
                Big brown bat  atccct-cgg-----gc------t----ttcg--tacc-------------------------
         David's myotis (bat)  acccct-cgg-----gc------t----ttcg--tatc-------------------------
B D                  Microbat  atccct-cgg-----gc------t----ttcg--gatc-------------------------
              Star-nosed mole  atctat--gg-----gc------t----ttag--tatt-------------------------
B D                  Elephant  aatccc-tgg-----gc------t----ctcc--tgcc-------------------------
          Cape elephant shrew  gttccc-tgg-----at------t----ttcc--tctc-------------------------
B D                   Manatee  gatccc-tgg-----gc------t----ttcc--cgtc-------------------------
             Cape golden mole  acatcc-taa-----gc------t----ttcc--tgtc-------------------------
B D                    Tenrec  gcgcct-cga-----gc------t----ttcc--ttt--------------------------
                     Aardvark  tatccc-tgg-----gc------t----ttcc--tttc-------------------------
B D                 Armadillo  tatcccttgg-----gc------t----ttcg--tgtc-------------------------
  D            Painted turtle  ctccct-tgc-----cc------t----tccc--ttgtagtagtagtgatagccacaggcatt
B D                     Shrew  ===============================================================
B D               Stickleback  ===============================================================
                 Spotted gar  ===============================================================
B D                  Hedgehog  ===============================================================
B D                Coelacanth  ===============================================================
B D                   Lamprey  ===============================================================
          Southern platyfish  ===============================================================
    Mexican tetra (cavefish)  ===============================================================
B D           Tasmanian devil  ===============================================================
  D               Rock pigeon  ===============================================================
  D    White-throated sparrow  ===============================================================
  D             Scarlet macaw  ===============================================================
  D                    Parrot  ===============================================================
B D                    Lizard  ===============================================================
B D               Zebra finch  ===============================================================
  D       Collared flycatcher  ===============================================================
  D  Chinese softshell turtle  ===============================================================
  D           Green seaturtle  ===============================================================
  D              Mallard duck  ===============================================================
B D                Budgerigar  ===============================================================
B D                    Turkey  ===============================================================
B D                   Chicken  ===============================================================
          Tibetan ground jay  ===============================================================
B D                   Wallaby  ===============================================================
B D        American alligator  ===============================================================
B D                   Opossum  ===============================================================
                Prairie vole  ===============================================================
B D           Chinese hamster  ===============================================================
B D                     Mouse  ===============================================================
B D                  Bushbaby  ===============================================================
B D           Squirrel monkey  ---------------------------------------------------------------

Inserts between block 30 and 31 in window
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
              Golden hamster 3bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 11bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 31 of 714 in window, 180602681 - 180602695, 15 bps 
B D                     Human  tgagttggaggcgt-c
B D                     Chimp  tgagttggaggcgt-c
B D                   Gorilla  tgagttggaggcgt-c
B D                 Orangutan  tgagttggaggcgt-c
B D                    Gibbon  tgagttggaggcgt-c
B D                    Rhesus  tgggttggaggcgt-c
B D       Crab-eating macaque  tgggttggaggcgt-c
B D                    Baboon  tgggttggaggcgt-c
B D              Green monkey  tgggttggaggcgt-c
B D                  Marmoset  tgggttggaggccg-c
B D                  Bushbaby  cgggctggaggagt-c
           Chinese tree shrew  gaagcgagaggcgt-t
B D                  Squirrel  gaagctggaggcgc-c
       Lesser Egyptian jerboa  gaagccctggacgc-c
               Golden hamster  gagtcccaggactcac
B D                       Rat  gacccccaagttgcac
B D            Naked mole-rat  atagctggaagctt-c
B D                Guinea pig  gaagctgga-gcgt-c
                   Chinchilla  ggagctggaggcgt-c
             Brush-tailed rat  gaggctggaggtgt-c
B D                    Rabbit  gctgctggaggcgt-c
B D                      Pika  acggctgatagcat-c
B D                       Pig  ggaactgcgcgggt-g
B D                    Alpaca  ggaattgcgcgggt-g
               Bactrian camel  ggaactgcgcgggt-g
B D                   Dolphin  -------cgcggct-g
                 Killer whale  -------cgcggct-g
             Tibetan antelope  ggaacagcgcggct-g
B D                       Cow  gaaacagcgcggct-g
B D                     Sheep  ggaacagcgcggct-g
                Domestic goat  ggaacagcacggct-g
B D                     Horse  ggcgctgcgggcgt-c
B D          White rhinoceros  ggagctgcgggcgt-c
B D                       Cat  gcagtcccc-------
B D                       Dog  ggagctgcgggactgt
B D                   Ferret   ggagcttcgggagt-t
B D                     Panda  ggagcttcgggagt-t
               Pacific walrus  ggagcttcgggagt-t
                 Weddell seal  ggagcttcgggagt-t
             Black flying-fox  ggggctgcgggcgt-c
B D                   Megabat  ggggctgcgggcgt-c
                Big brown bat  ggggctgcgggcat-c
         David's myotis (bat)  ggggctgcgggcat-c
B D                  Microbat  ggggctgcgggcat-c
              Star-nosed mole  gggaatgcgggctt-c
B D                  Elephant  ggcgctgggggcgt-c
          Cape elephant shrew  gccgccgagggcgt-c
B D                   Manatee  ggcgctgggggcgt-c
             Cape golden mole  ggagctg-gggcgt-c
B D                    Tenrec  --agccg---------
                     Aardvark  ggctctgggggcgt-c
B D                 Armadillo  ggaggtgagggagt-t
  D            Painted turtle  tcaaatgtcagcgc-c
B D                     Shrew  ================
B D               Stickleback  ================
                 Spotted gar  ================
B D                  Hedgehog  ================
B D                Coelacanth  ================
B D                   Lamprey  ================
          Southern platyfish  ================
    Mexican tetra (cavefish)  ================
B D           Tasmanian devil  ================
  D               Rock pigeon  ================
  D    White-throated sparrow  ================
  D             Scarlet macaw  ================
  D                    Parrot  ================
B D                    Lizard  ================
B D               Zebra finch  ================
  D       Collared flycatcher  ================
  D  Chinese softshell turtle  ================
  D           Green seaturtle  ================
  D              Mallard duck  ================
B D                Budgerigar  ================
B D                    Turkey  ================
B D                   Chicken  ================
          Tibetan ground jay  ================
B D                   Wallaby  ================
B D        American alligator  ================
B D                   Opossum  ================
                Prairie vole  ================
B D           Chinese hamster  ================
B D                     Mouse  ================
B D           Squirrel monkey  ----------------

Inserts between block 31 and 32 in window
B D                      Pig 4bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                      Cat 231bp
             Star-nosed mole 2bp

Alignment block 32 of 714 in window, 180602696 - 180602716, 21 bps 
B D                     Human  acttttta-a---gtttccccg-ctc
B D                     Chimp  acttttta-a---gtttccccg-ctc
B D                   Gorilla  acttttta-a---gtttccccg-ctc
B D                 Orangutan  acttttta-a---gtttccccg-ctc
B D                    Gibbon  gcttttta-a---gtttccccg-ctc
B D                    Rhesus  atttttta-a---gtttccccg-ttc
B D       Crab-eating macaque  atttttta-a---gtttccccg-ttc
B D                    Baboon  atttttta-a---gtttccccg-ttc
B D              Green monkey  atttttta-a---gtttccccg-ctc
B D                  Marmoset  acttttta-a---gtttgcccg-ccc
B D                  Bushbaby  acttttt-------------------
           Chinese tree shrew  acttttaa-a---gtttcccaa-ccc
B D                  Squirrel  acgttcta-g---gttttcccg-ccc
       Lesser Egyptian jerboa  actttgga-a---gtgtgcccg-ctc
               Golden hamster  gtggtagg-a-gcgggttcccc-aga
B D                       Rat  acagtggc-acacagacgccac-gta
B D            Naked mole-rat  acttgtta-a---gtttccccg-ccc
B D                Guinea pig  acttgtta-a---gtgtccccg-ccc
                   Chinchilla  acttgtta-a---gtttccccg-ccc
             Brush-tailed rat  tcttgttagg---gtttccccg-ccc
B D                    Rabbit  atttttta-a---gtgtccccg-cct
B D                      Pika  -tcttgca-g---gcttcagca-tct
B D                       Pig  atttttta-t---gtttccccg-ccc
B D                    Alpaca  acttttta-a---gtttccccg-ccc
               Bactrian camel  acttttta-a---gtttccccg-ccc
B D                   Dolphin  tcttttta-a---gtttccgcg-ccc
                 Killer whale  tcttttta-a---gtttccgcg-ccc
             Tibetan antelope  tgttttta-a---gtttccgcg-ccc
B D                       Cow  tgttttta-a---gtttccgcg-ccc
B D                     Sheep  tgttttta-a---gtttccgcg-ccc
                Domestic goat  tgttttta-a---gtttccgcg-ccc
B D                     Horse  acttttta-a---gtttccccg-ccc
B D          White rhinoceros  actcttta-a---gtttccccg-ctc
B D                       Cat  ncttttta-a---ctttccccg-ccc
B D                       Dog  ccttttta-a---ctttccttg-ccc
B D                   Ferret   actttgta-a---ctttcctcg-ccc
B D                     Panda  gcttttta-a---ctttcctcg-ccc
               Pacific walrus  acttttta-a---ttttcctcg-ccc
                 Weddell seal  acttttta-a---ctttcctcg-ccc
             Black flying-fox  acttatta-a---gtttcctcg-ccc
B D                   Megabat  acttttta-a---gtttcctcg-ccc
                Big brown bat  actcttga-c---gtttccccg-ccc
         David's myotis (bat)  gctcttgt-c---gcttccccg-ccc
B D                  Microbat  gctcttga-c---gcttccccg-ccc
              Star-nosed mole  ttttttta-a---gtgcctccg-ccc
B D                  Elephant  tcttctta-c---atttcccggcccc
          Cape elephant shrew  actttttt-g---ctttgtccgcccc
B D                   Manatee  cctttccc-c---atctgcccgcccc
             Cape golden mole  actttgta-c---atcgctccgcccc
B D                    Tenrec  ----------------cccccccccc
                     Aardvark  tcttttta-c-gtatccccccgcccc
B D                 Armadillo  acttttta-g---gtttctcca-ccc
  D            Painted turtle  ccctcccg-c---gttttcttc-ccc
B D                     Shrew  ==========================
B D               Stickleback  ==========================
                 Spotted gar  ==========================
B D                  Hedgehog  ==========================
B D                Coelacanth  ==========================
B D                   Lamprey  ==========================
          Southern platyfish  ==========================
    Mexican tetra (cavefish)  ==========================
B D           Tasmanian devil  ==========================
  D               Rock pigeon  ==========================
  D    White-throated sparrow  ==========================
  D             Scarlet macaw  ==========================
  D                    Parrot  ==========================
B D                    Lizard  ==========================
B D               Zebra finch  ==========================
  D       Collared flycatcher  ==========================
  D  Chinese softshell turtle  ==========================
  D           Green seaturtle  ==========================
  D              Mallard duck  ==========================
B D                Budgerigar  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
          Tibetan ground jay  ==========================
B D                   Wallaby  ==========================
B D        American alligator  ==========================
B D                   Opossum  ==========================
                Prairie vole  ==========================
B D           Chinese hamster  ==========================
B D                     Mouse  ==========================
B D           Squirrel monkey  --------------------------

Inserts between block 32 and 33 in window
              Golden hamster 5bp
  D           Painted turtle 1bp

Alignment block 33 of 714 in window, 180602717 - 180602748, 32 bps 
B D                     Human  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D                     Chimp  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D                   Gorilla  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D                 Orangutan  tcc-----------------acctccagg-------ttgattaatgagggaat----gcc
B D                    Gibbon  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D                    Rhesus  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D       Crab-eating macaque  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D                    Baboon  tcc-----------------acctccagg-------ttagttaatgagggaat----gcc
B D              Green monkey  tcc-----------------acctccagg-------ttggttaatgagggaat----gcc
B D                  Marmoset  ttc-----------------atctccagg-------ttggttaatgagggaat----gcc
B D                  Bushbaby  ----------------------ctccagg-------tcggtgaatgagggtct----atc
           Chinese tree shrew  tcc-----------------acctcc-gg-------ttagagaatgaggaagtaaacgac
B D                  Squirrel  tcc-----------------gcttccaag-------ttgtcggatgaggggag----tgc
       Lesser Egyptian jerboa  tcc-----------------ac-tccagg-------tgggcgggggagggatg----gaa
               Golden hamster  cct-----------------ac-actaaa-------tgaatacccattgaaaa----gcg
B D                       Rat  tct-----------------ac-accaaa-------taaacacataatgaaaa----gct
B D            Naked mole-rat  tcc-----------------acctccagg-------ttgaagaataagcgaat----tcc
B D                Guinea pig  tcc-----------------acctccagg-------tggacgaatacgcgaat----tgc
                   Chinchilla  tcc-----------------acctccagg-------ttgacgagtacgcgaat----tcc
             Brush-tailed rat  tcc-----------------accttcagg-------ttggcgaatgagcgaat----tcc
B D                    Rabbit  tcc-----------------acgccctgg-------ttggcgaatgagggaac----gtc
B D                      Pika  tcc-----------------ccgtcctag-------t--gc-agtgagcgaaa----gtc
B D                       Pig  tct-----------------atct--ggg-------ctggcaaatga-------------
B D                    Alpaca  tcc-----------------acctacaaa-------ctggcgaatgagggaat----ccc
               Bactrian camel  tcc-----------------acctacaaa-------ctggcgaatgagggaat----ccc
B D                   Dolphin  tcc-----------------acctacaga-------ccggcgaatgagggaat----cct
                 Killer whale  tcc-----------------acctacaga-------ccggcgaatgagggaat----cct
             Tibetan antelope  tcc-----------------atctacaga-------ctggcgtatgaggggat----ccc
B D                       Cow  tcc-----------------atctacaga-------ctggcgtatgaggggat----ccc
B D                     Sheep  tcc-----------------atctacaga-------ctggcgtatgaggggat----ccc
                Domestic goat  tcc-----------------atctacaga-------ctggcgtatgaggggat----ccc
B D                     Horse  tcc-----------------acctagaga-------ctggggagtgagagaat----ccc
B D          White rhinoceros  tcc-----------------acctacaga-------ctggcgactgaaggaat----ccc
B D                       Cat  tcc-----------------acctactgg-------ctggcgaatgagggagt----ctc
B D                       Dog  tcc-----------------acctccatg-------atggcgaatgacggatt----ccc
B D                   Ferret   tcc-----------------acctacagg-------ctggcgaatgagggaat----ccc
B D                     Panda  tcc-----------------acctacagg-------ctggtgaatgagagaat----ccc
               Pacific walrus  tcc-----------------acctacagg-------ctggcgaatgagggaat----ccc
                 Weddell seal  tcc-----------------acctacagg-------ctggcgaatgagggaat----ccc
             Black flying-fox  tcc-----------------acctacagg-------ctggcgagtgagagaat----ccc
B D                   Megabat  tcc-----------------acctacagg-------ctggcgagttagagaat----ccc
                Big brown bat  tcc-----------------aacaaccga-------ctggccagtgag------------
         David's myotis (bat)  tcc-----------------agcaaccga-------ctggccggtgag------------
B D                  Microbat  tcc-----------------agcaaccga-------ctggccggcgag------------
              Star-nosed mole  tcc-----------------atctagggaactaaagattcctagtgatggaat----ctt
B D                  Elephant  tcc-----------------acttccagc-------ctggccag----gagat----ctc
          Cape elephant shrew  cca-----------------agagcaagc-------ctgatgaa----ttcat----tcc
B D                   Manatee  tcc-----------------agctccagc-------ctggcgagtgacggaag----ccc
             Cape golden mole  tcc----------------aaactgcagc-------tcaagggatgaaggaat----tcc
B D                    Tenrec  tcc------------------------gc-------tcgcgg------------------
                     Aardvark  tcc-----------------aacgccagc-------ctcgtgaatgaaggaat----ccc
B D                 Armadillo  tct-----------------aattccagc-------ttggcaaatgaaagaat----ccc
B D                    Turkey  tct-----------------agatccagg-------ttggtaaatgggcaaat----gtt
  D            Painted turtle  tctccccccccccgctcaaaaaaatcatg-------acgcttaaaaatcagaa----ctt
B D                     Shrew  ============================================================
B D               Stickleback  ============================================================
                 Spotted gar  ============================================================
B D                  Hedgehog  ============================================================
B D                Coelacanth  ============================================================
B D                   Lamprey  ============================================================
          Southern platyfish  ============================================================
    Mexican tetra (cavefish)  ============================================================
B D           Tasmanian devil  ============================================================
  D               Rock pigeon  ============================================================
  D    White-throated sparrow  ============================================================
  D             Scarlet macaw  ============================================================
  D                    Parrot  ============================================================
B D                    Lizard  ============================================================
B D               Zebra finch  ============================================================
  D       Collared flycatcher  ============================================================
  D  Chinese softshell turtle  ============================================================
  D           Green seaturtle  ============================================================
  D              Mallard duck  ============================================================
B D                Budgerigar  ============================================================
B D                   Chicken  ============================================================
          Tibetan ground jay  ============================================================
B D                   Wallaby  ============================================================
B D        American alligator  ============================================================
B D                   Opossum  ============================================================
                Prairie vole  ============================================================
B D           Chinese hamster  ============================================================
B D                     Mouse  ============================================================
B D           Squirrel monkey  ------------------------------------------------------------

Inserts between block 33 and 34 in window
B D                 Squirrel 1bp
              Golden hamster 13bp
B D                      Rat 8bp

Alignment block 34 of 714 in window, 180602749 - 180602759, 11 bps 
B D                     Human  tagttaaaac--t-
B D                     Chimp  tagttaaaac--t-
B D                   Gorilla  tagttaaaac--t-
B D                 Orangutan  tagttaaaac--t-
B D                    Gibbon  tagttaaaac--t-
B D                    Rhesus  tagttaaaac--t-
B D       Crab-eating macaque  tagttaaaac--t-
B D                    Baboon  tagttaaaac--t-
B D              Green monkey  tagttaaaac--t-
B D                  Marmoset  tagttaaaac--t-
B D                  Bushbaby  aagttaaaac--t-
           Chinese tree shrew  tggtggaaac--t-
B D                  Squirrel  tggttaaaac----
       Lesser Egyptian jerboa  cgtctaaaac-t--
                 Prairie vole  taaataaaac----
               Golden hamster  taaataaaac----
B D                       Rat  caaataaaac----
B D            Naked mole-rat  tggttaaa------
B D                Guinea pig  tggttaaaag----
                   Chinchilla  tggttaaaac----
             Brush-tailed rat  tgtttaaaac----
B D                    Rabbit  tggac---ac----
B D                      Pika  tggtcagaag----
B D                       Pig  -ggttaaaac--a-
B D                    Alpaca  tggttaaaac--t-
               Bactrian camel  tggttaaaac--t-
B D                   Dolphin  tggttaaaac--t-
                 Killer whale  tggttaaaac--t-
             Tibetan antelope  tggttaaaac--t-
B D                       Cow  tggttaaaac--t-
B D                     Sheep  tggttaaaac----
                Domestic goat  tggttaaaac----
B D                     Horse  tggttaaaac--t-
B D          White rhinoceros  tggttaaaac--t-
B D                       Cat  tgattaaaac--t-
B D                       Dog  tgattaaaac--t-
B D                   Ferret   tgattaaaac--t-
B D                     Panda  tgattaaaac--t-
               Pacific walrus  tgattaaaac-tt-
                 Weddell seal  tgattaaaac--t-
             Black flying-fox  tggttaaaac--t-
B D                   Megabat  tggttaaaac--t-
                Big brown bat  -ggttaaaacttt-
         David's myotis (bat)  -ggttcaacc--t-
B D                  Microbat  -ggttcaaac--t-
              Star-nosed mole  tacttaaaac--t-
B D                  Elephant  tcgttagaac--t-
          Cape elephant shrew  ttttaagaaa--c-
B D                   Manatee  gcgttaaagc--t-
             Cape golden mole  tttttataac--t-
B D                    Tenrec  --------ac--t-
                     Aardvark  tcgttaaaac--t-
B D                 Armadillo  tcgttaaaac--t-
B D                    Turkey  -gacttggaa--ta
  D            Painted turtle  -gtttaaaaa----
B D                     Shrew  ==============
B D               Stickleback  ==============
                 Spotted gar  ==============
B D                  Hedgehog  ==============
B D                Coelacanth  ==============
B D                   Lamprey  ==============
          Southern platyfish  ==============
    Mexican tetra (cavefish)  ==============
B D           Tasmanian devil  ==============
  D               Rock pigeon  ==============
  D    White-throated sparrow  ==============
  D             Scarlet macaw  ==============
  D                    Parrot  ==============
B D                    Lizard  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D                Budgerigar  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D                   Wallaby  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
B D           Chinese hamster  ==============
B D                     Mouse  ==============
B D           Squirrel monkey  --------------

Inserts between block 34 and 35 in window
B D                 Marmoset 190bp

Alignment block 35 of 714 in window, 180602760 - 180602770, 11 bps 
B D                     Human  tttt---gtc--------------tgag
B D                     Chimp  tttt---gtc--------------tgag
B D                   Gorilla  tttt---gtc--------------tgag
B D                 Orangutan  tttt---ctc--------------tgag
B D                    Gibbon  ttt-----tc--------------tgag
B D                    Rhesus  tttt---ctc--------------tgag
B D       Crab-eating macaque  tttt---ctc--------------tgag
B D                    Baboon  tttt---ctc--------------tgag
B D              Green monkey  tttt---ctc--------------tgag
B D                  Marmoset  tttt---ctc--------------ccag
B D                  Bushbaby  tttt---ctc--------------taag
           Chinese tree shrew  ttct---ctg--------------tcag
B D                  Squirrel  ---t---ttt--------------tcct
       Lesser Egyptian jerboa  tttt---ttc--------------tcct
                 Prairie vole  ---t---ccc--------------tcca
               Golden hamster  ---t---ctc--------------tcca
B D                       Rat  ---t---tcc--------------tcca
B D            Naked mole-rat  --------tc--------------ctaa
B D                Guinea pig  ---t---ctc--------------ctga
                   Chinchilla  ---t---gtc--------------caag
             Brush-tailed rat  ---t---gtc--------------cgag