Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1330 in window, 78922118 - 78922120, 3 bps 
B D                     Human  ggc----------------
B D                     Chimp  ggc----------------
B D                   Gorilla  ggc----------------
B D                 Orangutan  ggc----------------
B D                    Gibbon  ggc----------------
B D                    Rhesus  ggc----------------
B D       Crab-eating macaque  ggc----------------
B D                    Baboon  ggc----------------
B D              Green monkey  ggc----------------
B D                  Marmoset  ggc----------------
B D           Squirrel monkey  ggc----------------
B D                  Bushbaby  cgc----------------
           Chinese tree shrew  -------------------
B D                  Squirrel  cac----------------
       Lesser Egyptian jerboa  cgc----------------
                 Prairie vole  tgc----------------
B D           Chinese hamster  tgc----------------
               Golden hamster  tga----------------
B D                     Mouse  tgc----------------
B D                       Rat  tgc----------------
B D                Guinea pig  agg----------------
                   Chinchilla  tgg----------------
             Brush-tailed rat  cgg----------------
B D                      Pika  -------------------
B D                       Pig  tgc----------------
B D                    Alpaca  gac----------------
               Bactrian camel  gac----------------
B D                   Dolphin  tgc----------------
                 Killer whale  tgc----------------
             Tibetan antelope  cgc----------------
B D                       Cow  cgc----------------
B D                     Sheep  cgc----------------
                Domestic goat  cgc----------------
B D                     Horse  gcc----------------
B D          White rhinoceros  ggc----------------
B D                       Cat  -------------------
B D                       Dog  -------------------
B D                   Ferret   -------------------
B D                     Panda  ggc----------------
               Pacific walrus  ggc----------------
                 Weddell seal  gga----------------
             Black flying-fox  cgc----------------
B D                   Megabat  cgc----------------
         David's myotis (bat)  cgc----------------
B D                     Shrew  --c----------------
B D                  Elephant  tgc----------------
          Cape elephant shrew  atc----------------
B D                   Manatee  tgc----------------
             Cape golden mole  -gt----------------
B D                    Tenrec  -------------------
                     Aardvark  tgc----------------
B D                   Opossum  -------------------
  D               Rock pigeon  -------------------
  D              Saker falcon  -------------------
  D          Peregrine falcon  -------------------
  D       Collared flycatcher  -------------------
  D    White-throated sparrow  -------------------
B D               Zebra finch  -------------------
           Tibetan ground jay  -------------------
B D                Budgerigar  -------------------
  D                    Parrot  -------------------
  D              Mallard duck  -------------------
B D                   Chicken  -------------------
B D                    Turkey  -------------------
B D        American alligator  -------------------
  D           Green seaturtle  -------------------
  D            Painted turtle  -------------------
  D  Chinese softshell turtle  -------------------
B D              Atlantic cod  -actggttttggttt----
                  Spotted gar  -cctcatttcaagtctgcc
               Big brown bat  ===================
B D                    Lizard  ===================
B D                    Rabbit  -------------------
B D                 Armadillo  -------------------
B D            Naked mole-rat  -------------------

Inserts between block 1 and 2 in window
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D      Collared flycatcher 2bp
  D   White-throated sparrow 1bp
B D              Zebra finch 1bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D             Mallard duck 2bp
B D                  Chicken 2bp
B D                   Turkey 2bp
B D       American alligator 2bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp
B D             Atlantic cod 3bp
                 Spotted gar 5bp

Alignment block 2 of 1330 in window, 78922121 - 78922123, 3 bps 
B D                     Human  tg------c--
B D                     Chimp  tg------c--
B D                   Gorilla  tg------c--
B D                 Orangutan  tg------c--
B D                    Gibbon  tg------c--
B D                    Rhesus  ag------c--
B D       Crab-eating macaque  ag------c--
B D                    Baboon  ag------c--
B D              Green monkey  ag------c--
B D                  Marmoset  tg------c--
B D           Squirrel monkey  tg------c--
B D                  Bushbaby  ca------a--
           Chinese tree shrew  tg------c--
B D                  Squirrel  ag------c--
       Lesser Egyptian jerboa  ag------t--
                 Prairie vole  ag------c--
B D           Chinese hamster  ag------c--
               Golden hamster  ag------c--
B D                     Mouse  ag------c--
B D                       Rat  ag------c--
B D            Naked mole-rat  ca------c--
B D                Guinea pig  ca---------
                   Chinchilla  ca------c--
             Brush-tailed rat  ca------c--
B D                      Pika  -a------c--
B D                       Pig  cc---------
B D                    Alpaca  at---------
               Bactrian camel  at---------
B D                   Dolphin  tgctgcagc--
                 Killer whale  tgctgcagc--
             Tibetan antelope  cg---------
B D                       Cow  cg---------
B D                     Sheep  tg---------
                Domestic goat  cg---------
B D                     Horse  at---------
B D          White rhinoceros  ct---------
B D                     Panda  gc---------
               Pacific walrus  ac---------
                 Weddell seal  gc---------
             Black flying-fox  gt---------
B D                   Megabat  gt---------
         David's myotis (bat)  tg---------
B D                     Shrew  ct---------
B D                  Elephant  ca------t--
          Cape elephant shrew  cg------t--
B D                   Manatee  cg------t--
             Cape golden mole  tg------t--
B D                    Tenrec  --------c--
                     Aardvark  tg------t--
B D                 Armadillo  -g------t--
B D               Stickleback  --------tgt
B D              Atlantic cod  --------tgt
                  Spotted gar  --------t--
               Big brown bat  ===========
B D                    Lizard  ===========
B D                    Rabbit  -----------
B D                   Ferret   -----------
B D                       Dog  -----------
  D               Rock pigeon  ===========
B D        American alligator  ===========
  D              Mallard duck  ===========
  D       Collared flycatcher  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D  Chinese softshell turtle  ===========
          Tibetan ground jay  -----------
B D                Budgerigar  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D                    Parrot  ===========
  D    White-throated sparrow  ===========
B D               Zebra finch  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D                   Opossum  -----------
B D                       Cat  -----------

Inserts between block 2 and 3 in window
B D              Stickleback 6bp
B D             Atlantic cod 3bp

Alignment block 3 of 1330 in window, 78922124 - 78922125, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  cg
           Chinese tree shrew  cc
B D                  Squirrel  tt
       Lesser Egyptian jerboa  cc
                 Prairie vole  gt
B D           Chinese hamster  ct
               Golden hamster  ct
B D                     Mouse  cg
B D                       Rat  cg
B D            Naked mole-rat  cc
B D                Guinea pig  -c
                   Chinchilla  cc
             Brush-tailed rat  ac
B D                      Pika  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cg
B D                   Megabat  cg
         David's myotis (bat)  cg
B D                  Elephant  cc
          Cape elephant shrew  ca
B D                   Manatee  cc
             Cape golden mole  cc
B D                    Tenrec  cg
                     Aardvark  cc
B D                 Armadillo  cc
                  Spotted gar  ca
B D                     Shrew  --
               Big brown bat  ==
B D                    Lizard  ==
B D                    Rabbit  --
B D                   Ferret   --
B D                       Dog  --
B D              Atlantic cod  ==
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
B D               Stickleback  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  --
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                       Cow  --
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
B D                       Pig  --
B D                   Opossum  --
B D                       Cat  --

Inserts between block 3 and 4 in window
B D                 Squirrel 4bp

Alignment block 4 of 1330 in window, 78922126 - 78922127, 2 bps 
B D                     Human  c-g
B D                     Chimp  c-g
B D                   Gorilla  c-g
B D                 Orangutan  c-g
B D                    Gibbon  c-g
B D                    Rhesus  t-g
B D       Crab-eating macaque  t-g
B D                    Baboon  t-g
B D              Green monkey  t-g
B D                  Marmoset  c-g
B D           Squirrel monkey  c-g
B D                  Bushbaby  t-g
           Chinese tree shrew  t-g
B D                  Squirrel  t-g
       Lesser Egyptian jerboa  t-g
                 Prairie vole  t-g
B D           Chinese hamster  t-g
               Golden hamster  t-t
B D                     Mouse  t-g
B D                       Rat  t-g
B D            Naked mole-rat  t-g
B D                Guinea pig  t-g
                   Chinchilla  c-a
             Brush-tailed rat  t-g
B D                    Rabbit  c-g
B D                      Pika  c-g
B D                       Pig  t-g
B D                    Alpaca  t-g
               Bactrian camel  t-g
B D                   Dolphin  c-g
                 Killer whale  c-g
             Tibetan antelope  g-g
B D                       Cow  g-g
B D                     Sheep  g-g
                Domestic goat  g-g
B D                     Horse  t-g
B D          White rhinoceros  t-g
B D                       Cat  a-g
B D                       Dog  c-g
B D                   Ferret   c-c
B D                     Panda  c-t
               Pacific walrus  c-c
                 Weddell seal  c-c
             Black flying-fox  g-g
B D                   Megabat  g-a
         David's myotis (bat)  gcc
B D                     Shrew  g-c
B D                  Elephant  c-t
          Cape elephant shrew  c-a
B D                   Manatee  c-t
             Cape golden mole  c-g
B D                    Tenrec  c-t
                     Aardvark  g-t
B D                 Armadillo  a-g
B D                   Opossum  c-t
B D                   Wallaby  c-a
     Mexican tetra (cavefish)  -ca
                  Spotted gar  -ca
               Big brown bat  ===
B D                    Lizard  ===
B D              Atlantic cod  ===
  D               Rock pigeon  ===
B D        American alligator  ===
  D              Mallard duck  ===
B D               Stickleback  ===
  D       Collared flycatcher  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ---
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===

Inserts between block 4 and 5 in window
    Mexican tetra (cavefish) 2bp

Alignment block 5 of 1330 in window, 78922128 - 78922129, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                  Bushbaby  gc
           Chinese tree shrew  gc
B D                  Squirrel  gc
       Lesser Egyptian jerboa  gc
                 Prairie vole  gc
B D           Chinese hamster  gc
               Golden hamster  gc
B D                     Mouse  gc
B D                       Rat  gc
B D            Naked mole-rat  ac
B D                Guinea pig  ac
                   Chinchilla  gc
             Brush-tailed rat  gt
B D                    Rabbit  gc
B D                      Pika  gc
B D                       Pig  gc
B D                    Alpaca  gc
               Bactrian camel  gc
B D                   Dolphin  gc
                 Killer whale  gc
             Tibetan antelope  gc
B D                       Cow  gc
B D                     Sheep  gc
                Domestic goat  gc
B D                     Horse  gc
B D          White rhinoceros  gc
B D                       Cat  gc
B D                       Dog  gc
B D                   Ferret   gc
B D                     Panda  gc
               Pacific walrus  ac
                 Weddell seal  gc
             Black flying-fox  gc
B D                   Megabat  gc
         David's myotis (bat)  gc
B D                     Shrew  cc
B D                  Elephant  gc
          Cape elephant shrew  gc
B D                   Manatee  gc
             Cape golden mole  gc
B D                    Tenrec  gc
                     Aardvark  gt
B D                 Armadillo  gc
B D                   Opossum  gt
B D           Tasmanian devil  gg
B D                   Wallaby  ga
  D               Rock pigeon  tc
  D              Saker falcon  tc
  D          Peregrine falcon  tc
  D       Collared flycatcher  cc
B D                Budgerigar  tc
  D                    Parrot  tc
  D              Mallard duck  tc
B D                   Chicken  tc
B D                    Turkey  tc
B D        American alligator  cc
  D           Green seaturtle  cc
  D            Painted turtle  cc
  D  Chinese softshell turtle  cc
B D                 Zebrafish  gt
     Mexican tetra (cavefish)  at
                  Spotted gar  gc
               Big brown bat  ==
B D                    Lizard  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Tibetan ground jay  --
  D    White-throated sparrow  ==
B D               Zebra finch  ==

Alignment block 6 of 1330 in window, 78922130 - 78922145, 16 bps 
B D                     Human  tcacaccagaggga------tg
B D                     Chimp  tcacaccagaggga------tg
B D                   Gorilla  tcacaccagaggga------tg
B D                 Orangutan  tcacaccagaggga------tg
B D                    Gibbon  tcacaccagaggga------tg
B D                    Rhesus  tcacaccagaggga------tg
B D       Crab-eating macaque  tcacaccagaggga------tg
B D                    Baboon  tcacaccagaggga------tg
B D              Green monkey  tcacaccagaggga------tg
B D                  Marmoset  tcacaccagaggga------cg
B D           Squirrel monkey  tcacaccagaggga------tg
B D                  Bushbaby  tcacacgagaggga------tg
           Chinese tree shrew  tcacaccaggggaa------cg
B D                  Squirrel  tcacacctgaggga------tg
       Lesser Egyptian jerboa  tcacacttggggga------tg
                 Prairie vole  ttatacctgaggga------tg
B D           Chinese hamster  ttatacctggggga------tg
               Golden hamster  ttatacctgaggga------tg
B D                     Mouse  ttatacctgaggaa------tg
B D                       Rat  ttatacctgaggga------tg
B D            Naked mole-rat  tcacacctgaggga------tg
B D                Guinea pig  tcacacctgaggga------tg
                   Chinchilla  tcatacctgaggga------tg
             Brush-tailed rat  tcacacctgaggga------tg
B D                    Rabbit  tcacaccaggggga------tg
B D                      Pika  tcacaccaggggga------tg
B D                       Pig  tcacaccaggggga------tc
B D                    Alpaca  tcacaccaggggga------tg
               Bactrian camel  tcacaccaggggga------tg
B D                   Dolphin  tcacaccaggggga------tg
                 Killer whale  tcacaccaggggga------tg
             Tibetan antelope  tcacaccaggggga------ta
B D                       Cow  tcacaccaggggga------ta
B D                     Sheep  tcacaccaggggga------ta
                Domestic goat  tcacaccaggggga------ta
B D                     Horse  tcacaccagaggga------tg
B D          White rhinoceros  tcacaccagaggga------tg
B D                       Cat  tcacaccagcggga------ta
B D                       Dog  tcacaccaggggga------tg
B D                   Ferret   tcacaccaggggga------cg
B D                     Panda  tcacaccaggggga------tg
               Pacific walrus  tcacaccaggggga------tg
                 Weddell seal  tcacaccaggggga------tg
             Black flying-fox  tcacaccagtggga------tg
B D                   Megabat  tcacaccagtggga------tg
         David's myotis (bat)  tcacacctgcggga------tg
B D                     Shrew  tcacacctgcggga------tg
B D                  Elephant  tcacaccagaggaa------tg
          Cape elephant shrew  tcacacctgaggga------tg
B D                   Manatee  tcacaccagaggga------tg
             Cape golden mole  tcatatcagaggga------tg
B D                    Tenrec  tcacaccctgggga------tg
                     Aardvark  tcacaccaaaggga------tg
B D                 Armadillo  tcacagcagaggga------tg
B D                   Opossum  ttacattcctggga------cg
B D           Tasmanian devil  tcacatttgtggga------ta
B D                   Wallaby  ttacattagtggga------tg
  D               Rock pigeon  tcacacctgaggaa------cc
  D              Saker falcon  ttacacctgaggaa------ct
  D          Peregrine falcon  ttacacctgaggaa------ct
  D       Collared flycatcher  ctacacctgaggca------cg
  D    White-throated sparrow  ctacacccgaggaa------cg
B D               Zebra finch  ctacacctggggaa------cg
           Tibetan ground jay  ctacacctgaggaa------ca
B D                Budgerigar  ttacacctgaggga------ct
  D                    Parrot  ttacacctgaggga------ct
  D              Mallard duck  ttacacctggggaa------ta
B D                   Chicken  tcacactagaggca------ct
B D                    Turkey  tcacaccagaggca------ct
B D        American alligator  ttagacccagggga------tg
  D           Green seaturtle  ttagacctgaggaa------tt
  D            Painted turtle  ttagacctgaggaa------tt
  D  Chinese softshell turtle  tcagaccagcggaa------cg
B D                Coelacanth  ttacagctgtggaa------tg
B D                      Fugu  tcacacctcaggaa--------
B D              Nile tilapia  tcacaccactggga--------
          Princess of Burundi  tcacaccactggga--------
        Burton's mouthbreeder  tcacaccactggga--------
                  Zebra mbuna  tcacaccactggga--------
          Pundamilia nyererei  tcacaccactggga--------
           Southern platyfish  tcacaccaccggaa--------
B D               Stickleback  tcaaactacaggtaga------
B D              Atlantic cod  tcagaccaaaggg---------
B D                 Zebrafish  ttacaccaaaggta--ta----
     Mexican tetra (cavefish)  ttacactagtggca--ga----
                  Spotted gar  tcacaccagaggga----tc--
               Big brown bat  ======================
B D                    Lizard  ======================

Alignment block 7 of 1330 in window, 78922146 - 78922208, 63 bps 
B D                     Human  gg--------------------------------------------------gtaggaggcgcaggcagc
B D                     Chimp  gg--------------------------------------------------gtaggaggcgcaggcagc
B D                   Gorilla  gg--------------------------------------------------gtaggaggcgcaggcagc
B D                 Orangutan  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                    Gibbon  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                    Rhesus  gg--------------------------------------------------gtaggaggcgcaggcagc
B D       Crab-eating macaque  gg--------------------------------------------------gtaggaggcgcaggcagc
B D                    Baboon  gg--------------------------------------------------gtaggaggcgcaggcagc
B D              Green monkey  gg--------------------------------------------------gtaggaggcgcaggcagc
B D                  Marmoset  gg--------------------------------------------------gtaggatgcgcaggcggc
B D           Squirrel monkey  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                  Bushbaby  gg--------------------------------------------------gtaggacgcgcaggcggc
           Chinese tree shrew  gg--------------------------------------------------gtaggaggcgcaagcagc
B D                  Squirrel  gg--------------------------------------------------gtaggaggcacaggcagc
       Lesser Egyptian jerboa  gg--------------------------------------------------gtaggaggcgcaggcagc
                 Prairie vole  gg--------------------------------------------------gtaggaggcacaggcagc
B D           Chinese hamster  gg--------------------------------------------------gtaggaggcacaggcagc
               Golden hamster  gg--------------------------------------------------gtaggaggcacaggcagc
B D                     Mouse  gg--------------------------------------------------ataggaggcacaagcagc
B D                       Rat  gg--------------------------------------------------gtaggaggcacaggcagc
B D            Naked mole-rat  gg--------------------------------------------------gtaggaggcacaggcagc
B D                Guinea pig  gg--------------------------------------------------gaaggaggcacaggcagc
                   Chinchilla  gg--------------------------------------------------gtaggaggcacaggcagc
             Brush-tailed rat  gg--------------------------------------------------gtaagaggcacaggcggc
B D                    Rabbit  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                      Pika  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                       Pig  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                    Alpaca  gg--------------------------------------------------gtaggaggcgcaggcggc
               Bactrian camel  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                   Dolphin  gg--------------------------------------------------gtaggaggcgcaggctgc
                 Killer whale  gg--------------------------------------------------gtaggaggcgcaggctgc
             Tibetan antelope  gg--------------------------------------------------gaaggaggcacaggccgc
B D                       Cow  gg--------------------------------------------------gaaggaggcacaggccgc
B D                     Sheep  gg--------------------------------------------------gaaggaggcacaggccgc
                Domestic goat  gg--------------------------------------------------gaaggaggcacaggccgc
B D                     Horse  gg--------------------------------------------------gtaggaggcacaggcggc
B D          White rhinoceros  gg--------------------------------------------------gtaggaggcacaggcggc
B D                       Cat  gg--------------------------------------------------gtaggaggcacaggccgc
B D                       Dog  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                   Ferret   gg--------------------------------------------------gtaggaggcgcaggccgc
B D                     Panda  gg--------------------------------------------------gtaggacgcgcacgccgc
               Pacific walrus  gg--------------------------------------------------gtaggaggcgcaggctgc
                 Weddell seal  gg--------------------------------------------------gtaggaggcgcaggctgc
             Black flying-fox  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                   Megabat  gg--------------------------------------------------gtaggaggcgcaggcggc
         David's myotis (bat)  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                     Shrew  gg--------------------------------------------------gtaggaggcgcaggctgc
B D                  Elephant  gg--------------------------------------------------gtaggaggcacaggcggc
          Cape elephant shrew  gg--------------------------------------------------gtaggaggcacaggcggc
B D                   Manatee  gg--------------------------------------------------gtaggaggcacaggcggc
             Cape golden mole  gg--------------------------------------------------gtaggaggcacaagcagc
B D                    Tenrec  gg--------------------------------------------------gtaggaggcgcaggctgc
                     Aardvark  gg--------------------------------------------------gtaggaggcacaggcggc
B D                 Armadillo  gg--------------------------------------------------gtaggaggcgcaggcggc
B D                   Opossum  gg--------------------------------------------------gtaagatgcacagtcagc
B D           Tasmanian devil  gg--------------------------------------------------ataagatgcacagtcagc
B D                   Wallaby  gg--------------------------------------------------ataagatgcacagtctgc
  D               Rock pigeon  gg--------------------------------------------------gtaagatgcacaagcagc
  D              Saker falcon  gg--------------------------------------------------gtaagatgcacaagcagc
  D          Peregrine falcon  gg--------------------------------------------------gtaagatgcacaagcagc
  D       Collared flycatcher  gg--------------------------------------------------gtaggaggcacaggcagc
  D    White-throated sparrow  gg--------------------------------------------------gtaggaggcacaggcagc
B D               Zebra finch  gg--------------------------------------------------gtaggaggcacaggcggc
           Tibetan ground jay  gg--------------------------------------------------gtacgaggcacaagcagc
B D                Budgerigar  gggtaagannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtaagacgcacaagcagc
  D                    Parrot  gg--------------------------------------------------ataagatgcacaagcagc
  D              Mallard duck  gg--------------------------------------------------gtaagatgcacaagcagc
B D                   Chicken  gg--------------------------------------------------gtaagatgcacaagcagc
B D                    Turkey  gg--------------------------------------------------gtaagaagcacaagcagc
B D        American alligator  gg--------------------------------------------------ataagaggcgcagtcagc
  D           Green seaturtle  gg--------------------------------------------------ataagatgcacacgcagc
  D            Painted turtle  gg--------------------------------------------------ataagatgcacatgcagc
  D  Chinese softshell turtle  gg--------------------------------------------------gtacgaggcgcacgcagc
B D                Coelacanth  gg--------------------------------------------------ataagaagcacaagcagc
B D                 Tetraodon  gg--------------------------------------------------ataagaagagcaagctgc
B D                      Fugu  ------------------------------------------------------aagagctacaagcagc
B D              Nile tilapia  ------------------------------------------------------atgatgcgcaggcagc
          Princess of Burundi  ------------------------------------------------------atgatgcgcaggcagc
        Burton's mouthbreeder  ------------------------------------------------------atgatgcgcaggcagc
                  Zebra mbuna  ------------------------------------------------------atgatgcgcaggcagc
          Pundamilia nyererei  ------------------------------------------------------atgatgcgcaggcagc
           Southern platyfish  ------------------------------------------------------aagatgagcagccagc
B D               Stickleback  gg--------------------------------------------------gtaggaagcgcatgcagc
B D              Atlantic cod  -----------------------------------------------------tatgaagagcaagccgc
B D                 Zebrafish  gg--------------------------------------------------ataggatgaacacgcagc
     Mexican tetra (cavefish)  gg--------------------------------------------------atatgatgagcaagcagc
                  Spotted gar  gg--------------------------------------------------ataagaggaacagcctgc
               Big brown bat  ======================================================================
B D                    Lizard  ======================================================================

                        Human  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                        Chimp  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                      Gorilla  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                    Orangutan  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                       Gibbon  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                       Rhesus  caggccacacatgttctttccgcgctcgatgaggaagtacctg
          Crab-eating macaque  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                       Baboon  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                 Green monkey  caggccacacatgttctttccgcgctcgatgaggaagtacctg
                     Marmoset  caggccacacatgttcttcccacgctcgatgaggaagtacctg
              Squirrel monkey  caggccacacatgttcttcccacgctcgatgaggaagtacctg
                     Bushbaby  cagaccacacatgttcttcccacgctcgatgaggaagtaccta
           Chinese tree shrew  caggccgcacatattcttgccacgctcgatgaggaagtacctg
                     Squirrel  cagaccacacatgttcttcccacgctcaatgaggaagtacctg
       Lesser Egyptian jerboa  caggccacacatgttcttcccccgctcgatcaggaagtaccta
                 Prairie vole  caggccacacatgttcttcccacgctcaatgagaaagtacctg
              Chinese hamster  caggccacacatgttctttccacgctcaatgaggaagtacctg
               Golden hamster  caggccacacatgttctttccacgctcaatgaggaagtacctg
                        Mouse  caggccacacatgttcttcccacgttcaatgaggaagtacctg
                          Rat  caggccacacatgttctttccacgctcaatgaggaagtacctg
               Naked mole-rat  caggccacacatgttcttcccacgctcgatgaggaagtacctg
                   Guinea pig  caggccacacatgttcttcccgcgctcaatgaggaagtacctg
                   Chinchilla  caggccacacatgttcttcccacgctcgatgaggaagtacctg
             Brush-tailed rat  caggccacacatgttcttcccacgctcgatgaggaagtacctg
                       Rabbit  caggccacacatgttcttcccgcgctctatgtagaagtacctg
                         Pika  caggccacacatgttcttcccacgctcgatgaggaagtacctg
                          Pig  caggccgcacatgttctttccacgctcgatgaggaagtacctg
                       Alpaca  caggccgcacatgttctttccgcgttcaatgaggaagtacctg
               Bactrian camel  caggccgcacatgttctttccgcgctcaatgaggaagtacctg
                      Dolphin  caggccgcacatgttcttcccgcgctccaagaggaagtacctg
                 Killer whale  caggccgcacatgttcttcccgcgctccaagaggaagtacctg
             Tibetan antelope  aaggccgcacatgttcttcccgcgctcgatgaggaagtacctg
                          Cow  aaggccgcacatgttcttcccgcgctcaatgaggaagtacctg
                        Sheep  aaggccgcacatgttcttcccgcgctcgatgaggaagtacctg
                Domestic goat  aaggccgcacatgttcttcccacgctcgatgaggaagtacctg
                        Horse  cagaccacacatgttcttcccacgctcaatgaggaagtacctg
             White rhinoceros  cagaccacacatgttcttcccacgctcaatgaggaagtacctg
                          Cat  cagcccacacatgttcttcccgcgctcgatgaggaagtacctg
                          Dog  caggccacacatgttcttcccacgctccatgaggaagtacctg
                      Ferret   caggccgcacatgttctttccgcgctcgatgaggaagtacct-
                        Panda  caggccacacatgttcttcccgcgctcgatgaggaagtacctg
               Pacific walrus  caggccgcacatgttcttcccacgctcgatgaggaagtacctg
                 Weddell seal  caggccgcacatgttcttcccgcgctcgatgaggaagtacctg
             Black flying-fox  cagcccgcacatgttcttcccgcgctcgatgaggaagtacctg
                      Megabat  cagcccgcacatgttcttcccgcgctcgatgaggaagtacctg
         David's myotis (bat)  cagcccgcacatgttcttcccgcgctcgatgaggaagtacctg
                        Shrew  cagcccacacatgttcttgccccgctcaatgagaaagtacctg
                     Elephant  cagaccacacatgttcttccctcgctcgatgaggaagtacctg
          Cape elephant shrew  cagtccgcacatgttcttccctcgctcgatgaggaagtacctg
                      Manatee  cagaccacacatgttcttccctcgctcgatgaggaagtacctg
             Cape golden mole  caggccgcacatgttcttcccgcgctcgatgaggaagtacctg
                       Tenrec  caggccacacatgttcttcccgcgctggatgaggaagtacct-
                     Aardvark  cagaccacacatgttcttccctcgctcaatgaggaagtacctg
                    Armadillo  caggccgcacatgttcttccctcgctcgatgaggaagtacctg
                      Opossum  aagaccacacatgttctttccacgctcaataaggaagtacctg
              Tasmanian devil  aagaccacacatgttctttccacgctcaataaggaagtacctg
                      Wallaby  aagaccacacatgttctttccacgctcaataaggaagtacctg
                  Rock pigeon  aagaccacacatatttttgccgcgttcaatgaggaagtaccta
                 Saker falcon  gagaccacacatattcttgccacgttcaataagaaagtaccta
             Peregrine falcon  gagaccacacatattcttgccacgttcaataagaaagtaccta
          Collared flycatcher  caggccacacatgttcttgccccgctcaatgaggaaatagctg
       White-throated sparrow  cagcccacacatgttcttgcctcgctcgataaggaaatacctg
                  Zebra finch  cagcccacacatgttcttgcctcgttcaataaggaaatacctg
           Tibetan ground jay  cagaccacacatgttcttgcctcgctcgataaggaaatacctg
                   Budgerigar  gaggccacacatattcttgccacgttcaataaggaagtaccta
                       Parrot  aagaccacacatgttcttgccacgttcaataaggaagtatcta
                 Mallard duck  aagaccacacatattcttgccacgttcaattaggaaatacctg
                      Chicken  aagaccacacatattcttgccccgttcaatgaggaagtaccta
                       Turkey  gagaccacacatattcttgcccctttcaatgaggaagtacct-
           American alligator  aaggccacacatgttcttcccacgctcgatgtggaagtacctg
              Green seaturtle  gagaccacacatattcttgccacgttcaatatagaagtagct-
               Painted turtle  gagaccgcacatattcttgccacgttcaataaggaagtagct-
     Chinese softshell turtle  gaggccacacatgttcttgccacgctcaatgtagaagtagct-
                   Coelacanth  aagaccacacatattcttcccacgttcaatataaaagtaccta
                    Tetraodon  tagtccgcacatgttcttcccccgttcgataaggaagtatctg
                         Fugu  tagtccacacatgttcttcccccgcatgataaggaagtatctg
                 Nile tilapia  aagtccacacatgttcttcccacgttcaatgaggaaatacctg
          Princess of Burundi  aagtccacacatgttcttcccacgttcaatgaggaaatacctg
        Burton's mouthbreeder  aagtccacacatgttcttcccacgttcaatgaggaaatacctg
                  Zebra mbuna  aagtccacacatgttcttcccacgttcaatgaggaaatacctg
          Pundamilia nyererei  aagtccacacatgttcttcccacgttcaatgaggaaatacctg
           Southern platyfish  gagtccacacatattctttcccctttcaataaggaagtacctg
                  Stickleback  cagtccgcacatgtttcttcctcgctcgatcatgaaatatctg
                 Atlantic cod  cagtccacacatattccttcctcgttcgataaggaaatatctg
                    Zebrafish  aagtccacacatgttctttcctctttcaatgtagaaatatctg
     Mexican tetra (cavefish)  aagaccacacatattctttcctcgctcgatgaagaaatatctg
                  Spotted gar  cagcccacacatgtttttccctctttcaatgtagaagtacctg
                Big brown bat  ===========================================
                       Lizard  ===========================================

Inserts between block 7 and 8 in window
B D                     Pika 6bp
  D   White-throated sparrow 374bp
B D       American alligator 2bp

Alignment block 8 of 1330 in window, 78922209 - 78922210, 2 bps 
B D                     Human  g-g
B D                     Chimp  g-g
B D                   Gorilla  g-g
B D                 Orangutan  a-g
B D                    Gibbon  g-g
B D                    Rhesus  g-g
B D       Crab-eating macaque  g-g
B D                    Baboon  g-g
B D              Green monkey  g-g
B D                  Marmoset  g-g
B D           Squirrel monkey  g-g
B D                  Bushbaby  g-g
           Chinese tree shrew  g-g
B D                  Squirrel  g-g
       Lesser Egyptian jerboa  g-g
                 Prairie vole  g-g
B D           Chinese hamster  t-g
               Golden hamster  g-g
B D                     Mouse  g-g
B D                       Rat  g-g
B D            Naked mole-rat  a-g
B D                Guinea pig  a-g
                   Chinchilla  a-g
             Brush-tailed rat  a-g
B D                    Rabbit  c-g
B D                      Pika  c-a
B D                       Pig  c-g
B D                    Alpaca  g-g
               Bactrian camel  g-g
B D                   Dolphin  c-a
                 Killer whale  c-a
             Tibetan antelope  g-g
B D                       Cow  g-g
B D                     Sheep  g-g
                Domestic goat  g-g
B D                     Horse  g-g
B D          White rhinoceros  g-g
B D                       Cat  g-g
B D                       Dog  g-g
B D                   Ferret   g-g
B D                     Panda  g-g
               Pacific walrus  g-g
                 Weddell seal  g-g
             Black flying-fox  g-g
B D                   Megabat  g-g
         David's myotis (bat)  c-g
B D                     Shrew  g-g
B D                  Elephant  g-g
          Cape elephant shrew  g-g
B D                   Manatee  a-g
             Cape golden mole  g-g
B D                    Tenrec  g-g
                     Aardvark  g-g
B D                 Armadillo  g-g
B D                   Opossum  gag
B D           Tasmanian devil  gaa
B D                   Wallaby  gag
B D        American alligator  --a
B D                Coelacanth  -ag
B D                 Tetraodon  -tg
B D                      Fugu  -cg
B D              Nile tilapia  -tg
          Princess of Burundi  -tg
        Burton's mouthbreeder  -tg
                  Zebra mbuna  -tg
          Pundamilia nyererei  -tg
           Southern platyfish  -tg
B D               Stickleback  -tt
B D              Atlantic cod  -ag
B D                 Zebrafish  -aa
     Mexican tetra (cavefish)  -tg
                  Spotted gar  -gg
               Big brown bat  ===
B D                    Lizard  ===
  D               Rock pigeon  ---
  D              Mallard duck  ---
  D       Collared flycatcher  ---
B D                    Turkey  ---
B D                   Chicken  ---
  D  Chinese softshell turtle  ---
          Tibetan ground jay  ---
B D                Budgerigar  ---
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D                    Parrot  ---
  D    White-throated sparrow  ===
B D               Zebra finch  ---
  D            Painted turtle  ---
  D           Green seaturtle  ---

Inserts between block 8 and 9 in window
B D               Coelacanth 2223bp

Alignment block 9 of 1330 in window, 78922211 - 78922215, 5 bps 
B D                     Human  c-ag----------a-a
B D                     Chimp  c-ag----------a-a
B D                   Gorilla  c-ag----------a-a
B D                 Orangutan  c-ag----------a-g
B D                    Gibbon  c-ag----------a-g
B D                    Rhesus  c-aa----------a-g
B D       Crab-eating macaque  c-aa----------a-g
B D                    Baboon  c-aa----------a-g
B D              Green monkey  c-aa----------a-g
B D                  Marmoset  c-ag----------a-g
B D           Squirrel monkey  c-ag----------a-g
B D                  Bushbaby  c-aa----------a-g
           Chinese tree shrew  c-ag----------g-g
B D                  Squirrel  c-cg----------a-g
       Lesser Egyptian jerboa  c-ag----------a-g
                 Prairie vole  c-ag----------a-g
B D           Chinese hamster  c-ag----------a-g
               Golden hamster  c-ag----------a-g
B D                     Mouse  c-ag----------a-g
B D                       Rat  t-ag----------a-g
B D            Naked mole-rat  c-ag----------a-g
B D                Guinea pig  g-gg----------a-g
                   Chinchilla  c-ag----------a-g
             Brush-tailed rat  c-ag----------a-g
B D                    Rabbit  c-ag----------a-g
B D                      Pika  c-ag----------g-g
B D                       Pig  c-ag----------a-g
B D                    Alpaca  c-ag----------a-g
               Bactrian camel  c-ag----------a-g
B D                   Dolphin  c-ag----------a-g
                 Killer whale  c-ag----------a-g
             Tibetan antelope  c-ag----------a-g
B D                       Cow  c-ag----------a-g
B D                     Sheep  c-ag----------a-g
                Domestic goat  c-ag----------a-g
B D                     Horse  c-ag----------a-g
B D          White rhinoceros  c-ag----------a-g
B D                       Cat  c-ag----------a-c
B D                       Dog  c-ag----------a-c
B D                   Ferret   c-gg----------g-c
B D                     Panda  c-ag----------a-c
               Pacific walrus  t-gg----------a-c
                 Weddell seal  c-gg----------a-c
             Black flying-fox  c-gg----------a-g
B D                   Megabat  c-ag----------a-g
         David's myotis (bat)  g-ga----------g-g
B D                     Shrew  --gg----------a-g
B D                  Elephant  c-ag----------a-g
          Cape elephant shrew  c-ag----------a-g
B D                   Manatee  c-ag----------a-g
             Cape golden mole  c-ag----------a-g
B D                    Tenrec  c-ag----------a-g
                     Aardvark  c-ag----------a-g
B D                 Armadillo  c-ag----------a-g
B D                   Opossum  c-aa----------a-c
B D           Tasmanian devil  c-aa----------t-c
B D                   Wallaby  c-aa----------t-c
  D               Rock pigeon  --aa----------a--
  D              Saker falcon  --ag----------a--
  D          Peregrine falcon  --ag----------a--
B D               Zebra finch  ---a----------a--
           Tibetan ground jay  ---a----------a--
B D                Budgerigar  --aa----------a--
  D                    Parrot  --aa----------a--
  D              Mallard duck  --ga----------a--
B D                   Chicken  --aa----------a--
B D                    Turkey  --aa----------a--
B D        American alligator  gcag----------aa-
  D           Green seaturtle  a-aa----------g--
  D            Painted turtle  a-aa----------a--
  D  Chinese softshell turtle  acaa----------a--
B D                 Tetraodon  --ag-------------
B D                      Fugu  --tg-------------
B D              Nile tilapia  --ag-------------
          Princess of Burundi  --ag-------------
        Burton's mouthbreeder  --ag-------------
                  Zebra mbuna  --ag-------------
          Pundamilia nyererei  --ag-------------
           Southern platyfish  --ag-------------
B D               Stickleback  --gg-------------
B D              Atlantic cod  --gg-------------
B D                 Zebrafish  --gagaaaa--------
     Mexican tetra (cavefish)  --tagaaga--------
                  Spotted gar  --gg-----gaaaa---
               Big brown bat  =================
B D                    Lizard  =================
B D                Coelacanth  =================
  D       Collared flycatcher  -----------------
  D    White-throated sparrow  =================

Inserts between block 9 and 10 in window
B D       American alligator 2122bp
          Southern platyfish 63bp
B D              Stickleback 7bp
B D             Atlantic cod 5bp

Alignment block 10 of 1330 in window, 78922216 - 78922217, 2 bps 
B D                     Human  a--g
B D                     Chimp  a--g
B D                   Gorilla  a--g
B D                 Orangutan  a--g
B D                    Gibbon  a--a
B D                    Rhesus  a--g
B D       Crab-eating macaque  a--g
B D                    Baboon  a--g
B D              Green monkey  a--g
B D                  Marmoset  a--g
B D           Squirrel monkey  a--g
B D                  Bushbaby  a--g
           Chinese tree shrew  a--g
B D                  Squirrel  a--g
       Lesser Egyptian jerboa  a--g
                 Prairie vole  a--g
B D           Chinese hamster  a--g
               Golden hamster  a--g
B D                     Mouse  a--g
B D                       Rat  a--g
B D            Naked mole-rat  a--a
B D                Guinea pig  a--g
                   Chinchilla  a--g
             Brush-tailed rat  a--a
B D                    Rabbit  a--g
B D                      Pika  a--g
B D                       Pig  g--g
B D                    Alpaca  g--g
               Bactrian camel  g--g
B D                   Dolphin  g--g
                 Killer whale  g--g
             Tibetan antelope  g--g
B D                       Cow  g--g
B D                     Sheep  g--g
                Domestic goat  g--g
B D                     Horse  a--g
B D          White rhinoceros  a--g
B D                       Cat  a--g
B D                       Dog  a--g
B D                   Ferret   a--g
B D                     Panda  a--g
               Pacific walrus  a--g
                 Weddell seal  a--g
             Black flying-fox  agcg
B D                   Megabat  agcg
         David's myotis (bat)  ggag
B D                     Shrew  g--g
B D                  Elephant  a--g
          Cape elephant shrew  a--c
B D                   Manatee  a--g
             Cape golden mole  a--g
B D                    Tenrec  a--g
                     Aardvark  a--g
B D                 Armadillo  a--g
B D                   Opossum  a--g
B D           Tasmanian devil  a--g
B D                   Wallaby  a--g
  D               Rock pigeon  a--a
  D              Saker falcon  a--g
  D          Peregrine falcon  a--g
  D       Collared flycatcher  g--a
B D               Zebra finch  a--g
           Tibetan ground jay  a--g
B D                Budgerigar  a--g
  D                    Parrot  a--g
  D              Mallard duck  a--g
B D                   Chicken  a--g
B D                    Turkey  a--g
  D           Green seaturtle  g--g
  D            Painted turtle  g--g
  D  Chinese softshell turtle  g--g
               Big brown bat  ====
B D                    Lizard  ====
B D              Atlantic cod  ====
          Southern platyfish  ====
                 Zebra mbuna  ----
B D              Nile tilapia  ----
         Pundamilia nyererei  ----
       Burton's mouthbreeder  ----
         Princess of Burundi  ----
                 Spotted gar  ----
B D                 Zebrafish  ----
B D                Coelacanth  ====
B D        American alligator  ====
B D                      Fugu  ----
    Mexican tetra (cavefish)  ----
B D                 Tetraodon  ----
B D               Stickleback  ====
  D    White-throated sparrow  ====

Alignment block 11 of 1330 in window, 78922218 - 78922218, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  a
B D                    Rabbit  c
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  g
B D                   Megabat  g
         David's myotis (bat)  g
B D                     Shrew  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
B D               Zebra finch  g
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
B D                 Tetraodon  g
B D                      Fugu  g
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D               Stickleback  a
B D              Atlantic cod  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
                  Spotted gar  a
               Big brown bat  =
B D                    Lizard  =
          Southern platyfish  =
B D                Coelacanth  =
B D        American alligator  =
  D    White-throated sparrow  =

Inserts between block 11 and 12 in window
B D                Tetraodon 79bp
B D                     Fugu 5bp
B D             Atlantic cod 366bp
                 Spotted gar 2bp

Alignment block 12 of 1330 in window, 78922219 - 78922221, 3 bps 
B D                     Human  gga
B D                     Chimp  gga
B D                   Gorilla  gga
B D                 Orangutan  gga
B D                    Gibbon  gga
B D                    Rhesus  gga
B D       Crab-eating macaque  gga
B D                    Baboon  gga
B D              Green monkey  gga
B D                  Marmoset  gga
B D           Squirrel monkey  gga
B D                  Bushbaby  gaa
           Chinese tree shrew  ggg
B D                  Squirrel  gag
       Lesser Egyptian jerboa  agg
                 Prairie vole  aag
B D           Chinese hamster  aag
               Golden hamster  gag
B D                     Mouse  agg
B D                       Rat  agg
B D            Naked mole-rat  a--
B D                Guinea pig  a--
                   Chinchilla  a--
             Brush-tailed rat  a--
B D                    Rabbit  ggg
B D                      Pika  ggg
B D                       Pig  ggg
B D                    Alpaca  agg
               Bactrian camel  ggg
B D                   Dolphin  ggg
                 Killer whale  ggg
             Tibetan antelope  ggg
B D                       Cow  ggg
B D                     Sheep  ggg
                Domestic goat  ggg
B D                     Horse  aca
B D          White rhinoceros  gtg
B D                       Cat  gtg
B D                       Dog  gcg
B D                   Ferret   gcg
B D                     Panda  gca
               Pacific walrus  gca
                 Weddell seal  gtg
             Black flying-fox  gtg
B D                   Megabat  gtg
         David's myotis (bat)  gtg
B D                     Shrew  cag
B D                  Elephant  gag
          Cape elephant shrew  gga
B D                   Manatee  ggg
             Cape golden mole  ggg
B D                    Tenrec  ggg
                     Aardvark  ggg
B D                 Armadillo  agg
B D                   Opossum  aga
B D           Tasmanian devil  aga
B D                   Wallaby  aga
  D               Rock pigeon  gaa
  D              Saker falcon  gaa
  D          Peregrine falcon  gaa
  D       Collared flycatcher  gag
B D               Zebra finch  gag
           Tibetan ground jay  gag
B D                Budgerigar  gaa
  D                    Parrot  gaa
  D              Mallard duck  gaa
B D                   Chicken  gaa
B D                    Turkey  gaa
  D           Green seaturtle  gaa
  D            Painted turtle  gaa
  D  Chinese softshell turtle  gac
B D                      Fugu  aaa
B D              Nile tilapia  gga
          Princess of Burundi  gga
        Burton's mouthbreeder  gga
                  Zebra mbuna  gga
          Pundamilia nyererei  gga
B D               Stickleback  aaa
B D                 Zebrafish  aga
     Mexican tetra (cavefish)  aat
                  Spotted gar  a--
               Big brown bat  ===
B D                    Lizard  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
B D                Coelacanth  ===
B D        American alligator  ===
B D                 Tetraodon  ===
  D    White-throated sparrow  ===

Inserts between block 12 and 13 in window
B D                      Pig 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
  D              Rock pigeon 4bp
  D             Saker falcon 612bp
  D         Peregrine falcon 100bp
  D      Collared flycatcher 4bp
B D              Zebra finch 4bp
          Tibetan ground jay 1518bp
B D               Budgerigar 4bp
  D                   Parrot 4bp
B D                     Fugu 70bp
B D             Nile tilapia 72bp
         Princess of Burundi 72bp
       Burton's mouthbreeder 72bp
                 Zebra mbuna 72bp
         Pundamilia nyererei 71bp
B D                Zebrafish 1620bp
    Mexican tetra (cavefish) 2bp

Alignment block 13 of 1330 in window, 78922222 - 78922222, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D                    Rabbit  c
B D                      Pika  c
B D                    Alpaca  a
               Bactrian camel  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  g
B D                   Megabat  g
         David's myotis (bat)  g
B D                     Shrew  c
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  g
  D               Rock pigeon  a
  D       Collared flycatcher  a
B D               Zebra finch  a
B D                Budgerigar  a
  D                    Parrot  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
                  Spotted gar  g
               Big brown bat  =
B D                    Lizard  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                 Zebrafish  =
B D                Coelacanth  =
B D        American alligator  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D                 Tetraodon  =
B D               Stickleback  -
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D    White-throated sparrow  =
B D                   Dolphin  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                       Pig  =
B D                  Squirrel  -
B D                Guinea pig  -
            Brush-tailed rat  -
B D            Naked mole-rat  -
                  Chinchilla  -

Inserts between block 13 and 14 in window
          Chinese tree shrew 3bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D                     Pika 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                    Shrew 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 2107bp
B D          Tasmanian devil 1923bp
B D                  Wallaby 2385bp
  D             Mallard duck 4bp
B D                  Chicken 533bp

Alignment block 14 of 1330 in window, 78922223 - 78922223, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D                      Pika  g
B D                       Pig  c
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  t
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
         David's myotis (bat)  c
B D                     Shrew  g
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  a
  D       Collared flycatcher  t
B D               Zebra finch  t
B D                Budgerigar  c
  D                    Parrot  c
  D           Green seaturtle  t
  D            Painted turtle  c
  D  Chinese softshell turtle  c
B D               Stickleback  t
                  Spotted gar  c
               Big brown bat  =
B D                    Lizard  =
B D                    Rabbit  -
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  -
B D        American alligator  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
  D              Mallard duck  =
B D                 Tetraodon  =
B D                    Turkey  -
B D                   Chicken  =
B D                   Wallaby  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                  Squirrel  -
B D                Guinea pig  -
            Brush-tailed rat  -
B D            Naked mole-rat  -
                  Chinchilla  -

Inserts between block 14 and 15 in window
B D               Budgerigar 411bp
  D                   Parrot 560bp
  D          Green seaturtle 963bp
  D           Painted turtle 979bp
B D              Stickleback 1bp

Alignment block 15 of 1330 in window, 78922224 - 78922226, 3 bps 
B D                     Human  tga
B D                     Chimp  tga
B D                   Gorilla  tga
B D                 Orangutan  tga
B D                    Gibbon  tga
B D                    Rhesus  tga
B D       Crab-eating macaque  tga
B D                    Baboon  tga
B D              Green monkey  tga
B D                  Marmoset  tga
B D           Squirrel monkey  tga
B D                  Bushbaby  tga
           Chinese tree shrew  tga
       Lesser Egyptian jerboa  tga
                 Prairie vole  tga
B D           Chinese hamster  tga
               Golden hamster  tga
B D                     Mouse  tga
B D                       Rat  tga
B D                    Rabbit  tga
B D                      Pika  tga
B D                       Pig  tga
B D                    Alpaca  tga
               Bactrian camel  tga
B D                   Dolphin  tga
                 Killer whale  tga
             Tibetan antelope  tga
B D                       Cow  tga
B D                     Sheep  tga
                Domestic goat  tga
B D                     Horse  tga
B D          White rhinoceros  tga
B D                       Cat  ggg
B D                       Dog  tgg
B D                   Ferret   tgg
B D                     Panda  tgg
               Pacific walrus  tgg
                 Weddell seal  -ga
             Black flying-fox  c--
B D                   Megabat  c--
         David's myotis (bat)  tga
B D                     Shrew  tga
B D                  Elephant  tga
          Cape elephant shrew  tga
B D                   Manatee  taa
             Cape golden mole  tga
B D                    Tenrec  -ga
                     Aardvark  tga
B D                 Armadillo  ggg
  D               Rock pigeon  --t
  D              Mallard duck  -ca
B D                    Turkey  cga
  D  Chinese softshell turtle  aga
B D               Stickleback  taa
     Mexican tetra (cavefish)  tga
                  Spotted gar  tta
               Big brown bat  ===
B D                    Lizard  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
B D        American alligator  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
  D       Collared flycatcher  ---
B D                   Chicken  ===
B D                   Wallaby  ===
          Tibetan ground jay  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ---
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                  Squirrel  ---
B D                Guinea pig  ---
            Brush-tailed rat  ---
B D            Naked mole-rat  ---
                  Chinchilla  ---

Inserts between block 15 and 16 in window
    Mexican tetra (cavefish) 420bp
                 Spotted gar 309bp

Alignment block 16 of 1330 in window, 78922227 - 78922228, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  gg
       Lesser Egyptian jerboa  gc
                 Prairie vole  gg
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  ag
B D            Naked mole-rat  -g
B D                Guinea pig  -g
                   Chinchilla  -g
             Brush-tailed rat  -g
B D                    Rabbit  gg
B D                      Pika  gg
B D                       Pig  gg
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gc
B D                       Cow  gg
B D                     Sheep  gc
                Domestic goat  gc
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
         David's myotis (bat)  gg
B D                     Shrew  gc
B D                  Elephant  cg
          Cape elephant shrew  gg
B D                   Manatee  gg
             Cape golden mole  gg
B D                    Tenrec  gg
                     Aardvark  gg
B D                 Armadillo  gg
  D               Rock pigeon  gc
  D       Collared flycatcher  gg
B D               Zebra finch  gg
  D              Mallard duck  gg
B D                    Turkey  gg
  D  Chinese softshell turtle  gg
B D               Stickleback  aa
               Big brown bat  ==
B D                    Lizard  ==
B D              Atlantic cod  ==
          Southern platyfish  ==
                 Zebra mbuna  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D                 Zebrafish  ==
B D                Coelacanth  ==
B D        American alligator  ==
B D                      Fugu  ==
    Mexican tetra (cavefish)  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D                   Wallaby  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Megabat  --
B D                   Opossum  ==
            Black flying-fox  --
B D                  Squirrel  --

Inserts between block 16 and 17 in window
B D                    Horse 1bp
  D              Rock pigeon 2bp
  D      Collared flycatcher 2bp
B D              Zebra finch 2bp
  D             Mallard duck 1bp
B D                   Turkey 250bp

Alignment block 17 of 1330 in window, 78922229 - 78922247, 19 bps 
B D                     Human  cc--cggcc---------ggcggt--ctcccc---
B D                     Chimp  cc--cggcc---------ggcggt--ctcccc---
B D                   Gorilla  cc--cggcc---------ggtggt--ctcccc---
B D                 Orangutan  cc--cagcc---------agcggt--ctcccc---
B D                    Gibbon  cc--tggcc---------ggcggt--ctcccc---
B D                    Rhesus  cc--cagcc---------ggcggt--ctcctg---
B D       Crab-eating macaque  cc--cagcc---------ggcggt--ctcctg---
B D                    Baboon  cc--cagcc---------ggcggt--ctcctg---
B D              Green monkey  cc--cagcc---------ggcggt--ctcctg---
B D                  Marmoset  cc--cggcc---------ggtggt--atcctc---
B D           Squirrel monkey  cc--cggcc---------ggtggt--ctcctc---
B D                  Bushbaby  cc--t--------------gtggtgcctcctc---
           Chinese tree shrew  cctgcaggc---------ggtggc--ctc------
       Lesser Egyptian jerboa  cg--aggc------------aggc--atccgt---
                 Prairie vole  cc--tgact---------agtggc--atccat---
B D           Chinese hamster  cc--tgact---------agtggc--agctgt---
               Golden hamster  cc--tgact---------agtgg------------
B D                     Mouse  ac--tgatt---------agtagc--atcttc---
B D                       Rat  ac--tgact---------agtggc--atctgt---
B D            Naked mole-rat  tt--tggct---------gttggt--gtcctc---
B D                Guinea pig  tc--t-g-t---------gttggt--gacctc---
                   Chinchilla  tc--tgg-t---------gttgct--gttttc---
             Brush-tailed rat  cc--tgg-c---------gttggt--gttttc---
B D                    Rabbit  cc--tg-ct---------ggccgc--tccctc---
B D                      Pika  cc--tgcct---------ggcagc--tccagc---
B D                       Pig  cc--tggct---------ggtggc--ttcctt---
B D                    Alpaca  cc--cggct---------ggtggc--ttc------
               Bactrian camel  cc--cagct---------ggtggc--ttc------
B D                   Dolphin  cg--tggct---------ggcggc--ttcctc---
                 Killer whale  cg--tggct---------ggcggc--ttcctc---
             Tibetan antelope  cc--tga----------------------------
B D                       Cow  cc--tgg----------------------------
B D                     Sheep  cc--tgg----------------------------
                Domestic goat  cc--tgg----------------------------
B D                     Horse  cc--tggct---------gggggc--ttcctc---
B D          White rhinoceros  cc--tggct---------ggaggc--ttcctc---
B D                       Cat  cc--tggct----------ggagc--ttcctc---
B D                       Dog  ac--gggct----------ggggc--tgcctc---
B D                   Ferret   cc--tggcc-----------gggc--tccgtc---
B D                     Panda  cc--tggct----------ggggc--ttcctc---
               Pacific walrus  cc--tggct----------ggggc--ttcctt---
                 Weddell seal  cc--tggct----------ggggc--ttcctc---
             Black flying-fox  ct--tagtg----------gagcc--c--------
B D                   Megabat  ct--tagcg----------gagcc--c--------
         David's myotis (bat)  cc--tggcg----------ggcgg--g--------
B D                     Shrew  cc--agggtggctgtggggaggtc--tgcctc---
B D                  Elephant  tt--g-gct---------ggtggc--ctccac---
          Cape elephant shrew  cc--t-act---------ggtggc--tcccac---
B D                   Manatee  tc--a-gct---------ggtggc--tcccta---
             Cape golden mole  cc--tggct---------gctgac--tc--ac---
B D                    Tenrec  cc--c-gct---------ggtgac--tcctac---
                     Aardvark  cc--cagct---------tgtgac--tcacat---
B D                 Armadillo  cc--t----------------ggc--tttc-t---
  D               Rock pigeon  -----------atgagcgagtgat--cccttc---
  D       Collared flycatcher  -----------gtga--gagtgtt--ccc------
B D               Zebra finch  -----------gtgagcgagcgtt--cccccc---
  D              Mallard duck  -----------atgagtgagtatt--ccctgc---
  D  Chinese softshell turtle  ------------tcggtgagcaca--cccctt---
B D               Stickleback  -----------------agttggc--cacgtgatc
               Big brown bat  ===================================
B D                    Lizard  ===================================
B D              Atlantic cod  ===================================
          Southern platyfish  ===================================
                 Zebra mbuna  ===================================
B D              Nile tilapia  ===================================
         Pundamilia nyererei  ===================================
       Burton's mouthbreeder  ===================================
         Princess of Burundi  ===================================
                 Spotted gar  ===================================
B D                 Zebrafish  ===================================
B D                Coelacanth  ===================================
B D        American alligator  ===================================
B D                      Fugu  ===================================
    Mexican tetra (cavefish)  ===================================
B D                 Tetraodon  ===================================
B D                    Turkey  ===================================
B D                   Chicken  ===================================
B D                   Wallaby  ===================================
          Tibetan ground jay  ===================================
B D                Budgerigar  ===================================
  D          Peregrine falcon  ===================================
  D              Saker falcon  ===================================
  D                    Parrot  ===================================
  D    White-throated sparrow  ===================================
B D           Tasmanian devil  ===================================
  D            Painted turtle  ===================================
  D           Green seaturtle  ===================================
B D                   Opossum  ===================================
B D                  Squirrel  -----------------------------------

Inserts between block 17 and 18 in window
  D      Collared flycatcher 2bp
B D              Zebra finch 2925bp
  D             Mallard duck 4bp
  D Chinese softshell turtle 4bp

Alignment block 18 of 1330 in window, 78922248 - 78922251, 4 bps 
B D                     Human  acca
B D                     Chimp  acca
B D                   Gorilla  acca
B D                 Orangutan  acca
B D                    Gibbon  acca
B D                    Rhesus  accg
B D       Crab-eating macaque  accg
B D                    Baboon  acca
B D              Green monkey  acca
B D                  Marmoset  acca
B D           Squirrel monkey  acca
B D                  Bushbaby  accg
       Lesser Egyptian jerboa  acca
                 Prairie vole  acta
B D           Chinese hamster  acca
B D                     Mouse  gcct
B D                       Rat  acct
B D            Naked mole-rat  acaa
B D                Guinea pig  agcg
                   Chinchilla  acta
             Brush-tailed rat  acca
B D                    Rabbit  ctgg
B D                      Pika  ccct
B D                       Pig  accc
B D                   Dolphin  tcca
                 Killer whale  tcca
B D                     Horse  gcca
B D          White rhinoceros  atca
B D                       Cat  acca
B D                       Dog  acgg
B D                   Ferret   ccca
B D                     Panda  acca
               Pacific walrus  acca
                 Weddell seal  acca
             Black flying-fox  -cgg
B D                   Megabat  -cgg
         David's myotis (bat)  -cgg
B D                     Shrew  caca
B D                  Elephant  acca
          Cape elephant shrew  agta
B D                   Manatee  acca
             Cape golden mole  acca
B D                    Tenrec  acca
                     Aardvark  acca
B D                 Armadillo  gcca
  D               Rock pigeon  cc--
  D       Collared flycatcher  ct--
  D              Mallard duck  cc--
  D  Chinese softshell turtle  cc--
B D               Stickleback  actg
              Golden hamster  ----
               Big brown bat  ====
B D                    Lizard  ====
B D              Atlantic cod  ====
          Southern platyfish  ====
                 Zebra mbuna  ====
B D              Nile tilapia  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
                 Spotted gar  ====
B D                 Zebrafish  ====
B D                Coelacanth  ====
B D        American alligator  ====
B D                      Fugu  ====
    Mexican tetra (cavefish)  ====
B D                 Tetraodon  ====
B D                    Turkey  ====
B D                   Chicken  ====
B D                   Wallaby  ====
          Tibetan ground jay  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
  D    White-throated sparrow  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                       Cow  ----
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                    Alpaca  ----
              Bactrian camel  ----
B D                   Opossum  ====
B D                  Squirrel  ----
          Chinese tree shrew  ----

Inserts between block 18 and 19 in window
  D              Rock pigeon 562bp
  D             Mallard duck 1bp
  D Chinese softshell turtle 2bp

Alignment block 19 of 1330 in window, 78922252 - 78922256, 5 bps 
B D                     Human  caggc
B D                     Chimp  caggc
B D                   Gorilla  caggc
B D                 Orangutan  caggc
B D                    Gibbon  caggc
B D                    Rhesus  caggc
B D       Crab-eating macaque  caggc
B D                    Baboon  caggc
B D              Green monkey  caggc
B D                  Marmoset  cagac
B D           Squirrel monkey  caggc
B D                  Bushbaby  cacag
B D                  Squirrel  ---at
       Lesser Egyptian jerboa  cagat
                 Prairie vole  cacag
B D           Chinese hamster  cacag
               Golden hamster  --cag
B D                     Mouse  cagaa
B D                       Rat  cagaa
B D            Naked mole-rat  --gaa
B D                Guinea pig  tagga
                   Chinchilla  cagaa
             Brush-tailed rat  ccgaa
B D                    Rabbit  cgcac
B D                      Pika  caggc
B D                       Pig  caggc
B D                   Dolphin  caggc
                 Killer whale  caggc
B D                     Horse  tagac
B D          White rhinoceros  cagac
B D                       Cat  cagac
B D                       Dog  cggac
B D                   Ferret   ctgtc
B D                     Panda  ctgcc
               Pacific walrus  ctgcc
                 Weddell seal  ctgcc
             Black flying-fox  gtggc
B D                   Megabat  gtggc
         David's myotis (bat)  gcgga
B D                     Shrew  cctgc
B D                  Elephant  cagac
          Cape elephant shrew  cagat
B D                   Manatee  cagac
             Cape golden mole  cagac
B D                    Tenrec  cagac
                     Aardvark  tgggc
B D                 Armadillo  caggc
  D       Collared flycatcher  cgggc
  D              Mallard duck  ---gc
  D  Chinese softshell turtle  ccggc
B D               Stickleback  gaagc
               Big brown bat  =====
B D                    Lizard  =====
B D              Atlantic cod  =====
          Southern platyfish  =====
                 Zebra mbuna  =====
B D              Nile tilapia  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
                 Spotted gar  =====
B D                 Zebrafish  =====
B D                Coelacanth  =====
  D               Rock pigeon  =====
B D        American alligator  =====
B D                      Fugu  =====
    Mexican tetra (cavefish)  =====
B D                 Tetraodon  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                   Wallaby  =====
          Tibetan ground jay  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
B D               Zebra finch  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                       Cow  -----
               Domestic goat  -----
B D                     Sheep  -----
            Tibetan antelope  -----
B D                    Alpaca  -----
              Bactrian camel  -----
B D                   Opossum  =====
          Chinese tree shrew  -----

Inserts between block 19 and 20 in window
  D      Collared flycatcher 1bp
  D             Mallard duck 3bp
  D Chinese softshell turtle 887bp

Alignment block 20 of 1330 in window, 78922257 - 78922259, 3 bps 
B D                     Human  ctt
B D                     Chimp  ctt
B D                   Gorilla  ctt
B D                 Orangutan  ctt
B D                    Gibbon  ctt
B D                    Rhesus  ctt
B D       Crab-eating macaque  ctt
B D                    Baboon  ctt
B D              Green monkey  ctt
B D                  Marmoset  ctt
B D           Squirrel monkey  ctt
B D                  Bushbaby  ctt
           Chinese tree shrew  --t
B D                  Squirrel  ctt
       Lesser Egyptian jerboa  ctt
                 Prairie vole  ctt
B D           Chinese hamster  ctt
               Golden hamster  ctt
B D                     Mouse  ctt
B D                       Rat  ctt
B D            Naked mole-rat  tat
B D                Guinea pig  ctt
                   Chinchilla  ctt
             Brush-tailed rat  ctt
B D                    Rabbit  cct
B D                      Pika  ctt
B D                       Pig  ctt
B D                   Dolphin  cct
                 Killer whale  cct
B D                     Horse  ctt
B D          White rhinoceros  ctt
B D                       Cat  ctt
B D                       Dog  ctt
B D                   Ferret   ctc
B D                     Panda  ctt
               Pacific walrus  ctt
                 Weddell seal  ctt
             Black flying-fox  ctg
B D                   Megabat  ctg
         David's myotis (bat)  cct
B D                     Shrew  cct
B D                  Elephant  ctt
          Cape elephant shrew  att
B D                   Manatee  ctt
             Cape golden mole  ctt
B D                    Tenrec  ctt
                     Aardvark  ctt
B D                 Armadillo  ctt
  D       Collared flycatcher  c--
  D              Mallard duck  c--
B D               Stickleback  ctt
               Big brown bat  ===
B D                    Lizard  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ===
B D                      Fugu  ===
    Mexican tetra (cavefish)  ===
B D                 Tetraodon  ===
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                       Cow  ---
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
B D                    Alpaca  ---
              Bactrian camel  ---
B D                   Opossum  ===

Inserts between block 20 and 21 in window
B D              Stickleback 30bp

Alignment block 21 of 1330 in window, 78922260 - 78922262, 3 bps 
B D                     Human  tct
B D                     Chimp  tct
B D                   Gorilla  tct
B D                 Orangutan  tct
B D                    Gibbon  tct
B D                    Rhesus  tct
B D       Crab-eating macaque  tct
B D                    Baboon  tct
B D              Green monkey  tct
B D                  Marmoset  tct
B D           Squirrel monkey  tct
B D                  Bushbaby  tct
           Chinese tree shrew  tct
B D                  Squirrel  tct
       Lesser Egyptian jerboa  tct
                 Prairie vole  tct
B D           Chinese hamster  tct
               Golden hamster  tct
B D                     Mouse  tct
B D                       Rat  tct
B D            Naked mole-rat  tct
B D                Guinea pig  tct
                   Chinchilla  cct
             Brush-tailed rat  tct
B D                    Rabbit  tct
B D                      Pika  tct
B D                       Pig  tct
B D                   Dolphin  tct
                 Killer whale  tct
B D                     Horse  tct
B D          White rhinoceros  tct
B D                       Cat  tct
B D                       Dog  cct
B D                   Ferret   tct
B D                     Panda  tct
               Pacific walrus  tcc
                 Weddell seal  tct
             Black flying-fox  gcc
B D                   Megabat  gcc
         David's myotis (bat)  tcc
B D                     Shrew  tcc
B D                  Elephant  tct
          Cape elephant shrew  tct
B D                   Manatee  tct
             Cape golden mole  tct
B D                    Tenrec  tct
                     Aardvark  tct
B D                 Armadillo  tct
               Big brown bat  ===
B D                    Lizard  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ===
B D                      Fugu  ===
    Mexican tetra (cavefish)  ===
  D              Mallard duck  ---
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                       Cow  ---
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
B D                    Alpaca  ---
              Bactrian camel  ---
B D                   Opossum  ===

Inserts between block 21 and 22 in window
B D                    Shrew 81bp

Alignment block 22 of 1330 in window, 78922263 - 78922267, 5 bps 
B D                     Human  ag-aat
B D                     Chimp  ag-aat
B D                   Gorilla  ag-aat
B D                 Orangutan  ag-aat
B D                    Gibbon  ag-aat
B D                    Rhesus  ag-aat
B D       Crab-eating macaque  ag-aat
B D                    Baboon  ag-aat
B D              Green monkey  ag-aat
B D                  Marmoset  ag-aat
B D           Squirrel monkey  ag-aat
B D                  Bushbaby  gg-aat
           Chinese tree shrew  gg-a--
B D                  Squirrel  ag-aat
       Lesser Egyptian jerboa  ag-aat
                 Prairie vole  ag-aat
B D           Chinese hamster  ag-aat
               Golden hamster  agaaat
B D                     Mouse  ag-aat
B D                       Rat  gg-aat
B D            Naked mole-rat  gc-aat
B D                Guinea pig  gg-aat
                   Chinchilla  ag-aat
             Brush-tailed rat  gg-aat
B D                    Rabbit  gg-aaa
B D                      Pika  gg-aag
B D                       Pig  gg-aa-
B D                   Dolphin  gg-aa-
                 Killer whale  gg-aa-
B D                     Horse  gg-aat
B D          White rhinoceros  gg-aat
B D                       Cat  gg-aag
B D                       Dog  ag-gat
B D                   Ferret   gc-cgg
B D                     Panda  gg-aat
               Pacific walrus  gg-aat
                 Weddell seal  gg-aat
             Black flying-fox  g-----
B D                   Megabat  g-----
         David's myotis (bat)  gg-ggt
B D                  Elephant  gg-tat
          Cape elephant shrew  ag-tat
B D                   Manatee  gg-tag
             Cape golden mole  gg-tat
B D                    Tenrec  ag-aat
                     Aardvark  gc-t--
B D                 Armadillo  gg-cat
  D       Collared flycatcher  ag-cac
  D              Mallard duck  ag-cat
B D                     Shrew  ======
               Big brown bat  ======
B D                    Lizard  ======
B D              Atlantic cod  ======
          Southern platyfish  ======
                 Zebra mbuna  ======
B D              Nile tilapia  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
                 Spotted gar  ======
B D                 Zebrafish  ======
B D                Coelacanth  ======
  D               Rock pigeon  ======
B D        American alligator  ======
B D                      Fugu  ======
    Mexican tetra (cavefish)  ======
B D                 Tetraodon  ======
B D               Stickleback  ======
B D                    Turkey  ======
B D                   Chicken  ======
B D                   Wallaby  ======
  D  Chinese softshell turtle  ======
          Tibetan ground jay  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
  D    White-throated sparrow  ======
B D               Zebra finch  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                       Cow  ------
               Domestic goat  ------
B D                     Sheep  ------
            Tibetan antelope  ------
B D                    Alpaca  ------
              Bactrian camel  ------
B D                   Opossum  ======

Inserts between block 22 and 23 in window
B D                   Tenrec 2370bp

Alignment block 23 of 1330 in window, 78922268 - 78922293, 26 bps 
B D                     Human  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D                     Chimp  gttctg--ctgct-caccaag----a--------gctgact---------------------
B D                   Gorilla  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D                 Orangutan  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D                    Gibbon  gttttg--ctgct-caccaag----a--------gctgatt---------------------
B D                    Rhesus  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D       Crab-eating macaque  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D                    Baboon  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D              Green monkey  gttttg--ctgct-caccaag----a--------gctgact---------------------
B D                  Marmoset  gttctg--ctgct-caccaag----a--------gctgact---------------------
B D           Squirrel monkey  gttcca--ctgct-caccaag----a--------gctgact---------------------
B D                  Bushbaby  gtcttg--ctgct-cacccag----a--------tctggct---------------------
           Chinese tree shrew  -------------------ag----a--------gccaact---------------------
B D                  Squirrel  gtcctg--ccact-caccaag----a--------cctgact---------------------
       Lesser Egyptian jerboa  gctctg--ctgctcagccaag----a--------tccagct---------------------
                 Prairie vole  gttc-----tgct-gc---------a--------catgact---------------------
B D           Chinese hamster  gttc-----tgca-aaccaag----a--------catgact---------------------
               Golden hamster  gttc-----tgca-aaccaag----a--------catgact---------------------
B D                     Mouse  gttctg--gtgca-aaccaa-----a------------act---------------------
B D                       Rat  gttctg--gtgca-aaccag-----a--------cttgact---------------------
B D            Naked mole-rat  gttctc--ttgcc-caccaag----a--------cctgact---------------------
B D                Guinea pig  gttctg--ctgcc-caccaag----a--------cttgact---------------------
                   Chinchilla  gttttg--gtgcc-caccgga----a--------cctgact---------------------
             Brush-tailed rat  gttcta--ctgcc-caccaag----a--------cccgact---------------------
B D                    Rabbit  gttctg--ccgcc-caccggacacta--------attaatt---------------------
B D                      Pika  gttctg--ctgcc-cacggag----a--------gctcatg---------------------
B D                       Pig  --------cca--------ag----a--------tctggct---------------------
B D                    Alpaca  -----------------------------------ctcacc---------------------
               Bactrian camel  -----------------------------------ctcacc---------------------
B D                   Dolphin  --------cca--------ag----g--------tctgact---------------------
                 Killer whale  --------cca--------ag----g--------tctgact---------------------
             Tibetan antelope  --------cca--------ag----a--------tctgact---------------------
B D                       Cow  --------cca--------ag----a--------tctgact---------------------
B D                     Sheep  --------cca--------ag----a--------tctgact---------------------
                Domestic goat  --------cca--------ag----a--------tctgagt---------------------
B D                     Horse  gttttg--ttgct-caccaag----a--------tctgact---------------------
B D          White rhinoceros  gttttg--ctgct-caccaag----a--------tctgcct---------------------
B D                       Cat  gtttta--ccgct-caccaag----a--------tctggcc---------------------
B D                       Dog  gctgta--cca------cgag----c--------tctgact---------------------
B D                   Ferret   gctctg--ctgcc-ccccga--------------cctgact---------------------
B D                     Panda  gttctgtaccgct-ccccgag----g--------tctgacc---------------------
               Pacific walrus  gttctg--ccact-ccccgag----a--------tctgact---------------------
                 Weddell seal  gttcta--ccatt-ccccaag----g--------tctgact---------------------
             Black flying-fox  ----cg--cagc-------ag----g--------gctgact---------------------
B D                   Megabat  ----cg--cagc-------ag----g--------gctgact---------------------
         David's myotis (bat)  g-tctg--ctgct-ccccgag----a--------cccgact---------------------
B D                  Elephant  gttttg--ctgct-t-------------------gctaact---------------------
          Cape elephant shrew  gttctg--ctgct-ccccaag----g--------gctcacc---------------------
B D                   Manatee  gttttg--ctgct-caccaag----g--------tctaact---------------------
             Cape golden mole  gctttg--ccgct-caccgag----g--------acaaact---------------------
                     Aardvark  gttttc--ctgct-caccaag----g--------tctaact---------------------
B D                 Armadillo  gttctg--ctgcc-ca-caag----a--------tctgact---------------------
  D       Collared flycatcher  -------------------------tggggagcccctggcagtgccccaggccaggctggac
  D              Mallard duck  -------------------------g--------cctgaca-----ccgacatacggtgact
B D                    Tenrec  ==============================================================
B D                     Shrew  ==============================================================
               Big brown bat  ==============================================================
B D                    Lizard  ==============================================================
B D              Atlantic cod  ==============================================================
          Southern platyfish  ==============================================================
                 Zebra mbuna  ==============================================================
B D              Nile tilapia  ==============================================================
         Pundamilia nyererei  ==============================================================
       Burton's mouthbreeder  ==============================================================
         Princess of Burundi  ==============================================================
                 Spotted gar  ==============================================================
B D                 Zebrafish  ==============================================================
B D                Coelacanth  ==============================================================
  D               Rock pigeon  ==============================================================
B D        American alligator  ==============================================================
B D                      Fugu  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
B D                 Tetraodon  ==============================================================
B D               Stickleback  ==============================================================
B D                    Turkey  ==============================================================
B D                   Chicken  ==============================================================
B D                   Wallaby  ==============================================================
  D  Chinese softshell turtle  ==============================================================
          Tibetan ground jay  ==============================================================
B D                Budgerigar  ==============================================================
  D          Peregrine falcon  ==============================================================
  D              Saker falcon  ==============================================================
  D                    Parrot  ==============================================================
  D    White-throated sparrow  ==============================================================
B D               Zebra finch  ==============================================================
B D           Tasmanian devil  ==============================================================
  D            Painted turtle  ==============================================================
  D           Green seaturtle  ==============================================================
B D                   Opossum  ==============================================================

Inserts between block 23 and 24 in window
            Black flying-fox 70bp
B D                  Megabat 4bp
        David's myotis (bat) 12bp

Alignment block 24 of 1330 in window, 78922294 - 78922310, 17 bps 
B D                     Human  tca--ggggtg-agaccctc
B D                     Chimp  tca--ggggtg-agaccctc
B D                   Gorilla  tca--ggggtg-agaccctc
B D                 Orangutan  tca--ggggtg-agaccctc
B D                    Gibbon  tca--ggggtg-agaccctc
B D                    Rhesus  tta--gggatg-agaccctc
B D       Crab-eating macaque  tta--gggatg-agaccctc
B D                    Baboon  tta--gggatg-agaccctc
B D              Green monkey  tta--gggatg-agaccctc
B D                  Marmoset  cca--gggatg-agaccctc
B D           Squirrel monkey  cca--gggatg-tgaccctc
B D                  Bushbaby  cca--gggatt-aggtcctc
           Chinese tree shrew  ctg--gggact-tggccctc
B D                  Squirrel  cca--gggatt-aagccctc
       Lesser Egyptian jerboa  ccagggggatt-aggccctc
                 Prairie vole  cca--gggatt-ttgccctc
B D           Chinese hamster  cca--gggatt-aggccctc
               Golden hamster  cca--gggatt-aggccctc
B D                     Mouse  tga--gagatt-aggccctc
B D                       Rat  tga--gagatt-gggccctc
B D            Naked mole-rat  cca--gggatt-aggtcctc
B D                Guinea pig  gca--gggatt-aaggcctc
                   Chinchilla  cca--ggggttgggggcctc
             Brush-tailed rat  ccc--agggtt-agggcctc
B D                    Rabbit  cca--gggact-cagccttt
B D                      Pika  cca--gcaaca-gagctttc
B D                       Pig  -ca--gggatc-aggccctc
B D                    Alpaca  cct--ggtctt-c--ccctc
               Bactrian camel  cct--ggcttt-t--ccctc
B D                   Dolphin  cca--gggatt-aggccctc
                 Killer whale  cca--gggatt-aggccctc
             Tibetan antelope  cca--ggggct-aggccctc
B D                       Cow  cca--ggggct-aggccctc
B D                     Sheep  cca--ggggct-aggccctc
                Domestic goat  cca--gggg-t-aggccctc
B D                     Horse  cca--gagatt-aggctctc
B D          White rhinoceros  cca--gagatt-aggccctc
B D                       Cat  ccg--ggggtg-agggcgtc
B D                       Dog  cca--ggggcg-atggc---
B D                   Ferret   cca--gggctg-agg-----
B D                     Panda  cca--gggtta-tg------
               Pacific walrus  cca--ggagtg-agggc---
                 Weddell seal  cca--ggggtg-agggc---
B D                   Megabat  ttt--a---ca-agg-----
         David's myotis (bat)  cct--gggttg-aggct---
B D                  Elephant  ctg--gggatt-gtgcgctt
          Cape elephant shrew  ctg--ggtagt-gtgtgcgc
B D                   Manatee  ctg--gggatt-gtgcactc
             Cape golden mole  ctg--gggatg-gtgtgctc
                     Aardvark  c----aggatt-atatgttc
B D                 Armadillo  cc---aggatc-gtgccctc
  D       Collared flycatcher  act--gggctg-ggcccccc
  D              Mallard duck  gct--gtcatg-tgagttcc
B D                    Tenrec  ====================
B D                     Shrew  ====================
               Big brown bat  ====================
B D                    Lizard  ====================
B D              Atlantic cod  ====================
          Southern platyfish  ====================
                 Zebra mbuna  ====================
B D              Nile tilapia  ====================
         Pundamilia nyererei  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
                 Spotted gar  ====================
B D                 Zebrafish  ====================
B D                Coelacanth  ====================
  D               Rock pigeon  ====================
B D        American alligator  ====================
B D                      Fugu  ====================
    Mexican tetra (cavefish)  ====================
B D                 Tetraodon  ====================
B D               Stickleback  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
B D                   Wallaby  ====================
  D  Chinese softshell turtle  ====================
          Tibetan ground jay  ====================
B D                Budgerigar  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D                    Parrot  ====================
  D    White-throated sparrow  ====================
B D               Zebra finch  ====================
B D           Tasmanian devil  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D                   Opossum  ====================
            Black flying-fox  ====================

Inserts between block 24 and 25 in window
  D      Collared flycatcher 1279bp
  D             Mallard duck 2bp

Alignment block 25 of 1330 in window, 78922311 - 78922348, 38 bps 
B D                     Human  ta-----aattt-----------attcata-----aaac-ag----------tag-c-------attcgg
B D                     Chimp  ta-----aattt-----------attcata-----aaac-ag----------tag-c-------attcgg
B D                   Gorilla  ta-----aattt-----------attcata-----aaac-ag----------tag-c-------attcgg
B D                 Orangutan  ta-----aattt-----------attcata-----aaac-ag----------tag-c-------attcag
B D                    Gibbon  ta-----aattt-----------attcata-----aaac-ag----------tag-c-------attcag
B D                    Rhesus  tg-----aattt-----------attcata-----aaac-ag----------tag-c-------attcag
B D       Crab-eating macaque  tg-----aattt-----------attcata-----aaac-ag----------tag-c-------attcag
B D                    Baboon  tg-----aattt-----------attcata-----aaac-ag----------tag-c-------attcag
B D              Green monkey  tg-----aattt-----------attcata-----aaac-ag----------tag-c-------attcag
B D                  Marmoset  tg-----aattt-----------attcata-----aaac-ag----------cag-c-------attcag
B D           Squirrel monkey  tg-----aattt-----------attcatg-----gaac-ag----------cag-c-------attcag
B D                  Bushbaby  tg-----aactt-----------attcata-----aaac-ag----------tag-c-------actggg
           Chinese tree shrew  gg-----aattccatttattctgatccatatttggaaac-ag----------tac-c-------actggg
B D                  Squirrel  tg-----aattt-----------attcatg-----aaac-ag----------tgg-c-------attggg
       Lesser Egyptian jerboa  tg-----aattt-----------atttata-----gaactaa----------ctt-cacagtgacaccgg
                 Prairie vole  tg-----aattt-----------attcata-----gaac-aa----------cta-c-------catggc
B D           Chinese hamster  tg-----aattt-----------attcata-----gaac-aa----------cta-c-------catggg
               Golden hamster  tg-----aattt-----------attcata-----gaac-aa----------ttg-c-------catggg
B D                     Mouse  tg-----tattt-----------cttcaca-----gaac-ag----------cta-t-------t-----
B D                       Rat  tgtatt-tattt-----------attcaca-----gaac-ag----------cta-c-------cacagg
B D            Naked mole-rat  ta-----aattt-----------attcata-----taat-gg----------tac-c-------attggg
B D                Guinea pig  ca-----cattt-----------attcatg-----gagc-ag----------taa-c-------attggg
                   Chinchilla  ca-----aattt-----------attcatg-----gaac-ag----------taa-c-------attggg
             Brush-tailed rat  ca-----aattt-----------attcatg-----gaac-ag----------taa-t-------attggg
B D                    Rabbit  tg-----gattt-----------ggtcatg-----acac-ag----------tgg-c-------cgtggg
B D                      Pika  tg-----gatgt-----------agtccgg-----caac-ag----------tg----------------
B D                       Pig  tg-----tattt-----------actcaga-----agac-aa----------cag-c-------gttggg
B D                    Alpaca  tg-----gattt-----------attcata-----aa---------------cag-c-------gttggg
               Bactrian camel  tg-----gattt-----------attcata-----aa---------------cag-c-------gttggg
B D                   Dolphin  tg-----aactt-----------gctcaca-----aaac-ag----------cag-t-------actggg
                 Killer whale  tg-----aactt-----------gctcaca-----aaac-ag----------cag-t-------actggg
             Tibetan antelope  c------tattt-----------attcaca-----aaag-ag----------tag-c-------gctggg
B D                       Cow  c------cattt-----------attcaca-----aaag-ag----------tag-c-------gctggg
B D                     Sheep  c------cattt-----------attcaca-----aaag-ag----------tag-c-------gttggg
                Domestic goat  c------cattt-----------attcaca-----aaag-ag----------tag-c-------gctggg
B D                     Horse  tg-----aattt-----------attcata-----aaac-ag----------tag-c-------attggg
B D          White rhinoceros  tg-----aattt-----------atttata-----aaac-ag----------tag-c-------attggg
B D                       Cat  tg-----aattt-----------actcata-----aaac-ag----------gag-c-------gctggg
B D                       Dog  -----------------------------------------------------------------ctgg-
B D                     Panda  ----------------------------------------------------------------------
               Pacific walrus  -----------------------------------------------------------------ctgg-
                 Weddell seal  -----------------------------------------------------------------ctgg-
B D                   Megabat  -----------------------------g-----aagc-ag----------tgggt-------gctggg
         David's myotis (bat)  -----------------------------a-----aaac-gg----------tgg---------cctggg
B D                  Elephant  tt-----aattt-----------attcata-----acac-ag----------tag-t-------gttggg
          Cape elephant shrew  tg-----aagtt-----------attcagg-----aaac-aa----------tag-a-------gttggg
B D                   Manatee  tg-----aattt-----------attcata-----acac-ag----------tag-t-------gttggg
             Cape golden mole  tg-----aagtc-----------atttatt-----agac-ag----------taa-t-------gctggg
                     Aardvark  tg-----aactt-----------attcata-----aaac-ag----------tag-t-------gttggg
B D                 Armadillo  cg-----aattt-----------attcata-----aagc-ac----------tag-t-------gtt---
  D              Mallard duck  --tctcacacca-----------atgcaaa-----gagc-aggtacgtgtcacag-a-------gctg--
B D                    Tenrec  ======================================================================
B D                     Shrew  ======================================================================
               Big brown bat  ======================================================================
B D                    Lizard  ======================================================================
B D                   Ferret   ----------------------------------------------------------------------
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Nile tilapia  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D                Coelacanth  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
            Black flying-fox  ======================================================================

                        Human  c-----ttat---ttg
                        Chimp  c-----ttat---ttg
                      Gorilla  c-----ttat---ttg
                    Orangutan  c-----ttat---ttg
                       Gibbon  c-----ttat---ttg
                       Rhesus  c-----ttat---ttg
          Crab-eating macaque  c-----ttat---ttg
                       Baboon  c-----ttat---ttg
                 Green monkey  c-----ttat---ttg
                     Marmoset  c-----ttat---ttg
              Squirrel monkey  c-----ttat---ttg
                     Bushbaby  g-----ttat---tta
           Chinese tree shrew  c-----ttag---ttg
                     Squirrel  cttttttttt---ttt
       Lesser Egyptian jerboa  g-----cttc---ttt
                 Prairie vole  c-----ttat---ttt
              Chinese hamster  a-----ttat---ttt
               Golden hamster  c-----ttgt---ttt
                        Mouse  --------------tt
                          Rat  --------------tt
               Naked mole-rat  c-----ttat---ttt
                   Guinea pig  c-----tta-------
                   Chinchilla  c-----ttaa---ttt
             Brush-tailed rat  c-----ttat---ttt
                       Rabbit  c-----tggc---ttc
                         Pika  ----------------
                          Pig  t-----ttatttgctg
                       Alpaca  c-----ttat---ctg
               Bactrian camel  c-----ttat---ctg
                      Dolphin  t-----ttat---ctg
                 Killer whale  t-----ttat---ctg
             Tibetan antelope  t-----tta----ctg
                          Cow  t-----ttt----ctg
                        Sheep  t-----tta----cag
                Domestic goat  t-----tta----ctg
                        Horse  c-----ttat---ttt
             White rhinoceros  c-----ttat---ttt
                          Cat  c-----ttac---ttt
                          Dog  -------------ctt
                        Panda  --------------tt
               Pacific walrus  -------------ctt
                 Weddell seal  -------------ctt
                      Megabat  t-----gtgt---tct
         David's myotis (bat)  g-----cttg---ttt
                     Elephant  g------------ctt
          Cape elephant shrew  a------------ctt
                      Manatee  g------------ctt
             Cape golden mole  g------------ctt
                     Aardvark  g------------ctt
                    Armadillo  ----------------
                 Mallard duck  ----------------
                       Tenrec  ================
                        Shrew  ================
                Big brown bat  ================
                       Lizard  ================
                      Ferret   ----------------
                 Atlantic cod  ================
           Southern platyfish  ================
                  Zebra mbuna  ================
                 Nile tilapia  ================
          Pundamilia nyererei  ================
        Burton's mouthbreeder  ================
          Princess of Burundi  ================
                  Spotted gar  ================
                    Zebrafish  ================
                   Coelacanth  ================
                  Rock pigeon  ================
           American alligator  ================
                         Fugu  ================
     Mexican tetra (cavefish)  ================
                    Tetraodon  ================
                  Stickleback  ================
          Collared flycatcher  ================
                       Turkey  ================
                      Chicken  ================
                      Wallaby  ================
     Chinese softshell turtle  ================
           Tibetan ground jay  ================
                   Budgerigar  ================
             Peregrine falcon  ================
                 Saker falcon  ================
                       Parrot  ================
       White-throated sparrow  ================
                  Zebra finch  ================
              Tasmanian devil  ================
               Painted turtle  ================
              Green seaturtle  ================
                      Opossum  ================
             Black flying-fox  ================

Inserts between block 25 and 26 in window
  D             Mallard duck 2bp

Alignment block 26 of 1330 in window, 78922349 - 78922388, 40 bps 
B D                     Human  -------------a-------------------------tca-----ccggcaaatc--acggacctgac
B D                     Chimp  -------------a-------------------------tca-----ccggcaaatc--acggacctgac
B D                   Gorilla  -------------a-------------------------tca-----ccggcaaatc--acggacctgac
B D                 Orangutan  -------------a-------------------------tca-----ccggtaagtc--acggacctgac
B D                    Gibbon  -------------a-------------------------tca-----ccggtaaatc--acggacctgac
B D                    Rhesus  -------------a-------------------------tca-----ccagcaaatc--actgacctgac
B D       Crab-eating macaque  -------------a-------------------------tca-----ccagcaaatc--actgacctgac
B D                    Baboon  -------------a-------------------------tca-----ccagcaaatc--actgacctgac
B D              Green monkey  -------------a-------------------------tca-----ccagcaaatc--actgacctgaa
B D                  Marmoset  -------------a-------------------------cca-----gcagtaaatc--gctgac----c
B D           Squirrel monkey  -------------a-------------------------cca-----gcagtaaatc--gctgacctgac
B D                  Bushbaby  -------------a-------------------------tca-----ccaggaagtt--aatgacctgac
           Chinese tree shrew  -------------a-------------------------tgg-----ccaggaaatg--actgagcctga
B D                  Squirrel  -------------a-------------------------tca-----acaagaaatt--actgatgtaac
       Lesser Egyptian jerboa  -------------a-------------------------gtg-----gcaggaaatg--actggc----c
                 Prairie vole  -------------a-------------------------tca-----gcaggaaatg--actggcctcac
B D           Chinese hamster  -------------annnnnnnnnnnnnnnnnnnnnnnnnnca-----gcaggaaatg--gctggtctcac
               Golden hamster  -------------a-------------------------tca-----gcagaaaatg--actggcctcac
B D                     Mouse  -------------a-------------------------tca-----gcaggaaatg--actggccgcac
B D                       Rat  -------------t-------------------------tcc-----gcaggaaatg--actggccttgc
B D            Naked mole-rat  -------------a-------------------------tca-----ccatgaaa------ttacctgac
B D                Guinea pig  ---------------------------------------tca-----ccaggaga-g--tcttacat-ac
                   Chinchilla  -------------a-------------------------tca-----tcaggaaa-------tacgtgat
             Brush-tailed rat  -------------g-------------------------tca-----ccaggaaa-------tatgtgac
B D                    Rabbit  -------------t-------------------------cca-----ccgagacact--cctgccctgac
B D                      Pika  -------------------------------------------------gag--------ctgccctggc
B D                       Pig  -------------c-------------------------tca-----ccaggaaatc--tctgacctgac
B D                    Alpaca  -------------a-------------------------gac-----ccaggagatc--tctgacctgac
               Bactrian camel  -------------a-------------------------gac-----ccaggagatc--tctgacctgac
B D                   Dolphin  -------------a-------------------------cca-----ccaggaaatc--tctgacctg--
                 Killer whale  -------------a-------------------------cca-----ccaggaaatc--tctgacctg--
             Tibetan antelope  -------------g-------------------------tct-----ccaggaaatc--tccg-------
B D                       Cow  -------------g-------------------------tct-----ccaggaaacc--t--g-------
B D                     Sheep  -------------g-------------------------tct-----ccaggaaacc--tctg-------
                Domestic goat  -------------g-------------------------tct-----ccaggaaacc--tccg-------
B D                     Horse  -------------a-------------------------tta-----ccaggaaatc--actgacctgac
B D          White rhinoceros  -------------a-------------------------tca-----ccaggaaatc--actgacctgac
B D                       Cat  -------------a-------------------------tgg-----tcagaaaacc----tgacctgac
B D                       Dog  -------------g-------------------------ctgaacacccaggaaacc--cctgacctgac
B D                   Ferret   -----------------------------------------g-----ccaggaaact--gatggcctgac
B D                     Panda  -------------a-------------------------ttg-----ccaggaaatc--cctgacctgat
               Pacific walrus  -------------a-------------------------tcg-----tcaggaaacc--gctgacctgac
                 Weddell seal  -------------a-------------------------tcg-----ccaggaaacc--gccgacctgac
B D                   Megabat  -------------g-------------------------cct-----ctgggagatc---ctggcccggc
         David's myotis (bat)  -------------a-------------------------tct-----ccaggaaatc--actggcctgac
B D                  Elephant  -------------t-------------------------tca-----ccaggaaatt--acccatctgac
          Cape elephant shrew  -------------c-------------------------tca-----ctaggaaact--gctgacctaac
B D                   Manatee  -------------t-------------------------tca-----ccaggaaatt--actgatctgac
             Cape golden mole  -------------t-------------------------cca-----ccaggaacag--actgccctgaa
                     Aardvark  -------------t-------------------------tca-----ctaggaaatt--actgacttgac
B D                 Armadillo  --------------------------------------------------ggaaatt--attgactggac
  D          Peregrine falcon  accaggagcaaata-------------------------cct-----gtgatggagctg-----------
  D              Mallard duck  -------------a-------------------------tct-----ccagtaggtc-------------
B D                    Tenrec  ======================================================================
B D                     Shrew  ======================================================================
               Big brown bat  ======================================================================
B D                    Lizard  ======================================================================
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Nile tilapia  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D                Coelacanth  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
            Black flying-fox  ======================================================================

                        Human  t---ttgtgaagaattca
                        Chimp  t---ttgtgaagaattca
                      Gorilla  t---ttgtgaagaattca
                    Orangutan  t---ttgtgaagaattca
                       Gibbon  t---ttgtgaagaattca
                       Rhesus  t---ttataaagaattca
          Crab-eating macaque  t---ttataaagaattca
                       Baboon  t---ttataaagaattca
                 Green monkey  t---ttatgaagaattca
                     Marmoset  t---ttgtgaataattca
              Squirrel monkey  t---tcgtgagtaattca
                     Bushbaby  t---t-gtgaataattta
           Chinese tree shrew  a---ccgtgaataactga
                     Squirrel  c---ttgtaaaaaatttc
       Lesser Egyptian jerboa  t---ttataaataatgtc
                 Prairie vole  t---ttgtaactaatttc
              Chinese hamster  t---ttgtaactaattgc
               Golden hamster  t---ttgtaactaatttc
                        Mouse  t---ttgtaactaaattc
                          Rat  t---ttgcaactaacttc
               Naked mole-rat  t----------taattta
                   Guinea pig  c---cagtggataattta
                   Chinchilla  t---tagtgggtaattta
             Brush-tailed rat  t---tactggataattca
                       Rabbit  t---ttgtgaatttggtg
                         Pika  t---ttgtgaacagtcca
                          Pig  ttt-gt--gaataatttc
                       Alpaca  ----gt--catgaataac
               Bactrian camel  ----tt--cgtgaataac
                      Dolphin  -----t--gagtaacttc
                 Killer whale  -----t--gagtaacttc
             Tibetan antelope  ------------------
                          Cow  ------------------
                        Sheep  ------------------
                Domestic goat  ------------------
                        Horse  t---tggtgaataatttc
             White rhinoceros  t---tggtgaataatttc
                          Cat  t---ttgcgaagaccttt
                          Dog  ctgact--gacgggcttt
                      Ferret   t---cg--gaacagcttt
                        Panda  t---ct--gaacaacttt
               Pacific walrus  t---ct--ggacaacatt
                 Weddell seal  t---ct--ggacaacttt
                      Megabat  t---ctgtgaacgatttc
         David's myotis (bat)  t---tggtgag-------
                     Elephant  t---ctgcaaataattta
          Cape elephant shrew  t---acccaaataattca
                      Manatee  t---ttgcaaataattta
             Cape golden mole  ------------------
                     Aardvark  t---ttataaataattta
                    Armadillo  t---ttgtgaatgattta
             Peregrine falcon  ------------------
                 Mallard duck  ------------------
                       Tenrec  ==================
                        Shrew  ==================
                Big brown bat  ==================
                       Lizard  ==================
                 Atlantic cod  ==================
           Southern platyfish  ==================
                  Zebra mbuna  ==================
                 Nile tilapia  ==================
          Pundamilia nyererei  ==================
        Burton's mouthbreeder  ==================
          Princess of Burundi  ==================
                  Spotted gar  ==================
                    Zebrafish  ==================
                   Coelacanth  ==================
                  Rock pigeon  ==================
           American alligator  ==================
                         Fugu  ==================
     Mexican tetra (cavefish)  ==================
                    Tetraodon  ==================
                  Stickleback  ==================
          Collared flycatcher  ==================
                       Turkey  ==================
                      Chicken  ==================
                      Wallaby  ==================
     Chinese softshell turtle  ==================
           Tibetan ground jay  ==================
                   Budgerigar  ==================
                 Saker falcon  ==================
                       Parrot  ==================
       White-throated sparrow  ==================
                  Zebra finch  ==================
              Tasmanian devil  ==================
               Painted turtle  ==================
              Green seaturtle  ==================
                      Opossum  ==================
             Black flying-fox  ==================

Inserts between block 26 and 27 in window
B D                  Ferret  1bp
              Pacific walrus 464bp
        David's myotis (bat) 2bp

Alignment block 27 of 1330 in window, 78922389 - 78922389, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  g
B D                    Rabbit  t
B D                      Pika  g
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  c
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  c
B D                   Megabat  t
B D                  Elephant  c
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
  D          Peregrine falcon  t
B D                    Tenrec  =
B D                     Shrew  =
        David's myotis (bat)  =
               Big brown bat  =
B D                    Lizard  =
B D                   Ferret   =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
B D        American alligator  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
  D              Mallard duck  -
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
            Cape golden mole  -
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D              Saker falcon  =
  D                    Parrot  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
B D                   Opossum  =
            Black flying-fox  =

Inserts between block 27 and 28 in window
B D                  Megabat 2bp

Alignment block 28 of 1330 in window, 78922390 - 78922416, 27 bps 
B D                     Human  tcttcc----ctctcctta------------gct---gccaaatga--
B D                     Chimp  tcttcc----ctctcctta------------gct---gccaaatga--
B D                   Gorilla  tcttcc----ctctcctta------------gct---gccaaatga--
B D                 Orangutan  tcttcc----ctctcctta------------gct---accaaatga--
B D                    Gibbon  tcttcc----ctctcctta------------gct---gccaaatga--
B D                    Rhesus  tcttcc----ttctccttg------------gct---gccaaatga--
B D       Crab-eating macaque  tcttcc----ttctccttg------------gct---gccaaatga--
B D                    Baboon  tcttcc----ttctccttg------------gct---gccaaatga--
B D              Green monkey  tcttcc----ttctccttg------------gct---gccaaatga--
B D                  Marmoset  tcttcc----ctctccttg------------gct---gctaaatga--
B D           Squirrel monkey  gcttcc----ctctccttg------------gct---gctaaatga--
B D                  Bushbaby  tcgttc------------------------------------------
           Chinese tree shrew  tcttcc----ctctccttg------------g-t---gccagatga--
B D                  Squirrel  ttttcc----ctctccttggtcaccaaatga-----------------
       Lesser Egyptian jerboa  tctttt----ctctctttg-----------------------------
                 Prairie vole  ttcttt----ttctccttg-----------------------------
B D           Chinese hamster  tctttt----ttctctttg-----------------------------
               Golden hamster  tccttt----ttctctctg-----------------------------
B D                     Mouse  tccttt----ttctccttg-----------------------------
B D                       Rat  tccttt----ttctccttg-----------------------------
B D            Naked mole-rat  tcttcc----tcctccttg------------gtt---gccaaatca--
B D                Guinea pig  tct-------tccttcttg------------gct---gccaaacca--
                   Chinchilla  tcc-------tccttcttg------------gct---accaaat----
             Brush-tailed rat  tct-------tccttcttg------------gct---gccaaatca--
B D                    Rabbit  ctttcc----ctccacgtg-----------------------------
B D                      Pika  gcttcc----ctccatatg-----------------------------
B D                       Pig  ccttcc----ctctacttg------------gct---gtca-------
B D                    Alpaca  tcttcc----ctctccttg------------gcc---acca-------
               Bactrian camel  tcttcc----ctctccttg------------gcc---acca-------
B D                   Dolphin  ccttcc----ctccacctg------------gct---gccc-------
                 Killer whale  ccttcc----ctccacctg------------gct---gccc-------
             Tibetan antelope  --------------acttg------------gcc---acca-------
B D                       Cow  --------------acttg------------gcc---acca-------
B D                     Sheep  --------------acttg------------gcc---acca-------
                Domestic goat  --------------acttg------------gcc---acca-------
B D                     Horse  cc-tctggaactccccttg------------gcc---atcaaatga--
B D          White rhinoceros  ccttctggaactctccttg------------gcc---gccaaatga--
B D                       Cat  ccttgt----ctctcttcg------------gct---gaca-------
B D                       Dog  tcttcc----ctccctgtg------------gct---acca-------
B D                   Ferret   -cctcc----cccgctctg------------gct---gcca-------
B D                     Panda  ccttcc----ctcccattg------------gct---gccg-------
               Pacific walrus  ccctcc----gtctctctg------------gct---gccg-------
                 Weddell seal  ccttcc----gtccctcgg------------gct---gccg-------
B D                  Elephant  ccttcc----ctctccttg------------gct---gccaaatta--
          Cape elephant shrew  ctttct----atctctttg------------gct---ggcaattta--
B D                   Manatee  ccttcc----ctctccttg------------gct---gccaaatta--
             Cape golden mole  ------------------g------------gca---gatagatga--
                     Aardvark  ccctct----ctctctttg------------gct---gccaaatca--
B D                 Armadillo  cctttc----ctctccttg------------act---gccaaatta--
  D          Peregrine falcon  ----------tactgccag------------tacttagccaggcaatg
  D              Mallard duck  --------------accag------------gagat-gccattccat-
B D                    Tenrec  ================================================
B D                     Shrew  ================================================
        David's myotis (bat)  ================================================
               Big brown bat  ================================================
B D                    Lizard  ================================================
B D              Atlantic cod  ================================================
          Southern platyfish  ================================================
                 Zebra mbuna  ================================================
B D              Nile tilapia  ================================================
         Pundamilia nyererei  ================================================
       Burton's mouthbreeder  ================================================
         Princess of Burundi  ================================================
                 Spotted gar  ================================================
B D                 Zebrafish  ================================================
B D                Coelacanth  ================================================
  D               Rock pigeon  ================================================
B D        American alligator  ================================================
B D                      Fugu  ================================================
    Mexican tetra (cavefish)  ================================================
B D                 Tetraodon  ================================================
B D               Stickleback  ================================================
  D       Collared flycatcher  ================================================
B D                    Turkey  ================================================
B D                   Chicken  ================================================
B D                   Wallaby  ================================================
  D  Chinese softshell turtle  ================================================
          Tibetan ground jay  ================================================
B D                Budgerigar  ================================================
  D              Saker falcon  ================================================
  D                    Parrot  ================================================
  D    White-throated sparrow  ================================================
B D               Zebra finch  ================================================
B D           Tasmanian devil  ================================================
  D            Painted turtle  ================================================
  D           Green seaturtle  ================================================
B D                   Megabat  ================================================
B D                   Opossum  ================================================
            Black flying-fox  ================================================

Inserts between block 28 and 29 in window
B D                 Squirrel 14bp
B D           Naked mole-rat 10bp
B D               Guinea pig 14bp
                  Chinchilla 16bp
            Brush-tailed rat 87bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 5bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 5bp
                Killer whale 5bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 15bp
B D         White rhinoceros 15bp
B D                      Cat 4bp
B D                      Dog 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp

Alignment block 29 of 1330 in window, 78922417 - 78922417, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                       Pig  a
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  c
B D                 Armadillo  a
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  -
B D                     Shrew  =
B D           Chinese hamster  -
                Prairie vole  -
        David's myotis (bat)  =
               Big brown bat  =
B D                    Lizard  =
B D                    Rabbit  =
B D                     Panda  =
B D                   Ferret   =
B D                       Dog  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
B D        American alligator  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
  D              Mallard duck  -
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  -
  D              Saker falcon  =
  D                    Parrot  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Megabat  =
B D                   Opossum  =
                Weddell seal  =
            Black flying-fox  =
B D                  Squirrel  =
B D                       Cat  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
              Pacific walrus  =
B D          White rhinoceros  =
B D                     Horse  =

Inserts between block 29 and 30 in window
B D                      Pig 258bp
B D                   Alpaca 14bp
              Bactrian camel 14bp
B D                  Dolphin 14bp
                Killer whale 14bp
            Tibetan antelope 15bp
B D                      Cow 15bp
B D                    Sheep 15bp
               Domestic goat 15bp
B D                 Elephant 9bp
         Cape elephant shrew 9bp
B D                  Manatee 13bp
            Cape golden mole 9bp
                    Aardvark 12bp
B D                Armadillo 7bp

Alignment block 30 of 1330 in window, 78922418 - 78922418, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  t
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  t
B D                   Megabat  t
         David's myotis (bat)  c
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
                     Aardvark  t
B D                 Armadillo  t
  D          Peregrine falcon  c
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  -
B D                     Shrew  =
B D           Chinese hamster  -
                Prairie vole  -
               Big brown bat  =
B D                    Lizard  =
B D                    Rabbit  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
B D        American alligator  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
  D              Mallard duck  -
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D              Saker falcon  =
  D                    Parrot  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                       Pig  =
B D                   Opossum  =
B D                  Squirrel  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =

Inserts between block 30 and 31 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 31 of 1330 in window, 78922419 - 78922451, 33 bps 
B D                     Human  g----------atccat-atc-ccactt-ctc--------------------------------------
B D                     Chimp  g----------atccat-atc-ccactt-ctc--------------------------------------
B D                   Gorilla  g----------atctat-atc-ccactt-ctc--------------------------------------
B D                 Orangutan  g----------atccat-atc-ccactt-ctc--------------------------------------
B D                    Gibbon  g----------atccat-atc-ccactt-ctc--------------------------------------
B D                    Rhesus  a----------ttccac-atc-ccactt-ctc--------------------------------------
B D       Crab-eating macaque  a----------ttccat-atc-ccactt-ctc--------------------------------------
B D                    Baboon  a----------ttccat-atc-ccactt-ctc--------------------------------------
B D              Green monkey  a----------ttccat-atc-ccactt-ctc--------------------------------------
B D                  Marmoset  g----------acccataatc-ccactt-ttc--------------------------------------
B D           Squirrel monkey  g----------atccat-atc-ccgctt-ttc--------------------------------------
B D                  Bushbaby  a----------ttctat--tt-ccactt-ct---------------------------------------
           Chinese tree shrew  gtccacgttctttccat-agc-ccacct-ctc--------------------------------------
B D                  Squirrel  --------tctgtccat-atc-ctactt-ctt--------------------------------------
       Lesser Egyptian jerboa  -----------gcctga-act-ctcttt-ctttctttttttgaggtagggtctcactctggtccaggctg
                 Prairie vole  --------------aat-att-cta----ctt--------------------------------------
B D           Chinese hamster  --------------cat-atg-ctgctt-ctt--------------------------------------
               Golden hamster  --------------cat-atg-ctactt-ctt--------------------------------------
B D                     Mouse  --------------cat-agc-ctactt-ctc--------------------------------------
B D                       Rat  --------------cat-atc-ctactt-cta--------------------------------------
B D            Naked mole-rat  --------tctatccat-ata-ccact--ctc--------------------------------------
B D                Guinea pig  --------tctgtccac-tta--tatt--ctc--------------------------------------
                   Chinchilla  --------tctatccat-ata--ca-----ac--------------------------------------
B D                    Rabbit  ------------actaa-atc-atagcc-cct--------------------------------------
B D                      Pika  ------------accgt-ccc-atggtc-ctt--------------------------------------
B D                       Pig  ----------tatctgc-gtc-tcactt-ctc--------------------------------------
B D                    Alpaca  ----------tatccac-acc-tcactg-ctc--------------------------------------
               Bactrian camel  ----------tgtccgc-acc-tcactg-ctc--------------------------------------
B D                   Dolphin  ----------tgtccat-atc-taactt-gtc--------------------------------------
                 Killer whale  ----------tgtccat-atc-tcactt-gtc--------------------------------------
             Tibetan antelope  ----------tgtccct-gct-tcactt-ctc--------------------------------------
B D                       Cow  ----------tatccct-gct-ttactt-ctc--------------------------------------
B D                     Sheep  ----------tgtccct-gct-tcactt-ctc--------------------------------------
                Domestic goat  ----------tgtccct-gct-tcactt-ctc--------------------------------------
B D                     Horse  ----------tatccat-aac-tcacttctcc--------------------------------------
B D          White rhinoceros  ----------tatccat-acc-tcacttctcc--------------------------------------
B D                       Cat  ----------tgtccac-acc-ccacct-tcc--------------------------------------
B D                       Dog  ----------cgtcca---tc-ccact--tcc--------------------------------------
B D                   Ferret   ----------tgtgcac--tc-ccacgg-tcc--------------------------------------
B D                     Panda  ----------tgtctgc--tc-ccagtg-tcc--------------------------------------
               Pacific walrus  ----------tgtccac--tc-ctgctg-tcc--------------------------------------
                 Weddell seal  ----------tgtccac--tc-ccgctg-tcc--------------------------------------
             Black flying-fox  ----------tccctgt--cc-ttggcc-aca--------------------------------------
B D                   Megabat  ----------tccctgt--cc-ttggcc-aca--------------------------------------
         David's myotis (bat)  ----------ccccttc--tc-tcactc-ccc--------------------------------------
B D                  Elephant  ----------tatccat-acccccactt-cgc--------------------------------------
          Cape elephant shrew  ----------tatccac-atc----------c--------------------------------------
B D                   Manatee  ----------tatccat-acccctactt-ctc--------------------------------------
             Cape golden mole  ----------tacccat--cccccactt-ctc--------------------------------------
                     Aardvark  ----------tacccag-acccctactt-ttc--------------------------------------
B D                 Armadillo  ----------tatccat-acc-ctactt-tcc--------------------------------------
  D          Peregrine falcon  ----------tatccct-gtc-cccttt-tat--------------------------------------
  D              Mallard duck  ------------tccct-gtc-cccctg-tac--------------------------------------
B D                    Tenrec  ======================================================================
B D                     Shrew  ======================================================================
               Big brown bat  ======================================================================
B D                    Lizard  ======================================================================
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Nile tilapia  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D                Coelacanth  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
            Brush-tailed rat  ======================================================================

                        Human  -ccg--------a------aaatt---t-accg
                        Chimp  -ccg--------a------aaatt---t-accg
                      Gorilla  -ccg--------a------aaatt---t-accg
                    Orangutan  -ccg--------a------aaatt---t-accg
                       Gibbon  -cca--------a------aaatt---t-acca
                       Rhesus  -ccg--------a------aaatt---t-accg
          Crab-eating macaque  -ccg--------a------aaatt---t-accg
                       Baboon  -ccg--------a------aaatt---t-accg
                 Green monkey  -cca--------a------aaatt---t-accg
                     Marmoset  -ctg--------a------aaatt---t-atgg
              Squirrel monkey  -ccg--------a------aaatt---t-accg
                     Bushbaby  --------------------------------g
           Chinese tree shrew  -ccc--------a------gaatt---t-actg
                     Squirrel  -ccc--------a------gaatt---gcctgt
       Lesser Egyptian jerboa  acct--------a------gaactcact-atgt
                 Prairie vole  -ccc--------a------gaatt---g-atgg
              Chinese hamster  -ccc--------a------gaatt---g-atgg
               Golden hamster  -ccc--------a------gaatt---g-atga
                        Mouse  -ccc--------g------gaatt---g-atgg
                          Rat  -ccc--------a------gaatg---g-acag
               Naked mole-rat  -tcc--------a------ggatt---g-tctg
                   Guinea pig  -tct--------a------cgttt---g-tgtg
                   Chinchilla  -tcc--------a------ggatt---g-tctg
                       Rabbit  -ccc--------c--------------------
                         Pika  -tcc--------ttcctca--------------
                          Pig  -tcc--------a------gaat----t-ccta
                       Alpaca  --cc--------a------gaatt---c-tcca
               Bactrian camel  --cc--------a------gaatt---c-tccg
                      Dolphin  --cc--------a------gagtt---t-gctg
                 Killer whale  --cc--------a------gagtt---t-gctg
             Tibetan antelope  -tcc--------a------gcatc---t-cctg
                          Cow  -tcc--------a------gaatc---t-cctg
                        Sheep  -tcc--------a------gaatc---t-cctg
                Domestic goat  -tcc--------a------gaatc---t-cctg
                        Horse  --cc--------a------gaatt---t-acct
             White rhinoceros  --cc--------a------gaatt---t-acct
                          Cat  --cc--------a------gaatt---t-tccg
                          Dog  --ct--------a------caact---t-----
                      Ferret   --cc--------a------caatt---t-accg
                        Panda  --cc--------a------cagtt---t-acca
               Pacific walrus  --cc--------a------caatt---t-accg
                 Weddell seal  --tc--------a------caatt---t-accg
             Black flying-fox  --cg--------a------actct---t-cctt
                      Megabat  --cg--------a------actct---t-cctt
         David's myotis (bat)  --cc--------a------gaatt---c-cctg
                     Elephant  -tcc--------a------gaatt---t-actg
          Cape elephant shrew  -tcc--------a------aaact---g-at--
                      Manatee  -tcc--------a------gaatt---t-actg
             Cape golden mole  -tcc--------a------g-------------
                     Aardvark  -tcc--------a------gaatt---t-actg
                    Armadillo  -tct--------t------gaatt---c-actg
             Peregrine falcon  -cacaaacaagc---------------------
                 Mallard duck  -tgc-----------------------------
                       Tenrec  =================================
                        Shrew  =================================
                Big brown bat  =================================
                       Lizard  =================================
                 Atlantic cod  =================================
           Southern platyfish  =================================
                  Zebra mbuna  =================================
                 Nile tilapia  =================================
          Pundamilia nyererei  =================================
        Burton's mouthbreeder  =================================
          Princess of Burundi  =================================
                  Spotted gar  =================================
                    Zebrafish  =================================
                   Coelacanth  =================================
                  Rock pigeon  =================================
           American alligator  =================================
                         Fugu  =================================
     Mexican tetra (cavefish)  =================================
                    Tetraodon  =================================
                  Stickleback  =================================
          Collared flycatcher  =================================
                       Turkey  =================================
                      Chicken  =================================
                      Wallaby  =================================
     Chinese softshell turtle  =================================
           Tibetan ground jay  =================================
                   Budgerigar  =================================
                 Saker falcon  =================================
                       Parrot  =================================
       White-throated sparrow  =================================
                  Zebra finch  =================================
              Tasmanian devil  =================================
               Painted turtle  =================================
              Green seaturtle  =================================
                      Opossum  =================================
             Brush-tailed rat  =================================

Inserts between block 31 and 32 in window
                  Chinchilla 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 32 of 1330 in window, 78922452 - 78922497, 46 bps 
B D                     Human  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D                     Chimp  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D                   Gorilla  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D                 Orangutan  ag-------ggct-------------------------tcctcttag--ccctg----g-----------
B D                    Gibbon  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D                    Rhesus  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D       Crab-eating macaque  ag-------gg-c-------------------------ccctcttag--ccctg----g-----------
B D                    Baboon  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D              Green monkey  ag-------ggcc-------------------------ccctcttag--ccctg----g-----------
B D                  Marmoset  ag-------ggcc-------------------------ccttcttag---cctg----g-----------
B D           Squirrel monkey  ac-------ggcc-------------------------ccttcttag---cctg----g-----------
B D                  Bushbaby  ag-------ggcc-------------------------cccacctta--gcctg----g-----------
           Chinese tree shrew  ag-------gg-c-------------------------ccttcctag--ccctg----g-----------
B D                  Squirrel  tg-------gccc-------------------------ccttcctag--ccctg----g-----------
       Lesser Egyptian jerboa  ag-------tctcaagggtagccttgaactcacagtgatcctcctac--ctctg----c-----------
                 Prairie vole  ag-------gctc-------------------------ccttcttcc--ctctg----t-----------
B D           Chinese hamster  ag-------cctc-------------------------ccttcttgcctctctg----t-----------
               Golden hamster  ag-------gctc-------------------------ccttcttgc--ctctg----a-----------
B D                     Mouse  ag-------gttc-------------------------ccttcttgc--tgctg----t-----------
B D                       Rat  ag-------gtcc-------------------------cctccttgc--tgctg----t-----------
B D            Naked mole-rat  ag-------gtct-------------------------ccttctgat--acctg----g-----------
B D                Guinea pig  ag-------gccc-------------------------ccagccaac--tcctg----g-----------
                   Chinchilla  ag-------ctcc-------------------------cttcctgat--ccctg----t-----------
             Brush-tailed rat  ag-------ttcc-------------------------cctactgat--ctctg----g-----------
B D                    Rabbit  ------------c-------------------------accccccag--cacgg----a-----------
B D                      Pika  ------------c-------------------------acgccctgg--cactg----atggacagctgt
B D                       Pig  gg-------gccc-------------------------ccttcttag--ccctg----c-----------
B D                    Alpaca  ga-------gccc-----------------------------cttag--ccctg----c-----------
               Bactrian camel  gg-------gccc-------------------------c-ttcttag--ccctg----c-----------
B D                   Dolphin  gg-------gccc-------------------------cgttcttag--ctctg----c-----------
                 Killer whale  gg-------gccc-------------------------cgttcttag--ctctg----c-----------
             Tibetan antelope  gg-------gccc-------------------------ccttctcag--tcttg----c-----------
B D                       Cow  gg-------gccc-------------------------ccttctcag--cctca----c-----------
B D                     Sheep  gg-------gccc-------------------------ccttctcag--tcttg----c-----------
                Domestic goat  gg-------gccc-------------------------ccttctcag--tcttg----c-----------
B D                     Horse  gg---------ct-------------------------gcttcctag--ccctg----c-----------
B D          White rhinoceros  gg---------cc-------------------------tcttcctag--ccctg----c-----------
B D                       Cat  gg---------ct-------------------------ccttctcag--ccctg----ac----------
B D                       Dog  --------------------------------------------------cccg----a-----------
B D                   Ferret   gg---------ct-------------------------ccctctcag--cccc-----------------
B D                     Panda  gg---------ct-------------------------ccttctcag--cccct----g-----------
               Pacific walrus  tg---------ct-------------------------ccttctcag--ccccc----a-----------
                 Weddell seal  gg---------ct-------------------------cctt---ag--ccccc----a-----------
             Black flying-fox  tg-------------------------------------ctacccat--gtctg----c-----------
B D                   Megabat  tt-------------------------------------ctacccat--gtctg----c-----------
         David's myotis (bat)  gg---------------------------------------agccct--ctctg----g-----------
B D                  Elephant  gg-------gcct-------------------------cctgcctgg--ccctg----g-----------
          Cape elephant shrew  ------------------------------------------cttgg--ccctg----g-----------
B D                   Manatee  ggtcccccctccc-------------------------ccttcttgg--ccgta----g-----------
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  gg-------tccc-------------------------ttttcatgg--ctctg----g-----------
B D                 Armadillo  gg-------gccc-------------------------tct-tttag--ccctg----g-----------
  D          Peregrine falcon  ag-------agtt-------------------------agcacccag--ctcccaaata-----------
  D              Mallard duck  -g-------agct-------------------------agcacccaa--ctataaa--g-----------
B D                    Tenrec  ======================================================================
B D                     Shrew  ======================================================================
               Big brown bat  ======================================================================
B D                    Lizard  ======================================================================
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Nile tilapia  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D                Coelacanth  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================

                        Human  --ccgg-------------------------------------------------gc-cctcacacagct
                        Chimp  --ccgg-------------------------------------------------gc-cctcacacagct
                      Gorilla  --ccgg-------------------------------------------------gc-cgtcacacagct
                    Orangutan  --ctgg-------------------------------------------------gc-cctcacacagct
                       Gibbon  --ccgg-------------------------------------------------gc-cctcacacagct
                       Rhesus  --ccag-------------------------------------------------gc-cctcacacagct
          Crab-eating macaque  --ccag-------------------------------------------------gc-cctcacacagct
                       Baboon  --ccag-------------------------------------------------gc-cctcacacagct
                 Green monkey  --ccag-------------------------------------------------gc-cctcacacagct
                     Marmoset  --ctgg-------------------------------------------------gc-cctcacacagct
              Squirrel monkey  --ctgg-------------------------------------------------gc-cctcacacagct
                     Bushbaby  --cta--------------------------------------------------gc-cctcacatagct
           Chinese tree shrew  --ccag-------------------------------------------------ac-cctagcagagag
                     Squirrel  --ctag-------------------------------------------------gc-cttcacat----
       Lesser Egyptian jerboa  --cttggagtgctgggataaaaggcgtgcaccaccacgcccggctccctttcttagt-ctatctgtatcc
                 Prairie vole  --ctag-------------------------------------------------gt-cctcacatagca
              Chinese hamster  --ccag-------------------------------------------------gt-cctcacatagct
               Golden hamster  --ccag-------------------------------------------------gt-cctcacatagtt
                        Mouse  --ctgg-------------------------------------------------gt-cctcatatagct
                          Rat  --ctgg-------------------------------------------------gt-ctccacatagct
               Naked mole-rat  --ctga-------------------------------------------------gc-cctaacatagcc
                   Guinea pig  --ctaa-------------------------------------------------gctcctaacctggcc
                   Chinchilla  --ctaa-------------------------------------------------gc-cctaatatagcc
             Brush-tailed rat  --ctaa-------------------------------------------------gg-cctaacatagct
                       Rabbit  --ctgc-------------------------------------------------gc-c-----------
                         Pika  ggctag-------------------------------------------------gc-cttcacacagct
                          Pig  --ctag-------------------------------------------------gc-cctcacatggtt
                       Alpaca  --cta--------------------------------------------------gc-tctcatgtag--
               Bactrian camel  --cta--------------------------------------------------gc-cctcatgtag--
                      Dolphin  --ctag-------------------------------------------------gc-cctcatgtagtt
                 Killer whale  --ctag-------------------------------------------------gc-tctcacgtagtt
             Tibetan antelope  --ctagtt-----------------------------------------------gg-cctcatgttg--
                          Cow  --ctagtt-----------------------------------------------gg-cctcatgttg--
                        Sheep  --ctagtt-----------------------------------------------gg-cctcatgctg--
                Domestic goat  --ctagtt-----------------------------------------------gg-cctcatgttg--
                        Horse  --tt-g-------------------------------------------------gc-cctcatgtagtt
             White rhinoceros  --ctag-------------------------------------------------gc-cctcacatagtt
                          Cat  --ctag-------------------------------------------------gc-cctcacagagtt
                          Dog  --ctcg-------------------------------------------------gc-cctcagctagtt
                      Ferret   ----------------------------------------------------------------------
                        Panda  --ctag-------------------------------------------------gc-cctcactcagtg
               Pacific walrus  --cgag-------------------------------------------------gc-cctcactcagtg
                 Weddell seal  --cgag-------------------------------------------------gc-cctcgctccgtg
             Black flying-fox  --ct-g-------------------------------------------------gc-cctcacgtagtt
                      Megabat  --ct-g-------------------------------------------------gc-cctcacgtagtt
         David's myotis (bat)  --ct---------------------------------------------------cc-cctcttgtagtt
                     Elephant  --gtagggcg---------------------------------------------gc-cctcatgtagtt
          Cape elephant shrew  --ctaggctg---------------------------------------------gc-tctcatagagtt
                      Manatee  --ctagggcg---------------------------------------------gt-gctcaggtagtt
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  --ctacagaa---------------------------------------------gc-cctcatgtagtt
                    Armadillo  --gtatg---------------------------------------------------tcctccataatc
             Peregrine falcon  --tttc-------------------------------------------------ac-ttgcagctggag
                 Mallard duck  --tttc-------------------------------------------------ac-ttgcacctggaa
                       Tenrec  ======================================================================
                        Shrew  ======================================================================
                Big brown bat  ======================================================================
                       Lizard  ======================================================================
                 Atlantic cod  ======================================================================
           Southern platyfish  ======================================================================
                  Zebra mbuna  ======================================================================
                 Nile tilapia  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                   Coelacanth  ======================================================================
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================

                        Human  atttt-----------at
                        Chimp  atttt-----------at
                      Gorilla  atttt-----------at
                    Orangutan  atttt-----------at
                       Gibbon  atttt-----------at
                       Rhesus  attta-----------at
          Crab-eating macaque  attta-----------at
                       Baboon  attta-----------at
                 Green monkey  attta-----------at
                     Marmoset  attta-----------ac
              Squirrel monkey  acttt-----------gt
                     Bushbaby  attta-----------gc
           Chinese tree shrew  actga-----------at
                     Squirrel  ------------------
       Lesser Egyptian jerboa  tacta-----------cg
                 Prairie vole  tcct--------------
              Chinese hamster  acata-----------ac
               Golden hamster  accta-----------ac
                        Mouse  atcta-----------ac
                          Rat  cacta-----------ac
               Naked mole-rat  attta-----------at
                   Guinea pig  actta-----------at
                   Chinchilla  actta-----------at
             Brush-tailed rat  actta-----------at
                       Rabbit  ----a-----------at
                         Pika  gctag-----------ag
                          Pig  attta-----------aa
                       Alpaca  ttaca-----------at
               Bactrian camel  ttaca-----------at
                      Dolphin  attta-----------at
                 Killer whale  attta-----------at
             Tibetan antelope  ------------------
                          Cow  ------------------
                        Sheep  ------------------
                Domestic goat  ------------------
                        Horse  attta-----------at
             White rhinoceros  attta-----------at
                          Cat  atgtatggtctctgtgcc
                          Dog  actta-----------at
                      Ferret   ------------------
                        Panda  acgta-----------ct
               Pacific walrus  atgga-----------at
                 Weddell seal  acgga-----------at
             Black flying-fox  g---------------at
                      Megabat  g---------------at
         David's myotis (bat)  atttc-----------at
                     Elephant  aatta-----------tt
          Cape elephant shrew  agtta-----------tt
                      Manatee  attta-----------tt
             Cape golden mole  ----g-----------tg
                     Aardvark  attta-----------tt
                    Armadillo  aatca-------------
             Peregrine falcon  ata---------------
                 Mallard duck  ata---------------
                       Tenrec  ==================
                        Shrew  ==================
                Big brown bat  ==================
                       Lizard  ==================
                 Atlantic cod  ==================
           Southern platyfish  ==================
                  Zebra mbuna  ==================
                 Nile tilapia  ==================
          Pundamilia nyererei  ==================
        Burton's mouthbreeder  ==================
          Princess of Burundi  ==================
                  Spotted gar  ==================
                    Zebrafish  ==================
                   Coelacanth  ==================
                  Rock pigeon  ==================
           American alligator  ==================
                         Fugu  ==================
     Mexican tetra (cavefish)  ==================
                    Tetraodon  ==================
                  Stickleback  ==================
          Collared flycatcher  ==================
                       Turkey  ==================
                      Chicken  ==================
                      Wallaby  ==================
     Chinese softshell turtle  ==================
           Tibetan ground jay  ==================
                   Budgerigar  ==================
                 Saker falcon  ==================
                       Parrot  ==================
       White-throated sparrow  ==================
                  Zebra finch  ==================
              Tasmanian devil  ==================
               Painted turtle  ==================
              Green seaturtle  ==================
                      Opossum  ==================

Inserts between block 32 and 33 in window
B D          Squirrel monkey 456bp
B D                 Bushbaby 9bp
          Chinese tree shrew 3bp
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
        David's myotis (bat) 3bp
B D                 Elephant 10bp
         Cape elephant shrew 10bp
B D                  Manatee 10bp
            Cape golden mole 10bp
                    Aardvark 10bp
B D                Armadillo 7bp

Alignment block 33 of 1330 in window, 78922498 - 78922509, 12 bps 
B D                     Human  ca-c---ca---------gga-----------------------g---------ccc-------------
B D                     Chimp  ca-c---ca---------gga-----------------------g---------cct-------------
B D                   Gorilla  ca-c---ca---------gga-----------------------c---------ccc-------------
B D                 Orangutan  ca-c---ca---------gga-----------------------c---------ccc-------------
B D                    Gibbon  ca-c---ca---------gga-----------------------c---------ccc-------------
B D                    Rhesus  ca-a---ca---------gga-----------------------c---------cct-------------
B D       Crab-eating macaque  ca-a---ca---------gga-----------------------c---------cct-------------
B D                    Baboon  ca-a---ca---------gga-----------------------c---------cct-------------
B D              Green monkey  ca-a---ca---------gga-----------------------c---------cct-------------
B D                  Marmoset  ca-c---ca---------ggg-----------------------c---------ccc-------------
B D                  Bushbaby  ca-c---aatcctttgttatc-----------------------c---------cct-------------
           Chinese tree shrew  ca-c---gg---------gga-----------------------c---------ccc-------------
B D                  Squirrel  ca-c---ca---------gga-----------------------c---------tcc-------------
       Lesser Egyptian jerboa  cc-c---ca---------gga-----------------------ttgactgtggatc-------------
                 Prairie vole  -a-c---ca---------gta-----------------------t---------atc-------------
B D           Chinese hamster  ca-c---ta---------gga-----------------------c---------ctc-------------
               Golden hamster  ca-c---ta---------gga-----------------------c---------ctc-------------
B D                     Mouse  ag-c---ca---------gta-----------------------t---------ggc-------------
B D                       Rat  ag-c---c--------------------------------------------------------------
B D            Naked mole-rat  ca-tgaata---------gga-----------------------g---------ttc-------------
B D                Guinea pig  ta-tgggta---------gga-----------------------c---------tcc-------------
                   Chinchilla  ca-tgagta---------gga-----------------------c---------tcc-------------
             Brush-tailed rat  ca-taagta---------ggg-----------------------c---------tcc-------------
B D                    Rabbit  ca-gcatcg---------gga-----------------------c---------acg-------------
B D                      Pika  tg-gcatcg---------ggactccccagcatcccacccttaccc---------cca-------------
B D                       Pig  ca-c---ca---------gga-----------------------c-------------------------
B D                    Alpaca  cc-c---tg---------gga-----------------------c-------------------------
               Bactrian camel  cc-c---tg---------gga-----------------------c-------------------------
B D                   Dolphin  ca-c---tg---------gga-----------------------c-------------------------
                 Killer whale  ca-c---tg---------gga-----------------------c-------------------------
             Tibetan antelope  --------g---------gga-----------------------c-------------------------
B D                       Cow  --------g---------gga-----------------------c-------------------------
B D                     Sheep  --------g---------gga-----------------------c-------------------------
                Domestic goat  --------g---------gga-----------------------c-------------------------
B D                     Horse  ta-c---cg---------gga-----------------------c-------------------------
B D          White rhinoceros  ca-c---tg---------gga-----------------------c-------------------------
B D                       Cat  cc-c---ac---------cct-----------------------g-------------------------
B D                       Dog  ca-c---cg---------gga-----------------------c-------------------------
B D                     Panda  cacc---gg---------gcc-----------------------c-------------------------
               Pacific walrus  ca-c---ag---------gcc-----------------------c-------------------------
                 Weddell seal  ca-t---gg---------gcc-----------------------c-------------------------
             Black flying-fox  ca-c---gg---------ggt-----------------------c-------------------------
B D                   Megabat  ca-c---gg---------ggt-----------------------c-------------------------
         David's myotis (bat)  ca-c---ca---------ggt-----------------------c-------------------------
B D                  Elephant  ca--------------------------------------------------------------------
          Cape elephant shrew  ca--------------------------------------------------------------------
B D                   Manatee  ca--------------------------------------------------------------------
             Cape golden mole  ct--------------------------------------------------------------------
                     Aardvark  ca--------------------------------------------------------------------
B D                 Armadillo  ca--------------------------------------------------------------------
  D          Peregrine falcon  ------------------------------------------------------ttc--------gtgga
  D              Mallard duck  ------------------------------------------------------cacaagatactgtgga
B D                    Tenrec  ======================================================================
B D