Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 429 in window, 71508287 - 71508491, 205 bps 
B D                   Human  attttttcaataaaaatatttttatctcatcctatgttttaaatacattcttgttaaaaagccttggaaa
B D                   Chimp  attttttcaataaaaatatttttatctcatcctatgttttaaatacattcttgttaaaatgccttggaaa
B D                 Gorilla  attttttcaataaaaatatttttatctcatcctatgttttaaatacattcttgttaaaaagccttggaaa
B D               Orangutan  attttttcaacaaaaatatttttatctcatcctatgttttaaatacattcttgttaaaaagccttggaaa
B D                  Gibbon  attttttcaataaaaatatttttatctcatcccatgttttaaatacattcttgttaaaaagccttggaaa
B D                  Rhesus  attttttcaataaaaatatttttatctcatcccatattttaaatacattcttgttaaaaagccttggaaa
B D     Crab-eating macaque  attttttcaataaaaatatttttatctcatcccatattttaaatacattcttgttaaaaagccttggaaa
B D                  Baboon  attttttcaataaaaatatttttatctcatcccatattttaaatacattcttgttaaaaagccttggaaa
B D            Green monkey  attttttcaataaaaatatttttatctcatcccatgttttaaatacattcttgttaaaaagccttggaaa
           Star-nosed mole  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Sheep  ======================================================================
          Cape golden mole  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
B D                Bushbaby  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Pig  ======================================================================
B D                    Pika  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                 Ferret   ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                 Megabat  ======================================================================
                  Aardvark  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================

                      Human  tctatttcatttcacctatgaaaaatacccaccatataacctaattggacactctgatcctcattttcaa
                      Chimp  tctatttcatttcacctatgaaaaatacccaccatataacctaattggacactctgatcctcattttcaa
                    Gorilla  tctatttcatttcacctatgaaaaatacccaccatataacctaattggacactctgatcctcattttcaa
                  Orangutan  tctatttcatttcaactatgaaaaatacccaccatataacctaattggacactctgatcctcattttcaa
                     Gibbon  tctatttcatttcacctatgaaaaatggccaccacataacctaattggacactctgatcctcattttcaa
                     Rhesus  tctatttcatttcacctatgaaaaatacccagcatataacctaattggacactctgatcctcattttcaa
        Crab-eating macaque  tctatttcatttcacctatgaaaaatacccagcatataacctaattggacactctgatcctcattttcaa
                     Baboon  cctatttcatttcacctatgaaaaatacccagcatataacctaattggacactctgatcctcattttcaa
               Green monkey  tctatttcatttcacctatgaaaaatacccagcatataacctaattggacactctgatcctcattttcaa
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  accaat-aaaataatcagagttaatttctctccgaa-------------------------ttttttttt
                      Chimp  accaat-aaaataatcagagttaatttctctctgaa------------------------tttttttttt
                    Gorilla  accaat-aaaataatcagagttaatttctctctgac----------------------------tttttt
                  Orangutan  accaat-aaaataatcagagttaatttctctctgact----------------------ttttttttttt
                     Gibbon  accaat-aaaataatcagagttaatttctctctgac-------------------------ttttttttt
                     Rhesus  accaat-aaaataatcagagttaatttctctctgaaa----------------------ttttttttttt
        Crab-eating macaque  accaat-aaaataatcagagttaatttctctctgaaa-----------------------tttttttttt
                     Baboon  accaat-aaaataatcagagttaatttctctctgaaattttttttttttttttttttttttttttttttt
               Green monkey  accaataaaaataatcagagttaatttctctctgaat------------------ttttttttttttttt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tttttttgagatggagtttca
                      Chimp  tttttttgagatggagtttca
                    Gorilla  tttttttgagatggagtttca
                  Orangutan  tttttttgagatggagtttca
                     Gibbon  tttttttgagatggagtttca
                     Rhesus  ttttttttagatggagtttca
        Crab-eating macaque  tttttttgagatggagtttca
                     Baboon  tttttttgagatggagtttca
               Green monkey  tttttttgagatggagtttca
            Star-nosed mole  =====================
                   Hedgehog  =====================
                      Shrew  =====================
                  Armadillo  =====================
                   Microbat  =====================
                     Tenrec  =====================
             Golden hamster  =====================
               Prairie vole  =====================
                   Squirrel  =====================
                        Rat  =====================
                      Mouse  =====================
                 Chinchilla  =====================
           Brush-tailed rat  =====================
                 Guinea pig  =====================
             Naked mole-rat  =====================
     Lesser Egyptian jerboa  =====================
            Chinese hamster  =====================
        Cape elephant shrew  =====================
                      Sheep  =====================
           Cape golden mole  =====================
           Tibetan antelope  =====================
       David's myotis (bat)  =====================
         Chinese tree shrew  =====================
                   Elephant  =====================
              Big brown bat  =====================
                        Cow  =====================
                   Bushbaby  =====================
             Pacific walrus  =====================
                      Panda  =====================
              Domestic goat  =====================
               Killer whale  =====================
             Bactrian camel  =====================
                     Alpaca  =====================
                     Rabbit  =====================
                        Pig  =====================
                       Pika  =====================
                        Dog  =====================
                        Cat  =====================
                    Ferret   =====================
                    Dolphin  =====================
               Weddell seal  =====================
                    Megabat  =====================
                   Aardvark  =====================
                    Manatee  =====================
           Black flying-fox  =====================
           White rhinoceros  =====================
                      Horse  =====================
            Squirrel monkey  =====================
                   Marmoset  =====================

Inserts between block 1 and 2 in window
B D                 Rhesus 2397bp

Alignment block 2 of 429 in window, 71508492 - 71508509, 18 bps 
B D                   Human  gtctcgttgcccagactg
B D                   Chimp  gtctcgttgcccagactg
B D                 Gorilla  gtctcgttgcccaggctg
B D               Orangutan  gtctcgttgcccaggctg
B D                  Gibbon  ctctcgttgcccaggctg
B D     Crab-eating macaque  ctctagttgcccaggctg
B D                  Baboon  ctctagttgcccaggctg
B D            Green monkey  ctctagttgcccaggctg
           Star-nosed mole  ==================
B D                Hedgehog  ==================
B D                   Shrew  ==================
B D               Armadillo  ==================
B D                Microbat  ==================
B D                  Tenrec  ==================
            Golden hamster  ==================
              Prairie vole  ==================
B D                Squirrel  ==================
B D                     Rat  ==================
B D                   Mouse  ==================
                Chinchilla  ==================
          Brush-tailed rat  ==================
B D              Guinea pig  ==================
B D          Naked mole-rat  ==================
    Lesser Egyptian jerboa  ==================
B D         Chinese hamster  ==================
       Cape elephant shrew  ==================
B D                   Sheep  ==================
          Cape golden mole  ==================
          Tibetan antelope  ==================
      David's myotis (bat)  ==================
        Chinese tree shrew  ==================
B D                Elephant  ==================
             Big brown bat  ==================
B D                     Cow  ==================
B D                Bushbaby  ==================
            Pacific walrus  ==================
B D                   Panda  ==================
             Domestic goat  ==================
              Killer whale  ==================
            Bactrian camel  ==================
B D                  Alpaca  ==================
B D                  Rabbit  ==================
B D                     Pig  ==================
B D                    Pika  ==================
B D                     Dog  ==================
B D                     Cat  ==================
B D                 Ferret   ==================
B D                 Dolphin  ==================
              Weddell seal  ==================
B D                 Megabat  ==================
                  Aardvark  ==================
B D                  Rhesus  ==================
B D                 Manatee  ==================
          Black flying-fox  ==================
B D        White rhinoceros  ==================
B D                   Horse  ==================
B D         Squirrel monkey  ==================
B D                Marmoset  ==================

Inserts between block 2 and 3 in window
B D              Orangutan 6694bp
B D    Crab-eating macaque 2351bp
B D                 Baboon 4367bp

Alignment block 3 of 429 in window, 71508510 - 71508512, 3 bps 
B D                   Human  gag
B D                   Chimp  gag
B D                 Gorilla  gag
B D               Orangutan  gag
B D                  Gibbon  gag
B D                  Rhesus  gag
B D     Crab-eating macaque  gag
B D                  Baboon  gag
B D            Green monkey  gag
           Star-nosed mole  ===
B D                Hedgehog  ===
B D                   Shrew  ===
B D               Armadillo  ===
B D                Microbat  ===
B D                  Tenrec  ===
            Golden hamster  ===
              Prairie vole  ===
B D                Squirrel  ===
B D                     Rat  ===
B D                   Mouse  ===
                Chinchilla  ===
          Brush-tailed rat  ===
B D              Guinea pig  ===
B D          Naked mole-rat  ===
    Lesser Egyptian jerboa  ===
B D         Chinese hamster  ===
       Cape elephant shrew  ===
B D                   Sheep  ===
          Cape golden mole  ===
          Tibetan antelope  ===
      David's myotis (bat)  ===
        Chinese tree shrew  ===
B D                Elephant  ===
             Big brown bat  ===
B D                     Cow  ===
B D                Bushbaby  ===
            Pacific walrus  ===
B D                   Panda  ===
             Domestic goat  ===
              Killer whale  ===
            Bactrian camel  ===
B D                  Alpaca  ===
B D                  Rabbit  ===
B D                     Pig  ===
B D                    Pika  ===
B D                     Dog  ===
B D                     Cat  ===
B D                 Ferret   ===
B D                 Dolphin  ===
              Weddell seal  ===
B D                 Megabat  ===
                  Aardvark  ===
B D                 Manatee  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D         Squirrel monkey  ===
B D                Marmoset  ===

Inserts between block 3 and 4 in window
B D                 Gibbon 8129bp
B D           Green monkey 3617bp

Alignment block 4 of 429 in window, 71508513 - 71509492, 980 bps 
B D                   Human  ctctagtttgattgcactgtggtctgagagacagtttgttataatttctgttcttttacatttgctgaga
B D                   Chimp  ttctagtttgattgcactgtggtctgagagacagtttgttataatttctgttcttttacatttactgaga
B D                 Gorilla  ttctagtttgattgcactgtggtctgagagacagtttgttataatttctgttcttttacatttgctgaga
B D               Orangutan  ttctagtttgattgcactgtggtctgagagacagtttgttataatttgtgttcttttacatttgctgaga
B D                  Rhesus  ttctagtttgattgcactgtggtctgagagacagtttgttataatttccattcttttacatttgctgagg
B D     Crab-eating macaque  ttctagtttgattgcactgtggtctgagagacagtttgttataatttccattcttttacatttgctgagg
B D                  Baboon  ttctagtttgattgcactgtgctctgagagacagtctgttataatttccgttcttttacatttgctgagg
           Star-nosed mole  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Sheep  ======================================================================
          Cape golden mole  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
B D                Bushbaby  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Pig  ======================================================================
B D                    Pika  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                 Ferret   ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                 Megabat  ======================================================================
                  Aardvark  ======================================================================
B D            Green monkey  ======================================================================
B D                  Gibbon  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================

                      Human  actgctttacttccaactatgtggtcaattttggaataagtgcgatgtggtgctgagaagaatgtatatt
                      Chimp  actgctttacttccaactatgtggtcaattttggaataagtgcgatgtggtgctgagaagaatgcatatt
                    Gorilla  actgctttacttccaactatgtggtcaattttggaataagtgcgatgtggtgctgagaagaatgtatatt
                  Orangutan  actgctttacttccaactatgtggtcaattttggaataagtgcgatgtggtgctgagaagaatgtatatt
                     Rhesus  agtgctttacttccaactatgtggtcaattttagaataagtgtgatgtggtgctgagaagaatgtatatt
        Crab-eating macaque  agtgctttacttccaactatgtggtcaattttagaataagtgtgatgtggtgctgagaagaatgtatatt
                     Baboon  agtgctttacttccaactatgtggtcaattttagaataagtgtgatgtggtgctgagacgaatgtatatt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ctgttgatttggggtggagagttctgtagatgtctattaggtctgcttggtgcagagctgagttcaattc
                      Chimp  ctgttgatttggggtggagagttctgtagatgtctattaggtctgcttggtgcagagctgagttcaattc
                    Gorilla  ctgttgatttggggtggagagttctgtagatgtctattaggtctgcttgatgcagagctgagttcaattc
                  Orangutan  ctgttgatttggggtggagagttctgtagatgtctattaggtctacttggtgcagagctgagttcaattc
                     Rhesus  ctgttgatttggggtggagagt----------tctattaggtccacttggtgcagagctgagttcaattc
        Crab-eating macaque  ctgttgatttggggtggagagt----------tctattaggtccacttggtgcagagctgagttcaattc
                     Baboon  ctgttgatttggggtggagagt----------tctattaggtccacttggtgcagagctgagttcaattc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ctggatatccttgttaactttctggctcatggatctgtcttatattgacagtggggtgttaaagcctccc
                      Chimp  ctggatatccttgttaactttctggctcatggatctgtcttatattgacagtggggtgttaaagcctccc
                    Gorilla  ctggatatccttgttaactttctggctcatggatctgtcttatattgacagtggggtgttaaagtctccc
                  Orangutan  ctggatatccttgttaactttctggctcatggatctgtcttatattgacagtggggtgttaaagtctccc
                     Rhesus  ctggatatccttgttaactttctgtctcattgatctgtctaatgttgacagtgggatgttagagtctccc
        Crab-eating macaque  ctggatatccttgttaactttctgtctcattgatctgtctaatgttgacagtgggatgttagagtctccc
                     Baboon  ctggatatccttgttaactttctgtctcattgatctgtctaatgttgacagtgggatgttagagtctccc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  attattattgtgtgggggtctaagtctc-ttgtaggtctctaaggacttgctttatgaatctgggtgctc
                      Chimp  attattattgtgtgggggtctaagtctc-ttgtaggtctctaaggacttgctttatgaatctgggtgctc
                    Gorilla  attattattgtgtgggggtctaagtctc-ttgtaggtctctaaggacttgctttatgaatctgggtgctc
                  Orangutan  attattattgtgtgggggtctaagtctctttgtaggtctctaaggacttgctttatgaatctggttgctc
                     Rhesus  attattactgtatgggagtctaagtctctttgtaagtctctaaggacttgctttatgaatctgggtgctc
        Crab-eating macaque  attattactgtacaggagtctaagtctctttgtaggtctctaaggacttgctttatgaatctgggtgctc
                     Baboon  attattactgtacaggagtctaagtctctttgtaggtctctaaggacttgctttatgaatctgggtgctc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ctgtattgggtggatatatatttaggatagttagctcttcttgttgaattgatccctttaccattatgta
                      Chimp  ctgtattgggtggatatatatttaggatagttagctcttcttgttgaattgatccctttacaattatgta
                    Gorilla  ctgtattgggtggatatatatttaggatagttagctcttcttgttcaattgatccctttaccattatgta
                  Orangutan  ctgtattgggtgtatatatatttaggatagttagctcttcttgttgaactgatccttttaccattatgta
                     Rhesus  ctgtattgggtgcatatatatttaggatagttagctcttcctgttgaattgatccctttaccattatgta
        Crab-eating macaque  ctgtgttaggtgcatatatatttaggataattagctcttcttgttgaattgatccctttaccattatgta
                     Baboon  ctgtgttaggtgcatatatatttaggataattagctcttcttgttgaattgatccctttaccattatgta
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  atggccttctttgtctcctttgatctttgttggtttaaagtctgttttatcagagactaggattgcaacc
                      Chimp  atggccttctttgtctcttttgatctttgttggtttaaagtctgttttatcagagactaggattgcaacc
                    Gorilla  atggccttctttgtctcttttgatctttgttggtttaaagtctgttttatcagagactaggattgcaact
                  Orangutan  atggtcttctttgtctcttttgatctttgttggtttaaagtctgttttatcagagactaggattgcaacc
                     Rhesus  atggccttctttgtctcttttgatctttgatggtttaaagtctgttttatcagagactagtattgcaacc
        Crab-eating macaque  atggccttctttgtctcttttgacctttgttggtttaaagtctgtttcatcagagactaggattgcaacc
                     Baboon  atggccttctttgtctcttttgacctttgttggtttaaagtctgttttatcagagactaggattgcaacc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  cctgcctttttttgttttccatttgcttggtagatcttcctccatccctttattttgagcctatgtgtgt
                      Chimp  cctgcctttttttgttttccatttgcttggtagatcttcctccatccctttattttgagcctatgtgtgt
                    Gorilla  cctgcctttttttgttttccatttgcttggtagatcttcctccatccctttattttgagcctatgtgtat
                  Orangutan  cctgcctttttttgttttccatttgcttggtagatcttcctccatccctttattttgaacctgtgtgtgt
                     Rhesus  cccgcttttttttgttctccatttgcttggtaaatcttcctccatccctttattttgagcctatgtatgt
        Crab-eating macaque  cctgcttttttttgttttccatttgcttggtagatcttcctccatccctttattttgagcctatgtgtgt
                     Baboon  cctgcttttttttgttttccatttgcttggtagatcttcccctatccctttattttgagcctatgtgtgt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ctctgcacgtgagatgggtctcctgaatacagcatagtgataggtcttgactc--tatccaatttgccag
                      Chimp  ctctgcatgtgagatgggtctcctgaatacagcatagtgataggtcttgactc--tatccaatttgccag
                    Gorilla  ctctgcatgtgagatgggtctcctgaatacagcatactgataggtcttgactctttatccaatttgccag
                  Orangutan  ctctgcatgtgagatgggtcttctgaatacagcatactgataggtcttgattctttatccaatttgccag
                     Rhesus  ctctgcgtgtgagatgggtctcctgaatacagcagactgatgggtcttgactctttatccagtttgccag
        Crab-eating macaque  ctctgcacgtgagatgggtctcctgaatacagcacactgatgggtcctgactc--tatccaatttgccag
                     Baboon  ctctgcacgtgagatgggtctcctgaatacagcacactgatgggtcctgactc--tatccaatttgccag
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tctgtgtcttttaattggagcatttagcccatttacatctaaggttaatattgttatgtgtgaatttgat
                      Chimp  tctgtgtcttttaattggagcatttagcccatttacatctaaggttaatattgttatgtgtgaatttgat
                    Gorilla  tctgtgtcttttaattggagcatttagcccatttacatctaaggttaatattgttatgtgtgaatttgat
                  Orangutan  tctgtgtcttttaattggagcatttagcccatttacatttaaggttaatactgttatatgtgaatttgat
                     Rhesus  tctgtgtcttttaattggagcatttagtccatttacatttaaggttaagattgttatgtgtgaacttgat
        Crab-eating macaque  tctgagtcttttaattggagcatttagcccatttacatttaagtttaatattgttatgtgagaatttgat
                     Baboon  tctgagtcttttaattggagcatttagcccatttatatttaagtttaatattgttatgtgtgaatttgat
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  cctgtcattatgatgttagctggttatcttgctcattagttgatgcagtttcttcctagcatcgatggtc
                      Chimp  cctgtcattatgatgttagctggttatcttgctcattagttgatgcagtttcttcctagcatcgatggtc
                    Gorilla  cctgtcattatgatgttagctggttatcttgctcattagttgatgcagtttcttcctagcattgatggtc
                  Orangutan  cctgtcattatgatgttagctggttattttgctcgtcagttgatgcagtttcttcctagcatcgatggtc
                     Rhesus  cctgccattatgatattaactggttattttgctcgttagttgatgcagtttcttcctagcctcgatggtc
        Crab-eating macaque  cctgtcattatgatgttagctggttactttgctcatt---------agtttcttcctagcattgatggtc
                     Baboon  cctgtcattatgatgttagctggttactttgctcatt---------agtttcttcctagcattgatggtc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tttacaatttagcatgtttttgcagtggctggtaccgggtgttcctttccatgtttagtgcttccttcag
                      Chimp  tttacaatttagcatgtttttgcagtggctggtaccaggtgttcctttccatgtttagtgcttccttcag
                    Gorilla  tttacaatttagcatgcttttgcagtggctggtaccgggtgttcctttccatgtttagtgcttccttcag
                  Orangutan  tttacaatttggcatgtttttgcagtggctggtaccgggtgttcctttccatgtttagtgcttccttcag
                     Rhesus  tttacattttggcatgtttttgcaatggctggtaccggttgttcctttccatgtttagtgcttccttcag
        Crab-eating macaque  tttacaatttggcatgtttttgcagtggctggtaccagttgttcctttccatgtttactgcttccttcag
                     Baboon  tttacaatttggcatgtttttgcagtggctggtaccagttgttcctttccatgtttactgcttccttcag
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  gagctcttgtaaggtaggcctggtggtgac-aaaatctctcagcatttgcttgtctgtaaaggattttat
                      Chimp  gagctcttgtaaggtaggcctggtggtgac-aaaatctctcagcatttgcttgtctgtaaaggattttat
                    Gorilla  gagctcttgtaaggtaggcctggtggtgac-aaaatctctcagcatttgcttgtctgtaaaggattttat
                  Orangutan  gagctcttgtaaggtaggcctggtggtgac-aaaatctctcagcatttgcttgtctgtaaaggatttta-
                     Rhesus  ggtctcttgtaaggcaggcctagtggtgac-aaaatctctaagcatttgcttatctgtaaaggatttta-
        Crab-eating macaque  gagctcttgtaaggcaggcctggtggtgacaaaaatctctcagcattttcttgtctgtaaaggatttta-
                     Baboon  gagctcttgtaaggcaggcctggtggtgacaaaaatctctcagcattttcttgtctgtaaaggatttta-
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ttctccttttctccttcacttatgaagcttagtttggctggatatgaaattctgggttgaaaatgctttt
                      Chimp  ttctccttttctccttcacttatgaagcttagtttggctggatatgaaattctgggttgaaaatgctttt
                    Gorilla  ttctccttttctccttcacttatgaagcttagtttggctggatatgaaattctgggttgaaaatgctttt
                  Orangutan  -------tttctccttcacctatgaagcttagtttggctggatatgaaattctgggttgaaaattctttt
                     Rhesus  -------tttctccttcacttatgaaacttagtttggctggatatgaaattctgggtttaaaattctttt
        Crab-eating macaque  -------tttctccttcacttatgaggcttagtttggctggatatgaaattctgtgttgaaaattctttt
                     Baboon  -------tttctccttcacttatgaggcttagtttggctggatatgaaattctgtgttgaaaattctttt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
               Green monkey  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  cttt
                      Chimp  cttt
                    Gorilla  cttt
                  Orangutan  cttt
                     Rhesus  cttt
        Crab-eating macaque  cttt
                     Baboon  cttt
            Star-nosed mole  ====
                   Hedgehog  ====
                      Shrew  ====
                  Armadillo  ====
                   Microbat  ====
                     Tenrec  ====
             Golden hamster  ====
               Prairie vole  ====
                   Squirrel  ====
                        Rat  ====
                      Mouse  ====
                 Chinchilla  ====
           Brush-tailed rat  ====
                 Guinea pig  ====
             Naked mole-rat  ====
     Lesser Egyptian jerboa  ====
            Chinese hamster  ====
        Cape elephant shrew  ====
                      Sheep  ====
           Cape golden mole  ====
           Tibetan antelope  ====
       David's myotis (bat)  ====
         Chinese tree shrew  ====
                   Elephant  ====
              Big brown bat  ====
                        Cow  ====
                   Bushbaby  ====
             Pacific walrus  ====
                      Panda  ====
              Domestic goat  ====
               Killer whale  ====
             Bactrian camel  ====
                     Alpaca  ====
                     Rabbit  ====
                        Pig  ====
                       Pika  ====
                        Dog  ====
                        Cat  ====
                    Ferret   ====
                    Dolphin  ====
               Weddell seal  ====
                    Megabat  ====
                   Aardvark  ====
               Green monkey  ====
                     Gibbon  ====
                    Manatee  ====
           Black flying-fox  ====
           White rhinoceros  ====
                      Horse  ====
            Squirrel monkey  ====
                   Marmoset  ====

Alignment block 5 of 429 in window, 71509493 - 71509664, 172 bps 
B D                   Human  aagaatgttgaatactgtcccccactctcttctggcttgtagagtttctgctgagagatccactgttagt
B D                   Chimp  aagaatgttgaatactggcccccactctcttctggctcatagagtttctgctgagagatccactgttagt
B D                 Gorilla  aagaatgttgaatactggcccccactctcttctggcttgtagagtttctgctgagagatccactgttagt
B D               Orangutan  aagaatgttgaatattggcccccactctcttctggcttgtagagtttctgctgagagatccactgttagt
B D                  Rhesus  aagaatgttgaatattggcccccactctcttctggcttggagagtttctgccgagagatctgctgttagt
B D     Crab-eating macaque  aagaatgttgaatattggcccccactctcttctggcttgtagagtttctgctgagagatccactgttagt
B D                  Baboon  aagaatgttgaatattggcccccactctcttctggcttgtagagtttctgctgagagatccactgttagt
B D            Green monkey  aagaatgttgaatattggcccccactctcttctggcttgtagagtttctgctgagagatccactgttagt
           Star-nosed mole  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Sheep  ======================================================================
          Cape golden mole  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
B D                Bushbaby  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Pig  ======================================================================
B D                    Pika  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                 Ferret   ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                 Megabat  ======================================================================
                  Aardvark  ======================================================================
B D                  Gibbon  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================

                      Human  ctgatgggcttccctttgtgggtaacccgacctttctatctggctgcccttaatattttttccttcattt
                      Chimp  ctgatgggcttccctttgtgggtaacccgacctttctatctggctgcccttaatattttttccttcattt
                    Gorilla  ctgatgggcttccctttgtgggtaacccaacctttctatctagctgcccttaatattttttccttcattt
                  Orangutan  ctgatgggcttccctttgtgggtaacccaatctttctgtctggctgcccttaatattttttccttcattt
                     Rhesus  ctgatgggcttccctttgtgggtaacccgacctttctctctggctgcccttaagattttttccttcattt
        Crab-eating macaque  ctgatgggcttccctttgtgggtaacccgacctttctctctggctacccttaatattttttccttcattt
                     Baboon  ctgatgggcttccctttgtgggtaacccaacctttttctctggctacccttaatattttttccttcattt
               Green monkey  ctgatgggcttccctttgtgggtaacctgacctttctctctggctacccttaatattttttccttcattt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                     Gibbon  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  caactttgctgaatctgaaaattacgtgtctt
                      Chimp  caactttgcggaatctgaaaattacgtgtctt
                    Gorilla  caactttggtgaatctgacaattatgtgtctt
                  Orangutan  caacttcggtgaatctgacaattacgagtctt
                     Rhesus  caactttggtgaatctggcaattatgtgtctt
        Crab-eating macaque  caactttggtgaatctgacaattatgtgtctt
                     Baboon  caactttggtgaatctgacaattatgtgtctt
               Green monkey  caactttggtgaatctgacaattatgtgtctt
            Star-nosed mole  ================================
                   Hedgehog  ================================
                      Shrew  ================================
                  Armadillo  ================================
                   Microbat  ================================
                     Tenrec  ================================
             Golden hamster  ================================
               Prairie vole  ================================
                   Squirrel  ================================
                        Rat  ================================
                      Mouse  ================================
                 Chinchilla  ================================
           Brush-tailed rat  ================================
                 Guinea pig  ================================
             Naked mole-rat  ================================
     Lesser Egyptian jerboa  ================================
            Chinese hamster  ================================
        Cape elephant shrew  ================================
                      Sheep  ================================
           Cape golden mole  ================================
           Tibetan antelope  ================================
       David's myotis (bat)  ================================
         Chinese tree shrew  ================================
                   Elephant  ================================
              Big brown bat  ================================
                        Cow  ================================
                   Bushbaby  ================================
             Pacific walrus  ================================
                      Panda  ================================
              Domestic goat  ================================
               Killer whale  ================================
             Bactrian camel  ================================
                     Alpaca  ================================
                     Rabbit  ================================
                        Pig  ================================
                       Pika  ================================
                        Dog  ================================
                        Cat  ================================
                    Ferret   ================================
                    Dolphin  ================================
               Weddell seal  ================================
                    Megabat  ================================
                   Aardvark  ================================
                     Gibbon  ================================
                    Manatee  ================================
           Black flying-fox  ================================
           White rhinoceros  ================================
                      Horse  ================================
            Squirrel monkey  ================================
                   Marmoset  ================================

Alignment block 6 of 429 in window, 71509665 - 71510727, 1063 bps 
B D                   Human  ggagttgctcttctcgaggagtatctttgtggtgtactctgtatttcctgaatttgaatgttggcctatc
B D                   Chimp  ggagttgctcttctcgaggagtatctttgtggtgttctctgtatttcctgaatttgaatgttggcctacc
B D                 Gorilla  ggagttgctcttctcaaggagtatctttgtggtgttctctgtatttcctgaatttgaatgttggcctacc
B D               Orangutan  ggagttgctcttctcgaggagtatctttgtggcattctctgtatttcctgaatttgaatgttggcctacc
B D                  Gibbon  ggaattgctcttcttgaggaatatctttgtggcattctctgtatttcctgaatttgaatattgtcctacc
B D                  Rhesus  ggagttgctcttctcgaggagtatctttgtggcgttctctgtatttcctggatttgaatgttggcctgcc
B D     Crab-eating macaque  ggagttgctcttctcaaggagtatctttgtggtgttctctgtatttcctgaattcgaatgttgggctgcc
B D                  Baboon  gcagttgctcttctcaaggagtatctttgtggtgttctctgtatttcctgaatttgaatgttgggctgcc
B D            Green monkey  ggagttgctcttctcaaggagtatctttgtgg-------tgtatttcctgaatttgaatgttgggctgcc
           Star-nosed mole  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Sheep  ======================================================================
          Cape golden mole  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
B D                Bushbaby  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Pig  ======================================================================
B D                    Pika  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                 Ferret   ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                 Megabat  ======================================================================
                  Aardvark  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================

                      Human  ttgctaggttggggaagttctcctggataatatcctgaagagtgttttccaacttggttccattctcccc
                      Chimp  ttgctaggttggggaagttctcctggataatatcctgaagagtgttttccaacttggttccattct-ccc
                    Gorilla  ttgctaggttggggaagttctcctggataatatcctgaagagtgttttccaacttggttccattctcccc
                  Orangutan  ttgctaggttggggaagttctcctggataatatcctgaagagtgttttccaacttggttccattctccct
                     Gibbon  ttgctaggttggggaagttctcctggatagtatcctgaagagtgttttccaacttggttccattctcccc
                     Rhesus  ctactaggttggggaagttctcctggatgatatcctgaagagtgttttccaacttggttccattttcccc
        Crab-eating macaque  ttgctaggttggggaagttctcctgaataatatcctgaagagtattttccaacttggttccattctcccc
                     Baboon  ttgctaggttggggaagttctcctgaataatatcctgaagagtattttccaacttggttccattctcccc
               Green monkey  ttgctaggttggggaagttctcctgaataatatcctgaagagtattttccagcttggttccattctcccc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  atcactttcaggtacaccaatcaaaagtagatttggtgttttcacatagtcccatatttcttggaggatt
                      Chimp  gtcactttcaggtacaccaatcaaaagtagatttggtgttttcacatagtcccatatttcttggaggatt
                    Gorilla  gtcactttcaggtacaccaatcaaaagtagatttggtgttttcacatagtcccatatttcttggaggatt
                  Orangutan  gtcactttcaggtacaccaatcaaaagtagatttggtgttttcacatagtcccatatttcttggaggatt
                     Gibbon  atcactttcaggtacaccaatcaaacgtagatttggtcttttcacatagtcccatatttcttggaggctt
                     Rhesus  ctcactttcaggcaccccaatcagacgtagatttggtctttttacataatcccatacttcttgcaggctt
        Crab-eating macaque  atcactttcaggtacaccaatcaaacacagatttggtcttttcacagagtcccatatttcttggaagctt
                     Baboon  gtcactttcaggtacaccaatcaaacacagatttggtcttttcacagagtcccatatttcttggaagctt
               Green monkey  gtcactttcaggtacaccaatcaaacacagatttggtcttttcacatagtcccatatttcttggaagctt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tgtttgtttctttttactcttttttctctaaacttctcttctcgcttcatttcattcatttgatcttcaa
                      Chimp  tgtttgtttctttttactcttttttctctaaacttctcttctcgcttcatttcattcatttgatcttcaa
                    Gorilla  tgtttgtttctttttactcttttttctctaaacttctcttcttgcttcatttcattcatttgatcttcca
                  Orangutan  tgtttgtttctttttactcttttttctctaaacttctcttctcacttcatttcattcatttgatcttcaa
                     Gibbon  tgtttgtttctttttactc--ttttctctaaaattctcttctcacttcatttcattcatttggtcttcaa
                     Rhesus  tgttcatttctttttcttcttttttcttttggtttctcttctcgcttcatttcattcatttgatcctcaa
        Crab-eating macaque  tgtttgtttctttttactattttttctctaaacttttcttctcacttcatttcattcagttgatcttcag
                     Baboon  tgtttgtttctttttactattttttctctaaacttttcttctcacttcatttcattcagttgatcttcag
               Green monkey  tgtttgtttctttttactattttttctctaaacttttcttctcacttcatttcattcagttgatcttcag
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tcactgataccctttcttccacttgatcgaattggctactgaagcttgtgcatgtgtcacgtagttctca
                      Chimp  tcactgataccctttcttccactcgatcgaattggctactgaagcttgtgcatgtgtcatgtagttctca
                    Gorilla  tcactgataccctttcttccacttgatcgaattggctactgaagcttgtgcatgtgtcacgtagttcaca
                  Orangutan  tcactgataccctttcttccacttgatcaaatcggctactgaagcttgtgcatgtgtcacgtagttctca
                     Gibbon  tcactgatacactttcttccacttgatcgaatcggctactgaagcttatgcatgtgtcacgtagttctca
                     Rhesus  tcgcagatactctttcttccagttgatcgagtcggttactgaagcttgtgcatttgtcacgtatttctcg
        Crab-eating macaque  tcactgatactctttcttccacttgatcgaatcagctactgaagcttgtacatgagtcacgtagttctca
                     Baboon  tcgctgatactctttcttccacttgatcgaatcagctactgaagcttgtacatgagtcacgtagttctca
               Green monkey  tcactgatactctttcttccacttgatcaaatcagctactgaagcttgtacatgagtcacgtagttctca
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tgccatggttttcagctccatcaggtcatttaaggtcttctctatgctgtttattctacttagccattca
                      Chimp  tgccgtggttttcagctccatcaggtcatttaaggtcttctctatgctgtttattctagttagccattca
                    Gorilla  tgctgtggttttcagctccatcaggtcatttaaggtcttctctatgctgtttattctagttagccattca
                  Orangutan  tgctgtggttttcagctccatcaggtcatttaaggtcttctctatgctgtttattctagttagccatttg
                     Gibbon  tgctgtggttttcagctccatcaggtcatttaaggtcttctctatgctgtttattctagttagccattcg
                     Rhesus  tgtcatggttttcatctctttcatttcgtttatgaccttctctgcattaattactctagccatcaattct
        Crab-eating macaque  tgccatggttttcagctgcatcaggtcatttaaggccttctctatgctgtttattctagttagccattcg
                     Baboon  tgccatggttttcagctgcatcaggtcatttaaggccttctctatgctgtttattctagttagccattcg
               Green monkey  tgccatggttttcagctccatcaggtcatttaaggccttctctatgctgtttattctagttagccattcg
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tctaatcttttttcaaagtttttagcttctttgcaatgggttcgaacatcctcctttagctcggagaagt
                      Chimp  tctaatcttttttcaaagtttttagcttctttgcaatgggttcgaacatcctcctttagctcggagaagt
                    Gorilla  tctaatcttttttcaaagtttttagcttctttgcaatgggttcgaacatcctcctttagttcggagaagt
                  Orangutan  tctaatcttttttcaaggtttttagcttctttgcaacgggttcgaacatcctcctttagctcagagaagt
                     Gibbon  tctaatcttttttcaagatttttagcttctttgcaatgggttcgaacatcctcctttagttcggagaagt
                     Rhesus  tccacttttttttcaagatttttagtttctttgcgctgggtacgtaattcctcctttagctctgagaaat
        Crab-eating macaque  tctaacctcttttcaaggtttttagcttctttgcggtgggtccaaacatcctcctttagctcggagaagt
                     Baboon  tctaatcttttttcaaggtttttagcttctttgcggtgggtccaaacatcctcctttagctcggagaagt
               Green monkey  tctaatcttttttcaaggtttttagcttctttgtggtgggtccaaacatcctcctttagctcggagaagt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ttgttatta--------ctgaagc---cttctctcaactcgtcaaagtcattctccgtccagctttgttc
                      Chimp  ttgttatta--------ctgaagc---cttctctcaacttgtcaaagtcatcctccgtccagctttgttc
                    Gorilla  ttgttatta--------ctgaagc---cttctctcaactcgtcaaagtcattctccatccagctttgttc
                  Orangutan  ttgttatta--------ctgaagc---cttctctcaactcgtcaaagtcattctccatccagctttgttc
                     Gibbon  ttgttatta--------ctgaagc---cttctctgaactcatcaaaatcattctctgtccagctttgttc
                     Rhesus  t---------tgatggactgaagccttcttctctcatctcgtcaaagtcattctccgtccagctttgatc
        Crab-eating macaque  ttgttattactgattgtctgaagc---cttctctcaactcgtcaaagtcattttccatccagctttgttc
                     Baboon  ttgttattactgattgtctgaagc---cttctctcaactcgtcaaagtcattttccatccagctttgttc
               Green monkey  ttgttattactgattgtctgaagc---cttctctcaactcgtcaaagtcattttccatccagctttgttc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tgttgctggccaggagctgtgttcctttggaggagaagaggcgctctgatttttagaattttcagctttt
                      Chimp  tgttgttggccaggagctgtgttcccttggaggagaagaggcgctctgatttttagaattttcagctttt
                    Gorilla  tgttgctggccaggagctgttttcctttggaggagaagaggcagtctgatttttagaattttcagctttt
                  Orangutan  tgttgctggcgaggagctgtgttcctttggaaaagaagaggagctctgatttttagaattttcagctttt
                     Gibbon  tgttgctggcaaggagctgcattcctttggaggagaagaggcactctgatttttagaattttcagctttt
                     Rhesus  cgttgctggcgatgagctgcgctcctttgccgggggagatgcgctcttattttttgaatttccagctttt
        Crab-eating macaque  tgttgctagcaagaagctgcgttcctttggaggagaaaaggcgctctgatttttagaattttcagctttt
                     Baboon  tgttgctggcaagaagctgcgttcctttggaggagaaaaggcgctctgatttttagaattttcagctttt
               Green monkey  tgttgctggcaagaagctgcgttcctttggaggagaaaaggcgctctgatttttagaattttcagctttt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ctgctctggtttttccccatctttgtggttttatctacctttggtctttgatgatggggatgtacagatg
                      Chimp  ctgctctggtttttccccatctttgtggttttatctacctttggtctttgatgatggtgatgtacagatg
                    Gorilla  ctgctctggtttttccccatctttgtggttttatctaccttcggtctttgatgatggtgatgtacagatg
                  Orangutan  ctgctctggttttt-cccatctttgtggttttatctacctttggtctttgatgatggtgatgtacagatg
                     Gibbon  ctgctctggtttctcccaatctttgtggttatatctacctttgctctttgacgatggtgacgtacagatg
                     Rhesus  ctgccctgctttttccccatctttgtggttttatctgcctctggtctttgatgatggtgatgtactgatg
        Crab-eating macaque  ctgctctggtttcttcccatctttgtggttttatctacctttggtctttgatcatggtgacatacagatg
                     Baboon  ctgctctggtttcttcccatctttgtggttttatctacctttggtctttgatcatggtgacatacagatg
               Green monkey  ctgctctggtttcttcccatctttgtggttttatctacctttggtctttgatcatggtgacatacagatg
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  gggttttggcatggatgtcctttctgtttgttagttttccttcttacagtcaggaccctcagctgcaggt
                      Chimp  gggttttggcatggatgtcctttctgtttgttagttttccttcttacagtcaggaccctcagctgcaggt
                    Gorilla  gggttttggcatggatgtcctttctgtttgttagttttccttcttacagtcaggactctcagctgcaggt
                  Orangutan  gggttttggcatggatgtcctttctgtttgttagttttcctcctaacagtcaggaccctcatctgcaggt
                     Gibbon  gggttttggcgtagatgtcctttctgtttgttagttttccttctaa----tgggaccctcagctgaagat
                     Rhesus  gggttttggtgtaggtgtccttcctgtttgatagttttccttctaacagtcaggaccctcagctgtaggt
        Crab-eating macaque  gggttttggtgtggatgtcctttctgtttgttagtttcccttctaacagtcaggaccctcagctgcaggt
                     Baboon  gggttttggtgtggatgtcctttctgtttgttagtttcccttctaacagtcaggaccctcagctgcaggt
               Green monkey  gggttttggtgtggatgtcctttctgtttgttagtttcccttctaacagtcaggaccctcagctgcaggt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  ctgttggagtttgctgggggtccactccagaccctgtttgcctgggtatcaccagc----ataggctgca
                      Chimp  ctgttggagtttgctgggggtccactccagaccctgtttgcctgggtatcaccagc----ataggctgca
                    Gorilla  ctgttggagtttgctgggggtccattccagaccctgtttgcctgggtatcaccagc----ataggctgca
                  Orangutan  ctgttggagtttgctgggggtccactccagaccctgtttgcctgggtatcaccagc----ataggcagca
                     Gibbon  ctgttggagtttgctgggggtccactccagaccctgtttgcctgggtatcaccagc----ataggctgca
                     Rhesus  ctgttggagattgcttgaggtccactccagaccctgtttgc-----------------------------
        Crab-eating macaque  atgttggagtttgctggaggtccattccagaccctgtttgcctgggtatcaccagtggagggaggttaca
                     Baboon  atgttggagtttgctggaggtccattccagaccctgtttgcctgggtatcaccagtggagggaggctgca
               Green monkey  atgttggagtttgctggaggtccattccagaccctgtttgcctgggtatcaccagtggagggaggctgca
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  gaacagcaattactgcagaaag-----------------gccaatgttgctgcctgatccttcctctgga
                      Chimp  gaacagcaattattgcagaaag-----------------gcaaatgttgctgcctgatccttcctctgga
                    Gorilla  gaacagcaattattgcagaaag-----------------gcaaatgttgctgcctgatccttcctctgaa
                  Orangutan  gaacagcaaatattgcagaacg-----------------gcaaatgttgctgcctgatccttcctctgga
                     Gibbon  gaacagcaaatattgcagaacggcaaatattgcagaacagcaaatgttgctgcctgatccttcctctgga
                     Rhesus  -------------------------------------------------ctgcctgatccttcctctgga
        Crab-eating macaque  gaacagcaaatattgcagaaca-----------------gcaaatgttgctgcctgatccttcctctgga
                     Baboon  gaacagcaaatattgcagaaca-----------------gcaaatgttgctacctgatccttcctctgga
               Green monkey  gaacagcaaatattgcagaaca-----------------gcaaatgttgctgcctgatccttcctctgga
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  agcttcatctcagaggggcacccagctgtatgaggtgtcagtcagcccctactaggaggtgtctcccagt
                      Chimp  agcttcatctcagaggggcacccagctgtatgaggtgtcagtcagcccctactaggaggtgtctcccagt
                    Gorilla  agcttcatctcagaggggcacccagctgtatgaggtgtcagtcagcccctattaggaggtgtctcccagt
                  Orangutan  agcttcatctcagaggggcacccagctgtatgaggtgtcagttagcccctactgggaggtgtctcccagt
                     Gibbon  agcttcgtctcaggggggcacccagctgtatgaggtgtcagtcagcccctactgggaggtgtctcccact
                     Rhesus  agcttcgtctcagagaggcatccagctgtatgaggttttagttggcccctactgggaggtgtctcccagt
        Crab-eating macaque  agcttcgtctcagagaggcatccagctgtatgaggttttagttggcccctactgggaggtgtctcccagt
                     Baboon  agcttcgtctcagagaggcatccagctgtatgaggttttagtcggcccctactgggaggtgtctcccagt
               Green monkey  agcttcatctcagagaggcatccagctgtatg-----ttagtcggcccctactgggaggtgtctcccagt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  taggctactcaggggtcagggacccacttgaggaggcagtctgtccgttctcagatctcaaactccattc
                      Chimp  tgggctactcaggggtcagggacccacttgaggaggcagtctgtccgttctcagatctcaaactccattc
                    Gorilla  taggctactcaggggtcagggacccacttgaggaggcagtctgtctgttctcagatctcaaactccattc
                  Orangutan  taggctactcaggggtcagggacccacttgaggaggcagtctgtctgttctcagatctcgaactccatgc
                     Gibbon  taggctactcgggggtcagggacccacttgaggaggcagtctgtccattctcagatctcagactccgtgc
                     Rhesus  taggctagtcaggggtcagggacccacttgaggaggcagtctgtccatt-tcagatctcaaactccatgc
        Crab-eating macaque  taggctagtcaggggtcagggacccacttgaggaggcagtctgtccatt-tcagatctcaaactccatgc
                     Baboon  taggctactcaggggtcagggacccacttgaggaggcagtc-gtccatt-tcagatatcaaactccatgc
               Green monkey  taggctactcaggggtcagggacccacttgaggaggcagtctgtccatt-tcagatctcaaactctatgc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================

                      Human  tgggagaaccactactctc----ttcaaagctgtcagacatggacattt
                      Chimp  tgggagaatcactactctc----ttcaaagctgtcagacatggacattt
                    Gorilla  tgggagaaccactactctc----ttcaaagctgtcagacatggacattt
                  Orangutan  tgggagaaccactactctc----ttcaaagctgtcagacatggacattt
                     Gibbon  tgggagaaccactactctctgaattcaaagctatc-----ttctcttt-
                     Rhesus  tgggagaaccactactctc----ttcaaagctgtcagacaaggacattt
        Crab-eating macaque  tgggagaaccactactctc----ttcaaagctgtcagacaaggacattt
                     Baboon  tgggagaaccactactctc----ttcaaagctgtcagacaaggacattt
               Green monkey  tgggagaaccactacgctc----ttcaaagctgtcaaacaaggacattt
            Star-nosed mole  =================================================
                   Hedgehog  =================================================
                      Shrew  =================================================
                  Armadillo  =================================================
                   Microbat  =================================================
                     Tenrec  =================================================
             Golden hamster  =================================================
               Prairie vole  =================================================
                   Squirrel  =================================================
                        Rat  =================================================
                      Mouse  =================================================
                 Chinchilla  =================================================
           Brush-tailed rat  =================================================
                 Guinea pig  =================================================
             Naked mole-rat  =================================================
     Lesser Egyptian jerboa  =================================================
            Chinese hamster  =================================================
        Cape elephant shrew  =================================================
                      Sheep  =================================================
           Cape golden mole  =================================================
           Tibetan antelope  =================================================
       David's myotis (bat)  =================================================
         Chinese tree shrew  =================================================
                   Elephant  =================================================
              Big brown bat  =================================================
                        Cow  =================================================
                   Bushbaby  =================================================
             Pacific walrus  =================================================
                      Panda  =================================================
              Domestic goat  =================================================
               Killer whale  =================================================
             Bactrian camel  =================================================
                     Alpaca  =================================================
                     Rabbit  =================================================
                        Pig  =================================================
                       Pika  =================================================
                        Dog  =================================================
                        Cat  =================================================
                    Ferret   =================================================
                    Dolphin  =================================================
               Weddell seal  =================================================
                    Megabat  =================================================
                   Aardvark  =================================================
                    Manatee  =================================================
           Black flying-fox  =================================================
           White rhinoceros  =================================================
                      Horse  =================================================
            Squirrel monkey  =================================================
                   Marmoset  =================================================

Inserts between block 6 and 7 in window
B D                Gorilla 1428bp

Alignment block 7 of 429 in window, 71510728 - 71511225, 498 bps 
B D                   Human  aagtctgcagaagtttctgctgccttttgttcagctatgccctgccctcagaggtggagtctacagagac
B D                   Chimp  aagtctgcagaagtttctgctgccttttgttcagctatgccctgccctcagaggtggagtctgcagaggc
B D               Orangutan  aaatctgcagaagtttctgctgccttttgttcagctatgccctgcctccagaggtggagtctatagaggc
B D                  Gibbon  aagtctgcagaagtttctgctgccttttgttcagctacaccctgccctcagaggtggagtctacagaggc
B D                  Rhesus  aagtctgcagaagtttctgctgccttttgttcagctatgccctgcccctagaggtggagtctacagaggc
B D     Crab-eating macaque  aagtctgcagaagtttctgctgccttttgttcagctacgccctgcccctagaggtggagtctacagaggc
B D                  Baboon  aagtctgcagaagtttctgctgccttttgttcagctatgccctgcccctagaggtggagtctacagaggc
B D            Green monkey  aagtctgcagaagtttctgctgccttttgttcagctatgccctgcccctagaggtggagtctacagaggc
           Star-nosed mole  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Sheep  ======================================================================
          Cape golden mole  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
B D                Bushbaby  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Pig  ======================================================================
B D                    Pika  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                 Ferret   ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                 Megabat  ======================================================================
                  Aardvark  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                 Gorilla  ======================================================================

                      Human  atgcaggcctccttgagctgcagtgggctccccgcagttcaagcttcccagccactttgtttacctactc
                      Chimp  atgcaggcctccttgagctgcagtgggctccccgcagttcaagcttcccagccactttgtttacctactc
                  Orangutan  aggcaggcctccttgagctgcagtgggctccccccagttcaagcttcccagccactttgtttacctagtc
                     Gibbon  aggcaggcctccttgagctgcagtgggctccccccagttcaagcttcctggccactttgtttacttactc
                     Rhesus  aggcaggcctccttgagctgcagtgagctcccc-cagttcgagcttcccagccactttgtttaccgactc
        Crab-eating macaque  aggcaggcctccttgagctgcagtgagctcccc-cagttcgagcttcccagccactttgtttacctactc
                     Baboon  aggcaggcctccttgagctgcagtgagctcccc-caggtcgagcttcccagccactttgtttacctactc
               Green monkey  aggcaggcctccttgagctgcagtgagctcccc-cagttcgagcttcccaaccactttgtttacctactc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                    Gorilla  ======================================================================

                      Human  aagcctcagcaatggtgtacgcccctccccgagccttgctgccgccttgcagttcaatctcagactgctg
                      Chimp  aagcctcagcaatggtgtacgcccctccctgagccttgctgccgccttgcagttcaatctcagactgctg
                  Orangutan  aagcctcagcaatggtgtacgcccctccccgagccttgctgccgccttgcagttcaatctcagactgctg
                     Gibbon  aagcctcagcaatggcggatgcccctcccccagcctcactgccgccttgcagttcaatctcagactgctg
                     Rhesus  aagcctcagcaat-gtggacacccctcccccagcctcactgccaccttgcagtttgatctcagactgccg
        Crab-eating macaque  aagcctcagcaatggtggacacccctcccccagcctcactgccaccttgcagtttgatctcagactgccg
                     Baboon  aagcctcagcaatggtggacacccctcccccagcctcactgccgccttgctgtttgatctcagactgccg
               Green monkey  aagcctcagcaatggtggacacccctcccccagcctcgctgccgccttgcagtttgatctcagagtgcta
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                    Gorilla  ======================================================================

                      Human  tgctagaaatgagcgaggctccatgggcgtgggaccctctgagccaggtgtgggatataatctcctggtg
                      Chimp  tgctagcagtgagcgaggctccatgggcgtgggaccctctgagccatgtgtgggatataatctcctggtg
                  Orangutan  tgctagcagtgagcgaggctccatgggcatgggaccctctaagccaggcacaggatataatctcctggta
                     Gibbon  tgctagcagtgagcgaggttctgtgggcatcggaacctctaagccaggcacgggatataatctcctggtg
                     Rhesus  tgctagcagtgaacaaggctccgtgggcatgggaccctctgagacaggcatgggatataatctcctggta
        Crab-eating macaque  tgctagcagtgaacaaggctccgtgggcatgggaccctctgagccaggcatgggatataatctcctggta
                     Baboon  tgctagcagtgaacaaggctccgtgggcatgggaccctctgagccaggcatgggatataatctcctggta
               Green monkey  tgctagcaatgagcaaggctccgtgggcatgggaccctctgagccaggcatgggatataatctcctggta
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                    Gorilla  ======================================================================

                      Human  tgccatttgctaataccattggaaaagcacagtattagggtgggagtgtcccgattttccaggtaccgtc
                      Chimp  tgccgtttgctaataccattggaaaagtgcagtattagggtgggagtgtcccgattttccaggtaccgtc
                  Orangutan  tgccatttgctaagaccattggaaaagcgcagtattagggtaggagtgtcccgattttccaggtaccatc
                     Gibbon  tgccgtttgctaagaccattggaaaagtgcagtattagggtgggagtgtcccgattttctaggtaccatc
                     Rhesus  tgccatttgctaagattgttggaaaagcgcagtattagggtgggagtgtcctgattttccaggtaccgtc
        Crab-eating macaque  tgccatttgctaagattgttggaaaagtgcagtattagggtgggagtgtcctgattttccaggtaccgtc
                     Baboon  tgccatttgctaagattgttggaaaagtgcagtattagggtgggagtgtcctgattttccaggtaccatc
               Green monkey  tgccatttgctaagatcattggaaaagtgcagtattagggtgggagtgtcctgattttccaggtaccgtc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                    Gorilla  ======================================================================

                      Human  tgtcatggcttcccttggctaggaaagggaatttcccgaccccttgcgcttcccgggtgaagtgatgccc
                      Chimp  tgtcatggcttcccttggctaggaaagggaatttcccgaccccttgcgcttcccgggtgaagtgatgccc
                  Orangutan  tgtcatggcttcccttggctaggaaagggaattccctgaccccttgcacttcccgggtgaggtgatgccc
                     Gibbon  tgtcatggcttcccttggctaggaaagggaattccctgacgccttgtgcttcctgggtgaggcgatgccc
                     Rhesus  tgtcatggcttccctttgctaggaaagggaactccccaaccccttgcacttctggggtgaagagatgccc
        Crab-eating macaque  tgtcatggcttcccttggctaggaaagggaactccccaaccccttgcacttctggggtgaagagatgccc
                     Baboon  tgtcatggcttcccttgggtaggaaagggaattccccaaccccttgcacttctggggtgaagagatgccc
               Green monkey  tgtcatggcttcccttggctaggaaagggaattccccaaccccttgcacttctggggtgaagagatgccc
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                    Gorilla  ======================================================================

                      Human  cgccctgcttcagctcacattctgtgggctgcacccactgtctgacaagccccagtgagatgaaccgggt
                      Chimp  cgccctgcttcagctcacattctgtgggctgcacccactgtctgacaagccccagtgagatgaaccaggt
                  Orangutan  cgccctgcttcagctcacattctgtaggctgcacccactgtctgacaagccccagtgagatgaacccggt
                     Gibbon  tg-cctgctttggctcacactttgtgagctgcacccactgtccgacaagccccattgagatgaacccggt
                     Rhesus  tgccctgcttcagcttacactctgtgggctgcacccacgatctgactagccccagtgagatgaacccagt
        Crab-eating macaque  tgccctgcttcggcttacactctgtgggctgcacccacgatctgactagccccagtgagatgaacccagt
                     Baboon  tgccctgcttcggcttacaccctgtgggctgcacccacggtctgactagccccagtgagatgaacccagt
               Green monkey  tgccctgcttcggattacactctgtgggctgcacccactgtctgactagccccagtgagctgaacccagt
            Star-nosed mole  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                      Sheep  ======================================================================
           Cape golden mole  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
                   Bushbaby  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
              Domestic goat  ======================================================================
               Killer whale  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
                     Rabbit  ======================================================================
                        Pig  ======================================================================
                       Pika  ======================================================================
                        Dog  ======================================================================
                        Cat  ======================================================================
                    Ferret   ======================================================================
                    Dolphin  ======================================================================
               Weddell seal  ======================================================================
                    Megabat  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                    Gorilla  ======================================================================

                      Human  acctcagt
                      Chimp  acctcagt
                  Orangutan  acctcagt
                     Gibbon  acctcaat
                     Rhesus  acctaagt
        Crab-eating macaque  acctaagt
                     Baboon  acctaagt
               Green monkey  acctaagt
            Star-nosed mole  ========
                   Hedgehog  ========
                      Shrew  ========
                  Armadillo  ========
                   Microbat  ========
                     Tenrec  ========
             Golden hamster  ========
               Prairie vole  ========
                   Squirrel  ========
                        Rat  ========
                      Mouse  ========
                 Chinchilla  ========
           Brush-tailed rat  ========
                 Guinea pig  ========
             Naked mole-rat  ========
     Lesser Egyptian jerboa  ========
            Chinese hamster  ========
        Cape elephant shrew  ========
                      Sheep  ========
           Cape golden mole  ========
           Tibetan antelope  ========
       David's myotis (bat)  ========
         Chinese tree shrew  ========
                   Elephant  ========
              Big brown bat  ========
                        Cow  ========
                   Bushbaby  ========
             Pacific walrus  ========
                      Panda  ========
              Domestic goat  ========
               Killer whale  ========
             Bactrian camel  ========
                     Alpaca  ========
                     Rabbit  ========
                        Pig  ========
                       Pika  ========
                        Dog  ========
                        Cat  ========
                    Ferret   ========
                    Dolphin  ========
               Weddell seal  ========
                    Megabat  ========
                   Aardvark  ========
                    Manatee  ========
           Black flying-fox  ========
           White rhinoceros  ========
                      Horse  ========
            Squirrel monkey  ========
                   Marmoset  ========
                    Gorilla  ========

Alignment block 8 of 429 in window, 71511226 - 71511315, 90 bps 
B D                   Human  tggaaaagcagaaatc---------acctatcttctgcatcgctcatgctgggagctgtagactggagct
B D                   Chimp  tggaaaagcagaaatc---------acctatcttctgcatcgctcatgctgggagctgtagactggagct
B D               Orangutan  tggaaatgcagaaatc---------acccatcttctgcgtcgctcacgctgggagctgtagactggagct
B D                  Gibbon  tggaaatgcagaaatc---------acccatcttctgtgtcgctcacactggaagctatagattggggct
B D                  Rhesus  tggaaatgcagaaatc---------acctatcttctgcattgctcaagctgggagctgtagactggaact
B D     Crab-eating macaque  tggaaatgcagaaatc---------acctatcttctgcattgctcaagctgggagctgtagactggaact
B D                  Baboon  tggaaatgcagatatc---------acctatcttctgcattgctcaagctgggagctgtagactggaact
B D            Green monkey  tggaaatgcagaaatc---------acctatcttctgcattgctcaagctgggagctgtagactggaact
B D                Hedgehog  tggagaaggaaaaggcaattcaaggacttgttgtttgcttcgctttcat--ggggctgcttccaggagct
           Star-nosed mole  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Sheep  ======================================================================
          Cape golden mole  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
B D                Bushbaby  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
              Killer whale  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Pig  ======================================================================
B D                    Pika  ======================================================================
B D                     Dog  ======================================================================
B D                     Cat  ======================================================================
B D                 Ferret   ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                 Megabat  ======================================================================
                  Aardvark  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                 Gorilla  ======================================================================

                      Human  gttcctattcagccatcttggaacctctc
                      Chimp  gttcctattcagccatcttggaacctctc
                  Orangutan  gttcctattcagccatcttggaacctctc
                     Gibbon  gttcctattcggccatcttggaacctctc
                     Rhesus  gttcctattcggccatcttggaacctctc
        Crab-eating macaque  gttcctattcggccatcttggaacctctc
                     Baboon  gttcctcttcggccatcttggaacctctc
               Green monkey  gttcctattcggccatctcggaacctctc
                   Hedgehog  a-----aatcagccatcaaaaagaggc--
            Star-nosed mole  =============================
                      Shrew  =============================
                  Armadillo  =============================
                   Microbat  =============================
                     Tenrec  =============================
             Golden hamster  =============================
               Prairie vole  =============================
                   Squirrel  =============================
                        Rat  =============================
                      Mouse  =============================
                 Chinchilla  =============================
           Brush-tailed rat  =============================
                 Guinea pig  =============================
             Naked mole-rat  =============================
     Lesser Egyptian jerboa  =============================
            Chinese hamster  =============================
        Cape elephant shrew  =============================
                      Sheep  =============================
           Cape golden mole  =============================
           Tibetan antelope  =============================
       David's myotis (bat)  =============================
         Chinese tree shrew  =============================
                   Elephant  =============================
              Big brown bat  =============================
                        Cow  =============================
                   Bushbaby  =============================
             Pacific walrus  =============================
                      Panda  =============================
              Domestic goat  =============================
               Killer whale  =============================
             Bactrian camel  =============================
                     Alpaca  =============================
                     Rabbit  =============================
                        Pig  =============================
                       Pika  =============================
                        Dog  =============================
                        Cat  =============================
                    Ferret   =============================
                    Dolphin  =============================
               Weddell seal  =============================
                    Megabat  =============================
                   Aardvark  =============================
                    Manatee  =============================
           Black flying-fox  =============================
           White rhinoceros  =============================
                      Horse  =============================
            Squirrel monkey  =============================
                   Marmoset  =============================
                    Gorilla  =============================

Alignment block 9 of 429 in window, 71511316 - 71511316, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
           Tibetan antelope  t
B D                   Sheep  t
              Domestic goat  t
           Star-nosed mole  =
B D                Hedgehog  -
B D                   Shrew  =
B D               Armadillo  =
B D                Microbat  =
B D                  Tenrec  =
            Golden hamster  =
              Prairie vole  =
B D                Squirrel  =
B D                     Rat  =
B D                   Mouse  =
                Chinchilla  =
          Brush-tailed rat  =
B D              Guinea pig  =
B D          Naked mole-rat  =
    Lesser Egyptian jerboa  =
B D         Chinese hamster  =
       Cape elephant shrew  =
          Cape golden mole  =
      David's myotis (bat)  =
        Chinese tree shrew  =
B D                Elephant  =
             Big brown bat  =
B D                     Cow  =
B D                Bushbaby  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
            Bactrian camel  =
B D                  Alpaca  =
B D                  Rabbit  =
B D                     Pig  =
B D                    Pika  =
B D                     Dog  =
B D                     Cat  =
B D                 Ferret   =
B D                 Dolphin  =
              Weddell seal  =
B D                 Megabat  =
                  Aardvark  =
B D                 Manatee  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B D         Squirrel monkey  =
B D                Marmoset  =
B D                 Gorilla  =

Alignment block 10 of 429 in window, 71511317 - 71511318, 2 bps 
B D                   Human  ca
B D                   Chimp  ca
B D               Orangutan  ca
B D                  Gibbon  ca
B D                  Rhesus  ca
B D     Crab-eating macaque  ca
B D                  Baboon  ca
B D            Green monkey  ca
B D          Naked mole-rat  ca
B D                  Alpaca  ca
             Bactrian camel  ca
           Tibetan antelope  ca
B D                     Cow  ca
B D                   Sheep  ca
              Domestic goat  ca
B D                   Horse  ca
B D        White rhinoceros  ca
B D                Hedgehog  -a
           Star-nosed mole  ==
B D                   Shrew  ==
B D               Armadillo  ==
B D                Microbat  ==
B D                  Tenrec  ==
            Golden hamster  ==
              Prairie vole  ==
B D                Squirrel  ==
B D                     Rat  ==
B D                   Mouse  ==
                Chinchilla  ==
          Brush-tailed rat  ==
B D              Guinea pig  ==
    Lesser Egyptian jerboa  ==
B D         Chinese hamster  ==
       Cape elephant shrew  ==
          Cape golden mole  ==
      David's myotis (bat)  ==
        Chinese tree shrew  ==
B D                Elephant  ==
             Big brown bat  ==
B D                Bushbaby  ==
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
B D                  Rabbit  ==
B D                     Pig  ==
B D                    Pika  ==
B D                     Dog  ==
B D                     Cat  ==
B D                 Ferret   ==
B D                 Dolphin  ==
              Weddell seal  ==
B D                 Megabat  ==
                  Aardvark  ==
B D                 Manatee  ==
          Black flying-fox  ==
B D         Squirrel monkey  ==
B D                Marmoset  ==
B D                 Gorilla  ==

Alignment block 11 of 429 in window, 71511319 - 71511319, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D         Squirrel monkey  g
B D          Naked mole-rat  g
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
B D                Hedgehog  g
           Star-nosed mole  =
B D                   Shrew  =
B D               Armadillo  =
B D                Microbat  =
B D                  Tenrec  =
            Golden hamster  =
              Prairie vole  =
B D                Squirrel  =
B D                     Rat  =
B D                   Mouse  =
                Chinchilla  =
          Brush-tailed rat  =
B D              Guinea pig  =
    Lesser Egyptian jerboa  =
B D         Chinese hamster  =
       Cape elephant shrew  =
          Cape golden mole  =
      David's myotis (bat)  =
        Chinese tree shrew  =
B D                Elephant  =
             Big brown bat  =
B D                Bushbaby  =
B D                   Panda  =
              Killer whale  =
B D                  Rabbit  =
B D                     Pig  =
B D                    Pika  =
B D                 Dolphin  =
                  Aardvark  =
B D                 Manatee  =
B D                Marmoset  =
B D                 Gorilla  =

Alignment block 12 of 429 in window, 71511320 - 71511320, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D          Naked mole-rat  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  a
B D                 Megabat  a
B D                Hedgehog  a
           Star-nosed mole  =
B D                   Shrew  =
B D               Armadillo  =
B D                Microbat  =
B D                  Tenrec  =
            Golden hamster  =
              Prairie vole  =
B D                Squirrel  =
B D                     Rat  =
B D                   Mouse  =
                Chinchilla  =
          Brush-tailed rat  =
B D              Guinea pig  =
    Lesser Egyptian jerboa  =
B D         Chinese hamster  =
       Cape elephant shrew  =
          Cape golden mole  =
      David's myotis (bat)  =
        Chinese tree shrew  =
B D                Elephant  =
             Big brown bat  =
B D                Bushbaby  =
B D                   Panda  =
              Killer whale  =
B D                  Rabbit  =
B D                     Pig  =
B D                    Pika  =
B D                 Dolphin  =
                  Aardvark  =
B D                 Manatee  =
B D                 Gorilla  =

Alignment block 13 of 429 in window, 71511321 - 71511324, 4 bps 
B D                   Human  agag
B D                   Chimp  agag
B D               Orangutan  agag
B D                  Gibbon  agag
B D                  Rhesus  agag
B D     Crab-eating macaque  agag
B D                  Baboon  agag
B D            Green monkey  agag
B D                Marmoset  agag
B D         Squirrel monkey  agag
B D                Bushbaby  agag
B D          Naked mole-rat  agag
B D                  Alpaca  agag
             Bactrian camel  agag
           Tibetan antelope  agag
B D                     Cow  agag
B D                   Sheep  agag
              Domestic goat  agag
B D                   Horse  ggag
B D        White rhinoceros  ggag
B D                     Cat  agag
B D                     Dog  agag
B D                 Ferret   agaa
             Pacific walrus  agag
               Weddell seal  agag
           Black flying-fox  agag
B D                 Megabat  agag
B D                Hedgehog  gaag
           Star-nosed mole  ====
B D                   Shrew  ====
B D               Armadillo  ====
B D                Microbat  ====
B D                  Tenrec  ====
            Golden hamster  ====
              Prairie vole  ====
B D                Squirrel  ====
B D                     Rat  ====
B D                   Mouse  ====
                Chinchilla  ====
          Brush-tailed rat  ====
B D              Guinea pig  ====
    Lesser Egyptian jerboa  ====
B D         Chinese hamster  ====
       Cape elephant shrew  ====
          Cape golden mole  ====
      David's myotis (bat)  ====
        Chinese tree shrew  ====
B D                Elephant  ====
             Big brown bat  ====
B D                   Panda  ====
              Killer whale  ====
B D                  Rabbit  ====
B D                     Pig  ====
B D                    Pika  ====
B D                 Dolphin  ====
                  Aardvark  ====
B D                 Manatee  ====
B D                 Gorilla  ====

Alignment block 14 of 429 in window, 71511325 - 71511366, 42 bps 
B D                   Human  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D                   Chimp  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D                 Gorilla  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D               Orangutan  atgaaataacttctattcc----ac-tattcctactccacaatattc
B D                  Gibbon  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D                  Rhesus  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D     Crab-eating macaque  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D                  Baboon  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D            Green monkey  gtgaaataacttctattcc----ac-tattcctactccacaatattc
B D                Marmoset  gtaaagtaacttctattcc----ac-tattcctactctacaatattt
B D         Squirrel monkey  gtaaaataacttcgattcc----gc-tattcctactccacaatattt
B D                Bushbaby  gtaaga-gacttctagtcc----ac-ca-tcctactctgcaagatcc
B D          Naked mole-rat  ggaaagccacttctatttc----ac-ta-tccaactccacaacaccc
B D                  Alpaca  atgaagtcattcctacccc----ac-ta-tcacactccataatatct
             Bactrian camel  atgaagtcattcctacccc----ac-ta-tcacgctccataatatct
           Tibetan antelope  atgaagccattcctaccct----at-ta-tcacactccacaatatct
B D                     Cow  atgaagtcattcctactct----at-ta-tcacactccataatatct
B D                   Sheep  atgaagccattcctatcct----at-ta-tcacactccataatatct
              Domestic goat  atgaagccattcctaccct----at-ta-tcacactccataatatct
B D                   Horse  gcaaagtcatttccacccc----actta-tcgctctccacagcattc
B D        White rhinoceros  gcgaagtcatttctacccc----ac-tg-tccctctccacaatatct
B D                     Cat  gtgaagtcatttccactcc----at-ta-tcccactacacaatattt
B D                     Dog  gtgaaatgatttccacccccatgcc-ca-tgccactacacaatatct
B D                 Ferret   gtgaagtcacctgaacccc----gc-gg-catcggtacacagtatct
             Pacific walrus  gtgaagtcatctgcaaccc----ac-ta-tgccagtacacaatatct
               Weddell seal  gtgaagtcatctgcaaccc----ac-ta-tgccagtacacaatatct
           Black flying-fox  ataacgtcatttctacccc----ac-ta-tctcatgctacaatctct
B D                 Megabat  ataacgtcatttctacccc----ac-ta-tctcatgctacaatctct
B D                Hedgehog  atgaaatcatttctacccc----at-ta-c--cacttcataatgtct
           Star-nosed mole  ===============================================
B D                   Shrew  ===============================================
B D               Armadillo  ===============================================
B D                Microbat  ===============================================
B D                  Tenrec  ===============================================
            Golden hamster  ===============================================
              Prairie vole  ===============================================
B D                Squirrel  ===============================================
B D                     Rat  ===============================================
B D                   Mouse  ===============================================
                Chinchilla  ===============================================
          Brush-tailed rat  ===============================================
B D              Guinea pig  ===============================================
    Lesser Egyptian jerboa  ===============================================
B D         Chinese hamster  ===============================================
       Cape elephant shrew  ===============================================
          Cape golden mole  ===============================================
      David's myotis (bat)  ===============================================
        Chinese tree shrew  ===============================================
B D                Elephant  ===============================================
             Big brown bat  ===============================================
B D                   Panda  ===============================================
              Killer whale  ===============================================
B D                  Rabbit  ===============================================
B D                     Pig  ===============================================
B D                    Pika  ===============================================
B D                 Dolphin  ===============================================
                  Aardvark  ===============================================
B D                 Manatee  ===============================================

Inserts between block 14 and 15 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
B D               Hedgehog 1bp

Alignment block 15 of 429 in window, 71511367 - 71511371, 5 bps 
B D                   Human  aattc
B D                   Chimp  aattc
B D                 Gorilla  aattc
B D               Orangutan  aattc
B D                  Gibbon  aattc
B D                  Rhesus  aattc
B D     Crab-eating macaque  aattc
B D                  Baboon  aattc
B D            Green monkey  aattc
B D                Marmoset  aattc
B D         Squirrel monkey  aattc
B D                Bushbaby  aattc
B D          Naked mole-rat  aattc
B D                     Pig  aattc
B D                  Alpaca  aaatc
             Bactrian camel  aattc
           Tibetan antelope  aattc
B D                     Cow  aattc
B D                   Sheep  aattc
              Domestic goat  aattc
B D                   Horse  aattc
B D        White rhinoceros  aattc
B D                     Cat  aattc
B D                     Dog  cattc
B D                 Ferret   aattc
             Pacific walrus  aattc
               Weddell seal  aattc
           Black flying-fox  gattc
B D                 Megabat  gattc
B D                Hedgehog  atttc
           Star-nosed mole  =====
B D                   Shrew  =====
B D               Armadillo  =====
B D                Microbat  =====
B D                  Tenrec  =====
            Golden hamster  =====
              Prairie vole  =====
B D                Squirrel  =====
B D                     Rat  =====
B D                   Mouse  =====
                Chinchilla  =====
          Brush-tailed rat  =====
B D              Guinea pig  =====
    Lesser Egyptian jerboa  =====
B D         Chinese hamster  =====
       Cape elephant shrew  =====
          Cape golden mole  =====
      David's myotis (bat)  =====
        Chinese tree shrew  =====
B D                Elephant  =====
             Big brown bat  =====
B D                   Panda  =====
              Killer whale  =====
B D                  Rabbit  =====
B D                    Pika  =====
B D                 Dolphin  =====
                  Aardvark  =====
B D                 Manatee  =====

Alignment block 16 of 429 in window, 71511372 - 71511473, 102 bps 
B D                   Human  agaatatccatttgcaggccaattcctcccaa--t---ag-----------gaaa-----------a--t
B D                   Chimp  agaatatccatttgcaggccaattcctcccaa--t---ag-----------gaaa-----------a--t
B D                 Gorilla  agaatatccatttgcaggccaattcctcccaa--t---ag-----------gaaa-----------a--t
B D               Orangutan  agaatatccatttgcaggccaattcctcccaa--c---ag-----------gaaa-----------a--t
B D                  Gibbon  agaatatccatttgcaggccaattcctcccag--t---ag-----------gaaa-----------a--t
B D                  Rhesus  agaatatccacttgcaggccaattcctcccaa--c---ag-----------gaaa-----------a--t
B D     Crab-eating macaque  agaatatccacttgcaggccaattcctcccaa--t---ag-----------gaaa-----------a--t
B D                  Baboon  agaatatccacttgcaggccaattcctcccaa--t---ag-----------gaaa-----------a--t
B D            Green monkey  agaatatccacttgcaggccaattcctcccaa--t---ag-----------gaaa-----------a--t
B D                Marmoset  ataatatccatttgcaggccaattcttcccaa--t---ag-----------gaaa-----------a--c
B D         Squirrel monkey  ataatatccatttgcaggccaattcctcccaa--t---ag-----------gaat-----------a--t
B D                Bushbaby  aggatagtcctttgcgggccaatttcttctac--t---ag-----------gcaa-----------a--t
B D          Naked mole-rat  agattattagttttcaggccaattcctctaaa--t---ag-----------gaaa-----------a--t
B D                  Rabbit  agaatagctcttggca-gccaatt-ctcacaa--t---ag-----------gaaa----------ca--t
B D                     Pig  agaatatcccaatgcagattaattcctcttga--t---ag-----------aaaa-----------atgt
B D                  Alpaca  agaacatcccaatgcaggccaattcctcacca--t----a-----------aaaa-----------atac
             Bactrian camel  agaacatcccaatgcaggccaattcctcacca--t----a-----------aaaa-----------atac
           Tibetan antelope  agaatattccaacgcaggctaattccttccaa--taaaaa-----------aaaa-----------aaac
B D                     Cow  agaatattccaatgcaggctaattctttccaa--t---aa-----------aaaa-----------a---
B D                   Sheep  agaatattccaacgcaggctaattccttccaa--t--aaa-----------aaaa-----------aacc
              Domestic goat  agaatattccaatgcaggccaattccttccaa--t---aa-----------aaaa-----------aacc
B D                   Horse  agaatatcccaatgcaggccaatacttcctaa--t---aa-----------gaaa-----------a--c
B D        White rhinoceros  ggaatatcctaatgcaggcccatgcttcccaa--t---aa-----------aaaa-----------a--t
B D                     Cat  aaaatatcccaatggaggccaattcctcccaa--t---aa-----------aaaa-----------a--t
B D                     Dog  agactgtcaaaatgcaggccaattcttcctaa--t---a------------aaaa-----------a--t
B D                 Ferret   agactatcataacacagtccaattcctcccaa--t---aa-----------aaaa-----------a--t
             Pacific walrus  agactgtcataattcaggccaattccttccca--c---cccccccccggcaaaaa-----------a--t
               Weddell seal  agactgtcataattcaggccaattccttcccc--c---cacccccc-----aaaa-----------a--t
           Black flying-fox  agaatataccaatgcaggccaattcctcccaa--t---ta-----------aaaa----aaaaaaaa--t
B D                 Megabat  agaatataccaatgcaggccaattcctcccaa--t---aa-----------aaaaatttaaaaaaaa--t
B D                Hedgehog  agaataacgcaatacaggacaactactcacaaatt---aa-----------aaaa-----------a--a
           Star-nosed mole  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                Squirrel  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
          Cape golden mole  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                    Pika  ======================================================================
B D                 Dolphin  ======================================================================
                  Aardvark  ======================================================================
B D                 Manatee  ======================================================================

                      Human  gttcaagacaacggaaggtaaacggtaggcaa----g----ttttctcc----------------cc---
                      Chimp  gttcaagacaacggaaggtaaacggtaggcaa----g----ttttttcc----------------cc---
                    Gorilla  gttcaggacaacggaaggtaaacggtaggcaa----g----ttttttcc----------------cc---
                  Orangutan  gttcaagacaatggaaggtaaacggt-ggcaa----g----ttttctcc----------------cc---
                     Gibbon  gttcaagacaacagaatgtaaacggtaggcaa----g----ttttt--c----------------cc---
                     Rhesus  gtacaagacaatggaaggtaaatggtaggcaa----g----ttttc--c----------------cc---
        Crab-eating macaque  gtacaagacaatggaaggtaaatggtaggcaa----g----ttttc--c----------------cc---
                     Baboon  gtacaagacaatggaaggtaaatggtaggcaa----g----ttttc--c----------------cc---
               Green monkey  gtacaagacaatggaaggtaaatggtaggcaa----g----ttttc--c----------------cc---
                   Marmoset  gtacaagaaaatggaagataaatggtaggcag----t----ttttc--c----------------ct---
            Squirrel monkey  gtacaagaaaacggaagataaatggtaggcaa----t----ttttc--c----------------ct---
                   Bushbaby  gtgcaagacaatagtagaaaa------gacaa----a----acttc--c----------------tc---
             Naked mole-rat  gtgcaagacaatggaagacaactggcaggcaaaggtg----ttttt--t----------------ttttt
                     Rabbit  gt----gacaatggaagacaaatggtaggcaa----g----ttttc--t---------------------
                        Pig  a---aagacaacagaagccaaatggtgggcag----t----ttgtt--t----------------tt---
                     Alpaca  atacaagacaatgaaagacaaatggtgggcag----t----ttgtt--t----------------tt---
             Bactrian camel  atacaagacaatgaaagacaaatggtgggcag----t----ttgtt--t----------------tt---
           Tibetan antelope  atataagacaatggaagatatatcatgggcag----c----ttgtt--t----------------tt---
                        Cow  atacaagacaatggaagacatattgtgggcag----t----ttgtt--t----------------tt---
                      Sheep  atataagacaatggaagacgtatcgtgggcag----c----ttgtt--t----------------tt---
              Domestic goat  atataagacaatggaagacacatcgtgggcag----c----ttgtt--t----------------tt---
                      Horse  gtacaagacaatggaagacaaatggtaggcag----g----ttttt--t-----------------t---
           White rhinoceros  gtacaagacaatggaagacaaatggtaggcag----t----ttttt--c-----------------c---
                        Cat  atacaa-acaatggaagacaaaaagtaggcag----t----ttttc--t----------------tc---
                        Dog  gtataagacaatggaagacaaaaagtaggtgg----ggtttgtttt--t---------------------
                    Ferret   gtacaagacaatggaagacaaaagggaggcag----g----acttt--t-----------------c---
             Pacific walrus  gtacaagacaatgtaagacaaaaggtaggtgg----g----gtttt--t---------------------
               Weddell seal  gtacaagacaatgtaagacaaaaggtaggtgg----g----gtttt--t---------------------
           Black flying-fox  gtacaagacaatggaagacaaatgataggcag----t----ccctc--c---------------------
                    Megabat  gtacaagacaacggaagacaaatgataggcag----t----ccctc--c---------------------
                   Hedgehog  aaaaaagacaatggaagacaaatggcaggcag----g----atggt--tattatcagtcccccctcc---
            Star-nosed mole  ======================================================================
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                   Squirrel  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
           Cape golden mole  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                       Pika  ======================================================================
                    Dolphin  ======================================================================
                   Aardvark  ======================================================================
                    Manatee  ======================================================================

                      Human  --ctttcccctt-------------------tg----atta---tt
                      Chimp  --ccttcccctt-------------------tg----atta---tt
                    Gorilla  --ccttcccctt-------------------ta----atta---tt
                  Orangutan  --ccttcccctt-------------------tg----atta---ct
                     Gibbon  --ccttcccctt-------------------cg----atta---tt
                     Rhesus  --ccttcccctt-------------------tg----atta---tt
        Crab-eating macaque  --ccttcccctt-------------------tg----atta---tt
                     Baboon  --ccttcccctt-------------------tg----atta---tt
               Green monkey  --tcttcctctt-------------------tg----atta---tt
                   Marmoset  --gcttcccctt-------------------tg----atta---tt
            Squirrel monkey  --gcttcccctt-------------------tg----atta---tt
                   Bushbaby  --ctcctttctt-------------------ta----atta---tt
             Naked mole-rat  aaccctcctctt-------------------tgaataatta---tt
                     Rabbit  --cctctccctt-------------------tgattaatta---tt
                        Pig  ------cctttt-------------------tg----acta---at
                     Alpaca  ------cctctt-------------------tg----att----at
             Bactrian camel  ------cctctt-------------------tg----att----ac
           Tibetan antelope  ------gctctt-------------------gg----acta---at
                        Cow  ------gctctt-------------------gg----acta---at
                      Sheep  ------gctctt-------------------gg----acta---at
              Domestic goat  ------gctctt-------------------gg----acta---at
                      Horse  ------cccctt-------------------tg----atta---at
           White rhinoceros  ------cccctt-------------------tg----atta---at
                        Cat  ------cccctt-------------------tg----atta---at
                        Dog  -------ccctt-------------------ca----atta---at
                    Ferret   ------cccctt-------------------tg----attaattat
             Pacific walrus  -------tcttt-------------------tg----atta---at
               Weddell seal  -------tcttt-------------------tg----atta---at
           Black flying-fox  -------cccttccaacccactctcccagccca----atta---at
                    Megabat  -------cccttccaacccactctcccagccca----atta---at
                   Hedgehog  ------ccccac-------------------ca----atta---at
            Star-nosed mole  ==============================================
                      Shrew  ==============================================
                  Armadillo  ==============================================
                   Microbat  ==============================================
                     Tenrec  ==============================================
             Golden hamster  ==============================================
               Prairie vole  ==============================================
                   Squirrel  ==============================================
                        Rat  ==============================================
                      Mouse  ==============================================
                 Chinchilla  ==============================================
           Brush-tailed rat  ==============================================
                 Guinea pig  ==============================================
     Lesser Egyptian jerboa  ==============================================
            Chinese hamster  ==============================================
        Cape elephant shrew  ==============================================
           Cape golden mole  ==============================================
       David's myotis (bat)  ==============================================
         Chinese tree shrew  ==============================================
                   Elephant  ==============================================
              Big brown bat  ==============================================
                      Panda  ==============================================
               Killer whale  ==============================================
                       Pika  ==============================================
                    Dolphin  ==============================================
                   Aardvark  ==============================================
                    Manatee  ==============================================

Inserts between block 16 and 17 in window
B D                    Pig 4bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp
B D                  Horse 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 4bp
B D                Ferret  4bp
            Pacific walrus 4bp
              Weddell seal 4bp
          Black flying-fox 4bp
B D                Megabat 4bp
B D               Hedgehog 4bp

Alignment block 17 of 429 in window, 71511474 - 71511498, 25 bps 
B D                   Human  aaaagagccttt-tcagaagtccat-a
B D                   Chimp  aaaagagccttt-tcagaagtccat-a
B D                 Gorilla  aaaagagccttt-tcagaagtccat-a
B D               Orangutan  aaaggagcgtct-tcagaagtccat-a
B D                  Gibbon  aaaggagccttt-tcagaagtctat-a
B D                  Rhesus  aaaggagccttt-tcagaagtccat-a
B D     Crab-eating macaque  aaaggagccttt-tcagaagtccat-a
B D                  Baboon  aaaggagccttt-tcagaagtccat-a
B D            Green monkey  aaaggagccttt-tcagaagtccat-a
B D                Marmoset  aaaagagccttt-tcagaagtccat-a
B D         Squirrel monkey  aaaagagccttt-tcagaagtccat-a
B D                Bushbaby  aaaggagcctgt-tcagaaatccat-a
B D          Naked mole-rat  gaaggaaccttt-tcaggaatccat-a
B D                  Rabbit  aaaag--ttttt-tcagaaatccat-a
B D                     Pig  aaaggagccttt-tcagaagtccat-a
B D                  Alpaca  aaaggagccttt-tcagaaatccaa-g
             Bactrian camel  aaaggagccttt-tcagaaatccaa-g
           Tibetan antelope  caaggagccttt-tcagaaatccgc-g
B D                     Cow  caaggaaccttt-tcagaaatccgt-g
B D                   Sheep  caagaagccttt-tcagaaatccgt-g
              Domestic goat  caaggagccttt-tcagaaatccgt-g
B D                   Horse  aaaggaagcttt-ttagaaatccat-a
B D        White rhinoceros  aaaggaaccttt-tcagaaatccat-a
B D                     Cat  aaaggagccttt-tcagaaatctat-a
B D                     Dog  tagggagtcttt-tcagaaatctat-a
B D                 Ferret   aaaggatccttt-tcagaaacctat-a
             Pacific walrus  aaaggagccttt-tcagaaatctgt-a
               Weddell seal  aaaggagccttt-tcagaaatctgt-a
           Black flying-fox  aaagaagcc-tt-tcagaaattcgt-a
B D                 Megabat  aaagaagcc-tt-tcagaaattcgt-a
B D                Hedgehog  aaagaagcctttaacagaaatccac-a
            Star-nosed mole  aaaagtgtcttt-tcagaaattcacta
B D                   Shrew  ===========================
B D               Armadillo  ===========================
B D                Microbat  ===========================
B D                  Tenrec  ===========================
            Golden hamster  ===========================
              Prairie vole  ===========================
B D                Squirrel  ===========================
B D                     Rat  ===========================
B D                   Mouse  ===========================
                Chinchilla  ===========================
          Brush-tailed rat  ===========================
B D              Guinea pig  ===========================
    Lesser Egyptian jerboa  ===========================
B D         Chinese hamster  ===========================
       Cape elephant shrew  ===========================
          Cape golden mole  ===========================
      David's myotis (bat)  ===========================
        Chinese tree shrew  ===========================
B D                Elephant  ===========================
             Big brown bat  ===========================
B D                   Panda  ===========================
              Killer whale  ===========================
B D                    Pika  ===========================
B D                 Dolphin  ===========================
                  Aardvark  ===========================
B D                 Manatee  ===========================

Alignment block 18 of 429 in window, 71511499 - 71511547, 49 bps 
B D                   Human  tttgaa-agtgtccctttgtttggtgccc-------cagaggtttt-gcctccca-ggg
B D                   Chimp  tttgaa-agtgttcctttgtttggtgccc-------cagaggtttt-gcctccca-ggg
B D                 Gorilla  tttgaa-agtgtccctttgtttggtgccc-------cagaggtttt-gcctccca-ggg
B D               Orangutan  tttgaa-agtgtccctttgtttggtgccc-------cagaggtttt-gcctccca-ggg
B D                  Gibbon  tttgaa-agtgtccc----tttggtgccc-------cagaggtttt-gcctccca-gga
B D                  Rhesus  tttgaa-agtgtccctttgtttggtgccc-------cagagttgtt-gcctccca-ggg
B D     Crab-eating macaque  tttgaa-agtgtccctttgtttggtgccc-------cagagttgtt-gcctccca-ggg
B D                  Baboon  tttgaa-agtgtccctttgtttggtgccc-------cagagttgtt-gcctccca-ggg
B D            Green monkey  tttgaa-agtgtccctttgtttggtgccc-------tagagttgtt-gcctccca-ggg
B D                Marmoset  actcag-agtgtctctttgtttgatg-cc-------cagaggtttt-gcctccca-ggg
B D         Squirrel monkey  actcaacagtgtctc----tttgatgccc-------cagaggtttt-gcctccca-ggg
B D                Bushbaby  cttcaa-agtgtccctttgtttggtgccc-------cagaagtttg-gattccct-aga
B D          Naked mole-rat  tttcat-agtgtccttt--tttggtgccc-------cagaagttgt-aacttgct-gag
B D                  Rabbit  ttccaa-agtgtccctttgtttggtatcc-------aagaggtttt-aggtccct-gga
B D                     Pig  tttcaa-aatgtccctctgtttgatgccc-------caaaggtttt------ctt-gga
B D                  Alpaca  tttcaa-agtgtccctttgcttga-gccc-------cagaggtttt------ccc-agg
             Bactrian camel  tttcaa-agtgtccctttgcttga-gccc-------cagaggtttt------ccc-agg
           Tibetan antelope  ttttca-agtgtcccattgtgtggtgcct-------cagaggtttt------cctgggg
B D                     Cow  ttttca-agtgtcccattgtgtggtgcct-------cagaggtttt------cctgggg
B D                   Sheep  ttttca-agtgttccattgtgtggtgcct-------cagaggtttt------cctgggg
              Domestic goat  ttttca-agtgttccattgtgtggtgcct-------cagaggtttt------cctgggg
B D                   Horse  tttcaa-agtatccctttgtttggtgacc-------tagaggtttt-gactcccc-cag
B D        White rhinoceros  tttcaa-agcgtccctttgtttggtgacc-------tagaggtttt-gactccct-ggg
B D                     Cat  tttcaa-agtgtccctttgtttggtgccc-------cagaggtttt-tactccca-ggg
B D                     Dog  ttttaa-cctatctc----ttcggtgccc-------cagaggtttt-gactctgt-agg
B D                 Ferret   tttcaa-agtgtctctttgtttggtgccc-------cagaggttttgactccccc-agg
             Pacific walrus  tttcaa-agtgtctctttgtttggtgccc-------cagaggtttttgactcccg-agg
               Weddell seal  tttcaa-agtgtctctttgtttggtgccc-------cagaggtttttgactccct-agg
           Black flying-fox  tttcaa-agtgtccctttgtttggtgccc-------caaaagtttt------cct-gga
B D                 Megabat  tttcaa-agtgtccctttgtttggtgctc-------cgaaagtttt------cct-gga
B D                Hedgehog  caacaa-agagagcctttgtttggcactcc------cagagattct-gactacca-agg
            Star-nosed mole  tatcaa-agtgtacctttgtttggagccccagagaacagagaacat-ggctgtct-ggg
                   Aardvark  tttcag-agtgtccctttgtttggt-tgc-------aagagtattt-gacagcct-ggg
B D                   Shrew  ===========================================================
B D               Armadillo  ===========================================================
B D                Microbat  ===========================================================
B D                  Tenrec  ===========================================================
            Golden hamster  ===========================================================
              Prairie vole  ===========================================================
B D                Squirrel  ===========================================================
B D                     Rat  ===========================================================
B D                   Mouse  ===========================================================
                Chinchilla  ===========================================================
          Brush-tailed rat  ===========================================================
B D              Guinea pig  ===========================================================
    Lesser Egyptian jerboa  ===========================================================
B D         Chinese hamster  ===========================================================
       Cape elephant shrew  ===========================================================
          Cape golden mole  ===========================================================
      David's myotis (bat)  ===========================================================
        Chinese tree shrew  ===========================================================
B D                Elephant  ===========================================================
             Big brown bat  ===========================================================
B D                   Panda  ===========================================================
              Killer whale  ===========================================================
B D                    Pika  ===========================================================
B D                 Dolphin  ===========================================================
B D                 Manatee  ===========================================================

Alignment block 19 of 429 in window, 71511548 - 71511663, 116 bps 
B D                   Human  gcaattcagg-gcagattaagggtatgcactccttt----------------------------------
B D                   Chimp  gcaattcagg-gcagattaagggtatgcattccttt----------------------------------
B D                 Gorilla  gcaattcagg-gcagattaaaggtatgcagtccttt----------------------------------
B D               Orangutan  gcaattcagg-gcagggtaagggtatgcactccttt----------------------------------
B D                  Gibbon  gcaattcagg-gcagggtaagggtaagcagtccttt----------------------------------
B D                  Rhesus  gcaattcagg-gcagggtaagggtatgcactccttt----------------------------------
B D     Crab-eating macaque  gcaattcagg-gcagggtaagggtatgcactccttt----------------------------------
B D                  Baboon  gcaattcagg-gcagggtaagggtatgcactccttt----------------------------------
B D            Green monkey  gcaattcagg-gcaggttaagggtatgcactccttt----------------------------------
B D                Marmoset  gcaattcagg-gcaggataagggtatactctccttt----------------------------------
B D         Squirrel monkey  gcaattcagg-gcagggtaagggtatagacttcttt----------------------------------
B D                Bushbaby  gcaatttggg-gcaggttaagtctgagtacttcttc----------------------------------
B D                Squirrel  gcaattcaga-gcaggttacgagtatatattctttt----------------------------------
B D          Naked mole-rat  acaatttgga-gcaggttaagagcattcagtc-ttt----------------------------------
B D                  Rabbit  gcaactgaga-gcaggttaagagtgtgcacacctct----------------------------------
B D                     Pig  gaggttcagg-gcagagcaaaagtgagcatcccctttgtggttcagtgggttaatgaacccgactagtac
B D                  Alpaca  gcagttcagg-gcagggtaagggtgtgcattgcttt----------------------------------
             Bactrian camel  gcagttcagg-gcagggtaagggtgtgcattgcttt----------------------------------
           Tibetan antelope  gcagtccagg-gcagagtaagaatat--------------------------------------------
B D                     Cow  gcagtccagg-gcagagaaagagtat--------------------------------------------
B D                   Sheep  gcagtccagg-gcagagtaagactat--------------------------------------------
              Domestic goat  gcagtccagg-gcaaagtaagaatat--------------------------------------------
B D                   Horse  gtagttcc-g-gcagattaagagcctgcattccttt----------------------------------
B D        White rhinoceros  gcagttcc-g-gcagattaagagcgtgcattccttt----------------------------------
B D                     Cat  gcagttcagg-gcaggttaagagtatgcattccttt----------------------------------
B D                     Dog  gcaggtcagg-gcagcttaagagtatgtgttctttt----------------------------------
B D                 Ferret   gcagttcaag-gcaggttaggagcacgcattctttt----------------------------------
             Pacific walrus  gcagttcagg-gcaggttaagagtatgcattcttta----------------------------------
               Weddell seal  gcagttcagg-gcaggttaagagtatgcattcttta----------------------------------
           Black flying-fox  gcagtttggg-gcaggttaagagtatgtattccttt----------------------------------
B D                 Megabat  gcagttcagg-gtaggttaagagtatgcattccttt----------------------------------
B D                Hedgehog  gaaattcagg-acagattaagagaacagatcccttc----------------------------------
            Star-nosed mole  ---ctttaggtgcaggttacgag----tgttctttc----------------------------------
                   Aardvark  gcaattcagg-gcaggatagaagtgtgcattccttt----------------------------------
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
          Cape golden mole  ======================================================================
      David's myotis (bat)  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                    Pika  ======================================================================
B D                 Dolphin  ======================================================================
B D                 Manatee  ======================================================================

                      Human  -----------------------------------tgc---aaagcaaga--------------------
                      Chimp  -----------------------------------tgc---aaagcaaga--------------------
                    Gorilla  -----------------------------------tgc---aaagcaaga--------------------
                  Orangutan  -----------------------------------tgc---aaagcaaga--------------------
                     Gibbon  -----------------------------------tgc---aaagcaaga--------------------
                     Rhesus  -----------------------------------tgc---aaagcaag---------------------
        Crab-eating macaque  -----------------------------------tgc---aaagcaag---------------------
                     Baboon  -----------------------------------tgc---aaagcaag---------------------
               Green monkey  -----------------------------------tgc---aaagcaag---------------------
                   Marmoset  -----------------------------------tgc---aaagcaaat--------------------
            Squirrel monkey  -----------------------------------tgc---aaagcaaaa--------------------
                   Bushbaby  -----------------------------------cct---aaagcaaga--------------------
                   Squirrel  -----------------------------------tgc---aaaacaaga--------------------
             Naked mole-rat  -----------------------------------tgc---aaagtgaga--------------------
                     Rabbit  -----------------------------------tgt---aaagcacaa--------------------
                        Pig  ccatgaggatgcaggttcgattcctgaccttgctctgt---gggttaagaatctggcactgccgcaagct
                     Alpaca  -----------------------------------tgt---aaagcaaga--------------------
             Bactrian camel  -----------------------------------tgt---aaagcaaga--------------------
           Tibetan antelope  --------------------------------------------ttaaga--------------------
                        Cow  --------------------------------------------ttaaga--------------------
                      Sheep  --------------------------------------------tcaaga--------------------
              Domestic goat  --------------------------------------------ataaga--------------------
                      Horse  -----------------------------------tgt--gaaagcgaga--------------------
           White rhinoceros  -----------------------------------tgt--gaaagcagga--------------------
                        Cat  -----------------------------------tgt---aaagcaaga--------------------
                        Dog  -----------------------------------tat---aaagc---a--------------------
                    Ferret   -----------------------------------tat---caagc---a--------------------
             Pacific walrus  -----------------------------------tat---caagc---a--------------------
               Weddell seal  -----------------------------------tat---taagc---a--------------------
           Black flying-fox  -----------------------------------tgt---aaagcaaga--------------------
                    Megabat  -----------------------------------tgt---aaagcaaga--------------------
                   Hedgehog  -----------------------------------tgc----aaacaaga--------------------
            Star-nosed mole  -----------------------------------tgaggggaaagcagg--------------------
                   Aardvark  -----------------------------------cct---aaattaaga--------------------
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
           Cape golden mole  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                       Pika  ======================================================================
                    Dolphin  ======================================================================
                    Manatee  ======================================================================

                      Human  ------------------g--aagaacagat----------------tataggag-gcgct---------
                      Chimp  ------------------g--aagaacagat----------------tataggag-gcgct---------
                    Gorilla  ------------------g--aagaacagat----------------tataggag-gcgct---------
                  Orangutan  ------------------g--aagaacagat----------------tataggag-gtgct---------
                     Gibbon  ------------------g--aagaacagat----------------tataggag-gcgct---------
                     Rhesus  ----------------------agaacagat----------------tacaggag-gcact---------
        Crab-eating macaque  ----------------------agaacagat----------------tacaggag-gcact---------
                     Baboon  ----------------------agaacagat----------------tacaggag-gcact---------
               Green monkey  ----------------------agaacagat----------------tacaggag-gcact---------
                   Marmoset  ------------------g--aagaacagat----------------tacaggac-gtgct---------
            Squirrel monkey  ------------------g--aagaacagat----------------tacaagag-gtgct---------
                   Bushbaby  ------------------g--aaggacagag----------------tatgaaag-gggtt---------
                   Squirrel  ------------------ggagggggcagat----------------gtcaaaagggggtt---------
             Naked mole-rat  ------------------g--aggaccaggt----------------gactaaggtgagt----------
                     Rabbit  ------------------g-------------------------------------gagt----------
                        Pig  gcagcacaggttgcagatg--aggctcagatctggcattgctgtggctgtggagt-aggctggcagctgc
                     Alpaca  ------------------g--aaggtcagat----------------tatgaaag-agact---------
             Bactrian camel  ------------------g--aaggtcagat----------------tatgaaag-agact---------
           Tibetan antelope  ------------------g--caggtcagat----------------gatgaaag-agact---------
                        Cow  ------------------g--aaggtcagat----------------tatgaaag-agact---------
                      Sheep  ------------------g--aaggtcagat----------------gatgaaag-agact---------
              Domestic goat  ------------------g--aaggtcagat----------------gatgaaag-agact---------
                      Horse  ------------------g--aagggcagat----------------tataaaag-gggtt---------
           White rhinoceros  ------------------g--aagggcagat----------------tatgaaag-gtgct---------
                        Cat  ------------------g--gagggcaaat----------------tatgaaag-cagct---------
                        Dog  ------------------g--aagggcagat----------------tatgaaag-cggct---------
                    Ferret   ------------------a--aagggcagat----------------tgtgaaat-tggtt---------
             Pacific walrus  ------------------g--aagggcagat----------------tatgaaag-tggtt---------
               Weddell seal  ------------------g--aagggcagat----------------tttgaaag-cggtt---------
           Black flying-fox  ------------------a--aagggcagat----------------tatgaagg--ggct---------
                    Megabat  ------------------a--aagggcagat----------------tatgaagg--ggct---------
                   Hedgehog  ------------------g--agggccacat----------------tatgaaag---------------
            Star-nosed mole  ------------------g--actggcagat----------------tatgcaag-gggct---------
                   Aardvark  ------------------a--aagtgcagat----------------tctgaaag-cgttt---------
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
           Cape golden mole  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                       Pika  ======================================================================
                    Dolphin  ======================================================================
                    Manatee  ======================================================================

                      Human  ---------------------tgggaaa---------------------g-------------------g
                      Chimp  ---------------------tgggaaa---------------------g-------------------g
                    Gorilla  ---------------------tgggaaa---------------------g-------------------g
                  Orangutan  ---------------------tgggaaa---------------------g-------------------a
                     Gibbon  ---------------------tgggaaa---------------------g-------------------g
                     Rhesus  ---------------------tgggaaa---------------------g-------------------g
        Crab-eating macaque  ---------------------tgggaaa---------------------g-------------------g
                     Baboon  ---------------------tgggaaa---------------------g-------------------g
               Green monkey  ---------------------tgggaaa---------------------g-------------------g
                   Marmoset  ---------------------tccgaaa---------------------g-------------------g
            Squirrel monkey  ---------------------ttggaaa---------------------g-------------------a
                   Bushbaby  ---------------------taggaaa---------------------g-------------------c
                   Squirrel  ---------------------ggggcaa---------------------g-------------------a
             Naked mole-rat  ----------------------aagaaa---------------------a-------------------a
                     Rabbit  ----------------------------------------------------------------------
                        Pig  agctgtgattcatcccctagcctgggaactttcatatgccacgggtgcggccctaaaaagaagaaaaaag
                     Alpaca  ---------------------ttggaga---------------------g-------------------a
             Bactrian camel  ---------------------ttggaga---------------------g-------------------a
           Tibetan antelope  ---------------------ttggaaa--------------------gg-------------------g
                        Cow  ---------------------ttggaaa--------------------gg-------------------g
                      Sheep  ---------------------ttggaaa--------------------gg-------------------g
              Domestic goat  ---------------------ttggcaa--------------------gg-------------------g
                      Horse  ---------------------taggaaa---------------------g-------------------g
           White rhinoceros  ---------------------tcggaaa---------------------g-------------------g
                        Cat  ---------------------ttgagaa---------------------g-------------------g
                        Dog  ---------------------ttgg-aa---------------------g-------------------g
                    Ferret   ---------------------ttggaaa---------------------g-------------------g
             Pacific walrus  ---------------------ttgggaa---------------------g-------------------g
               Weddell seal  ---------------------gtgggaa---------------------g-------------------g
           Black flying-fox  ---------------------tcaggaa---------------------g--------------------
                    Megabat  ---------------------tcaggaa---------------------g--------------------
                   Hedgehog  ---------------------------a---------------------a-------------------g
            Star-nosed mole  ---------------------taagaaa---------------------a-------------------g
                   Aardvark  ---------------------tggggaa---------------------g-------------------g
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
           Cape golden mole  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                       Pika  ======================================================================
                    Dolphin  ======================================================================
                    Manatee  ======================================================================

                      Human  agcat--------------------------------------------------ctgcgcaag---caa
                      Chimp  agcat--------------------------------------------------ctgcgcaag---caa
                    Gorilla  agcat--------------------------------------------------ctgcgcaag---caa
                  Orangutan  agcat--------------------------------------------------ctgcacaag---caa
                     Gibbon  agcac--------------------------------------------------ctgcacaag---caa
                     Rhesus  agcat--------------------------------------------------ctgcacaag---caa
        Crab-eating macaque  agcat--------------------------------------------------ctgcacaag---caa
                     Baboon  agcat--------------------------------------------------ctgcacaag---caa
               Green monkey  agcat--------------------------------------------------ctgcacaag---caa
                   Marmoset  agaac--------------------------------------------------ctgtgtgag---caa
            Squirrel monkey  agaac--------------------------------------------------ctgtgtgag---caa
                   Bushbaby  agaac--------------------------------------------------ctccatgag---ccc
                   Squirrel  agaac--------------------------------------------------tggcatgag---caa
             Naked mole-rat  ataac--------------------------------------------------cagcatgggcaacaa
                     Rabbit  -------------------------------------------------------------gtg------
                        Pig  aaaagcgtggattccttttgtaaagcaagagaaggtgggagtatgacagagacttcggcaggac---taa
                     Alpaca  agaac--------------------------------------------------ctgcacaag---aaa
             Bactrian camel  agaac--------------------------------------------------ctgcacaag---aaa
           Tibetan antelope  aaaag--------------------------------------------------ccgcctgag---caa
                        Cow  aaaag--------------------------------------------------ccgcctgag---caa
                      Sheep  aaaag--------------------------------------------------ccgcctgag---caa
              Domestic goat  aaaag--------------------------------------------------ccgcctgag---caa
                      Horse  agaaccagcagg--------------------------------------------------gg---caa
           White rhinoceros  acaaccagcacg--------------------------------------------------ag---caa
                        Cat  agaacctgtgtg--------------------------------------------------ag---caa
                        Dog  agaacctgcaag--------------------------------------------------gg---caa
                    Ferret   agaacccgagggtggggttttgcgaaggagaac----------------------cagagcaag---caa
             Pacific walrus  agaccccaaggg--------------------------------------------------ag---caa
               Weddell seal  agaacccgaggg--------------------------------------------------ag---caa
           Black flying-fox  --------------------------------------------------------------gg---aaa
                    Megabat  --------------------------------------------------------------gg---aaa
                   Hedgehog  aac----------------------------------------------------ccacatgag---caa
            Star-nosed mole  aaa----------------------------------------------------ccaggtgag---cag
                   Aardvark  agaag--------------------------------------------------ctgtaagag---caa
                      Shrew  ======================================================================
                  Armadillo  ======================================================================
                   Microbat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
                 Chinchilla  ======================================================================
           Brush-tailed rat  ======================================================================
                 Guinea pig  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
            Chinese hamster  ======================================================================
        Cape elephant shrew  ======================================================================
           Cape golden mole  ======================================================================
       David's myotis (bat)  ======================================================================
         Chinese tree shrew  ======================================================================
                   Elephant  ======================================================================
              Big brown bat  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
                       Pika  ======================================================================
                    Dolphin  ======================================================================
                    Manatee  ======================================================================

                      Human  ccagggccattcccagaa-g
                      Chimp  ccagggccattcccagaa-g
                    Gorilla  ccagggccattcccagaa-g
                  Orangutan  ccagggccattcccagaa-g
                     Gibbon  ccagggccatttccagaa-g
                     Rhesus  ccagggccattcccagaa-g
        Crab-eating macaque  ccagggccattcccagaa-g
                     Baboon  ccagggccattcccagaa-g
               Green monkey  ccagggccattcccagaa-g
                   Marmoset  ccaggcccactcccagaa-g
            Squirrel monkey  ccaggcccactccgagaa-g
                   Bushbaby  aca-------ttcaggaa-g
                   Squirrel  tcaggcccactcccagaa-g
             Naked mole-rat  tcaggcccattcttagta-g
                     Rabbit  --------gctctcagaa-g
                        Pig  gtaggcctgctttcacag--
                     Alpaca  gcaggcctgctttcacag--
             Bactrian camel  gcaggcctgctttcacag--
           Tibetan antelope  gcaggcctgctttcacag--
                        Cow  gcaggcctgctttcacag--
                      Sheep  gcaggcctgctttcacag--
              Domestic goat  gcaggcctgcttgcacag--
                      Horse  gctggtctgctttccgag--
           White rhinoceros  gcaggcctgctttcagag--
                        Cat  gcagccctcctttc------
                        Dog  gcagccctgcttcc------
                    Ferret   gcagccctgctccc------
             Pacific walrus  tcagccctgcttcc------
               Weddell seal  tcagccctgcttcc------
           Black flying-fox  gcaagcctgctgtcagag--
                    Megabat  gcaagcctgctgtcagag--
                   Hedgehog  acagacctacttacagtaa-
            Star-nosed mole  tcag-cctgcttccagaa--
                   Aardvark  gaagacccattttcagaa-g
                      Shrew  ====================
                  Armadillo  ====================
                   Microbat  ====================
                     Tenrec  ====================
             Golden hamster  ====================
               Prairie vole  ====================
                        Rat  ====================
                      Mouse  ====================
                 Chinchilla  ====================
           Brush-tailed rat  ====================
                 Guinea pig  ====================
     Lesser Egyptian jerboa  ====================
            Chinese hamster  ====================
        Cape elephant shrew  ====================
           Cape golden mole  ====================
       David's myotis (bat)  ====================
         Chinese tree shrew  ====================
                   Elephant  ====================
              Big brown bat  ====================
                      Panda  ====================
               Killer whale  ====================
                       Pika  ====================
                    Dolphin  ====================
                    Manatee  ====================

Inserts between block 19 and 20 in window
B D               Hedgehog 187bp

Alignment block 20 of 429 in window, 71511664 - 71511702, 39 bps 
B D                   Human  accacacatgaagctgaggatctaaaactggagtcccct
B D                   Chimp  accacacatgaagctgaggatctaaaactggagtcccct
B D                 Gorilla  accacacatgaagctgaggatctaaaactggagtccctt
B D               Orangutan  accacacatgaagctgaggatctaaaactggagtccctt
B D                  Gibbon  accacacatgaagctgaggatctaaaactggagtccctt
B D                  Rhesus  accacacatgaagctgaggatctaaaactggagtccctt
B D     Crab-eating macaque  accacacatgaagctgaggatctaaaactggagtccctt
B D                  Baboon  accacacatgaagctgaggatctaaaactggagtccctt
B D            Green monkey  accacacatgaagctgaggatctaaaactggagtccctt
B D                Marmoset  actacacgtgaagttgaggatctaaaaatggattctctt
B D         Squirrel monkey  gctacacgtgaagccaaggatctaaaaatggattcccgt
B D                Bushbaby  accatgcatgaagttgagggtctggaactggattccctt
B D                Squirrel  accacaagtgaagctgacaatctggaactggactccctc
B D          Naked mole-rat  acgatacatcaaactgaggatctggaactgaagtccctt
B D                  Rabbit  atg-cacaccaagtctggggtctggagatgcattccctt
B D                     Pig  atgcagcttgaac-tgagaatctgaaaatgaattccttt
B D                  Alpaca  atg-agtcggaag-tgagaatctggaaatggattccctt
             Bactrian camel  atg-agtaggaag-tgagaatctggaaatggattccctt
           Tibetan antelope  atgaagcataaaa-tgagaatctggaaatgggttcccgt
B D                     Cow  atgaagcatgaaa-tgagaatctggaaatgggttccctt
B D                   Sheep  atgaagcataaaa-tgagaatctggaaatgggttccctt
              Domestic goat  atgaagcataaaa-tgagaatctggaaatgggttccctt
B D                   Horse  aaggaatatgaagctgaagatctagaaacggattccctt
B D        White rhinoceros  actgaacgtgaagctgacaatccagacatggattccctc
B D                     Cat  -----acgcaaagctggggatctggaaatag--------
B D                     Dog  -----acacgaaactgaggatctggatatag--------
B D                 Ferret   -----acacaaagctgaggatctgcaaatag--------
             Pacific walrus  -----acacaaagctgaggacctggaaatag--------
               Weddell seal  -----acacgaagttgaggatctggaaatag--------
           Black flying-fox  accgaacatgaagctgagaggctagcaatggacccgctt
B D                 Megabat  accaaacatgaagctgagaagctagcaacggacccgctt
            Star-nosed mole  -----------agttgaggatctaaaaatgggtgaccca
                   Aardvark  ggagcacatgaag-tgaggatctggaaatgaattctctt
B D                Hedgehog  =======================================
B D                   Shrew  =======================================
B D               Armadillo  =======================================
B D                Microbat  =======================================
B D                  Tenrec  =======================================
            Golden hamster  =======================================
              Prairie vole  =======================================
B D                     Rat  =======================================
B D                   Mouse  =======================================
                Chinchilla  =======================================
          Brush-tailed rat  =======================================
B D              Guinea pig  =======================================
    Lesser Egyptian jerboa  =======================================
B D         Chinese hamster  =======================================
       Cape elephant shrew  =======================================
          Cape golden mole  =======================================
      David's myotis (bat)  =======================================
        Chinese tree shrew  =======================================
B D                Elephant  =======================================
             Big brown bat  =======================================
B D                   Panda  =======================================
              Killer whale  =======================================
B D                    Pika  =======================================
B D                 Dolphin  =======================================
B D                 Manatee  =======================================

Alignment block 21 of 429 in window, 71511703 - 71511797, 95 bps 
B D                   Human  agaactgtccacttta-ctcttcccaatttgaagac--cactgact---gctgaccccttgctttgagaa
B D                   Chimp  agaactgtccacttta-ctcttcccactttgaagac--cactgact---gctgaccccttgctttgagaa
B D                 Gorilla  agaactgtccacttta-ctcttcccactttgaagac--cactgact---gctgaccccttgctttgagaa
B D               Orangutan  agaactgtccacttta-ctcttcccactttgaagac--cactgact---gctgaccccttgctttgagaa
B D                  Gibbon  agaactgtccactctg-ctcttcccactttgaagac--cactgact---gctgaccccttgctttgagaa
B D                  Rhesus  agaactttccactctg-ctcttcccactttgaagac--ccctgatt---gctgaccccttgctttgagaa
B D     Crab-eating macaque  agaactttccactctg-ctcttcccactttgaagac--ccctgact---gctgaccccttgctttgagaa
B D                  Baboon  agaactgtccactctg-ctcttcccactttgaagac--cactgact---gctgaccccttgctttgagaa
B D            Green monkey  agaactgtccactctg-ctcttcccactttgaagac--cactgact---gccgaccccttgctttgagaa
B D                Marmoset  agaactgtccactctg-ctcttcccactttgaagac--tactaact---gctgacctcttgctttaagaa
B D         Squirrel monkey  agaactgtccactctg-ctcttcccactttgaagac--cactaacg---gctgacctcttgctttaagaa
B D                Bushbaby  agcactgtccacactg-ccattcccactcttaagac--cactgacc---actgacctccagctctgagga
         Chinese tree shrew  aaaactgtccatgctg-ctcttcccgctctgcagac--caatgacc---actgacctatagctttgaggc
B D                Squirrel  agaccggtccatctca---------gcatggaagat---actgac----------ctctagcttcgagaa
B D          Naked mole-rat  agaactgtccatgttg-ctgctcttatttggaagat--cactgac----------cactagctctgagga
B D                  Rabbit  agaactgtccacgctg-ctgctccctcgtggaacag--cactgaca---gctgatctccagctttgaaga
B D                     Pig  agaacgccccatactg-ctgcttccaccctgaagac--cactagct---gctgacctct-gctttgagga
B D                  Alpaca  agaagtatccatgcag-ctgctcccactttaaaggc--cactaact---gctgacccccggctttgagga
             Bactrian camel  agaactacccatgctg-ctgctcccactttaaaggc--cactaact---gctgacccccggctttgagga
           Tibetan antelope  aggactgtccatgctg-ccgctcccacttagaagac--cactaagt---gctggcctctagctctgaagt
B D                     Cow  aggactgtccatgctg-ctgctcccacttagaagaa--cactaagt---gctggcctctagctctgaagt
B D                   Sheep  aggactgtccatgctg-ctgctcccacttagaagac--cactaagt---gctggcctctagctctgaagt
              Domestic goat  aggactgcccatgctg-ctgctcccactcagaagac--cactaagt---gctggcctctagctctgaagt
B D                   Horse  agaactgtctatgctg-ctgttcccagtttgaagac--cactgaca---gctcacctctggcttcaagga
B D        White rhinoceros  agaactgtccatgctg-ctgttcccactttgaagac--cactgact---gctgacctctgctttcgagga
B D                     Cat  ----------atgctg-ctgttcccactttgaagac--atctgacc---actgacctccagctttgagga
B D                     Dog  ----------atgctg-ctagtctcaatttgaagaccacactgacc---actgacctccagctttgaggg
B D                 Ferret   ----------atgatg-ctattcccactttgaagac--cactgacccagactgacctccagcttcaagga
             Pacific walrus  ----------atgctg-ctattcccactttgaagac--cactgacc---actgacctccagctttgagga
               Weddell seal  ----------atgctg-ctattcccactttgaagac--cactgacc---actgacctccagctttgagga
           Black flying-fox  agaactatc-ctgcgg-ctgttcccaccgc-cagac--cactgacc---cctaacctttggctttgagga
B D                 Megabat  agaactatc-ctgcgg-ctgttcccaccgc-aagac--cactgacc---cctaacctttggctttgagga
            Star-nosed mole  agaccgaatggtgctg-ctggtcccccttggaagac--cactcagc---cctgacctctggcttggagga
                   Aardvark  aaaactacccatgatggctattcgtgctttgaaggc--caatggcc---tttgactgctggctctgaggc
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
          Cape golden mole  ======================================================================
      David's myotis (bat)  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                    Pika  ======================================================================
B D                 Dolphin  ======================================================================
B D                 Manatee  ======================================================================

                      Human  tatttcctcaaaag-actgg--aaaaaggcagat
                      Chimp  tatttcctcaaaag-actgg--aaaaaggcagat
                    Gorilla  tatttcctcaaaag-actgg--aaaaaggcagat
                  Orangutan  tatttcctcaaaat-attgg--aaaaaggcagat
                     Gibbon  tatttcctcaaaag-actgg--aaaaaggcagat
                     Rhesus  tatttcctcaaaag-actgg--aaaaaggcagat
        Crab-eating macaque  tatttcctcaaaag-actgg--aaaaaggcagat
                     Baboon  tatttcctcaaaag-actgg--gaaaaggcagat
               Green monkey  tatttcctcaaaag-actgg--aaaaaggcagat
                   Marmoset  taattcctcaaaag-actgg-aaaaaaggcagat
            Squirrel monkey  taattcctcaaaag-actggaaaaaaaggcagat
                   Bushbaby  caaatcctcaaagg-acttg--gaaaaggcagat
         Chinese tree shrew  tatttcctca---g-gctgg--gaaaaggcacat
                   Squirrel  tacttcttt---ag-gctgt--gaaaaggcagat
             Naked mole-rat  tttttcctt---gg-cttag--gaaaaagcagat
                     Rabbit  ------------gg-gctgg--g-tcaggtagct
                        Pig  cattttctt---ag-actgg--gaaacagtaaat
                     Alpaca  tattttctt---gg-actgg--aaaatggtagag
             Bactrian camel  tattttctt---gg-actgg--gaaatggtagct
           Tibetan antelope  catttccgt---gg-actgg--gaagaagtagat
                        Cow  catttccgt---gg-actgg--gaagaagtagat
                      Sheep  catttccgt---gg-actgg--gaagaagtagat
              Domestic goat  catttccgt---gg-actgg--gaagaagtagat
                      Horse  tatttcctt---gg-actgg--gaaaaggcagat
           White rhinoceros  tatttcctt---gg-actgg--caaaaggcagat
                        Cat  tatttcctt---gg-cctgg--acaaaggcagat
                        Dog  tatttcctt---gg-actgg--gaaaaggtagat
                    Ferret   tatttcttt---gg-gctgg--agaaaggcagat
             Pacific walrus  tatttcctt---gg-gctgg--gaaaaggcagat
               Weddell seal  tatttcctt---gg-gctgg--gaaaaggcagat
           Black flying-fox  tatttcctt---gg-actga--gaaaagacagac
                    Megabat  tacttcctt---ggtactga--gaaaagacagac
            Star-nosed mole  tatttcttt---gg-actgg-----aagacagag
                   Aardvark  tacttcctt---gg-a-tgg--ggaacagcaagt
                   Hedgehog  ==================================
                      Shrew  ==================================
                  Armadillo  ==================================
                   Microbat  ==================================
                     Tenrec  ==================================
             Golden hamster  ==================================
               Prairie vole  ==================================
                        Rat  ==================================
                      Mouse  ==================================
                 Chinchilla  ==================================
           Brush-tailed rat  ==================================
                 Guinea pig  ==================================
     Lesser Egyptian jerboa  ==================================
            Chinese hamster  ==================================
        Cape elephant shrew  ==================================
           Cape golden mole  ==================================
       David's myotis (bat)  ==================================
                   Elephant  ==================================
              Big brown bat  ==================================
                      Panda  ==================================
               Killer whale  ==================================
                       Pika  ==================================
                    Dolphin  ==================================
                    Manatee  ==================================

Inserts between block 21 and 22 in window
        Chinese tree shrew 1048bp
B D               Squirrel 8bp
B D         Naked mole-rat 4bp
B D                 Rabbit 5bp

Alignment block 22 of 429 in window, 71511798 - 71511803, 6 bps 
B D                   Human  aacagt
B D                   Chimp  aacagt
B D                 Gorilla  aacagc
B D               Orangutan  aacagc
B D                  Gibbon  aacagt
B D                  Rhesus  aacagc
B D     Crab-eating macaque  aacagc
B D                  Baboon  aacagc
B D            Green monkey  aacagc
B D                Marmoset  aacagc
B D         Squirrel monkey  aacagc
B D                Bushbaby  gtgaca
B D                Squirrel  tccagt
B D          Naked mole-rat  tacagc
B D                     Pig  -atgga
B D                  Alpaca  -agaga
             Bactrian camel  -agaga
           Tibetan antelope  -atagc
B D                     Cow  -atagc
B D                   Sheep  -agagc
              Domestic goat  -agagc
B D                   Horse  -atagc
B D        White rhinoceros  -agagc
B D                     Cat  -atagc
B D                     Dog  aataac
B D                 Ferret   -agagc
             Pacific walrus  -acaac
               Weddell seal  -acagc
           Black flying-fox  -ataga
B D                 Megabat  -ataga
            Star-nosed mole  -acaca
B D                Hedgehog  ======
B D                   Shrew  ======
B D               Armadillo  ======
B D                Microbat  ======
B D                  Tenrec  ======
            Golden hamster  ======
              Prairie vole  ======
B D                     Rat  ======
B D                   Mouse  ======
                Chinchilla  ======
          Brush-tailed rat  ======
B D              Guinea pig  ======
    Lesser Egyptian jerboa  ======
B D         Chinese hamster  ======
       Cape elephant shrew  ======
          Cape golden mole  ======
      David's myotis (bat)  ======
        Chinese tree shrew  ======
B D                Elephant  ======
             Big brown bat  ======
B D                   Panda  ======
              Killer whale  ======
B D                  Rabbit  ======
B D                    Pika  ======
B D                 Dolphin  ======
                  Aardvark  ------
B D                 Manatee  ======

Inserts between block 22 and 23 in window
B D               Squirrel 153bp

Alignment block 23 of 429 in window, 71511804 - 71511816, 13 bps 
B D                   Human  ggtct---caactgtt
B D                   Chimp  ggtct---caaccgtt
B D                 Gorilla  ggtct---caaccgtt
B D               Orangutan  ggttt---caaccgtt
B D                  Gibbon  ggtct---caaccgtt
B D                  Rhesus  agtct---caaccgtt
B D     Crab-eating macaque  agtct---caaccgtt
B D                  Baboon  agtct---caaccgtt
B D            Green monkey  ggtct---caaccgtt
B D                Marmoset  ggtcc---caaccgtt
B D         Squirrel monkey  ggtcc---caaccgtt
B D                Bushbaby  agctc---aagcc---
B D                Squirrel  ctagt---tgctt---
B D          Naked mole-rat  cagct---caacc---
B D                  Rabbit  cagct---cagcc---
B D                     Pig  aggct---agact---
B D                  Alpaca  aggtc---tgacc---
             Bactrian camel  aggtc---tgacc---
           Tibetan antelope  agact---tgacc---
B D                     Cow  agact---tgacc---
B D                   Sheep  agact---tgacc---
              Domestic goat  agact---tgacc---
B D                   Horse  acact---tgacc---
B D        White rhinoceros  agact---taacc---
B D                     Cat  aggc----tcacc---
B D                     Dog  aggctc--ccccc---
B D                 Ferret   aggctccaccacc---
             Pacific walrus  aggct---tcacc---
               Weddell seal  aggct---tcacc---
           Black flying-fox  aggct---ggacc---
B D                 Megabat  a-gct---cgacc---
            Star-nosed mole  agctt---tgtcc---
                   Aardvark  --------caacc---
B D                Hedgehog  ================
B D                   Shrew  ================
B D               Armadillo  ================
B D                Microbat  ================
B D                  Tenrec  ================
            Golden hamster  ================
              Prairie vole  ================
B D                     Rat  ================
B D                   Mouse  ================
                Chinchilla  ================
          Brush-tailed rat  ================
B D              Guinea pig  ================
    Lesser Egyptian jerboa  ================
B D         Chinese hamster  ================
       Cape elephant shrew  ================
          Cape golden mole  ================
      David's myotis (bat)  ================
        Chinese tree shrew  ================
B D                Elephant  ================
             Big brown bat  ================
B D                   Panda  ================
              Killer whale  ================
B D                    Pika  ================
B D                 Dolphin  ================
B D                 Manatee  ================

Alignment block 24 of 429 in window, 71511817 - 71511836, 20 bps 
B D                   Human  actgacttgct-----------------------ttgaaactt
B D                   Chimp  actgacttgct-----------------------ttgaaactt
B D                 Gorilla  actgacttgct-----------------------ttgaaactt
B D               Orangutan  actgacttgct-----------------------ttgaaactt
B D                  Gibbon  actgacttgct-----------------------ttgaaactt
B D                  Rhesus  actgacttgct-----------------------ttgaaactg
B D     Crab-eating macaque  actgacttgct-----------------------ttgaaactt
B D                  Baboon  actgacttgct-----------------------ttgaaactt
B D            Green monkey  actgacttgct-----------------------ttgaaactt
B D                Marmoset  actgacttact-----------------------ttgaaactt
B D         Squirrel monkey  actgacttact-----------------------ttgaaactt
B D                Bushbaby  -ctaacttgct-----------------------ttgaaaatc
         Chinese tree shrew  actgccttgct-----------------------tcgggactt
B D                Squirrel  atggacttgctaattggggagactggctttgaacttgcaatcc
B D          Naked mole-rat  acagacttgct-----------------------ttgcaattc
B D                  Rabbit  actgacttgct-------------------------------c
B D                     Pig  actgattcgct-----------------------tcagtactc
B D                  Alpaca  actaacttgtt-----------------------ttggaactc
             Bactrian camel  actaacttgtt-----------------------ttggaactc
           Tibetan antelope  actagtttgct-----------------------ttggaactc
B D                     Cow  attagtttgct-----------------------ttggaactc
B D                   Sheep  actagtttgct-----------------------ttggaactc
              Domestic goat  actagtttgct-----------------------ttggaactc
B D                   Horse  actaatttgct-----------------------tcagaactt
B D        White rhinoceros  acgaatttgct-----------------------ttggaactt
B D                     Cat  actgagttgct-----------------------ttggaactc
B D                     Dog  actgacttgct-----------------------ttggaattc
B D                 Ferret   actgacttgct-----------------------ttggaa---
             Pacific walrus  actgacttgct-----------------------ttggaattc
               Weddell seal  actgacttgct-----------------------ttggaattc
           Black flying-fox  a-tgactcact-----------------------ctgcaactt
B D                 Megabat  a-tgactcgct-----------------------ctgcaactt
            Star-nosed mole  atggccttgct-----------------------atataactc
                   Aardvark  actgacttgct-----------------------ttggcactt
B D                Hedgehog  ===========================================
B D                   Shrew  ===========================================
B D               Armadillo  ===========================================
B D                Microbat  ===========================================
B D                  Tenrec  ===========================================
            Golden hamster  ===========================================
              Prairie vole  ===========================================
B D                     Rat  ===========================================
B D                   Mouse  ===========================================
                Chinchilla  ===========================================
          Brush-tailed rat  ===========================================
B D              Guinea pig  ===========================================
    Lesser Egyptian jerboa  ===========================================
B D         Chinese hamster  ===========================================
       Cape elephant shrew  ===========================================
          Cape golden mole  ===========================================
      David's myotis (bat)  ===========================================
B D                Elephant  ===========================================
             Big brown bat  ===========================================
B D                   Panda  ===========================================
              Killer whale  ===========================================
B D                    Pika  ===========================================
B D                 Dolphin  ===========================================
B D                 Manatee  ===========================================

Inserts between block 24 and 25 in window
        Chinese tree shrew 1bp
B D                Megabat 111bp

Alignment block 25 of 429 in window, 71511837 - 71511854, 18 bps 
B D                   Human  g-----------------------------------------------------------gagaactttc
B D                   Chimp  g-----------------------------------------------------------gagaacattc
B D                 Gorilla  g-----------------------------------------------------------gagaacattc
B D               Orangutan  g-----------------------------------------------------------gagaacattc
B D                  Gibbon  g-----------------------------------------------------------gagaacattc
B D                  Rhesus  g-----------------------------------------------------------gagaacactc
B D     Crab-eating macaque  g-----------------------------------------------------------gagaacactc
B D                  Baboon  g-----------------------------------------------------------gagaacactc
B D            Green monkey  g-----------------------------------------------------------gagaacactc
B D                Marmoset  g-----------------------------------------------------------gagaacattc
B D         Squirrel monkey  g-----------------------------------------------------------gagaacattc
B D                Bushbaby  ----------------------------------------------------------------------
         Chinese tree shrew  t-----------------------------------------------------------gatagcattc
B D                Squirrel  tcctgcctcagcctcccgagccactgggattacaggcatgtgccaccacacctggcccccaagaacattc
B D          Naked mole-rat  t-----------------------------------------------------------aagaaca-tc
B D                  Rabbit  t-----------------------------------------------------------gagagtgttc
B D                     Pig  -----------------------------------------------------------aggaa---gtc
B D                  Alpaca  -----------------------------------------------------------acggaacattt
             Bactrian camel  -----------------------------------------------------------atggaacattt
           Tibetan antelope  -----------------------------------------------------------atggaacggtc
B D                     Cow  -----------------------------------------------------------atgcaacagtc
B D                   Sheep  -----------------------------------------------------------acggaacagtc
              Domestic goat  -----------------------------------------------------------atggaatggtc
B D                   Horse  -----------------------------------------------------------ggagaacattc
B D        White rhinoceros  -----------------------------------------------------------ggggaacattc
B D                     Cat  -----------------------------------------------------------agggaacattc
B D                     Dog  -----------------------------------------------------------agggaacgttc
B D                 Ferret   ----------------------------------------------------------------------
             Pacific walrus  -----------------------------------------------------------agggaacattc
               Weddell seal  -----------------------------------------------------------agggaacattc
            Star-nosed mole  -----------------------------------------------------------agggaatgctc
                   Aardvark  -----------------------------------------------------------gaaaaaaactc
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D               Armadillo  ======================================================================
B D                Microbat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
                Chinchilla  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D         Chinese hamster  ======================================================================
       Cape elephant shrew  ======================================================================
          Cape golden mole  ======================================================================
      David's myotis (bat)  ======================================================================
B D                Elephant  ======================================================================
             Big brown bat  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                    Pika  ======================================================================
B D                 Dolphin  ======================================================================
B D                 Megabat  ======================================================================
B D                 Manatee  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------

                      Human  ct--taa--tg
                      Chimp  ct--taa--tg
                    Gorilla  ct--taa--tg
                  Orangutan  ct--taa--tg
                     Gibbon  ct--taa--tg
                     Rhesus  ct--taa--tg
        Crab-eating macaque  ct--taa--tg
                     Baboon  ct--taa--tg
               Green monkey  ct--taa--tg
                   Marmoset  ct--tag--tg
            Squirrel monkey  ct--tag--tg
                   Bushbaby  ---------tg
         Chinese tree shrew  tt--ta----g
                   Squirrel  ct--ca----g
             Naked mole-rat  tt--ta----g
                     Rabbit  tttgca----g
                        Pig  tt--tag----
                     Alpaca  tt--tag----
             Bactrian camel  tt--tag----
           Tibetan antelope  tt--tag----
                        Cow  tt--tag----
                      Sheep  tt--tag----
              Domestic goat  tt--tag----
                      Horse  tt--tag----
           White rhinoceros  tt--tag----
                        Cat  tt--cat----
                        Dog  tt--cag----
                    Ferret   tt--tag----
             Pacific walrus  tt--tag----
               Weddell seal  tt--tag----
            Star-nosed mole  tt--tagca--
                   Aardvark  tt--tag----
                   Hedgehog  ===========
                      Shrew  ===========
                  Armadillo  ===========
                   Microbat  ===========
                     Tenrec  ===========
             Golden hamster  ===========
               Prairie vole  ===========
                        Rat  ===========
                      Mouse  ===========
                 Chinchilla  ===========
           Brush-tailed rat  ===========
                 Guinea pig  ===========
     Lesser Egyptian jerboa  ===========
            Chinese hamster  ===========
        Cape elephant shrew  ===========
           Cape golden mole  ===========
       David's myotis (bat)  ===========
                   Elephant  ===========
              Big brown bat  ===========
                      Panda  ===========
               Killer whale  ===========
                       Pika  ===========
                    Dolphin  ===========
                    Megabat  ===========
                    Manatee  ===========
           Black flying-fox  -----------

Alignment block 26 of 429 in window, 71511855 - 71511911, 57 bps 
B D                   Human  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttccttctcat
B D                   Chimp  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttccttctcat
B D                 Gorilla  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttccttctcat
B D               Orangutan  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttccttctcat
B D                  Gibbon  tctccctgtgctaatct-gaaattggaat-caatatctagttttctgtttccttctcat
B D                  Rhesus  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttttttctcaa
B D     Crab-eating macaque  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttttttctcaa
B D                  Baboon  tcttactgtgctaatct-gaaattggaat-caatatctaatttcctgtttttttctcaa
B D            Green monkey  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttctttctcaa
B D                Marmoset  ccttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttccttctcat
B D         Squirrel monkey  tcttactgtgctaatct-gaaattggaat-caatatctagtttcctgtttccttctcat
B D                Bushbaby  tcttactgttctaacctggagagtgcaac-tgatacctagttacctggttccttttcat
         Chinese tree shrew  tcttactgttgtcatct-ggaaactggat----------gtttcccgtgtccctctcat
B D                Squirrel  tc---ttgttctgatgtggaaagtagaac-cagtacctagtttcctgtttctttctcaa
B D          Naked mole-rat  tcttattgttctgacctggaaagtagcac-caatgtctggtttcatgtttccttctgat
B D                  Rabbit  tgttattgttccaagctggaaagtggagc-caagaccttgtttcttgtttccttcttgt
B D                     Pig  ccctattgttctaatcggaaatgtataat-caatatgtggtttcttgtttccctcccgt
B D                  Alpaca  ccttattgttttcatctgaaaagtacaat-cagtatctgctttcctgtttctttcccat
             Bactrian camel  ccttattgttttcatctgaaaagtagaat-caatatctgctttcctgtttctttcccat
           Tibetan antelope  ctttattattctaatctgaaaagtggaat-caatatctactgacctatttccttcccat
B D                     Cow  ct---ttgttctaatctgaaaagtggaat-caatatctagtgacctgtttccttcccat
B D                   Sheep  ctttattgttctaatctgaaaagtggaat-caatatccagtgacctatttccttcccat
              Domestic goat  ctttattgttctaatctgaaaagtggaat-caatatctactgacctatttccttcccat
B D                   Horse  cttaattgttgtaatctggaaagtggaac-caatatctggtttcctgtttccttcccat
B D        White rhinoceros  ccttattgttctaatctggagagtagaac-caatatctagtttcctgtttccttcccat
B D                     Cat  ccatcttgttctaatcttgcaagtggaac-cagtgtctaggttccagtttccct-ccat
B D                     Dog  ctttcttgtttcaatctcgcaagtggaac-caatgtctagtttctggtttcctt-ccac
B D                 Ferret   ccatcttgttctaatctggcaaactgagc-caatgtctagtttttggtttcctt-ccat
             Pacific walrus  ccttcttgttctaatctggcaagttgaac-caatgtctagtttccagtttcctt-ccat
               Weddell seal  ccttcttgttctaatctggcaagttgaac-caatgtctagtttccggtttcttt-ccat
           Black flying-fox  ------aagtctaatccggaaagtggaac-caatatctagtttcttgtttccttctcat
B D                Hedgehog  ttttattgttctaatctggagagtaggaagctatatctagtgtcctgtttctttcccat
            Star-nosed mole  --------------tttggaaaagaggac-caacatttagtctcctgtttccttcccat
                   Aardvark  ccttatcattttaatctggcgtgtggaac-taatacctagtttcttatttccttcctgt
B D                   Shrew  ===========================================================
B D               Armadillo  ===========================================================
B D                Microbat  ===========================================================
B D                  Tenrec  ===========================================================
            Golden hamster  ===========================================================
              Prairie vole  ===========================================================
B D                     Rat  ===========================================================
B D                   Mouse  ===========================================================
                Chinchilla  ===========================================================
          Brush-tailed rat  ===========================================================
B D              Guinea pig  ===========================================================
    Lesser Egyptian jerboa  ===========================================================
B D         Chinese hamster  ===========================================================
       Cape elephant shrew  ===========================================================
          Cape golden mole  ===========================================================
      David's myotis (bat)  ===========================================================
B D                Elephant  ===========================================================
             Big brown bat  ===========================================================
B D                   Panda  ===========================================================
              Killer whale  ===========================================================
B D                    Pika  ===========================================================
B D                 Dolphin  ===========================================================
B D                 Megabat  ===========================================================
B D                 Manatee  ===========================================================

Inserts between block 26 and 27 in window
B D                 Rabbit 7bp

Alignment block 27 of 429 in window, 71511912 - 71511914, 3 bps 
B D                   Human  ggt-
B D                   Chimp  ggt-
B D                 Gorilla  ggt-
B D               Orangutan  ggt-
B D                  Gibbon  ggt-
B D                  Rhesus  ggt-
B D     Crab-eating macaque  ggt-
B D                  Baboon  ggt-
B D            Green monkey  ggt-
B D                Marmoset  ggt-
B D         Squirrel monkey  ggt-
B D                Bushbaby  ggt-
         Chinese tree shrew  agt-
B D                Squirrel  ggt-
B D          Naked mole-rat  aat-
B D                     Pig  ggt-
B D                  Alpaca  ggt-
             Bactrian camel  ggt-
           Tibetan antelope  ggt-
B D                     Cow  ggt-
B D                   Sheep  ggt-
              Domestic goat  ggt-
B D                   Horse  ggt-
B D        White rhinoceros  ggt-
B D                     Cat  agt-
B D                     Dog  agt-
B D                 Ferret   agt-
             Pacific walrus  agt-
               Weddell seal  agt-
           Black flying-fox  gaa-
B D                Hedgehog  gca-
            Star-nosed mole  ggt-
                   Aardvark  -gtt
B D                   Shrew  ====
B D               Armadillo  ====
B D                Microbat  ====
B D                  Tenrec  ====
            Golden hamster  ====
              Prairie vole  ====
B D                     Rat  ====
B D                   Mouse  ====
                Chinchilla  ====
          Brush-tailed rat  ====
B D              Guinea pig  ====
    Lesser Egyptian jerboa  ====
B D         Chinese hamster  ====
       Cape elephant shrew  ====
          Cape golden mole  ====
      David's myotis (bat)  ====
B D                Elephant  ====
             Big brown bat  ====
B D                   Panda  ====
              Killer whale  ====
B D                  Rabbit  ====
B D                    Pika  ====
B D                 Dolphin  ====
B D                 Megabat  ====
B D                 Manatee  ====

Inserts between block 27 and 28 in window
B D         Naked mole-rat 2bp

Alignment block 28 of 429 in window, 71511915 - 71511918, 4 bps 
B D                   Human  attt
B D                   Chimp  attt
B D                 Gorilla  attt
B D               Orangutan  attt
B D                  Gibbon  attt
B D                  Rhesus  attt
B D     Crab-eating macaque  attt
B D                  Baboon  attt
B D            Green monkey  attt
B D                Marmoset  attt
B D         Squirrel monkey  attt
B D                Bushbaby  attt
         Chinese tree shrew  attt
B D                Squirrel  attt
B D                     Pig  attt
B D                  Alpaca  attt
             Bactrian camel  attt
           Tibetan antelope  attt
B D                     Cow  attt
B D                   Sheep  attt
              Domestic goat  attt
B D                   Horse  attt
B D        White rhinoceros  attt
B D                     Cat  attt
B D                     Dog  attt
B D                 Ferret   gttc
             Pacific walrus  gttc
               Weddell seal  gttc
           Black flying-fox  gttt
B D                Hedgehog  ttt-
            Star-nosed mole  gttt
                   Aardvark  attt
B D                   Shrew  ====
B D               Armadillo  ====
B D                Microbat  ====
B D                  Tenrec  ====
            Golden hamster  ====
              Prairie vole  ====
B D                     Rat  ====
B D                   Mouse  ====
                Chinchilla  ====
          Brush-tailed rat  ====
B D              Guinea pig  ====
B D          Naked mole-rat  ====
    Lesser Egyptian jerboa  ====
B D         Chinese hamster  ====
       Cape elephant shrew  ====
          Cape golden mole  ====
      David's myotis (bat)  ====
B D                Elephant  ====
             Big brown bat  ====
B D                   Panda  ====
              Killer whale  ====
B D                  Rabbit  ====
B D                    Pika  ====
B D                 Dolphin  ====
B D                 Megabat  ====
B D                 Manatee  ====

Inserts between block 28 and 29 in window
B D               Hedgehog 1bp
           Star-nosed mole 6bp

Alignment block 29 of 429 in window, 71511919 - 71511919, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
B D                     Pig  t
B D                  Alpaca  t
             Bactrian camel  a
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
                   Aardvark  t
           Star-nosed mole  =
B D                Hedgehog  =
B D                   Shrew  =
B D               Armadillo  =
B D                Microbat  =
B D                  Tenrec  =
            Golden hamster  =
              Prairie vole  =
B D                     Rat  =
B D                   Mouse  =
                Chinchilla  =
          Brush-tailed rat  =
B D              Guinea pig  =
B D          Naked mole-rat  =
    Lesser Egyptian jerboa  =
B D         Chinese hamster  =
       Cape elephant shrew  =
          Cape golden mole  =
      David's myotis (bat)  =
B D                Elephant  =
             Big brown bat  =
B D                   Panda  =
              Killer whale  =
B D                  Rabbit  =
B D                    Pika  =
B D                 Dolphin  =
B D                 Megabat  =
B D                 Manatee  =

Inserts between block 29 and 30 in window
B D                    Dog 212bp

Alignment block 30 of 429 in window, 71511920 - 71511924, 5 bps 
B D                   Human  gagaa
B D                   Chimp  gagaa
B D                 Gorilla  gagaa
B D               Orangutan  gagaa
B D                  Gibbon  gagaa
B D                  Rhesus  gagaa
B D     Crab-eating macaque  gagaa
B D                  Baboon  gagaa
B D            Green monkey  gagaa
B D                Marmoset  gagaa
B D         Squirrel monkey  gagaa
B D                Bushbaby  aagaa
         Chinese tree shrew  gagaa
B D                Squirrel  gagaa
B D                     Pig  gcaaa
B D                  Alpaca  gagaa
             Bactrian camel  gagaa
           Tibetan antelope  gagaa
B