Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 861 in window, 43671197 - 43671347, 151 bps 
B D                     Human  gcccc---tttgag--gaacgcagtttcttggattcacacg--ag--agcggcaagtg---tgtcag---
B D                     Chimp  gcccc---tttgag--gaacgcagtttcttggattcacacg--ag--agcggcaagtg---tgtcag---
B D                   Gorilla  gcccc---tttgag--gaacgcagtttcttggattcacaca--ag--agcggcaagtg---tgtcag---
B D                 Orangutan  gcccc---tttgag--gaacgcagtttcttggattcacatg--ag--agcagcaagtg---tgtcag---
B D                    Gibbon  gcccc---tttgag--gaacgcagtttcttggattcacacg--ag--agcggcaagtt---tgtcag---
B D                    Rhesus  gcccc---tttgag--aaaggcagtttcttggattcacacg--ag--agcggcaagtg---tgtcag---
B D       Crab-eating macaque  gcccc---tttgag--gaaggcagtttcttggattcacacg--ag--agcggcaagtg---tgtcag---
B D                    Baboon  gcccc---tttgag--gaaggcagtttcttggattcacacg--ag--agcggcaagtg---tgtcag---
B D              Green monkey  gcccc---tttgag--gaaggcagtttcttggattcacacg--ag--agcggcaagtg---tgtcag---
B D                  Marmoset  gcccc---tttgaa--gaaggcagtttcttggattcacacg--ag--agcggcaagtg---tgccag---
B D           Squirrel monkey  gcccc---tttgaa--gaaggcagtttcttggattcacacg--ag--cgcagcaagtg---tgccag---
           Chinese tree shrew  ggccc---tctgag--gaaggcagctttgtggactcaggtg--ag--agctacatgtg---ggccag---
B D                  Squirrel  aatcc---tctgag--gaaggcagctccttagactcaggtg--ag--agctacatgta---ggccat---
       Lesser Egyptian jerboa  --------gaagga--g--------cttctgggttgaggtg--aa--aggtgcatgag------------
                 Prairie vole  tgtct---gctgaa--g--------ttcctcgactctactg--aa--agctacttgtg------------
               Golden hamster  -gcct---gctcag--g--------tgcctggactcaccca--ac--agctactgtgg------------
B D                     Mouse  ggccc---gctcaa--a--------ttcctggattcaactg--aa--agctgctagtaactgacagt---
B D                       Rat  agcct---gctcga--g--------ttcccagagtcaac-a--aa--agctgcttgtaactgatcat---
B D            Naked mole-rat  ----t---catgag--ggcggctgctccttgggctcatatg--ag--agcgacatgtg---ggccag---
B D                Guinea pig  -gact---cgtgaa--gatggctgctcctggggctcagatg--ag--agcga--tgtg---ggccac---
                   Chinchilla  -gact---cgtgag--gatggctgcttctgaggctcagatg--ag--agtgacgtgtg---gaccat---
             Brush-tailed rat  -gact---cgtgag--gacagctgctccttaggctcaggtg--ag--actgacatggg---tgcca----
B D                    Rabbit  -ggcc---cctgag--g------------aggggcccac----------ctactgctg------------
B D                      Pika  -gg----------g--g------------aagacccacc----------ctgctgctc------------
B D                       Pig  agccc---ttcaag--cagggctgcttcttggcc------------------------------------
B D                    Alpaca  aaccc---tttgag--aaaggcaatttcttggactca---g--ag--agctgtgcatg---ggcccg---
               Bactrian camel  aaccc---tttgag--aaaggcaacttcttggactca---g--ag--agctgtgcatg---ggcccg---
B D                   Dolphin  agccc---tctgag--gagggcagcttcctggactcagatg--ag--agctgcacatg---ggccag---
                 Killer whale  agccc---tctgag--gagggcagcttcctggactcagatg--ag--aggggcacatg---ggccag---
             Tibetan antelope  aggct---tctgag--gagggcagcttcttggactcagaag--ag--agctgcacgta---ggccgg---
B D                       Cow  aggcc---tctgag--gagggcagctttttggactcagaag--ag--agctgcacgta---ggccgg---
B D                     Sheep  aggcc---tctgag--gagggcagcttcttggactcagaag--ag--agctgcacgta---ggccgg---
                Domestic goat  aggcc---tctgag--gagggcagcttcttggactcagaag--ag--agctgcacgta---ggctgg---
B D                     Horse  agccc----ttgag--gaaggcaacctcctgcactcagatg--ag--agctgcacatc---ggtcag---
B D          White rhinoceros  agccc---tttgag--gaaggcactctcttggactcagatg--ag--agctgcatgta---ggccag---
B D                       Cat  agcct---tccgag--gaaggc------------------------------------------------
B D                       Dog  agtcc---tttgag--gagggc------------------------------------------------
B D                   Ferret   agtcc---tctgag--gaaggc------------------------------------------------
B D                     Panda  agtcc---tctgag--gaaggc------------------------------------------------
               Pacific walrus  agccc---tcggag--gaaggc------------------------------------------------
                 Weddell seal  agtcc---tcggag--g-----------------------------------------------------
             Black flying-fox  agccc---tttgag--caaggc-agctcttggactcagatg--ag--agctgcacatg---gaccag---
B D                   Megabat  agccc---ttttag--caaggc-agctcttggactcagatg--ag--agctgcacatg---gaccag---
                Big brown bat  agccc---tttgag--gaaggc-agctcctggactcacatc--ag--agttgtacaca---ggccag---
         David's myotis (bat)  agccc---tttgag--gaaggc-agctcctggactcacact--gg--agttgtacaca---ggccag---
B D                  Microbat  agccc---tttgag--gaaggc-agctcctggactcacatt--ag--agttgtacaca---ggccag---
B D                  Hedgehog  gcccc---tttcag--gaaggcagtggccaggcctcacatg--ag--agctgcatgtg---aggcag---
B D                     Shrew  acccc---ggtcagccgcatgcaa-ggc--------aaatgcaaa--caccctacc-----cactag---
              Star-nosed mole  ----c---tcttagaggaaggcag-cgcgtggtgttagatg--ag--cactgtaccca---caccag---
B D                  Elephant  ggccc---cctgag--gagagcattttcttggactcagatg--ac--agcagcatatg---gg-------
          Cape elephant shrew  ggcct---caaagg--gagggcagcttcttggactc--ctg--ag--agctgcatgaa---ggctca---
B D                   Manatee  ggccc---ttt-----gagggcagcttcttgaacgcagatg--ag--agctgtatatg---ggctag---
             Cape golden mole  ggccc---tttgag--ggcagcagcttcttggcctcagat----g--agctgcatatg---ggccag---
B D                    Tenrec  ggccc---tcagag--gg--------------------------g--agctgcacaca---ggccaa---
                     Aardvark  -acac---tttgag--gagggcaacttcttggactcagatt--ag--agctgcatatg---gg-caa---
B D                 Armadillo  ggtcc---tctgag--gaaggcaa-ttcttggcctcagatt--ta--agctgc-cgtg---ggccag---
B D                   Opossum  gtcccttctttggg--taaattaagtgca------tagcca--ag--tgctgtacaca---gaacagagg
B D           Tasmanian devil  atctcctttttgga--taagttacttagacttatgtagcca--ggacacttgtactca---aaa------
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                  Bushbaby  ======================================================================

                        Human  -----------------gcagcccacct---tg--------gctccc------tgcagctc--tc-----
                        Chimp  -----------------gcagcccacct---tg--------gctccc------tgcagctc--tc-----
                      Gorilla  -----------------gtagcccacct---tg--------gctccc------tgcagctc--tc-----
                    Orangutan  -----------------gtagcccacct---tg--------gctcct------tgcagctc--tc-----
                       Gibbon  -----------------gtagcccacct---tg--------gctcct------tgcagctc--tc-----
                       Rhesus  -----------------gtagcccacct---tg--------gctcct------tgcagctc--tc-----
          Crab-eating macaque  -----------------gtagcccacct---tg--------gctcct------tgcagctc--tc-----
                       Baboon  -----------------gtagcccacct---tg--------gctcct------tgcagctc--tc-----
                 Green monkey  -----------------gtagcccacct---tg--------gctcct------tgcagctc--tc-----
                     Marmoset  -----------------gaatccctcct---tg--------gctcct------tgcggctc--tc-----
              Squirrel monkey  -----------------gaagccttcct---tg--------gctcct------tgtggctg--tc-----
           Chinese tree shrew  -----------------gtagtccaact---ca--------cctcct------tgcagc-c--cc-----
                     Squirrel  -----------------gc-------------------------agc------ttaactca--cg-----
       Lesser Egyptian jerboa  ---------------------------------------------ga------ccagcctc--ct-----
                 Prairie vole  ---------------------------------------------gt------taggtccc--ca-----
               Golden hamster  ---------------------------------------------gt------taggccct--ca-----
                        Mouse  --------------------------------------------cac------taggccct--ca-----
                          Rat  --------------------------------------------cac------tcggcctc--ca-----
               Naked mole-rat  -----------------gcagc----------------------ccc------tgcacctc--ct-----
                   Guinea pig  -----------------gcag-----------------------ccc------tgcccctc--ccggagt
                   Chinchilla  -----------------gcagc----------------------tct------tgcacctc--cc-----
             Brush-tailed rat  -----------------gcagg----------------------ctc------tgcacctc--cc-----
                       Rabbit  --------------------------------------------ccc------tggagccc--cc-----
                         Pika  --------------------------------------------cct------tgcagccc--ct-----
                          Pig  -----------------gcagcccaact---cacct-----cctcct------tgcagtcc--gc-----
                       Alpaca  -----------------acagcccaact---cacct-----cctcct------agcagccc---t-----
               Bactrian camel  -----------------acagcccaact---cacct-----cctcct------agtagccc---t-----
                      Dolphin  -----------------gcagcctaact---tacct-----cctcct------tgcagccc---t-----
                 Killer whale  -----------------gcagcctaact---tacct-----cctcct------tgcagccc---c-----
             Tibetan antelope  -----------------gcagcctaa--------------------------------------------
                          Cow  -----------------gcagcctaa--------------------------------------------
                        Sheep  -----------------gcagcctaa--------------------------------------------
                Domestic goat  -----------------gcagcctaa--------------------------------------------
                        Horse  -----------------gtagcccaact---cacct-----cctcct------tgcagcc----c-----
             White rhinoceros  -----------------gcagcccaact---ca--------cctcgt------tgcagcc----c-----
                          Cat  -------------------agctcaact---ta--------tttcct------cgaagcc----c-----
                          Dog  -------------------agcccaact---ca--------cctcct------cacagcc----c-----
                      Ferret   -------------------aacccaact---ca--------cctcct------cacagcc----c-----
                        Panda  -------------------agcccaact---ca-----------tct------cacagcc----c-----
               Pacific walrus  -------------------agcccaacc---ca--------cctcct------cacagcc----c-----
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  -----------------gcagcccaacttccct--------cctcct------cgcagcct---c-----
                      Megabat  -----------------gcagcccaacttccct--------cctcct------cgcagcct---c-----
                Big brown bat  -----------------gcagaccaact---tg--------cctcct------tgcagcc----c-----
         David's myotis (bat)  -----------------gcagaccagct---cg--------cctcct------tgcagcc----c-----
                     Microbat  -----------------gcagaccaact---cg--------cctcct------tgcagcc----c-----
                     Hedgehog  -----------------gcagttgaact---ta-ca-----tcttct------tcccagt----c-----
                        Shrew  -----------------agggcttgggc------------------------------------------
              Star-nosed mole  -----------------atggcccaatc---tc-ct-----cctcct------tgcagcc----c-----
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  -----------------gttccccaacc---ttcct------ctcgt------cctggtc----c-----
                      Manatee  -----------------gcaccccaact---cccct-----cctcct------tgcagtc----c-----
             Cape golden mole  -----------------ggaccccaact---ctcct-----cctcca------tggagtc----c-----
                       Tenrec  -----------------gcaccccaacctggctgct-----cctcct------tgcagtc----c-----
                     Aardvark  -----------------acaacccaacg---cccctgtcttcgccct------tgcaatc----c-----
                    Armadillo  -----------------gcaccccaact---tgtct-----cctccc------tgtagccg---t-----
                      Opossum  agtgctcatacaggtctgtag----tct---ct--------gctttc------ctcaatccaatc-----
              Tasmanian devil  -------acaaaggtctctagcctctct---ct--------gctttttcttcattcaacccaacc-----
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                     Bushbaby  ======================================================================

                        Human  -----------------------------------------------------c-ca-------------
                        Chimp  -----------------------------------------------------c-ca-------------
                      Gorilla  -----------------------------------------------------c-ca-------------
                    Orangutan  -----------------------------------------------------c-ca-------------
                       Gibbon  -----------------------------------------------------c-ca-------------
                       Rhesus  -----------------------------------------------------c-ca-------------
          Crab-eating macaque  -----------------------------------------------------c-ca-------------
                       Baboon  -----------------------------------------------------c-ca-------------
                 Green monkey  -----------------------------------------------------c-ca-------------
                     Marmoset  -----------------------------------------------------c-ca-------------
              Squirrel monkey  -----------------------------------------------------c-ca-------------
           Chinese tree shrew  -----------------------------------------------------c-ca-------------
                     Squirrel  -------------------------------------ttc------------tc-ca-------------
       Lesser Egyptian jerboa  ----------------------------------------------------tc-ct-------------
                 Prairie vole  -----------------------------------------------------c-ta-------------
               Golden hamster  ----------------------------------------------------gc-ta-------------
                        Mouse  -----------------------------------------------------c-tg-------------
                          Rat  ----------------------------------------------------cc-ta-------------
               Naked mole-rat  -------------------------------------tcctgcagcccccggag-ta-------------
                   Guinea pig  tgccaaaagggaagagccttggcatgagtttgacctttgtcacctcttccatcc-taccctaggagcggt
                   Chinchilla  -------------------------------------tcctacagccccaagac-ta-------------
             Brush-tailed rat  -------------------------------------tgctgcagcctcatccc-tg-------------
                       Rabbit  --------------------------------------------------------a-------------
                         Pika  --------------------------------------------------------a-------------
                          Pig  -----------------------------------------------------c-ca-------------
                       Alpaca  -----------------------------------------------------c-ca-------------
               Bactrian camel  -----------------------------------------------------c-ca-------------
                      Dolphin  -----------------------------------------------------c-ct-------------
                 Killer whale  -----------------------------------------------------c-ct-------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  -----------------------------------------------------ccca-------------
             White rhinoceros  -----------------------------------------------------ccca-------------
                          Cat  -----------------------------------------------------tgca-------------
                          Dog  -----------------------------------------------------c-ca-------------
                      Ferret   -----------------------------------------------------t-cg-------------
                        Panda  -----------------------------------------------------t-ca-------------
               Pacific walrus  -----------------------------------------------------t-ca-------------
                 Weddell seal  --------------------------------------------------------a-------------
             Black flying-fox  -----------------------------------------------------c-ca-------------
                      Megabat  -----------------------------------------------------c-ca-------------
                Big brown bat  -----------------------------------------------------c-ca-------------
         David's myotis (bat)  -----------------------------------------------------c-ca-------------
                     Microbat  -----------------------------------------------------c-ca-------------
                     Hedgehog  -----------------------------------------------------c-ca-------------
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  -----------------------------------------------------c-ct-------------
                     Elephant  -----------------------------------------------------c-ca-------------
          Cape elephant shrew  -----------------------------------------------------c-ca-------------
                      Manatee  -----------------------------------------------------c-ct-------------
             Cape golden mole  -----------------------------------------------------c-ga-------------
                       Tenrec  -----------------------------------------------------c----------------
                     Aardvark  -----------------------------------------------------g-ca-------------
                    Armadillo  -----------------------------------------------------t-ca-------------
                      Opossum  -----------------------------------------------------c-cc-------------
              Tasmanian devil  -----------------------------------------------------c-cc-------------
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                     Bushbaby  ======================================================================

                        Human  ------c-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
                        Chimp  ------c-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
                      Gorilla  ------c-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
                    Orangutan  ------c-agtaaggag-ctcacagctg-tcatca-----------agaggatggga-c-----------
                       Gibbon  ------c-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
                       Rhesus  ------g-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
          Crab-eating macaque  ------g-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
                       Baboon  ------g-agtaaggag-ctcacaactg-tcatga-----------agaggatggga-c-----------
                 Green monkey  ------g-agtaaggag-ctcacagctg-tcatga-----------agaggatggga-c-----------
                     Marmoset  ------g-actaaggag-ctcacagctg-tcataa-----------agaggatagaa-t-----------
              Squirrel monkey  ------g-actacggag-ctcacagctg-tcataa-----------agaggatggaa-c-----------
           Chinese tree shrew  ------g-actaaagag-ttgtcaac--------------------agaggatgggacc-----------
                     Squirrel  ------g-aataaggcg-ctcagagctg-tcaata----------aaaagtatggaa-c-----------
       Lesser Egyptian jerboa  ------a-actgaagtg-ctaatggctg-t---------------gagaagatgggaac-----------
                 Prairie vole  ------g-agtgtgatgcctattggc--------------------agaggatgggcac-----------
               Golden hamster  ------g-agtgtggtg-ctgtcggc--------------------agaggacaggcac-----------
                        Mouse  ------c-agtgtggtgcccgtcagc--------------------agacgatggga-c-----------
                          Rat  ------c-agtgctg--------------------------------gaccatgggc-c-----------
               Naked mole-rat  ------g-agctccacg-ctgtcctc--------------------ggcggctggtacc-----------
                   Guinea pig  ggtgacg-agctgtgtg-------ac--------------------agctgagggccgc-----------
                   Chinchilla  ------g-agc-------------ac--------------------ag----------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ------g-g-------------------------------------------------------------
                         Pika  ------g-gctgccaag-ctgtcact--------------------aag---------c-----------
                          Pig  ------g-gcctaagag-ctaagagcgg-tcagta----------gtgaggaagggaac-----------
                       Alpaca  ------g-gctgaagag-ctaacagttg-tcaaca----------gagaggaagggaac-----------
               Bactrian camel  ------g-gctgaagag-ctaacagttg-tcaata----------gagaggaagggaac-----------
                      Dolphin  ------g-gccaaaaag-ctaacagctg-tcaata----------gagaggaagggaac-----------
                 Killer whale  ------g-gccaaaaag-ctaacagctg-tcaata----------gagaggaagggaac-----------
             Tibetan antelope  ----------caaaaag-ccaatggctg-tcagca----------gagaggaagggaac-----------
                          Cow  ----------cgaaaag-ccaacggctg-tcaaca----------aggaagaagggaac-----------
                        Sheep  ----------caaaaag-ccaacggctg-tcaaca----------gagaggaagggaac-----------
                Domestic goat  ----------caaaaag-ccaacggctg-tcaaca----------gagaggaagggaac-----------
                        Horse  ------g-gctgaagag-ctaacagctt-tcaata----------aagagaatgggaac-----------
             White rhinoceros  ------g-gctgaagag-ctaacagcta-tcaata----------aagagaatgggaac-----------
                          Cat  ------g-ggtgaagag-ctgaaggcgg-tcaaca----------cagggctagggaac-----------
                          Dog  ------a-gctgaagag-cttaaggcta-tcaaca----------------acaggaac-----------
                      Ferret   ------a-gcc-aatgg-ctgacggctg-tcaaca----------cagggcatgggaac-----------
                        Panda  ------a-gctgaagag-ctgaaggctc-tcgaca----------cagggcatgggcac-----------
               Pacific walrus  ------a-gctgaagag-ctgagggcttgtcaaca----------cagggcatgggaac-----------
                 Weddell seal  ------a-gctgaagag-ctgagggcttgtcaaca----------cagggcatgggaac-----------
             Black flying-fox  ------g-gcccaaga--caaagagctg-tcaaaa----------aagaggatgggaac-----------
                      Megabat  ------g-gcccaaga--caa--agctg-tcaaaa----------aagaggatgggaac-----------
                Big brown bat  ------g-gcccaaga--ctaacagctg-tcaaaa----------cagagggtgggaac-----------
         David's myotis (bat)  ------g-gccccaga--cgaacagctg-tcaaaa----------cagagggtgggaac-----------
                     Microbat  ------g-gccccaga--ctaacagctg-tcaaaa----------cagagggtgggaac-----------
                     Hedgehog  ------a-gccgaaaac-ctgt---ttg-gc---------------------------------------
                        Shrew  --------gtggaggag-ctgccggctg-gc---------------------------------------
              Star-nosed mole  ------aggctgaagag-ttaacagctg-tcaaga----------aagaggctggaaac-----------
                     Elephant  ------g-gctaaaggg-caatcagctg-tcagtt----------aagaggatgggaac-----------
          Cape elephant shrew  ------g-gctaagggg-cgctcagctg-tc---t----------tagaaattgggaac-----------
                      Manatee  ------g-gctaaagag-caatcagctg-tc---a----------ataaagatgggaac-----------
             Cape golden mole  ------g-actaaaggg-catccagctg-tcaata----------aagaggacaggaac-----------
                       Tenrec  ---------------------ccagtta-gctgac----------aagagggt-----------------
                     Aardvark  ------g-gctaaa----caagccgctg-tcagta----------aagaggacaggaac-----------
                    Armadillo  ------g-gcagaagag-ccatcagctg-tc--ta----------tggaggacgggaac-----------
                      Opossum  ------t-agtgagaac-tc--aggcaa-ggatgatccccaggggaagaggaaggagacacatcaaactt
              Tasmanian devil  ------t-actcagaac-tcataggcag-ttagggtcctcagaagaaca-gatggggacacatcaaatta
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                     Bushbaby  ======================================================================

                        Human  ---ctg--------------------tttg-gc--ccatgaattc----------------aattg--ac
                        Chimp  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
                      Gorilla  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
                    Orangutan  ---ctg--------------------tttg-gc--ccacgaattccttt-------c----aattg--ac
                       Gibbon  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
                       Rhesus  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
          Crab-eating macaque  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
                       Baboon  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
                 Green monkey  ---ctg--------------------tttg-gc--ccatgaattccttt-------c----aattg--ac
                     Marmoset  ---ctg--------------------tttg-gc--ccatgaattccctc-------t----aattg--ac
              Squirrel monkey  ---ctg--------------------tttg-gc--ccatgaattacctc-------t----gactg--ac
           Chinese tree shrew  ---ctg--------------------ttgc-gt--cc---agctgcatt-------c----agtgg----
                     Squirrel  ---ctg--------------------ctta-gt--gcatgaactccatc-------c----agcgg-cac
       Lesser Egyptian jerboa  ---ctg--------------------tttg-gc--acatgaacccactc-------c----agctg-cac
                 Prairie vole  ---ctg--------------------tgtgtgc--acatggacccactc-------c----agt---ggc
               Golden hamster  ---ctg--------------------tgtg-ga--acatggatccactc-------c----agt---cac
                        Mouse  ---ctg--------------------tgtg-gc--acatggacctgccc-------c----aggtc-cac
                          Rat  ---ctg--------------------cgtg-gc--ac-tga--------------------------cac
               Naked mole-rat  ---ctgtgg-----------------caca-ga--ctcccc---------------c----agttg-cac
                   Guinea pig  ---ctggaggctgacacctggcccagcgct-gt--ccttgg---------------c----ggcca-cac
                   Chinchilla  --------------------------tgct-gt--tcttgg---------------c----agcgggaac
             Brush-tailed rat  -------------------------------gt--ccctgg---------------c----agttagaac
                       Rabbit  -------------------------------gc--ct-------ccctc-------c----agctg-cat
                         Pika  ---atg--------------------cat--gc--ctgtga---cccccacctacac----aggtg-cat
                          Pig  ---ctg--------------------tctg-gc--ccatgaattccact----------------g-cat
                       Alpaca  ---ctg--------------------ttag-gc--ctgtgaactccact----------------g-ctt
               Bactrian camel  ---ctg--------------------ttag-gc--ctgtgaactccact----------------g-ctt
                      Dolphin  ---ctg--------------------tttg-gc--ccgtgaactcccct-------------gttg-cat
                 Killer whale  ---ctg--------------------tttg-gc--ccgtgaactcccct-------------gttg-cat
             Tibetan antelope  ---ctg--------------------tgtg-g---ccgtgagctccgct-------c-----gatg-cgc
                          Cow  ---ctg--------------------tgtg-g---ccgtgagctccgct-------c-----ggtg-cgc
                        Sheep  ---ctg--------------------tgtg-g---ctgtgagctccgat-------c-----gatg-cgc
                Domestic goat  ---ctg--------------------tgtg-g---ccatgagctccgct-------c-----gatg-tgt
                        Horse  ---ctg--------------------tttg-gc--ccacgaactccctc-------c----agtta-cat
             White rhinoceros  ---ctg--------------------tttg-gc--ccatgaactccctc-------c----agttg-cat
                          Cat  ---cat--------------------ctt-----------------------------------------
                          Dog  ---cca--------------------tttg-gc--ccagaaact---tc-------t----ggtgg-cag
                      Ferret   ---cca--------------------cttg-gc--ccagaaacttcctc-------t----ggtgg-cat
                        Panda  ---cca--------------------cttg-gc--ctgggaatgtcctc-------t----ggtgg-cgt
               Pacific walrus  ---cca--------------------cttg-gc--ccagaaacttcctc-------t----ggtgg-cat
                 Weddell seal  ---cca--------------------cttg-gc--ccggaaacttcgtc-------t----ggtgg-cat
             Black flying-fox  ---ctg--------------------tttg-gc--ccatgaactccctc-------cctcaagttg-cat
                      Megabat  ---ctg--------------------tttg-gc--ccatgaactccctc-------cctcaagttg-cat
                Big brown bat  ---ctg--------------------ttca-gc--ccacaaactccctt-------c----agttg-tgt
         David's myotis (bat)  ---ctg--------------------ttca-gc--ccatgaactccctt-------c----agttg-cat
                     Microbat  ---ctg--------------------ttca-gc--ccatgaactccctt-------c----agttg-cat
                     Hedgehog  -----------------------------------cc--gagttccctc-------t----ggctg-aat
                        Shrew  -----------------------------------ccaggaactcacc--------------gctg-tat
              Star-nosed mole  ---ctg--------------------tttg-g---tcaacaactccctt-------t----ggttg-tat
                     Elephant  ---ctg--------------------tg-g-gg--gcatgatcaccctc-------c----aattg-cat
          Cape elephant shrew  ---ctg--------------------t----gg--ccaggattgccttc-------c----aattg-cgt
                      Manatee  ---ctg--------------------tg-a-gg--ccatgaaggccctc-------c----agtta-cat
             Cape golden mole  ---cta--------------------a----gg--ttgtggacaccctc-------c----a------at
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ---cta--------------------tg-g-gg--ccatgatcaccctc-------c----aattg-tgt
                    Armadillo  ---c-------------------------------------------tc-------c----aattg-tat
                      Opossum  catcct--------------------cttg-gtacccatgcatt--------------------------
              Tasmanian devil  catcct--------------------tttg-gcagccatgtatt--------------------------
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                     Bushbaby  ======================================================================

Alignment block 2 of 861 in window, 43671348 - 43671431, 84 bps 
B D                     Human  tcatt-----ggcc-ccatcacaagagatcagtga--ctcaat------gc-----tcagcaccca--gc
B D                     Chimp  tcatt-----ggcc-caatcacaagagatcagtga--ctcaat------gc-----tcagcaccca--gc
B D                   Gorilla  tcatt-----ggcc-ccatcacaagagatcagtga--ctgaat------gc-----tcagcaccca--gc
B D                 Orangutan  tcatt-----ggcc-ccatcacaagagatgagtga--ctcagt------gc-----tcagcaccca--gc
B D                    Gibbon  tcatt-----ggcc-ccatcacaagagatcagtga--ctcaat------gc-----tcagcaccca--gc
B D                    Rhesus  tcatt-----ggcc-ccatcacaagagatcagtga--ctcaac------ac-----tctgcaccga--ac
B D       Crab-eating macaque  tcatt-----ggcc-ccatcacaagagatcagtga--ctcaac------ac-----tctgcaccga--ac
B D                    Baboon  tcatt-----ggcc-ccatcacaagagatcagtga--ctcaac------ac-----tctgcaccga--ac
B D              Green monkey  tcatt-----ggtc-ccatcacaagagatcagtga--ctcaac------a-------ctgcaccga--ac
B D                  Marmoset  tcatt-----ggcc-ccaccacaagagatcagtga--ctcagt------gc-----tcagcaccca--gc
B D           Squirrel monkey  tcatt-----ggcc-ccatcacaagagatcagtga--ctcaat------gc-----t-------ca--gc
B D                  Bushbaby  tcatg-----tggc-ccaccacaagagatgagc----ctcagt------ac-----tcagcaatca--gc
           Chinese tree shrew  -------------c-ccacggca---------ttg--ctccgt------gt-----tcagcagcca--gc
B D                  Squirrel  tccag-----tggt-ccattgtaagggcttagtgg--cttgat------gc-----tcagcaacca--ga
       Lesser Egyptian jerboa  tcaca-----tggc-ccacccaaacagccaagtga--ctcaga------ac-----tcagcatgtg--gc
                 Prairie vole  agata-----ggg--ccatccag--agatgagcag--cttcgc------at-----tctgaagtgt----
               Golden hamster  agaaa-----gggc-ccactcag--aggccagcag--cgccat------ac-----acaagacagt----
B D                     Mouse  tgaca-----gggc-cca---------ttaggcag--ttccct------ac-----tatgcacag-----
B D                       Rat  tgaca-----gggc-cca---------ataagcag--gtccgc------ac-----gctgcacgg-----
B D            Naked mole-rat  cct-------tgcc-cctgccaa---------------------------------cctggccacc----
B D                Guinea pig  tctgtggcacagac--cccctag----------------ctgt------acctgtgctggggctcct-gc
                   Chinchilla  cgtgtggc--agac-tttcccag----------------tggt------ac-----ccagggcccc----
             Brush-tailed rat  cctgcagca-agac-tcccccag----------------ttct------cc-----ccaggccccc----
B D                    Rabbit  cacat-----ggcctccgcgc------------------tggc------gc-----tcagcac------c
B D                      Pika  cacgt-----ggcc-cagcacga--------ggga--tgtggg------ac-----tcagagctcagaat
B D                       Pig  tcacg-----tggc-ccatcgcaaaagatgagcga--ttc--t------gc-----tcagtaactt--gc
B D                    Alpaca  ccacg-----tggc-ccatcacaagaggtcagtga--ctcaat------gc-----tcagcaactg--gc
               Bactrian camel  ccacg-----tggc-ccatcacaagaggtcagtga--ctcaat------gc-----tcagcaattg--gc
B D                   Dolphin  tcaca-----tggc-ccatcacaagagatcagtga--cttaat------gc-----tcagtaactg--gc
                 Killer whale  tcacg-----tggc-ccatcacaagagatcagtga--cttaat------gc-----tcagtaactg--gc
             Tibetan antelope  ccacg-----tggc-ccaccacccgagcccggtga--ctcaat------gt-----gcagtgactg--gc
B D                       Cow  ccacg-----tggc-ccaccaccagagcccagtga--ctcaat------gc-----gcagtgactg--gc
B D                     Sheep  ccacg-----tggc-ccaccaccagagcccggtga--ctcaat------gc-----gcagtgactg--gc
                Domestic goat  ccacg-----tggc-ccaccaccagagcccggtga--ctcaat------gc-----gcagtgactg--gc
B D                     Horse  tcatg-----tagt-ccatcacaaga-----------------------gc-----tctgtaactg--gc
B D          White rhinoceros  tcata-----tagc-ccatcacaaga-----------------------gc-----tcagcaactg--gc
B D                       Cat  -----------ggc-ctatcacaagggattagtga--ctcgac------gt-----tcagtaactg--gc
B D                       Dog  tcata-----tggc-ctattacaaaagattaggga--ctcaat------gc-----tcaagaactg--gc
B D                   Ferret   tcatg-----cggc-ctatccca--agctgagtga--ctcagt------gc-----tcaagaactg--gc
B D                     Panda  tcatg-----tggc-ctatcacaagagatgagtga--ctcggg------gc-----tcaagaactg--gc
               Pacific walrus  tcatg-----tggc-ctatcacaagagatgagtga--ctcagt------gc-----tcaagaactg--gc
                 Weddell seal  tcatg-----tggc-ctatcacaagagatgagtga--ctcagt------gc-----tcaagaactg--gc
             Black flying-fox  tcatg-----tggc-ccatcat-agagatcaatga--ctcaaa------gt-----tcggtaactg--gc
B D                   Megabat  tcatg-----tggc-ccatcac-agggatcaatga--ctcaaa------gt-----tcagtaactg--gc
                Big brown bat  t-atg-----tagc-ccagcacaagagatcggtgactct----------gc-----tcagtaactg--gc
         David's myotis (bat)  t-atg-----cagc-ccagcac--gagatcagtga--ct----------gc-----tcagaaactg--gc
B D                  Microbat  t-atg-----cagc-ccagcac--gagttcagtga--ct----------gc-----tcagtaactg--gc
B D                  Hedgehog  tcacg-----tggc-cc-----agcagattggtga--ctcaat------gt-----t-aataactg--tc
B D                     Shrew  ccagg-----ggac-cc-tcgcaggaagttaacca--cc--------------------agaactg--gc
              Star-nosed mole  tcatg-----cagc-ccatcacaagaaattaatga--ctcaat------gc-----t-agtaatca--gt
B D                  Elephant  tcaca-----tggc-ccttcaaaacaga-tgagtg--tctaat------gc-----tcggcaactg--gc
          Cape elephant shrew  ttgtg-----tggt-cccttcaaaaggg-gaacag--ctgagt------gc-----ttaggaacta--gc
B D                   Manatee  tcaca-----cggc-ccttcacaagaga-tgagtga-ctctat------gc-----tcagcaaccg--gc
             Cape golden mole  tcatg-----tggc-ccttcacaaggga-cagtga--ctt--t------gt-----tcagaagtca--gc
B D                    Tenrec  ------------gt-ccctcacaagaca-cacaga--------------gc-----tcagcaattg--gc
                     Aardvark  t-atg-----tggc-ccttcatgagacg--agcaa--cccagt------gc-----tcagcaaccg--gc
B D                 Armadillo  ttctg-----tgac-ttgtcacaaaagattagcaa--ctctgt------gc-----tcagcaactg--gc
B D                   Opossum  ------------gt-caattacaggatatcatttg--cattatttcccaag-----tctccaagca--ac
B D           Tasmanian devil  ------------at-caattacaggatatcaatcc--cattattttccaag-----tctccaagct--gc
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================

                        Human  tggcaat--------gtgcccag------g-------ac----------ccc-ct-----g-cacttc-c
                        Chimp  tggcaat--------gtgcccag------g-------ac----------ccc-ct-----g-cacttc-c
                      Gorilla  tggcaat--------gtgcccag------g-------ac----------ccc-ct-----g-cacttc-c
                    Orangutan  tggaaat--------gtgcccag------g-------a-----------ccc-ct-----g-cacttc-c
                       Gibbon  tggaaat--------gtgcccag------g-------ac----------ccc-ct-----g-cacttc-c
                       Rhesus  tggaaat--------gtgcccag------a-------ac----------ccc-ct-----g-cacttc-c
          Crab-eating macaque  tggaaat--------gtgcccag------a-------ac----------ccc-ct-----g-cacttc-c
                       Baboon  tggaaat--------gtgcccag------a-------ac----------ccc-ct-----g-cacttc-c
                 Green monkey  tggaaat--------gtgcccag------a-------ac----------ccc-ct-----g-cacttc-c
                     Marmoset  ctgaaat--------gtgcccag------g-------tg----------ccc-ct-----g-cacttc-c
              Squirrel monkey  ctgaaat--------gtgcccag------g-------tg----------tcc-ct-----g-cacctc-c
                     Bushbaby  cagaaat--------gtgtccag------g-------cc----------ccc-c--------aacttc-c
           Chinese tree shrew  tgggact--------gtgcccag------g--------c----------ccc-ag-----g-tactt--c
                     Squirrel  tggtaac--------atgctcag------g-------ct----------ccc----------agacttcc
       Lesser Egyptian jerboa  tggagac--------gggcgcac--------------gc----------ctc----------cctttt-c
                 Prairie vole  -------------------------------------gc----------ccc----------acactt-c
               Golden hamster  -----------------cagcac------g-------gg----------ccc----------acactt-c
                        Mouse  -------------------------------------gc----------ccc----------acattt-c
                          Rat  -------------------------------------gc----------ccc----------acactt-c
               Naked mole-rat  ----------------agccca---------------gc----------ccc----------cagttc-c
                   Guinea pig  cagcccc--------tagcctg---------------g-----------ctc----------cccttc-c
                   Chinchilla  --------------------------------------------------------------tacctc-c
             Brush-tailed rat  --------------------------------------------------ct----------cacttc-c
                       Rabbit  cagctgc--------gaatgcc---------------cg----------ccc----------ccatgc-c
                         Pika  cagctgc--------aaatgcc---------------tg----------ccc----------ccacac-c
                          Pig  tggaagc--------gagcc-aa------g-------ct----------ccc-c------a-cacttc-c
                       Alpaca  caggaat--------gggcc-aa------g-------cc----------ccc-c------g-c-ctat-c
               Bactrian camel  caggaat--------gggcc-aa------g-------cc----------ccc-c------g-c-ctat-c
                      Dolphin  cggaaac--------gggtt-ga------g-------cc----------ccc-c------g-cacttc-c
                 Killer whale  cggaaac--------gggtt-ga------g-------cc----------ccc-c------g-cacttc-c
             Tibetan antelope  cagaaac--------gggct-ga------g-------cc----------ccc-c------g-cgctcc-c
                          Cow  cagaaac--------gggct-ga------g-------cc----------ccc-c------g-cgctcc-c
                        Sheep  cagaaac--------gggct-ga------g-------cc----------ccc-c------g-cgctcc-c
                Domestic goat  cagaaac--------gggct-ga------g-------cc----------ccc-c------g-cgctcc-c
                        Horse  ctgaaat--------gggctcaaaccactg-------cc----------acc-ccccaaca-cccttc-c
             White rhinoceros  tggaaat--------gggctcaa------g-------gc----------acc-cccca--c-cccttc-c
                          Cat  tagaaat--------gggttcaa------g-------gc----------ccc-t------g-cacttc-c
                          Dog  tagaaat--------gggctgaa------g-------cc----------ccc-t------g-tacttc-a
                      Ferret   tagaaag--------gggctcaa------g-------cc----------tcc-t------g-cacttc-t
                        Panda  tagaaac--------gggctcaa------g-------cc----------ccc-t------g-cacttg-c
               Pacific walrus  tag-aac--------gggctcaa------g-------cc----------ccc-t------g-tacttc-c
                 Weddell seal  tagaaat--------gggctcaa------g-------cc----------ccc-t------g-cacttc-c
             Black flying-fox  tgaaaat--------gagcccaa------g-------ct----------ccc-c------a-cacttg-c
                      Megabat  tgaaaat--------gagcccaa------g-------ct----------ccc-c------a-cacttg-c
                Big brown bat  cggaaac--------aggcccaa------g-------cc----------c-------------------c
         David's myotis (bat)  cggaaac--------gggcccaa------g-------cc----------c-------------------c
                     Microbat  cggaaac--------aggcccaa------g-------cc----------c-------------------c
                     Hedgehog  cggaaac--------tggcccaa------g-------cc----------ccctc------gctgcttc-c
                        Shrew  cggaagt--------agcccaga------g-------ac----------ccc-t------gtcccccc-c
              Star-nosed mole  cagaaac--------caccccca------g-------ct----------ccc-c------g-cacttc-c
                     Elephant  cggcaat--------gggcccaa------g-------cc----------ccc--------a-caccc--c
          Cape elephant shrew  tagaaat--------gggctgca------gttcttctca----------cct--------t-ccctt--c
                      Manatee  cagaaat--------gggcccaa------a-------gc----------ccc--------a-caccc--c
             Cape golden mole  tataaac--------aggaccaa------a-----------------------------------gc--c
                       Tenrec  tccaaat--------gggttcga------a--------t----------tgt--------a-ccctt--c
                     Aardvark  aggaaat--------ggaccccc------a-------ac----------ccc--------a-caccca-c
                    Armadillo  tggaaa---------aggcccag------g-------cc----------ccc--------a-cacttc-c
                      Opossum  ttgatct-----tgagggttgag------t-------aacctttacccccct-c------c-tctccc-c
              Tasmanian devil  acgatatgaaggtgaagatccag------t-------aa----------cct-c------c-agtttc-t
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================

                        Human  caag
                        Chimp  caag
                      Gorilla  caag
                    Orangutan  caag
                       Gibbon  caag
                       Rhesus  cagg
          Crab-eating macaque  cagg
                       Baboon  caag
                 Green monkey  caag
                     Marmoset  caaa
              Squirrel monkey  caag
                     Bushbaby  caag
           Chinese tree shrew  gaag
                     Squirrel  caag
       Lesser Egyptian jerboa  caag
                 Prairie vole  taag
               Golden hamster  caag
                        Mouse  taag
                          Rat  taag
               Naked mole-rat  taag
                   Guinea pig  ccag
                   Chinchilla  ccag
             Brush-tailed rat  ccag
                       Rabbit  cggg
                         Pika  ----
                          Pig  cagg
                       Alpaca  caag
               Bactrian camel  caag
                      Dolphin  caag
                 Killer whale  caag
             Tibetan antelope  caag
                          Cow  caag
                        Sheep  caag
                Domestic goat  caag
                        Horse  caag
             White rhinoceros  caag
                          Cat  cagg
                          Dog  cagg
                      Ferret   cagg
                        Panda  cagg
               Pacific walrus  cagg
                 Weddell seal  cagg
             Black flying-fox  caag
                      Megabat  caag
                Big brown bat  caag
         David's myotis (bat)  cacg
                     Microbat  cacg
                     Hedgehog  caag
                        Shrew  cttg
              Star-nosed mole  caag
                     Elephant  caag
          Cape elephant shrew  caaa
                      Manatee  ccaa
             Cape golden mole  caag
                       Tenrec  caag
                     Aardvark  caag
                    Armadillo  ccaa
                      Opossum  cca-
              Tasmanian devil  gaag
                 Atlantic cod  ====
                  Spotted gar  ====
           Southern platyfish  ====
                    Zebrafish  ====
                  Stickleback  ====
                       Medaka  ====
          Pundamilia nyererei  ====
                  Zebra mbuna  ====
        Burton's mouthbreeder  ====
          Princess of Burundi  ====
                 Nile tilapia  ====
                   Coelacanth  ====
                       Lizard  ====
     Chinese softshell turtle  ====
               Painted turtle  ====
              Green seaturtle  ====
                       Turkey  ====
                      Chicken  ====
                 Mallard duck  ====
                Scarlet macaw  ====
                       Parrot  ====
                   Budgerigar  ====
           Tibetan ground jay  ====
                  Zebra finch  ====
          Medium ground finch  ====
       White-throated sparrow  ====
          Collared flycatcher  ====
             Peregrine falcon  ====
                 Saker falcon  ====
                  Rock pigeon  ====
                     Platypus  ====
                      Wallaby  ====
           American alligator  ====

Alignment block 3 of 861 in window, 43671432 - 43671644, 213 bps 
B D                     Human  cag----tga------------------gcgcac----ac--ccaa-----tggg-taagcccatgaacc
B D                     Chimp  cag----tga------------------gcacac----ac--ccaa-----tggg-taagcccacgaacc
B D                   Gorilla  cag----tga------------------gcgcac----ac--ccaa-----tggg-taagcccacgaacc
B D                 Orangutan  cag----tga------------------gcacac----ac--ccag-----tggg-taagccc-cgaacc
B D                    Gibbon  cag----tga------------------gcacac----ac--tcac-----tggg-taagcccacgaacc
B D                    Rhesus  cag----tga------------------gcacac----ac--ccag-----tggg-taagcccacgagcc
B D       Crab-eating macaque  cag----tga------------------gcacac----ac--ccag-----tggg-taagcccacgagcc
B D                    Baboon  cag----tga------------------gcacac----ac--ccag-----tggg-taagcccacgagcc
B D              Green monkey  cag----tga------------------gcacac----ac--ccag-----tggg-taagcctacgagcc
B D                  Marmoset  caa----tga------------------gcacac----at--ccag-----tggg-taagcccatgagcc
B D           Squirrel monkey  cag----tga------------------gcacac----at--ccag-----cggg-taagcccatgagcc
B D                  Bushbaby  cac----tga------------------gcaca----------cag-----tagg-taagcccatgaacc
           Chinese tree shrew  cag----tga------------------gcacac----ac--ctagcaggtcagg-taagcccacaggcc
B D                  Squirrel  cag----caa------------------gcacac----ac--tcag-----aagg-taag-tccgtggtc
       Lesser Egyptian jerboa  cagcacacac------------------ccacaa------------------ggg-aagc-ctgggagct
                 Prairie vole  cag----tga------------------ccacac------------------tgg-gaag-ccgagagcc
               Golden hamster  cag----tga------------------ccacac------------------ggg-gaag-ccgagag-c
B D                     Mouse  cac----tga------------------ccacac------------------ggg-gaag-ccaagagcc
B D                       Rat  cac----tga------------------ccacat------------------ggg-gagg-ccaagagcc
B D            Naked mole-rat  cag----aga------------------gcacgc----ac--ccag-----ccgg-aagg-ccaggaacc
B D                Guinea pig  gag----aca------------------gcatgcaccaca--cagg-----cgga-gaag-ccatgagcc
                   Chinchilla  cag----aga------------------gcacac----cg--tcag-----cggg-aagg-ccgtgagcc
             Brush-tailed rat  cag----aaa------------------gcacac----ag--ccgg-----tcag-aagg-ctataaggc
B D                    Rabbit  cag----tga------------------atacgc----ac--ccag-----cggg-caagtccagctgcc
B D                      Pika  cag----tgaacacacacacacacacacacacac----ac--acag-----tggg-gaagcccacctgcc
B D                       Pig  caa----tga------------------gcgcac----ac--ccgg-----tggg-aggg--taagagcc
B D                    Alpaca  cag----tga------------------gcacac----ac--ccag-----tggg-cgag--tacgagcc
               Bactrian camel  cag----tga------------------gcacac----ac--ccag-----tggg-caag--tacgagcc
B D                   Dolphin  cag----tgg------------------gcgcac----ac--ccag-----tggg-tgag--tacaagcc
                 Killer whale  cag----tgg------------------gcgcac----ac--ccag-----tggg-tgag--tacaagcc
             Tibetan antelope  cag----tga------------------gcacac----ac--ccag-----cgag-ggag--cacaagcc
B D                       Cow  cag----tga------------------gcacac----ac--ccag-----cggg-ggag--cacaagcc
B D                     Sheep  cag----tga------------------gcacac----ac--ccag-----cggg-ggag--cacaagcc
                Domestic goat  cag----tga------------------gcacac----ac--ccag-----cggg-ggag--cacaagcc
B D                     Horse  caa----tga------------------gcacac----acacccag-----tggg-tgactacatgagcc
B D          White rhinoceros  cag----tga------------------gcacac----acacccag-----tggg-tgagtacatgagcc
B D                       Cat  cag----tga------------------gcacac----ataaccag-----tggt-ggagtccatgagcc
B D                       Dog  cag----tga------------------acacac----ac--c-aa-----cagc-agagtccatgagct
B D                   Ferret   cag----taa------------------gtacac----ac--cgac-----cagc-acagtccatgaacc
B D                     Panda  cag----taa------------------gcacac----ac--ccag-----tggc-agagtccgagagcc
               Pacific walrus  cag----taa------------------gcacac----ac--ccag-----tggc-agagtctaagagcc
                 Weddell seal  cag----caa------------------gcacac----ac--ccag-----tggcaagagtccatgagcc
             Black flying-fox  cag----gga------------------atatgc----ac--ccag-----tggg-tgag-acgtgagcc
B D                   Megabat  cag----gga------------------atatgc----ac--ccag-----tggg-tgag-acgtgagcc
                Big brown bat  cag----tga------------------gcacac----at--ccag-----tggg-tgaa-acacgagcc
         David's myotis (bat)  cag----tga------------------gcacac----at--ccag-----tggg-tgaa-acatgagcc
B D                  Microbat  cag----tga------------------gcacac----at--ccag-----tggg-tgaa-acatgagcc
B D                  Hedgehog  cta----tga------------------gcacac----ag--ccag-----tgag-tgagtatataagcc
B D                     Shrew  cag----tga------------------gcacac----ac--ccac-----agca---agttcggaaggc
              Star-nosed mole  cag----cga----------------gcgcacac----ac--ccca-----agga-gcagcacatgagcc
B D                  Elephant  caa----tga------------------gcacac----ac--tcac-----tggg-taagcacatgagcc
          Cape elephant shrew  ca------ga------------------gtgcac----ac--tcag-----taga-tacaaagatgagcc
B D                   Manatee  gaa---gtga------------------gcacac----ac--ccag-----tggg-taaacacatgagcc
             Cape golden mole  ca-----ttg------------------acacat----ac--ccac-----tggg-taaacacataaacc
B D                    Tenrec  cag----tca------------------gcaca-----ac--ccag-----tgag-taaccacacaagcc
                     Aardvark  cag----tga------------------gcacac----ac--ccag-----tggg-taagtacatgagct
B D                 Armadillo  cag----tgc------------------acatac----ac--ccag-----tggg-taagcatgagagcc
B D                   Opossum  --------aa------------------gcacac----ac--caaa-----tagg-ttagcaaataggtc
B D           Tasmanian devil  aag----caa------------------gcatac----ac--caag-----tagt-ttagcaaacatgtc
B D                  Platypus  cag----aac------------------acacac----gg--cgga-----ggag-ggagcgcaggagag
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================

                        Human  -ca---------gttta-t----g----acactg-cgttgggcaaaactcctgt-cc-ccagca-c--tg
                        Chimp  -ca---------gttta-t----g----acactg-cgttgggcaaaactcctgt-cc-ccagca-c--tg
                      Gorilla  -ca---------gttta-t----g----acactg-cattgggcaaaactcctgt-cc-ccagca-c--tg
                    Orangutan  -ca---------gttga-t----g----acactg-cattgggcaaaactcttgt-cc-ccagca-c--tg
                       Gibbon  -ca---------gttta-t----g----acactg-cattgggcaaaactcctgt-cc-ccagca-c--tg
                       Rhesus  -ca-aactcaatgttta-t----g----acattg-tattgggaaaaactcctgt-cc-ccagca-c--tg
          Crab-eating macaque  -cacaactcaatgttta-t----g----acattg-tattgggaaaaactcctgt-cc-ccagca-c--tg
                       Baboon  -cacaactcaatgttta-t----g----acattg-tattgggaaaaactcctgt-cc-ccagca-c--tg
                 Green monkey  -cacaactgaatgttta-t----g----acactg-tattgggaaaaactcctgt-cc-ccagca-c--tg
                     Marmoset  -ta---------cttta-t----g----acattt-cattgggcaaaactcctgt-cc-tcagca-c--tg
              Squirrel monkey  -ta---------cttta-t----g----acattc-cattgggcagaactcctgt-cc-ccagca-c--tg
                     Bushbaby  -at---------gttta-t----gacatacattc-ctttgggcaaaactcctgt-cc-ct-gag-c--ag
           Chinese tree shrew  -t----------ggtta-t----g----acattc-cttagggcaaaactcttgt-ccgccagcc-c--ca
                     Squirrel  -gg---------gttta-t----g----acattg-cttctggcaaaactcctgtgcc-ccagca-c--tg
       Lesser Egyptian jerboa  -tg---------cttta-t----c----acatct-cctcaggtaga--------act-cctgcg-c--cg
                 Prairie vole  -tg---------cttta-t----t----accttt-ctttgtgtaaggctcc--tgcc-ctcgca-c--ag
               Golden hamster  -tg---------cttca-t----------ccatt-ctatgcgtaagactcc--tgtc-cttgcc-c--cc
                        Mouse  -tg---------cttta-t----t----acattg-ccttgggtaaggctcc--cgtc-cctgct-c--ca
                          Rat  -tg---------ctttatt----t----atattt-ccttgggtaag--------ttt-cctgct-c--cg
               Naked mole-rat  -tg---------gttta-tgaaca----acactt-gttggggtgaaactga----tg-ctggca-c--ca
                   Guinea pig  -tg---------gttta-taaatg----actgtc-cctagggtgaaactgc----cc-ttagca-c--tg
                   Chinchilla  -tg---------gctga-tgaatg----acaatc-cttagagtgaaactgt----cc-ctagta-c--tg
             Brush-tailed rat  -tg---------gttta-tgaatg----acactc-cttagagtaaaactgt----cc-ccagaa-c--ag
                       Rabbit  -tg---------gttta-t----g----atcttc-cttcaggcaaacctcttgcccc-cca-tg-c--tg
                         Pika  -tg---------gttta-t----g----atgttc-ctttaggcaagccccttgtccc-tcagca-c--tg
                          Pig  ttg---------tttta-t----a----agattc-ctttgggccaagctcccacccg-tcagcg-c--tg
                       Alpaca  -tg---------gttta-t----a----atattc-ctctgggcaaaactcctgtccc-ctggca-c--tg
               Bactrian camel  -tg---------gttta-t----a----atat----tctaggcaaaactcctgtccc-ctggca-c--tg
                      Dolphin  -tg---------gttta-t----a----acattc-ctgtgggaaaagctcctgtcca-ccagca-a--tg
                 Killer whale  -tg---------gttta-t----a----acattc-ctgtgggcaaagctcctgtcca-ccagca-a--tg
             Tibetan antelope  -tg---------gttta-t----a----atagtc-cttcagacaaagggccggtgcc-ccagcc-c--tg
                          Cow  -tg---------gttta-t----a----atattc-ctctggacaaagggccagtgcc-ccagcc-c--tg
                        Sheep  -ag---------gttta-t----a----acattc-cttcagacaaagggccggtgcc-ccagcc-c--tg
                Domestic goat  -tg---------gttta-t----a----atattc-cttcagacaaagggccggtgcc-ccagcc-c--tg
                        Horse  -tg---------gttta-t----g----acattc-ctttgggcaaaaatcctgtccc-ccagca-c--tg
             White rhinoceros  -tg---------gttta-t----g----acattc-ctttgggcaaaactcgtgtccc-ccagca-c--tg
                          Cat  -tg---------gttta-t----g----atatgcttttttgggagaact---------------------
                          Dog  -tg---------gttta-t----g----aaattc-ctttgcagacaactcctatccc-tcagca-c--tg
                      Ferret   -tg---------gttta-t----g----acattc-ttttggggagagttcctatgcc-ccagca-c--ga
                        Panda  -tg---------gttta-t----g----atgctc-ctttggggagagctcctggtgc-ccagca-c--ta
               Pacific walrus  -tg---------gttga-t----g----actttc-ctttggggagaactcctgttcc-ccagca-c--ta
                 Weddell seal  -tg---------gttta-t----g----a------cattggggagaactcctgttcc-cccgca-c--tg
             Black flying-fox  -tg---------gttta-t----g----acattc-ctttgggcaaaacccctgtccc-ccagca-c--tg
                      Megabat  -tg---------gttta-t----g----acattc-ctttgggcaaaacccctgtccc-ccagca-c--tg
                Big brown bat  -tg---------gttta-t----g----acattc-tgttgagcaaaactcctgtccc-ctagca-c--ag
         David's myotis (bat)  -tg---------gttta-t----g----acattc--gttgagcaaaactcctgtccc-ctagca-c--ag
                     Microbat  -tg---------gttta-t----g----acattc--gttgagcaaaactcctgtccc-ctagca-c--ag
                     Hedgehog  -tg---------gttta-t----g----acatta--tttgggtaaaa---cgatccc-tcagca-c--ca
                        Shrew  -ta---------gttta-t----a------agcg-cctggggcaaga---ctgt-cc-tccgca-c--cg
              Star-nosed mole  -tg---------gttta-t----g----acactc-ctttgggcaaaa---ttgt-cc-tctg--------
                     Elephant  -tg---------gttta-t----g----acattc-c-tcaggcaaaact---gtccc-ccagcc-c--tg
          Cape elephant shrew  -tg---------gttta-t----g----acgttc-c-acaggcaaaa-t---gtccc-ctacccga--gg
                      Manatee  -tg---------gttta-t----g----acactc-c-tcaggcaaaact---gtccc-ccggcc-c--tg
             Cape golden mole  -tg---------gttta-t----a----acattt-c-tctggcaaaact---gttcc-ccagcc-c--tg
                       Tenrec  -tg---------gttta-t----g----aca------tcaggcacagct----tccc-cctccc-c--cg
                     Aardvark  -tg---------gttta-t----g----acaatc-t-tcaggcaaaact---gtccc-ctagcc-c--tg
                    Armadillo  -tg---------cttta-t----g----acactt-c-ctgggctaaact-------c-ctgtcc-c--cc
                      Opossum  tta---------tttta-t----g----actttt-c-ttgggtaatatac-tac-ct---gact-c----
              Tasmanian devil  ttg---------tttta-t----g----acattt-c-ttgggtaatatttatat-ct-tcaact-caaag
                     Platypus  -ag---------cttta-t----g----acggtc-c-tcgggtgagacttccgtccc-ccaatc-c--ca
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================

                        Human  ag------catggcctaa----------gcc-------------c-catagcagctggcaagggaccca-
                        Chimp  ag------catggcctaa----------gcc-------------c-catagcagctggcaagggaccca-
                      Gorilla  ag------catggcctaa----------gcc-------------c-catagcagctggcaagggaccca-
                    Orangutan  ag------catggcctaa----------gcc-------------c-cacagcagctggcaagggaccca-
                       Gibbon  ag------catggcctaa----------gcc-------------c-cacagcagctggcaagggaccca-
                       Rhesus  ag------catggcccaa----------gcc-------------c-cacagcacctggcaagggaccca-
          Crab-eating macaque  ag------catggcccaa----------gcc-------------c-cacagcacctggcaagggaccca-
                       Baboon  ag------catggcccaa----------gcc-------------c-cacagcacctggcaagggaccca-
                 Green monkey  ag------catggcccaa----------gcc-------------c-cacagcacctggcaagggaccca-
                     Marmoset  ag------catggcccaa----------gcc-------------c-cacagcagctgccaagggatcca-
              Squirrel monkey  ag------catggcccaa----------gcc-------------c-cacagcagctgccaagggaccca-
                     Bushbaby  ag------cttagctcaa----------a-c-------------c-cacagcagctgccaagggaccca-
           Chinese tree shrew  aa------ctcatcatga-----------ca-------------c-cacagtggctgctgagggaccca-
                     Squirrel  ac------catcacccaa----------gccagtc---ataaaat-cacagcaactgccaaaggaccca-
       Lesser Egyptian jerboa  gg------ctaggtccaa----------gccag-------------------------cttgagatccc-
                 Prairie vole  ac------ctcagcccaa----------gctagtc---agaagac-cacagg--------------cca-
               Golden hamster  at------ctcagcc--------------ccagac---agaagac-cacagg-----ccgggagaccca-
                        Mouse  ac------ctcagcccca----------gccaggc---agaagac-cacagtg---gccaggagatcca-
                          Rat  ac------ctcggccaca----------gccagtc---atcaga---acagtg---accaggagatcca-
               Naked mole-rat  gg------cacagcccat----------gccagtc---aggaggc-caccg-------------------
                   Guinea pig  gg------catatcccac----------ggcagtc---aggaggc-cactg-------------------
                   Chinchilla  gg------catagcccac----------agccgtc---aggccac-caccg-------------------
             Brush-tailed rat  gg------cacaacccct----------ggtagtt---aggaggc-tacta-------------------
                       Rabbit  aa------catcacccaggtcctgcccagccagtctcgtggagaa-cacagcagtggccgagggacccg-
                         Pika  ggcacagccatcactcgg----------accaatctagtgcaaaa-cagagca-----------------
                          Pig  -----------aacccag----------gccaggc---ctgagcc-cctggcagctgcccggggacccg-
                       Alpaca  ag------cgaagcccag----------gccagtt---atgagac-cacagcagctgtccaggaacctg-
               Bactrian camel  ag------cgaagcccag----------gccagtt---atgagac-cacagcagctgcccaggaacccg-
                      Dolphin  -----------agcccag----------gccagtc---acaagac-cacagcagctgcctggggactcg-
                 Killer whale  -----------agcccag----------gccagtc---acaagac-cacagcagctgcctggggactcg-
             Tibetan antelope  -----------agcccag----------gccagtc---gtgagac-caccgcagctgcgcaggg--tcg-
                          Cow  -----------agcccag----------gccagtc---gtgagac-cactgcagctgcgcaggg--tcg-
                        Sheep  -----------agcccag----------gccagtc---gtgagac-caccgcagctgcgcaggg--tcg-
                Domestic goat  -----------agcccag----------gccagtc---gtgaaac-caccgcagctgcgcaggg--tcg-
                        Horse  ag------cacagcccaa----------gccagtc---atgagac-catagcagctgccaagggaccca-
             White rhinoceros  ag------ctcggcccaa----------gccagtc---atgagac-cacagcagctgccaagggaccca-
                          Cat  ----------------------------gccagtt---ataggac-cacaactgctgctcagggacccc-
                          Dog  ag------catggcccaa----------ggcagtc---acaaggc-cactg---------aggg------
                      Ferret   ag------cgctgcccaa----------ggcagtc---atcagac-cacagctgctgctcagggaccca-
                        Panda  ag------cgtgacccaa----------ggcggtc---atgagac-cacagctgctgctcagggaccctt
               Pacific walrus  ag------cacggcccac----------ggcggtc---acgagac-caccgctgctgctcagggacccg-
                 Weddell seal  aa------cacggcccac----------ggcggtc---atgagac-cactgctgctgctcagggaccca-
             Black flying-fox  ag------cacagaccca----------gccagtc---atgagac-cacggcacctgccaagggac----
                      Megabat  ag------cacagaccca----------gccagtc---atgagac-cacggcacctgccaagggac----
                Big brown bat  ag------tatggcccca----------accggcc---aggagac-catcgtagttgccaaagaaccca-
         David's myotis (bat)  ag------tatggccgca----------actagcc---atgagac-catcgtagttgccaaagaaccca-
                     Microbat  ag------tatggccgca----------actagcc---atgagac-catcgtagttgccaaagaaccca-
                     Hedgehog  ag------caaagccc------------gtcagtc---atgagac-cacagcagctgccatggggccca-
                        Shrew  ag------tgctgtctga----------ggccgtt---acaagag-tacagcagc-------gagc----
              Star-nosed mole  ------------gcccaa----------gccagtc---acgtgat-cacagtagctgccaaggagcaca-
                     Elephant  ac------catggcccaa----------gcccgtc---atgataa-gacggcagctgccaaggggccca-
          Cape elephant shrew  gc------catg---taa----------gctagtt---atgagac-gtcagcagccgcccacaggccca-
                      Manatee  ag------ctcagcccaa----------gccagtc---atgacac-cacagcagttgccaaggggccca-
             Cape golden mole  ag------cgtagcc---------------------------------cagcagctgcctagggtccc--
                       Tenrec  ag------catattccaa----------gagagtt---ttgagat-cacagcagttcccaaggatccc--
                     Aardvark  aa------catggcctac----------actagtc---atgagat-gacagcaactaccaagaggccca-
                    Armadillo  ag------cacagcccaa----------ggcagct---acgccac-caaagcagctgccaaggggccca-
                      Opossum  ag------ttcattcaga----------gctgacc---atgatatccacagcagtcatcaatagcttcc-
              Tasmanian devil  ag------ttcagtctga----------gctgaac---atatggt-----acattcgccatttgtttcc-
                     Platypus  gg--------------------------accgacc-------gac---cggaaggggccaggcggctca-
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================

                        Human  -actgc---cc-t-gcctgc--ct--------ctag--ctcccagca----t---------tgctactg-
                        Chimp  -actgc---cc-t-gcctgc--ct--------ctag--ctcccagca----t---------tgctactg-
                      Gorilla  -actgc---cc-t-gcctgc--ct--------ctag--ctcccagca----t---------tgctactg-
                    Orangutan  -actgc---cc-t-gcctgc--ct--------ctag--ctcccagca----t---------tgctactg-
                       Gibbon  -agtgc---cc-t-gcctgc--ct--------ctag--ctcccagca----t---------tgctactg-
                       Rhesus  -actgc---cc-t-gcctgc--ct--------ttag--ctcccagca----t---------tgctactg-
          Crab-eating macaque  -actgc---cc-t-gcctgc--ct--------ttag--ctcccagca----t---------tgctactg-
                       Baboon  -actgc---cc-t-gcctgc--ct--------ttag--ctcccagca----t---------tgctactg-
                 Green monkey  -actgc---cc-t-gcctgc--ct--------ttag--ctcccagca----t---------tgctactg-
                     Marmoset  -actgc---cc-t-gcttgc--ct--------ctag--ctctcagca----t---------tgctactg-
              Squirrel monkey  -cctgc---cc-t-gcttgc--ct--------ctag--ctctcagca----t---------tgctactg-
                     Bushbaby  -actgc---cctt-gcctat--c---------------ctcccagtg----g---------tgttcctg-
           Chinese tree shrew  -agtgt---cc-t-gt------------------------------------------------------
                     Squirrel  -gct--------t-gcctgc--cc--------ctag--ctcccagca----c---------tgttgct--
       Lesser Egyptian jerboa  -gtt-----ac-t---ctgc--ct--------gtgg---------------------------cagcca-
                 Prairie vole  -gtt-----cc-t-gcctgc--cc--------c-ag--ctcccaaca----c---------catggctg-
               Golden hamster  -gct-----cc-t-gcctgc--cc--------t-gc--ctcccaatg----c-----------tggctg-
                        Mouse  -gct-----cc-t-ggctgc--cc--------ttgg--cttccaaca----t---------tgcagctg-
                          Rat  -gct-----cc-t-ggctgc--ct--------ctgg--ctcccaacg----c---------tgcagctg-
               Naked mole-rat  ---------------------------------------------------------------cagatg-
                   Guinea pig  ---------------------------------------------------------------tgg-ta-
                   Chinchilla  ---------------------------------------------------------------ttgctg-
             Brush-tailed rat  ---------------------------------------------------------------cagctgc
                       Rabbit  ---------ac-t-gcttgc--ct--------gcgg--ctcccagct----c---------agctccta-
                         Pika  ---------ac-t-gtctgc--ct--------gcag--ttcccagtg----t---------tgcatttg-
                          Pig  -actgc---cc-t-gcctgg--cc--------c-------------------------------------
                       Alpaca  -actccctgcc-c-acctgc--cc--------ccag--ctcccagca----c---------tgtggctg-
               Bactrian camel  -actccctgcc-c-acctgc--cc--------ccag--ctcccagca----c---------tgtagctg-
                      Dolphin  -actgc---cc-c-acctgc--ac--------ccag--cgcccagct----c---------tgttgcag-
                 Killer whale  -actgc---cc-c-acctgc--ac--------ccag--cgcccagct----c---------tgttgcag-
             Tibetan antelope  -cctgc---cc-t-gactgc--cg--------ccag--cgcccagca----c---------cgtagtgg-
                          Cow  -cctgc---cc-c-atctgc--cc--------ccag--ctcccagca----c---------cgtggtgg-
                        Sheep  -cctgc---cc-t-gactgc--cg--------ccag--tgcccagca----c---------cgtagtgg-
                Domestic goat  -cctgc---cc-t-gactgc--cg--------ccag--cgcccagca----c---------cgtagtgg-
                        Horse  -actgc---cc-t-gtctgc--cc--------ccaa--ct----gca----c---------tgttgctg-
             White rhinoceros  -actgc---cc-t-gcctgc--cc--------ctag--ctccccgca----c---------tgttgctg-
                          Cat  -gccac---cc-t----------c--------cca---------gtg----c---------tgtcacca-
                          Dog  --------------------------------tca---------g-------------------------
                      Ferret   -accac---ct-t----------c--------cca---------gtg----c---------tgctgtca-
                        Panda  caccac---cg-c----------ccccctctgccg---------gtg----c---------tgctgcca-
               Pacific walrus  -accat---ca-t----------c--------ctg---------gtg----c---------tgttgcca-
                 Weddell seal  -gccat---ct-t----------c--------ccg---------gtg----c---------tgttgcca-
             Black flying-fox  --ctgt---tt-t-gtttgc--cc---------------------------------------ttgct--
                      Megabat  --ctgt---tt-t-gtttgc--cc---------------------------------------ttgct--
                Big brown bat  -actgc---cc-t-gcctg---cc--------ccag--ctcccagca----c---------tgctgct--
         David's myotis (bat)  -actgc---cc-t-gcctgc--cc--------ccag--ctcccagca----c---------tgctgct--
                     Microbat  -actgc---cc-t-gcctgc--cc--------ccac--ctcccagca----c---------tgccgct--
                     Hedgehog  -acggc---cc-t-ccctgc---c--------ctag--cttcccaca----tgctaccacatgctacca-
                        Shrew  ---------------------------------------------ca----c---------tggagatg-
              Star-nosed mole  -agtgc---cc-t-ccctgc---c--------tcag--ctcccagca----c---------tgctgctg-
                     Elephant  -cgg-----cc-t-gcccag--ct--------gtat--cttccagca----c---------tgctgctg-
          Cape elephant shrew  -tgg-----cc-c-agccag--cc--------ccat--ctcccagca----a---------tgctgctg-
                      Manatee  -agg-----cc-t-gcccag--tc--------ctat--ctcccagca----c---------agctgctg-
             Cape golden mole  ----------------------------------ac--agcc----------------------tggtg-
                       Tenrec  ----------------------tt--------gtat--ctcc----------------------------
                     Aardvark  -cag-----cc-t-gcccag--tc--------ctat--ctcccagca----c---------tgctgctg-
                    Armadillo  -a-------------------------------tcg--ctcccagca----c---------tgctgctg-
                      Opossum  -ccatc---at-taaatagcagct--------agagacagcccattt----a---------ctccacaa-
              Tasmanian devil  -ctatc---ac-t-agcagctgct--------ttag--agtccattctatga---------tgccataa-
                     Platypus  ---------cc-c-tccc----ct--------ccgc--ctccccggc----c---------ggctgccg-
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================

                        Human  tgcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                        Chimp  tgcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                      Gorilla  tgcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                    Orangutan  cgcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                       Gibbon  ctcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                       Rhesus  cgcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
          Crab-eating macaque  cgcaggccaagggtactgaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                       Baboon  cgcaggccaagggtactgaggt--tag--ttccact-gtcc-c-------ctg---------t-cca---
                 Green monkey  cacaggccaaaggtactaaagt--tag--tcccact-gtcc-c-------ctg---------t-cca---
                     Marmoset  ggcaagccaagcatactgaagt--ttg--tcccact-gtcc-c-------ctg---------t-cca---
              Squirrel monkey  ggcaggccaagggtactgaagt--ttg--tcccact-gtcc-c---------g---------t-cca---
                     Bushbaby  ggcaggatgatggtactgaagt--tag--tcccact-gtcc-cttttcccttg---------c-cca---
           Chinese tree shrew  -------------------ggt--tag--tcccact-gtcc-g-------ctg---------tgcca---
                     Squirrel  ggcag--caagagcactaaagtactat--cccttgt-gcat-t-------t-g---------tgctg---
       Lesser Egyptian jerboa  ggccggcccaaggcaagggagc--tag--tcccagc-gtct-c-------c-a---------tgccac--
                 Prairie vole  ggcagatccgaggaacagaagt--tag--tcctgaa-gtcc-c-------c-a---------tgctg---
               Golden hamster  ggctgatccagggaacagaaa---tag--tcccaga-gtcc-c-------c-a---------tgcag---
                        Mouse  ggcagatccaaggcacagaagt--tag--t--------tct-c-------t-g---------tgctg---
                          Rat  ggcagatctaaggaacagaagt--aag--ttccaac-atcc-c-------t-g---------ccctg---
               Naked mole-rat  cccggggcccaggcacttaag---tgg--tcctgct-gtcc-c-------tgg---------tgcca---
                   Guinea pig  cctggagcccaggcacagaag---tgg--taccact-gtcc-c-------ttg---------tgctg---
                   Chinchilla  tgtgaggcccaggcactgaaa---tgg--tcctact-gtcc-c-------ctg---------tgccg---
             Brush-tailed rat  tagggggcccagg-acagaag---tgg--ccccact-gtcc-t-------ttg---------tgctg---
                       Rabbit  ggcaggctaagggtattggagt--tcg--tcccgct-gtcc-c-------ttg---------cgctg---
                         Pika  ggcaacctcaaagaactggagt--tag--t-ccact-gttt-c-------ttg---------tgcca---
                          Pig  ---------------ctggagg--ggg--tcctgct-gtcc-c-------ttg---------cgttg---
                       Alpaca  ggcaggcccaggacactgaaga--tgg--tcctgct-gacc-g-------tcg---------tgcca---
               Bactrian camel  ggcaggcccaggacactgaaga--tgg--tcctgct-gacc-g-------ttg---------tgcca---
                      Dolphin  agcaggcccagggcactagtgt--tgg--acctgct-agcc-c-------tcg---------tgcca---
                 Killer whale  agcaggcccagggcactagtgt--tgg--acctgct-agcc-c-------tcg---------tgcca---
             Tibetan antelope  tgcaggtcccgggcactggag---cag--acctgcc-gccctc-------ccg---------tgcca---
                          Cow  tgcaggtccctggcactggag---gag--acctgcc-accc-c-------ccg---------tgcca---
                        Sheep  tgcaggtcccaggcactggag---cag--acctgcc-gccctc-------ctg---------tgcca---
                Domestic goat  tgcaggtcctgggcactggag---cag--acctgcc-accccc-------ccg---------tgcca---
                        Horse  ggcaggccaagggctctgaagt--tgg--tcccact-gccc-c-------tca---------cgtcc---
             White rhinoceros  ggcaggtcgagggctctgaagt--tgg--tcccact-gccc-c-------tcg---------tgtcc---
                          Cat  ggcagggtgagggcactgaagt--tgg--t-ccatt-gcct-c-------ctg---------tgcc----
                          Dog  ------------------------------cccact-gtct-g-------ctg---------tgcc----
                      Ferret   ggcaggctgagggcactgaagt--cgg--tcccact-gcct-c-------ctgcgtctgccacgcc----
                        Panda  ggcaggccgagggcactgaagt--cag--tcccact-gccc-g-------ccg---------cacc----
               Pacific walrus  ggtgggctgggggcactgaagt--cgg--tcccacc-gccg-c-------tcg---------cacc----
                 Weddell seal  ggcgggctggggacactgaagt--cgg--tcccacc-gcct-c-------ttg---------cacc----
             Black flying-fox  gacaggccgagggcactgaagg--agg--tcccact-gacc-c-------tca---------tgctg---
                      Megabat  gacaggccgagggcactgaagg--agg--tcccact-gacc-c-------tca---------tgctg---
                Big brown bat  ggagggctgagggcactgagg-------------------------------g---------tgtcc---
         David's myotis (bat)  ggaaggcggagggcattgaagg--tgg---cccact-gcca-c--------tg---------tgtcc---
                     Microbat  ggaaggcggagggcattgaagg--tgg---cccact-gcca-c-------ttg---------tgtcc---
                     Hedgehog  ggcaggcggaaagcactggagt--ggg--ttccact-gtcc-t-------ttg---------tcttc---
                        Shrew  g--------------ccgc-----ggg----------gtcc-c-------tca---------tgctg---
              Star-nosed mole  ggcag-------gcaccgg-----agg--tgctgta-gtcc-c-------ttc---------tgctg---
                     Elephant  ggcaggccaaggggaagaa----------------t-gcct-c-------ca------------------
          Cape elephant shrew  ggcaggcagaggggatgtg----------------tcgccc-t-------ca-------------cgctg
                      Manatee  ggcaggtggagggcacaaa----------------t-gccc-c-------ttg---------tgtcactc
             Cape golden mole  ggcaggctgaggacgcatgc---------ccatgtg-gcct-c-------aa------------------
                       Tenrec  --caagctggaggggcccg--------------gct-gccc-c-------ag------------------
                     Aardvark  ggcaagctgaggcgagaaa----------------t-accc-c-------ttg---------ggccatt-
                    Armadillo  ggcaggccgggggcactgatgt--tag--tctccct-gccc-----------------------------
                      Opossum  gaagttccaatagaatcaggat--ca---ttttaat-gcct-t-------tcc---------ccatg---
              Tasmanian devil  gcatttccatcagaatttggac--catattcttatt-gcc--t-------tcc---------tgttg---
                     Platypus  -----------gcccccgaccc--ggg--acacgcc-ggtc-a-------c-g---------tcacg---
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================

                        Human  ---tgca---------tgtt---------gga------------------
                        Chimp  ---tgca---------tgtt---------gga------------------
                      Gorilla  ---tgca---------tgtc---------gga------------------
                    Orangutan  ---tcca---------tgtc---------gga------------------
                       Gibbon  ---tcca---------tgtc---------aga------------------
                       Rhesus  ---tcca---------tgtc---------gaa------------------
          Crab-eating macaque  ---tcca---------tgtc---------gaa------------------
                       Baboon  ---tcca---------tgtc---------gaa------------------
                 Green monkey  ---tcca---------tgtc---------gaa------------------
                     Marmoset  ---tcca---------tgtt---------gga------------------
              Squirrel monkey  ---tcca---------tgtt---------gga------------------
                     Bushbaby  ---ttcg---------cact---------gga------------------
           Chinese tree shrew  ---ttca---------tgtt---------gga------------------
                     Squirrel  ---gctg---------gcca---------ggccatc--ctatggtggag-
       Lesser Egyptian jerboa  ---tgtg--------ctgga---------gggcagcag-tctggtgagat
                 Prairie vole  ---tgtg---------tgga---------gggcagtggttctggtggga-
               Golden hamster  ---tgtg---------tgga---------gggcagggtttctggtggga-
                        Mouse  ----ttg---------tgga---------ggataatggttctggtggga-
                          Rat  ---tttg---------tgga---------ggacagtggttctggcagga-
               Naked mole-rat  ---ctgg---------tact---------gga------------------
                   Guinea pig  ---c--t---------tgct---------ggc------------------
                   Chinchilla  ---cggg---------tgct---------gga----------------g-
             Brush-tailed rat  ---cagg---------tgct---------gga------------------
                       Rabbit  ---ctgg---------cgtg---------gga------------------
                         Pika  ---ctggaggtcatcctgtg---------ggg------------------
                          Pig  ---acaa---------tgct---------gga------------------
                       Alpaca  ---tcca---------cttt---------gga------------------
               Bactrian camel  ---tcca---------cttt---------gga------------------
                      Dolphin  ---tcca---------cgtt---------gga------------------
                 Killer whale  ---tcca---------cgtt---------gga------------------
             Tibetan antelope  ---tctg---------cact---------gga------------------
                          Cow  ---tctg---------cact---------gga------------------
                        Sheep  ---tctg---------cact---------gga------------------
                Domestic goat  ---tctg---------cact---------gga------------------
                        Horse  ---ttca---------tgtt---------gga------------------
             White rhinoceros  ---ttca---------tgtt---------gga------------------
                          Cat  ----------------tgccgtgcccattgga------------------
                          Dog  ----------------ttcc---------cga------------------
                      Ferret   ----------------tgct---------gga------------------
                        Panda  ----------------tgcc---------gca------------------
               Pacific walrus  ----------------tgcc---------ggg------------------
                 Weddell seal  ----------------tgcc---------gga------------------
             Black flying-fox  ---ttca---------cgtt---------gca------------------
                      Megabat  ---ttca---------cgtt---------gca------------------
                Big brown bat  ---ttcc---------tgtt---------gga------------------
         David's myotis (bat)  ---ttca---------tgtt---------gga------------------
                     Microbat  ---ttca---------tggt---------gga------------------
                     Hedgehog  ---ttca---------tgtt---------gga------------------
                        Shrew  ---tccg---------tgtt---------gga------------------
              Star-nosed mole  ---ctcg---------ggct---------gga------------------
                     Elephant  ---gtct---------tgct---------gga------------------
          Cape elephant shrew  gccgtgc---------tggt---------ggg------------------
                      Manatee  g--gtca---------tgct---------ggg------------------
             Cape golden mole  ---gtc--------------------------------------------
                       Tenrec  ---gtcg---------ggct------------------------------
                     Aardvark  ---caca---------tgct---------gga------------------
                    Armadillo  ---ctca---------tgcc------------------------------
                      Opossum  ---tcca---------tgtt-------ttggt------------------
              Tasmanian devil  ---tcca---------catt-------ttggt------------------
                     Platypus  ---gccg---------cgcc------------------------------
                 Atlantic cod  ==================================================
                  Spotted gar  ==================================================
           Southern platyfish  ==================================================
                    Zebrafish  ==================================================
                  Stickleback  ==================================================
                       Medaka  ==================================================
          Pundamilia nyererei  ==================================================
                  Zebra mbuna  ==================================================
        Burton's mouthbreeder  ==================================================
          Princess of Burundi  ==================================================
                 Nile tilapia  ==================================================
                   Coelacanth  ==================================================
                       Lizard  ==================================================
     Chinese softshell turtle  ==================================================
               Painted turtle  ==================================================
              Green seaturtle  ==================================================
                       Turkey  ==================================================
                      Chicken  ==================================================
                 Mallard duck  ==================================================
                Scarlet macaw  ==================================================
                       Parrot  ==================================================
                   Budgerigar  ==================================================
           Tibetan ground jay  ==================================================
                  Zebra finch  ==================================================
          Medium ground finch  ==================================================
       White-throated sparrow  ==================================================
          Collared flycatcher  ==================================================
             Peregrine falcon  ==================================================
                 Saker falcon  ==================================================
                  Rock pigeon  ==================================================
                      Wallaby  ==================================================
           American alligator  ==================================================

Alignment block 4 of 861 in window, 43671645 - 43671683, 39 bps 
B D                     Human  gggacc--a---ggccatc--gtggtggggt-----gggaca---ggagt---------atag
B D                     Chimp  gggacc--a---ggccatc--gtggtggggt-----gggaca---ggagt---------atag
B D                   Gorilla  gggacc--a---ggccatc--gtggtggggt-----gggaca---ggagt---------atag
B D                 Orangutan  gggacc--a---ggccatt--gtggtggggt-----gggaca---ggagt---------atag
B D                    Gibbon  gggacc--a---ggccatc--gtggtggggt-----gggaca---ggagt---------atag
B D                    Rhesus  ggggcc--a---ggccatc--atggt--------------ct---ggagt---------atag
B D       Crab-eating macaque  ggggcc--a---ggccatc--atggt--------------ct---ggagt---------atag
B D                    Baboon  ggggcc--a---ggccatc--gtggt--------------ct---ggagt---------atag
B D              Green monkey  ggggcc--a---ggccatc--gtgat--------------ct---ggagt---------atag
B D                  Marmoset  ggggcc--a---ggacatc--gtggtggggt-----gggaca---ggagt---------atag
B D           Squirrel monkey  ggggcc--a---ggccatc--gtggtggggt-----ggggca---ggagt---------atag
B D                  Bushbaby  ggaccc--a---agccatc--ttggtgggag-----agggca---agagt---------gtgg
           Chinese tree shrew  gg---c--c---ggccatc--ctggagggat-----ggggca---acagc---------acag
B D                  Squirrel  ggcaga--a---ggaca----------------------------------------------
       Lesser Egyptian jerboa  ggggtg--g---gtgcaaa--gctgtag------------ct---g-------------atgg
                 Prairie vole  ggggca--a---gtaca----------------------------------------------
               Golden hamster  ggggcc--a---gtgca----------------------------------------------
B D                     Mouse  ggagca--a---gtgca----------------------------------------------
B D                       Rat  ggggca--a---gcaca----------------------------------------------
B D            Naked mole-rat  ggggcc--a---ggc-a----------------------------------------------
B D                Guinea pig  ggagcc--a---ggcca----------------------------------------------
                   Chinchilla  ggggcc--a---ggctg----------------------------------------------
             Brush-tailed rat  agggcc--a---tgctg----------------------------------------------
B D                    Rabbit  ggcgca--g---gacag----------------------------------------------
B D                      Pika  agcgca--g---gaatg----------------------------------------------
B D                       Pig  ggagccggg---ggccg-t--agggcgggct-----ggggtg---g-agt---------gcgg
B D                    Alpaca  ggagcc--g---gaacg-c--ctggtgggat-----ggggcg---gaagt---------gcag
               Bactrian camel  ggagcc--g---gaacg-c--ctggtgggat-----ggggcg---gaagt---------gcag
B D                   Dolphin  ggagct--g---ggccacc--ctggtgggat-----ggggcg---ggagt---------gcag
                 Killer whale  ggagcc--g---ggccacc--ctggtgggat-----ggggcg---ggagt---------gcag
             Tibetan antelope  ggagcc--g---ggccgcc--ctggtgggat-----ggggtg---ggagt---------gcag
B D                       Cow  ggagcc--g---ggccgcc--ctggtgggat-----ggggtg---ggagt---------gcag
B D                     Sheep  ggagcc--g---ggccgcc--ctggtgggat-----ggggtg---ggagt---------gcag
                Domestic goat  ggagcc--g---ggccgcc--ctggtgggat-----ggggtg---ggagt---------gcag
B D                     Horse  ggagct--g---ggtggcc--ctagtggcat-----ggggtg---ggagt-----gcag----
B D          White rhinoceros  ggcgcg--g---ggccgcc--ctggtgggat-----ggggtg---ggagt-----ggag----
B D                       Cat  ggagct--g---ggccaga--gtacaggag---------------------------------
B D                       Dog  ggagct--g---ggacacc--ctggtgggat-----gggg-----------------------
B D                   Ferret   gaagct--g---ggccgcc--gtggtgcaac-----agagct---ggagtgtg-g--------
B D                     Panda  ggagct--g---ggccgcc--gtggcaggat------gggcc---cgcgt-------------
               Pacific walrus  ggagct--g---ggctgcc--gtggcgggac-----ggggct---ggagt-------------
                 Weddell seal  ggagct--g---ggccacc--gtggcgggat-----ggggct---ggagt-------------
             Black flying-fox  ggagcc--g---ggccacc--ctggtaggga----tggggca---ggagt---------acag
B D                   Megabat  ggagcc--g---ggccacc--ctggtaggga----tggggca---ggagt---------acag
                Big brown bat  ggggcc------ggccagc--c--gcgggaa------gggca---ggagt---------gcag
         David's myotis (bat)  agggcc--a---ggccagc--c--gtgggaa------gggca---ggagt---------gcag
B D                  Microbat  ggggcc--a---ggccagc--c--gtgggaa------gggca---ggagt---------gcag
B D                  Hedgehog  ggagct--g---ggtcacc--ctggtggcat------gggtt---ggagtaaac---------
B D                     Shrew  ggggca--g------------------------------------------------------
              Star-nosed mole  gaagca--g---ggccacctgctggtgggat------ggatg---gggctgaa----------
B D                  Elephant  ggga--------ggccacc--ctgctggggt-----aggcaa---gaagt---------acgg
          Cape elephant shrew  gagg--------ggtcacc--ttgct-ggat-----gtgctg---gaagg---------acag
B D                   Manatee  gggggg--c-ctggccgcc--ctggtggggt-----gggcag---gaagt---------acga
             Cape golden mole  ------------------------------------------------------------cag
B D                    Tenrec  ------------aacca------------------------------------------acag
                     Aardvark  gggggg--cgttggccacc--atgatggggt-----g---cc---aaagt---------acac
B D                 Armadillo  ------------attcacc--ctggc-------------------------------------
B D                   Opossum  taggaa--t---aacca----ctggtgaagatatttggttct---gcagt---------tcta
B D           Tasmanian devil  gaggaa--t---aacta----attttgaaggcatctgggtctgtagcagt---------tcca
B D                  Platypus  gg-------------------------------------------------------------
  D  Chinese softshell turtle  ggaatc--a---gggtatt--gttggggctt-----gagaaa---------------------
B D              Atlantic cod  ===============================================================
                 Spotted gar  ===============================================================
          Southern platyfish  ===============================================================
B D                 Zebrafish  ===============================================================
B D               Stickleback  ===============================================================
B D                    Medaka  ===============================================================
         Pundamilia nyererei  ===============================================================
                 Zebra mbuna  ===============================================================
       Burton's mouthbreeder  ===============================================================
         Princess of Burundi  ===============================================================
B D              Nile tilapia  ===============================================================
B D                Coelacanth  ===============================================================
B D                    Lizard  ===============================================================
  D            Painted turtle  ===============================================================
  D           Green seaturtle  ===============================================================
B D                    Turkey  ===============================================================
B D                   Chicken  ===============================================================
  D              Mallard duck  ===============================================================
  D             Scarlet macaw  ===============================================================
  D                    Parrot  ===============================================================
B D                Budgerigar  ===============================================================
          Tibetan ground jay  ===============================================================
B D               Zebra finch  ===============================================================
B D       Medium ground finch  ===============================================================
  D    White-throated sparrow  ===============================================================
  D       Collared flycatcher  ===============================================================
  D          Peregrine falcon  ===============================================================
  D              Saker falcon  ===============================================================
  D               Rock pigeon  ===============================================================
B D                   Wallaby  ===============================================================
B D        American alligator  ===============================================================

Inserts between block 4 and 5 in window
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                  Ferret  25bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 6bp
B D                  Megabat 6bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                  Opossum 9bp
B D          Tasmanian devil 19bp

Alignment block 5 of 861 in window, 43671684 - 43671702, 19 bps 
B D                     Human  ttg---t-----------ggccaag-gg--cttgtg
B D                     Chimp  ttg---t-----------ggccgag-gg--cttgtg
B D                   Gorilla  ttg---t-----------ggccgag-gg--cttgtg
B D                 Orangutan  ttg---t-----------ggccgag-gg--cttgtg
B D                    Gibbon  ttg---t-----------ggccgag-gg--cttgtg
B D                    Rhesus  ttg---c-----------ggccgag-gg--cttatg
B D       Crab-eating macaque  ttg---t-----------ggccgag-gg--cttatg
B D                    Baboon  ttg---t-----------ggccgag-gg--cttatg
B D              Green monkey  ttg---t-----------ggccgag-gg--cttatg
B D                  Marmoset  ttg---g-----------ggccgag-gg--cttgtg
B D           Squirrel monkey  ttg---g-----------ggccgag-gg--cttatg
B D                  Bushbaby  ttg---t-----------gggtaaa-gg--ctcatg
           Chinese tree shrew  ttg---t-----------agctgag-gg--ctcata
B D                  Squirrel  -gc---------------tgtgggg-gc--tcc-ca
       Lesser Egyptian jerboa  ctc---tg------gagctgtgggg-ggctctc-tg
                 Prairie vole  -tc---a-----------tctggaa-gg--ttc-tg
               Golden hamster  -tc---a-----------cgtggaa-gg--ttc-ca
B D                     Mouse  -tc---t-----------tctagac-gg--ttc-ta
B D                       Rat  -tc---t-----------tctggaa-gg--ttc-ta
B D            Naked mole-rat  -cc---c-----------tggtggc-ac-------a
B D                Guinea pig  -cc---c-----------tggtgag-gt-------g
                   Chinchilla  -gc---c-----------tggtggg-gc-------a
             Brush-tailed rat  -cc---c-----------tggtggg-gt-------a
B D                    Rabbit  -cg---t-----------ggcggag-gg--ctggcg
B D                      Pika  -aggttt-----------ggctgag-gg--tttgca
B D                  Elephant  --------------ttcaggctgag-ag--ctg---
          Cape elephant shrew  --------------ctgaggcggag-gg--ctg---
B D                   Manatee  --------------ttgaggctgag-ag--ctg---
             Cape golden mole  --------------gagaggctgag-cg--ctg---
B D                    Tenrec  --------------tggaggctcag-ag--ctg---
                     Aardvark  --------------ctgaggctgag-ag--ctg---
B D                 Armadillo  ------------------ggctgag-gg--ctcaca
  D  Chinese softshell turtle  -------ctctgaagaagggcagagtgg--------
B D                     Shrew  ------------------------------------
B D                  Hedgehog  ------------------------------------
             Star-nosed mole  ------------------------------------
            Black flying-fox  ====================================
                Weddell seal  ====================================
                Killer whale  ------------------------------------
B D                     Panda  ====================================
               Big brown bat  ====================================
B D                       Cow  ------------------------------------
               Domestic goat  ------------------------------------
B D                     Sheep  ------------------------------------
            Tibetan antelope  ------------------------------------
B D                  Microbat  ====================================
        David's myotis (bat)  ====================================
B D                       Dog  ------------------------------------
B D                   Ferret   ====================================
B D                       Cat  ------------------------------------
              Pacific walrus  ====================================
B D                   Dolphin  ------------------------------------
B D              Atlantic cod  ====================================
                 Spotted gar  ====================================
          Southern platyfish  ====================================
B D                 Zebrafish  ====================================
B D               Stickleback  ====================================
B D                    Medaka  ====================================
         Pundamilia nyererei  ====================================
                 Zebra mbuna  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
B D              Nile tilapia  ====================================
B D                Coelacanth  ====================================
B D                    Lizard  ====================================
  D            Painted turtle  ====================================
  D           Green seaturtle  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
  D              Mallard duck  ====================================
  D             Scarlet macaw  ====================================
  D                    Parrot  ====================================
B D                Budgerigar  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
B D       Medium ground finch  ====================================
  D    White-throated sparrow  ====================================
  D       Collared flycatcher  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D               Rock pigeon  ====================================
B D                  Platypus  ------------------------------------
B D                   Wallaby  ====================================
B D        American alligator  ====================================
B D           Tasmanian devil  ====================================
B D                   Opossum  ====================================
              Bactrian camel  ------------------------------------
B D                   Megabat  ====================================
B D                       Pig  ------------------------------------
B D          White rhinoceros  ====================================
B D                     Horse  ====================================
B D                    Alpaca  ------------------------------------

Inserts between block 5 and 6 in window
  D Chinese softshell turtle 6bp

Alignment block 6 of 861 in window, 43671703 - 43671712, 10 bps 
B D                     Human  agtggg------cctc
B D                     Chimp  agtggg------cctc
B D                   Gorilla  agtggg------cctc
B D                 Orangutan  agtggg------cctc
B D                    Gibbon  agtggg------cctc
B D                    Rhesus  agtgtg------cctc
B D       Crab-eating macaque  agtgtg------cctc
B D                    Baboon  agtgtg------cctc
B D              Green monkey  agtgtg------cctc
B D                  Marmoset  agtggg------cctc
B D           Squirrel monkey  agtggg------cctc
B D                  Bushbaby  agtgag------cctc
           Chinese tree shrew  agctgg--------tc
B D                  Squirrel  agctgg------cctg
       Lesser Egyptian jerboa  gccag-----------
                 Prairie vole  gtcaa-----------
               Golden hamster  gtcag-----------
B D                     Mouse  gtca------------
B D                       Rat  gtcag-----------
B D                Guinea pig  ggcag-----------
                   Chinchilla  gtcag-----------
             Brush-tailed rat  ggcag-----------
B D                    Rabbit  agccg-----------
B D                      Pika  agctg-----------
          Cape elephant shrew  --------------tt
B D                   Manatee  --------------cc
                     Aardvark  --------------gc
B D                 Armadillo  cactgg------cctc
B D                  Platypus  -gtggga----tcttc
B D              Atlantic cod  ------agagtgcttc
B D                     Shrew  ----------------
B D                  Hedgehog  ----------------
B D                    Tenrec  ----------------
             Star-nosed mole  ----------------
            Black flying-fox  ================
                Weddell seal  ================
                Killer whale  ----------------
B D                     Panda  ================
               Big brown bat  ================
B D                       Cow  ----------------
               Domestic goat  ----------------
B D                     Sheep  ----------------
            Tibetan antelope  ----------------
B D                  Microbat  ================
        David's myotis (bat)  ================
B D                       Dog  ----------------
B D                   Ferret   ================
B D                       Cat  ----------------
              Pacific walrus  ================
B D                   Dolphin  ----------------
                 Spotted gar  ================
          Southern platyfish  ================
B D                 Zebrafish  ================
B D               Stickleback  ================
B D                    Medaka  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
B D                Coelacanth  ================
B D                    Lizard  ================
  D  Chinese softshell turtle  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
  D             Scarlet macaw  ================
  D                    Parrot  ================
B D                Budgerigar  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
  D       Collared flycatcher  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D                   Wallaby  ================
B D        American alligator  ================
B D           Tasmanian devil  ================
B D                   Opossum  ================
B D                  Elephant  ----------------
B D            Naked mole-rat  ----------------
              Bactrian camel  ----------------
B D                   Megabat  ================
            Cape golden mole  ----------------
B D                       Pig  ----------------
B D          White rhinoceros  ================
B D                     Horse  ================
B D                    Alpaca  ----------------

Alignment block 7 of 861 in window, 43671713 - 43671739, 27 bps 
B D                     Human  ctactccccag-------------------------caca-------ggtgcagg---------------
B D                     Chimp  ctactccccag-------------------------caca-------ggtgcagg---------------
B D                   Gorilla  ctactccccag-------------------------caca-------ggtgcagg---------------
B D                 Orangutan  ctactccccag-------------------------caca-------ggtgcagg---------------
B D                    Gibbon  ccactccccag-------------------------caca-------ggtgcagg---------------
B D                    Rhesus  ttactccccag-------------------------caca-------ggtgcagg---------------
B D       Crab-eating macaque  ttactccccag-------------------------caca-------ggtgcagg---------------
B D                    Baboon  ttactccccag-------------------------caca-------ggtgcagg---------------
B D              Green monkey  ttactccccat-------------------------caca-------ggtgcagg---------------
B D                  Marmoset  ctactccacag-------------------------caca-------ggtgcaag---------------
B D           Squirrel monkey  ctactccacag-------------------------caca-------ggtgcaag---------------
B D                  Bushbaby  ctattccacag-------------------------agga-------agtgtggg---------------
           Chinese tree shrew  taactccacag-------------------------tgaa-------ggggtagg---------------
B D                  Squirrel  ctgct-----------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
B D                       Pig  ------------------------------------gcgg-------agctgc-----------------
B D                    Alpaca  ------------------------------------gaca-------agcttgggc--------------
               Bactrian camel  ------------------------------------gaca-------agcttgggc--------------
B D                   Dolphin  ------------------------------------gatg-------agctcacgg--------------
                 Killer whale  ------------------------------------gatg-------agctcacgg--------------
             Tibetan antelope  ------------------------------------gatg-------agctca-----------------
B D                       Cow  ------------------------------------gacg-------agctca-----------------
B D                     Sheep  ------------------------------------gatg-------agctca-----------------
                Domestic goat  ------------------------------------gatg-------agctca-----------------
B D                     Horse  -------------------------------------------------ctgtggc--------------
B D          White rhinoceros  -------------------------------------------------ctctggc--------------
B D                       Cat  -------------------------------------------------ctctggt--------------
B D                     Panda  -------------------------------------------------ctctggt--------------
               Pacific walrus  -------------------------------------------------ctctggt--------------
                 Weddell seal  -------------------------------------------------ctctggt--------------
             Black flying-fox  -------------------------------------------------ttctggc--------------
B D                   Megabat  -------------------------------------------------ttctggc--------------
                Big brown bat  -------------------------------------------------ctcgggg--------------
         David's myotis (bat)  -------------------------------------------------ctttggc--------------
B D                  Microbat  -------------------------------------------------ctccggc--------------
B D                  Hedgehog  ttgtggctgagagcacagaaa-ccagcccagctccacagc-------agtgttggc--------------
B D                     Shrew  ----ggtgcagggctctg----------------------------------------------------
              Star-nosed mole  tggtggcccagggctcgggtg-ctgg---aggacacgatc-------agttctggc--------------
B D                  Elephant  ccctactccagtagag--gca-ct------------tgca------gggccctggc--------------
          Cape elephant shrew  cccccccacagtggag-tgc----------------tgca------gggccctggc--------------
B D                   Manatee  ctactccacagtggaggtgc----------------tgca------gggccctggc--------------
             Cape golden mole  -----gctcagtggaggtgc----------------tgta------gggcctgggc--------------
B D                    Tenrec  -----gctca---------c----------------ttcc------ttcccaagga--------------
                     Aardvark  ctgcttcacagtggg---------------------tgtt------gggctctgg---------------
B D                 Armadillo  ctaccccacagtagaggtgc----------------cgga-----ggggcactggc--------------
B D                   Opossum  ttcttccttgggatgatgggagacagtttctattggcaagagttgggggctctggc--------------
B D           Tasmanian devil  tccttccttggaatgaaaggagatagttcccattgccaggggtagggagttttggc--------------
B D                  Platypus  ctcctccccgg-------------------------ggcc-------gctgcaggt---gggg-------
B D        American alligator  ttggtataaaaaaa--------------------------------------------------------
  D  Chinese softshell turtle  gtgatccatggg----------------------------------------------------------
B D              Atlantic cod  ----------------------------------------------atgctacggtctcgaagctggtcc
B D                       Dog  ----------------------------------------------------------------------
B D                   Ferret   ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D            Naked mole-rat  ----------------------------------------------------------------------

                        Human  -ag-------ga--
                        Chimp  -ag-------ga--
                      Gorilla  -ag-------ga--
                    Orangutan  -ag-------ga--
                       Gibbon  -ag-------ga--
                       Rhesus  -ag-------ga--
          Crab-eating macaque  -ag-------ga--
                       Baboon  -ag-------ga--
                 Green monkey  -ag-------ga--
                     Marmoset  -ag-------ga--
              Squirrel monkey  -a--------ga--
                     Bushbaby  -ag-------gt--
           Chinese tree shrew  -agctctggtca--
                     Squirrel  ----------gc--
       Lesser Egyptian jerboa  ----------gt--
                 Prairie vole  ----------ga--
               Golden hamster  ----------ga--
                        Mouse  ----------gc--
                          Rat  ----------ga--
                   Guinea pig  ----------ga--
                   Chinchilla  ----------ga--
             Brush-tailed rat  ----------ga--
                       Rabbit  ----------gc--
                         Pika  ----------gc--
                          Pig  --------------
                       Alpaca  cag-------gc--
               Bactrian camel  cag-------gc--
                      Dolphin  ccg-------gc--
                 Killer whale  ccg-------gc--
             Tibetan antelope  --g-------gc--
                          Cow  --g-------gc--
                        Sheep  --g-------gc--
                Domestic goat  --g-------gc--
                        Horse  gag-------gt--
             White rhinoceros  cag-------gt--
                          Cat  cac-------g---
                        Panda  cac-------ac--
               Pacific walrus  cat-------gt--
                 Weddell seal  cac-------gt--
             Black flying-fox  cag-------gc--
                      Megabat  cag-------gc--
                Big brown bat  cag-----------
         David's myotis (bat)  cag-------gt--
                     Microbat  cag-------gt--
                     Hedgehog  cag-------ct--
                        Shrew  --------------
              Star-nosed mole  cag-------ac--
                     Elephant  tag-------gt--
          Cape elephant shrew  ca--------gt--
                      Manatee  cag-------gt--
             Cape golden mole  caa-------gt--
                       Tenrec  ggt-------gc--
                     Aardvark  ----------gc--
                    Armadillo  cag-------gt--
                      Opossum  caa-------gg--
              Tasmanian devil  caagtt----ga--
                     Platypus  tgg-------gg--
           American alligator  --------------
     Chinese softshell turtle  --------------
                 Atlantic cod  tgg-------gagt
                          Dog  --------------
                      Ferret   ==============
                  Spotted gar  ==============
           Southern platyfish  ==============
                    Zebrafish  ==============
                  Stickleback  ==============
                       Medaka  ==============
          Pundamilia nyererei  ==============
                  Zebra mbuna  ==============
        Burton's mouthbreeder  ==============
          Princess of Burundi  ==============
                 Nile tilapia  ==============
                   Coelacanth  ==============
                       Lizard  ==============
               Painted turtle  ==============
              Green seaturtle  ==============
                       Turkey  ==============
                      Chicken  ==============
                 Mallard duck  ==============
                Scarlet macaw  ==============
                       Parrot  ==============
                   Budgerigar  ==============
           Tibetan ground jay  ==============
                  Zebra finch  ==============
          Medium ground finch  ==============
       White-throated sparrow  ==============
          Collared flycatcher  ==============
             Peregrine falcon  ==============
                 Saker falcon  ==============
                  Rock pigeon  ==============
                      Wallaby  ==============
               Naked mole-rat  --------------

Inserts between block 7 and 8 in window
B D       American alligator 11bp

Alignment block 8 of 861 in window, 43671740 - 43671740, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -g
           Chinese tree shrew  -g
B D                  Squirrel  -t
       Lesser Egyptian jerboa  -t
                 Prairie vole  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D                Guinea pig  -g
                   Chinchilla  -g
             Brush-tailed rat  -g
B D                    Rabbit  -c
B D                      Pika  -t
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                       Cow  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                     Horse  -t
B D          White rhinoceros  -t
B D                       Cat  -t
B D                     Panda  -c
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -t
B D                   Megabat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
B D                  Hedgehog  -t
              Star-nosed mole  -t
B D                  Elephant  -c
          Cape elephant shrew  -t
B D                   Manatee  -c
             Cape golden mole  -c
B D                    Tenrec  -c
                     Aardvark  -g
B D                 Armadillo  -t
B D                   Opossum  -t
B D           Tasmanian devil  -t
B D                  Platypus  -g
B D              Atlantic cod  g-
B D                     Shrew  --
               Big brown bat  --
B D                       Dog  --
B D                   Ferret   ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  --
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D            Naked mole-rat  --
B D                       Pig  --

Alignment block 9 of 861 in window, 43671741 - 43671742, 2 bps 
B D                     Human  c-------------t
B D                     Chimp  c-------------t
B D                   Gorilla  c-------------t
B D                 Orangutan  c-------------t
B D                    Gibbon  c-------------t
B D                    Rhesus  c-------------t
B D       Crab-eating macaque  c-------------t
B D                    Baboon  c-------------t
B D              Green monkey  c-------------t
B D                  Marmoset  c-------------t
B D           Squirrel monkey  c-------------t
B D                  Bushbaby  ctccagccaggtttt
           Chinese tree shrew  g-------------t
B D                  Squirrel  c-------------c
       Lesser Egyptian jerboa  c-------------t
                 Prairie vole  a-------------t
               Golden hamster  c-------------t
B D                     Mouse  c-------------t
B D                       Rat  c-------------t
B D                Guinea pig  g-------------t
                   Chinchilla  g-------------t
             Brush-tailed rat  g-------------g
B D                    Rabbit  t-------------t
B D                      Pika  t-------------c
B D                    Alpaca  c-------------t
               Bactrian camel  c-------------t
B D                   Dolphin  c-------------t
                 Killer whale  c-------------t
             Tibetan antelope  c-------------t
B D                       Cow  c-------------t
B D                     Sheep  c-------------t
                Domestic goat  c-------------t
B D                     Horse  c-------------c
B D          White rhinoceros  c-------------t
B D                       Cat  c-------------t
B D                     Panda  c-------------t
               Pacific walrus  c-------------t
                 Weddell seal  c-------------t
             Black flying-fox  c-------------t
B D                   Megabat  c-------------t
                Big brown bat  c-------------t
         David's myotis (bat)  c-------------t
B D                  Microbat  c-------------t
B D                  Hedgehog  c-------------t
              Star-nosed mole  g-------------g
B D                  Elephant  c-------------t
          Cape elephant shrew  t-------------t
B D                   Manatee  c-------------t
             Cape golden mole  c-------------t
B D                    Tenrec  t-------------t
                     Aardvark  a-------------t
B D                 Armadillo  c-------------t
B D                   Opossum  c-------------t
B D           Tasmanian devil  c-------------t
B D                  Platypus  g-------------t
  D       Collared flycatcher  c-------------t
  D    White-throated sparrow  c-------------t
B D       Medium ground finch  c-------------t
B D               Zebra finch  c-------------t
B D                Budgerigar  c-------------t
  D              Mallard duck  c-------------t
  D           Green seaturtle  c-------------t
  D            Painted turtle  c-------------t
  D  Chinese softshell turtle  c-------------t
B D                Coelacanth  t-------------t
B D              Atlantic cod  -------------gt
B D                     Shrew  ---------------
B D                       Dog  ---------------
B D                   Ferret   ===============
                 Spotted gar  ===============
          Southern platyfish  ===============
B D                 Zebrafish  ===============
B D               Stickleback  ===============
B D                    Medaka  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
B D                    Lizard  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
          Tibetan ground jay  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ===============
B D                   Wallaby  ===============
B D        American alligator  ===============
B D            Naked mole-rat  ---------------
B D                       Pig  ---------------

Inserts between block 9 and 10 in window
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
B D               Budgerigar 1bp
  D             Mallard duck 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
B D               Coelacanth 2bp

Alignment block 10 of 861 in window, 43671743 - 43671744, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  ct
           Chinese tree shrew  cg
B D                  Squirrel  cc
       Lesser Egyptian jerboa  ca
                 Prairie vole  tc
               Golden hamster  tc
B D                     Mouse  tc
B D                       Rat  tc
B D                Guinea pig  gc
                   Chinchilla  gc
             Brush-tailed rat  gc
B D                    Rabbit  gc
B D                      Pika  cc
B D                    Alpaca  cg
               Bactrian camel  cg
B D                   Dolphin  cg
                 Killer whale  cg
             Tibetan antelope  ca
B D                       Cow  ca
B D                     Sheep  ca
                Domestic goat  ca
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Cat  ca
B D                     Panda  ca
               Pacific walrus  ca
                 Weddell seal  cc
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  aa
         David's myotis (bat)  aa
B D                  Microbat  aa
B D                  Hedgehog  ca
              Star-nosed mole  ca
B D                  Elephant  ca
          Cape elephant shrew  ca
B D                   Manatee  ca
             Cape golden mole  ca
B D                    Tenrec  cg
                     Aardvark  ca
B D                 Armadillo  ca
B D                   Opossum  ta
B D           Tasmanian devil  ta
B D                  Platypus  c-
B D              Atlantic cod  cg
B D                     Shrew  --
B D                       Dog  --
B D                   Ferret   ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D            Naked mole-rat  --
B D                       Pig  --

Inserts between block 10 and 11 in window
B D                     Pika 43bp

Alignment block 11 of 861 in window, 43671745 - 43671752, 8 bps 
B D                     Human  ---ggaag---cac
B D                     Chimp  ---ggaag---cac
B D                   Gorilla  ---ggaag---cac
B D                 Orangutan  ---ggaag---cac
B D                    Gibbon  ---ggaag---cac
B D                    Rhesus  ---ggaag---ccc
B D       Crab-eating macaque  ---ggaag---ccc
B D                    Baboon  ---ggaag---ccc
B D              Green monkey  ---ggaag---ccc
B D                  Marmoset  ---ggaag---ccc
B D           Squirrel monkey  ---ggaag---ccc
B D                  Bushbaby  ---ggaag---ccc
           Chinese tree shrew  ---ggaag---gcc
B D                  Squirrel  ---agcag---atg
       Lesser Egyptian jerboa  ---gggag---cct
                 Prairie vole  ---agcag---cgt
               Golden hamster  ---agctg---cag
B D                     Mouse  ---agaag---tcc
B D                       Rat  ---agcag---tat
B D                Guinea pig  ---tcggg---cca
                   Chinchilla  ---ttggg---cca
             Brush-tailed rat  ---tcagg---cca
B D                      Pika  ---ggaag---ctg
B D                    Alpaca  ---ggagg---ccc
               Bactrian camel  ---ggagg---ccc
B D                   Dolphin  ---ggagg---ccg
                 Killer whale  ---ggagg---ccg
             Tibetan antelope  ---ggagg---ccc
B D                       Cow  ---ggagg---tcc
B D                     Sheep  ---ggagg---ccc
                Domestic goat  ---ggagg---ccc
B D                     Horse  ---ggaag---ccc
B D          White rhinoceros  ---ggaag---cc-
B D                       Cat  ---ggaag---ctc
B D                       Dog  ------ag---ccc
B D                     Panda  ---gggag---ccc
               Pacific walrus  ---gggag---ccc
                 Weddell seal  ---gggag---ccc
             Black flying-fox  ---gaaag---ccc
B D                   Megabat  ---gaaag---ccc
B D                  Hedgehog  ---ggaaactcct-
B D                     Shrew  ------------c-
              Star-nosed mole  ---ggaag---cc-
B D                  Elephant  ---ggaag---tca
          Cape elephant shrew  ---gggag---ccc
B D                   Manatee  ---ggaag--tccc
             Cape golden mole  ---ggaag---ccc
B D                    Tenrec  ---agaag---ccc
                     Aardvark  ---ggaag---cct
B D                 Armadillo  ---ggaag---ctc
B D                   Opossum  ---gaaaa---cac
B D           Tasmanian devil  ---caaac---tat
B D                Coelacanth  ---caaag---ctt
B D              Atlantic cod  ---attag------
B D                 Zebrafish  gtaaacag------
               Big brown bat  --------------
B D                  Microbat  --------------
        David's myotis (bat)  --------------
B D                   Ferret   ==============
                 Spotted gar  ==============
          Southern platyfish  ==============
B D               Stickleback  ==============
B D                    Medaka  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
B D                    Lizard  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
  D             Scarlet macaw  ==============
  D                    Parrot  ==============
B D                Budgerigar  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
B D       Medium ground finch  ==============
  D    White-throated sparrow  ==============
  D       Collared flycatcher  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
B D                  Platypus  --------------
B D                   Wallaby  ==============
B D        American alligator  ==============
B D            Naked mole-rat  --------------
B D                    Rabbit  --------------
B D                       Pig  --------------

Inserts between block 11 and 12 in window
            Cape golden mole 3bp
B D             Atlantic cod 3bp

Alignment block 12 of 861 in window, 43671753 - 43671754, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  ta
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  tg
B D                  Squirrel  tg
       Lesser Egyptian jerboa  tg
                 Prairie vole  gg
               Golden hamster  gg
B D                     Mouse  tg
B D                       Rat  cc
B D                Guinea pig  gc
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                      Pika  gg
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  tg
B D                       Cow  tg
B D                     Sheep  tg
                Domestic goat  tg
B D                     Horse  a-
B D                       Cat  tg
B D                       Dog  tg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                   Megabat  tg
B D                  Elephant  -g
          Cape elephant shrew  -g
B D                   Manatee  -a
             Cape golden mole  ag
B D                 Armadillo  tg
B D                   Opossum  ac
B D           Tasmanian devil  tc
  D       Collared flycatcher  tg
  D    White-throated sparrow  tg
B D       Medium ground finch  tg
B D               Zebra finch  tg
B D                Budgerigar  tg
  D              Mallard duck  tg
  D           Green seaturtle  tg
  D            Painted turtle  tg
  D  Chinese softshell turtle  tg
B D                    Lizard  tg
B D                Coelacanth  cg
B D                     Shrew  --
B D                  Hedgehog  --
B D                    Tenrec  --
             Star-nosed mole  --
               Big brown bat  --
B D                  Microbat  --
        David's myotis (bat)  --
B D                   Ferret   ==
B D              Atlantic cod  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  --
B D               Stickleback  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                  Platypus  --
B D                   Wallaby  ==
B D        American alligator  ==
B D            Naked mole-rat  --
B D                    Rabbit  --
                    Aardvark  --
B D                       Pig  --
B D          White rhinoceros  --

Inserts between block 12 and 13 in window
  D      Collared flycatcher 9bp
  D   White-throated sparrow 9bp
B D      Medium ground finch 9bp
B D              Zebra finch 9bp
B D               Budgerigar 9bp
  D             Mallard duck 9bp
  D          Green seaturtle 12bp
  D           Painted turtle 12bp
  D Chinese softshell turtle 12bp
B D                   Lizard 19bp

Alignment block 13 of 861 in window, 43671755 - 43671756, 2 bps 
B D                     Human  c-------------------t
B D                     Chimp  c-------------------t
B D                   Gorilla  c-------------------t
B D                 Orangutan  c-------------------t
B D                    Gibbon  c-------------------t
B D                    Rhesus  c-------------------t
B D       Crab-eating macaque  c-------------------t
B D                    Baboon  c-------------------t
B D              Green monkey  c-------------------t
B D                  Marmoset  c-------------------t
B D           Squirrel monkey  c-------------------t
B D                  Bushbaby  c-------------------t
           Chinese tree shrew  t-------------------c
B D                  Squirrel  caggaggtgctctggctaggt
       Lesser Egyptian jerboa  c-------------------t
                 Prairie vole  c-------------------t
               Golden hamster  c-------------------t
B D                     Mouse  c-------------------t
B D                       Rat  c-------------------t
B D                Guinea pig  c-------------------t
                   Chinchilla  t-------------------g
             Brush-tailed rat  a-------------------g
B D                      Pika  c-------------------a
B D                    Alpaca  c-------------------t
               Bactrian camel  c-------------------t
B D                   Dolphin  c-------------------t
                 Killer whale  c-------------------t
             Tibetan antelope  c-------------------t
B D                       Cow  c-------------------t
B D                     Sheep  c-------------------t
                Domestic goat  c-------------------t
B D                       Dog  c-------------------c
B D                     Panda  c-------------------t
               Pacific walrus  c-------------------t
                 Weddell seal  c-------------------t
             Black flying-fox  c-------------------t
B D                   Megabat  c-------------------t
B D                  Elephant  c-------------------t
          Cape elephant shrew  c-------------------c
B D                   Manatee  t-------------------t
             Cape golden mole  c-------------------t
B D                    Tenrec  c-------------------a
                     Aardvark  t-------------------g
B D                 Armadillo  c-------------------t
B D                   Opossum  c-------------------t
B D           Tasmanian devil  c-------------------c
B D                   Wallaby  --------------------c
  D       Collared flycatcher  --------------------g
  D    White-throated sparrow  --------------------g
B D       Medium ground finch  --------------------g
B D               Zebra finch  --------------------g
B D                Budgerigar  --------------------g
  D              Mallard duck  --------------------g
B D        American alligator  --------------------c
  D           Green seaturtle  --------------------t
  D            Painted turtle  --------------------t
  D  Chinese softshell turtle  --------------------t
B D                    Lizard  --------------------t
B D                Coelacanth  c-------------------t
           Southern platyfish  -------------------tt
B D              Atlantic cod  --------------------t
B D                 Zebrafish  -------------------at
B D                     Shrew  ---------------------
B D                  Hedgehog  ---------------------
             Star-nosed mole  ---------------------
               Big brown bat  ---------------------
B D                  Microbat  ---------------------
        David's myotis (bat)  ---------------------
B D                   Ferret   =====================
B D                       Cat  ---------------------
                 Spotted gar  =====================
B D               Stickleback  =====================
B D                    Medaka  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
          Tibetan ground jay  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  =====================
B D                  Platypus  ---------------------
B D            Naked mole-rat  ---------------------
B D                    Rabbit  ---------------------
B D                       Pig  ---------------------
B D          White rhinoceros  ---------------------
B D                     Horse  ---------------------

Inserts between block 13 and 14 in window
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
B D               Budgerigar 1bp
  D             Mallard duck 1bp
B D       American alligator 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
B D                   Lizard 1bp

Alignment block 14 of 861 in window, 43671757 - 43671757, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
               Golden hamster  t
B D                     Mouse  c
B D                       Rat  c
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
B D                  Hedgehog  c
B D                     Shrew  g
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  g
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
           Southern platyfish  c
B D              Atlantic cod  c
B D                 Zebrafish  c
               Big brown bat  -
B D                  Microbat  -
        David's myotis (bat)  -
B D                       Dog  -
                 Spotted gar  =
B D               Stickleback  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D                Coelacanth  -
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D        American alligator  =
B D            Naked mole-rat  -
B D                    Rabbit  -

Inserts between block 14 and 15 in window
          Southern platyfish 2bp
B D             Atlantic cod 3bp
B D                Zebrafish 2bp

Alignment block 15 of 861 in window, 43671758 - 43671758, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D                Guinea pig  a
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  a
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  t
B D                     Shrew  c
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D              Nile tilapia  t
          Princess of Burundi  t
        Burton's mouthbreeder  t
                  Zebra mbuna  t
          Pundamilia nyererei  t
           Southern platyfish  t
B D              Atlantic cod  c
B D                 Zebrafish  t
                  Spotted gar  t
               Big brown bat  -
B D                  Microbat  -
        David's myotis (bat)  -
B D               Stickleback  =
B D                    Medaka  =
B D                Coelacanth  -
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D        American alligator  =
B D            Naked mole-rat  -
B D                    Rabbit  -

Alignment block 16 of 861 in window, 43671759 - 43671759, 1 bps 
B D                     Human  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                      Pika  t
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
B D                    Medaka  c
           Southern platyfish  c
B D              Atlantic cod  t
B D                 Zebrafish  c
                  Spotted gar  t
      Lesser Egyptian jerboa  -
B D                Guinea pig  -
            Brush-tailed rat  -
                  Chinchilla  -
                Prairie vole  -
B D                     Mouse  -
              Golden hamster  -
B D                       Rat  -
               Big brown bat  -
            Tibetan antelope  -
B D                  Microbat  -
        David's myotis (bat)  -
B D                  Squirrel  -
B D               Stickleback  =
B D                Coelacanth  -
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D        American alligator  =
B D            Naked mole-rat  -
B D                    Rabbit  -
B D                     Chimp  -

Alignment block 17 of 861 in window, 43671760 - 43671779, 20 bps 
B D                     Human  tg--tcagtgatacagcttcca
B D                     Chimp  -g--tcagtgatacagcttcca
B D                   Gorilla  tg--tcagtgatacagcttcca
B D                 Orangutan  tg--tcagtgatacagcttcca
B D                    Gibbon  tg--tcagtgatacagcttcca
B D                    Rhesus  tg--tcagtgatacagcttcca
B D       Crab-eating macaque  tg--tcagtgatacagcttcca
B D                    Baboon  tg--tcagtgatacagcttcca
B D              Green monkey  tg--tcagtgatacagcttcca
B D                  Marmoset  tg--tcagtgatacagcttcca
B D           Squirrel monkey  tg--tcattgatacagtttcaa
B D                  Bushbaby  ag--tcaatgataccacttcaa
           Chinese tree shrew  aa--tcagtgatacagcttcaa
B D                  Squirrel  cag-tcaatgatagaatttcaa
       Lesser Egyptian jerboa  cg--ttaatgatacatcttcaa
                 Prairie vole  ca--ttaatgcatcagcttcaa
               Golden hamster  ca--ctaatgaaggagcttcaa
B D                     Mouse  ca--ctaatgcatcatcttcag
B D                       Rat  ca--ttagtgcatcagcttcag
B D            Naked mole-rat  ag--tcagtggtacagcttcag
B D                Guinea pig  gg--tcagtggtacagcgtcca
                   Chinchilla  ag--tcagtggtacagcttcca
             Brush-tailed rat  ag--tcagtggtacagcttcca
B D                    Rabbit  gc--tcagtgatagaacttcaa
B D                      Pika  gg--tcagtgatacagcttcaa
B D                       Pig  ag--tcagtggtacagcagcag
B D                    Alpaca  ag--tcagtgatacagcaccaa
               Bactrian camel  ag--tcagtgatacagcaccaa
B D                   Dolphin  ag--tcagtgatacagcaccaa
                 Killer whale  ag--tcagtgatacagcaccaa
             Tibetan antelope  -g--tcagtgatacagcaccaa
B D                       Cow  ag--tcagtgatacagcaccaa
B D                     Sheep  ag--tcagtgatacagcaccaa
                Domestic goat  ag--tcagtgatacagcaccaa
B D                     Horse  ag--tcaatggtacagcaccaa
B D          White rhinoceros  ag--tcaatggtacagcaccaa
B D                       Cat  cg--tcagtgatacagcaccaa
B D                       Dog  ag--tcagtgatacagtatcag
B D                   Ferret   ag--tcagtgatataacaccag
B D                     Panda  ag--tcagtgatgcagcatcag
               Pacific walrus  ag--tcagtgatacagcatcag
                 Weddell seal  ag--tcagtgatacagcatcag
             Black flying-fox  ag--tcaatgatacagcaccaa
B D                   Megabat  ag--tcaatgatacagcaccaa
                Big brown bat  -----ccctgatagagcaccag
         David's myotis (bat)  -----ccatgatacagcaccaa
B D                  Microbat  -----ccctgatacagcaccaa
B D                  Hedgehog  ta--tcagtgatacagcacagg
B D                     Shrew  ga--tcactgatagaacgccag
              Star-nosed mole  cg--tcagtgatacagcgccag
B D                  Elephant  ag--tcaatgatagaacactaa
          Cape elephant shrew  ag--tcagtgatacagcaccaa
B D                   Manatee  ag--tcaatgatacaacaccaa
             Cape golden mole  ag--tcagtgattgagcaccaa
B D                    Tenrec  tg--tcagtgatacagcagcag
                     Aardvark  tc--tcaatgatacagcaccaa
B D                 Armadillo  ag--tcaatgatgcagcaacaa
B D                   Opossum  ct--ttagtggtacaaaagcag
B D           Tasmanian devil  ca--ttaatggtacatcactag
B D                   Wallaby  ct--tcagtggtacatcaccag
B D                  Platypus  -g--tcactggtagaagaccaa
  D       Collared flycatcher  --cactagtggtttaaacagag
  D    White-throated sparrow  --cactagtggtttaaacagag
B D       Medium ground finch  --cactagtggtttaaacagag
B D               Zebra finch  --cactagtggtttaaacagag
B D                Budgerigar  --cactagtggtttaaacagag
  D              Mallard duck  --ccctagtggttgaagttaag
B D        American alligator  --cctcagtgattcaaataaat
  D           Green seaturtle  --cctcagtgatttaaataaac
  D            Painted turtle  --cctcagtgatttaaataaac
  D  Chinese softshell turtle  --cttcagtgatttaaataaac
B D                    Lizard  --ctttagtggttaaaccgaag
B D                Coelacanth  --tttcagtgctttaaatatga
B D              Nile tilapia  ct--tcagtgttttatgtacaa
          Princess of Burundi  ct--tcagtgttttatgtacaa
        Burton's mouthbreeder  ct--tcagtgttttatgtacaa
                  Zebra mbuna  ct--tcagtgttttatgtacaa
          Pundamilia nyererei  ct--tcagtgttttatgtacaa
B D                    Medaka  tt--tcagtgttttatgtacag
           Southern platyfish  ct--tcagtgctttatgtacag
B D              Atlantic cod  cg--tcagtgtttcaaatagac
B D                 Zebrafish  ca--tcagtgctttaagtacca
                  Spotted gar  tt--tcagtggtttatatagta
B D                   Lamprey  tg--ctagtgttccatgtacaa
B D               Stickleback  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
  D             Scarlet macaw  ======================
  D                    Parrot  ======================
          Tibetan ground jay  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
  D               Rock pigeon  ======================

Alignment block 18 of 861 in window, 43671780 - 43671783, 4 bps 
B D                     Human  -aggt
B D                     Chimp  -aggt
B D                   Gorilla  -aggt
B D                 Orangutan  -aggt
B D                    Gibbon  -aggt
B D                    Rhesus  -aggt
B D       Crab-eating macaque  -aggt
B D                    Baboon  -aggt
B D              Green monkey  -aggt
B D                  Marmoset  -aggt
B D           Squirrel monkey  -aggt
B D                  Bushbaby  -aggc
           Chinese tree shrew  -aggt
B D                  Squirrel  -aggc
       Lesser Egyptian jerboa  -aggc
                 Prairie vole  -aggc
               Golden hamster  -aggc
B D                     Mouse  -aggc
B D                       Rat  -aggc
B D            Naked mole-rat  -aggc
B D                Guinea pig  -acgg
                   Chinchilla  -aggc
             Brush-tailed rat  -aggc
B D                    Rabbit  -aggt
B D                      Pika  -aggt
B D                       Pig  -gggc
B D                    Alpaca  -aggc
               Bactrian camel  -aggc
B D                   Dolphin  -aggc
                 Killer whale  -aggc
             Tibetan antelope  -aggc
B D                       Cow  -aggc
B D                     Sheep  -aggc
                Domestic goat  -aggc
B D                     Horse  -aggc
B D          White rhinoceros  -aggc
B D                       Cat  -aggc
B D                       Dog  -aggc
B D                   Ferret   -aggc
B D                     Panda  -aggc
               Pacific walrus  -aggc
                 Weddell seal  -aggc
             Black flying-fox  -aggc
B D                   Megabat  -aggc
                Big brown bat  -aggc
         David's myotis (bat)  -aggc
B D                  Microbat  -aggc
B D                  Hedgehog  -gggt
B D                     Shrew  -gggt
              Star-nosed mole  -aggt
B D                  Elephant  -aggt
          Cape elephant shrew  -aggc
B D                   Manatee  -aggt
             Cape golden mole  -aggt
B D                    Tenrec  -aggt
                     Aardvark  -aggt
B D                 Armadillo  -aggc
B D                   Opossum  -gggt
B D           Tasmanian devil  -gggt
B D                   Wallaby  -gggt
B D                  Platypus  -gggt
  D       Collared flycatcher  -aggt
  D    White-throated sparrow  -aggc
B D       Medium ground finch  -aggc
B D               Zebra finch  -aggc
           Tibetan ground jay  -aggc
B D                Budgerigar  -aggc
  D                    Parrot  -aagc
  D             Scarlet macaw  -aagc
  D              Mallard duck  -aggc
B D        American alligator  -aggt
  D           Green seaturtle  -aggc
  D            Painted turtle  -aggc
  D  Chinese softshell turtle  -aggt
B D                    Lizard  -aggc
B D                Coelacanth  -cggc
B D              Nile tilapia  -gggc
          Princess of Burundi  -gggc
        Burton's mouthbreeder  -gggc
                  Zebra mbuna  -gggc
          Pundamilia nyererei  -gggc
B D                    Medaka  -aggt
           Southern platyfish  -cggc
B D              Atlantic cod  -gggt
B D                 Zebrafish  -gggt
                  Spotted gar  -tggt
B D                   Lamprey  tggg-
B D               Stickleback  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====

Alignment block 19 of 861 in window, 43671784 - 43671788, 5 bps 
B D                     Human  --gttct
B D                     Chimp  --gttct
B D                   Gorilla  --gttct
B D                 Orangutan  --gttcc
B D                    Gibbon  --gttct
B D                    Rhesus  --gttct
B D       Crab-eating macaque  --gttct
B D                    Baboon  --gttct
B D              Green monkey  --gttct
B D                  Marmoset  --gttct
B D           Squirrel monkey  --gttct
B D                  Bushbaby  --attct
           Chinese tree shrew  --gttct
B D                  Squirrel  --gttct
       Lesser Egyptian jerboa  --tttct
                 Prairie vole  --cttct
               Golden hamster  --ctcct
B D                     Mouse  --cttct
B D                       Rat  --cttct
B D            Naked mole-rat  --cggac
B D                Guinea pig  --ccacc
                   Chinchilla  --cggct
             Brush-tailed rat  --tggcc
B D                    Rabbit  --gttct
B D                      Pika  --gtttt
B D                       Pig  --ctgcc
B D                    Alpaca  --ctgcc
               Bactrian camel  --ctgcc
B D                   Dolphin  --ctgct
                 Killer whale  --ctgct
             Tibetan antelope  --ctgcc
B D                       Cow  --ctgcc
B D                     Sheep  --ctgcc
                Domestic goat  --ctgcc
B D                     Horse  --cttct
B D          White rhinoceros  --cttct
B D                       Cat  --tttct
B D                       Dog  --cttct
B D                   Ferret   --cttcc
B D                     Panda  --tttct
               Pacific walrus  --tttct
                 Weddell seal  --tttct
             Black flying-fox  --cttct
B D                   Megabat  --cttct
                Big brown bat  --cttct
         David's myotis (bat)  --ttgct
B D                  Microbat  --tttct
B D                  Hedgehog  --ctctg
B D                     Shrew  --ctcgg
              Star-nosed mole  --cttct
B D                  Elephant  --tttct
          Cape elephant shrew  --tttct
B D                   Manatee  --gttct
             Cape golden mole  --cttct
B D                    Tenrec  --ctgcg
                     Aardvark  --tttcc
B D                 Armadillo  --atccc
B D                   Opossum  --tttcc
B D           Tasmanian devil  --ttgtt
B D                   Wallaby  --ttgcc
B D                  Platypus  --ttgcg
  D       Collared flycatcher  --ttctg
  D    White-throated sparrow  --ttttg
B D       Medium ground finch  --ttttg
B D               Zebra finch  --ttttg
           Tibetan ground jay  --ttttg
B D                Budgerigar  --ttttg
  D                    Parrot  --ttttg
  D             Scarlet macaw  --ttttg
  D              Mallard duck  --ttgtg
B D        American alligator  --ttgtt
  D           Green seaturtle  --ttctg
  D            Painted turtle  --ctctg
  D  Chinese softshell turtle  --ttctg
B D                    Lizard  --tttga
B D                Coelacanth  --ttctt
B D              Nile tilapia  ------t
          Princess of Burundi  ------t
        Burton's mouthbreeder  ------t
                  Zebra mbuna  ------t
          Pundamilia nyererei  ------t
B D                    Medaka  ------t
           Southern platyfish  ------t
B D               Stickleback  --gtgct
B D              Atlantic cod  ------c
B D                 Zebrafish  ------t
                  Spotted gar  ------t
B D                   Lamprey  ccctt--
B D                    Turkey  =======
B D                   Chicken  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======

Inserts between block 19 and 20 in window
B D             Nile tilapia 4bp
         Princess of Burundi 4bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 4bp
B D                   Medaka 4bp
          Southern platyfish 4bp
B D              Stickleback 4bp
B D             Atlantic cod 4bp
B D                Zebrafish 4bp
                 Spotted gar 4bp

Alignment block 20 of 861 in window, 43671789 - 43671797, 9 bps 
B D                     Human  tgagtagca
B D                     Chimp  tgagtagca
B D                   Gorilla  tgagtagca
B D                 Orangutan  tgagtagca
B D                    Gibbon  tgagtagca
B D                    Rhesus  tgagtagca
B D       Crab-eating macaque  tgagtagca
B D                    Baboon  tgagtagca
B D              Green monkey  tgagtagca
B D                  Marmoset  tgagtagca
B D           Squirrel monkey  tgagtagca
B D                  Bushbaby  tgagtagga
           Chinese tree shrew  tgagtagga
B D                  Squirrel  tgagtagca
       Lesser Egyptian jerboa  tgagtagga
                 Prairie vole  ggagtagca
               Golden hamster  tgagtagtt
B D                     Mouse  ggagtagca
B D                       Rat  ggagtagcg
B D            Naked mole-rat  cgagtagca
B D                Guinea pig  cgagtagca
                   Chinchilla  ggagtagca
             Brush-tailed rat  tgtgtagga
B D                    Rabbit  cgagtagca
B D                      Pika  tgagtagca
B D                       Pig  cgagtagga
B D                    Alpaca  cgagtagga
               Bactrian camel  cgagtagga
B D                   Dolphin  cgcgtagga
                 Killer whale  cgcgtagga
             Tibetan antelope  cgtgtagga
B D                       Cow  cgtgtagga
B D                     Sheep  cgtgtagga
                Domestic goat  cgtgtagga
B D                     Horse  agagtagga
B D          White rhinoceros  tgagtagga
B D                       Cat  tgagtagga
B D                       Dog  tgagtagga
B D                   Ferret   tgagtagga
B D                     Panda  tgagtagga
               Pacific walrus  tgagtagga
                 Weddell seal  tgagtagga
             Black flying-fox  tgagtagga
B D                   Megabat  tgagtagga
                Big brown bat  tgagtagcg
         David's myotis (bat)  tgagtagca
B D                  Microbat  tgagtagca
B D                  Hedgehog  tgagtagaa
B D                     Shrew  agcgtagca
              Star-nosed mole  tgagtagga
B D                  Elephant  tgagtagga
          Cape elephant shrew  cgaatagga
B D                   Manatee  tgagtagga
             Cape golden mole  tgagtagga
B D                    Tenrec  agagtagca
                     Aardvark  tgagtagga
B D                 Armadillo  tgagtagga
B D                   Opossum  cgtgtagca
B D           Tasmanian devil  tgtatagtt
B D                   Wallaby  tgtgtagtt
B D                  Platypus  ggagtagtt
  D               Rock pigeon  tgtatattt
  D       Collared flycatcher  tgtatattt
  D    White-throated sparrow  tgtatattt
B D       Medium ground finch  tgtatattt
B D               Zebra finch  tgtatattt
           Tibetan ground jay  tgtatattt
B D                Budgerigar  tgtgtatgt
  D                    Parrot  tgtgtatgt
  D             Scarlet macaw  tgtgtatgt
  D              Mallard duck  tgtatattt
B D        American alligator  cccatatct
  D           Green seaturtle  cccatagtt
  D            Painted turtle  cctatagtt
  D  Chinese softshell turtle  cccatagct
B D                    Lizard  tccataatt
B D                Coelacanth  cccataatt
B D              Nile tilapia  accataacg
          Princess of Burundi  accataacg
        Burton's mouthbreeder  accataacg
                  Zebra mbuna  accataacg
          Pundamilia nyererei  accataacg
B D                    Medaka  accatagcg
           Southern platyfish  accgtaccg
B D               Stickleback  accgtaacg
B D              Atlantic cod  gccgtactg
B D                 Zebrafish  gttgtatct
                  Spotted gar  cccatattg
B D                   Lamprey  cgtataacg
B D                    Turkey  =========
B D                   Chicken  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========

Alignment block 21 of 861 in window, 43671798 - 43671910, 113 bps 
B D                     Human  gacattgtccctcagaaggggtgaccccacgggcatgcgcaccctgttccagcgggggccttttttgtag
B D                     Chimp  gacattgtccctcagaaggggtgaccccacgggcatgcgcaccctgttccagcgggggccttttttgtag
B D                   Gorilla  gacattgtccctcagaaggggtgaccccacgggcatgcgcaccctgttccagcgggggccttttttgtag
B D                 Orangutan  gacattatccctcagaaggggtgaccccacgggcatgcgcaccctgttccagcgggggccttttttgtag
B D                    Gibbon  gacattgtccctcaggaggggtgaccccacaggcatgcgcaccctgttccagcgggggccttttttgtag
B D                    Rhesus  gacattgtccctcaggaggggtgaccccacgggcatgcacaccttgttccagcgggggcctttcttgtag
B D       Crab-eating macaque  gacattgtccctcaggaggggtgaccccacgggcatgcacaccttgttccagcgggggcctttcttgtag
B D                    Baboon  gacattgtccctcaggaggggtgaccccacgggcatgcacaccttgttccagcgggggcctttcttgtag
B D              Green monkey  gacattgtccctcaggaggggtgaccccacgggcatgcacaccttgttccagcgggggccttttttgtag
B D                  Marmoset  gacattgtccctcaggaggggtgaccccacgggcatgagcaccctgttccagcgggggccttttttgtag
B D           Squirrel monkey  gacattgtccctcaggaggggtgaccccacgggcatgggcaccttgttccagcgggggccttttttgtag
B D                  Bushbaby  gatgttgtccttcagtaggggtgaccccacagccatgcgcaccttgttccagcggtgaccttttttatag
           Chinese tree shrew  gatgttgtccttcaggaggggtgaccccacggccatgtgcaccttgttccagcggtgacctttattgtag
B D                  Squirrel  gatgttgtcctttaggagtggtgaccccacagccatgcccaccttgttccagcgggcaccttttttgtag
       Lesser Egyptian jerboa  gacgttatccttcaagagtggtgaccccacagccatgccaaccttgttccagcggcggcctctgttgtag
                 Prairie vole  gacattgtccttcaggagtggtgaccccacagccatccccaccttatcccaacggtggccttttttatag
               Golden hamster  gacattgtccttcaggagtggtgaccccacggccatacccaccttattccaacggggcccttttttgtag
B D                     Mouse  gacattgtctttcaggagtggtgaccccacggccatacccaccttgttccaacggtggccttttttatag
B D                       Rat  gacattgtctttcaggagaggtgatcccacggccatacccaccttgttccaagggtggcctttcttgtag
B D            Naked mole-rat  gatgttgtccttcaggagtggtgaccccacagccatgcgcaccttcttccagcgggggccttttttatag
B D                Guinea pig  gatgttgtccttcagcagtggtgagcccacagccatgcgcaccttgttccagcggtggccttttttgtag
                   Chinchilla  gatgttgtccttcaggagtggtgaccccacagccatgcgcaccttgtcccagcggtggccttttttatag
             Brush-tailed rat  gatattgtccttcaggagtggtgacccgacagccatgcgcaccttgtcccagcggtggccttttttgtag
B D                    Rabbit  gacgttgtccctcaggaggggcgagcccacgggcatgcgcaccttgttccagcggtggcctctgttgtag
B D                      Pika  gacattgtccttcaagagcggtgagcccacgggcatgcacaccttgttccagcggtggcctttgttgtag
B D                       Pig  gacgttgtccttcaagaggggggaccccacgggcatgcgcaccttgttccagcggtggcctttgttgtag
B D                    Alpaca  gacattgtccttcaggaggggggaccccacagccatgtgcaccctgttccagcggtggcctttgttgtag
               Bactrian camel  gatattgtccttcaggaggggggaccccacagccatgcgcaccctgttccagcggtggcctttgttgtag
B D                   Dolphin  gacgttgtccttcaggaggggggaccccacggccatgcgcaccttgttccagcggtggcctttgttgtag
                 Killer whale  gacgttgtccttcaggaggggggaccccacggccatgcgcaccttgttccagcggtggcctttgttgtag
             Tibetan antelope  gacgttgtccttcaggaggggggaccccacagccatgcgcaccttgttccagcggtggcctttgttgtag
B D                       Cow  gacgttgtccttcaggaggggggaccccacagccatgcgaaccttgttccagcggtggcctttgttgtag
B D                     Sheep  gacgttgtccttcaggaggggggaccccacagccatgcgcaccttgttccagcggtggcctttgttgtag
                Domestic goat  gacgttgtccttcaggaggggggaccccacagccatgcgcaccttgttccagcggtggcctttgttgtag
B D                     Horse  gacattgtctttcaggaggggtgacccaacagccatgcgcaccttgttccagcggtggcctttattgtag
B D          White rhinoceros  gatgttgtctttcaggaggggtgacccgacagccatgcgcaccttgttccagcggtggcctttattgtag
B D                       Cat  gacgttgtctttcaggaggggtgaccccacagccatgcgcactttgttccagcggtggcctttattatag
B D                       Dog  gatgttgtctttcaggaggggcgaccccacagccatgcgtactttgttccagcggtggcctttattatag
B D                   Ferret   gacgttgtctttcaggaggggtgaccccacagccatacgcactttgttccagcggtggcctttattatag
B D                     Panda  gacgttgtctttcaggaggggtgaccccacggccatgcgcaccttgttccagcggtggcctttgttatag
               Pacific walrus  gacgttgtctttcaggaggggtgaccccacggccatgcgcactttgttccagcggtggcctttattatag
                 Weddell seal  gacgttgtctttcaggaggggtgaccccacggccatgcgcactttgttccagcggtggcctttattatag
             Black flying-fox  gatgttgtctttcaggaggggtgatcccacagccatgcgcaccttgttccagcggtggcctttattgtag
B D                   Megabat  gatgttgtctttcaggaggggtgatcccacagccatgcgcaccttgttccagcggtggcctttattgtag
                Big brown bat  gacgttgtctttcaggaggggtgatcccacggccatgcgcaccttattccagcggtggcctttattgtag
         David's myotis (bat)  gacgttgtctttcaggaggggcgatcccacagccatgcgcaccttattccagcggtggcctttattgtag
B D                  Microbat  gacgttgtctttcaggaggggtgatcccacagccatgcgcaccttattccagcggtggcctttattgtag
B D                  Hedgehog  gacgttgtctttcaggaggggggaccccacagccatgcgcaccttgttccagcggtgacctttattgtag
B D                     Shrew  gacattgtctctgaggaggggagaccccacagccatgcgcaccttgttccagcggtggcctttattgtag
              Star-nosed mole  ggtgttgtctttcaggaggggtgaccccacagccatgcgcaccttgttccagcgatgccctttattgtag
B D                  Elephant  gacattgtccttcagcaggggtgaccccacagccatgcgtactttgttccagcggtggcctttattgtag
          Cape elephant shrew  gacattgtccttcagcaggggggaccccacagccatgcgcactttgttccagcggtggcctttattgtag
B D                   Manatee  gacattgtccttcagcaggggggaccccacagccatgcgcactttgttccagcggtggcctttattgtag
             Cape golden mole  gacattgtccttcagcaggggtgaccctacagccatgcgcactttattccagcggtggcctttattgtag
B D                    Tenrec  gacgttgtctttgagcaggggtgagcccacaggcatgcgcactttgttccagcgggggcccttcttgtaa
                     Aardvark  gacgttgtccttcagcaagggcgaccccacggccatgcgcactttgttccagcggtggcctttattgtag
B D                 Armadillo  gacgttgtccttcaacaggggtgaccccacggccatgcgtactttgttccagcgggggcctttgttgtag
B D                   Opossum  gacattatccttcagcaggggggaacccacagccattcgaactttgttccattttggacctttctttaag
B D           Tasmanian devil  gacattatccttaagcaagggggagcccacaggcattcgaactttgttccattttggacctttctttaag
B D                   Wallaby  gacattatccttaagcagaggggagcccacagccatttgaactttgttccattttggacctttctttaag
B D                  Platypus  gacgttatccttgagcaagggcgaacctacggccatcttcactcggttccagcgcgggcccttcttgaag
  D               Rock pigeon  gacattatccttcagcaaagggtgtccgactggcaagggttttttgcaccacttagggcctctcctccag
  D       Collared flycatcher  gacattatccttcagcaaagggtgtccgactgcatagggctttttgcaccacttagggcccctcttccaa
  D    White-throated sparrow  gatattatccttcagcaaagggtgtccaactggatagggctttttgcaccacttagggcccctcttccaa
B D       Medium ground finch  gatattatccttcagcaaagggtgtccaactggatagggctttttgccccacttagggcccctcttccaa
B D               Zebra finch  gatattatccttcagcaaagggtgtccgaccggaaagggctttttgcaccacttagggcccctcttccaa
           Tibetan ground jay  gacattatccttcagcaaagggtgtccaactggaaagggctttttgcaccacttaggacccctcttccaa
B D                Budgerigar  gacattatctttcagcaaagggtgtccgactgggaagggctttttgcaccacttggggcccctcttccag
  D                    Parrot  gacattatctctcagcaaagggtgtccgactgggaagggctttttgcaccacttggggcccctcttccag
  D             Scarlet macaw  gacattatctttcagcaaagggtgtccgactgggaagggctttttgcaccacctggggcccctcttccag
  D              Mallard duck  gacattatccttcagcaaggggtgtccaactggcatggggactttgcaccacttagggcctctcgtccag
B D                   Chicken  gacgttatccttcagaagaaggtgtccaactggcatgggaactctgcaccacttagggcccctcttccag
B D                    Turkey  gacattatctttcagaagaaggtttccaactggcataggaactttgcaccacttagggcccctcttccag
B D        American alligator  gatgttgtcctgcagcacaggatgtccaactaccttggggactttgcaccatttgtggcctttgttccag
  D           Green seaturtle  gatgttatccattagcaaggggtgtccaacacggaaggggactctgcaccacttaggacccctcttccag
  D            Painted turtle  gatgttattcatcagcaaggggtgtccaacacgaaaggggactcggcaccacttagggcctctcttccag
  D  Chinese softshell turtle  gatattatccatcagcaaggggtgtccaacacggaaggggattctacaccacttagggcctctcttccag
B D                    Lizard  aacattatctctgaggatgggatgtgatatcggcataggaaccttgcaccactttcggcccttgttgtag
B D                Coelacanth  aatgttgtcctgcagtcttgggtgtccaaccaccatccgctttttgcaccacttcaggcctttcctccaa
B D              Nile tilapia  cacattgttctttagtattgggtggccaacaggcatgcgcttcttacaccatttcagtccagttttatag
          Princess of Burundi  cacattgttctttagtattgggtggccaacaggcatacgcttcttacaccacttcagtccagttttatag
        Burton's mouthbreeder  cacattgttctttagtattgggtggccaacaggcatacgcttcttacaccacttcagtccagttttatag
                  Zebra mbuna  cacattgttctttagtattgggtggccaacaggcatacgcttcttacaccacttcagtccagttttatag
          Pundamilia nyererei  cacattgttctttagtattgggtggccaacaggcatacgcttcttacaccacttcagtccagttttatag
B D                    Medaka  cacattgttcttgagagctggatgacccacagccatgcgcttcttacaccacttcagtccagttttatag
           Southern platyfish  cacgttgttcttcagtgccgggtgacctacatccatgcgcttcttgcaccacttcagtccactcttatag
B D               Stickleback  cacattgtcctggagaagccggttgccaaccaccatgcgcttcttacaccacttcagtccacttctatat
B D              Atlantic cod  tacgttgttcttgagcgcggggtcgccgaccggcatgcgcctcttgcaccatttgagaccggttctgacg
B D                 Zebrafish  gacattgtttttcagggcaggatgtccaacaaccattctattcttacaccacttcagccctgtccagtag
                  Spotted gar  gacattatcttgcagtttatagtggcctacaggcattggtttcttgcaccatttcagtccttttttccaa
B D                   Lamprey  cacgttgtccttgagaatgggatcgcccacaggcatggtctttttgaatcccttgtgcccccttttccat
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================

                        Human  atgggcttgacggagccaggagcccagcgcgtcaggtacctgt
                        Chimp  atgggcttgacggagccaggagcccagcgcgtcaggtacctgt
                      Gorilla  atgggcttgacggagccaggagcccagcgcgtcaggtacctgt
                    Orangutan  atgggcttgacggagccaggagcccaacgcgtcaggtacctgt
                       Gibbon  ataggcttgacggagccaggagcccagcgcgtcaggtacctgt
                       Rhesus  atgggcttgacggagccaggagcccagcgcgtcaggtacctgt
          Crab-eating macaque  atgggcttgacggagccaggagcccagcgcgtcaggtacctgt
                       Baboon  atgggcttgacggagccaggagcccagcgcgttaggtacctgt
                 Green monkey  atgggcttgacagagccaggagcccagcgcgtcaggtacctgt
                     Marmoset  atgggcttgacggacttgggagcccagcgcgtcaggtacctgt
              Squirrel monkey  atgggcttgacggacttgggagaccagcgcgtcaggtacctgt
                     Bushbaby  atgggcttgacggaacggggagaccagcgagtcaggtacctgt
           Chinese tree shrew  atgggcttgacagaacggggagaccagcgggtcaggtagctgt
                     Squirrel  atgggcttgacggagtggggagaccagcgggtcagataactgt
       Lesser Egyptian jerboa  atgggcttcacggagctgggagcccagcgggtcaggtagctgt
                 Prairie vole  atgggcttgacagagctgggagcccagcgagtcaggtagctgt
               Golden hamster  atgggcttgacagagctgggagcccagcgagtcaggtagctgc
                        Mouse  atgggcttgacggacttgggagcccagcgagtcagatagctgt
                          Rat  attggcttgacggacttgggagcccagcgagtcagatagctgt
               Naked mole-rat  atgggcttgactgagtgtggggaccagcgggtgaggtagctgt
                   Guinea pig  atgggtttgacagagcgtggagcccagcgggtgaggtagctat
                   Chinchilla  atgggcttgacagagcgtggagaccagcgggtgaggtagctat
             Brush-tailed rat  atgggcttgacagagcgtgtagaccagcgggtgaggtagctat
                       Rabbit  atgggcctggcggagcggggggaccagcgggtcaggtagctgt
                         Pika  atgggcttgacggagcggggagaccagcgggtcaggtagctgt
                          Pig  atgggcttgacagagcggggagaccagcgggtcaggtacctgt
                       Alpaca  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
               Bactrian camel  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
                      Dolphin  atgggcttgacggagcggggagaccagcgggtgaggtacctgt
                 Killer whale  atgggcttgacggagcggggagaccagcgggtgaggtacctgt
             Tibetan antelope  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
                          Cow  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
                        Sheep  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
                Domestic goat  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
                        Horse  atgggcttgacagagcggggagaccagcgggtcaggtacctgt
             White rhinoceros  atgggcttgacagagcggggagaccagcgggtcaggtacctgt
                          Cat  atgggcttgacggagcggggagaccagcgggtcaggtacctgt
                          Dog  atgggcttgactgaacggggagaccagcgggtcaggtacctgt
                      Ferret   atgggcttgacagagcggggagaccagcgggtcaggtacctgt
                        Panda  atgggcttgacagagcggggcgaccagcgggtcaggtacctgt
               Pacific walrus  atgggcttgacagagcgtggagaccagcgggtcaggtacctgt
                 Weddell seal  atgggcttgacagagcgtggagaccagcgcgtcaggtacctgt
             Black flying-fox  atgggcttgacagagcgaggggaccagcgggtcaggtacctgt
                      Megabat  atgggcttgacagagcgaggggaccagcgggtcaggtacctgt
                Big brown bat  atgggcttgacggagcggcgggaccagcgggtcaggtacctgt
         David's myotis (bat)  atgggcttgacggagcggcgggaccagcgggtcaggtacctgt
                     Microbat  atgggcttgacggagcggcgggaccagcgggtcaggtacctgt
                     Hedgehog  ataggcttgacagagtggggagaccatcgggtcaggtacctgt
                        Shrew  atgggcttgacggaccgggtggaccaacgggtcaggtacctga
              Star-nosed mole  atgggtttgacagagtggggagaccagcgggtcaggtacctgc
                     Elephant  atgggcttgacagaggtgcgagaccagcgggtcaggtacctgt
          Cape elephant shrew  atgggcttgacggatttgggagaccaacgtgtcaggtatc--t
                      Manatee  atgggcttgacagacctgcgagaccagcgggtcaggtacctgt
             Cape golden mole  atgggtctgacggacctgggagaccaccgggtcaggtacctgt
                       Tenrec  atgggcttggcggatctgcaagaccagcgcgtcaggtacctgc
                     Aardvark  atgggcttgacggagctgggagaccagcgggtcaggtacctat
                    Armadillo  atgggcttgacggatcggcgagaccagcgggtcaggtacctga
                      Opossum  atgggcttgacagagcggggagcccaacgggtcaggtatctgt
              Tasmanian devil  atgggtttgacagagcggggagcccatcgtgtcaggtacctgt
                      Wallaby  atgggtttgacagagcggggagcccaacgagtcaggtacctgt
                     Platypus  atgggcttgacggagcgggcggaccagcgggtcaggtacctac
                  Rock pigeon  atgggctttgcagatttgacggaccaacgcgtcagatacctgt
          Collared flycatcher  atgggctttgcagatctgacgggccagcgggtcaggtacctgt
       White-throated sparrow  atgggctttgcagatctgacgggccagcgggtcaggtacctgt
          Medium ground finch  atgggctttgcagatctgacgggccagcgggtcaggtacctgt
                  Zebra finch  atgggctttgcagatctgacgggccagcgggtcaggtacctgt
           Tibetan ground jay  atgggttttgcagatctgacgggccagcgggtcaggtacctgt
                   Budgerigar  atgggctttgcagacctgatggaccagcgggtcagatacctgt
                       Parrot  atgggctttgcagacctgatggaccagcgggtcagatacctgt
                Scarlet macaw  atgggctttgcagacctgatggaccagcgggtcagatacctgt
                 Mallard duck  atgggctttgcagatctgacggaccagcgggtcagatacctgt
                      Chicken  atgggctttgcagatctgacggaccagcgagtcagatacctgt
                       Turkey  atgggctttgcagatctgacggaccagcgagtcagatacctgt
           American alligator  ataggtttggcagatttgatggaccaccgggtgagatacctgt
              Green seaturtle  atgggcttagcagatctgactgaccagcgggtaagatacctgt
               Painted turtle  atgggcttagcagatctgactgaccagcgggtaagatacctgt
     Chinese softshell turtle  atgggcttagcagatctgactgaccagcgagtaaggtacctgt
                       Lizard  atgggcttcatagatttgatagaatatcgggtaagatacctgt
                   Coelacanth  attggctttacagagtcgattgaccagcgagtgagatacctgc
                 Nile tilapia  atgggtttcactgagtcgatggaccagcgagttaggtatctgc
          Princess of Burundi  atgggtttcactgagtcgatggaccagcgagtcaggtatctgt
        Burton's mouthbreeder  atgggtttcactgagtcgatggaccagcgagtcaggtatctgt
                  Zebra mbuna  atgggtttcactgagtcaatggaccagcgagtcaggtatctgt
          Pundamilia nyererei  atgggtttcactgagtcgatggaccagcgagtcaggtatctgt
                       Medaka  atgggttttacagagtcaatagaccaccgtgtcaggtacctgc
           Southern platyfish  atgggtttcaccgaatcaatggaccagcgagtcaagtatctgt
                  Stickleback  atgggtttggccgtgtcaatggaccagcgagtgaggtatctgt
                 Atlantic cod  aagggcttcaccgagcctatggaccagcgggtgaggtacctgt
                    Zebrafish  atgggcttcacagacttcacagagtaccgtgtcagatatctgc
                  Spotted gar  ataggcttcactgtgtcaacagaccaacgggttaaatacctat
                      Lamprey  atgggcttggctgtgcccacggcccagcgagtcaggtagctgc
             Peregrine falcon  ===========================================
                 Saker falcon  ===========================================

Inserts between block 21 and 22 in window
B D             Nile tilapia 5bp
         Princess of Burundi 5bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 5bp
         Pundamilia nyererei 5bp
B D                   Medaka 1713bp
          Southern platyfish 11bp
B D              Stickleback 642bp

Alignment block 22 of 861 in window, 43671911 - 43671914, 4 bps 
B D                     Human  gga------g
B D                     Chimp  gga------g
B D                   Gorilla  gga------g
B D                 Orangutan  gga------a
B D                    Gibbon  gga------g
B D                    Rhesus  gga------g
B D       Crab-eating macaque  gga------g
B D                    Baboon  gga------g
B D              Green monkey  gga------g
B D                  Marmoset  gga------g
B D           Squirrel monkey  gga------g
B D                  Bushbaby  gaa------g
           Chinese tree shrew  g-c------g
B D                  Squirrel  gga------g
       Lesser Egyptian jerboa  gaa------g
                 Prairie vole  gga------g
               Golden hamster  aga------g
B D                     Mouse  agt------g
B D                       Rat  agt------g
B D            Naked mole-rat  gga------g
B D                Guinea pig  gga------g
                   Chinchilla  cga------g
             Brush-tailed rat  gga------g
B D                    Rabbit  gga------g
B D                      Pika  gga------g
B D                       Pig  gga------g
B D                    Alpaca  gga------g
               Bactrian camel  gga------g
B D                   Dolphin  gga------g
                 Killer whale  gga------g
             Tibetan antelope  tag------g
B D                       Cow  ggg------g
B D                     Sheep  tag------g
                Domestic goat  tag------g
B D                     Horse  gga------g
B D          White rhinoceros  aca------g
B D                       Cat  gga------g
B D                       Dog  gga------g
B D                   Ferret   gga------g
B D                     Panda  gga------g
             Black flying-fox  gga------a
B D                   Megabat  gga------a
                Big brown bat  gga------g
         David's myotis (bat)  gga------g
B D                  Microbat  gga------g
B D                  Hedgehog  ggaacaaccg
B D                     Shrew  gga------g
              Star-nosed mole  aga------g
B D                  Elephant  gga------g
          Cape elephant shrew  gga------g
B D                   Manatee  aga------a
             Cape golden mole  gga------g
B D                    Tenrec  gga------g
                     Aardvark  gga------g
B D                 Armadillo  gga------g
B D                   Opossum  aaa------g
B D           Tasmanian devil  aaa------g
B D                   Wallaby  aga------a
B D                  Platypus  ggg------a
  D               Rock pigeon  caa------a
  D       Collared flycatcher  caa------a
  D    White-throated sparrow  caa------a
B D       Medium ground finch  gaa------a
B D               Zebra finch  caa------a
           Tibetan ground jay  caa------a
B D                Budgerigar  tga------a
  D                    Parrot  cga------a
  D             Scarlet macaw  cga------a
  D              Mallard duck  tga------g
B D                   Chicken  caa------a
B D                    Turkey  caa------a
B D        American alligator  gaa------c
  D           Green seaturtle  aaa------a
  D            Painted turtle  aaa------a
  D  Chinese softshell turtle  aaa------a
B D                    Lizard  gaa-------
B D                Coelacanth  aa--------
B D              Atlantic cod  ggg------g
B D                 Zebrafish  --a------a
                  Spotted gar  aaa------g
B D                   Lamprey  caa------g
                Weddell seal  ----------
              Pacific walrus  ----------
          Southern platyfish  ==========
B D               Stickleback  ==========
B D                    Medaka  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========

Inserts between block 22 and 23 in window
  D             Mallard duck 7109bp
B D       American alligator 1bp
B D                Zebrafish 9bp
                 Spotted gar 7bp

Alignment block 23 of 861 in window, 43671915 - 43671924, 10 bps 
B D                     Human  ggaga-------------acaaa
B D                     Chimp  ggaga-------------acaaa
B D                   Gorilla  ggaga-------------acaaa
B D                 Orangutan  ggaga-------------acaaa
B D                    Gibbon  ggaga-------------acaaa
B D                    Rhesus  ggaga-------------acaaa
B D       Crab-eating macaque  ggaga-------------acaaa
B D                    Baboon  ggaga-------------acaaa
B D              Green monkey  ggaga-------------acaaa
B D                  Marmoset  ggaga-------------acaaa
B D           Squirrel monkey  ggaga-------------acaaa
B D                  Bushbaby  ggagg-------------acaag
           Chinese tree shrew  ggagg-------------acaga
B D                  Squirrel  gaagc-------------acaag
       Lesser Egyptian jerboa  ggagc-------------acgag
                 Prairie vole  ggaac-------------acaag
               Golden hamster  gaaac-------------acaat
B D                     Mouse  ggaac-------------ac-aa
B D                       Rat  agaac-------------acaaa
B D            Naked mole-rat  aaagc-------------at-ag
B D                Guinea pig  gaagc-------------at-ag
                   Chinchilla  aaagc-------------ac-ag
             Brush-tailed rat  aaggc-------------ac-ag
B D                    Rabbit  tgagg-------------acaag
B D                      Pika  ggaga-------------ccgag
B D                       Pig  ggagg-------------a-cgg
B D                    Alpaca  ggagg-------------gccag
               Bactrian camel  ggagg-------------gccag
B D                   Dolphin  cgagg-------------a-tga
                 Killer whale  tgagg-------------a-tga
             Tibetan antelope  ggagg-------------a-tgg
B D                       Cow  ggagg-------------a-tgg
B D                     Sheep  ggagg-------------a-tgg
                Domestic goat  ggagg-------------a-tgg
B D                     Horse  ggagg-------------a-tgg
B D          White rhinoceros  ggagg-------------accag
B D                       Cat  ggagg-------------gtagg
B D                       Dog  ggagg-------------ggagg
B D                   Ferret   ggaga-------------gcaat
B D                     Panda  ggagg-------------gtagg
               Pacific walrus  ggagg-------------gtagg
                 Weddell seal  ggagg-------------gtagg
             Black flying-fox  ggagg-------------accag
B D                   Megabat  ggagg-------------accag
                Big brown bat  ggagg-------------acc-a
         David's myotis (bat)  ggagg-------------accaa
B D                  Microbat  ggagg-------------accaa
B D                  Hedgehog  ggagg-------------g----
B D                     Shrew  ggagg-------------c----
              Star-nosed mole  ggagg-------------a----
B D                  Elephant  ggagg-------------ataag
          Cape elephant shrew  ggaga-------------acaca
B D                   Manatee  ggagg-------------ataag
             Cape golden mole  gaggg-------------acaag
B D                    Tenrec  g-ggg-------------acaag
                     Aardvark  g--gg-------------acaag
B D                 Armadillo  ggcgg-------------acaag
B D                   Opossum  ggagg----caggataatataat
B D           Tasmanian devil  gaaggtatatagaatagtacaat
B D                   Wallaby  gaaggtagacagaatagtataat
B D                  Platypus  cggga-------------cgaag
  D               Rock pigeon  --aca-------------acaca
  D       Collared flycatcher  --aaa-------------acaca
  D    White-throated sparrow  --aca-------------acaca
B D       Medium ground finch  --aca-------------acaca
B D               Zebra finch  --aaa-------------acaca
           Tibetan ground jay  --aca-------------acaca
B D                Budgerigar  --aca-------------acaca
  D                    Parrot  --aca-------------acaaa
  D             Scarlet macaw  --aca-------------acaca
B D                   Chicken  --aca-------------ataca
B D                    Turkey  --aga-------------ataca
B D        American alligator  --aag-------------aaaca
  D           Green seaturtle  ------------------acaga
  D            Painted turtle  ------------------acaga
  D  Chinese softshell turtle  ------------------acaga
B D                    Lizard  gaaaa-------------gcaga
B D                Coelacanth  -gaag-------------attga
B D              Nile tilapia  aaa--------------------
          Princess of Burundi  aaa--------------------
        Burton's mouthbreeder  aaa--------------------
                  Zebra mbuna  aaa--------------------
          Pundamilia nyererei  aaa--------------------
           Southern platyfish  aga--------------------
B D              Atlantic cod  aga--------------------
B D                 Zebrafish  aga--------------------
                  Spotted gar  aaa--------------------
B D                   Lamprey  tgaca-------------acaaa
B D               Stickleback  =======================
B D                    Medaka  =======================
  D              Mallard duck  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================

Inserts between block 23 and 24 in window
  D              Rock pigeon 8050bp
  D      Collared flycatcher 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 6615bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
B D                  Chicken 6682bp
B D                   Turkey 6491bp
B D       American alligator 1bp
  D          Green seaturtle 6bp
  D           Painted turtle 6bp
  D Chinese softshell turtle 6bp
B D               Coelacanth 1bp
          Southern platyfish 729bp
B D                  Lamprey 9bp

Alignment block 24 of 861 in window, 43671925 - 43671926, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  g-
B D                  Squirrel  ga
       Lesser Egyptian jerboa  gt
                 Prairie vole  aa
               Golden hamster  ga
B D                     Mouse  ga
B D                       Rat  ga
B D            Naked mole-rat  ga
B D                Guinea pig  gc
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                    Rabbit  ga
B D                      Pika  ac
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  ga
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  ga
B D                       Dog  ga
B D                   Ferret   ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  gg
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                  Elephant  ga
          Cape elephant shrew  ga
B D                   Manatee  ga
             Cape golden mole  ga
B D                    Tenrec  gt
                     Aardvark  ga
B D                 Armadillo  ga
B D                   Opossum  ga
B D           Tasmanian devil  ga
B D                   Wallaby  ga
B D                  Platypus  gg
  D       Collared flycatcher  ca
  D    White-throated sparrow  ca
B D       Medium ground finch  ca
B D               Zebra finch  ca
B D                Budgerigar  ca
  D                    Parrot  ca
  D             Scarlet macaw  ca
B D        American alligator  ga
  D           Green seaturtle  -a
  D            Painted turtle  -a
  D  Chinese softshell turtle  -a
B D                    Lizard  -a
B D                Coelacanth  aa
B D              Nile tilapia  ca
          Princess of Burundi  ca
        Burton's mouthbreeder  ca
                  Zebra mbuna  ca
          Pundamilia nyererei  ca
B D                 Zebrafish  ga
                  Spotted gar  ta
B D                   Lamprey  ga
B D                     Shrew  --
B D                  Hedgehog  --
             Star-nosed mole  --
B D              Atlantic cod  --
          Southern platyfish  ==
B D               Stickleback  ==
B D                    Medaka  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==

Inserts between block 24 and 25 in window
                 Spotted gar 12845bp

Alignment block 25 of 861 in window, 43671927 - 43671927, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  c
B D           Squirrel monkey  t
B D                  Bushbaby  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  c
                 Prairie vole  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  t
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   t
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  a
B D                  Platypus  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
B D                    Lizard  a
B D                Coelacanth  g
B D              Nile tilapia  g
          Princess of Burundi  g
        Burton's mouthbreeder  g
                  Zebra mbuna  g
          Pundamilia nyererei  g
B D              Atlantic cod  g
B D                 Zebrafish  g
B D                   Lamprey  g
B D                     Shrew  -
B D                  Hedgehog  -
             Star-nosed mole  -
          Chinese tree shrew  -
                 Spotted gar  =
          Southern platyfish  =
B D               Stickleback  =
B D                    Medaka  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =

Inserts between block 25 and 26 in window
B D               Coelacanth 20557bp
B D                Zebrafish 95bp

Alignment block 26 of 861 in window, 43671928 - 43671928, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -a
B D           Squirrel monkey  -g
B D                  Bushbaby  -g
B D                  Squirrel  -g
       Lesser Egyptian jerboa  -a
                 Prairie vole  -g
               Golden hamster  -g
B D                     Mouse  -g
B D                       Rat  -g
B D            Naked mole-rat  -g
B D                Guinea pig  -g
                   Chinchilla  -g
             Brush-tailed rat  -g
B D                    Rabbit  -g
B D                      Pika  -g
B D                       Pig  -g
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  -g
                 Killer whale  -g
             Tibetan antelope  -g
B D                       Cow  -g
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -g
B D          White rhinoceros  -g
B D                       Cat  -g
B D                       Dog  -g
B D                   Ferret   -g
B D                     Panda  -g
               Pacific walrus  -g
                 Weddell seal  -g
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
B D                  Elephant  -g
          Cape elephant shrew  -g
B D                   Manatee  -g
             Cape golden mole  -g
B D                    Tenrec  -t
                     Aardvark  -g
B D                 Armadillo  -g
B D                   Opossum  -g
B D           Tasmanian devil  -a
B D                   Wallaby  -g
B D                  Platypus  -g
  D       Collared flycatcher  -a
  D    White-throated sparrow  -a
B D       Medium ground finch  -a
B D               Zebra finch  -a
B D                Budgerigar  -a
  D                    Parrot  -a
  D             Scarlet macaw  -a
B D        American alligator  -a
  D           Green seaturtle  -a
  D            Painted turtle  -a
  D  Chinese softshell turtle  -a
B D                    Lizard  -g
B D              Nile tilapia  -a
          Princess of Burundi  -a
        Burton's mouthbreeder  -a
                  Zebra mbuna  -a
          Pundamilia nyererei  -a
B D              Atlantic cod  -a
B D                   Lamprey  t-
B D                     Shrew  --
B D                  Hedgehog  --
             Star-nosed mole  --
          Chinese tree shrew  --
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==

Inserts between block 26 and 27 in window
B D                     Pika 3bp
B D                  Opossum 25bp
B D          Tasmanian devil 15bp
B D                  Wallaby 17bp
B D                   Lizard 7631bp
B D             Nile tilapia 2bp
         Princess of Burundi 2bp
       Burton's mouthbreeder 2816bp
                 Zebra mbuna 2bp
         Pundamilia nyererei 2bp
B D             Atlantic cod 2bp

Alignment block 27 of 861 in window, 43671929 - 43671929, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  c
                 Prairie vole  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  c
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  t
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  t
B D                 Armadillo  c
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  g
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
B D               Zebra finch  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
B D        American alligator  t
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
B D              Nile tilapia  t
          Princess of Burundi  t
                  Zebra mbuna  t
          Pundamilia nyererei  t
B D              Atlantic cod  t
B D                   Lamprey  t
B D                     Shrew  -
B D                  Hedgehog  -
             Star-nosed mole  -
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
B D                    Medaka  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =

Inserts between block 27 and 28 in window
B D       American alligator 7115bp
  D          Green seaturtle 8357bp
  D           Painted turtle 9006bp
  D Chinese softshell turtle 3bp
B D             Nile tilapia 3bp
         Princess of Burundi 3bp
                 Zebra mbuna 3bp
         Pundamilia nyererei 3bp
B D             Atlantic cod 3bp

Alignment block 28 of 861 in window, 43671930 - 43671933, 4 bps 
B D                     Human  gcct-
B D                     Chimp  gcct-
B D                   Gorilla  gcct-
B D                 Orangutan  gcct-
B D                    Gibbon  gcct-
B D                    Rhesus  gcct-
B D       Crab-eating macaque  gcct-
B D                    Baboon  gcct-
B D              Green monkey  gccc-
B D                  Marmoset  gcct-
B D           Squirrel monkey  gcct-
B D                  Bushbaby  tcct-
           Chinese tree shrew  ggct-
B D                  Squirrel  ggct-
       Lesser Egyptian jerboa  tg---
                 Prairie vole  tg---
               Golden hamster  tg---
B D                     Mouse  tg---
B D                       Rat  tg---
B D            Naked mole-rat  gg---
B D                Guinea pig  gg---
                   Chinchilla  gg---
             Brush-tailed rat  ga---
B D                    Rabbit  gg---
B D                      Pika  gt---
B D                       Pig  agct-
B D                    Alpaca  ggct-
               Bactrian camel  ggct-
B D                   Dolphin  ggcc-
                 Killer whale  ggct-
             Tibetan antelope  agcc-
B D                       Cow  agcc-
B D                     Sheep  agcc-
                Domestic goat  agcc-
B D                     Horse  agct-
B D          White rhinoceros  ggct-
B