Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1389 in window, 61477935 - 61477963, 29 bps 
B D                     Human  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                     Chimp  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                   Gorilla  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                 Orangutan  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                    Gibbon  aaat--gtaaaccaag--tttat----------------------------tctgc--tttta
B D                    Rhesus  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D       Crab-eating macaque  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                    Baboon  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D              Green monkey  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                  Marmoset  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D           Squirrel monkey  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                  Bushbaby  aaat--gtaaaccaag--tttat----------------------------tttgc--ttgtt
           Chinese tree shrew  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                  Squirrel  aaat--gtaaaccaag--tttat----------------------------tttgcttttttt
       Lesser Egyptian jerboa  aaat--gtaaaccaag--tttat----------------------------tttgc--tttta
                 Prairie vole  aaat--gtaaaccaag--tttat----------------------------tttgc--gtttt
B D           Chinese hamster  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
               Golden hamster  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                     Mouse  aaat--gtaaaccaag--tttat----------------------------tttgc--ctttt
B D                       Rat  aaat--gtaaaccaag--tttat----------------------------tttgc--ctttt
B D            Naked mole-rat  -aat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                Guinea pig  -aat--gtaaaccaag--tttat----------------------------tttgc--ttttt
                   Chinchilla  -aat--gtaaaccaag--tttat----------------------------tttgc--ttttt
             Brush-tailed rat  -aat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                    Rabbit  taat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D                      Pika  aaat--gtaaaccaag--tttat----------------------------ttcac--gtttt
B D                       Pig  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                    Alpaca  aaat--gtaaaccaag--tttat----------------------------tttgc--ctttt
               Bactrian camel  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                   Dolphin  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
                 Killer whale  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
             Tibetan antelope  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                       Cow  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                     Sheep  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
                Domestic goat  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                     Horse  aaat--gtaaaccaag--tttat----------------------------tttgc-tttttt
B D          White rhinoceros  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                       Cat  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                       Dog  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                   Ferret   aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                     Panda  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
               Pacific walrus  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
                 Weddell seal  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
             Black flying-fox  aaat--gtaaaccaag--tttat----------------------------tttgc--ctttt
B D                   Megabat  aaat--gtaaaccaag--tttat----------------------------tttgc--ctttt
                Big brown bat  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
         David's myotis (bat)  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                  Microbat  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                  Hedgehog  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                     Shrew  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
              Star-nosed mole  -aat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                  Elephant  aaat--gtaaaccaag--tttat----------------------------tctgc--ttttt
          Cape elephant shrew  aaat--gtaaaccaag--tttat----------------------------tttgc-tttttt
B D                   Manatee  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
             Cape golden mole  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                    Tenrec  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
                     Aardvark  -aat--gtaaaccaag--tttat----------------------------ttcgc--ttttt
B D                 Armadillo  aaat--gtaaaccaag--tttat----------------------------tttgc-----tt
B D                   Opossum  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D           Tasmanian devil  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D                   Wallaby  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D                  Platypus  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D               Rock pigeon  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D              Saker falcon  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D          Peregrine falcon  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D       Collared flycatcher  aaat--gtaaaccaag--tttat----------------------------tttgc---tctt
  D    White-throated sparrow  aaat--gtaaaccaag--tttat----------------------------tttgc---tctt
B D       Medium ground finch  aaat--gtaaaccaag--tttat----------------------------tttgc---tctt
B D               Zebra finch  aaat--gtaaaccaag--tttat----------------------------tttgc---tctt
           Tibetan ground jay  aaat--gtaaaccaag--tttat----------------------------tttgc---tctt
B D                Budgerigar  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D                    Parrot  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D             Scarlet macaw  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D              Mallard duck  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D                   Chicken  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D                    Turkey  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
B D        American alligator  aaat--gtaaaccaag--tttat----------------------------tttgc---tttt
  D           Green seaturtle  aaat--gtaaaccaat--tttat----------------------------tttgc---tttt
  D            Painted turtle  aaat--gtaaaccaat--tttat----------------------------tttgc---tttt
  D  Chinese softshell turtle  aaat--gtaaaccaat--tttat----------------------------tttgc---tttt
  D    Spiny softshell turtle  aaat--gtaaaccaat--tttat----------------------------tttgc---tttt
B D                    Lizard  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D             X. tropicalis  aaat--gtaaaccaag--tttat----------------------------tttgc--ttttt
B D                Coelacanth  --at--gtaaaccaag--tttat----------------------------tttgc----ttt
B D                      Fugu  aaat--gtaaacccaggttttat----------------------------tttgc--tctaa
B D              Nile tilapia  aaat--gtaaacccaggtttatt----------------------------tctca--ttttg
          Princess of Burundi  aaat--gtataacaaaacttgtt----------------------------attac--tcatt
        Burton's mouthbreeder  -------tataacaaaacttgtt----------------------------cttac--tcctt
                  Zebra mbuna  aaat--gtataacaaaacttgtt----------------------------attac--tcctt
          Pundamilia nyererei  aaat--gtataacaaaacttgtt----------------------------attac--tcctc
B D                    Medaka  aaat--gtaaaccca-----gtt-------------taatcgtttaaa---tttgc--tctag
           Southern platyfish  aaat--gtaaacccatatttatt-------------tatttattaaaa---tttgc--tctgt
B D               Stickleback  aaat--gtaaacccagttttatt-----------------gttttcac---tttgc--tctaa
B D              Atlantic cod  aaataagtaaaccaagg-ttgta----------------------------ttggt--ttct-
B D                 Zebrafish  aaac--aaaaaccaaagtacagtacgataatgatggtattcccaaaaatattatgc--tccat
                  Spotted gar  aaat--gtaaaccag---tttat----------------------------tttgc--tctt-
    Mexican tetra (cavefish)  ===============================================================
B D                   Lamprey  ===============================================================
B D                 Tetraodon  ===============================================================
      Yellowbelly pufferfish  ===============================================================

Inserts between block 1 and 2 in window
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                     Fugu 2bp
B D             Nile tilapia 5bp
         Princess of Burundi 2bp
       Burton's mouthbreeder 2bp
                 Zebra mbuna 2bp
         Pundamilia nyererei 2bp
B D                   Medaka 1bp
          Southern platyfish 1bp
B D              Stickleback 1bp
B D             Atlantic cod 2bp
B D                Zebrafish 7bp

Alignment block 2 of 1389 in window, 61477964 - 61477984, 21 bps 
B D                     Human  a---agtagtgttcttaaagcact
B D                     Chimp  a---agtagtgttcttaaagcact
B D                   Gorilla  a---agtagtgttcttaaagcact
B D                 Orangutan  a---agtagtgttcttaaagcact
B D                    Gibbon  a---agtagtgttcttaaagcact
B D                    Rhesus  a---agtagtgttcttaaagcact
B D       Crab-eating macaque  a---agtagtgttcttaaagcact
B D                    Baboon  a---agtagtgttcttaaagcact
B D              Green monkey  a---agtagtgttcttaaagcact
B D                  Marmoset  a---agtagtgttcttaaagcact
B D           Squirrel monkey  a---agtagtgttcttaaagcact
B D                  Bushbaby  a---agtagtgttcttaaagcact
           Chinese tree shrew  a---agtagtgttcttaaagcact
B D                  Squirrel  a---agtagtgttcttaaagcact
       Lesser Egyptian jerboa  a---agtagtgttcttaaagcact
                 Prairie vole  a---agtagtgttcttaaagcact
B D           Chinese hamster  a---agtagtgttcttaaagcact
               Golden hamster  a---agtagtgttcttaaagcact
B D                     Mouse  a---agtagtgttcttaaagcact
B D                       Rat  a---agtagtgttcttaaagcact
B D            Naked mole-rat  a---agtagtgttcttaaagcact
B D                Guinea pig  a---agtagtgttcttaaagcact
                   Chinchilla  a---agtagtgttcttaaagcact
             Brush-tailed rat  a---agtagtgttcttaaagcact
B D                    Rabbit  a---agtagtgttcttaaagcact
B D                      Pika  a---agtagtgttctgaaagcact
B D                       Pig  a---agtagtgttcttaaagcact
B D                    Alpaca  a---agtagtgttcttaaagcact
               Bactrian camel  a---agtagtgttcttaaagcact
B D                   Dolphin  a---agtagtgttcttaaagcact
                 Killer whale  a---agtagtgttcttaaagcact
             Tibetan antelope  a---agtagtgttcttaaagcact
B D                       Cow  a---agtagtgttcttaaagcact
B D                     Sheep  a---agtagtgttcttaaagcact
                Domestic goat  a---agtagtgttcttaaagcact
B D                     Horse  a---agtagtgttcttaaagcact
B D          White rhinoceros  a---agtagtgttcttaaagcact
B D                       Cat  a---agtagtgttcttaaagcact
B D                       Dog  a---agtagtgttcttaaagcact
B D                   Ferret   a---agtagtgttcttaaagcact
B D                     Panda  a---agtagtgttcttaaagcact
               Pacific walrus  a---agtagtgttcttaaagcact
                 Weddell seal  a---agtagtgttcttaaagcact
             Black flying-fox  a---agtagtgtatttaaagcact
B D                   Megabat  a---agtagtgtatttaaagcact
                Big brown bat  a---agtagtgttcttaaagcact
         David's myotis (bat)  a---agtagtgttcttaaagcact
B D                  Microbat  a---agtagtgttcttaaagcact
B D                  Hedgehog  a---agtagtgttcttaaagcact
B D                     Shrew  a---agtagtgttcttaaagcact
              Star-nosed mole  a---agtagtgttcttaaagcact
B D                  Elephant  a---agtagtgttgttaaagcact
          Cape elephant shrew  a---agtagtgttcttaaagcact
B D                   Manatee  a---agtagtgttcttaaagcact
             Cape golden mole  a---agtagtgttcttaaagcact
B D                    Tenrec  a---agtagtgttcttaaagcact
                     Aardvark  a---agtagtgttcttaaagcact
B D                 Armadillo  a---agtagtgttcttaaagcact
B D                   Opossum  a---agtagtgttcttaaagcact
B D           Tasmanian devil  a---agtagtgttcttaaagcact
B D                   Wallaby  a---agtagtgttcttaaagcact
B D                  Platypus  a---ggtagtgttcttaaagcact
  D               Rock pigeon  a---agtagtgttctttaagcact
  D              Saker falcon  a---agtagtgttctttaagcact
  D          Peregrine falcon  a---agtagtgttctttaagcact
  D       Collared flycatcher  a---agtagtgttctttaagcact
  D    White-throated sparrow  a---agtagtgttctttaagcact
B D       Medium ground finch  a---agtagtgttctttaagcact
B D               Zebra finch  a---agtagtgttctttacgcact
           Tibetan ground jay  a---agtagtgttctttaagcact
B D                Budgerigar  a---agtagtgttctttaagcact
  D                    Parrot  a---agtagtgttctttaagcact
  D             Scarlet macaw  a---agtagtgttctttaagcact
  D              Mallard duck  a---agtagtgttctttaagcact
B D                   Chicken  a---agtagtgttctttaagcact
B D                    Turkey  a---agtagtgttctttaagcact
B D        American alligator  a---agtagtgttcttaaagcact
  D           Green seaturtle  a---agtagtgttcttaaagcact
  D            Painted turtle  a---agtagtgttcttaaagcact
  D  Chinese softshell turtle  a---agtagtgttcttaaagcact
  D    Spiny softshell turtle  a---agtagtgttcttaaagcact
B D                    Lizard  a---agtagtgttcttaaagcact
B D             X. tropicalis  aagtagtagtgttcttaaagcact
B D                Coelacanth  t---agtagtgttcttaaagcact
B D                      Fugu  -----gtagtgtc-ttgaagcact
       Yellowbelly pufferfish  -----gtagtgtc-ttgaagcact
B D              Nile tilapia  a---agtagtgtc-ttgaagcact
          Princess of Burundi  -----gtagtatc---aaagaagt
        Burton's mouthbreeder  -----gtagtatc---aaagaagt
                  Zebra mbuna  -----gtagtatc---aaagaagt
          Pundamilia nyererei  -----gtagtatc---aaagaagt
B D                    Medaka  a---cgtagtgtc-ttgaagcact
           Southern platyfish  a---ggtagtgtc-ctgacgcact
B D               Stickleback  a---ggtagcgtg-ttggagcact
B D              Atlantic cod  a---ggtagtgaa-ttgaagcact
B D                 Zebrafish  a---aatagatta-ttgaatatca
                  Spotted gar  a---agtagtgttcttgaagcact
    Mexican tetra (cavefish)  ========================
B D                   Lamprey  ========================
B D                 Tetraodon  ========================

Inserts between block 2 and 3 in window
B D                Zebrafish 2bp

Alignment block 3 of 1389 in window, 61477985 - 61478031, 47 bps 
B D                     Human  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                     Chimp  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Gorilla  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                 Orangutan  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Gibbon  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Rhesus  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D       Crab-eating macaque  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Baboon  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D              Green monkey  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Marmoset  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D           Squirrel monkey  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Bushbaby  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----tcatcc
           Chinese tree shrew  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Squirrel  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
       Lesser Egyptian jerboa  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                 Prairie vole  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D           Chinese hamster  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
               Golden hamster  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                     Mouse  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                       Rat  acagc-tt---ggtaaacaatgtgaa-ttag----------------------tataag-----t----c
B D            Naked mole-rat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                Guinea pig  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                   Chinchilla  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
             Brush-tailed rat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Rabbit  acagc-ct---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                      Pika  acagc-ct---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                       Pig  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Alpaca  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
               Bactrian camel  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Dolphin  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                 Killer whale  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
             Tibetan antelope  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                       Cow  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                     Sheep  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                Domestic goat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                     Horse  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D          White rhinoceros  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                       Cat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                       Dog  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Ferret   acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                     Panda  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
               Pacific walrus  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                 Weddell seal  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
             Black flying-fox  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Megabat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                Big brown bat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
         David's myotis (bat)  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Microbat  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Hedgehog  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                     Shrew  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
              Star-nosed mole  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Elephant  acagc-tt---ggtaaacagtgtaaa-ttag----------------------tacaag-----t----c
          Cape elephant shrew  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Manatee  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
             Cape golden mole  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Tenrec  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
                     Aardvark  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                 Armadillo  acagc-tt---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Opossum  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D           Tasmanian devil  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Wallaby  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                  Platypus  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D               Rock pigeon  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D              Saker falcon  acagcaat---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D          Peregrine falcon  acagcaat---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D       Collared flycatcher  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D    White-throated sparrow  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D       Medium ground finch  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D               Zebra finch  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
           Tibetan ground jay  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                Budgerigar  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D                    Parrot  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----a
  D             Scarlet macaw  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----a
  D              Mallard duck  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                   Chicken  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Turkey  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D        American alligator  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D           Green seaturtle  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D            Painted turtle  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D  Chinese softshell turtle  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
  D    Spiny softshell turtle  acagc-at---ggtaaacaatgtaaa-ttag----------------------tataag-----t----c
B D                    Lizard  acagc-at---ggtaaacaatgtaaa-ttag----------------------tagaag-----t----c
B D             X. tropicalis  acagc-at---ggtaaacaatgtaaa-ttag----------------------tacaag-----t----c
B D                Coelacanth  acagc-at---ggtaaacaatgtaaa-ttag----------------------tttaag-----t----c
B D                      Fugu  actga-ac---agtaaacaatctaaa-ttag----------------------tacaat-----t----c
       Yellowbelly pufferfish  actga-ac---agtaaacaatctaaa-ttag----------------------tacaat-----t----c
B D              Nile tilapia  actgc-at---ggtaaacaatctaaa-ttag----------------------tacaat-----t----c
          Princess of Burundi  gctat-atttggataaac-gtgcaag-ttga----------------------tttagt-----t----c
        Burton's mouthbreeder  gctat-atttggataaat-gtgcaag-ttga----------------------tttagt-----t----c
                  Zebra mbuna  gctat-atttggataaat-gtgcaag-ttga----------------------tttagt-----t----c
          Pundamilia nyererei  gctat-atttggataaat-gtgcaag-ttga----------------------tttagt-----t----c
B D                    Medaka  acagc-ac---agtaaacaatctaaagtgag----------------------gagaat-----g----c
           Southern platyfish  actgc-at---ggtaaacaatctaaa-ttag----------------------tacagt-----t----c
B D               Stickleback  actac-t----ggtaaacaatctaaa-ttag----------------------tacaat-----t----c
B D              Atlantic cod  acagg-attatggtaaacaacgtaaa-ttag----------------------tagaat-----t----c
B D                 Zebrafish  accgc-tt---gtaaaatattgtcag-atagactgtggaaaactgaacattggaataat-----g----c
     Mexican tetra (cavefish)  acaga-ct---agagaagcttgtaga-gaagcatgt-----------------attatt-----t----t
                  Spotted gar  acagc-at---ggtaaacaatgtaaa-ttag----------------------tacaatttgtct----c
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================

                        Human  atctcaaaagcca
                        Chimp  atctcaaaagcca
                      Gorilla  atctcaaaagcca
                    Orangutan  atctcaaaagcca
                       Gibbon  atctcaaaagcca
                       Rhesus  atctcaaaagcca
          Crab-eating macaque  atctcaaaagcca
                       Baboon  atctcaaaagcca
                 Green monkey  atctcaaaagcca
                     Marmoset  atctcaaaagcca
              Squirrel monkey  atctcaaaagcca
                     Bushbaby  atctcaaaagcca
           Chinese tree shrew  atctcaaaagcca
                     Squirrel  atctcaaaagcca
       Lesser Egyptian jerboa  atttcaaaagcca
                 Prairie vole  atctcaaaagcca
              Chinese hamster  atctcaaaagcca
               Golden hamster  atctcaaaagcca
                        Mouse  atctcaaaagcca
                          Rat  atctcaaaagcca
               Naked mole-rat  atctcaaaagcca
                   Guinea pig  atctcaaaagcca
                   Chinchilla  atctcaaaagcca
             Brush-tailed rat  atctcaaaagcca
                       Rabbit  atctcaaaagcca
                         Pika  atctcaaaagcca
                          Pig  atctcaaaagcca
                       Alpaca  atctcaaaagcca
               Bactrian camel  atctcaaaagcca
                      Dolphin  atctcaaaagcca
                 Killer whale  atctcaaaagcca
             Tibetan antelope  atctcaaaagcca
                          Cow  atctcaaaagcca
                        Sheep  atctcaaaagcca
                Domestic goat  atctcaaaagcca
                        Horse  atctcaaaagcca
             White rhinoceros  atctcaaaagcca
                          Cat  atctcaaaagcca
                          Dog  atctcaaaagcca
                      Ferret   atctcaaaagcca
                        Panda  atctcaaaagcca
               Pacific walrus  atctcaaaagcca
                 Weddell seal  atctcaaaagcca
             Black flying-fox  atctcaaaagcc-
                      Megabat  atctcaaaagcc-
                Big brown bat  atctcaaaagcc-
         David's myotis (bat)  atctcaaaagcc-
                     Microbat  atctcaaaagcc-
                     Hedgehog  atctcaaaagcc-
                        Shrew  atctcaaaagccg
              Star-nosed mole  atctcaaaagcca
                     Elephant  atctcaaaagcca
          Cape elephant shrew  atctcaaaagcca
                      Manatee  atctcaaaagcca
             Cape golden mole  atctcaaaagcca
                       Tenrec  atctcaaaagcca
                     Aardvark  atctcaaaagcca
                    Armadillo  atctcaaaagcca
                      Opossum  atctcaaaagcca
              Tasmanian devil  atctcaaaagcca
                      Wallaby  atctcaaaagcca
                     Platypus  atctcaaaagcca
                  Rock pigeon  atctcaaaagcca
                 Saker falcon  atcttaaaagcca
             Peregrine falcon  atcttaaaagcca
          Collared flycatcher  atctcaaaagcca
       White-throated sparrow  atctcaaaagcca
          Medium ground finch  atctcaaaagcca
                  Zebra finch  atctcaaaagcca
           Tibetan ground jay  atctcaaaagcca
                   Budgerigar  atctcaaaagcca
                       Parrot  atctcaaaagcca
                Scarlet macaw  atctcaaaagcca
                 Mallard duck  atctcaaaagcca
                      Chicken  atctcaaaagcca
                       Turkey  atctcaaaagcca
           American alligator  atctcaaaagcca
              Green seaturtle  atctcaaaagcca
               Painted turtle  atctcaaaagcca
     Chinese softshell turtle  atctcaaaagcca
       Spiny softshell turtle  atctcaaaagcca
                       Lizard  atctcaaaagcca
                X. tropicalis  atctcaaaagcca
                   Coelacanth  ctttcaaaagcca
                         Fugu  -----caaacctt
       Yellowbelly pufferfish  -----caaacctt
                 Nile tilapia  -----aaaatctc
          Princess of Burundi  -----aacatctc
        Burton's mouthbreeder  -----aacatctc
                  Zebra mbuna  -----aacatctc
          Pundamilia nyererei  -----aacatctc
                       Medaka  -----cgaaagcc
           Southern platyfish  -----aaaaaaat
                  Stickleback  a--aaaaaatctc
                 Atlantic cod  -----aaaatcct
                    Zebrafish  a--gtaataatt-
     Mexican tetra (cavefish)  t--ctaatattt-
                  Spotted gar  -----aaaagcca
                      Lamprey  =============
                    Tetraodon  =============

Inserts between block 3 and 4 in window
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
B D             Nile tilapia 8bp
         Princess of Burundi 3bp
       Burton's mouthbreeder 3bp
                 Zebra mbuna 3bp
         Pundamilia nyererei 3bp
B D                   Medaka 3781bp
          Southern platyfish 10bp
B D             Atlantic cod 13bp

Alignment block 4 of 1389 in window, 61478032 - 61478034, 3 bps 
B D                     Human  --gag
B D                     Chimp  --gag
B D                   Gorilla  --gag
B D                 Orangutan  --gag
B D                    Gibbon  --gag
B D                    Rhesus  --gag
B D       Crab-eating macaque  --gag
B D                    Baboon  --gag
B D              Green monkey  --gag
B D                  Marmoset  --gag
B D           Squirrel monkey  --gag
B D                  Bushbaby  --gag
           Chinese tree shrew  --gtt
B D                  Squirrel  --gag
       Lesser Egyptian jerboa  --g--
                 Prairie vole  --gg-
B D           Chinese hamster  --gag
               Golden hamster  --gag
B D                     Mouse  --gag
B D                       Rat  --gag
B D                Guinea pig  --g--
                   Chinchilla  --g--
B D                    Rabbit  --gag
B D                      Pika  --gaa
B D                       Pig  --gag
B D                    Alpaca  --gaa
               Bactrian camel  --gaa
B D                   Dolphin  --gag
                 Killer whale  --gag
             Tibetan antelope  --gag
B D                       Cow  --gag
B D                     Sheep  --gag
                Domestic goat  --gag
B D                     Horse  --gag
B D          White rhinoceros  --gag
B D                       Cat  --gag
B D                       Dog  --gag
B D                   Ferret   --gag
B D                     Panda  --gag
               Pacific walrus  --gag
                 Weddell seal  --gag
             Black flying-fox  ---ag
B D                   Megabat  ---ag
                Big brown bat  ---ag
         David's myotis (bat)  ---ag
B D                  Microbat  ---ag
B D                  Hedgehog  ---ag
B D                     Shrew  --gag
              Star-nosed mole  --gag
B D                  Elephant  --gag
          Cape elephant shrew  --gag
B D                   Manatee  --gag
             Cape golden mole  --gaa
B D                    Tenrec  --gag
                     Aardvark  --gag
B D                 Armadillo  --gag
B D                   Opossum  --gag
B D           Tasmanian devil  --gag
B D                   Wallaby  --gag
B D                  Platypus  --ggt
  D               Rock pigeon  --g--
  D              Saker falcon  --g--
  D          Peregrine falcon  --g--
  D       Collared flycatcher  --g--
  D    White-throated sparrow  --g--
B D       Medium ground finch  --g--
B D               Zebra finch  --g--
           Tibetan ground jay  --gtt
B D                Budgerigar  --gag
  D                    Parrot  --gag
  D             Scarlet macaw  --gag
  D              Mallard duck  --gag
B D                   Chicken  --gag
B D                    Turkey  --gaa
B D        American alligator  --gag
  D           Green seaturtle  --g--
  D            Painted turtle  --g--
  D  Chinese softshell turtle  --g--
  D    Spiny softshell turtle  --g--
B D                    Lizard  --g--
B D             X. tropicalis  --gag
           Southern platyfish  aag--
B D               Stickleback  aag--
B D              Atlantic cod  gag--
B D                 Zebrafish  --g--
     Mexican tetra (cavefish)  --g--
                 Zebra mbuna  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
                 Spotted gar  -----
B D                Coelacanth  -----
B D                    Medaka  =====
B D                   Lamprey  =====
B D                 Tetraodon  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
            Brush-tailed rat  -----
B D            Naked mole-rat  -----

Inserts between block 4 and 5 in window
B D                Orangutan 2bp
B D                 Squirrel 2bp
                Prairie vole 1bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 2bp
                    Aardvark 2bp
B D                Armadillo 2bp
B D          Tasmanian devil 4bp
B D                 Platypus 2bp
  D              Rock pigeon 1bp
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 4bp
B D               Budgerigar 5bp
  D                   Parrot 5bp
  D            Scarlet macaw 5bp
  D             Mallard duck 5bp
B D                  Chicken 5bp
B D                   Turkey 5bp
B D       American alligator 1bp
B D                Zebrafish 2bp
    Mexican tetra (cavefish) 2bp

Alignment block 5 of 1389 in window, 61478035 - 61478108, 74 bps 
B D                     Human  ttg------t-tttgt-------------ttt--------------------------------------
B D                     Chimp  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D                   Gorilla  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D                 Orangutan  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D                    Gibbon  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D                    Rhesus  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D       Crab-eating macaque  ttg------t-tttgt-------------tttg-t-------------t--------------------t
B D                    Baboon  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D              Green monkey  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D                  Marmoset  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D           Squirrel monkey  ttg------t-tttgt-------------tttgtt-------------t--------------------t
B D                  Bushbaby  tag------t-tttgt-------------tttgtt-------------t--------------------t
           Chinese tree shrew  ttg------t-tttg--------------tttgtt-------------t--------------------t
B D                  Squirrel  ctg------t-tttgt-------------tt-----------------t--------------------t
       Lesser Egyptian jerboa  ------------------------------t-tttgttgt--------t--------------------t
                 Prairie vole  ttg------t-tttct-------------tt-ctt-------ttttttt--------------------t
B D           Chinese hamster  ttg------t-tttct-------------tt-gttgtttcttttttttt--------------------t
               Golden hamster  ttg------t-tttct-------------tt-cttgtttc--ggttttt--------------------t
B D                     Mouse  ttg------t-tttcg-------------tt-gttgttgt---tgttgt--------------------t
B D                       Rat  ttg------t-tttcg-------------tt-gttgttgt--------t--------------------t
B D            Naked mole-rat  --g------t-tttgt-------------tt-----------------t--------------------t
B D                Guinea pig  ttg------t-tttg--------------tt-----------------t--------------------t
                   Chinchilla  ttg------t-tttgt-------------tt-----------------t--------------------t
             Brush-tailed rat  --g------t-tttgt-------------tt-----------------t--------------------t
B D                    Rabbit  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                      Pika  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                       Pig  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                    Alpaca  ttg------t-tttgt-------------gt---t-------------t--------------------t
               Bactrian camel  ttg------t-tttgt-------------gt---t-------------t--------------------t
B D                   Dolphin  ttg------t-tttgt------------------t-------------t--------------------t
                 Killer whale  ttg------t-tttgt------------------t-------------t--------------------t
             Tibetan antelope  ttg------t-tttgt-------------tt-g-t-------------t--------------------t
B D                       Cow  ttg------t-tttgt-------------tt-g-t-------------t--------------------t
B D                     Sheep  ttg------t-tttgt-------------tt-g-t-------------t--------------------t
                Domestic goat  ttg------t-tttgt-------------tt-g-t-------------t--------------------t
B D                     Horse  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D          White rhinoceros  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                       Cat  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                       Dog  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                   Ferret   ttg------t-tttgt-------------tt-gtt-------------t--------------------t
B D                     Panda  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
               Pacific walrus  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
                 Weddell seal  ttg------t-tttgt-------------tt-gtt-------------t--------------------t
             Black flying-fox  ttg------t-----t-------------tt-gtt-------------t--------------------t
B D                   Megabat  ttg------t-----t-------------tt-gtt-------------t--------------------t
                Big brown bat  ttg------t---tgt-------------tt-gtt-------------t--------------------t
         David's myotis (bat)  ttg------t---tgt-------------tt-gtt-------------t--------------------t
B D                  Microbat  ttg------t---tgt-------------tt-gtt-------------t--------------------t
B D                  Hedgehog  ttg------t-----t-------------tt-gtt-------------t--------------------c
B D                     Shrew  ttt------tgtttgt-------------tt-gtt-------------t--------------------t
              Star-nosed mole  ttg------t-----t-------------tt-gtt-------------t--------------------t
B D                  Elephant  ctg------t-----t-------------tt-gtt-------------t--------------------c
          Cape elephant shrew  ctg------t-----t-------------tt-gtt-------------t--------------------t
B D                   Manatee  ctgttttttt-----t-------------tt-ttt-------------t--------------------t
             Cape golden mole  ctt------------t-------------tt-gtt-------------t--------------------t
B D                    Tenrec  ctg------------t-------------tt-tgt-------------t--------------------t
                     Aardvark  ctg------t-----t-------------tt-gtt-------------t--------------------t
B D                 Armadillo  ttgttttgtt-----t-------------tg-ttt-------------t--------------------t
B D                   Opossum  ---------t------------------------t-------------t--------------------t
B D           Tasmanian devil  ttt------t------------------------t-------------t--------------------t
B D                   Wallaby  --t------t------------------------t-------------t--------------------t
B D                  Platypus  ttt------t--------------------------------------t--------------------t
  D               Rock pigeon  gtt------g-----t-------------tt-ttt-------------a--------------------t
  D              Saker falcon  ttt------t-----t-------------tt-ttt-------------a--------------------t
  D          Peregrine falcon  ttt------t-----t-------------tt-ttt-------------a--------------------t
  D       Collared flycatcher  ttt------t-----t-------------tt-ttt-------------a--------------------t
  D    White-throated sparrow  ttt------t-----t-------------tt-ttt-------------a--------------------t
B D       Medium ground finch  ttt------t-----t-------------tt-ttt-------------a--------------------t
B D               Zebra finch  gtt------t-----t-------------tt-ttt-------------a--------------------t
           Tibetan ground jay  ttt------t-----t-------------tt-ttt-------------a--------------------t
B D                Budgerigar  gtt-----gt-----t-------------tt-ttt-------------a--------------------t
  D                    Parrot  gtt------t-----t-------------tt-ttt-------------a--------------------t
  D             Scarlet macaw  g-t------t-----t-------------tt-ttt-------------a--------------------t
  D              Mallard duck  ttt------t-----tt------------tt-ttt-------------at-------------------t
B D                   Chicken  ttt------t-----t-----------------tt-------------a--------------------t
B D                    Turkey  ttt------t-----t--------------t-ctt-------------a--------------------t
B D        American alligator  ---------t-----t-------------gt-ttt-------------t--------------------t
  D           Green seaturtle  ---------a-----g-------------tt-ctc-------------t--------------------t
  D            Painted turtle  ---------a-----g-------------tt-ctc-------------t--------------------t
  D  Chinese softshell turtle  ---------a-----g-------------tt-ctc-------------t--------------------t
  D    Spiny softshell turtle  ---------a-----g-------------tt-ctc-------------t--------------------t
B D                    Lizard  ---------a-----g-------------tt-ctt-------------c--------------------t
B D             X. tropicalis  ---------t-------------------tt-----------------t---------------------
B D                Coelacanth  ---------t-------------------ca-gaa-------------t--------------------t
B D                      Fugu  -----------------------------tg-agt-------------t--------------------a
       Yellowbelly pufferfish  -----------------------------tg-agt-------------t--------------------a
B D              Nile tilapia  ---------------------------tctg-agt-------------t--------------------a
          Princess of Burundi  -----------------------------tg-ttt-------------c--------------------c
        Burton's mouthbreeder  -----------------------------tg-ttt-------------c--------------------a
                  Zebra mbuna  -----------------------------tg-ttt-------------c--------------------a
          Pundamilia nyererei  -----------------------------tg-ttt-------------c--------------------a
B D                    Medaka  ----------------ttattttcttttttg-act-------------t--------------------a
           Southern platyfish  ------------------------ccatctg-agt-------------t--------------------a
B D               Stickleback  ------------------------ccatccg-agt-------------t--------------------t
B D              Atlantic cod  ----------------------------------t-------------g--------------------a
B D                 Zebrafish  -----------------------aaattcag-ctt-------------tgggagtcactggagaaaagaa
     Mexican tetra (cavefish)  -----------------------taattttg-tct-------------c--------------------a
                  Spotted gar  ---------------------------tctg-aat-------------t--------------------a
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================

                        Human  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                        Chimp  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Gorilla  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                    Orangutan  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Gibbon  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Rhesus  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
          Crab-eating macaque  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Baboon  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                 Green monkey  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                     Marmoset  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
              Squirrel monkey  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                     Bushbaby  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
           Chinese tree shrew  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                     Squirrel  ttaa--------------tgag-ttgttaaaaag--atgc---------------agactat----tct-
       Lesser Egyptian jerboa  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                 Prairie vole  ttaa--------------tgag-ctgttaaaaag--atgc---------------aacctat----tct-
              Chinese hamster  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
               Golden hamster  ttaa--------------tgag-ctgttaaaaag--atgc---------------agcctat----tct-
                        Mouse  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                          Rat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
               Naked mole-rat  ttaa--------------tgag-ttgttaaaaag--atgc---------------aacctat----tct-
                   Guinea pig  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctag----tct-
                   Chinchilla  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
             Brush-tailed rat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Rabbit  ttaa--------------tgag-ttgttaaaaag--atgc---------------aggctat----tct-
                         Pika  ttaa--------------tgag-ttgttaaaaag--atgc---------------aggctat----tct-
                          Pig  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Alpaca  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
               Bactrian camel  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Dolphin  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                 Killer whale  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
             Tibetan antelope  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                          Cow  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                        Sheep  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                Domestic goat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                        Horse  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
             White rhinoceros  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                          Cat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                          Dog  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Ferret   ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                        Panda  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
               Pacific walrus  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                 Weddell seal  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
             Black flying-fox  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctac----tct-
                      Megabat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctac----tct-
                Big brown bat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
         David's myotis (bat)  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                     Microbat  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                     Hedgehog  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                        Shrew  ttaa--------------tgag-ttgttaaaaag--atgc---------------aggctat----tct-
              Star-nosed mole  ttaa--------------tgag-ttgttaaaaag--atgc---------------aggctat----tct-
                     Elephant  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctag----tct-
          Cape elephant shrew  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Manatee  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
             Cape golden mole  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Tenrec  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctac----tct-
                     Aardvark  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                    Armadillo  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Opossum  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
              Tasmanian devil  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Wallaby  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                     Platypus  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                  Rock pigeon  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                 Saker falcon  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
             Peregrine falcon  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
          Collared flycatcher  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
       White-throated sparrow  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
          Medium ground finch  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                  Zebra finch  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
           Tibetan ground jay  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                   Budgerigar  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Parrot  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                Scarlet macaw  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                 Mallard duck  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                      Chicken  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Turkey  ttta--------------tgaa-ttgttaaaaag--atgc---------------agcctat----tct-
           American alligator  ttaa--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
              Green seaturtle  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
               Painted turtle  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
     Chinese softshell turtle  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
       Spiny softshell turtle  ttta--------------tgag-ttgttaaaaag--atgc---------------agcctat----tct-
                       Lizard  ttaa--------------tgagcttgttaaaaag--atgc---------------agcctat----gct-
                X. tropicalis  ---a--------------tgag-ttgttaaaaag--atgca--------------agcctat----tct-
                   Coelacanth  ttca--------------tgag-ttgttataaag--atgc---------------agcctat----ttct
                         Fugu  aaca--------------ggag-ccgttatagatgcaacc---------------aaataagaa--ccc-
       Yellowbelly pufferfish  aaca--------------ggag-ccgttatagatgcaacc---------------aaataagaa--ccc-
                 Nile tilapia  aaca--------------ggag-ttgttataaag--atgc---------------aacca------acc-
          Princess of Burundi  aatg--------------actg--gg--gcacca--cagt---------------ggcttttta--agt-
        Burton's mouthbreeder  tata--------------tgtg--tgctgcaaat--aact---------------gactggggc--acc-
                  Zebra mbuna  tata--------------tgcg--tgctgcaaat--aact---------------gactggggc--acc-
          Pundamilia nyererei  tata--------------tgtg--tgctgcaaat--aact---------------gactggggc--acc-
                       Medaka  catt--------------gaga-tttttgaaaat--aaacttaaagtaaaaatatgatcaaata---tt-
           Southern platyfish  aaca--------------ggag-tcgttataaag--aagc---------------gaccaacca------
                  Stickleback  aaca--------------ggag-ttgttataaag--atgc---------------aacca----------
                 Atlantic cod  aaca--------------ggag----ttataaag--atgc---------------aaccaa---------
                    Zebrafish  aatatcgatgtagccggctgaa--ttttgtaaag--caat---------------taatataat--ctc-
     Mexican tetra (cavefish)  aata----------------aa--ttgtgcata----------------------tagtgtaaa--ctc-
                  Spotted gar  -aca--------------tgag----ttataaag--atgc---------------agcctatgctaacc-
                      Lamprey  ======================================================================
                    Tetraodon  ======================================================================

                        Human  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                        Chimp  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Gorilla  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                    Orangutan  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                       Gibbon  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                       Rhesus  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
          Crab-eating macaque  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                       Baboon  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                 Green monkey  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Marmoset  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
              Squirrel monkey  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Bushbaby  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
           Chinese tree shrew  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Squirrel  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
       Lesser Egyptian jerboa  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                 Prairie vole  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
              Chinese hamster  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
               Golden hamster  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                        Mouse  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                          Rat  -aacagga-----taaatt-------------t-ttttaa-c----ca-ttt-------cac
               Naked mole-rat  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                   Guinea pig  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                   Chinchilla  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
             Brush-tailed rat  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                       Rabbit  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                         Pika  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                          Pig  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                       Alpaca  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
               Bactrian camel  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Dolphin  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                 Killer whale  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
             Tibetan antelope  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                          Cow  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                        Sheep  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                Domestic goat  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                        Horse  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
             White rhinoceros  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                          Cat  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                          Dog  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Ferret   -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                        Panda  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
               Pacific walrus  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                 Weddell seal  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
             Black flying-fox  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Megabat  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                Big brown bat  -accagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
         David's myotis (bat)  -accagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Microbat  -accagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Hedgehog  -aacagga-----taaata-------------tcttttaa-c----ca-ttt-------cac
                        Shrew  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
              Star-nosed mole  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Elephant  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
          Cape elephant shrew  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Manatee  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
             Cape golden mole  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                       Tenrec  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                     Aardvark  -aacagga-----taaata-------------t-ttgtaa-c----ca-ttt-------cac
                    Armadillo  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Opossum  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
              Tasmanian devil  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                      Wallaby  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                     Platypus  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                  Rock pigeon  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                 Saker falcon  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
             Peregrine falcon  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
          Collared flycatcher  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
       White-throated sparrow  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
          Medium ground finch  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                  Zebra finch  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
           Tibetan ground jay  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                   Budgerigar  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                       Parrot  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                Scarlet macaw  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                 Mallard duck  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                      Chicken  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                       Turkey  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
           American alligator  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
              Green seaturtle  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
               Painted turtle  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
     Chinese softshell turtle  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
       Spiny softshell turtle  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                       Lizard  -aacagga-----taaata---------------ttttaa-c----ca-ttt-------cac
                X. tropicalis  -aacagga-----taaata-------------t-ttttaa-c----ca-ttt-------cac
                   Coelacanth  aaatcgga-----taaata---------------tttcaa-c----cacttt-------cac
                         Fugu  -ataaatacctctgcaaca-----------tcc-tttaaa-a----ca-tcc-------cat
       Yellowbelly pufferfish  -ataaatacctctgcaaca-----------tcc-tttaaa-a----ca-tcc-------cat
                 Nile tilapia  -aaagagccca--taaata-cctccgccacttc-cttaaa-a----ca-tcc-------cat
          Princess of Burundi  -gtagtgatta------------------ttca-cttaga-aactgca-tctcatctgacat
        Burton's mouthbreeder  -acagtggctttttaagtg-tagtgattattca-cttaaa-aactgca-tct-------cat
                  Zebra mbuna  -acagtggctttttaagtg-tagtgattattca-cttaaa-aactgca-tct-------cat
          Pundamilia nyererei  -acagtggctttttaagtg-tagtgattattca-cttaaa-aactgca-tct-------cat
                       Medaka  -gtaaaggactcagcaagaaccaaactcctttg-tgtgaatgaa---------------cat
           Southern platyfish  -accaggaacccataaata--cgccccgcctcg-tccgga-aaa---------------cat
                  Stickleback  -actaagaacccataaata-------ccacttc-cttaaa-a----ca-tcc-------cgt
                 Atlantic cod  -accaagaacccataaata-tatccactgcttc-cttaaa-a----ca-tgc-------cat
                    Zebrafish  -aac---------gttttc----------ttca-ttttat-a----ta-cac-------aac
     Mexican tetra (cavefish)  -aacaggacatttgttgag----------tata-ttttaa-a----ct-cac-------aaa
                  Spotted gar  -gataaatatttttaacca---------------ctttta-a----ct-tcg-------att
                      Lamprey  ==============================================================
                    Tetraodon  ==============================================================

Alignment block 6 of 1389 in window, 61478109 - 61478144, 36 bps 
B D                     Human  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                     Chimp  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Gorilla  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                 Orangutan  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Gibbon  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Rhesus  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D       Crab-eating macaque  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Baboon  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D              Green monkey  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                  Marmoset  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D           Squirrel monkey  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                  Bushbaby  ttcgagttaatgaaggctc----acaaatgagcaacactc
           Chinese tree shrew  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                  Squirrel  tttgagttaatgaaggctc----acaaatgagcaacactc
       Lesser Egyptian jerboa  tttgagttaatgaaggctc----acaaatgagcaacactc
                 Prairie vole  tttgagttaatgaaggctc----acaaatgagcaacactc
B D           Chinese hamster  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                     Mouse  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                       Rat  tttgagttaatgaaggctc----acaaatgagcaacactc
B D            Naked mole-rat  tttgagttaatgaaggctc----acatatgagcaacactc
B D                Guinea pig  tttgagttaatgaaggctc----acaaatgagc-acactc
                   Chinchilla  tttgagttaatgaaggctc----acaaatgagcaacactc
             Brush-tailed rat  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                    Rabbit  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                      Pika  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                       Pig  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Alpaca  ttcgagttaatgaaggctc----acaaatgagcaacactc
               Bactrian camel  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Dolphin  ttcgagttaatgaaggctc----acaaatgagcaacactc
                 Killer whale  ttcgagttaatgaaggctc----acaaatgagcaacactc
             Tibetan antelope  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                       Cow  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                     Sheep  tttgagttaatgaaggctc----acaaatgagcaacactc
                Domestic goat  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                     Horse  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D          White rhinoceros  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                       Cat  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                       Dog  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Ferret   ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                     Panda  ttcgagttaatgaaggctc----acaaatgagcaacactc
               Pacific walrus  ttcgagttaatgaaggctc----acaaatgagcaacactc
                 Weddell seal  ttcgagttaatgaaggctc----acaaatgagcaacactc
             Black flying-fox  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Megabat  ttcgagttaatgaaggctc----acaaatgagcaacactc
                Big brown bat  ttcgagttaatgaaggctc----acaaatgagcaacactc
         David's myotis (bat)  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                  Microbat  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                  Hedgehog  tttgagttaatgaaggctc----acaaatgagcaacactc
B D                     Shrew  tttgagttaatgaaggctc----acaaatgagcaacactc
              Star-nosed mole  tttgagttaatgaaagctc----acaaatgagcaacactc
B D                  Elephant  ttcgagttaatgaaggctc----acaaatgagcaacactc
          Cape elephant shrew  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Manatee  ttcgagttaatgaaggctc----acaaatgagcaacactc
             Cape golden mole  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Tenrec  ttcgagttaatgaaggctc----acaaatgagcaacactc
                     Aardvark  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                 Armadillo  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Opossum  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D           Tasmanian devil  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Wallaby  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                  Platypus  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D               Rock pigeon  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D              Saker falcon  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D          Peregrine falcon  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D       Collared flycatcher  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D    White-throated sparrow  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D       Medium ground finch  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D               Zebra finch  ttcgagatcatgaaggctc----acaaatgagcaacactc
           Tibetan ground jay  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                Budgerigar  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D                    Parrot  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D             Scarlet macaw  ttcgagctaatgaaggctc----acaaatgagcaacactc
  D              Mallard duck  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                   Chicken  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Turkey  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D        American alligator  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D           Green seaturtle  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D            Painted turtle  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D  Chinese softshell turtle  ttcgagttaatgaaggctc----acaaatgagcaacactc
  D    Spiny softshell turtle  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D                    Lizard  ttcgagttaatgaaggctc----acaaatgagcaacactc
B D             X. tropicalis  ttctcgttaatgaaggctc----acaaatgagcaacactc
B D                Coelacanth  ttagaattaatgaacgctc----acaaatgagcaacactc
B D                      Fugu  --------aatgaaggctc----accaatgagcaacaatc
       Yellowbelly pufferfish  --------aatgaaggctc----accaatgagcaacaatc
B D              Nile tilapia  -------taatgaaggctc----acaaatgagcaacaatc
          Princess of Burundi  ---------------------------atcagtagcacct
        Burton's mouthbreeder  ----------------ctg----acctatcagtagcacc-
                  Zebra mbuna  ----------------ctg----acctatcagtagcacct
          Pundamilia nyererei  ----------------ctg----acctatcagtagcacct
B D                    Medaka  -----------------------gcacatgtttaa-----
           Southern platyfish  -----------------------ccccatgatgaacaatc
B D               Stickleback  -------tgatgaaggctc----acacatgagcaacaatc
B D              Atlantic cod  -------taatgaaggctc----ataaatgagcaacagtc
B D                 Zebrafish  -----------------tc----ctaaacgcttaacacgc
     Mexican tetra (cavefish)  -----------agactgtcaaagttaaatgaggaataagg
                  Spotted gar  -------taatgaaggctc----acaaatgagcaatgctc
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Lamprey  ========================================
B D                 Tetraodon  ========================================

Inserts between block 6 and 7 in window
         Princess of Burundi 34bp
                 Zebra mbuna 49bp
         Pundamilia nyererei 49bp

Alignment block 7 of 1389 in window, 61478145 - 61478198, 54 bps 
B D                     Human  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                     Chimp  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                   Gorilla  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                 Orangutan  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                    Gibbon  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                    Rhesus  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D       Crab-eating macaque  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                    Baboon  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D              Green monkey  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                  Marmoset  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D           Squirrel monkey  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                  Bushbaby  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgacagcg----cacacacacacaa
           Chinese tree shrew  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                  Squirrel  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
       Lesser Egyptian jerboa  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
                 Prairie vole  ctcattgaggaaaacaaaaagctgttgttgac-aagcgaca--g----cacacacacacaa
B D           Chinese hamster  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----catacacacacaa
B D                     Mouse  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--gcacacacacacacacac
B D                       Rat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g------cgcacacacac
B D            Naked mole-rat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                Guinea pig  ctcattgagg-aaacaaaaagctgttgtcgac-aagcgaca--g----c-cacacacacaa
                   Chinchilla  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
             Brush-tailed rat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                    Rabbit  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                      Pika  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                       Pig  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                    Alpaca  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
               Bactrian camel  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                   Dolphin  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacac
                 Killer whale  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacac
             Tibetan antelope  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                       Cow  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                     Sheep  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
                Domestic goat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                     Horse  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D          White rhinoceros  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                       Cat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                       Dog  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                   Ferret   ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                     Panda  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
               Pacific walrus  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacac--
                 Weddell seal  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacac--
             Black flying-fox  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                   Megabat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
                Big brown bat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
         David's myotis (bat)  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                  Microbat  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                  Hedgehog  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                     Shrew  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
              Star-nosed mole  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                  Elephant  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
          Cape elephant shrew  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                   Manatee  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacaaaa
             Cape golden mole  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                    Tenrec  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
                     Aardvark  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                 Armadillo  ctcattgaggaaaacaaaaagctgttgtcgac-aagcgaca--g----cacacacacacaa
B D                   Opossum  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g----cacacacacac--
B D           Tasmanian devil  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g----cacacacacacaa
B D                   Wallaby  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g----cacacacacac--
B D                  Platypus  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g----cacacacacacaa
  D               Rock pigeon  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D              Saker falcon  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D          Peregrine falcon  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D       Collared flycatcher  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D    White-throated sparrow  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D       Medium ground finch  ctcattgaggaaaacaaaaagctgttgtcgacaacgcgaca--g------cacacacacaa
B D               Zebra finch  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
           Tibetan ground jay  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D                Budgerigar  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D                    Parrot  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D             Scarlet macaw  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D              Mallard duck  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D                   Chicken  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D                    Turkey  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D        American alligator  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D           Green seaturtle  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D            Painted turtle  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D  Chinese softshell turtle  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
  D    Spiny softshell turtle  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D                    Lizard  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D             X. tropicalis  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g------cacacacacaa
B D                Coelacanth  ctcattgaggaaaacaaaaagctgttgtcgacaaagcgaca--g----cgcacacacgcac
B D                      Fugu  ctcttagaggaaaacaaaatgctgatgtcgactaggcgaca--g----cacacacacacac
       Yellowbelly pufferfish  ctcttagaggaaaacaaaatgctgatgtcgactaggcgaca--g----cacacacacacac
B D              Nile tilapia  ctcttagaggaaaacaaaacgctgatgtcgactaggcgaca--g----cacacacgcgcac
          Princess of Burundi  ------------------------------------------------------ggcttac
        Burton's mouthbreeder  ----tgaagcttatctaaacttttaggtccttaaggt---------------taggcttac
B D                    Medaka  --attatgcaaaatttatac-ttggtgttatctg---------------------------
           Southern platyfish  ctcttagaggaaaacgaaacgccgatgtcgactgagcgaca--g----cacacacacgcac
B D               Stickleback  ctcttagaggaaaacaaaacgctgatgtcgactcggcgaca--g----cacacacccacaa
B D              Atlantic cod  ctcttagaggaaaacaaaactctgatgtcgaccaggcgaca--g----cacacacgcacac
B D                 Zebrafish  ------------atc------ctcatac----gacacagtg--a----aaaacac--acac
     Mexican tetra (cavefish)  ------------agcta----ctaatact-atgaaataatg--g----cagacaatgacag
                  Spotted gar  ctcattgaggaaaacaaaaagctgttgtcggcagagcgaca--g----cacacacacac--
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Zebra mbuna  =============================================================
         Pundamilia nyererei  =============================================================
B D                   Lamprey  =============================================================
B D                 Tetraodon  =============================================================

Inserts between block 7 and 8 in window
B D             Nile tilapia 17bp
         Princess of Burundi 15bp
       Burton's mouthbreeder 11bp
B D                   Medaka 5bp
          Southern platyfish 14bp
B D              Stickleback 2bp
B D             Atlantic cod 12bp

Alignment block 8 of 1389 in window, 61478199 - 61478203, 5 bps 
B D                     Human  aaaca
B D                     Chimp  aaaca
B D                   Gorilla  aaaca
B D                 Orangutan  aaaca
B D                    Gibbon  aaaca
B D                    Rhesus  aaaca
B D       Crab-eating macaque  aaaca
B D                    Baboon  aaaca
B D              Green monkey  aaaca
B D                  Marmoset  aaaca
B D           Squirrel monkey  aaaca
B D                  Bushbaby  aaaca
           Chinese tree shrew  aaaca
B D                  Squirrel  aaaca
       Lesser Egyptian jerboa  aaaca
                 Prairie vole  aaaca
B D           Chinese hamster  aaaca
B D                     Mouse  aaaca
B D                       Rat  aaaca
B D            Naked mole-rat  aaac-
B D                Guinea pig  aaaca
                   Chinchilla  aaaca
             Brush-tailed rat  aaaca
B D                    Rabbit  aaaca
B D                      Pika  aaac-
B D                       Pig  aaaca
B D                    Alpaca  aaaca
               Bactrian camel  aaaca
B D                   Dolphin  aaaca
                 Killer whale  aaaca
             Tibetan antelope  aaaca
B D                       Cow  aaaca
B D                     Sheep  aaaca
                Domestic goat  aaaca
B D                     Horse  aaaca
B D          White rhinoceros  aaaca
B D                       Cat  aaaca
B D                       Dog  aaaca
B D                   Ferret   aaaca
B D                     Panda  aaaca
               Pacific walrus  aaaca
                 Weddell seal  aaaca
             Black flying-fox  aaaca
B D                   Megabat  aaaca
                Big brown bat  aaaca
         David's myotis (bat)  aaaca
B D                  Microbat  aaaca
B D                  Hedgehog  aaaca
B D                     Shrew  aaaca
              Star-nosed mole  aaaca
B D                  Elephant  aaac-
          Cape elephant shrew  cca--
B D                   Manatee  ac---
             Cape golden mole  aaac-
B D                    Tenrec  aaac-
                     Aardvark  aaaca
B D                 Armadillo  aaaca
B D                   Opossum  aaaca
B D           Tasmanian devil  aaaca
B D                   Wallaby  aaaca
B D                  Platypus  aaaca
  D               Rock pigeon  aaac-
  D              Saker falcon  aaac-
  D          Peregrine falcon  aaac-
  D       Collared flycatcher  aaac-
  D    White-throated sparrow  aaac-
B D       Medium ground finch  aaac-
B D               Zebra finch  aaac-
           Tibetan ground jay  aaac-
B D                Budgerigar  aaac-
  D                    Parrot  aaac-
  D             Scarlet macaw  aaac-
  D              Mallard duck  aaac-
B D                   Chicken  aaac-
B D                    Turkey  aaac-
B D        American alligator  aaac-
  D           Green seaturtle  aaac-
  D            Painted turtle  aaac-
  D  Chinese softshell turtle  aaac-
  D    Spiny softshell turtle  aaac-
B D                    Lizard  aaac-
B D             X. tropicalis  aa---
B D                Coelacanth  acaca
B D                      Fugu  acgca
       Yellowbelly pufferfish  acgca
B D              Nile tilapia  aaata
          Princess of Burundi  ----a
        Burton's mouthbreeder  aatca
                  Zebra mbuna  aatca
          Pundamilia nyererei  aatca
B D                    Medaka  aataa
           Southern platyfish  aaaaa
B D               Stickleback  aaa--
B D              Atlantic cod  aaaaa
B D                 Zebrafish  acaca
     Mexican tetra (cavefish)  aattg
                  Spotted gar  ----a
              Golden hamster  NNNNN
B D                   Lamprey  =====
B D                 Tetraodon  =====

Inserts between block 8 and 9 in window
B D               Coelacanth 1bp
B D                     Fugu 35bp
      Yellowbelly pufferfish 5058bp
B D             Nile tilapia 2bp
         Princess of Burundi 3bp
       Burton's mouthbreeder 3bp
                 Zebra mbuna 3bp
         Pundamilia nyererei 3bp
B D                   Medaka 4bp
          Southern platyfish 4bp
B D              Stickleback 1bp
B D             Atlantic cod 3bp
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 2bp

Alignment block 9 of 1389 in window, 61478204 - 61478233, 30 bps 
B D                     Human  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                     Chimp  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                   Gorilla  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                 Orangutan  aaaag---aactg-taaaaa------ta---ac-----tg--tg
B D                    Gibbon  aaaag---aactg-tgtaaaaataacta---ac-t---tg--tg
B D                    Rhesus  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D       Crab-eating macaque  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                    Baboon  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D              Green monkey  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                  Marmoset  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D           Squirrel monkey  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                  Bushbaby  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
           Chinese tree shrew  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                  Squirrel  aaaag---aactg-tgtaaaaataacta---ac-----tg----
       Lesser Egyptian jerboa  aaaag---aactg-tgtaaa---aaata---ac-----tg----
                 Prairie vole  aaaag---aactg-tgtaaaaataacta---ac-----tg----
B D           Chinese hamster  aaaag---aactg-tgtaaaaataacta---ac-----tg----
B D                     Mouse  aaaag---aactg-tgtaaaaataacta---ac-----tg----
B D                       Rat  aaaag---aactg-tgtaaaaataacta---ac-----tg----
B D            Naked mole-rat  aaaag---aactg-tgtaaaaa----ta---ac-t--gtg----
B D                Guinea pig  aaaag---aactg-tgtaaaaataacta---ac-----tg----
                   Chinchilla  aaaag---aactg-tgtaaaaataacta---ac-t--gtg----
             Brush-tailed rat  aaaag---aactg-tgtaaaaa----ta---ac-t--gtg----
B D                    Rabbit  aaaag---aactg-tgtaaaaataacta---ac-----tgtg--
B D                      Pika  aaaag---aactg-tgtaaaaataacta---ac-----tgtg--
B D                       Pig  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                    Alpaca  aaaag---aactg-tgtaaaaatatcta---ac-----tg--tg
               Bactrian camel  aaaag---aactg-tgtaaaaatatcta---ac-----tg--tg
B D                   Dolphin  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
                 Killer whale  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
             Tibetan antelope  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                       Cow  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                     Sheep  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
                Domestic goat  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                     Horse  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D          White rhinoceros  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                       Cat  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                       Dog  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                   Ferret   aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                     Panda  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
               Pacific walrus  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
                 Weddell seal  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
             Black flying-fox  aaaag---aactg-tgtaaaaataacta---ac---------tg
B D                   Megabat  aaaag---aactg-tgtaaaaataacta---ac---------tg
                Big brown bat  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
         David's myotis (bat)  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                  Microbat  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                  Hedgehog  aaaag---aactg-tgtaaaaataacta---ac-t---tg--tg
B D                     Shrew  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
              Star-nosed mole  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                  Elephant  aaaac---aactg-tgtaaaaataactg---ac-----tg--tg
          Cape elephant shrew  aaaag---aacta-tgtaaaaata-------ac-----tg--tg
B D                   Manatee  aaaac---aactg-tgtaaaaataacta---ac-----tg--tg
             Cape golden mole  aaaag---aacta-tgtaaaaataacta---ac-----tg--tg
B D                    Tenrec  aaaag---aacta-tgtaaaaataacta---ac-----gg--tg
                     Aardvark  aaaag---aacta-tgtaaaaataacta---ac-----tg--tg
B D                 Armadillo  aaaag---aactg-tgtaaaaataac----------------tg
B D                   Opossum  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D           Tasmanian devil  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
B D                   Wallaby  aaaag---aac---tgtaaaaataacta---ac-----tg--tg
B D                  Platypus  aaaag---aactg-tgtaaaaataacta---ac-----tg--tg
  D               Rock pigeon  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D              Saker falcon  aaaag---aactg-tgtaaaaataacta---at-----tg--ta
  D          Peregrine falcon  aaaag---aactg-tgtaaaaataacta---at-----tg--ta
  D       Collared flycatcher  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D    White-throated sparrow  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D       Medium ground finch  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D               Zebra finch  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
           Tibetan ground jay  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D                Budgerigar  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D                    Parrot  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D             Scarlet macaw  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D              Mallard duck  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D                   Chicken  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D                    Turkey  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D        American alligator  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D           Green seaturtle  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D            Painted turtle  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D  Chinese softshell turtle  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
  D    Spiny softshell turtle  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D                    Lizard  aaaag---aactg-tgtaaaaataacta---ac-----tg--ta
B D             X. tropicalis  caaaa---aactg-tgtaaaaataacta---ac-----tg--ta
B D                Coelacanth  aaaaa---aaaat-tgtaaaaataacca---ac-----tg--ta
B D                      Fugu  -agaa---ca-----ggaaaaaaagaaa---------atg----
B D              Nile tilapia  -agaa---taaga-ggaaaaaaaaaa-----------atg----
          Princess of Burundi  -agaa---tgttt-tgtaaaaatagcca---ac-tttata----
        Burton's mouthbreeder  -agaa---tgttt-tgtaaaaatagcca---ac-tttata----
                  Zebra mbuna  -agaa---tgttt-tgtaaaaatagcca---ac-tttata----
          Pundamilia nyererei  -agaa---tgttt-tgtaaaaatagcca---ac-tttata----
B D                    Medaka  -gaagccgttctt-tgtaaaaatagcca------ctttta----
           Southern platyfish  -aaaa----------gaaaaaacag-------------tg----
B D               Stickleback  -agaa---tcaac-acaataaaaagaaa---------acg----
B D              Atlantic cod  -agaa---taag---gaagaaataatcatccat-tttctg----
B D                 Zebrafish  -ccaa---tgctt-tgtaaaaataacca---ac-tttatg----
     Mexican tetra (cavefish)  -cgca---tgcttacacagcaatga---------ttcatc----
                  Spotted gar  aaaaa---aaatc-tgtaaaaataacca---acttttgtg----
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Lamprey  ============================================
B D                 Tetraodon  ============================================
      Yellowbelly pufferfish  ============================================

Inserts between block 9 and 10 in window
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 2bp
B D                      Rat 358bp
  D              Rock pigeon 5bp
  D             Saker falcon 5bp
  D         Peregrine falcon 5bp
  D      Collared flycatcher 5bp
  D   White-throated sparrow 5bp
B D      Medium ground finch 5bp
B D              Zebra finch 5bp
          Tibetan ground jay 5bp
B D               Budgerigar 5bp
  D                   Parrot 5bp
  D            Scarlet macaw 5bp
  D             Mallard duck 5bp
B D                  Chicken 5bp
B D                   Turkey 5bp
B D       American alligator 5bp
  D          Green seaturtle 5bp
  D           Painted turtle 5bp
  D Chinese softshell turtle 5bp
  D   Spiny softshell turtle 5bp
B D                   Lizard 5bp
B D            X. tropicalis 5bp
B D               Coelacanth 5bp

Alignment block 10 of 1389 in window, 61478234 - 61478234, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  t
  D               Rock pigeon  t
  D              Saker falcon  t
  D          Peregrine falcon  t
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
B D               Zebra finch  t
           Tibetan ground jay  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                    Lizard  t
B D             X. tropicalis  t
B D                Coelacanth  t
B D                      Fugu  t
B D              Nile tilapia  t
          Princess of Burundi  t
        Burton's mouthbreeder  t
                  Zebra mbuna  t
          Pundamilia nyererei  t
B D                    Medaka  t
           Southern platyfish  t
B D               Stickleback  t
B D              Atlantic cod  t
B D                 Zebrafish  t
     Mexican tetra (cavefish)  a
                  Spotted gar  t
              Golden hamster  N
B D                       Rat  =
B D                   Lamprey  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =

Alignment block 11 of 1389 in window, 61478235 - 61478282, 48 bps 
B D                     Human  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                     Chimp  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Gorilla  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                 Orangutan  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Gibbon  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Rhesus  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D       Crab-eating macaque  tcccata----ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Baboon  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D              Green monkey  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Marmoset  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D           Squirrel monkey  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Bushbaby  tcccata--g-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
           Chinese tree shrew  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Squirrel  tcccata-tt-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
       Lesser Egyptian jerboa  tcccatattt-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
                 Prairie vole  tcccata-----tttt-t---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D           Chinese hamster  tcccata----ttttt-t---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                     Mouse  tcccata----ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                       Rat  tcccata----ctttc-a---------gagttactttaaaa-tgg---gatgatatgcacat-gat----
B D            Naked mole-rat  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                Guinea pig  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
                   Chinchilla  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
             Brush-tailed rat  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Rabbit  tcccata----ttttttg---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                      Pika  tcccata----ctttt-----------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                       Pig  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Alpaca  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
               Bactrian camel  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Dolphin  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
                 Killer whale  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
             Tibetan antelope  tcccata--t-ttttt-g---------aagtcg-tttacaa-tgg---gatgatatgcacat-gat----
B D                       Cow  tcccata--t-ttttt-g---------aagtcg-tttacaa-tgg---gatgatatgcacat-gat----
B D                     Sheep  tcccata--t-ttttt-g---------aagtcg-tttacaa-tgg---gatgatatgcacat-gat----
                Domestic goat  tcccata--t-ttttt-g---------aagtcg-tttacaa-tgg---gatgatatgcacat-gat----
B D                     Horse  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D          White rhinoceros  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                       Cat  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                       Dog  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Ferret   tcccata-tt-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                     Panda  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
               Pacific walrus  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
                 Weddell seal  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
             Black flying-fox  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Megabat  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
                Big brown bat  tcacata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
         David's myotis (bat)  tcacata----ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Microbat  tcacata----ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Hedgehog  tcccata----ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                     Shrew  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
              Star-nosed mole  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Elephant  tcccata--t-ttctt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
          Cape elephant shrew  tcccgta--g-cattt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Manatee  tcccata--g-ttctt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
             Cape golden mole  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Tenrec  tcccata--t-ttttt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
                     Aardvark  tcccata--t-ttctt-g---------aagtcgctttacaa-tgg---gatgatatgcacat-gat----
B D                 Armadillo  tcccata--t-ttttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Opossum  tcccata--c-tcttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D           Tasmanian devil  tcccata--c-tcttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Wallaby  tcccata--c-tcttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                  Platypus  tcccata--c-tcttt-g---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D               Rock pigeon  tcccata--c-tcttccg---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D              Saker falcon  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D          Peregrine falcon  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D       Collared flycatcher  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D    White-throated sparrow  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D       Medium ground finch  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D               Zebra finch  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
           Tibetan ground jay  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                Budgerigar  tcccata--c-tctttcc---------aagttgctttacaa-tgggatgatgatatgcacat-gat----
  D                    Parrot  tcccata--c-tctttcc---------aagttgctttacaa-tgggatgatgatatgcacat-gat----
  D             Scarlet macaw  tcccata--c-tctttcc---------aagttgctttacaa-tgggatgatgatatgcacat-gat----
  D              Mallard duck  tcccata--c-tctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                   Chicken  tcccata--c-gctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Turkey  tcccata--c-gctttag---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D        American alligator  tcccata--c-tcttttg---------tagttgctttacaa-tgg---gatgatatgcacat-gat----
  D           Green seaturtle  tcccata--c-tcttttg---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D            Painted turtle  tcccata--c-tcttttg---------aagttgctttacag-tgg---gatgatatgcacat-gat----
  D  Chinese softshell turtle  tcccata--c-tcttttg---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
  D    Spiny softshell turtle  tcccata--c-tcttttg---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D                    Lizard  tcccata--cttttttcc---------aagttgctttacaa-tgg---gatgatatgcacat-gat----
B D             X. tropicalis  tcccata--c-tttct-g---------aagtcactttacaa-tgg---gatgatatgcacat-gat----
B D                Coelacanth  ccccata----ttact-g---------tagatgctttacaa-tgg---gatgatatgcacat-gat----
B D                      Fugu  tcccatg----atatt-a---------aagatgctttacagttgg---gatgatatgcacaa-ttt----
B D              Nile tilapia  tcccatg----gtatt-a---------aagatgctatacaattgg---gatgatatgcacat-att----
          Princess of Burundi  tttcaga----gtact-a---------agacagctttacaaacag---gatgatatgcacgc-act----
        Burton's mouthbreeder  tttcaga----gtact-a---------agacagctttacaaacag---gatgatatgcacgc-act----
                  Zebra mbuna  tttcaga----gtact-a---------agacagctttacaaacag---gatgatatgcacgc-act----
          Pundamilia nyererei  tttcaga----gtact-a---------agacagctttacaaacag---gatgatatgcacgc-act----
B D                    Medaka  agtcaga----atact-c---------a----gctttacagtcag---aatactttgcacac-aac---t
           Southern platyfish  tcccatg----gtatt-c---------aagatgctatacaattgg---gatgatatgcacaa-atccggt
B D               Stickleback  tcccatg----gtatt-a---------aagatgctatacaattgg---gatgatatgcacat-attcggt
B D              Atlantic cod  tcccacg----gtatt-c---------ataatgcgttacagttgg---gaggatatgcacat-tat----
B D                 Zebrafish  ttccata----ttact-a-------atacacagctttacaaatag---gatgatatgaacaa-acc----
     Mexican tetra (cavefish)  tttcctg----ttaat-ataaaaccgttcagtgcttta-----------atattgtgtacaacaac----
                  Spotted gar  tcccgtg----ttatt-a---------aagatgctttacaa-tag---gatgatatgcacat-aat----
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================

                        Human  --------c
                        Chimp  --------c
                      Gorilla  --------c
                    Orangutan  --------c
                       Gibbon  --------c
                       Rhesus  --------c
          Crab-eating macaque  --------c
                       Baboon  --------c
                 Green monkey  --------c
                     Marmoset  --------c
              Squirrel monkey  --------c
                     Bushbaby  --------c
           Chinese tree shrew  --------c
                     Squirrel  --------c
       Lesser Egyptian jerboa  --------c
                 Prairie vole  --------c
              Chinese hamster  --------c
                        Mouse  --------c
                          Rat  --------c
               Naked mole-rat  --------c
                   Guinea pig  --------c
                   Chinchilla  --------c
             Brush-tailed rat  --------c
                       Rabbit  --------c
                         Pika  --------c
                          Pig  --------c
                       Alpaca  --------c
               Bactrian camel  --------c
                      Dolphin  --------c
                 Killer whale  --------c
             Tibetan antelope  --------c
                          Cow  --------c
                        Sheep  --------c
                Domestic goat  --------c
                        Horse  --------c
             White rhinoceros  --------c
                          Cat  --------c
                          Dog  --------c
                      Ferret   --------c
                        Panda  --------c
               Pacific walrus  --------c
                 Weddell seal  --------c
             Black flying-fox  --------c
                      Megabat  --------c
                Big brown bat  --------c
         David's myotis (bat)  --------c
                     Microbat  --------c
                     Hedgehog  --------c
                        Shrew  --------c
              Star-nosed mole  --------c
                     Elephant  ---------
          Cape elephant shrew  --------c
                      Manatee  --------c
             Cape golden mole  --------c
                       Tenrec  --------c
                     Aardvark  --------c
                    Armadillo  --------c
                      Opossum  --------c
              Tasmanian devil  --------c
                      Wallaby  --------c
                     Platypus  --------c
                  Rock pigeon  --------c
                 Saker falcon  --------c
             Peregrine falcon  --------c
          Collared flycatcher  --------c
       White-throated sparrow  --------c
          Medium ground finch  --------c
                  Zebra finch  --------c
           Tibetan ground jay  --------c
                   Budgerigar  --------c
                       Parrot  --------c
                Scarlet macaw  --------c
                 Mallard duck  --------c
                      Chicken  --------c
                       Turkey  --------c
           American alligator  --------c
              Green seaturtle  --------c
               Painted turtle  --------c
     Chinese softshell turtle  --------c
       Spiny softshell turtle  --------c
                       Lizard  --------c
                X. tropicalis  --------c
                   Coelacanth  --------c
                         Fugu  --------c
                 Nile tilapia  --------c
          Princess of Burundi  --------c
        Burton's mouthbreeder  --------c
                  Zebra mbuna  --------c
          Pundamilia nyererei  --------c
                       Medaka  ttccttttc
           Southern platyfish  ttagttttc
                  Stickleback  cttgctttc
                 Atlantic cod  --------c
                    Zebrafish  ---------
     Mexican tetra (cavefish)  ---------
                  Spotted gar  --------c
               Golden hamster  NNNNNNNNN
                      Lamprey  =========
                    Tetraodon  =========
       Yellowbelly pufferfish  =========

Inserts between block 11 and 12 in window
B D             Nile tilapia 91bp

Alignment block 12 of 1389 in window, 61478283 - 61478310, 28 bps 
B D                     Human  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                     Chimp  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                   Gorilla  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                 Orangutan  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                    Gibbon  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                    Rhesus  ttgctgca------------a-----tct--------tgccaaagagactttg
B D       Crab-eating macaque  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                    Baboon  ttgctgca------------a-----tct--------tgccaaagagactttg
B D              Green monkey  ttgctgca------------a-----tct--------tgccaaagagactttg
B D                  Marmoset  ttgctgca------------a-----act--------tgccaaagagacttt-
B D           Squirrel monkey  ttgctgca------------a-----act--------tgccaaagagacttt-
B D                  Bushbaby  ttgctgca------------a-----act--------tgccatacagac-ttg
           Chinese tree shrew  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                  Squirrel  ttgctgca------------a-----act--------tgccatacagac-ttg
       Lesser Egyptian jerboa  tcgctgca------------a-----act--------tgccatacagac-ttg
                 Prairie vole  ttgctgca------------a-----act--------caacacacagac-tc-
B D           Chinese hamster  ttgctgca------------a-----act--------cgacacacagac-tt-
B D                     Mouse  ttgctgca------------a-----act--------tgacacacagac-tt-
B D                       Rat  ttgctgc-------------a-----act--------cgacacacagac-cg-
B D            Naked mole-rat  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                Guinea pig  ttgctgca------------a-----act--------tgccatacagac-ttg
                   Chinchilla  ttgctgca------------a-----act--------tgccatacagac-ttg
             Brush-tailed rat  ttgctgca------------a-----act--------t-ccatacagac-ttg
B D                    Rabbit  ttgctgca------------a-----act--------tgtcatacagac-ttg
B D                      Pika  ttgctgca------------g-----act--------tgccatacagac-ttg
B D                       Pig  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                    Alpaca  ttgctgca------------a-----act--------tgccatacagac-ttg
               Bactrian camel  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                   Dolphin  ttgctgca------------a-----act--------tgccaaacagac-ttg
                 Killer whale  ttgctgca------------a-----act--------tgccaaacagac-ttg
             Tibetan antelope  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                       Cow  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                     Sheep  ttgctgca------------a-----act--------tgccatacagac-ttg
                Domestic goat  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                     Horse  ttgctgca------------a-----act--------tgtcatacagac-ttg
B D          White rhinoceros  ttgctgca------------a-----act--------tgccatacagactttg
B D                       Cat  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                       Dog  ttgctgca------------a-----act--------tgccatacagac-tcg
B D                   Ferret   ttgctgca------------g-----act--------tgccatacagac-ttg
B D                     Panda  ttgctgca------------a-----acc--------tgccatacagac-tcg
               Pacific walrus  ttgctgca------------a-----act--------tgccatacagac-tcg
                 Weddell seal  ttgctgca------------a-----act--------tgccattcagac-tcg
             Black flying-fox  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                   Megabat  ttgctgca------------a-----act--------tgccatacagac-ttg
                Big brown bat  ttgctgca------------a-----act--------tgccatacagac-ttg
         David's myotis (bat)  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                  Microbat  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                  Hedgehog  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                     Shrew  ttgctgca------------a-----act--------tgccatacagac-ttg
              Star-nosed mole  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                  Elephant  ---------------------------ct--------tgccgtacagac-ttg
          Cape elephant shrew  ttgctgca------------a-----act--------tgccatacagac--tg
B D                   Manatee  ttgctgca------------a-----act--------tgccatacagac-ttg
             Cape golden mole  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                    Tenrec  ttgctgca------------a-----act--------tgccatacagac--tg
                     Aardvark  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                 Armadillo  ttgctgca------------a-----acc--------tgccatacagac-ttg
B D                   Opossum  ttgctgca------------a-----act--------tgccatacagac-ttg
B D           Tasmanian devil  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                   Wallaby  ttgctgca------------a-----act--------tgccatacagac-ttg
B D                  Platypus  ttgctgca------------a-----act--------tgccat---gac-ttg
  D               Rock pigeon  ttgctgca------------a-----act--------tgccgtacaatt-tgc
  D              Saker falcon  ttgctgca------------a-----act--------tgccatacaact-tgc
  D          Peregrine falcon  ttgctgca------------a-----act--------tgccatacaact-tgc
  D       Collared flycatcher  ttgctgca------------a-----act--------tgccatacaact-tgc
  D    White-throated sparrow  ttgctgca------------a-----act--------tgccatacaact-tgc
B D       Medium ground finch  ttgctgca------------a-----act--------tgccatacaact-tgc
B D               Zebra finch  ttgctgca------------a-----act--------tgccatacaact-tgc
           Tibetan ground jay  ttgctgca------------a-----act--------tgccatacaact-tgc
B D                Budgerigar  ttgctgca------------a-----act--------tgccatacaact-tgc
  D                    Parrot  ttgctgcg------------a-----act--------tgccatacaact-tgc
  D             Scarlet macaw  ttgctgca------------a-----act--------tgccatacaact-tgc
  D              Mallard duck  ttgctgca------------a-----act--------tgccatacaact-tgc
B D                   Chicken  ttgctgca------------a-----act--------tgccatacaact-tgc
B D                    Turkey  ttgctgca------------a-----act--------tgccatacaact-tgc
B D        American alligator  ttgctgca------------a-----act--------tgccgtatgact-tgc
  D           Green seaturtle  ttgatgca------------a-----act--------tgtcatattact-tgc
  D            Painted turtle  ttgctgca------------a-----act--------tgtcatattact-tgc
  D  Chinese softshell turtle  ttgctgca------------a-----act--------tgtcatattact-tgc
  D    Spiny softshell turtle  ttgctgca------------a-----act--------tgtcatattact-tg-
B D                    Lizard  ttgctgca------------a-----act--------tgtcatatgact-tgc
B D             X. tropicalis  ttgctgca------------ccaattatc--------ttctgttca-ac-ttg
B D                Coelacanth  ttgctgcag-----------a-----act--------cg--------ac-tat
B D                      Fugu  --------------------a---gctct--------gctcgccg--------
          Princess of Burundi  --------------------a-----tcc--------aaaagcagagg-----
        Burton's mouthbreeder  --------------------a-----tcc--------aaaagcagagg-----
                  Zebra mbuna  --------------------a-----tcc--------aaaagcagagg-----
          Pundamilia nyererei  --------------------a-----tcc--------aaaagcaga-------
B D                    Medaka  --------------------a-----acc--------aaaagtaaaac-----
           Southern platyfish  --------------------c-----cta--------aaaa------------
B D               Stickleback  --------------------c-----cta--------aaaagaaaaaa-----
B D                 Zebrafish  cttccatttgaatga----ca-----tccctatgcaaaaaaaaagact-----
     Mexican tetra (cavefish)  ctgcca---aactca----ca-----ccgtt------aagattagtat-----
                  Spotted gar  ttgctgcaaaattcatgtcta-----gcc--------acaaactg--------
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Nile tilapia  =====================================================
B D                   Lamprey  =====================================================
B D                 Tetraodon  =====================================================
      Yellowbelly pufferfish  =====================================================
B D              Atlantic cod  =====================================================

Inserts between block 12 and 13 in window
B D           Naked mole-rat 3bp
B D               Guinea pig 3bp
            Brush-tailed rat 3bp
         Princess of Burundi 30bp
       Burton's mouthbreeder 30bp
                 Zebra mbuna 30bp
         Pundamilia nyererei 11bp
B D                   Medaka 19bp
          Southern platyfish 1bp
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 1bp

Alignment block 13 of 1389 in window, 61478311 - 61478346, 36 bps 
B D                     Human  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                     Chimp  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                   Gorilla  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                 Orangutan  -----------------------------------tagtacatgt-a---gtc--t--agac-aa--acg
B D                    Gibbon  -----------------------------------taatacacgt-a---gtc--t--agac-aa--acg
B D                    Rhesus  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D       Crab-eating macaque  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                    Baboon  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D              Green monkey  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                  Marmoset  -----------------------------------taatacatat-a---gtc--t--agac-aa--acg
B D           Squirrel monkey  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                  Bushbaby  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
           Chinese tree shrew  -----------------------------------taatacatgt-a---gtc--t--agac-at--acg
B D                  Squirrel  -----------------------------------taatacatgt-a---gtc--t--agac-ag--acg
       Lesser Egyptian jerboa  -----------------------------------taatacatgt-a---gtc--tacagac-ag--acg
                 Prairie vole  -----------------------------------taacacatgtaa---gtc--tagagac-ag--aca
B D           Chinese hamster  -----------------------------------taatacatgt-a---gtc--tagagac-ag--aca
B D                     Mouse  -----------------------------------taatacacgt-a---gtc--tagagac-ag--aca
B D                       Rat  -----------------------------------taatacatgt-a---gtc--cagagac-a---acg
B D            Naked mole-rat  -----------------------------------taatacatat-a---gtc--t--agac-ag--acg
B D                Guinea pig  -----------------------------------taatacatgt-a---gtc--t--agac-ag--acg
                   Chinchilla  -----------------------------------taatacatgt-a---gtc--t--agac-ag--acg
             Brush-tailed rat  -----------------------------------taatacatat-a---gtc--t--agac--------
B D                    Rabbit  -----------------------------------taatacacat-a---gtc--t--agag-aa--acg
B D                      Pika  -----------------------------------tagtacacgt-a---gtc--t--agac-aa--acg
B D                       Pig  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                    Alpaca  -----------------------------------taatacatgt-g---gtc--t--agac-aa--acg
               Bactrian camel  -----------------------------------taatacatgt-g---gtc--t--agac-aa--acg
B D                   Dolphin  -----------------------------------taatacatgt-a---gcc--t--agac-aa--aca
                 Killer whale  -----------------------------------taatacatgt-a---gcc--t--agac-aa--aca
             Tibetan antelope  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                       Cow  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                     Sheep  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
                Domestic goat  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                     Horse  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D          White rhinoceros  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                       Cat  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                       Dog  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                   Ferret   -----------------------------------taacacatgt-a---gtc--t--agac-aa--acg
B D                     Panda  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
               Pacific walrus  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
                 Weddell seal  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
             Black flying-fox  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                   Megabat  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
                Big brown bat  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
         David's myotis (bat)  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                  Microbat  -----------------------------------taatacatgt-a---gtc--t--agac-aa--acg
B D                  Hedgehog  -----------------------------------tagtacatgg-a---gtc--t--agac-aa--acg
B D                     Shrew  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
              Star-nosed mole  -----------------------------------taatacatgt-t---gtc--t--agac-aa--ata
B D                  Elephant  -----------------------------------cagaacgtga-a---gtc--t--cgac-aa--acc
          Cape elephant shrew  -----------------------------------taatacatgg-a---gcc--t--agac-aa--aca
B D                   Manatee  -----------------------------------taatacatgt-t---gtc--t--agac-aa--acg
             Cape golden mole  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                    Tenrec  -----------------------------------tcatacatgt-a---gtc--t--agac-ca--aca
                     Aardvark  -----------------------------------taatacatgt-a---gtc--t--agacaaa--aca
B D                 Armadillo  -----------------------------------taatacatgt-a---gtc--t--agac-aa--aca
B D                   Opossum  -----------------------------------taatacatgt-a---gtc--t--agcc-at--cca
B D           Tasmanian devil  -----------------------------------taatacatgt-a---gtc--t--agcc-at--cca
B D                   Wallaby  -----------------------------------taatacatgt-a---gtc--t--agcc-at--cca
B D                  Platypus  -----------------------------------taatacatgt-a---gtc--t--cgcc-at--acc
  D               Rock pigeon  -----------------------------------aaatacacgt-a---gcctat--agcc-tt--acc
  D              Saker falcon  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D          Peregrine falcon  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D       Collared flycatcher  -----------------------------------aaatacacgt-a---gcctat--agcc-tt--acc
  D    White-throated sparrow  -----------------------------------aaatacacgt-a---gcctat--agcc-tt--acc
B D       Medium ground finch  -----------------------------------aaatacacgt-a---gcctat--agcc-tt--acc
B D               Zebra finch  -----------------------------------aaatacacat-a---gcctat--agcc-tt--acc
           Tibetan ground jay  -----------------------------------aaatacacgt-a---gcctat--agcc-tt--acc
B D                Budgerigar  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D                    Parrot  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D             Scarlet macaw  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D              Mallard duck  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
B D                   Chicken  -----------------------------------aaatacatgtaa---gcc--t--agcc-tttaccc
B D                    Turkey  -----------------------------------aaatacatgtaa---gcc--t--agcc-tttaccc
B D        American alligator  -----------------------------------aaatacatat-a---gcc--t--agcc-tt--atc
  D           Green seaturtle  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D            Painted turtle  -----------------------------------aaatacatgt-a---gcc--t--accc-tt--acc
  D  Chinese softshell turtle  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
  D    Spiny softshell turtle  -----------------------------------aaatacatgt-a---gcc--t--agcc-tt--acc
B D                    Lizard  -----------------------------------aaatactggt-t---gcc--t--agcc-ta--gcc
B D             X. tropicalis  -----------------------------------tagtatgtat-gtatgtc--t--agcc-ca--cc-
B D                Coelacanth  -----------------------------------taacacattt-----gtc--a--agca-ac--aac
B D                      Fugu  ------------------tg----------------aaaacatctgg---ccc--a--caa---------
          Princess of Burundi  aaacaaaagaaaaagaaaca----------------aaaacaacc-a---cac--t--caa---------
        Burton's mouthbreeder  aaacaaaagaaaa-gaaac-----------------aaaacaacc-a---cac--t--caa---------
                  Zebra mbuna  aaacaaaagaaaa-gaaac-----------------aaaacaacc-a---cac--t--caa---------
          Pundamilia nyererei  aaagaaaagaaac-----------------------aaaacaacc-a---cac--t--caa---------
B D                    Medaka  gagcaaaagaaggtgaa-------------------aaaacaacc-a---gac--a--g-----------
           Southern platyfish  gaacaaaaaaagaggaa-------------------aaaaatacc-c---cct--g--c-----------
B D               Stickleback  -------------------ccctgctggc-------agcattcgc-a---cac--t--tgt---------
B D                 Zebrafish  ----------------------------------------caatc-t---ccc--t--cat---------
     Mexican tetra (cavefish)  ----------------------------------------taatt-t---ata--t--cta---------
                  Spotted gar  ----------------------cgatagtttagtcaagcacaacc-a---tga--c--cca---------
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Nile tilapia  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D              Atlantic cod  ======================================================================

                        Human  attc-agtccaag
                        Chimp  attc-agtccaag
                      Gorilla  attc-agtccaag
                    Orangutan  attc-agtccaag
                       Gibbon  attc-agtccaag
                       Rhesus  attc-agtccaag
          Crab-eating macaque  attc-agtccaag
                       Baboon  attc-agtccaag
                 Green monkey  attc-agtccaag
                     Marmoset  attc-agtccaag
              Squirrel monkey  attc-agtccaag
                     Bushbaby  attc-agtccaac
           Chinese tree shrew  attc-agtccaag
                     Squirrel  attc-agtccaag
       Lesser Egyptian jerboa  gttc-ggcccaag
                 Prairie vole  attc-agctcg--
              Chinese hamster  attc-agctg---
                        Mouse  attc-agctcagg
                          Rat  attc-agctcagg
               Naked mole-rat  attc-agtccaag
                   Guinea pig  attc-agtccaag
                   Chinchilla  attc-agtccaag
             Brush-tailed rat  attc-agtccaag
                       Rabbit  attc-agtccaag
                         Pika  attc-agtccaag
                          Pig  attc-agtccaag
                       Alpaca  attc-agtccaac
               Bactrian camel  attc-agtccaac
                      Dolphin  attc-agtccaag
                 Killer whale  attc-agtccaag
             Tibetan antelope  attc-agtccaag
                          Cow  attc-agtccaag
                        Sheep  attc-agtccaag
                Domestic goat  attc-agtccaag
                        Horse  attc-agtccaag
             White rhinoceros  attc-agtccaag
                          Cat  attc-agtccaag
                          Dog  attc-agtccaag
                      Ferret   attc-agtccaag
                        Panda  attc-agtccaag
               Pacific walrus  attc-agtccatg
                 Weddell seal  attc-agtccaag
             Black flying-fox  attc-agtccaag
                      Megabat  attc-agtccaag
                Big brown bat  attc-agtccaag
         David's myotis (bat)  attc-agtccaag
                     Microbat  attc-agtccaag
                     Hedgehog  attc-agtccaag
                        Shrew  attc-agt-caag
              Star-nosed mole  attc-agtccaag
                     Elephant  attc-agtccaaa
          Cape elephant shrew  cttc-agtccaag
                      Manatee  atcc-agtccaag
             Cape golden mole  attc-agttcaag
                       Tenrec  gttc-agtccaag
                     Aardvark  attc-agtccaag
                    Armadillo  attc-agtccaag
                      Opossum  attc-agtccaag
              Tasmanian devil  attc-agtccaag
                      Wallaby  attc-agtccaag
                     Platypus  attc-agtccaaa
                  Rock pigeon  actc-agtccaaa
                 Saker falcon  actc-agtccaaa
             Peregrine falcon  actc-agtccaaa
          Collared flycatcher  actc-agtccaga
       White-throated sparrow  actc-agtccaga
          Medium ground finch  actc-agtccaga
                  Zebra finch  actc-agtccaga
           Tibetan ground jay  actc-agtccaga
                   Budgerigar  actc-agtccaaa
                       Parrot  actc-agtccaaa
                Scarlet macaw  actc-agtccaaa
                 Mallard duck  actcaagtccaaa
                      Chicken  actcaaatccaaa
                       Turkey  actcaaatccaaa
           American alligator  actc-agtcca-a
              Green seaturtle  gttc-agtcca-a
               Painted turtle  attc-agtcca-a
     Chinese softshell turtle  attc-agtcca-a
       Spiny softshell turtle  gttc-agtcca-a
                       Lizard  att--agcccc-a
                X. tropicalis  --tc-aaccctaa
                   Coelacanth  attc-agaccaaa
                         Fugu  -------------
          Princess of Burundi  -------------
        Burton's mouthbreeder  -------------
                  Zebra mbuna  -------------
          Pundamilia nyererei  -------------
                       Medaka  -------------
           Southern platyfish  -------------
                  Stickleback  -------------
                    Zebrafish  -------------
     Mexican tetra (cavefish)  -------------
                  Spotted gar  -------------
               Golden hamster  NNNNNNNNNNNNN
                 Nile tilapia  =============
                      Lamprey  =============
                    Tetraodon  =============
       Yellowbelly pufferfish  =============
                 Atlantic cod  =============

Inserts between block 13 and 14 in window
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
B D       American alligator 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp
B D                   Lizard 1bp
B D            X. tropicalis 2bp
B D               Coelacanth 2bp
B D                   Medaka 3bp
          Southern platyfish 3bp

Alignment block 14 of 1389 in window, 61478347 - 61478359, 13 bps 
B D                     Human  aggtg--cta--act---tc
B D                     Chimp  aggtg--cta--act---tc
B D                   Gorilla  aggtg--cta--act---tc
B D                 Orangutan  aggtg--cta--act---tc
B D                    Gibbon  aggtg--cta--act---tc
B D                    Rhesus  aggtg--cta--act---tc
B D       Crab-eating macaque  aggtg--cta--act---tc
B D                    Baboon  aggtg--cta--act---tc
B D              Green monkey  aggtg--cta--act---tc
B D                  Marmoset  agttg--cta--act---tc
B D           Squirrel monkey  agttg--cta--act---tc
B D                  Bushbaby  aggtg--cta--act---tc
           Chinese tree shrew  aggtg--cta--act---tc
B D                  Squirrel  aggtg--cta--act---tc
       Lesser Egyptian jerboa  tggtg--cta--act---tt
                 Prairie vole  aggtg--cca--act---cc
B D           Chinese hamster  aggtg--cca--act---cc
               Golden hamster  aggtg--cca--act---ct
B D                     Mouse  aggtg--cca--act---cc
B D                       Rat  aggcg--cca--act---cc
B D            Naked mole-rat  aggtg--cta--act---tc
B D                Guinea pig  aggtg--cta--act---tc
                   Chinchilla  aggtg--cta--act---tc
             Brush-tailed rat  aggtg--cta--act---tc
B D                    Rabbit  aggtg--cta--act---tt
B D                      Pika  aggtg--cta--gct---tc
B D                       Pig  aggtg--cta--act---cc
B D                    Alpaca  aggtg--cta--act---tc
               Bactrian camel  aggtg--cta--act---tc
B D                   Dolphin  aggtg--cta--att---tc
                 Killer whale  aggtg--cta--att---tc
             Tibetan antelope  aggtg--cta--act---tc
B D                       Cow  aggtg--cta--act---tc
B D                     Sheep  aggtg--cta--act---tc
                Domestic goat  aggtg--cta--act---tc
B D                     Horse  aggtg--cta--act---tc
B D          White rhinoceros  aggtg--cta--aat---tc
B D                       Cat  aggtg--cta--act---tc
B D                       Dog  aggtg--cta--act---tc
B D                   Ferret   aggtg--cta--act---tt
B D                     Panda  aggtg--cta--act---tc
               Pacific walrus  aggtg--cta--act---tt
                 Weddell seal  aggtg--cta--act---tt
             Black flying-fox  aggtg--cta--act---tc
B D                   Megabat  aggtg--cta--act---tc
                Big brown bat  aggtg--cta--act---tc
         David's myotis (bat)  aggtg--cta--act---tc
B D                  Microbat  aggtg--cta--act---tc
B D                  Hedgehog  aggtg--cta--act---tt
B D                     Shrew  agatg--cta--act---tc
              Star-nosed mole  aggtg--cta--act---tc
B D                  Elephant  gggtg--cca--gct---tc
          Cape elephant shrew  aggtg--ctattact---tc
B D                   Manatee  aggtg--cta--act---tc
             Cape golden mole  aggtg--cta--act---tc
B D                    Tenrec  aggtg--cca--aat---tc
                     Aardvark  aggtg--cta--act---tc
B D                 Armadillo  aggtgctcta--act---tc
B D                   Opossum  ttgtg--cta--cct---tt
B D           Tasmanian devil  tggtg--cta--cat---tc
B D                   Wallaby  tggtg--cta--cct---tc
B D                  Platypus  aggtg--cta--att---tc
  D               Rock pigeon  agctg--cta--act-gatc
  D              Saker falcon  agctg--cta--act-gata
  D          Peregrine falcon  agctg--cta--act-gata
  D       Collared flycatcher  agctg--cta--act-gatc
  D    White-throated sparrow  agctg--cta--act-gatc
B D       Medium ground finch  agctg--cta--act-gatc
B D               Zebra finch  agctg--tta--act-gatc
           Tibetan ground jay  agctg--cta--act-gctc
B D                Budgerigar  agctg--cta--act-gctc
  D                    Parrot  agctg--cta--act-gctc
  D             Scarlet macaw  agctg--cta--act-gctc
  D              Mallard duck  agctg--cta--act-gatc
B D                   Chicken  agctg--cta--att-gatc
B D                    Turkey  agctg--cta--atg-gatc
B D        American alligator  agctg--cta--act-gttc
  D           Green seaturtle  agctg--cta--act-gttc
  D            Painted turtle  agctg--cta--act-gttc
  D  Chinese softshell turtle  agctg--tta--act-gttc
  D    Spiny softshell turtle  agctg--tta--act-gttc
B D                    Lizard  agctg--ctc--ata-tgtg
B D             X. tropicalis  gacgg--tta--att-gttc
B D                Coelacanth  aggta--cta--acttgtct
B D                      Fugu  cagtc--aga--cgc---gt
          Princess of Burundi  aaacc--aaa--aca---ac
        Burton's mouthbreeder  aaacc--aaa--aca---ac
                  Zebra mbuna  aaacc--aaa--aca---ac
          Pundamilia nyererei  aaacc--aaa--aca---ac
B D               Stickleback  tagtc--gtt--ttg---tt
B D                 Zebrafish  acact--gca--atc---aa
     Mexican tetra (cavefish)  ttacc--ata--agt---gt
                  Spotted gar  aactt--taa--cct---ac
B D              Nile tilapia  ====================
          Southern platyfish  ====================
B D                    Medaka  ====================
B D                   Lamprey  ====================
B D                 Tetraodon  ====================
      Yellowbelly pufferfish  ====================
B D              Atlantic cod  ====================

Inserts between block 14 and 15 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp
B D                     Fugu 3bp
         Princess of Burundi 9bp
       Burton's mouthbreeder 9bp
                 Zebra mbuna 9bp
         Pundamilia nyererei 9bp
B D              Stickleback 3bp
B D                Zebrafish 4bp
    Mexican tetra (cavefish) 4bp
                 Spotted gar 7bp

Alignment block 15 of 1389 in window, 61478360 - 61478374, 15 bps 
B D                     Human  aga--caatgcagca---ct
B D                     Chimp  aga--caatgcagca---ct
B D                   Gorilla  aga--caatgcagca---ct
B D                 Orangutan  aga--caatgcagca---ct
B D                    Gibbon  aga--caatgcagca---ct
B D                    Rhesus  aga--caatgcagca---ct
B D       Crab-eating macaque  aga--caatgcagca---ct
B D                    Baboon  aga--caatgcagca---ct
B D              Green monkey  aga--caatgcagca---ct
B D                  Marmoset  aga--caatgcagca---ct
B D           Squirrel monkey  aga--caatgcagca---ct
B D                  Bushbaby  aga--caatgcagca---ct
           Chinese tree shrew  aga--caatgcagca---ct
B D                  Squirrel  aga--caatgcagca---ct
       Lesser Egyptian jerboa  aaa--caacgcaggt---ct
                 Prairie vole  aga--caatgcagct---ct
B D           Chinese hamster  aga--cagtgcagct---ct
               Golden hamster  aga--cagtgcagct---ct
B D                     Mouse  gga--caatgcagct---ct
B D                       Rat  aga--cagcgcagcg---ct
B D            Naked mole-rat  aga--caatgcagca---ct
B D                Guinea pig  aga--caatgcagca---ct
                   Chinchilla  aga--caatgcagca---ct
             Brush-tailed rat  aga--cagtgcagca---ct
B D                    Rabbit  aga--caatgcagca---ct
B D                      Pika  aga--caatgcagca---ct
B D                       Pig  aga--caatgcagca---ct
B D                    Alpaca  aga--caatgcagca---ct
               Bactrian camel  aga--caatgcagca---ct
B D                   Dolphin  aga--caatgcagca---ct
                 Killer whale  aga--caatgcagca---ct
             Tibetan antelope  aga--caatgcagca---ct
B D                       Cow  aga--caatgcagca---ct
B D                     Sheep  aga--caatgcagca---ct
                Domestic goat  aga--caatgcagca---ct
B D                     Horse  aga--caatgcagca---ct
B D          White rhinoceros  aga--cagtgcagca---ct
B D                       Cat  aga--caatgcagca---ct
B D                       Dog  aga--caatgcagca---ct
B D                   Ferret   aga--caatgcagca---ct
B D                     Panda  aga--caatgcagca---ct
               Pacific walrus  aga--caatgcagca---ct
                 Weddell seal  aga--caatgcagca---ct
             Black flying-fox  aga--caatgcagca---ct
B D                   Megabat  aga--caatgcagca---ct
                Big brown bat  aga--caatgcagca---ct
         David's myotis (bat)  tga--caatgcagca---ct
B D                  Microbat  tga--caatgcagca---ct
B D                  Hedgehog  aga--caatgcagca---ct
B D                     Shrew  aga--caatgcagca---c-
              Star-nosed mole  aga--caatgcagca---ct
B D                  Elephant  aga--cgaggcagca---cc
          Cape elephant shrew  aga--cgatgcagca---ct
B D                   Manatee  aga--cgatgcagca---ct
             Cape golden mole  aga--caatgtagca---ct
B D                    Tenrec  aga--tggtgcagca---ct
                     Aardvark  aga--cgatgcagca---ct
B D                 Armadillo  aga--cgatgcagca---ct
B D                   Opossum  aga--caatgcagca---ct
B D           Tasmanian devil  aga--taatgcagca---ct
B D                   Wallaby  aga--caaagcagca---ct
B D                  Platypus  aga--caatgcagcg---ct
  D               Rock pigeon  caaacaaacgcagcg---ct
  D              Saker falcon  aaaacaaatgcagca---ct
  D          Peregrine falcon  aaaacaaatgcagca---ct
  D       Collared flycatcher  agaacaaacgcagca---ct
  D    White-throated sparrow  agaacaaacgcagca---ct
B D       Medium ground finch  agaacaaacgcagca---ct
B D               Zebra finch  agaataaatgcagca---ct
           Tibetan ground jay  agaacaaacgcagca---ct
B D                Budgerigar  cgaacaaaggcagcg---ct
  D                    Parrot  cgaacaaacgcagcg---ct
  D             Scarlet macaw  cgaacaaacgcagcg---ct
  D              Mallard duck  aaaaaaa-tgcagca---ct
B D                   Chicken  aaaaaaattgcagca---ct
B D                    Turkey  aaaaaaattgcagca---ct
B D        American alligator  aga--taatgcagca---ct
  D           Green seaturtle  agg--taatgcagca---ct
  D            Painted turtle  agg--taatgcagca---ct
  D  Chinese softshell turtle  agg--taatgcagca---ct
  D    Spiny softshell turtle  agg--taatgcagca---ct
B D                    Lizard  a----tgacgcagcg---ct
B D             X. tropicalis  agc--gaatgcagcagtgcc
B D                Coelacanth  aga--caaagcagca---ct
B D                      Fugu  agc--agaagcagga---ct
B D              Nile tilapia  tgc--acgagcagcg---tc
          Princess of Burundi  aag--caaaggagta---ca
        Burton's mouthbreeder  aag--caaaggagta---ca
                  Zebra mbuna  aag--caaaggagta---ca
          Pundamilia nyererei  aag--caaaggagta---ca
B D                    Medaka  aat--caaggtagta---ca
           Southern platyfish  tag--caggttggtt---tt
B D               Stickleback  agg--tgaagcagaa---ct
B D                 Zebrafish  ------aa------------
     Mexican tetra (cavefish)  ------aatgcagcc---ct
                  Spotted gar  gac--aaaagcagca---tc
B D                   Lamprey  ====================
B D                 Tetraodon  ====================
      Yellowbelly pufferfish  ====================
B D              Atlantic cod  ====================

Inserts between block 15 and 16 in window
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D                   Lizard 1bp
B D                     Fugu 2bp
B D             Nile tilapia 2bp
         Princess of Burundi 2bp
       Burton's mouthbreeder 2bp
                 Zebra mbuna 2bp
         Pundamilia nyererei 2bp
B D                   Medaka 4bp
          Southern platyfish 2bp
B D              Stickleback 11605bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 13bp

Alignment block 16 of 1389 in window, 61478375 - 61478494, 120 bps 
B D                     Human  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                     Chimp  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                   Gorilla  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                 Orangutan  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                    Gibbon  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                    Rhesus  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D       Crab-eating macaque  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                    Baboon  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D              Green monkey  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                  Marmoset  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D           Squirrel monkey  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                  Bushbaby  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
           Chinese tree shrew  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                  Squirrel  ataat---c------------c-ttt--------t----aac-a-----------a----cg---ca---
       Lesser Egyptian jerboa  ataat---c------------c-tct--------c--------a-----------a----cg---ca---
                 Prairie vole  ataac---c------------c-tct--------t--------a-----------a----cg---ca---
B D           Chinese hamster  acaaa---c------------c-tct--------g--------a-----------a----tg---ca---
               Golden hamster  acaaa---c------------c-tct--------g--------a-----------a----tg---ca---
B D                     Mouse  agaac---c------------c-cct--------t--------g-----------a----cg---ca---
B D                       Rat  ataa----t------------c-cgt--------t--------a-----------g----cg---ca---
B D            Naked mole-rat  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                Guinea pig  ataat---c------------c-ttt------aac--------a-----------a----cg---aa---
                   Chinchilla  ataat---c------------c-ttt------aac--------a-----------a----cg---ca---
             Brush-tailed rat  ctact---c------------c-tct--------t--------a-----------a----cg---ca---
B D                    Rabbit  ataat---c------------ctttt------aac--------a-----------a----cg---ca---
B D                      Pika  ataat---c------------c-ttt------aac--------a-----------a----cg---ca---
B D                       Pig  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                    Alpaca  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
               Bactrian camel  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                   Dolphin  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
                 Killer whale  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
             Tibetan antelope  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                       Cow  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                     Sheep  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
                Domestic goat  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                     Horse  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D          White rhinoceros  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                       Cat  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                       Dog  agaat---t------------c-tct-----taac--------a-----------a----cg---ca---
B D                   Ferret   agaat---c------------c-tct-----taac--------a-----------a----cg---ca---
B D                     Panda  agaat---c------------c-tct-----taac--------a-----------a----cg---ca---
               Pacific walrus  agaat---c------------c-tct-----taac--------a-----------a----cg---ca---
                 Weddell seal  agaat---c------------c-tct-----t-----------a-----------a----cg---ca---
             Black flying-fox  ataat---c------------c-ttt-----caac--------a-----------a----tg---ca---
B D                   Megabat  ataat---c------------c-ttt-----caac--------a-----------a----tg---ca---
                Big brown bat  ataat---c------------c-ttt-----taac--------a-----------a----tg---ca---
         David's myotis (bat)  ataat---c------------c-ttt-----taac--------a-----------a----tg---ca---
B D                  Microbat  ataat---c------------c-ttt-----taac--------a-----------a----tg---ca---
B D                  Hedgehog  ataataact------------t-ttt-----taac--------a-----------a----cg---ca---
B D                     Shrew  ------------------------tt-----taac--------a-----------a----cg---ca---
              Star-nosed mole  ataat---c------------c-ttt-----aaac--------a-----------a----cg---ca---
B D                  Elephant  -gtag---c------------c-ttt-----taac--------a-----------a----cg---ca---
          Cape elephant shrew  agaat---c------------c-ttt-----taac--------a-----------a----cg---ca---
B D                   Manatee  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
             Cape golden mole  ataat---t------------c-ttt-----caac--------a-----------a----cg---ca---
B D                    Tenrec  ataat---c------------c-ttt-----taac--------a-----------a----cg---ca---
                     Aardvark  acaat---c------------g-tct-----taac--------a-----------a----cg---ca---
B D                 Armadillo  ataat---c------------c-ttt-----taac--------c-----------a----cg---ca---
B D                   Opossum  ataataa-t------------c-ctt-----taac--------a-----------a----cg---ca---
B D           Tasmanian devil  ataataa-t------------c-ctt-----taac--------a-----------a----cg---ca---
B D                   Wallaby  ataataa-t------------c-ctt-----taac--------a-----------a----cg---ca---
B D                  Platypus  acagt---c------------c-att------aac--------a-----------attaccg---cc---
  D               Rock pigeon  agaat---c------------c-tct--gctcaac----aatta-----------a----tt---cc---
  D              Saker falcon  agaat---c------------c-tct--gcttaac----aattc-----------a----tt---ca---
  D          Peregrine falcon  agaat---c------------c-tct--gcttaac----aattc-----------a----tt---ca---
  D       Collared flycatcher  aggat---c------------c-tct--gcttaac----aatta-----------a----tt---ca---
  D    White-throated sparrow  agaat---c------------c-tct--gctgaacaattaatta-----------a----tt---ct---
B D       Medium ground finch  agaat---c------------c-tct--gcttaac----aatta-----------a----tt---ct---
B D               Zebra finch  agaat---c------------c-tct--gcttaac--------a-----------a----tt---ca---
           Tibetan ground jay  agaat---c------------c-tct--gcttaac----aatta-----------a----tt---ca---
B D                Budgerigar  agaat---c------------c-tct--gcttaac----aagga-----------a----gt---ca---
  D                    Parrot  ataat---c------------c-tct--gcttaac----aatga-----------a----gt---ca---
  D             Scarlet macaw  ataat---c------------c-tct--gcttaac----aatga-----------a----gt---ca---
  D              Mallard duck  ataat---c------------c-tct--gcataac----gatta-----------a----tt---aa---
B D                   Chicken  ataat---c------------c-tct--gcttaac----aatta-----------a----tt---aa---
B D                    Turkey  ataat---c------------c-tct--gcttaac----aatta-----------a----tt---aa---
B D        American alligator  atatt---c------------c-tct--gcttaac----aatta-----------a----ct---ca---
  D           Green seaturtle  atact---c------------t-tct--gc-ttac----catca-----------a----ct---ca---
  D            Painted turtle  atact---c------------t-gct-----taac----aatca-----------a----ct---ca---
  D  Chinese softshell turtle  atact---t------------c-tct--gcttaac----aatca-----------a----ct---ca---
  D    Spiny softshell turtle  atact---t------------c-tct--gcttaac----aatca-----------a----ct---ca---
B D                    Lizard  ctcct---c------------c-tcc--ccctaac----aatta-----------------t---ct---
B D             X. tropicalis  atact---t------------g-tct-----acac--------a-----------a----gt---ca---
B D                Coelacanth  g-------c------------c-tgtttgcttgac--------a-----------t----tt--------
B D                      Fugu  gggcg---c----------cac-gcc-----gagc--------a-----gcgtcgc----cg---cc---
B D              Nile tilapia  tcagc---cttcattcattttc-cat-----taga--------t-----------t----ca---ca---
          Princess of Burundi  tggac---c------------c-ctt-----gaac--------a-----------t----ca---ca---
        Burton's mouthbreeder  tggac---c------------c-ctt-----gaac--------a-----------t----ca---ca---
                  Zebra mbuna  tggac---c------------c-ctt-----gaac--------a-----------t----ca---ca---
          Pundamilia nyererei  tggac---c------------c-ctt-----gaac--------a-----------t----ca---ca---
B D                    Medaka  tgtca---t------------c-cta-----aagc--------a-----------t----ca---ca---
           Southern platyfish  tagaa---c------------t-tat-----gagc--------a-----------a----cagagcc---
B D                 Zebrafish  aaata---t------------a-tat-----aaac--------acacacacacgcg----ca---cacac
     Mexican tetra (cavefish)  tagta---c------------t-caa-----taac--------aaagaaactgtag----ca---ga---
                  Spotted gar  -ataa---t------------c-ctc-----taac--------ttgcaatatttgt----ca---ta---
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================

                        Human  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaat-
                        Chimp  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaat-
                      Gorilla  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaat-
                    Orangutan  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaat-
                       Gibbon  ----a--tt------------tg-ttt-tac----tc------attt-tcttttcttctagactgaaat-
                       Rhesus  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaat-
          Crab-eating macaque  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaat-
                       Baboon  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaat-
                 Green monkey  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaat-
                     Marmoset  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaac-
              Squirrel monkey  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaat-
                     Bushbaby  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
           Chinese tree shrew  ----a--tt------------tg-ttt-tac----tc------ataa-ccttttcttctagaccaaaatg
                     Squirrel  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
       Lesser Egyptian jerboa  ----a--tt------------gg-ttt-tac----tc------atta-cctttccttctagactgaaaga
                 Prairie vole  ----a--ct------------gg-ttt-tac----tc------atta-c-ttttcttctagaccgaaata
              Chinese hamster  ----a--tt------------gg-ttt-tac----tc------atta-c-ttttcttctagactgagata
               Golden hamster  ----g--tt------------gg-ttt-tac----tc------atta-c-ttttcttctagactgagaga
                        Mouse  ----a--tt------------gc--tt-tac----tc------atta-c-gtttcttctaggccaagata
                          Rat  ----a--ct------------gc-ttt-tac----tc------agta-t--ttccttctagactgagata
               Naked mole-rat  ----a--tt------------tg-ttt-tactcattc------atta-ctttttcttctagactgaaata
                   Guinea pig  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
                   Chinchilla  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
             Brush-tailed rat  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttttagactgaaata
                       Rabbit  ----a--tt------------tg-ttt-tac----tc------ac-----ttttcttctaggctgaaata
                         Pika  ----a--tt------------tg--tt-tac----tc------ac-----ttttcttctaggctgaaata
                          Pig  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                       Alpaca  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
               Bactrian camel  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                      Dolphin  ----a--tt------------tg-tct-tac----tc------atta-tcttttcttctagactgaaata
                 Killer whale  ----a--tt------------tg-tct-tac----tc------atta-tcttttcttctagactgaaata
             Tibetan antelope  ----a--tc------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                          Cow  ----a--tc------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                        Sheep  ----a--tc------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                Domestic goat  ----a--tc------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                        Horse  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaata
             White rhinoceros  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                          Cat  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaata
                          Dog  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                      Ferret   ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                        Panda  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
               Pacific walrus  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
                 Weddell seal  ----a--tt------------tg-ttt-tac----tc------atta-cctttccttctagactgaaata
             Black flying-fox  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaatg
                      Megabat  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctaggctgaaatg
                Big brown bat  ----a--tt------------tg-ttt-tac----tc------atta-t-ttttcttctagactgaaata
         David's myotis (bat)  ----a--tt------------tg-ttt-tac----tc------atta-t-ttttcttctagactgaaata
                     Microbat  ----a--tt------------tg-ttt-tac----tc------atta-t-ttttcttctagactgaaata
                     Hedgehog  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                        Shrew  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgatata
              Star-nosed mole  ----a--tt------------tg-ttt-tac----tc------atta-tcttttcttctagactgaaata
                     Elephant  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaaca
          Cape elephant shrew  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
                      Manatee  ----a--tt------------tg-ttt-tac----tc------atta-cctttccttctagactgaaaca
             Cape golden mole  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagaccaaaata
                       Tenrec  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctaggctgaaata
                     Aardvark  ----atttt------------tg-ttt-tac----tc------atta-ctttttcttctagactgaaata
                    Armadillo  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttctagactgaaata
                      Opossum  ----a--tt-------------g-ttt-tac----tc------atta-ccttttcttctagactgaaata
              Tasmanian devil  ----a--tt-------------g-ttt-tac----tc------atta-ccttttcttctagactgaaata
                      Wallaby  ----a--tt-------------g-ttt-ta-----tc------atta-ccttttcttctagactgaaata
                     Platypus  ----a--tt------------tg-ttt-tac----ac------actg-ccttttcttctaggctgcagtg
                  Rock pigeon  ----a--tc------------tg-gtt-tac----tc------atta-ccttttctcctagactgcagga
                 Saker falcon  ----a--tc------------tg-ttt-tac----tc------ataa-ccttttctcctagactgcagga
             Peregrine falcon  ----a--tc------------tg-ttt-tac----tc------ataa-ccttttctcctagactgcagga
          Collared flycatcher  ----a--tc------------tg-ctt-tac----tc------ttta-ccttttctcctagactgcagga
       White-throated sparrow  ----g--tc------------tg-ctt-tac----tc------ttta-ccttttctcctagactgcagga
          Medium ground finch  ----g--tc------------tg-ctt-tac----tc------ttta-ccttttctcctagactgcagga
                  Zebra finch  ----g--tc------------tg-ctt-tac----tc------ttta-cctttcctcctagactgtagga
           Tibetan ground jay  ----a--tc------------tg-ctt-tac----tc------ttta-ccttttctcctagactgcagga
                   Budgerigar  ----a--ac------------catttt-tac----tc------attc-cctttcctcctaggctgcagga
                       Parrot  ----a--tc------------cgtttt-tac----tc------attc-cctttcctcctaggctgcagga
                Scarlet macaw  ----a--tc------------catttt-tac----tc------attc-cctttcctcctaggctgcagga
                 Mallard duck  ----a--tc------------tg-ttt-tac----tc------atta-ccttttctcctaggctgcaggg
                      Chicken  ----a--ac------------tg-ttt-tac----tc------at----tttttctcctagactgcaggg
                       Turkey  ----a--ac------------tg-ttt-tac----tc------attg-ctttttctactagactggagga
           American alligator  ----a--tt------------tg-ttt-tac----tc------atta-ccttttcttccaggctgcaggg
              Green seaturtle  ----a--ta------------tg-ttt-tac----tc------atta-ccttttcttctagactgcaggg
               Painted turtle  ----g--ta------------tg-ttt-tac----tc------atta-tcttttcttctagactgcaggg
     Chinese softshell turtle  ----a--tt------------tgtttt-tac----tc------atta-ccttctcttctagactgca-gg
       Spiny softshell turtle  ----a--tt------------tg-ttt-tac----tc------atta-ccttctcttctagactgca-gg
                       Lizard  ----g--at------------gg-att-tac----at------attatccttatctcctagactgcagag
                X. tropicalis  ----a--tt------------tg---t-tat----ca------actg-aaattccttctaggctgcaaaa
                   Coelacanth  ----a--tc------------ac-ttt-ttc----tt------gcta-cccttt-tcccaggctgcagta
                         Fugu  -------tt------------ca-ttc-gtc----acccgaaagatt-c---------------------
                 Nile tilapia  -------ttctcccacaatgccg-tgg-ggc----ac------caaa-c---------------------
          Princess of Burundi  -------tt------------cg-ttc-tgc----ac------agtg-c---------------------
        Burton's mouthbreeder  -------tt------------cg-ttc-tgc----ac------agtg-c---------------------
                  Zebra mbuna  -------tt------------cg-ttc-tgc----ac------agtg-c---------------------
          Pundamilia nyererei  -------tt------------cg-ttc-tgc----ac------agtg-c---------------------
                       Medaka  -------tt------------ca-ttc-tgt----ac------agtc-a---------------------
           Southern platyfish  -------tt------------ca-ttcgttt----tc------tgtt-a---------------------
                    Zebrafish  acaac--ct------------cc-tta-taa----ag------acct-c----------ag---------
     Mexican tetra (cavefish)  -------ct------------ac-tta-tgg----ag---------------------------------
                  Spotted gar  -------tg------------c------tgc----ag------agta-c----------ag---------
                      Lamprey  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================

                        Human  -agactag--aag------------------g--------aaaatg------ct-ccctaatt-----aa
                        Chimp  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                      Gorilla  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                    Orangutan  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                       Gibbon  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                       Rhesus  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
          Crab-eating macaque  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                       Baboon  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                 Green monkey  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                     Marmoset  -agactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
              Squirrel monkey  -agactag--aaa------------------g--------aaaata------ct-ccctaatt-----aa
                     Bushbaby  cagactag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
           Chinese tree shrew  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                     Squirrel  caggctaa---aa------------------g--------aaaatg------ct-ccctaatt------a
       Lesser Egyptian jerboa  ccgactag--aaa------------------g--------aaaatg------ct-ccctaatt------a
                 Prairie vole  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt------a
              Chinese hamster  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt------a
               Golden hamster  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt------a
                        Mouse  caggctag---aa------------------a--------aaaatg------ct-ccctaatt------a
                          Rat  cagactag----a------------------a--------aaaatg------ct-ccctaatt------a
               Naked mole-rat  cagactag--aaa------------------g--------aaaatg------ct-ccctaatt------a
                   Guinea pig  cagactag--aaa------------------g--------aaaatg------ct-ccctaatt------a
                   Chinchilla  cagactag--aaa------------------g--------aaaatg------ct-ccctaatt------a
             Brush-tailed rat  cagactag--aaa------------------g--------aaaatg------ct-ccctaatt------a
                       Rabbit  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                         Pika  caggctag--aaa------------------g--------aaaatg------tt-ccctaatt-----aa
                          Pig  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                       Alpaca  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
               Bactrian camel  caggctag--gaa------------------g--------aaaatg------cc-ccctaatt-----aa
                      Dolphin  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                 Killer whale  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
             Tibetan antelope  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                          Cow  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                        Sheep  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                Domestic goat  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                        Horse  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
             White rhinoceros  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                          Cat  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                          Dog  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                      Ferret   caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                        Panda  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
               Pacific walrus  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                 Weddell seal  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
             Black flying-fox  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                      Megabat  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                Big brown bat  caggctag--aaa------------------g--------aaaatt------ct-ccctaatt-----aa
         David's myotis (bat)  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                     Microbat  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                     Hedgehog  caggctag--aaa------------------g--------aaaatg------tt-ccctaatt-----aa
                        Shrew  caggctag--aaa------------------g--------aaaatg------tt-ccctaatt-----aa
              Star-nosed mole  caggctag--aaa------------------g--------aaaatg------tc-ccctaatt-----aa
                     Elephant  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
          Cape elephant shrew  caggctagaaaaa------------------g--------aaaatg------ct-tcctaatt-----aa
                      Manatee  caggctag--aaa------------------g--------aaaata------ct-ccctaatt-----aa
             Cape golden mole  caggtcag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                       Tenrec  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                     Aardvark  cagactag--aaa------------------g--------aaaata------ct-ccctaatt-----aa
                    Armadillo  caggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                      Opossum  taggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
              Tasmanian devil  taggctag--aaa------------------g--------aaaatg------tt-ccctaatt-----aa
                      Wallaby  taggctag--aaa------------------g--------aaaatg------ct-ccctaatt-----aa
                     Platypus  tagcctag--aaa------------------g--------aaaacg------ct-ccctaatt-----aa
                  Rock pigeon  cagactag--aaa------------------g--------aaaatg------at-cccgaatt-----aa
                 Saker falcon  cagactag--aaa------------------g--------aaaatg------at-cccgaatt-----aa
             Peregrine falcon  cagactag--aaa------------------g--------aaaatg------at-cccgaatt-----aa
          Collared flycatcher  cagactag--aaa------------------g--------aaaatt------ac-tccgaatt-----aa
       White-throated sparrow  cagactag--aaa------------------g--------aaaatg------ac-tccgaatt-----aa
          Medium ground finch  cagactag--aaa------------------g--------aaaatg------ac-tccaaatt-----aa
                  Zebra finch  cagactag--aaa------------------g--------aaaatt------ac-tccaaatt-----ag
           Tibetan ground jay  cagactag--aaa------------------g--------aaaatg------ac-tccgaatt-----aa
                   Budgerigar  caggctag--aaa------------------g--------aaaatg------at-cccgaatt-----aa
                       Parrot  caggctag--aaa------------------g--------aaaatg------at-cccgaatt-----aa
                Scarlet macaw  caggctag--aaa------------------g--------aaaatg------at-cccgaatt-----at
                 Mallard duck  caggctag--aaa------------------g--------aaagtg------at-cccaaatt-----aa
                      Chicken  caggctag--aaa------------------g--------aaaatg------at-cccaaatt-----aa
                       Turkey  caggctag--aaa------------------g--------aaaa-g------at-cccaaatt------a
           American alligator  cagactag--aaa------------------g--------aaagtg------at-ccctaatt-----aa
              Green seaturtle  caggttag--aaa------------------g--------aaaatg------atcccctcatt-----aa
               Painted turtle  caggttag--aaa------------------g-------aaaaatg------atcccctcatt-----aa
     Chinese softshell turtle  caggctag--aaa------------------g--------aaaatg------atcccctcatt-----aa
       Spiny softshell turtle  caggctag--aaa------------------g--------aaaatg------atcccctcatt-----aa
                       Lizard  caggctag--aca------------------g--------aaagtg------at-ccctaattttttaaa
                X. tropicalis  tcaatatg--aaa------------------g--------aaaaagggaaaaaa-aactcata-----aa
                   Coelacanth  caggctac--acc------------------a--------aa----------tt-------ta-----aa
                         Fugu  -------a--cattctcccgccacgcagcggg-------------g------ca-ct----t--------
                 Nile tilapia  -------a--agc------------------g-------------g------tg-cg----tg-----cg
          Princess of Burundi  -------a--cat------------------g-------------g------ca-ct----tg-----tg
        Burton's mouthbreeder  -------a--cat------------------g-------------g------ca-ct----tg-----tg
                  Zebra mbuna  -------a--cat------------------g-------------g------ca-ct----tg-----tg
          Pundamilia nyererei  -------a--cat------------------g-------------g------ca-ct----tg-----tg
                       Medaka  -------a--ctt------------------g-------------g------ca-cc----tc-----tg
           Southern platyfish  -------g--att---------------------------------------ca-ca----tt-----cc
                    Zebrafish  --gaacag--caa------------------g-------aggactg------at-cc----ta-----aa
     Mexican tetra (cavefish)  -------g--caa------------------a-------------g------at-tc----ct-----ta
                  Spotted gar  -------g--cat------------------gccacattactgcag------ca-tc----cc-----ct
                      Lamprey  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================

                        Human  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                        Chimp  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                      Gorilla  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                    Orangutan  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                       Gibbon  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                       Rhesus  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
          Crab-eating macaque  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                       Baboon  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                 Green monkey  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                     Marmoset  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aaacg-tg------
              Squirrel monkey  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aaatg-tg------
                     Bushbaby  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aactg-ta------
           Chinese tree shrew  aaattggt------a-ctg--tt---------------tac-ag-----g-aaa--aattg-ta------
                     Squirrel  aaattggt------a-ttg--tt---------------tac-aa-----g-aaa--aattg-ta------
       Lesser Egyptian jerboa  aaattggt------a-ttg--tt---------------tac-aa-----g-aaa--aa--c-tg------
                 Prairie vole  aaattagt------a-ttg--tt---------------tac-aa-----g-aaaagaattt-ta------
              Chinese hamster  aaattggt------a-atg--tt---------------tac-aa-----g-aaaa-aattt-ta------
               Golden hamster  aaattggt------a-ttg--ta---------------tac-aa-----g-aaaa-aattt-ta------
                        Mouse  aaatttgt------a-ttg--tt---------------tac-aa-----g-aaa--aaatt-ta------
                          Rat  aaatttgt------a-ttg--tt---------------tac-aa-----g-aaa--aattt-ta------
               Naked mole-rat  aaattggt------a-ttg--tt---------------tac-aa-----g-aaa--atttg-tg------
                   Guinea pig  aaattgtt------a-ttg--tt---------------tac-aa-----g-aaa--atctg-ta------
                   Chinchilla  aaattggt------a-ttg--tt---------------tac-aa-----g-aaa--atttg-ta------
             Brush-tailed rat  aaattggt------a-ttg--tt---------------tac-aa-----g-aaa-----tt-tg------
                       Rabbit  aaatcggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                         Pika  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                          Pig  aaatgggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                       Alpaca  aaattggt------a-ctg--tt---------------tac-ag-----g-aaa--aattg-ta------
               Bactrian camel  aaattggt------a-ctg--tt---------------tac-ag-----g-aaa--aattg-ta------
                      Dolphin  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                 Killer whale  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
             Tibetan antelope  aaattggt------a-ttc--tt---------------tac-ag-----g-aaa--aattg-ta------
                          Cow  aaactggt------a-ttc--tt---------------tac-ag-----g-aaa--aattg-ta------
                        Sheep  aaattggt------a-ttc--tt---------------tac-ag-----g-aaa--aattg-ta------
                Domestic goat  aaattggt------a-ttc--tt---------------tac-ag-----g-aaa--aattg-ta------
                        Horse  aaactggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
             White rhinoceros  aaactggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                          Cat  aaattggt------a-ctg--tt---------------tac-ag-----g-aaa---attg-tg------
                          Dog  aaattgat------a-ttgtttt---------------tac-ag-----g-aaa---attg-tg------
                      Ferret   aaattggt------a-ttg--tt---------------tac-ag-----g-aaa----ctg-tg------
                        Panda  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa---gttg-tg------
               Pacific walrus  aaattggt------a-tca--tt---------------tac-ag-----g-aaa---actg-tg------
                 Weddell seal  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa---attg-tg------
             Black flying-fox  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                      Megabat  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                Big brown bat  aaattggt------a---g--tt---------------tac-agaaaaaa-aaa--aattg-ta------
         David's myotis (bat)  aaattggt------a---g--tt---------------tac-ag---aaa-aaa--aattg-ta------
                     Microbat  aaattggt------a---g--tt---------------tac-ag---aaa-aaa--aattg-ta------
                     Hedgehog  aaattgtt------a-ttg--tt---------------tac-ag-----g-aaa--aaatg-ta------
                        Shrew  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
              Star-nosed mole  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                     Elephant  aaattggt------a---g--tt---------------tac-ag-----g-aaa--aactg-tg------
          Cape elephant shrew  aaatcagt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                      Manatee  aaattggt------a---g--tt---------------tac-ag-----g-aaa--aattg-ta------
             Cape golden mole  aaattggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                       Tenrec  aaatcggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-tg------
                     Aardvark  aaactggt------a-ttg--tt---------------tac-ag-----g-aaa--aattg-ta------
                    Armadillo  aaattagt------a-tcg--tt---------------tac-ac-----g-aaa--aattg-ta------
                      Opossum  aaattggt------t-ttg---t---------------tac-ag-----gaaaa--aattg-ta------
              Tasmanian devil  aaattggt------a-ctg---t---------------tac-ag-----g-aaa--aattg-ta------
                      Wallaby  aaattggt------a-ttg---t---------------tac-ag-----gaaaa--aattg-ta------
                     Platypus  aaattggt------a-tca--tt---------------aaa-gg-----a-aaa--aactt-ta------
                  Rock pigeon  aaatcgat------a-ct---tt---------------tac-ag-----g---a--aatcg-ta------
                 Saker falcon  aaatcaaa------a-ct---ct---------------tac-ag-----g---a--aattg-ta------
             Peregrine falcon  aaatcaaa------a-ct---ct---------------tac-ag-----g---a--aattg-ta------
          Collared flycatcher  aaatcaat------a-ct---ct---------------tacaag-----g---a--aattg-ta------
       White-throated sparrow  aaatcgat------a-ct---ct---------------gac-ag-----g---a--aattg-ta------
          Medium ground finch  aaatcgat------a-ct---ct---------------gac-ag-----g---a--aattg-ta------
                  Zebra finch  aaatcaat------a-ct---ct---------------taa-ag-----g---a--aattg-ta------
           Tibetan ground jay  aaatcgat------a-ct---ct---------------tac-ag-----g---a--aattg-ta------
                   Budgerigar  aaatcgat------a-ct---ct---------------tcc-ag-----g--aa--aatgg-ta------
                       Parrot  aaattgat------a-ct---ct---------------tcc-ag-----g--aa--aatgg-ga------
                Scarlet macaw  aaactgat------a-ct---ct---------------tcc-ag-----g--aa--aacgg-ta------
                 Mallard duck  aaatcgat------a-ct---ct---------------tac-ag-----g---a--aattg-ta------
                      Chicken  aaattgat------a-ct---ct---------------gac-ag-----g---a--aattg-ta------
                       Turkey  aaattgat------a-ct---ct---------------tac-ag-----g---a--agttg-ta------
           American alligator  aaattggt------a-ct---ct---------------tac-gg-----a---a--aactg-ta------
              Green seaturtle  aaattggt------a-ct---ct---------------tat-ag-----g--aa--aaatg-tg------
               Painted turtle  aaattggt------a-ct---ct---------------cac-ag-----g--aa--aaatg-tg------
     Chinese softshell turtle  aaattagt------a-ct---ct---------------tac-ag-----g--aa--aagta-tg------
       Spiny softshell turtle  aaattagt------a-ct---ct---------------tac-ag-----g--aa--aagta-tg------
                       Lizard  aaatctct------g-tt---ct---------------aac-tg-----g--aa--aaatg-ta------
                X. tropicalis  aagtatgt------g-tct--tt---------------cat-gg-----g-gag--ga-----a------
                   Coelacanth  agattggt------aatta--gt---------------tac-aa-----a--ga--agttg-ta------
                         Fugu  --------------c-ctg--tc---------------cgt-cg-----t-agc--acagg-cgagccag
                 Nile tilapia  cctctaaa-agacca-ctt--tc---------------tgt-ca-----c-acc--acggg-tc------
          Princess of Burundi  aaactgga------g-caa--tc---------------tgt-ca-----c-ata--accat-tg------
        Burton's mouthbreeder  aaactgga------g-caa--tc---------------tgt-ca-----c-ata--accat-tg------
                  Zebra mbuna  aaactgga------g-caa--tc---------------tgt-ca-----c-ata--accat-tg------
          Pundamilia nyererei  aaactgga------g-caa--tc---------------tgt-ca-----c-ata--accat-tg------
                       Medaka  aaaccaga------g-caa--acgttcaggattttaattta-ca-----t-att--aacacgtg------
           Southern platyfish  aaggaaac------a-cga--tcatctgaagcttctgccgg-cg-----c-gat--gccgc-ta------
                    Zebrafish  ccatcaca------t-tca--cc---------------tgc-tg-----t-ggt--ttacg-ag------
     Mexican tetra (cavefish)  tcacagag------t-taatgcg---------------tgc-ct-----t-act--gcaag-ag------
                  Spotted gar  agattgaatacattt-gta--tc---------------tgc-aa-----c-aga--acgat-tc------
                      Lamprey  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================

                        Human  -taa
                        Chimp  -taa
                      Gorilla  -taa
                    Orangutan  -taa
                       Gibbon  -taa
                       Rhesus  -taa
          Crab-eating macaque  -taa
                       Baboon  -taa
                 Green monkey  -taa
                     Marmoset  -taa
              Squirrel monkey  -taa
                     Bushbaby  -taa
           Chinese tree shrew  -taa
                     Squirrel  -taa
       Lesser Egyptian jerboa  -taa
                 Prairie vole  -taa
              Chinese hamster  -taa
               Golden hamster  -tag
                        Mouse  -taa
                          Rat  -taa
               Naked mole-rat  -taa
                   Guinea pig  -taa
                   Chinchilla  -taa
             Brush-tailed rat  -tag
                       Rabbit  -taa
                         Pika  -taa
                          Pig  -taa
                       Alpaca  -taa
               Bactrian camel  -taa
                      Dolphin  -taa
                 Killer whale  -taa
             Tibetan antelope  -tac
                          Cow  -tac
                        Sheep  -tac
                Domestic goat  -tac
                        Horse  -taa
             White rhinoceros  -taa
                          Cat  -taa
                          Dog  -taa
                      Ferret   -taa
                        Panda  -taa
               Pacific walrus  -taa
                 Weddell seal  -taa
             Black flying-fox  -taa
                      Megabat  -taa
                Big brown bat  -taa
         David's myotis (bat)  -taa
                     Microbat  -taa
                     Hedgehog  -taa
                        Shrew  -taa
              Star-nosed mole  -taa
                     Elephant  -taa
          Cape elephant shrew  -taa
                      Manatee  -taa
             Cape golden mole  -tta
                       Tenrec  -taa
                     Aardvark  -taa
                    Armadillo  -taa
                      Opossum  -taa
              Tasmanian devil  -taa
                      Wallaby  -taa
                     Platypus  -taa
                  Rock pigeon  -cta
                 Saker falcon  -tta
             Peregrine falcon  -tta
          Collared flycatcher  -tta
       White-throated sparrow  -tta
          Medium ground finch  -tta
                  Zebra finch  -tta
           Tibetan ground jay  -tta
                   Budgerigar  -gga
                       Parrot  -gga
                Scarlet macaw  -gga
                 Mallard duck  -taa
                      Chicken  -tag
                       Turkey  -tag
           American alligator  -taa
              Green seaturtle  -taa
               Painted turtle  -taa
     Chinese softshell turtle  -taa
       Spiny softshell turtle  -taa
                       Lizard  -taa
                X. tropicalis  -tta
                   Coelacanth  ttta
                         Fugu  tcga
                 Nile tilapia  -tag
          Princess of Burundi  -caa
        Burton's mouthbreeder  -caa
                  Zebra mbuna  -caa
          Pundamilia nyererei  -caa
                       Medaka  -gaa
           Southern platyfish  -aca
                    Zebrafish  -cca
     Mexican tetra (cavefish)  -gaa
                  Spotted gar  -tag
                      Lamprey  ====
                    Tetraodon  ====
       Yellowbelly pufferfish  ====
                 Atlantic cod  ====
                  Stickleback  ====

Inserts between block 16 and 17 in window
B D                   Rabbit 1bp
B D                 Elephant 8bp
B D                     Fugu 4bp
B D             Nile tilapia 4bp
         Princess of Burundi 4bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 4bp
B D                   Medaka 41bp
          Southern platyfish 5431bp
B D                Zebrafish 20bp
    Mexican tetra (cavefish) 14bp
                 Spotted gar 6bp

Alignment block 17 of 1389 in window, 61478495 - 61478558, 64 bps 
B D                     Human  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                     Chimp  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                   Gorilla  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                 Orangutan  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                    Gibbon  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                    Rhesus  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D       Crab-eating macaque  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                    Baboon  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D              Green monkey  t----tt---------tg-cattaga---a-ttac-a---a-----------------------------
B D                  Marmoset  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D           Squirrel monkey  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                  Bushbaby  t----tt---------tg-cattaga---atttac-a---a-----------------------------
           Chinese tree shrew  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                  Squirrel  t----tt---------tg-cattaga---atttac-a---a-----------------------------
       Lesser Egyptian jerboa  t----tt---------cg-cattaga---atttac-a---a-----------------------------
                 Prairie vole  ttaattt---------tg-cattaga---atttac-a---a-----------------------------
B D           Chinese hamster  ttaattt---------tg-cattaga---atttac-a---a-----------------------------
               Golden hamster  ttaattt---------tg-cattaga---atttac-a---a-----------------------------
B D                     Mouse  t----tt---------tg-tattaga---atttac-a---a-----------------------------
B D                       Rat  ttaa-tt---------tg-tattaga---atttac-a---a-----------------------------
B D            Naked mole-rat  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                Guinea pig  t----tt---------tg-cattaga---atttac-a---a-----------------------------
                   Chinchilla  t----tt---------tg-tattaga---atttac-a---a-----------------------------
             Brush-tailed rat  c----tt---------tg-cattaca---atttac-a---a-----------------------------
B D                    Rabbit  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                      Pika  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                       Pig  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                    Alpaca  t----tt---------tg-cattaga---atttac-a---a-----------------------------
               Bactrian camel  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                   Dolphin  t----tt---------tg-cattaga---atttac-a---a-----------------------------
                 Killer whale  t----tt---------tg-cattaga---atttac-a---a-----------------------------
             Tibetan antelope  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                       Cow  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                     Sheep  t----tt---------tg-catcaga---atttac-a---a-----------------------------
                Domestic goat  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                     Horse  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D          White rhinoceros  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                       Cat  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                       Dog  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                   Ferret   t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                     Panda  t----tt---------tg-cattaga---atttac-a---a-----------------------------
               Pacific walrus  t----tt---------tg-cattaga---atttac-a---g-----------------------------
                 Weddell seal  t----tt---------tg-cattaga---atttac-a---a-----------------------------
             Black flying-fox  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                   Megabat  t----tt---------tg-cattaga---atttac-a---a-----------------------------
                Big brown bat  t----tt---------tg-cattaga---atttac-a---a-----------------------------
         David's myotis (bat)  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                  Microbat  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                  Hedgehog  t----tt---------tg-catcaga---atttac-a---a-----------------------------
B D                     Shrew  t----tt---------tg-cattaga---atttac-aagta-----------------------------
              Star-nosed mole  t----tt---------tg-cattaga---atttac-a---a-----------------------------
B D                  Elephant  t----ct---------tg-cattaga---atttac-a---a-----------------------------
          Cape elephant shrew  -----ct---------tg-cattaga---atttac-a---a-----------------------------
B D                   Manatee  t----ct---------tg-cattaga---atttac-a---a-----------------------------
             Cape golden mole  t----ct---------tg-cattaga---atttac-a---a-----------------------------
B D                    Tenrec  t----ct---------tg-cattaga---atttac-a---a-----------------------------
                     Aardvark  t----ct---------tg-cgttaga---atttac-a---a-----------------------------
B D                 Armadillo  t----tt---------tg-caataga---atttac-a---a-----------------------------
B D                   Opossum  t----tt---------tg-caataga---atttac-a---a-----------------------------
B D           Tasmanian devil  t----tt---------tg-caataga---atttac-a---a-----------------------------
B D                   Wallaby  t----tt---------tg-caataga---atttac-a---a-----------------------------
B D                  Platypus  t----tt---------tg-caacgga---atttac-a---a-----------------------------
  D               Rock pigeon  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
  D              Saker falcon  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
  D          Peregrine falcon  t----tt---------tg-caatataatcttttac-a---a-----------------------------
  D       Collared flycatcher  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
  D    White-throated sparrow  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
B D       Medium ground finch  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
B D               Zebra finch  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
           Tibetan ground jay  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
B D                Budgerigar  t----tt---------tg-caatagagtcttttac-a---a-----------------------------
  D                    Parrot  t----tt---------tg-caatagagtcttttac-a---a-----------------------------
  D             Scarlet macaw  t----tt---------tg-caatagagtcttttac-a---a-----------------------------
  D              Mallard duck  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
B D                   Chicken  t----tt---------tg-caatatagtcttttac-a---a-----------------------------
B D                    Turkey  t----tt---------tg-caatatagtcctttac-a---a-----------------------------
B D        American alligator  t----tt---------tg-gaatagactc---tac-a---a-----------------------------
  D           Green seaturtle  t----tt---------tg-caataga---cttaac-a---a-----------------------------
  D            Painted turtle  t----tt---------tg-caataga---cttaac-a---a-----------------------------
  D  Chinese softshell turtle  t----tt---------tg-caatagc---cttaac-a---a-----------------------------
  D    Spiny softshell turtle  t----tt---------tg-caataga---cttaac-a---a-----------------------------
B D                    Lizard  t----tc---------tg-caataga---ctttac-a---a-----------------------------
B D             X. tropicalis  c----at---------tt-tagcaga---cctaacta---a-----------------------------
B D                Coelacanth  t----tt---------tgtttttaga---ctttac-a---a-----------------------------
B D                      Fugu  -----tc---------cc-ccataat---atattc-a---ccgtatcc----------------------
B D              Nile tilapia  -----ttctatgc---ca-actcaac---acatgg-g---ccgattttcacaacacccccgcccacccct
          Princess of Burundi  -----tc---------ca-acattat---atatat-a---------------------------------
        Burton's mouthbreeder  -----tt---------ca-acattat---atatat-a---------------------------------
                  Zebra mbuna  -----tt---------ca-acattat---atatat-a---------------------------------
          Pundamilia nyererei  -----tt---------ca-acattat---atatat-a---------------------------------
B D                    Medaka  -----tt---------ta-ttcttcg---atcttt-a---c-----------------------------
           Southern platyfish  -----ct---------ta-acattat---atttt------------------------------------
B D                 Zebrafish  -----cc---------tg-ccatact---ctatat-----------------------------------
     Mexican tetra (cavefish)  -----tt---------ta-atataca---atatac-a---aaacaa------------------------
                  Spotted gar  -------ttctgcagtag-actttac---acgtag-a---agt---------------------------
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================

                        Human  ------------------------gta-----tatg------------------tt--------------
                        Chimp  ------------------------gta-----tatg------------------tt--------------
                      Gorilla  ------------------------gta-----tatg------------------tt--------------
                    Orangutan  ------------------------gta-----tatg------------------tt--------------
                       Gibbon  ------------------------gta-----tatg------------------tt--------------
                       Rhesus  ------------------------gta-----tatg------------------tt--------------
          Crab-eating macaque  ------------------------gta-----tatg------------------tt--------------
                       Baboon  ------------------------gta-----tatg------------------tt--------------
                 Green monkey  ------------------------gta-----tatg------------------tt--------------
                     Marmoset  ------------------------gtc-----tatg------------------tt--------------
              Squirrel monkey  ------------------------gtc-----aatg------------------tt--------------
                     Bushbaby  ------------------------gta-----tatg------------------tt--------------
           Chinese tree shrew  ------------------------gta-----tctg------------------tt--------------
                     Squirrel  ------------------------gta-----tatg------------------tt--------------
       Lesser Egyptian jerboa  ------------------------gta-----aatg------------------tt--------------
                 Prairie vole  ------------------------gta-----tatg------------------tt--------------
              Chinese hamster  ------------------------gta-----tatg------------------tt--------------
               Golden hamster  ------------------------gta-----tatg------------------tt--------------
                        Mouse  ------------------------gtc-----tatt------------------tt--------------
                          Rat  ------------------------gta-----tatt------------------ct--------------
               Naked mole-rat  ------------------------tta-----tatg------------------tt--------------
                   Guinea pig  ------------------------ctg-----tatg------------------tt--------------
                   Chinchilla  ------------------------cta-----tacg------------------tt--------------
             Brush-tailed rat  ------------------------cta-----tatg------------------tt--------------
                       Rabbit  ------------------------gta-----tatg------------------ct--------------
                         Pika  ------------------------gtg-----tatc------------------ct--------------
                          Pig  ------------------------gta-----tatg------------------tt--------------
                       Alpaca  ------------------------gta-----tatg------------------tt--------------
               Bactrian camel  ------------------------gta-----tatg------------------tt--------------
                      Dolphin  ------------------------gta-----tatg------------------tt--------------
                 Killer whale  ------------------------gta-----tatg------------------tt--------------
             Tibetan antelope  ------------------------gta-----tatg------------------tt--------------
                          Cow  ------------------------gta-----tatg------------------tt--------------
                        Sheep  ------------------------gta-----tatg------------------tt--------------
                Domestic goat  ------------------------gta-----tatg------------------tt--------------
                        Horse  ------------------------gta-----taag------------------tt--------------
             White rhinoceros  ------------------------gtt-----tatg------------------tt--------------
                          Cat  ------------------------gta-----tatg------------------tt--------------
                          Dog  ------------------------gta-----tatg------------------ct--------------
                      Ferret   ------------------------gta-----tatg------------------tt--------------
                        Panda  ------------------------gta-----tatg------------------tt--------------
               Pacific walrus  ------------------------gta-----tatg------------------tt--------------
                 Weddell seal  ------------------------gta-----tatg------------------tt--------------
             Black flying-fox  ------------------------gta-----tatg------------------tt--------------
                      Megabat  ------------------------gta-----tatg------------------tt--------------
                Big brown bat  ------------------------gta-----tatg------------------tt--------------
         David's myotis (bat)  ------------------------gta-----tatg------------------tt--------------
                     Microbat  ------------------------gta-----tatg------------------tt--------------
                     Hedgehog  ------------------------gtt-----tatg------------------tt--------------
                        Shrew  ------------------------gta-----tatg------------------tt--------------
              Star-nosed mole  ------------------------gta-----tatg------------------tt--------------
                     Elephant  ------------------------gta-----tatg------------------tt--------------
          Cape elephant shrew  ------------------------gta-----tatg------------------tt--------------
                      Manatee  ------------------------gta-----tatg------------------tt--------------
             Cape golden mole  ------------------------gta-----tatg------------------tt--------------
                       Tenrec  ------------------------gta-----tatg------------------tt--------------
                     Aardvark  ------------------------gta-----tatg------------------tt--------------
                    Armadillo  ------------------------gta----ttatg------------------tt--------------
                      Opossum  ------------------------gta---tatttt------------------tt--------------
              Tasmanian devil  ------------------------gtattttttttt------------------tt--------------
                      Wallaby  ------------------------gta---tttttt------------------tt--------------
                     Platypus  ------------------------gaa-----tacg------------------tt--------------
                  Rock pigeon  ------------------------gt------tat-----------------------------------
                 Saker falcon  ------------------------gt------tat-----------------------------------
             Peregrine falcon  ------------------------gt------tat-----------------------------------
          Collared flycatcher  ------------------------gt------tac-----------------------------------
       White-throated sparrow  ------------------------gt------tac-----------------------------------
          Medium ground finch  ------------------------gt------tac-----------------------------------
                  Zebra finch  ------------------------gt------tac-----------------------------------
           Tibetan ground jay  ------------------------gt------tac-----------------------------------
                   Budgerigar  ------------------------gt------tat-----------------------------------
                       Parrot  ------------------------gt------tat-----------------------------------
                Scarlet macaw  ------------------------gt------tat-----------------------------------
                 Mallard duck  ------------------------ct------tat-----------------------------------
                      Chicken  ------------------------tt------tat-----------------------------------
                       Turkey  ------------------------tt------tat-----------------------------------
           American alligator  ------------------------gt------tgg-----------------------------------
              Green seaturtle  ------------------------gt------tat-----------------------------------
               Painted turtle  ------------------------gg------tat-----------------------------------
     Chinese softshell turtle  ------------------------gt------tat-----------------------------------
       Spiny softshell turtle  ------------------------gt------tat-----------------------------------
                       Lizard  ------------------------gt------tat-----------------------------------
                X. tropicalis  ------------------------ata-----caag------------------tt--------------
                   Coelacanth  ------------------------gta-----catg------------------tt--------------
                         Fugu  ------------------------gtt-----cata------------------ta-------aagcaac
                 Nile tilapia  gcccacactgggtgtagaatagatcta-----tata------------------ta-------aa-----
          Princess of Burundi  ------------------------tta-----cata------------------tt-------aa-----
        Burton's mouthbreeder  ------------------------tta-----cata------------------tt-------aa-----
                  Zebra mbuna  ------------------------tta-----cata------------------tt-------aa-----
          Pundamilia nyererei  ------------------------tta-----cata------------------tt-------aa-----
                       Medaka  ------------------------gca-----catg------------------tg------aaa-----
           Southern platyfish  --------------------------a-----cata------------------tt-------aa-----
                    Zebrafish  -------------------------ta-----cata------------------tt--------------
     Mexican tetra (cavefish)  ------------------------ata-----catg------------------atgggaaa--------
                  Spotted gar  ------------------------tta-----cataaatctgtttctcttgcctct-------ga-----
                      Lamprey  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================

                        Human  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                        Chimp  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                      Gorilla  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                    Orangutan  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                       Gibbon  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                       Rhesus  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
          Crab-eating macaque  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                       Baboon  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                 Green monkey  --caaatcg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                     Marmoset  --caaatcg----------a--atttgcctc--ctccccc-ccagccc---agccac
              Squirrel monkey  --caaattg----------a--atttgcctc--ct-cccc-ccagccc---agccac
                     Bushbaby  --caaattg----------a--atttgcctc--ct-cccc-ccagccc---agccac
           Chinese tree shrew  --caaatca----------a--atttgcctc--ct-cccc-ctagccc---agccac
                     Squirrel  --caaattg----------a--atttttatc--ttccccc-caagccc---tgccac
       Lesser Egyptian jerboa  --caaatca----------a--acttgccaa--ct-cccc-ccagccc---tgccac
                 Prairie vole  --caaatct----------a--atttacttc--ctccccc-ccagcct---tgccac
              Chinese hamster  --caaatca----------a--a-ttaattc--ct-cccc-ccagcct---tgccac
               Golden hamster  --caaatca----------a--atttacttc--ct-cccc-ccagcct---tgccac
                        Mouse  --caaatca----------a--atttactgc--c--tccc-acagcat---tgcctc
                          Rat  --caaatca----------t--acttgctgc--ct-tccc-ccagcat---tgcctc
               Naked mole-rat  --caaatta----------a--atttgccaa--ct-cccc-ccagccc---tgccac
                   Guinea pig  --caaatcg----------a--atttgctgc--ct-cccc-ccagccc---tgtcac
                   Chinchilla  --caaatca----------a--atttgccgc--ct--ccc-ccaaccc---tgccac
             Brush-tailed rat  --caaatcg----------a--atttgcctc--ct-cccc-ccaaccc---tgccac
                       Rabbit  --caaactg----------a--atttgcctc--ct-cccc-ccagacc---agccac
                         Pika  --caaactgaatttgcctaa--atttgcctc--ct-cccc-ccaaccc---agccac
                          Pig  --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
                       Alpaca  --caaattg----------a--atttgcctc--ct--ccc-ccatccc---agccac
               Bactrian camel  --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
                      Dolphin  --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
                 Killer whale  --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
             Tibetan antelope  --caaattg----------g--atttgcctc--ct-cccc-ccatccc---agccac
                          Cow  --caaattg----------g--attttcctc--ct-cccc-ccatccc---agccac
                        Sheep  --caaattg----------g--atttgcctc--ct-cccc-ccatccc---agccac
                Domestic goat  --caaattg----------g--atttgcctc--ct-cccc-ccatccc---agccac
                        Horse  --caaattg----------a--atttgcctc--ct--ccc-ccatccc---agccac
             White rhinoceros  --caaattg----------a--atttgcctc--ct--ccc-ccatccc---agccac
                          Cat  --caaattg----------a--atttacctc--ct-cccc-ccatccc---agccac
                          Dog  --caaatta----------a--atttgcctc--ct-cccc-ccatccc---agccac
                      Ferret   --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
                        Panda  --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
               Pacific walrus  --caaattg----------a--atttgcctc--ct--ccc-ccgtccc---agccac
                 Weddell seal  --caaattg----------a--atttgcctc--ct-cccc-ccgtccc---agccac
             Black flying-fox  --caaatcg----------a--attcgcctc--tt--cccgcaatccc---agccac
                      Megabat  --caaatcg----------a--attcgcctc--tt--cccgcaatccc---agccac
                Big brown bat  --caaatcg----------a--atttgtctc--ct--ccc-ccatcct---agccac
         David's myotis (bat)  --caaattg----------g--atttgcctc--ct--ccc-ccatcct---agccac
                     Microbat  --caaatcg----------g--atttgcctc--ct--ccc-ccatcct---agccac
                     Hedgehog  --c-aattg----------a--atttacctc--ct-cccc-ccaaccc---agccac
                        Shrew  --caaattg----------a--a--tgactc--ct-cccc-ccatccc---atccac
              Star-nosed mole  --caaattg----------g--atttgcctc--ct--ccc-ccatccc---agccac
                     Elephant  --caaatcg----------a--atttgcttc--ct-cccc-ccatccc---agccac
          Cape elephant shrew  --c-aattg----------a--atttgcctc--ct--ccc-caatccc---agccac
                      Manatee  --caaatcg----------a--atttgcctc--ct-cccc-ccatccc---agccac
             Cape golden mole  --caaatcg----------a--atttgcctc--ct-cccc-ccatccc---tgccac
                       Tenrec  --caaattg----------a--atttgcctt--ct-cccc-ccaaccc---agccac
                     Aardvark  --caaatca----------a--atttacctc--ct-cccc-ccatccc---agccac
                    Armadillo  --caaattg----------a--atttgcctc--ct-cccc-ccatccc---agccac
                      Opossum  --caaattc----------a--atttgcttc--ttccccc-ccatccc---agccac
              Tasmanian devil  --caaattc----------a--atttgcttc--tt-cccc-ccatccc---agccac
                      Wallaby  --caaattc----------a--atttgcttc--tt-cccc-ccatccc---agtcac
                     Platypus  --caaattc----------a--atttgcttc--ct-ccct-c--tccc---agccac
                  Rock pigeon  -------------------g--ttttgccta--tt-ttcc-c---ctt---agccac
                 Saker falcon  -------------------g--ttttgcctat-tt-ttcc-c---ctt---agccac
             Peregrine falcon  -------------------g--ttttgcctat-tt-ttcc-c---ctt---agccac
          Collared flycatcher  -------------------g--ttttgccta--tt-ttcc-c---ctt---agccac
       White-throated sparrow  -------------------g--ctttgccta--tt-ttcc-c---ctt---agccac
          Medium ground finch  -------------------g--ctttgccta--tt-ttcc-c---ctt---agccac
                  Zebra finch  -------------------g--ctttgccta--tt-ttcc-c---ctt---agccac
           Tibetan ground jay  -------------------g--ttttgccta--tt-ttcc-c---ctt---agccac
                   Budgerigar  -------------------gttttttgcctat-tt-ttcc-c---ctt---agccac
                       Parrot  -------------------gttttttgcctat-tt-ttcc-c---ctt---agccac
                Scarlet macaw  -------------------gttttttgcctat-tt-ttcc-c---ctt---agccac
                 Mallard duck  -------------------g--ttttgccta--tt-ttcc-c---ctt---agccac
                      Chicken  -------------------g--ttttgccta--tt-ttcc-c---ctt---agccac
                       Turkey  -------------------g--ttttgccta--tt-ttcc-c---ctt---agccac
           American alligator  -------------------g--ttttgactc--ct-ttcc-c---tgt---agccac
              Green seaturtle  -------------------g--ttttgcctctctt-ttcc-c---ctt---agccac
               Painted turtle  -------------------g--ttttgcctctctt-ttcc-c---ctt---agccac
     Chinese softshell turtle  -------------------g--ttttgcctctctt-ttcc-t---ctt---agccac
       Spiny softshell turtle  -------------------g--ttttgcctctctt-ttcc-t---ctt---agccac
                       Lizard  -------------------atgttttgcctctttt-ttat-c---ctt---agccac
                X. tropicalis  --ctgaatc----------a--gtt---ctt--ct-gtcc-tcaaccccaaagccat
                   Coelacanth  --cacaaga----------a--------ctc--ca-tccc-ccg-ttt---agccac
                         Fugu  atcaa----------------------------------------------------
                 Nile tilapia  --caa----------------------------------------------------
          Princess of Burundi  --caa----------------------------------------------------
        Burton's mouthbreeder  --caa----------------------------------------------------
                  Zebra mbuna  --caa----------------------------------------------------
          Pundamilia nyererei  --caa----------------------------------------------------
                       Medaka  --taa----------------------------------------------------
           Southern platyfish  --caa----------------------------------------------------
                    Zebrafish  ---------------------------------------------------------
     Mexican tetra (cavefish)  ---------------------------------------------------------
                  Spotted gar  --caa----------------------------------------------------
                      Lamprey  =========================================================
                    Tetraodon  =========================================================
       Yellowbelly pufferfish  =========================================================
                 Atlantic cod  =========================================================
                  Stickleback  =========================================================

Inserts between block 17 and 18 in window
B D               Guinea pig 1bp
B D                     Fugu 13bp
B D             Nile tilapia 31bp
         Princess of Burundi 13bp
       Burton's mouthbreeder 13bp
                 Zebra mbuna 13bp
         Pundamilia nyererei 13bp
B D                   Medaka 12bp
          Southern platyfish 12bp

Alignment block 18 of 1389 in window, 61478559 - 61478570, 12 bps 
B D                     Human  aaaaatgggcat
B D                     Chimp  aaaaatgggcat
B D                   Gorilla  aaaaatgggcat
B D                 Orangutan  aaaaatgggcat
B D                    Gibbon  aaaaatgggcat
B D                    Rhesus  aaaaatgggcat
B D       Crab-eating macaque  aaaaatgggcat
B D                    Baboon  aaaaatgggcat
B D              Green monkey  aaaaatgggcat
B D                  Marmoset  aaaaatgggcat
B D           Squirrel monkey  aaaaatgggcat
B D                  Bushbaby  -aaaatgggcat
           Chinese tree shrew  -aaaatgggcat
B D                  Squirrel  -aaaatgggcat
       Lesser Egyptian jerboa  -aaaatgggcat
                 Prairie vole  -aaaataggcat
B D           Chinese hamster  -aaaataggcat
               Golden hamster  -aaaataggcat
B D                     Mouse  -aaaatgggcat
B D                       Rat  -aaaatgggcat
B D            Naked mole-rat  -aaaatgggcat
B D                Guinea pig  aaaaatgggcat
                   Chinchilla  -aaaatgggcat
             Brush-tailed rat  -aaaatgggcat
B D                    Rabbit  -aaaatgggcat
B D                      Pika  -aaaatgggcat
B D                       Pig  -aaaatgggcat
B D                    Alpaca  -aaaatgggcat
               Bactrian camel  -aaaatgggcat
B D                   Dolphin  -aaaatgggcat
                 Killer whale  -aaaatgggcat
             Tibetan antelope  -aaaatggggat
B D                       Cow  -aaaatggggat
B D                     Sheep  -aaaatggggat
                Domestic goat  -aaaatggggat
B D                     Horse  -aaaatgggcat
B D          White rhinoceros  -aaaatgggcat
B D                       Cat  -aacatgggcat
B D                       Dog  -aaaatgggcat
B D                   Ferret   -aaaatgggcat
B D                     Panda  -aaaatgggcat
               Pacific walrus  -aaaatgggcat
                 Weddell seal  -aaaatgggcat
             Black flying-fox  -aaaatgggcat
B D                   Megabat  -aaaatgggcat
                Big brown bat  -aagatgggcat
         David's myotis (bat)  -aagatgggcat
B D                  Microbat  -aagatgggcat
B D                  Hedgehog  -aaaatgggcat
B D                     Shrew  -aaaatgggcat
              Star-nosed mole  -aaaatgggcat
B D                  Elephant  -aaaatgggcat
          Cape elephant shrew  -aaaatgggcat
B D                   Manatee  -aaaatgggcat
             Cape golden mole  -aaaatgggcat
B D                    Tenrec  -aaaatgggcat
                     Aardvark  -aaaatgggcat
B D                 Armadillo  -aaaatgggcat
B D                   Opossum  -aaaatgggcat
B D           Tasmanian devil  -aaaatgggcat
B D                   Wallaby  -aaaatgggcat
B D                  Platypus  -aaaatgggcat
  D               Rock pigeon  -aaaatgggcat
  D              Saker falcon  -aaaatgggcat
  D          Peregrine falcon  -aaaatgggcat
  D       Collared flycatcher  -aaaatgggcat
  D    White-throated sparrow  -aaaatgggcat
B D       Medium ground finch  -aaaatgggcat
B D               Zebra finch  -aaaatgggcat
           Tibetan ground jay  -aaaatgggcat
B D                Budgerigar  -aaaatgggcat
  D                    Parrot  -aaaatgggcat
  D             Scarlet macaw  -aaaatgggcat
  D              Mallard duck  -aaaatgggcat
B D                   Chicken  aaaaatgggcat
B D                    Turkey  aaaaatgggcat
B D        American alligator  -aaaatgggcat
  D           Green seaturtle  -aaaatgggcat
  D            Painted turtle  -aaaatgggcat
  D  Chinese softshell turtle  -aaaatgggcat
  D    Spiny softshell turtle  -aaaatgggcat
B D                    Lizard  -aaaatgggcat
B D             X. tropicalis  -aaaatgggcat
B D                Coelacanth  -aaaatgggca-
B D                      Fugu  tggaaggccaga
B D              Nile tilapia  agaaagagggaa
          Princess of Burundi  tgaaataagcat
        Burton's mouthbreeder  tgaaataagcat
                  Zebra mbuna  tgaaataagcat
          Pundamilia nyererei  tgaaataagcat
B D                    Medaka  gaagct------
           Southern platyfish  gaatctatcgag
B D              Atlantic cod  aaaaaagaacat
B D                 Zebrafish  ---------cac
     Mexican tetra (cavefish)  ttagaggagcat
                  Spotted gar  actgatgggcaa
B D                   Lamprey  ============
B D                 Tetraodon  ============
      Yellowbelly pufferfish  ============
B D               Stickleback  ============

Inserts between block 18 and 19 in window
B D             Atlantic cod 1bp
B D                Zebrafish 4bp
    Mexican tetra (cavefish) 4bp

Alignment block 19 of 1389 in window, 61478571 - 61478580, 10 bps 
B D                     Human  gaag-t-a---aa---------------a---t
B D                     Chimp  gaag-t-a---aa---------------a---t
B D                   Gorilla  gaag-t-a---aa---------------a---t
B D                 Orangutan  gaag-t-a---aa---------------a---t
B D                    Gibbon  gaag-t-a---aa---------------a---t
B D                    Rhesus  gaag-t-a---aa---------------a---t
B D       Crab-eating macaque  gaag-t-a---aa---------------a---t
B D                    Baboon  gaag-t-a---aa---------------a---t
B D              Green monkey  gaag-t-a---aa---------------a---t
B D                  Marmoset  gaag-t-a---aa---------------a---t
B D           Squirrel monkey  gaag-t-a---aa---------------a---t
B D                  Bushbaby  gaag-t-a---aa---------------a---t
           Chinese tree shrew  gaag-t-a---aa---------------a---t
B D                  Squirrel  gaag-t-a---aa---------------a-t-t
       Lesser Egyptian jerboa  gaag-t-a---ag-------------------t
                 Prairie vole  gaag-t-a---aa---------------act-t
B D           Chinese hamster  gaag-t-a---aa---------------agt-t
               Golden hamster  gaag-t-a---aa---------------ctt-t
B D                     Mouse  gaag-t-a---aa---------------agt-t
B D                       Rat  gaag-t-a---aa---------------agt-t
B D            Naked mole-rat  gaag-t-a---aa---------------a---t
B D                Guinea pig  gaag-t-a---aa---------------a---t
                   Chinchilla  gaag-t-a---aa---------------a---t
             Brush-tailed rat  gaag-t-a---aa---------------a---t
B D                    Rabbit  gaag-t-a---aa---------------a---t
B D                      Pika  gaag-t-a---aa---------------a---t
B D                       Pig  gaag-t-a---aa---------------a---t
B D                    Alpaca  gaag-t-a---aa---------------a---t
               Bactrian camel  gaag-t-a---aa---------------a---t
B D                   Dolphin  gaag-t-a---aa---------------a---t
                 Killer whale  gaag-t-a---aa---------------a---t
             Tibetan antelope  gaagtt-a---aa---------------a---t
B D                       Cow  gaagtt-a---aa---------------a---t
B D                     Sheep  gaagtt-a---aa---------------a---t
                Domestic goat  gaagtt-a---aa---------------a---t
B D                     Horse  gaag-t-a---aa---------------a---t
B D          White rhinoceros  gaag-t-a---aa---------------a---t
B D                       Cat  gaag-t-a---aa---------------a---t
B D                       Dog  gaag-t-a---aa---------------a---t
B D                   Ferret   gaag-t-a---aa---------------a---t
B D                     Panda  gaag-t-a---aa---------------a---t
               Pacific walrus  gaag-t-a---aa---------------a---t
                 Weddell seal  gaag-t-a---aa---------------a---t
             Black flying-fox  gaag-t-a---ga---------------a---t
B D                   Megabat  gaag-t-a---ga---------------a---t
                Big brown bat  gaag-t-a---ga---------------a---t
         David's myotis (bat)  gaag-t-a---ga---------------a---t
B D                  Microbat  gaag-t-a---ga---------------a---t
B D                  Hedgehog  gaag-t-a---aa---------------a---t
B D                     Shrew  gaag-t-a---aa---------------a---t
              Star-nosed mole  gaag-t-a---aa---------------a---t
B D                  Elephant  gaag-taa---aa---------------t---t
          Cape elephant shrew  gaag-t-a---ag---------------t---t
B D                   Manatee  gaag-t-a---aa---------------a---t
             Cape golden mole  gaag-t-a---aa---------------a---t
B D                    Tenrec  gaag-t-a---aa---------------a---t
                     Aardvark  gagg-t-a---aa---------------a---t
B D                 Armadillo  gaag-t-a---aa---------------a---t
B D                   Opossum  gaag-t-a---at---------------attgt
B D           Tasmanian devil  gaag-t-a---tt---------------attgt
B D                   Wallaby  gaag-t-a---at---------------attgt
B D                  Platypus  gaag-t-a---at---------------cc--t
  D               Rock pigeon  gaag-t-a---at---------------t---a
  D              Saker falcon  gaag-t-a---at---------------t---a
  D          Peregrine falcon  gaag-t-a---at---------------t---a
  D       Collared flycatcher  gaag-t-a---at---------------t---a
  D    White-throated sparrow  gaag-t-a---at---------------t---a
B D       Medium ground finch  gaag-t-a---at---------------t---a
B D               Zebra finch  gaag-t-a---at---------------t---a
           Tibetan ground jay  gaag-t-a---at---------------t---a
B D                Budgerigar  gaag-t-a---ag---------------t---a
  D                    Parrot  gaag-t-a---at---------------t---a
  D             Scarlet macaw  gaag-t-a---at---------------t---a
  D              Mallard duck  gaag-t-a---at---------------t---a
B D                   Chicken  gaaa-t-a---at---------------t---a
B D                    Turkey  gaaa-t-a---at---------------t---a
B D        American alligator  gaag-t-attttt---------------t---t
  D           Green seaturtle  gaag-t-a---ttggtttgttttttgttt---t
  D            Painted turtle  gaag-t-a---tt-------------ttt---t
  D  Chinese softshell turtle  gaag-t-a---at--------------------
  D    Spiny softshell turtle  gaag-t-a---at--------------------
B D                    Lizard  gaag-t-g---tt------------ttct---t
B D             X. tropicalis  gaaa-g-a---at---------------t---t
B D                Coelacanth  aaag-c-a---at---------------a----
B D                      Fugu  atag-a-a---a---------------------
B D              Nile tilapia  gtga-c-g---g---------------------
          Princess of Burundi  gtag-t-a---g---------------------
        Burton's mouthbreeder  gtag-t-a---g---------------------
                  Zebra mbuna  gtag-t-a---g---------------------
          Pundamilia nyererei  gtag-t-a---g---------------------
B D                    Medaka  ttaa-c-a---g---------------------
           Southern platyfish  ttga-g-g---g---------------------
B D               Stickleback  gtaa-a-g---g---------------------
B D              Atlantic cod  ttca-c-t-------------------------
B D                 Zebrafish  aaaa-c-a-------------------------
     Mexican tetra (cavefish)  aaag-a-a-------------------------
                  Spotted gar  -gaa-a-a-------------------------
B D                   Lamprey  =================================
B D                 Tetraodon  =================================
      Yellowbelly pufferfish  =================================

Inserts between block 19 and 20 in window
B D                     Fugu 8698bp
B D             Nile tilapia 6bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
          Southern platyfish 1bp
B D              Stickleback 1bp

Alignment block 20 of 1389 in window, 61478581 - 61478582, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  tt
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
               Golden hamster  tt
B D                     Mouse  at
B D                       Rat  gt
B D            Naked mole-rat  tt
B D                Guinea pig  tt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  -t
B D                      Pika  ct
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Cat  tt
B D                       Dog  tt
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                  Hedgehog  tt
B D                     Shrew  tt
              Star-nosed mole  tt
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
             Cape golden mole  tt
B D                    Tenrec  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                   Opossum  tt
B D           Tasmanian devil  tt
B D                   Wallaby  tt
B D                  Platypus  tt
  D               Rock pigeon  ct
  D              Saker falcon  ct
  D          Peregrine falcon  ct
  D       Collared flycatcher  ct
  D    White-throated sparrow  ct
B D       Medium ground finch  ct
B D               Zebra finch  ca
           Tibetan ground jay  ct
B D                Budgerigar  ct
  D                    Parrot  ct
  D             Scarlet macaw  ct
  D              Mallard duck  ct
B D                   Chicken  ct
B D                    Turkey  ct
B D        American alligator  tt
  D           Green seaturtle  tt
  D            Painted turtle  tt
  D  Chinese softshell turtle  tt
  D    Spiny softshell turtle  tt
B D                    Lizard  tt
B D             X. tropicalis  ta
B D                Coelacanth  -t
B D                      Fugu  -t
       Yellowbelly pufferfish  -t
B D              Nile tilapia  -a
          Princess of Burundi  -t
        Burton's mouthbreeder  -t
                  Zebra mbuna  -t
          Pundamilia nyererei  -t
           Southern platyfish  -t
B D               Stickleback  -a
B D              Atlantic cod  tt
B D                 Zebrafish  -t
     Mexican tetra (cavefish)  -c
                  Spotted gar  -t
B D                    Medaka  --
B D                   Lamprey  ==
B D                 Tetraodon  ==

Inserts between block 20 and 21 in window
B D                    Mouse 1bp
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
B D              Stickleback 1bp
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 1bp

Alignment block 21 of 1389 in window, 61478583 - 61478592, 10 bps 
B D                     Human  tt--aaaaatg-c
B D                     Chimp  tt--aaaaatg-c
B D                   Gorilla  tt--aaaaatg-c
B D                 Orangutan  tt--aaaaatg-c
B D                    Gibbon  tt--aaaaatg-a
B D                    Rhesus  tt--aaaaatg-c
B D       Crab-eating macaque  tt--aaaaatg-c
B D                    Baboon  tt--aaaaatg-c
B D              Green monkey  tt--aaaaatg-c
B D                  Marmoset  tt--aaaaatg-c
B D           Squirrel monkey  tt--aaaaatg-c
B D                  Bushbaby  tt--aaaaatg-c
           Chinese tree shrew  tt--aaaaatg-c
B D                  Squirrel  ta--aaaaatg-c
       Lesser Egyptian jerboa  tt--aaaaatg-t
                 Prairie vole  ta--aaaaatg-c
B D           Chinese hamster  tt--aaaaatg-c
               Golden hamster  tttaaaaaatg-c
B D                     Mouse  tt--aaaaatg-c
B D                       Rat  tt--aaaaatg-c
B D            Naked mole-rat  tt--aaaaatg-c
B D                Guinea pig  tt--taaaatg-c
                   Chinchilla  tt--aaaaatg-c
             Brush-tailed rat  tt--aaaaatg-c
B D                    Rabbit  tt--aaaaatg-c
B D                      Pika  tt--aaaaatg-c
B D                       Pig  ta--aaaaatg-c
B D                    Alpaca  tt--aaaaatg-c
               Bactrian camel  tt--aaaaatg-c
B D                   Dolphin  ta--aaaaatg-c
                 Killer whale  ta--aaaaatg-c
             Tibetan antelope  tt--aaaaatg-c
B D                       Cow  tt--aaaaatg-c
B D                     Sheep  tt--aaaaatg-c
                Domestic goat  tt--aaaaatg-c
B D                     Horse  tt--aaaaatg-c
B D          White rhinoceros  tt--aaaaatg-c
B D                       Cat  tt--aaaaatg-c
B D                       Dog  ta--aaaaatg-c
B D                   Ferret   tt--aaaaatg-c
B D                     Panda  tt--aaaaatg-c
               Pacific walrus  tt--aaaaatg-c
                 Weddell seal  tt--aaaaatg-c
             Black flying-fox  ta--aaaaatg-c
B D                   Megabat  tt--aaaaatg-c
                Big brown bat  ta--aaaaatg-c
         David's myotis (bat)  ta--aaaaatg-c
B D                  Microbat  ta--aaaaatg-c
B D                  Hedgehog  ta--aaaaatg-c
B D                     Shrew  tt--aaaaatg-c
              Star-nosed mole  gt--aaaaatg-c
B D                  Elephant  ta--aaaaatg-c
          Cape elephant shrew  aa--aaaaatg-c
B D                   Manatee  ta--aaaaatg-c
             Cape golden mole  tt--aaaaatg-c
B D                    Tenrec  ta--aaaaatg-c
                     Aardvark  ta--aaaaaag-c
B D                 Armadillo  tt--aaaaatg-c
B D                   Opossum  tt--taaaatg-c
B D           Tasmanian devil  tt--taaaatg-c
B D                   Wallaby  tt--taaaatg-c
B D                  Platypus  tt--taaaatg-c
  D               Rock pigeon  tt--gaaaatg-c
  D              Saker falcon  tt--gaaaatg-c
  D          Peregrine falcon  tt--gaaaatg-c
  D       Collared flycatcher  tt--gaaaatg-c
  D    White-throated sparrow  tt--gaaaatg-c
B D       Medium ground finch  tt--gaaaatg-c
B D               Zebra finch  tt--gaaaatg-c
           Tibetan ground jay  tt--gaaaatg-c
B D                Budgerigar  tt--gaaaatg-c
  D                    Parrot  tt--gaaaatg-c
  D             Scarlet macaw  tt--gaaaatg-c
  D              Mallard duck  tt--gaaaatg-c
B D                   Chicken  tt--gaaaatg-c
B D                    Turkey  tt--gaaaatg-c
B D        American alligator  tt--taaaatg-c
  D           Green seaturtle  tt--taaaatg-c
  D            Painted turtle  tt--taaaatg-c
  D  Chinese softshell turtle  tt--taaaatg-c
  D    Spiny softshell turtle  tt--taaaatg-c
B D                    Lizard  tt--taaaatg-c
B D             X. tropicalis  aa--aaaggaa-a
B D                Coelacanth  tt--taaaatg-c
B D                 Tetraodon  tt--aaaaata-t
B D                      Fugu  tt--aaaaata-g
       Yellowbelly pufferfish  tt--aaaaata-g
B D              Nile tilapia  tc--caaaaca-a
          Princess of Burundi  tc--aaaaata-a
        Burton's mouthbreeder  ta--aaaaata-a
                  Zebra mbuna  ta--aaaaata-a
          Pundamilia nyererei  ta--aaaaata-a
B D                    Medaka  -c--aaaagaa-a
           Southern platyfish  -t--aaaacta-a
B D               Stickleback  ta--aaaaata-a
B D              Atlantic cod  tc--caaactg-t
B D                 Zebrafish  -----aaaacg--
     Mexican tetra (cavefish)  -----aaggtgc-
                  Spotted gar  ct--taaaatg-t
B D                   Lamprey  =============

Inserts between block 21 and 22 in window
B D                Tetraodon 6bp
B D                     Fugu 6bp
      Yellowbelly pufferfish 6bp
B D             Nile tilapia 18bp
         Princess of Burundi 6bp
       Burton's mouthbreeder 6bp
                 Zebra mbuna 6bp
         Pundamilia nyererei 6bp
B D                   Medaka 6bp
          Southern platyfish 6bp
B D              Stickleback 6bp
B D             Atlantic cod 1bp
B D                Zebrafish 27bp
    Mexican tetra (cavefish) 25bp
                 Spotted gar 4bp

Alignment block 22 of 1389 in window, 61478593 - 61478610, 18 bps 
B D                     Human  cttaa---tttt--c-aa-----ct---tcat
B D                     Chimp  cttaa---tttt--c-aa-----ct---tcat
B D                   Gorilla  cttaa---tttt--c-aa-----ct---tcat
B D                 Orangutan  cttaa---tttt--c-aa-----ct---tcat
B D                    Gibbon  cttaa---tttt--c-aa-----ct---tcat
B D                    Rhesus  cttaa---tttt--c-aa-----ct---tcat
B D       Crab-eating macaque  cttaa---tttt--c-aa-----ct---tcat
B D                    Baboon  cttaa---tttt--c-aa-----ct---tcat
B D              Green monkey  cttaa---tttt--c-aa-----ct---tcat
B D                  Marmoset  cttaa---tttt--c-aa-----ct---tcat
B D           Squirrel monkey  cttaa---tttt--c-aa-----ct---tcat
B D                  Bushbaby  cttaa---tttt--c-aa-----ct---tcat
           Chinese tree shrew  cttaa---tttt--c-aa-----ct---tcat
B D                  Squirrel  cttaa---tttt--c-aa-----ct---tcat
       Lesser Egyptian jerboa  cttat---tttt--c-aa-----ct---tcat
                 Prairie vole  cttaa---tttt--caaa-----ct---tcat
B D           Chinese hamster  cttaa---tttt--c-aa-----ct---tcat
               Golden hamster  cttaa---tttt--c-aa-----ct---tcat
B D                     Mouse  cgtaa---tttt--c-aa-----ct---tcat
B D                       Rat  cttaa---tttt--c-aa-----ct---tcat
B D            Naked mole-rat  cttaa---tttt--c-aa-----ct---tcat
B D                Guinea pig  cttaa---tttt--c-aa-----ct---tcat
                   Chinchilla  cttaa---tttt--c-aa-----ct---tcat
             Brush-tailed rat  cttaa---tttt--c-aa-----ct---tcat
B D                    Rabbit  cttaa---tttt--c-aa-----ct---tcat
B D                      Pika  cttaa---tttg--g-aa-----ct---tcat
B D                       Pig  cttaa---tttt--c-aa-----ct---tcat
B D                    Alpaca  cttaa---tttt--c-aa-----ct---tcat
               Bactrian camel  cttaa---tttt--c-aa-----ct---tcat
B D                   Dolphin  cttaa---tttc--c-aa-----ct---tcat
                 Killer whale  cttaa---tttc--c-aa-----ct---tcat
             Tibetan antelope  cgtaa---tttt--c-aa-----ct---tcat
B D                       Cow  cgtaa---tttt--c-aa-----ct---tcat
B D                     Sheep  cgtaa---tttt--c-aa-----ct---tcat
                Domestic goat  cgtaa---tttt--c-aa-----ct---tcat
B D                     Horse  cttaa---tttt--c-aa-----ct---tcat
B D          White rhinoceros  cttaa---tttt--c-aa-----ct---tcat
B D                       Cat  cttaa---tttt--t-aa-----ct---tcat
B D                       Dog  cttaa---tttt--t-aa-----ct---tcat
B D                   Ferret   cttaat--tttt--t-aa-----ct---tcat
B D                     Panda  cttaa---tttt--t-aa-----ct---tcat
               Pacific walrus  cttaa---tttt--a-aa-----ct---tcat
                 Weddell seal  cttaa---tttt--a-aa-----ct---tcat
             Black flying-fox  cttaa---tttt--c-aa-----ct---tcat
B D                   Megabat  cttaa---tttt--c-aa-----ct---tcat
                Big brown bat  cttaa---tttt--c-aa-----ct---tcat
         David's myotis (bat)  cttaa---tttt--c-aa-----ct---tcat
B D                  Microbat  cttaa---tttt--c-aa-----ct---tcat
B D                  Hedgehog  cttaa---tttt--a-aa-----ct---tcat
B D                     Shrew  cttaa---tttt--t-aa-----ct---tcat
              Star-nosed mole  cttaa---tttt--t-aa-----ct---tcat
B D                  Elephant  cttaa---tttt--c-aa-----ct---tcat
          Cape elephant shrew  cttaa---tttt--t-aa-----ct---tcat
B D                   Manatee  cttaa---tttt--c-aa-----ct---tcat
             Cape golden mole  cttaa---tttt--c-aa-----ct---tcat
B D                    Tenrec  cttaa---tttt--c-aa-----ct---tcat
                     Aardvark  cttaa---tttt--c-aa-----ct---tcat
B D                 Armadillo  cttaa---tttt--c-aa-----ct---tcat
B D                   Opossum  cttaa---ttct--c-aa-----ct---tcat
B D           Tasmanian devil  cttaa---ttct--c-aa-----ct---tcat
B D                   Wallaby  cttaa---ttct--c-aa-----ct---tcat
B D                  Platypus  cttaa---ttct--c-aa-----ct---tcat
  D               Rock pigeon  cttaa---tttt--c-aa-----ct---tcat
  D              Saker falcon  cttaa---tttt--c-aa-----ct---tcat
  D          Peregrine falcon  cttaa---tttt--c-aa-----ct---tcat
  D       Collared flycatcher  cttaa---tttt--c-aa-----ct---tcat
  D    White-throated sparrow  cttaa---tttt--c-aa-----ct---tcat
B D       Medium ground finch  cttaa---tttt--c-aa-----ct---tcat
B D               Zebra finch  cttaa---tttt--t-aa-----at---tcat
           Tibetan ground jay  cttaa---tttt--c-aa-----ct---tcat
B D                Budgerigar  cttaa---tttt--c-aa-----ct---tcat
  D                    Parrot  cttaa---tttt--c-aa-----ct---tcat
  D             Scarlet macaw  cttaa---tttt--c-aa-----ct---tcat
  D              Mallard duck  attaa---tttt--c-aa-----ct---tcat
B D                   Chicken  attaa---tttt--c-aa------t---tcat
B D                    Turkey  attaa---tttt--c-aa------t---tcat
B D        American alligator  cttaa---ttct--t-aa-----ct---tcat
  D           Green seaturtle  cttaa---ttat--c-aa-----ct---tcat
  D            Painted turtle  cttaa---ttct--c-aa-----ct---tcat
  D  Chinese softshell turtle  cttaa---ttct--c-aa-----ct---tcat
  D    Spiny softshell turtle  cttaa---ttct--c-aa-----ct---tcat
B D                    Lizard  cttaa---tttt--c-aa-----cc---tcat
B D             X. tropicalis  aaaaa---tcct--t-aa-----tg---tcat
B D                Coelacanth  cttaa---ttattac-aa-----cc---tcat
B D                 Tetraodon  -----ttt--------------------tcat
B D                      Fugu  -----ttt--------------------tcat
       Yellowbelly pufferfish  -----ttt--------------------tcat
B D              Nile tilapia  -----atcgtta--t-aa-----cttcatcat
          Princess of Burundi  -----cttctta--c-aa-----ct---tcat
        Burton's mouthbreeder  -----cttctta--c-aa-----ct---tcat
                  Zebra mbuna  -----cttctta--c-aa-----ct---tcat
          Pundamilia nyererei  -----cttctta--c-aa-----ct---tcat
B D                    Medaka  -----gactttg--a-aa-----------aaa
           Southern platyfish  -----atttttg--a-aa-----ct---tcaa
B D               Stickleback  -----attctta--t-ga-----ct---tcat
B D              Atlantic cod  -----------g--c-aa-----cc---tcat
     Mexican tetra (cavefish)  --------ttca--g-aaataaact---ccac
                  Spotted gar  -----attctta--c-aa-----tc---tcat
B D                 Zebrafish  ================================
B D                   Lamprey  ================================

Inserts between block 22 and 23 in window
    Mexican tetra (cavefish) 5bp

Alignment block 23 of 1389 in window, 61478611 - 61478765, 155 bps 
B D                     Human  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                     Chimp  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                   Gorilla  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                 Orangutan  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                    Gibbon  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----taaaa
B D                    Rhesus  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D       Crab-eating macaque  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                    Baboon  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D              Green monkey  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                  Marmoset  gcaaa---cta---aataaag---acgaccaaa--ac-a-aa---------------agct----t-aaa
B D           Squirrel monkey  gcaaa---cta---aataaag---acgaccaaa--ac-a-aa---------------ggct----t-aaa
B D                  Bushbaby  gcaaa---c-------taaag---atgaccaaa--at-a-aa---------------agct----t-aaa
           Chinese tree shrew  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-taa
B D                  Squirrel  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
       Lesser Egyptian jerboa  gcaaa---cta---aataaag---atgaccaaa--ca-a-aa---------------g-ct----t-aaa
                 Prairie vole  gcaaa---c-------taaag---atgaccaaa--ca-g-aa---------------g-ct----t-aaa
B D           Chinese hamster  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------acct----t-aaa
               Golden hamster  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------g-tt----t-aaa
B D                     Mouse  gcaaa---ctg---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                       Rat  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D            Naked mole-rat  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                Guinea pig  gcaaa---cta---aataaag---atggccaaa--ac-a-aa---------------agct----t-aaa
                   Chinchilla  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
             Brush-tailed rat  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------aact----t-aaa
B D                    Rabbit  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                      Pika  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-gaa
B D                       Pig  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                    Alpaca  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
               Bactrian camel  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                   Dolphin  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
                 Killer whale  gcaaa---cta---aataaag---acgaccaaa--ac-a-aa---------------agct----t-aaa
             Tibetan antelope  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                       Cow  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                     Sheep  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
                Domestic goat  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                     Horse  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D          White rhinoceros  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                       Cat  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                       Dog  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----taaaa
B D                   Ferret   gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                     Panda  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
               Pacific walrus  gcaaa---cta---aataaag---atgatcaaa--ac-a-aa---------------agct----t-aaa
                 Weddell seal  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
             Black flying-fox  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                   Megabat  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
                Big brown bat  gcaga---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
         David's myotis (bat)  gcaga---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                  Microbat  gcaga---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                  Hedgehog  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                     Shrew  gcaaa---c-------taaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
              Star-nosed mole  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                  Elephant  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
          Cape elephant shrew  gcaaa---cta---aataaag---atgactgaa--ac-a-aa---------------agct----t-aaa
B D                   Manatee  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
             Cape golden mole  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                    Tenrec  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
                     Aardvark  gcaaa---cta---aat--ag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                 Armadillo  gcaaa---cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                   Opossum  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D           Tasmanian devil  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                   Wallaby  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                  Platypus  gcaagt--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
  D               Rock pigeon  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D              Saker falcon  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D          Peregrine falcon  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D       Collared flycatcher  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D    White-throated sparrow  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
B D       Medium ground finch  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
B D               Zebra finch  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
           Tibetan ground jay  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
B D                Budgerigar  gcaaat--cta---aagaaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D                    Parrot  gcaaat--cta---aagaaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D             Scarlet macaw  gcaaat--cta---aagaaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
  D              Mallard duck  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
B D                   Chicken  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
B D                    Turkey  gcaaat--cta---aataaag---atgacc-aa--ac-a-aa---------------agct----t-aaa
B D        American alligator  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
  D           Green seaturtle  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
  D            Painted turtle  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
  D  Chinese softshell turtle  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
  D    Spiny softshell turtle  gcaaat--cta---aataaag---atgaccaaa--ac-a-aa---------------agct----t-aaa
B D                    Lizard  gcaaat--cta---aataaag---atgaccaaa--acaa-aa---------------agct----t-aaa
B D             X. tropicalis  gcaaa---cc------taaag---atgaccaaa--gc----------------------tt----t-aaa
B D                Coelacanth  gcagat--cta---aataaag---atgacc-aa--ac-a-ta---------------agct----t-aaa
B D                 Tetraodon  gcaggt--gca---aaataac-cca-------------a-aagttttaattagca--agaa----t-caa
B D                      Fugu  gcaggt--gca---aaataac-cca-------------a-aagctttaattagca--agaa----t-caa
       Yellowbelly pufferfish  gcaggt--gca---aaataac-cca-------------a-aagctttaattagca--agaa----t-caa
B D              Nile tilapia  gcaggt--ctg---agaaggg-ccagagac-ca--ac-a-gaac---gt-aagct--aga-----t-taa
          Princess of Burundi  gcaggt--tta---aatgaat-gcatggcc-aa--ac-a-aaggtttga-tagca--agaa---gg-taa
        Burton's mouthbreeder  gcaggt--tta---aatgaat-gcatggcc-aa--ac-a-aagctttga-cagca--agaa---gg-taa
                  Zebra mbuna  gcaggt--tta---aatgaat-gcatggcc-aa--ac-a-aagctttga-cagca--agaa---gg-taa
          Pundamilia nyererei  gcaggt--tta---aatgaat-gcatggcc-aa--ac-a-aagctttga-cagca--agaa---gg-taa
B D                    Medaka  aaacat--ttactcaaagtttcgtgt-----aa--aa-t-aagataaaa----------------c-aaa
           Southern platyfish  gcagat--gta---aaagaaccgtgttgcc-aa--tc-a-aagctttaa----------------t-aaa
B D               Stickleback  gcaggt--gta---aagtaaccgtatggcc-aaacac-a-aagctttaatcagcaacagaa----t-taa
B D              Atlantic cod  gcaagttcttg---ggatgtg-tcacagat-ca--aa-c-aaacttcag-ttgaa--ataaccgtt-ttg
B D                 Zebrafish  --------gaa---agcaaac----aaacc-ga--ac-agaaacactgaggagta--taca---gt-gaa
     Mexican tetra (cavefish)  --------gca---agttaac----tgacc-aa--ac-ataagctt----gagtt--aacg---at-gaa
                  Spotted gar  gcagat--cta---aataaag---atgacc-aa--ac-a-aa-----------ct--tgaa----t-taa
B D                   Lamprey  ======================================================================

                        Human  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                        Chimp  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Gorilla  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                    Orangutan  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Gibbon  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Rhesus  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
          Crab-eating macaque  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Baboon  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                 Green monkey  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                     Marmoset  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
              Squirrel monkey  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                     Bushbaby  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
           Chinese tree shrew  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                     Squirrel  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
       Lesser Egyptian jerboa  --------c-a-------a-tgaa-----------aggata--tttcac---a-----gaaaattcct--
                 Prairie vole  --------c-a-------a-tgta-----------agggta--tttcac---a-----gaaaatttct--
              Chinese hamster  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
               Golden hamster  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttcg--
                        Mouse  --------c-a-------a-tgaa-----------agaata--tttcac---a-----gaaaatttct--
                          Rat  --------c-a-------a-tgaa-----------aggata--tttcac---a-----gaaaagttct--
               Naked mole-rat  --------c-a-------a-ggga-----------aggata--tttcac---a-----gaaaatttct--
                   Guinea pig  --------c-a-------a-tgga-----------aggata--tctcac---a-----gaaaatttct--
                   Chinchilla  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
             Brush-tailed rat  --------c-a-------a-tgga-----------agggta--tttcac---a-----gaaaatttct--
                       Rabbit  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                         Pika  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                          Pig  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Alpaca  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
               Bactrian camel  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Dolphin  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                 Killer whale  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
             Tibetan antelope  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                          Cow  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                        Sheep  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                Domestic goat  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                        Horse  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
             White rhinoceros  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                          Cat  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                          Dog  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Ferret   --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                        Panda  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
               Pacific walrus  --------c-a-------a-tgga-----------agggta--tttcac---a-----gaaaatttct--
                 Weddell seal  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
             Black flying-fox  --------c-a-------gttgga-----------agg-ta--tttcac---a-----gaaaatttct--
                      Megabat  --------c-a-------gttgga-----------agg-ta--tttcac---a-----gaaaatttct--
                Big brown bat  --------c-a-------a-tgga-----------agg-ta--tttcac---a-----gaaaatttct--
         David's myotis (bat)  --------c-a-------a-tgga-----------agg-ta--tttcac---a-----gaaaatttct--
                     Microbat  --------c-a-------a-tgga-----------agg-ta--tttcac---a-----gaaaatttct--
                     Hedgehog  --------c-a-------a-tgga-----------agggta--tttcac---a-----gaaaatttct--
                        Shrew  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
              Star-nosed mole  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                     Elephant  --------c-a-------a-tgga-----------agaata--tttcac---a-----gaaaatttct--
          Cape elephant shrew  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Manatee  --------c-a-------a-tgga-----------agaata--tttcac---a-----gaaaatttct--
             Cape golden mole  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Tenrec  --------c-a-------a-tgga-----------ggaata--tttcac---a-----gaaaatttct--
                     Aardvark  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                    Armadillo  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Opossum  --------c-a-------t-tgga-----------aggata--tttcac---a-----gaaaatttct--
              Tasmanian devil  --------c-a-------t-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Wallaby  --------c-a-------t-tgga-----------aggata--tttcac---a-----gaaaatttct--
                     Platypus  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                  Rock pigeon  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaaattct--
                 Saker falcon  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
             Peregrine falcon  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
          Collared flycatcher  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
       White-throated sparrow  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
          Medium ground finch  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                  Zebra finch  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
           Tibetan ground jay  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                   Budgerigar  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Parrot  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                Scarlet macaw  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                 Mallard duck  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                      Chicken  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Turkey  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
           American alligator  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
              Green seaturtle  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
               Painted turtle  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
     Chinese softshell turtle  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
       Spiny softshell turtle  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                       Lizard  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                X. tropicalis  --------c-a-------a-tgga-----------aggata--tttcac---a-----gaaaatttct--
                   Coelacanth  --------c-a-------a-taga-----------aaggta--attcacaaga-----aaagattcca--
                    Tetraodon  --------caa-------a-aaaa----------tgacatc--acacac---ac----aacaagctag--
                         Fugu  --------c-a-------a-aaga----------tgacatc--acacac---aa----aacaagctat--
       Yellowbelly pufferfish  --------c-a-------a-aaga----------tgacatc--acacac---aa----aacaagctat--
                 Nile tilapia  --------c-agttttgga-aag---------------tta--ttacac---a-----aaaag--tct--
          Princess of Burundi  --------c-a-------a-aaga----------tggcatg--ttacat---a-----aacaa--tgt--
        Burton's mouthbreeder  --------c-a-------a-aaga----------tggcatg--ttacat---a-----aacaa--tgt--
                  Zebra mbuna  --------c-a-------a-aaga----------tggcatg--ttacat---a-----aacaa--tgt--
          Pundamilia nyererei  --------c-a-------a-aaga----------tggcatg--ttacat---a-----aacaa--tgt--
                       Medaka  --------c-a-------a-aa------------------a--ctccat---tt----aaggg-------
           Southern platyfish  --------c-a-------a-aaga----------tggcatg--ttacac---ac----aaaaaccttt--
                  Stickleback  --------c-a-------a-aaca----------tggcata--ttacac---tcacagaaaaacactg--
                 Atlantic cod  --------t-a-------a-ag----------------ata--ttacac---c-----aag----tca--
                    Zebrafish  ttgatatgc-a-------g-gagacgcacagcaacggcttcctttatat---a-----aaagctctgt--
     Mexican tetra (cavefish)  --------a-a-------a-gaga-------------------ttacac---a-----aaaatattgtgt
                  Spotted gar  --------c-a-------a-tgga-----------aagata--ttacgc---a-----aaaga--tct--
                      Lamprey  ======================================================================

                        Human  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                        Chimp  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Gorilla  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                    Orangutan  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Gibbon  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Rhesus  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
          Crab-eating macaque  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Baboon  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                 Green monkey  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                     Marmoset  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
              Squirrel monkey  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                     Bushbaby  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
           Chinese tree shrew  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                     Squirrel  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
       Lesser Egyptian jerboa  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--ggggc------------
                 Prairie vole  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
              Chinese hamster  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
               Golden hamster  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                        Mouse  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                          Rat  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
               Naked mole-rat  ---tatac-aaaaa-------acac---g--t--aag----------aaaa--agggc------------
                   Guinea pig  ---tatac-aaaaa-------acac---g--t--aag----------aaaa--agggc------------
                   Chinchilla  ---tatac-aaaaa-------acac---g--t--aag----------aaaa--agggc------------
             Brush-tailed rat  ---tatac-aaaaa-------acac---g--t--aag----------aaaa--agggc------------
                       Rabbit  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                         Pika  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                          Pig  ---tatacaaaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Alpaca  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
               Bactrian camel  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Dolphin  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                 Killer whale  ---tacac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
             Tibetan antelope  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                          Cow  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                        Sheep  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                Domestic goat  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                        Horse  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
             White rhinoceros  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                          Cat  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                          Dog  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Ferret   ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                        Panda  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
               Pacific walrus  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                 Weddell seal  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
             Black flying-fox  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Megabat  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                Big brown bat  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
         David's myotis (bat)  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                     Microbat  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                     Hedgehog  ---tatac-aaaaa-------acac---a--t--aaga---------aaaa--agggc------------
                        Shrew  ---tatac-aaaaa-------acac---a--t--aag-----------aaa--agggc------------
              Star-nosed mole  ---tatac-aaaaa-------acac---t--t--aag----------aaaa--agggc------------
                     Elephant  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
          Cape elephant shrew  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Manatee  ---tttac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
             Cape golden mole  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Tenrec  ---tatac-aaaaa-------acac---t--t--aag----------aaaa--agggc------------
                     Aardvark  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggt------------
                    Armadillo  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Opossum  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
              Tasmanian devil  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Wallaby  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                     Platypus  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                  Rock pigeon  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                 Saker falcon  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
             Peregrine falcon  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
          Collared flycatcher  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
       White-throated sparrow  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
          Medium ground finch  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                  Zebra finch  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
           Tibetan ground jay  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                   Budgerigar  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Parrot  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                Scarlet macaw  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                 Mallard duck  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                      Chicken  ---tatac-aaaaa-------acac---a--t--aag----------aaaa-gagggc------------
                       Turkey  ---tatac-aaaaa-------acac---a--t--aag----------aaaa-gagggc------------
           American alligator  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
              Green seaturtle  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
               Painted turtle  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
     Chinese softshell turtle  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
       Spiny softshell turtle  ---tatac-aaaaa-------acac---a--t--aag----------aaaa--agggc------------
                       Lizard  ---tatac--aaaa-------acac---a--t--aag----------aaaaaaagggc------------
                X. tropicalis  ---tatac--aaaa-------acgcataa--t--aag----------aaaa--agggc------------
                   Coelacanth  ---ttaaa-aaaaa-------aaat---a--t--atgcttactaagtaaaa--agggt------------
                    Tetraodon  --gtataa-aatag-------gtct---g--t--ggg----------gggt-------------------
                         Fugu  --gtataa-aatgt-------gttt---g--t--ggg----------gggt--tggaa------------
       Yellowbelly pufferfish  --gtataa-aatgt-------gttt---g--t--ggg----------gggt--tggaa------------
                 Nile tilapia  --ccatag-aaaac-------gcag---a--tcatgt----------aaaa--agga-------------
          Princess of Burundi  --atataa-aagaa-------gctg---g--t--ggt----------gggg--aggaa------------
        Burton's mouthbreeder  --atataa-aagaa-------gctg---g--t--ggt----------gggg--aggaa------------
                  Zebra mbuna  --atataa-aagaa-------gctg---g--t--ggt----------gggg--aggaa------------
          Pundamilia nyererei  --atataa-aagaa-------gctg---g--t--ggt----------aggg--aggaa------------
                       Medaka  ------aa-aatgg-------gatg---ggct--gat----------cctc--atgta------------
           Southern platyfish  --gtataa-aataa-------gatg---g--t--aaa----------ggaa--aaaaa------------
                  Stickleback  --gtataa-aataa-------gttt---g--t--tga----------gaga--aaaaaaaaaaggaaaga
                 Atlantic cod  --ccatac-aaaat-------gcct---a--t--gat----------gcaa--aagag------------
                    Zebrafish  -tgtgtaa-aaccaaggagtttttt---t--t--gga----------gggg--ggaga------------
     Mexican tetra (cavefish)  ccatataa-aacggaga----tcat---g--t--aaa----------aagg--gccaa------------
                  Spotted gar  ---catac-aaaac-------gcat---a--c--tat----------gtaa--aaagg------------
                      Lamprey  ======================================================================

                        Human  -----------cact------aggtgac--a---------------------------tttt-aatttac
                        Chimp  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Gorilla  -----------cact------aggtgac--a---------------------------tttt-aatttac
                    Orangutan  -----------cact------aggtgac--a---------------------------attt-aatttac
                       Gibbon  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Rhesus  -----------cact------aggtgac--a---------------------------tttt-aatttac
          Crab-eating macaque  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Baboon  -----------cact------aggtgac--a---------------------------tttt-aatttac
                 Green monkey  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Marmoset  -----------cact------aggtgac--a---------------------------tttt-aatttac
              Squirrel monkey  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Bushbaby  -----------cact------aggtgac--g---------------------------tttt-aatttac
           Chinese tree shrew  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Squirrel  -----------cact------aggtgac--a---------------------------tttt-aatttac
       Lesser Egyptian jerboa  -----------cact------aggtgac--a---------------------------tttt-aatttac
                 Prairie vole  -----------cact------aggtgac--a---------------------------tttt-aatttac
              Chinese hamster  -----------cact------aggtgac--a---------------------------tttt-aatttac
               Golden hamster  -----------cact------aggtgac--a---------------------------tttt-aatttac
                        Mouse  -----------cact------aggtgac--a---------------------------tttt-aatttac
                          Rat  -----------cact------aggtgac--a---------------------------tttt-aatttac
               Naked mole-rat  -----------cact------aggtgac--a---------------------------tttt-aatttac
                   Guinea pig  -----------cact------aggtgac--a---------------------------tttt-aatttac
                   Chinchilla  -----------cact------aggtgac--a---------------------------tttt-aatttac
             Brush-tailed rat  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Rabbit  -----------cact------aggtgac--a---------------------------tttt-aatttac
                         Pika  -----------cact------aggtgac--a---------------------------tttt-aatttac
                          Pig  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Alpaca  -----------cact------aggtgac--a---------------------------tttt-aatttac
               Bactrian camel  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Dolphin  -----------cact------aggtgac--a---------------------------tttt-aatttac
                 Killer whale  -----------cact------aggtgac--a---------------------------tttt-aatttac
             Tibetan antelope  -----------cact------aggtgac--a---------------------------tttt-aatttac
                          Cow  -----------cact------aggtgac--a---------------------------tttt-aatttac
                        Sheep  -----------cact------aggtgac--a---------------------------tttt-aatttac
                Domestic goat  -----------cact------aggtgac--a---------------------------tttt-aatttac
                        Horse  -----------cact------aggtgac--a---------------------------tttt-aatttac
             White rhinoceros  -----------cact------aggtgac--a---------------------------tttt-aatttac
                          Cat  -----------cact------aggtgac--a---------------------------tttt-aatttac
                          Dog  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Ferret   -----------cact------aggtgac--a---------------------------tttt-aatttac
                        Panda  -----------cact------aggtgac--a---------------------------tttt-aatttac
               Pacific walrus  -----------cact------aggtgac--a---------------------------tttt-aatttac
                 Weddell seal  -----------cact------aggtgac--a---------------------------tttt-aatttac
             Black flying-fox  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Megabat  -----------cact------aggtgac--a---------------------------tttt-aatttac
                Big brown bat  -----------cact------aggtgac--a---------------------------tttt-aatttac
         David's myotis (bat)  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Microbat  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Hedgehog  -----------cact------aggtgac--a---------------------------tttt-aatttac
                        Shrew  -----------cact------aggtgac--a---------------------------tttt-aatttac
              Star-nosed mole  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Elephant  -----------cact------aggtgac--a---------------------------tttc-aatttac
          Cape elephant shrew  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Manatee  -----------cact------aggtgac--a---------------------------tttt-aatttac
             Cape golden mole  -----------cact------aggtgac--a---------------------------attt-aatttac
                       Tenrec  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Aardvark  -----------cact------aggtgac--a---------------------------tttt-aatttac
                    Armadillo  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Opossum  -----------cact------aggtgac--a---------------------------tttt-aatttac
              Tasmanian devil  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Wallaby  -----------cact------aggtgac--a---------------------------tttt-aatttac
                     Platypus  -----------cact------aggtgac--a---------------------------tttt-aatttac
                  Rock pigeon  -----------cact------aggtgac--a---------------------------tttt-aatttac
                 Saker falcon  -----------cact------aggtgac--a---------------------------tttt-aatttac
             Peregrine falcon  -----------cact------aggtgac--a---------------------------tttt-aatttac
          Collared flycatcher  -----------cact------aggtgac--a---------------------------tttt-aatttac
       White-throated sparrow  -----------cact------aggtgac--a---------------------------tttt-aatttac
          Medium ground finch  -----------cact------aggtgac--a---------------------------tttt-aatttac
                  Zebra finch  -----------cact------aggtgac--a---------------------------tttt-aatttac
           Tibetan ground jay  -----------cact------aggtgac--a---------------------------tttt-aatttac
                   Budgerigar  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Parrot  -----------cact------aggtgac--a---------------------------tttt-aatttac
                Scarlet macaw  -----------cact------aggtgac--a---------------------------tttt-aatttac
                 Mallard duck  -----------cact------aggtgac--a---------------------------tttt-aatttac
                      Chicken  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Turkey  -----------cact------aggtgac--a---------------------------tttt-aatttac
           American alligator  -----------cact------aggtgac--a---------------------------tttt-aatttac
              Green seaturtle  -----------cact------aggtgac--a---------------------------tttt-aatttac
               Painted turtle  -----------cact------aggtgac--a---------------------------tttt-aatttac
     Chinese softshell turtle  -----------cact------aggtgac--a---------------------------tttt-aatttac
       Spiny softshell turtle  -----------cact------aggtgac--a---------------------------tttt-aatttac
                       Lizard  -----------cact------aggtgac--a---------------------------tcttaaatttac
                X. tropicalis  -----------cact------aggtgac--a---------------------------ttat-aatttac
                   Coelacanth  -----------cact------aggtgactgg---------------------------gttt-aatttac
                    Tetraodon  ----------------gggg-gtggagg--a-gggc----------tacagcggacacttct-catttac
                         Fugu  ------------aaaatggg-gtgttgg--aggggc----------taaaggggacaaatct-catttac
       Yellowbelly pufferfish  ------------aaaatggg-gtgttgg--aggggc----------taaaggggacaaatct-catttac
                 Nile tilapia  ----------ccaca------gggtgat--------------------------gcggtaat-catttac
          Princess of Burundi  ----tctgtgccagaattgg-gggtagt--a----------------ataaggggcgattct-catttac
        Burton's mouthbreeder  ----tctgtgccagaattgg-gggtagt--a----------------ataaggggcgattct-catttac
                  Zebra mbuna  ----tctgtgccagaattgg-gggtagt--a----------------ataaggggcgattct-catttac
          Pundamilia nyererei  ----tctgtgccagaattgg-gggtagt--a----------------ataaggggcgattct-catttac
                       Medaka  ------catatcaa-------------------------------------------------catttat
           Southern platyfish  ------tataccaaaactga-ct-------------------------------gcgattct-catttac
                  Stickleback  agaatccgcaccagggttggcgggtcgg--a----------------gggggggtgggggcg-catttac
                 Atlantic cod  ----------ccaca------gggtgac--a------------------------tggttat-catttac
                    Zebrafish  -------------------g-gagtacg--aggagccggctttactaataacagac--ttta-aatttac
     Mexican tetra (cavefish)  -------------------c-gggtgag--gggatc----------------------------atttac
                  Spotted gar  ---------gccactaggtg-acactgt--a------------------------------t-aatttac
                      Lamprey  ======================================================================

                        Human  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                        Chimp  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                      Gorilla  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                    Orangutan  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                       Gibbon  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                       Rhesus  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
          Crab-eating macaque  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                       Baboon  a---a-a---ttggcatcat-tttg-----gtcgacaaat-acccac-------------atg
                 Green monkey  a---a-a---ttggcatcat-tttg-----gtcgacaaat