Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 923 in window, 113666822 - 113666825, 4 bps 
B D                     Human  tca--t
B D                     Chimp  tca--t
B D                 Orangutan  tca--t
B D                    Rhesus  tcg--t
B D       Crab-eating macaque  tcg--t
B D                    Baboon  tcg--t
B D              Green monkey  tca--t
B D                  Marmoset  tcaggt
B D           Squirrel monkey  tcaggt
                 Prairie vole  ------
             Brush-tailed rat  ------
             Star-nosed mole  ======
B D                     Shrew  ======
B D              Nile tilapia  ------
                 Zebra mbuna  ======
B D                 Tetraodon  ======
B D               Stickleback  ======
                 Spotted gar  ------
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                      Fugu  ------
B D                  Hedgehog  ======
B D                Coelacanth  ======
          Southern platyfish  ------
B D              Atlantic cod  ======
B D                    Medaka  ======
B D                 Zebrafish  ------
    Mexican tetra (cavefish)  ------
      Yellowbelly pufferfish  ------
B D             X. tropicalis  ======
B D                      Pika  ======
B D                    Rabbit  ======
B D           Tasmanian devil  ======
  D               Rock pigeon  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
  D                    Parrot  ======
  D    Spiny softshell turtle  ======
  D            Painted turtle  ======
B D                   Gorilla  ------
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                    Lizard  ======
B D                   Megabat  ======
            Black flying-fox  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
  D              Saker falcon  ======
  D           Green seaturtle  ======
  D              Mallard duck  ======
B D                Budgerigar  ======
B D                    Turkey  ======
B D                   Chicken  ======
          Tibetan ground jay  ======
B D        American alligator  ======
B D                   Opossum  ======
B D                    Tenrec  ======
               Domestic goat  ======
  D          Peregrine falcon  ======
              Pacific walrus  ======
B D                 Armadillo  ======
         Cape elephant shrew  ======
                    Aardvark  ======
            Cape golden mole  ======
              Golden hamster  ======
B D                       Rat  ======
B D           Chinese hamster  ======
              Bactrian camel  ======
B D                     Horse  ======
B D                     Panda  ======
      Lesser Egyptian jerboa  ======
B D                     Mouse  ======
B D                Guinea pig  ======
B D            Naked mole-rat  ======
                  Chinchilla  ======
B D                  Squirrel  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D                     Sheep  ======
            Tibetan antelope  ======
          Chinese tree shrew  ======
B D                    Gibbon  ======
                Weddell seal  ======
B D                       Cat  ======
B D                    Alpaca  ======
B D                       Cow  ======
                Killer whale  ======
B D                   Dolphin  ======
B D                       Pig  ======
B D                   Ferret   ======
B D                       Dog  ======
B D          White rhinoceros  ======
B D                  Bushbaby  ------

Inserts between block 1 and 2 in window
                Prairie vole 1bp
            Brush-tailed rat 73bp

Alignment block 2 of 923 in window, 113666826 - 113666877, 52 bps 
B D                     Human  tatctgcccgcctcggtctcccaaagtgctgggattacaggtgtgagccact
B D                     Chimp  tatctgcctgcctcggtctcccaaagtgctgggattacaggtgtgagccacc
B D                 Orangutan  tatctgcctgcctccgtctcccaaagtgctgggattacaggtgtgagccacc
B D                    Rhesus  gatccacccgcctcagctttccaaagtgctgggattacaggtgtgagtcacc
B D       Crab-eating macaque  gatccacccgcctcagctttccaaagtgctgggattacaggtgtgagtcacc
B D                    Baboon  gatccgcccgcctcggctttccaaagtgctgggattacaagtgtgagtcacc
B D              Green monkey  gatccacccacctcggctttctaaagtgctgggattacaggcgtgagtcacc
B D                  Marmoset  gatcctcctgccttggcctcccaaattggtgggattacaggtgtgagccacc
B D           Squirrel monkey  gatcctcctgccttggcctcacagagtggtgggattacaggtgtgagtcacg
                 Prairie vole  gatccacctgcctctgcctccc-gagtgctgggattaaaggcatgcgccacc
             Star-nosed mole  ====================================================
B D                     Shrew  ====================================================
B D              Nile tilapia  ----------------------------------------------------
                 Zebra mbuna  ====================================================
B D                 Tetraodon  ====================================================
B D               Stickleback  ====================================================
                 Spotted gar  ----------------------------------------------------
         Pundamilia nyererei  ====================================================
       Burton's mouthbreeder  ====================================================
         Princess of Burundi  ====================================================
B D                      Fugu  ----------------------------------------------------
B D                  Hedgehog  ====================================================
B D                Coelacanth  ====================================================
          Southern platyfish  ----------------------------------------------------
B D              Atlantic cod  ====================================================
B D                    Medaka  ====================================================
B D                 Zebrafish  ----------------------------------------------------
    Mexican tetra (cavefish)  ----------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------
B D             X. tropicalis  ====================================================
B D                      Pika  ====================================================
B D                    Rabbit  ====================================================
B D           Tasmanian devil  ====================================================
  D               Rock pigeon  ====================================================
  D    White-throated sparrow  ====================================================
  D             Scarlet macaw  ====================================================
  D                    Parrot  ====================================================
  D    Spiny softshell turtle  ====================================================
  D            Painted turtle  ====================================================
B D                   Gorilla  ----------------------------------------------------
               Big brown bat  ====================================================
B D                  Microbat  ====================================================
        David's myotis (bat)  ====================================================
B D                    Lizard  ====================================================
B D                   Megabat  ====================================================
            Black flying-fox  ====================================================
B D               Zebra finch  ====================================================
B D       Medium ground finch  ====================================================
  D       Collared flycatcher  ====================================================
  D  Chinese softshell turtle  ====================================================
  D              Saker falcon  ====================================================
  D           Green seaturtle  ====================================================
  D              Mallard duck  ====================================================
B D                Budgerigar  ====================================================
B D                    Turkey  ====================================================
B D                   Chicken  ====================================================
          Tibetan ground jay  ====================================================
B D        American alligator  ====================================================
B D                   Opossum  ====================================================
B D                    Tenrec  ====================================================
               Domestic goat  ====================================================
  D          Peregrine falcon  ====================================================
              Pacific walrus  ====================================================
B D                 Armadillo  ====================================================
         Cape elephant shrew  ====================================================
                    Aardvark  ====================================================
            Cape golden mole  ====================================================
              Golden hamster  ====================================================
B D                       Rat  ====================================================
B D           Chinese hamster  ====================================================
              Bactrian camel  ====================================================
B D                     Horse  ====================================================
B D                     Panda  ====================================================
      Lesser Egyptian jerboa  ====================================================
B D                     Mouse  ====================================================
            Brush-tailed rat  ====================================================
B D                Guinea pig  ====================================================
B D            Naked mole-rat  ====================================================
                  Chinchilla  ====================================================
B D                  Squirrel  ====================================================
B D                   Manatee  ====================================================
B D                  Elephant  ====================================================
B D                     Sheep  ====================================================
            Tibetan antelope  ====================================================
          Chinese tree shrew  ====================================================
B D                    Gibbon  ====================================================
                Weddell seal  ====================================================
B D                       Cat  ====================================================
B D                    Alpaca  ====================================================
B D                       Cow  ====================================================
                Killer whale  ====================================================
B D                   Dolphin  ====================================================
B D                       Pig  ====================================================
B D                   Ferret   ====================================================
B D                       Dog  ====================================================
B D          White rhinoceros  ====================================================
B D                  Bushbaby  ----------------------------------------------------

Alignment block 3 of 923 in window, 113666878 - 113666885, 8 bps 
B D                     Human  -gtgcccgg
B D                     Chimp  -gtgcccgg
B D                   Gorilla  -gtgcccgg
B D                 Orangutan  -gcgcccgg
B D                    Rhesus  -gcacccag
B D       Crab-eating macaque  -gcacccag
B D                    Baboon  -gcacccag
B D              Green monkey  -gtgcccag
B D                  Marmoset  -atgctcgg
B D           Squirrel monkey  -atgctcag
                 Prairie vole  accgcccgg
             Star-nosed mole  =========
B D                     Shrew  =========
B D              Nile tilapia  ---------
                 Zebra mbuna  =========
B D                 Tetraodon  =========
B D               Stickleback  =========
                 Spotted gar  ---------
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D                      Fugu  ---------
B D                  Hedgehog  =========
B D                Coelacanth  =========
          Southern platyfish  ---------
B D              Atlantic cod  =========
B D                    Medaka  =========
B D                 Zebrafish  ---------
    Mexican tetra (cavefish)  ---------
      Yellowbelly pufferfish  ---------
B D             X. tropicalis  =========
B D                      Pika  =========
B D                    Rabbit  =========
B D           Tasmanian devil  =========
  D               Rock pigeon  =========
  D    White-throated sparrow  =========
  D             Scarlet macaw  =========
  D                    Parrot  =========
  D    Spiny softshell turtle  =========
  D            Painted turtle  =========
               Big brown bat  =========
B D                  Microbat  =========
        David's myotis (bat)  =========
B D                    Lizard  =========
B D                   Megabat  =========
            Black flying-fox  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D       Collared flycatcher  =========
  D  Chinese softshell turtle  =========
  D              Saker falcon  =========
  D           Green seaturtle  =========
  D              Mallard duck  =========
B D                Budgerigar  =========
B D                    Turkey  =========
B D                   Chicken  =========
          Tibetan ground jay  =========
B D        American alligator  =========
B D                   Opossum  =========
B D                    Tenrec  =========
               Domestic goat  =========
  D          Peregrine falcon  =========
              Pacific walrus  =========
B D                 Armadillo  =========
         Cape elephant shrew  =========
                    Aardvark  =========
            Cape golden mole  =========
              Golden hamster  =========
B D                       Rat  =========
B D           Chinese hamster  =========
              Bactrian camel  =========
B D                     Horse  =========
B D                     Panda  =========
      Lesser Egyptian jerboa  =========
B D                     Mouse  =========
            Brush-tailed rat  =========
B D                Guinea pig  =========
B D            Naked mole-rat  =========
                  Chinchilla  =========
B D                  Squirrel  =========
B D                   Manatee  =========
B D                  Elephant  =========
B D                     Sheep  =========
            Tibetan antelope  =========
          Chinese tree shrew  =========
B D                    Gibbon  =========
                Weddell seal  =========
B D                       Cat  =========
B D                    Alpaca  =========
B D                       Cow  =========
                Killer whale  =========
B D                   Dolphin  =========
B D                       Pig  =========
B D                   Ferret   =========
B D                       Dog  =========
B D          White rhinoceros  =========
B D                  Bushbaby  ---------

Inserts between block 3 and 4 in window
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp

Alignment block 4 of 923 in window, 113666886 - 113666889, 4 bps 
B D                     Human  acta
B D                     Chimp  acta
B D                   Gorilla  acta
B D                 Orangutan  acta
B D                    Rhesus  ccta
B D       Crab-eating macaque  ccta
B D                    Baboon  ccta
B D              Green monkey  ccta
B D                  Marmoset  ccta
B D           Squirrel monkey  ccta
                 Prairie vole  acta
             Star-nosed mole  ====
B D                     Shrew  ====
B D              Nile tilapia  ----
                 Zebra mbuna  ====
B D                 Tetraodon  ====
B D               Stickleback  ====
                 Spotted gar  ----
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                      Fugu  ----
B D                  Hedgehog  ====
B D                Coelacanth  ====
          Southern platyfish  ----
B D              Atlantic cod  ====
B D                    Medaka  ====
B D                 Zebrafish  ----
    Mexican tetra (cavefish)  ----
      Yellowbelly pufferfish  ----
B D             X. tropicalis  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D           Tasmanian devil  ====
  D               Rock pigeon  ====
  D    White-throated sparrow  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
  D    Spiny softshell turtle  ====
  D            Painted turtle  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Lizard  ====
B D                   Megabat  ====
            Black flying-fox  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
  D              Saker falcon  ====
  D           Green seaturtle  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
B D                    Turkey  ====
B D                   Chicken  ====
          Tibetan ground jay  ====
B D        American alligator  ====
B D                   Opossum  ====
B D                    Tenrec  ====
               Domestic goat  ====
  D          Peregrine falcon  ====
              Pacific walrus  ====
B D                 Armadillo  ====
         Cape elephant shrew  ====
                    Aardvark  ====
            Cape golden mole  ====
              Golden hamster  ====
B D                       Rat  ====
B D           Chinese hamster  ====
              Bactrian camel  ====
B D                     Horse  ====
B D                     Panda  ====
      Lesser Egyptian jerboa  ====
B D                     Mouse  ====
            Brush-tailed rat  ====
B D                Guinea pig  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
B D                  Squirrel  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D                     Sheep  ====
            Tibetan antelope  ====
          Chinese tree shrew  ====
B D                    Gibbon  ====
                Weddell seal  ====
B D                       Cat  ====
B D                    Alpaca  ====
B D                       Cow  ====
                Killer whale  ====
B D                   Dolphin  ====
B D                       Pig  ====
B D                   Ferret   ====
B D                       Dog  ====
B D          White rhinoceros  ====
B D                  Bushbaby  ----

Inserts between block 4 and 5 in window
                Prairie vole 1bp

Alignment block 5 of 923 in window, 113666890 - 113666890, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  c
                 Prairie vole  c
             Brush-tailed rat  c
B D                     Panda  c
B D                   Manatee  c
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
              Pacific walrus  =
B D                 Armadillo  =
         Cape elephant shrew  =
                    Aardvark  =
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  =
B D           Chinese hamster  =
              Bactrian camel  =
B D                     Horse  =
      Lesser Egyptian jerboa  =
B D                     Mouse  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
                Weddell seal  =
B D                       Cat  =
B D                    Alpaca  =
B D                       Cow  =
                Killer whale  =
B D                   Dolphin  =
B D                       Pig  =
B D                   Ferret   =
B D                       Dog  =
B D          White rhinoceros  =
B D                  Bushbaby  -

Alignment block 6 of 923 in window, 113666891 - 113666891, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
                 Prairie vole  t
             Brush-tailed rat  t
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
B D                  Hedgehog  t
B D                   Manatee  t
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
                    Aardvark  =
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  =
B D           Chinese hamster  =
              Bactrian camel  =
B D                     Horse  =
      Lesser Egyptian jerboa  =
B D                     Mouse  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                    Alpaca  =
B D                       Cow  =
                Killer whale  =
B D                   Dolphin  =
B D                       Pig  =
B D                       Dog  =
B D                  Bushbaby  -

Inserts between block 6 and 7 in window
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
B D                 Hedgehog 2bp

Alignment block 7 of 923 in window, 113666892 - 113666892, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
                 Prairie vole  g
B D            Naked mole-rat  t
             Brush-tailed rat  t
B D                    Alpaca  t
B D                   Dolphin  t
                 Killer whale  t
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
B D                  Hedgehog  t
B D                   Manatee  t
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
                    Aardvark  =
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  =
B D           Chinese hamster  =
              Bactrian camel  =
B D                     Horse  =
      Lesser Egyptian jerboa  =
B D                     Mouse  =
B D                Guinea pig  =
                  Chinchilla  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =
B D                  Bushbaby  -

Alignment block 8 of 923 in window, 113666893 - 113666896, 4 bps 
B D                     Human  attg
B D                     Chimp  gttg
B D                   Gorilla  attg
B D                 Orangutan  attg
B D                    Rhesus  attg
B D       Crab-eating macaque  attg
B D                    Baboon  atca
B D              Green monkey  attg
B D                  Marmoset  gttg
B D           Squirrel monkey  attg
B D                  Squirrel  attc
                 Prairie vole  actc
B D           Chinese hamster  actc
B D            Naked mole-rat  attc
             Brush-tailed rat  attc
B D                    Alpaca  at--
B D                   Dolphin  ac--
                 Killer whale  ac--
B D          White rhinoceros  ac--
B D                       Cat  ac--
B D                   Ferret   ac--
B D                     Panda  ac--
               Pacific walrus  ac--
                 Weddell seal  ac--
B D                  Hedgehog  at--
B D                   Manatee  att-
             Star-nosed mole  ====
B D                     Shrew  ====
B D              Nile tilapia  ----
                 Zebra mbuna  ====
B D                 Tetraodon  ====
B D               Stickleback  ====
                 Spotted gar  ----
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                      Fugu  ----
B D                Coelacanth  ====
          Southern platyfish  ----
B D              Atlantic cod  ====
B D                    Medaka  ====
B D                 Zebrafish  ----
    Mexican tetra (cavefish)  ----
      Yellowbelly pufferfish  ----
B D             X. tropicalis  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D           Tasmanian devil  ====
  D               Rock pigeon  ====
  D    White-throated sparrow  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
  D    Spiny softshell turtle  ====
  D            Painted turtle  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Lizard  ====
B D                   Megabat  ====
            Black flying-fox  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
  D              Saker falcon  ====
  D           Green seaturtle  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
B D                    Turkey  ====
B D                   Chicken  ====
          Tibetan ground jay  ====
B D        American alligator  ====
B D                   Opossum  ====
B D                    Tenrec  ====
               Domestic goat  ====
  D          Peregrine falcon  ====
B D                 Armadillo  ====
         Cape elephant shrew  ====
                    Aardvark  ====
            Cape golden mole  ====
              Golden hamster  ====
B D                       Rat  ====
              Bactrian camel  ====
B D                     Horse  ====
      Lesser Egyptian jerboa  ====
B D                     Mouse  ====
B D                Guinea pig  ====
                  Chinchilla  ====
B D                  Elephant  ====
B D                     Sheep  ====
            Tibetan antelope  ====
          Chinese tree shrew  ====
B D                    Gibbon  ====
B D                       Cow  ====
B D                       Pig  ====
B D                       Dog  ====
B D                  Bushbaby  ----

Inserts between block 8 and 9 in window
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D           Naked mole-rat 1bp
            Brush-tailed rat 1bp
B D                   Alpaca 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
B D                 Hedgehog 1bp

Alignment block 9 of 923 in window, 113666897 - 113666899, 3 bps 
B D                     Human  ttg
B D                     Chimp  ttg
B D                   Gorilla  ttg
B D                 Orangutan  ttg
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ctt
B D           Squirrel monkey  ttt
B D                  Squirrel  tt-
                 Prairie vole  tt-
B D           Chinese hamster  tc-
B D                       Rat  tt-
B D            Naked mole-rat  tt-
             Brush-tailed rat  tc-
B D                    Alpaca  tt-
B D                   Dolphin  tt-
                 Killer whale  tt-
B D                     Horse  tt-
B D          White rhinoceros  tt-
B D                       Cat  tt-
B D                   Ferret   tt-
B D                     Panda  tt-
               Pacific walrus  tt-
                 Weddell seal  tt-
B D                  Hedgehog  tt-
             Star-nosed mole  ===
B D                     Shrew  ===
B D              Nile tilapia  ---
                 Zebra mbuna  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
                 Spotted gar  ---
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                      Fugu  ---
B D                Coelacanth  ===
          Southern platyfish  ---
B D              Atlantic cod  ===
B D                    Medaka  ===
B D                 Zebrafish  ---
    Mexican tetra (cavefish)  ---
      Yellowbelly pufferfish  ---
B D             X. tropicalis  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D           Tasmanian devil  ===
  D               Rock pigeon  ===
  D    White-throated sparrow  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
  D    Spiny softshell turtle  ===
  D            Painted turtle  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                    Lizard  ===
B D                   Megabat  ===
            Black flying-fox  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
  D              Saker falcon  ===
  D           Green seaturtle  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D        American alligator  ===
B D                   Opossum  ===
B D                    Tenrec  ===
               Domestic goat  ===
  D          Peregrine falcon  ===
B D                 Armadillo  ===
         Cape elephant shrew  ===
                    Aardvark  ===
            Cape golden mole  ===
              Golden hamster  ===
              Bactrian camel  ===
      Lesser Egyptian jerboa  ===
B D                     Mouse  ===
B D                Guinea pig  ===
                  Chinchilla  ===
B D                   Manatee  ---
B D                  Elephant  ===
B D                     Sheep  ===
            Tibetan antelope  ===
          Chinese tree shrew  ===
B D                    Gibbon  ===
B D                       Cow  ===
B D                       Pig  ===
B D                       Dog  ===
B D                  Bushbaby  ---

Alignment block 10 of 923 in window, 113666900 - 113666900, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  c
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D                    Alpaca  c
B D                   Dolphin  c
                 Killer whale  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  g
                 Weddell seal  g
B D                  Hedgehog  c
B D                   Manatee  c
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
                    Aardvark  =
            Cape golden mole  =
              Golden hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  -
B D                Guinea pig  =
B D            Naked mole-rat  -
                  Chinchilla  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =
B D                  Bushbaby  -

Alignment block 11 of 923 in window, 113666901 - 113666901, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
             Brush-tailed rat  t
B D                    Alpaca  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
B D                  Hedgehog  c
B D                   Manatee  t
                     Aardvark  t
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
                  Chinchilla  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =
B D                  Bushbaby  -

Inserts between block 11 and 12 in window
B D           Naked mole-rat 1bp
            Brush-tailed rat 1bp

Alignment block 12 of 923 in window, 113666902 - 113666906, 5 bps 
B D                     Human  aatga
B D                     Chimp  aatga
B D                   Gorilla  aatga
B D                 Orangutan  aatga
B D                    Rhesus  aatga
B D       Crab-eating macaque  aatga
B D                    Baboon  aatga
B D              Green monkey  aatga
B D                  Marmoset  aatga
B D           Squirrel monkey  aatga
B D                  Squirrel  aatgg
                 Prairie vole  aacga
B D           Chinese hamster  aatgg
B D                     Mouse  aatga
B D                       Rat  aatgg
B D            Naked mole-rat  aatgg
                   Chinchilla  aatgg
             Brush-tailed rat  aatgg
B D                    Alpaca  aaagg
B D                   Dolphin  aaagg
                 Killer whale  aaagg
B D                     Horse  aaagg
B D          White rhinoceros  aaaag
B D                       Cat  aaagg
B D                   Ferret   aaagg
B D                     Panda  aaagg
               Pacific walrus  aaagg
                 Weddell seal  aaagg
B D                  Hedgehog  aatgg
B D                   Manatee  actgg
                     Aardvark  aatgg
             Star-nosed mole  =====
B D                     Shrew  =====
B D              Nile tilapia  -----
                 Zebra mbuna  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
                 Spotted gar  -----
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                      Fugu  -----
B D                Coelacanth  =====
          Southern platyfish  -----
B D              Atlantic cod  =====
B D                    Medaka  =====
B D                 Zebrafish  -----
    Mexican tetra (cavefish)  -----
      Yellowbelly pufferfish  -----
B D             X. tropicalis  =====
B D                      Pika  =====
B D                    Rabbit  =====
B D           Tasmanian devil  =====
  D               Rock pigeon  =====
  D    White-throated sparrow  =====
  D             Scarlet macaw  =====
  D                    Parrot  =====
  D    Spiny softshell turtle  =====
  D            Painted turtle  =====
               Big brown bat  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
B D                    Lizard  =====
B D                   Megabat  =====
            Black flying-fox  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
  D              Saker falcon  =====
  D           Green seaturtle  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
B D                    Turkey  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D        American alligator  =====
B D                   Opossum  =====
B D                    Tenrec  =====
               Domestic goat  =====
  D          Peregrine falcon  =====
B D                 Armadillo  =====
         Cape elephant shrew  =====
            Cape golden mole  =====
              Golden hamster  =====
              Bactrian camel  =====
      Lesser Egyptian jerboa  =====
B D                Guinea pig  =====
B D                  Elephant  =====
B D                     Sheep  =====
            Tibetan antelope  =====
          Chinese tree shrew  =====
B D                    Gibbon  =====
B D                       Cow  =====
B D                       Pig  =====
B D                       Dog  =====
B D                  Bushbaby  -----

Alignment block 13 of 923 in window, 113666907 - 113666907, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  c
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Alpaca  t
B D                   Dolphin  c
                 Killer whale  c
B D                     Horse  a
B D          White rhinoceros  c
B D                       Cat  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                   Manatee  c
                     Aardvark  c
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =
B D                  Bushbaby  -

Alignment block 14 of 923 in window, 113666908 - 113666915, 8 bps 
B D                     Human  tgtattta
B D                     Chimp  tgtattta
B D                   Gorilla  tgtattta
B D                 Orangutan  tgtattta
B D                    Rhesus  tgtattta
B D       Crab-eating macaque  tgtattta
B D                    Baboon  tgtattta
B D              Green monkey  tgtattta
B D                  Marmoset  tgtattta
B D           Squirrel monkey  tgcattta
B D                  Squirrel  tgtattta
                 Prairie vole  tgtattcc
B D           Chinese hamster  tgtatttc
B D                     Mouse  --tatttc
B D                       Rat  --cattcc
B D            Naked mole-rat  tatattta
                   Chinchilla  tatattta
             Brush-tailed rat  tgtgtt--
B D                    Alpaca  tgtgtcta
               Bactrian camel  tgtgtcta
B D                   Dolphin  tgtattta
                 Killer whale  tgtattta
B D                     Horse  tatattta
B D          White rhinoceros  tgcattta
B D                       Cat  tgtattta
B D                   Ferret   tgaattta
B D                     Panda  tgaatcta
               Pacific walrus  tgaattta
                 Weddell seal  tgaattta
         David's myotis (bat)  tgtattta
B D                  Microbat  tgtattta
B D                  Hedgehog  tatattta
B D                   Manatee  tatatttc
                     Aardvark  tgtatttc
             Star-nosed mole  ========
B D                     Shrew  ========
B D              Nile tilapia  --------
                 Zebra mbuna  ========
B D                 Tetraodon  ========
B D               Stickleback  ========
                 Spotted gar  --------
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                      Fugu  --------
B D                Coelacanth  ========
          Southern platyfish  --------
B D              Atlantic cod  ========
B D                    Medaka  ========
B D                 Zebrafish  --------
    Mexican tetra (cavefish)  --------
      Yellowbelly pufferfish  --------
B D             X. tropicalis  ========
B D                      Pika  ========
B D                    Rabbit  ========
B D           Tasmanian devil  ========
  D               Rock pigeon  ========
  D    White-throated sparrow  ========
  D             Scarlet macaw  ========
  D                    Parrot  ========
  D    Spiny softshell turtle  ========
  D            Painted turtle  ========
               Big brown bat  ========
B D                    Lizard  ========
B D                   Megabat  ========
            Black flying-fox  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
  D              Saker falcon  ========
  D           Green seaturtle  ========
  D              Mallard duck  ========
B D                Budgerigar  ========
B D                    Turkey  ========
B D                   Chicken  ========
          Tibetan ground jay  ========
B D        American alligator  ========
B D                   Opossum  ========
B D                    Tenrec  ========
               Domestic goat  ========
  D          Peregrine falcon  ========
B D                 Armadillo  ========
         Cape elephant shrew  ========
            Cape golden mole  ========
              Golden hamster  ========
      Lesser Egyptian jerboa  ========
B D                Guinea pig  ========
B D                  Elephant  ========
B D                     Sheep  ========
            Tibetan antelope  ========
          Chinese tree shrew  ========
B D                    Gibbon  ========
B D                       Cow  ========
B D                       Pig  ========
B D                       Dog  ========
B D                  Bushbaby  --------

Alignment block 15 of 923 in window, 113666916 - 113666916, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  c
                   Chinchilla  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                   Manatee  t
                     Aardvark  t
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                    Rabbit  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  -
B D                Guinea pig  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =
B D                  Bushbaby  -

Alignment block 16 of 923 in window, 113666917 - 113666922, 6 bps 
B D                     Human  tttat-t
B D                     Chimp  tttat-t
B D                   Gorilla  tttat-t
B D                 Orangutan  tttat-t
B D                    Rhesus  tttat-t
B D       Crab-eating macaque  tttat-t
B D                    Baboon  tttat-t
B D              Green monkey  tttat-t
B D                  Marmoset  tttat-t
B D           Squirrel monkey  tttat-t
B D                  Squirrel  tttac-t
                 Prairie vole  tttat-t
B D           Chinese hamster  ttcct-t
B D                     Mouse  tttac-t
B D                       Rat  tttac-c
B D            Naked mole-rat  tt-ac-t
                   Chinchilla  tt-at-t
B D                    Rabbit  tttat-t
B D                      Pika  tttatct
B D                    Alpaca  tttat-t
               Bactrian camel  tttat-t
B D                   Dolphin  tttgt-t
                 Killer whale  tttgt-t
B D                     Horse  ttcat-t
B D          White rhinoceros  ctcat-t
B D                       Cat  tttat-t
B D                   Ferret   tttat-t
B D                     Panda  tttat-g
               Pacific walrus  tttat-t
                 Weddell seal  tttat-t
         David's myotis (bat)  tttat-t
B D                  Microbat  ttta---
B D                  Hedgehog  tttat-t
B D                   Manatee  tttat-t
                     Aardvark  tttat-t
             Star-nosed mole  =======
B D                     Shrew  =======
B D              Nile tilapia  -------
                 Zebra mbuna  =======
B D                 Tetraodon  =======
B D               Stickleback  =======
                 Spotted gar  -------
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                      Fugu  -------
B D                Coelacanth  =======
          Southern platyfish  -------
B D              Atlantic cod  =======
B D                    Medaka  =======
B D                 Zebrafish  -------
    Mexican tetra (cavefish)  -------
      Yellowbelly pufferfish  -------
B D             X. tropicalis  =======
B D           Tasmanian devil  =======
  D               Rock pigeon  =======
  D    White-throated sparrow  =======
  D             Scarlet macaw  =======
  D                    Parrot  =======
  D    Spiny softshell turtle  =======
  D            Painted turtle  =======
               Big brown bat  =======
B D                    Lizard  =======
B D                   Megabat  =======
            Black flying-fox  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
  D              Saker falcon  =======
  D           Green seaturtle  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
B D                    Turkey  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D        American alligator  =======
B D                   Opossum  =======
B D                    Tenrec  =======
               Domestic goat  =======
  D          Peregrine falcon  =======
B D                 Armadillo  =======
         Cape elephant shrew  =======
            Cape golden mole  =======
              Golden hamster  =======
      Lesser Egyptian jerboa  =======
            Brush-tailed rat  -------
B D                Guinea pig  =======
B D                  Elephant  =======
B D                     Sheep  =======
            Tibetan antelope  =======
          Chinese tree shrew  =======
B D                    Gibbon  =======
B D                       Cow  =======
B D                       Pig  =======
B D                       Dog  =======
B D                  Bushbaby  -------

Alignment block 17 of 923 in window, 113666923 - 113666929, 7 bps 
B D                     Human  t----accagt
B D                     Chimp  t----accagt
B D                   Gorilla  t----accagt
B D                 Orangutan  t----accagt
B D                    Rhesus  t----accagt
B D       Crab-eating macaque  t----accagt
B D                    Baboon  t----accagt
B D              Green monkey  t----accagt
B D                  Marmoset  t----accagt
B D           Squirrel monkey  t----accagt
B D                  Bushbaby  t----gccatt
B D                  Squirrel  t----agcagt
                 Prairie vole  t----gccagt
B D           Chinese hamster  t----gccagc
B D                     Mouse  t----gccagt
B D                       Rat  t----gccagc
B D            Naked mole-rat  t----accaat
                   Chinchilla  t----accaat
             Brush-tailed rat  ----------a
B D                    Rabbit  t----gccaat
B D                      Pika  t----accagt
B D                    Alpaca  t----acaagt
               Bactrian camel  t----acaagt
B D                   Dolphin  t----accagt
                 Killer whale  t----accagt
B D                     Horse  a----accatt
B D          White rhinoceros  a----accagt
B D                       Cat  t----tccagt
B D                   Ferret   t----ttgagt
B D                     Panda  t----ttgagt
               Pacific walrus  t----ttgagt
                 Weddell seal  t----ttgagt
         David's myotis (bat)  t----accagt
B D                  Microbat  ----------t
B D                  Hedgehog  taccaaccagt
B D                   Manatee  t----accagt
                     Aardvark  t----accaat
             Star-nosed mole  ===========
B D                     Shrew  ===========
B D              Nile tilapia  -----------
                 Zebra mbuna  ===========
B D                 Tetraodon  ===========
B D               Stickleback  ===========
                 Spotted gar  -----------
         Pundamilia nyererei  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D                      Fugu  -----------
B D                Coelacanth  ===========
          Southern platyfish  -----------
B D              Atlantic cod  ===========
B D                    Medaka  ===========
B D                 Zebrafish  -----------
    Mexican tetra (cavefish)  -----------
      Yellowbelly pufferfish  -----------
B D             X. tropicalis  ===========
B D           Tasmanian devil  ===========
  D               Rock pigeon  ===========
  D    White-throated sparrow  ===========
  D             Scarlet macaw  ===========
  D                    Parrot  ===========
  D    Spiny softshell turtle  ===========
  D            Painted turtle  ===========
               Big brown bat  ===========
B D                    Lizard  ===========
B D                   Megabat  ===========
            Black flying-fox  ===========
B D               Zebra finch  ===========
B D       Medium ground finch  ===========
  D       Collared flycatcher  ===========
  D  Chinese softshell turtle  ===========
  D              Saker falcon  ===========
  D           Green seaturtle  ===========
  D              Mallard duck  ===========
B D                Budgerigar  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
          Tibetan ground jay  ===========
B D        American alligator  ===========
B D                   Opossum  ===========
B D                    Tenrec  ===========
               Domestic goat  ===========
  D          Peregrine falcon  ===========
B D                 Armadillo  ===========
         Cape elephant shrew  ===========
            Cape golden mole  ===========
              Golden hamster  ===========
      Lesser Egyptian jerboa  ===========
B D                Guinea pig  ===========
B D                  Elephant  ===========
B D                     Sheep  ===========
            Tibetan antelope  ===========
          Chinese tree shrew  ===========
B D                    Gibbon  ===========
B D                       Cow  ===========
B D                       Pig  ===========
B D                       Dog  ===========

Inserts between block 17 and 18 in window
                    Aardvark 219bp

Alignment block 18 of 923 in window, 113666930 - 113666933, 4 bps 
B D                     Human  --ctat
B D                     Chimp  --ctat
B D                   Gorilla  --ctat
B D                 Orangutan  --ctat
B D                    Rhesus  --ctat
B D       Crab-eating macaque  --ctat
B D                    Baboon  --ctgt
B D              Green monkey  --ctat
B D                  Marmoset  --ctat
B D           Squirrel monkey  --ctat
B D                  Bushbaby  --ttat
B D                  Squirrel  --ctat
                 Prairie vole  --ttat
B D           Chinese hamster  --ttat
B D                     Mouse  --ttat
B D                       Rat  --ttat
B D            Naked mole-rat  --ctat
                   Chinchilla  --ctat
             Brush-tailed rat  --ctat
B D                    Rabbit  --ctac
B D                      Pika  --tggc
B D                    Alpaca  --ttat
               Bactrian camel  --ttat
B D                   Dolphin  --ctat
                 Killer whale  --ctat
B D                     Horse  --ctat
B D          White rhinoceros  --ttat
B D                       Cat  --atag
B D                   Ferret   --ccat
B D                     Panda  --ccat
               Pacific walrus  --ccat
                 Weddell seal  --ccat
         David's myotis (bat)  --ctat
B D                  Microbat  --ctat
B D                  Hedgehog  --ctgt
B D                  Elephant  --ct--
B D                   Manatee  ctct--
                     Aardvark  --ct--
             Star-nosed mole  ======
B D                     Shrew  ======
B D              Nile tilapia  ------
                 Zebra mbuna  ======
B D                 Tetraodon  ======
B D               Stickleback  ======
                 Spotted gar  ------
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                      Fugu  ------
B D                Coelacanth  ======
          Southern platyfish  ------
B D              Atlantic cod  ======
B D                    Medaka  ======
B D                 Zebrafish  ------
    Mexican tetra (cavefish)  ------
      Yellowbelly pufferfish  ------
B D             X. tropicalis  ======
B D           Tasmanian devil  ======
  D               Rock pigeon  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
  D                    Parrot  ======
  D    Spiny softshell turtle  ======
  D            Painted turtle  ======
               Big brown bat  ======
B D                    Lizard  ======
B D                   Megabat  ======
            Black flying-fox  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
  D              Saker falcon  ======
  D           Green seaturtle  ======
  D              Mallard duck  ======
B D                Budgerigar  ======
B D                    Turkey  ======
B D                   Chicken  ======
          Tibetan ground jay  ======
B D        American alligator  ======
B D                   Opossum  ======
B D                    Tenrec  ======
               Domestic goat  ======
  D          Peregrine falcon  ======
B D                 Armadillo  ======
         Cape elephant shrew  ======
            Cape golden mole  ======
              Golden hamster  ======
      Lesser Egyptian jerboa  ======
B D                Guinea pig  ======
B D                     Sheep  ======
            Tibetan antelope  ======
          Chinese tree shrew  ======
B D                    Gibbon  ======
B D                       Cow  ======
B D                       Pig  ======
B D                       Dog  ======

Inserts between block 18 and 19 in window
B D                 Elephant 2bp
B D                  Manatee 213bp
                    Aardvark 2bp

Alignment block 19 of 923 in window, 113666934 - 113666969, 36 bps 
B D                     Human  tattgataaacatttaagataccttaacagt--cattt-
B D                     Chimp  tattgataaacatttaagataccttaacagt--cattt-
B D                   Gorilla  tattgataaacatttaagataccttaacagt--cattt-
B D                 Orangutan  tattgataaatatttaagataccttaacagt--cattt-
B D                    Rhesus  tgttgataaacatttaagatatctt----gt--cattt-
B D       Crab-eating macaque  tgttgataaacatttaagatatctt----gt--cattt-
B D                    Baboon  tgttgataaacatttaagatatctt----gt--cattt-
B D              Green monkey  tgttgataaacatttaagatatctt----gt--ca--t-
B D                  Marmoset  tattgataaacatttaagatatcttaacagt--cattt-
B D           Squirrel monkey  tattgataaatatttaagatatcttaacagt--cattt-
B D                  Bushbaby  tattgattaaatattaaagtcacttaacaat--cattc-
B D                  Squirrel  tcctgataaacatttaagtta-cctaagagc--cattt-
                 Prairie vole  aactaagaaacatttaagctt-ttcactggc--tactt-
B D           Chinese hamster  tactaagaaccatttaagcta-ttcactggc--cactt-
B D                     Mouse  tactaagaagcattttagcta-cccactggt--cactt-
B D                       Rat  tatgaagaagcattttagcta-cccactggt--cactt-
B D            Naked mole-rat  tgctggtaaacatttgagcta-cttaatatc--tgcct-
                   Chinchilla  tactggtaaacatctgacctc-tttaatagt--cattt-
             Brush-tailed rat  tactggcaagcatttgacc-a-agtaatagc--cactt-
B D                    Rabbit  agctga-aaaca-ttgtgct-----aacaat--cactt-
B D                      Pika  aaatga-aaacatttgtgcta-tggaatagt--cattt-
B D                    Alpaca  tactgataaatatttaagctg-tgaaagaga--aattt-
               Bactrian camel  tactgataaatatttaagctg-tgaaagaga--aattt-
B D                   Dolphin  tactgataaatacgtaagcta-tgaaagagg--aattt-
                 Killer whale  tactgataaatacttaagcta-tgaaagagg--aattt-
B D                     Horse  taatgatacatatttaagctg-tgtaaaagg--cattc-
B D          White rhinoceros  tactgatacatatttaagctg-tgtaaaagg--tattt-
B D                       Cat  ta-tgataactatttaacc------aagagg--cattt-
B D                   Ferret   tactgacaactatttaatctg-tataagagg--cattt-
B D                     Panda  tactgacaactatttaagctg-tatcagagg--cattt-
               Pacific walrus  tactgacaact-tttaagctg-tataagagg--cattt-
                 Weddell seal  tactgacaact-cttaagctg-tataagagg--cattt-
         David's myotis (bat)  tactaataaatatttaagctg-tataagaag--cattt-
B D                  Microbat  tactaataaatatttaagctg-tataagagg--cattt-
B D                  Hedgehog  tactgacaa---tttaagtta-tggaagaga--cattt-
B D                  Elephant  tgccaataaacatttaagctg-tgta---gg--cttttt
B D                   Manatee  tactgacaaacatttaagctg-tgta---ggcacttttt
                     Aardvark  tactgataaacatttaagcag-tgta---gg--catttt
             Star-nosed mole  =======================================
B D                     Shrew  =======================================
B D              Nile tilapia  ---------------------------------------
                 Zebra mbuna  =======================================
B D                 Tetraodon  =======================================
B D               Stickleback  =======================================
                 Spotted gar  ---------------------------------------
         Pundamilia nyererei  =======================================
       Burton's mouthbreeder  =======================================
         Princess of Burundi  =======================================
B D                      Fugu  ---------------------------------------
B D                Coelacanth  =======================================
          Southern platyfish  ---------------------------------------
B D              Atlantic cod  =======================================
B D                    Medaka  =======================================
B D                 Zebrafish  ---------------------------------------
    Mexican tetra (cavefish)  ---------------------------------------
      Yellowbelly pufferfish  ---------------------------------------
B D             X. tropicalis  =======================================
B D           Tasmanian devil  =======================================
  D               Rock pigeon  =======================================
  D    White-throated sparrow  =======================================
  D             Scarlet macaw  =======================================
  D                    Parrot  =======================================
  D    Spiny softshell turtle  =======================================
  D            Painted turtle  =======================================
               Big brown bat  =======================================
B D                    Lizard  =======================================
B D                   Megabat  =======================================
            Black flying-fox  =======================================
B D               Zebra finch  =======================================
B D       Medium ground finch  =======================================
  D       Collared flycatcher  =======================================
  D  Chinese softshell turtle  =======================================
  D              Saker falcon  =======================================
  D           Green seaturtle  =======================================
  D              Mallard duck  =======================================
B D                Budgerigar  =======================================
B D                    Turkey  =======================================
B D                   Chicken  =======================================
          Tibetan ground jay  =======================================
B D        American alligator  =======================================
B D                   Opossum  =======================================
B D                    Tenrec  =======================================
               Domestic goat  =======================================
  D          Peregrine falcon  =======================================
B D                 Armadillo  =======================================
         Cape elephant shrew  =======================================
            Cape golden mole  =======================================
              Golden hamster  =======================================
      Lesser Egyptian jerboa  =======================================
B D                Guinea pig  =======================================
B D                     Sheep  =======================================
            Tibetan antelope  =======================================
          Chinese tree shrew  =======================================
B D                    Gibbon  =======================================
B D                       Cow  =======================================
B D                       Pig  =======================================
B D                       Dog  =======================================

Inserts between block 19 and 20 in window
                Prairie vole 185bp

Alignment block 20 of 923 in window, 113666970 - 113666991, 22 bps 
B D                     Human  ct-ggttttt-atccttcag-ctat
B D                     Chimp  ct-ggttttt-atccttcag-ctat
B D                   Gorilla  ct-ggttttt-atccttcag-ctat
B D                 Orangutan  ct-ggttttt-atcctttag-ctat
B D                    Rhesus  ct-gattttt-ctccttcag-ctat
B D       Crab-eating macaque  ct-gattttt-ctccttcag-ctat
B D                    Baboon  ct-gattttt-ctccttcag-ctat
B D              Green monkey  ct-gattttt-ctccttcag-ctat
B D                  Marmoset  ct-ggttttt-acccttcag-ccat
B D           Squirrel monkey  ct-ggttttt-attcttcag-ccat
B D                  Bushbaby  cg-g--tttt-attctctaa-ctat
B D                  Squirrel  ct-ggtttcc--ttctttgg-ctac
                 Prairie vole  ct-ggtttct--ttcttttg---ac
B D           Chinese hamster  at-ggtttct--ctcttttg---ac
B D                     Mouse  ca-attttct--ttcttttgactac
B D                       Rat  gt-ggtgtct--tccttttgactac
B D            Naked mole-rat  ct-ggttt-t--gtctttgg-ctat
                   Chinchilla  ct-agttt-t--gtctttgg-ctat
             Brush-tailed rat  ct-ggttt-t--atctttgg-ctat
B D                    Rabbit  ct-ggtcttt-gctctttgg-ctat
B D                      Pika  ct-gggttct-gctctttgg-ttgt
B D                    Alpaca  ca-gtttttt-atccttcag-ct--
               Bactrian camel  ca-gtttttt-attcttcag-tt--
B D                   Dolphin  cgtttttttt-attcttcag-cttt
                 Killer whale  cgtttttttt-attcttcag-cttt
B D                     Horse  ca-gtttttcaatgcttcag-ctat
B D          White rhinoceros  tg-gtatttt-attctccag-ctat
B D                       Cat  tg-gtttctt-attcttcag-ctat
B D                   Ferret   tg-ttttttt-attattcag-ctat
B D                     Panda  tg-gttcttt-atttttcag-ctat
               Pacific walrus  tg-ttttttt-atttttcag-ctat
                 Weddell seal  tg-ttttttt-atttttcag-ctat
         David's myotis (bat)  ca-gtttttt-attcttcag-ctat
B D                  Microbat  ca-gtttttt-attcttcag-ctat
B D                  Hedgehog  ca-attttt--atttttaat-ttat
B D                  Elephant  tt-ttttttc-acttttcag-ctgt
B D                   Manatee  tt-ttttttc-actcttcag-ctgt
                     Aardvark  ct-atttttc-actgttcag-ctat
             Star-nosed mole  =========================
B D                     Shrew  =========================
B D              Nile tilapia  -------------------------
                 Zebra mbuna  =========================
B D                 Tetraodon  =========================
B D               Stickleback  =========================
                 Spotted gar  -------------------------
         Pundamilia nyererei  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D                      Fugu  -------------------------
B D                Coelacanth  =========================
          Southern platyfish  -------------------------
B D              Atlantic cod  =========================
B D                    Medaka  =========================
B D                 Zebrafish  -------------------------
    Mexican tetra (cavefish)  -------------------------
      Yellowbelly pufferfish  -------------------------
B D             X. tropicalis  =========================
B D           Tasmanian devil  =========================
  D               Rock pigeon  =========================
  D    White-throated sparrow  =========================
  D             Scarlet macaw  =========================
  D                    Parrot  =========================
  D    Spiny softshell turtle  =========================
  D            Painted turtle  =========================
               Big brown bat  =========================
B D                    Lizard  =========================
B D                   Megabat  =========================
            Black flying-fox  =========================
B D               Zebra finch  =========================
B D       Medium ground finch  =========================
  D       Collared flycatcher  =========================
  D  Chinese softshell turtle  =========================
  D              Saker falcon  =========================
  D           Green seaturtle  =========================
  D              Mallard duck  =========================
B D                Budgerigar  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
          Tibetan ground jay  =========================
B D        American alligator  =========================
B D                   Opossum  =========================
B D                    Tenrec  =========================
               Domestic goat  =========================
  D          Peregrine falcon  =========================
B D                 Armadillo  =========================
         Cape elephant shrew  =========================
            Cape golden mole  =========================
              Golden hamster  =========================
      Lesser Egyptian jerboa  =========================
B D                Guinea pig  =========================
B D                     Sheep  =========================
            Tibetan antelope  =========================
          Chinese tree shrew  =========================
B D                    Gibbon  =========================
B D                       Cow  =========================
B D                       Pig  =========================
B D                       Dog  =========================

Inserts between block 20 and 21 in window
B D                 Hedgehog 451bp

Alignment block 21 of 923 in window, 113666992 - 113666992, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
B D                  Squirrel  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  g
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Elephant  t
B D                   Manatee  t
                     Aardvark  t
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
              Bactrian camel  -
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Gibbon  =
B D                    Alpaca  -
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =

Alignment block 22 of 923 in window, 113666993 - 113666993, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  g
                 Prairie vole  a
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  t
B D                      Pika  t
B D                   Dolphin  a
                 Killer whale  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
B D                   Manatee  a
                     Aardvark  a
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
              Bactrian camel  -
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
B D                    Alpaca  -
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =

Alignment block 23 of 923 in window, 113666994 - 113666995, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  aa
           Chinese tree shrew  aa
B D                  Squirrel  aa
                 Prairie vole  ag
B D           Chinese hamster  tg
B D                     Mouse  ag
B D                       Rat  ag
B D            Naked mole-rat  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  aa
B D                      Pika  ac
B D                   Dolphin  aa
                 Killer whale  aa
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  aa
B D                   Ferret   aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  aa
         David's myotis (bat)  aa
B D                  Microbat  aa
B D                  Elephant  aa
B D                   Manatee  aa
                     Aardvark  aa
             Star-nosed mole  ==
B D                     Shrew  ==
B D              Nile tilapia  --
                 Zebra mbuna  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
                 Spotted gar  --
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  --
B D                  Hedgehog  ==
B D                Coelacanth  ==
          Southern platyfish  --
B D              Atlantic cod  ==
B D                    Medaka  ==
B D                 Zebrafish  --
    Mexican tetra (cavefish)  --
      Yellowbelly pufferfish  --
B D             X. tropicalis  ==
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
               Big brown bat  ==
B D                    Lizard  ==
B D                   Megabat  ==
            Black flying-fox  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D        American alligator  ==
B D                   Opossum  ==
B D                    Tenrec  ==
               Domestic goat  ==
  D          Peregrine falcon  ==
B D                 Armadillo  ==
         Cape elephant shrew  ==
            Cape golden mole  ==
              Golden hamster  ==
              Bactrian camel  --
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                    Alpaca  --
B D                       Cow  ==
B D                       Pig  ==
B D                       Dog  ==

Inserts between block 23 and 24 in window
        David's myotis (bat) 40bp
B D                 Microbat 580bp

Alignment block 24 of 923 in window, 113666996 - 113667009, 14 bps 
B D                     Human  a-atgttgcaatgaa
B D                     Chimp  a-atgttgcaatgaa
B D                   Gorilla  a-atgttgcaatgaa
B D                 Orangutan  a-atgttgcaatgaa
B D                    Gibbon  a-atgttgcaatgaa
B D                    Rhesus  a-atgttgcaatgaa
B D       Crab-eating macaque  a-atgttgcaatgaa
B D                    Baboon  a-atgttgcgatgaa
B D              Green monkey  a-atgttgcaatgaa
B D                  Marmoset  a-atgttgcaatgaa
B D           Squirrel monkey  a-atgttgcaatgaa
B D                  Bushbaby  a-atgctacagtgac
           Chinese tree shrew  a-atgctgtagtgaa
B D                  Squirrel  caatgtggcagtaaa
                 Prairie vole  t-atgtggtcttgag
B D           Chinese hamster  c-atgtggtcttgaa
B D                     Mouse  c-atgtggttgcgat
B D                       Rat  c-atgtggtcatgaa
B D            Naked mole-rat  c-atgtggcaatgaa
                   Chinchilla  c-atgtgggaatgaa
             Brush-tailed rat  c-atgtagcagtgaa
B D                    Rabbit  g-acgtggcagtgac
B D                      Pika  c-atgtgggggtgaa
B D                    Alpaca  --atgttgcagtgaa
               Bactrian camel  --atgttgcagtaaa
B D                   Dolphin  a-atgttacagtgaa
                 Killer whale  a-atgttacagtgaa
B D                     Horse  a-atgttgcagtgaa
B D          White rhinoceros  a-atgttgcagtaaa
B D                       Cat  a-atattgcagtgaa
B D                   Ferret   a-atgttgcagtgaa
B D                     Panda  a-atgttgcagtgaa
               Pacific walrus  a-atgttacagtgaa
                 Weddell seal  a-atgttgcggtgaa
         David's myotis (bat)  a-atgttgcagtgca
B D                  Microbat  a-atgttgcagtgca
B D                  Elephant  a-atgttacagtgaa
B D                   Manatee  a-atgttacagtgaa
                     Aardvark  a-acattacagtgaa
             Star-nosed mole  ===============
B D                     Shrew  ===============
B D              Nile tilapia  ---------------
                 Zebra mbuna  ===============
B D                 Tetraodon  ===============
B D               Stickleback  ===============
                 Spotted gar  ---------------
         Pundamilia nyererei  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D                      Fugu  ---------------
B D                  Hedgehog  ===============
B D                Coelacanth  ===============
          Southern platyfish  ---------------
B D              Atlantic cod  ===============
B D                    Medaka  ===============
B D                 Zebrafish  ---------------
    Mexican tetra (cavefish)  ---------------
      Yellowbelly pufferfish  ---------------
B D             X. tropicalis  ===============
B D           Tasmanian devil  ===============
  D               Rock pigeon  ===============
  D    White-throated sparrow  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
  D    Spiny softshell turtle  ===============
  D            Painted turtle  ===============
               Big brown bat  ===============
B D                    Lizard  ===============
B D                   Megabat  ===============
            Black flying-fox  ===============
B D               Zebra finch  ===============
B D       Medium ground finch  ===============
  D       Collared flycatcher  ===============
  D  Chinese softshell turtle  ===============
  D              Saker falcon  ===============
  D           Green seaturtle  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
          Tibetan ground jay  ===============
B D        American alligator  ===============
B D                   Opossum  ===============
B D                    Tenrec  ===============
               Domestic goat  ===============
  D          Peregrine falcon  ===============
B D                 Armadillo  ===============
         Cape elephant shrew  ===============
            Cape golden mole  ===============
              Golden hamster  ===============
      Lesser Egyptian jerboa  ===============
B D                Guinea pig  ===============
B D                     Sheep  ===============
            Tibetan antelope  ===============
B D                       Cow  ===============
B D                       Pig  ===============
B D                       Dog  ===============

Alignment block 25 of 923 in window, 113667010 - 113667016, 7 bps 
B D                     Human  tatttaa
B D                     Chimp  tatttaa
B D                   Gorilla  tatttaa
B D                 Orangutan  tatttaa
B D                    Gibbon  tatttaa
B D                    Rhesus  tatttaa
B D       Crab-eating macaque  tatttaa
B D                    Baboon  tatttaa
B D              Green monkey  tatttaa
B D                  Marmoset  tatttaa
B D           Squirrel monkey  tatttaa
B D                  Bushbaby  tatttaa
           Chinese tree shrew  tgctagc
B D                  Squirrel  tatttaa
                 Prairie vole  ttactaa
B D           Chinese hamster  tgactaa
B D                     Mouse  tgactaa
B D                       Rat  tgactaa
B D            Naked mole-rat  tatttat
                   Chinchilla  tg---aa
             Brush-tailed rat  tatttaa
B D                    Rabbit  tgcttca
B D                      Pika  tgcttca
B D                    Alpaca  tatttaa
               Bactrian camel  tgtttaa
B D                   Dolphin  tgtttaa
                 Killer whale  tatttaa
B D                     Horse  tatttaa
B D          White rhinoceros  t-tttaa
B D                       Cat  tgtttaa
B D                   Ferret   tgtttaa
B D                     Panda  tgtttaa
               Pacific walrus  tgtttaa
                 Weddell seal  tgtttaa
         David's myotis (bat)  tgtttaa
B D                  Microbat  tgtttaa
B D                  Hedgehog  tatttaa
B D                  Elephant  tgtttaa
B D                   Manatee  tgtttaa
                     Aardvark  tgtttaa
             Star-nosed mole  =======
B D                     Shrew  =======
B D              Nile tilapia  -------
                 Zebra mbuna  =======
B D                 Tetraodon  =======
B D               Stickleback  =======
                 Spotted gar  -------
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                      Fugu  -------
B D                Coelacanth  =======
          Southern platyfish  -------
B D              Atlantic cod  =======
B D                    Medaka  =======
B D                 Zebrafish  -------
    Mexican tetra (cavefish)  -------
      Yellowbelly pufferfish  -------
B D             X. tropicalis  =======
B D           Tasmanian devil  =======
  D               Rock pigeon  =======
  D    White-throated sparrow  =======
  D             Scarlet macaw  =======
  D                    Parrot  =======
  D    Spiny softshell turtle  =======
  D            Painted turtle  =======
               Big brown bat  =======
B D                    Lizard  =======
B D                   Megabat  =======
            Black flying-fox  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
  D              Saker falcon  =======
  D           Green seaturtle  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
B D                    Turkey  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D        American alligator  =======
B D                   Opossum  =======
B D                    Tenrec  =======
               Domestic goat  =======
  D          Peregrine falcon  =======
B D                 Armadillo  =======
         Cape elephant shrew  =======
            Cape golden mole  =======
              Golden hamster  =======
      Lesser Egyptian jerboa  =======
B D                Guinea pig  =======
B D                     Sheep  =======
            Tibetan antelope  =======
B D                       Cow  =======
B D                       Pig  =======
B D                       Dog  =======

Alignment block 26 of 923 in window, 113667017 - 113667037, 21 bps 
B D                     Human  cctctactccaggatatatat
B D                     Chimp  cttctactccaggatatatat
B D                   Gorilla  cctctactccaggatatatat
B D                 Orangutan  cctctactccaggatatatat
B D                    Gibbon  cctctactccaggatatatat
B D                    Rhesus  cctctactccaggatatatat
B D       Crab-eating macaque  cctctactccaggatatatat
B D                    Baboon  cctctactccagcatatatat
B D              Green monkey  cctctactccaggatatatat
B D                  Marmoset  cctctactccaggatgtatat
B D           Squirrel monkey  cttctactccaggatatatat
B D                  Bushbaby  cttctactccagtatctttat
           Chinese tree shrew  cttctattctagcacatatat
B D                  Squirrel  tttctcctccagcatacatat
                 Prairie vole  cttctattccagt---cacag
B D           Chinese hamster  cttccaatctaatatgcatag
B D                     Mouse  tgtccactccaaagtgcatag
B D                       Rat  gttcctgtccaatgtgcacag
B D            Naked mole-rat  cttctccttcatcatgtatat
                   Chinchilla  cttctgcttcatcatgtacat
             Brush-tailed rat  cttctacttcatcaggtatat
B D                    Alpaca  gttctactccagtatgtatat
               Bactrian camel  gttctactccagtatgtatat
B D                   Dolphin  gctctac-ccagtatttatac
                 Killer whale  gctctac-ccagtatttatac
B D                     Horse  cttctcctccagtatgtatat
B D          White rhinoceros  cttctcctccagtatgtgtat
B D                       Cat  cttctattccagtatgcttat
B D                   Ferret   tttctattccagtatgtatat
B D                     Panda  tttctattccagtatgtatat
               Pacific walrus  tttctattccagtatgtatat
                 Weddell seal  tttctattccagtatgtatat
         David's myotis (bat)  ctcctactcccatgtgcacat
B D                  Microbat  ctcctactcccatgtgcacat
B D                  Hedgehog  attttattctactatgtagat
B D                  Elephant  ctcctactccagtatacagga
B D                   Manatee  cttctattccagtatatatga
                     Aardvark  cttctactccagtatatataa
             Star-nosed mole  =====================
B D                     Shrew  =====================
B D              Nile tilapia  ---------------------
                 Zebra mbuna  =====================
B D                 Tetraodon  =====================
B D               Stickleback  =====================
                 Spotted gar  ---------------------
         Pundamilia nyererei  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D                      Fugu  ---------------------
B D                Coelacanth  =====================
          Southern platyfish  ---------------------
B D              Atlantic cod  =====================
B D                    Medaka  =====================
B D                 Zebrafish  ---------------------
    Mexican tetra (cavefish)  ---------------------
      Yellowbelly pufferfish  ---------------------
B D             X. tropicalis  =====================
B D                      Pika  ---------------------
B D                    Rabbit  ---------------------
B D           Tasmanian devil  =====================
  D               Rock pigeon  =====================
  D    White-throated sparrow  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
  D    Spiny softshell turtle  =====================
  D            Painted turtle  =====================
               Big brown bat  =====================
B D                    Lizard  =====================
B D                   Megabat  =====================
            Black flying-fox  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D       Collared flycatcher  =====================
  D  Chinese softshell turtle  =====================
  D              Saker falcon  =====================
  D           Green seaturtle  =====================
  D              Mallard duck  =====================
B D                Budgerigar  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
          Tibetan ground jay  =====================
B D        American alligator  =====================
B D                   Opossum  =====================
B D                    Tenrec  =====================
               Domestic goat  =====================
  D          Peregrine falcon  =====================
B D                 Armadillo  =====================
         Cape elephant shrew  =====================
            Cape golden mole  =====================
              Golden hamster  =====================
      Lesser Egyptian jerboa  =====================
B D                Guinea pig  =====================
B D                     Sheep  =====================
            Tibetan antelope  =====================
B D                       Cow  =====================
B D                       Pig  =====================
B D                       Dog  =====================

Alignment block 27 of 923 in window, 113667038 - 113667051, 14 bps 
B D                     Human  tattagctatctct
B D                     Chimp  tattagctatctct
B D                   Gorilla  tattagctatctct
B D                 Orangutan  tattagctatctct
B D                    Gibbon  tattagctatctct
B D                    Rhesus  tattagctatctct
B D       Crab-eating macaque  tattagctatctct
B D                    Baboon  ttttagctatctct
B D              Green monkey  tattagctatctct
B D                  Marmoset  tattagctgtctct
B D           Squirrel monkey  tattagctatctct
B D                  Bushbaby  tattaaacatctcc
           Chinese tree shrew  tattaaatactttc
B D                  Squirrel  tacc-tatg-----
                 Prairie vole  tatt-gatatttcc
B D           Chinese hamster  tatt-aatatctcc
B D                     Mouse  tatt-aatatcgcc
B D                       Rat  tacg-tatgcggcc
B D            Naked mole-rat  tattaaataactcc
                   Chinchilla  tactaaataactta
             Brush-tailed rat  tattaaataactca
B D                    Alpaca  tattaaatatctcc
               Bactrian camel  tattaaatatctcc
B D                   Dolphin  tattaaatatctcc
                 Killer whale  tattaaatatctcc
B D                     Horse  tattaaagatctcc
B D          White rhinoceros  tattaaatatctcc
B D                       Cat  tattaaatatcccc
B D                   Ferret   tattaaatatcccc
B D                     Panda  tattaaatatcccc
               Pacific walrus  tattaaatatcccc
                 Weddell seal  tattaaatatccct
         David's myotis (bat)  tattaaatatctcc
B D                  Microbat  tattaaatatctcc
B D                  Hedgehog  tattaaacaccccc
B D                  Elephant  tgttaaatctcttc
B D                   Manatee  tgttaaatatctct
             Cape golden mole  tactaaacatctct
                     Aardvark  tgct-agtatctcc
             Star-nosed mole  ==============
B D                     Shrew  ==============
B D              Nile tilapia  --------------
                 Zebra mbuna  ==============
B D                 Tetraodon  ==============
B D               Stickleback  ==============
                 Spotted gar  --------------
         Pundamilia nyererei  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D                      Fugu  --------------
B D                Coelacanth  ==============
          Southern platyfish  --------------
B D              Atlantic cod  ==============
B D                    Medaka  ==============
B D                 Zebrafish  --------------
    Mexican tetra (cavefish)  --------------
      Yellowbelly pufferfish  --------------
B D             X. tropicalis  ==============
B D                      Pika  --------------
B D                    Rabbit  --------------
B D           Tasmanian devil  ==============
  D               Rock pigeon  ==============
  D    White-throated sparrow  ==============
  D             Scarlet macaw  ==============
  D                    Parrot  ==============
  D    Spiny softshell turtle  ==============
  D            Painted turtle  ==============
               Big brown bat  ==============
B D                    Lizard  ==============
B D                   Megabat  ==============
            Black flying-fox  ==============
B D               Zebra finch  ==============
B D       Medium ground finch  ==============
  D       Collared flycatcher  ==============
  D  Chinese softshell turtle  ==============
  D              Saker falcon  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D                Budgerigar  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
B D                    Tenrec  ==============
               Domestic goat  ==============
  D          Peregrine falcon  ==============
B D                 Armadillo  ==============
         Cape elephant shrew  ==============
              Golden hamster  ==============
      Lesser Egyptian jerboa  ==============
B D                Guinea pig  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
B D                       Cow  ==============
B D                       Pig  ==============
B D                       Dog  ==============

Inserts between block 27 and 28 in window
B D                 Marmoset 720bp
          Chinese tree shrew 3bp

Alignment block 28 of 923 in window, 113667052 - 113667066, 15 bps 
B D                     Human  ggtactttgta-gata
B D                     Chimp  ggtactttgta-gata
B D                   Gorilla  ggtactttgta-gata
B D                 Orangutan  ggtactttgta-gata
B D                    Gibbon  ggtactttgta-gata
B D                    Rhesus  agtactttgta-aata
B D       Crab-eating macaque  agtactttgta-aata
B D                    Baboon  agtactttgta-gata
B D              Green monkey  agtactttgta-gata
B D                  Bushbaby  aatgctctgca-gata
           Chinese tree shrew  ataactttatg-gata
B D                  Squirrel  -------gatt-gctc
                 Prairie vole  catcctttatt-tttc
B D           Chinese hamster  catccttcatt-tttc
B D                     Mouse  aggcctttatt-gctc
B D                       Rat  aggcctctatt-gctc
B D            Naked mole-rat  agtactttatg-tata
                   Chinchilla  agtactttatg-tata
             Brush-tailed rat  agtactttatg-tgta
B D                    Alpaca  agtatttgatc-aata
               Bactrian camel  agtatttgatc-aata
B D                   Dolphin  agtactttatctgata
                 Killer whale  agtactttatctgata
B D                     Horse  agtacgt-----atca
B D          White rhinoceros  agtactttatcaaata
B D                       Cat  agtactttatcagata
B D                   Ferret   agtactttctcagata
B D                     Panda  agtactttatcagaga
               Pacific walrus  agtactttatcagata
                 Weddell seal  agtactttatcagata
         David's myotis (bat)  agtactttatcagaca
B D                  Microbat  agtactttaccagaca
B D                  Hedgehog  agtacttaatcagata
B D                  Elephant  tgtacttgatcagata
B D                   Manatee  ggtacttgatcagata
             Cape golden mole  agcacttgatcagata
                     Aardvark  agtacttgagcagaca
             Star-nosed mole  ================
B D                     Shrew  ================
B D              Nile tilapia  ----------------
                 Zebra mbuna  ================
B D                 Tetraodon  ================
B D               Stickleback  ================
                 Spotted gar  ----------------
         Pundamilia nyererei  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D                      Fugu  ----------------
B D                Coelacanth  ================
          Southern platyfish  ----------------
B D              Atlantic cod  ================
B D                    Medaka  ================
B D                 Zebrafish  ----------------
    Mexican tetra (cavefish)  ----------------
      Yellowbelly pufferfish  ----------------
B D             X. tropicalis  ================
B D                      Pika  ----------------
B D                    Rabbit  ----------------
B D           Tasmanian devil  ================
  D               Rock pigeon  ================
  D    White-throated sparrow  ================
  D             Scarlet macaw  ================
  D                    Parrot  ================
  D    Spiny softshell turtle  ================
  D            Painted turtle  ================
               Big brown bat  ================
B D                    Lizard  ================
B D                   Megabat  ================
            Black flying-fox  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D       Collared flycatcher  ================
  D  Chinese softshell turtle  ================
  D              Saker falcon  ================
  D           Green seaturtle  ================
  D              Mallard duck  ================
B D                Budgerigar  ================
B D                    Turkey  ================
B D                   Chicken  ================
          Tibetan ground jay  ================
B D        American alligator  ================
B D                   Opossum  ================
B D                    Tenrec  ================
               Domestic goat  ================
  D          Peregrine falcon  ================
B D                 Armadillo  ================
         Cape elephant shrew  ================
              Golden hamster  ================
      Lesser Egyptian jerboa  ================
B D                Guinea pig  ================
B D                     Sheep  ================
            Tibetan antelope  ================
B D                       Cow  ================
B D                       Pig  ================
B D                       Dog  ================
B D           Squirrel monkey  ----------------
B D                  Marmoset  ================

Alignment block 29 of 923 in window, 113667067 - 113667104, 38 bps 
B D                     Human  actcttttcatgtaggaatcactgtgatt--tagtccttt
B D                     Chimp  actcttttcatgtaggaatcactgagatt--tagtccttt
B D                   Gorilla  actgttttcatgtaggaatcactgtgatt--tagtccttt
B D                 Orangutan  actcttttcatgtaggaatcactgtgatt--tagtccttt
B D                    Gibbon  actcttttcatgtaggaatcactgtgatt--tagtccttt
B D                    Rhesus  actgttttcatgtaggaatcactgtgatt--tagtccttt
B D       Crab-eating macaque  actgttttcatgtaggaatcactgtgatt--tagtccttt
B D                    Baboon  actgttttcatgtaggaatcactgtgatt--tagtccttt
B D              Green monkey  actgttttcatgtaggaatcactgtgatt--tagtccttt
B D                  Marmoset  actcttttcgtgtaggaaacactgtgatt--cagcccttt
B D           Squirrel monkey  actctttttgtgtaggaatcactgtgatt--tagtctttt
B D                  Bushbaby  gcactatccatctaggaatcattgtgatttatagcatctt
           Chinese tree shrew  gctcatttcatacagga---------att--tagcactct
B D                  Squirrel  tt----ttcatgtatgaatcactgtaatt--tagtgcttt
                 Prairie vole  tc-----tcatgtatccatcactgtgatt--tagaggctt
B D           Chinese hamster  tc-----taatgtatccattgctgcgact--tagtgcctt
B D                     Mouse  tc-----tcatgtagtcactgctgtgacg--aagtggttt
B D                       Rat  tc-------------tcactgttgtgact--tggtggttt
B D            Naked mole-rat  tctcatttcatgtgggaatcactataatt--taacgcttt
                   Chinchilla  tctcttttcatgtaggaatcactagaat------------
             Brush-tailed rat  tctcttttcatgtaggaatcactataaat--taatgtttt
B D                    Alpaca  gttgtcttcatgtaggagtca--gggatt--tagggcttt
               Bactrian camel  gttgtcttcatgtaggagtca--gtgatt--tagggcttt
B D                   Dolphin  gctctcttcatgtaggagtcg--gtgatt--tagggcttt
                 Killer whale  gctctcttcatgtaggagtcg--gtgatt--tagggcttt
B D                     Horse  gctcttttcacgttggagtca--gtgatt--tagggcttt
B D          White rhinoceros  gctcatttcatgtaggaatca--gtgact--tagggcttt
B D                       Cat  gtttttttcaggtaggaatca--gggatt--tagggcttt
B D                   Ferret   gctcttttcaggt-ggaatcg--gtgatt--cagggcttt
B D                     Panda  gctcttttcaggtaggaatca--gtgttt--tagggcttt
               Pacific walrus  gctcttttcaggtaggaatca--gtgatt--tagggcttt
                 Weddell seal  gctcttttcaggtaggaatca--gtgatt--tagggcttt
         David's myotis (bat)  actcttttcatgcaggaattg--gtgatc--tagtgcttt
B D                  Microbat  actcttttcatgcagaaattg--gtgatt--tagtgcttt
B D                  Hedgehog  gttctttccacacaggaatca--gt----------gctaa
B D                  Elephant  gctc--------------------tgcat--tggttcttt
B D                   Manatee  gctcttctaatgtaggaatcactgtgatt--tagttcttt
             Cape golden mole  gctcttccaatgtaggaatcactatgatt--tagttgttc
                     Aardvark  gctcttttaatgcaggaatcattgtggct--taacacttt
             Star-nosed mole  ========================================
B D                     Shrew  ========================================
B D              Nile tilapia  ----------------------------------------
                 Zebra mbuna  ========================================
B D                 Tetraodon  ========================================
B D               Stickleback  ========================================
                 Spotted gar  ----------------------------------------
         Pundamilia nyererei  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D                      Fugu  ----------------------------------------
B D                Coelacanth  ========================================
          Southern platyfish  ----------------------------------------
B D              Atlantic cod  ========================================
B D                    Medaka  ========================================
B D                 Zebrafish  ----------------------------------------
    Mexican tetra (cavefish)  ----------------------------------------
      Yellowbelly pufferfish  ----------------------------------------
B D             X. tropicalis  ========================================
B D                      Pika  ----------------------------------------
B D                    Rabbit  ----------------------------------------
B D           Tasmanian devil  ========================================
  D               Rock pigeon  ========================================
  D    White-throated sparrow  ========================================
  D             Scarlet macaw  ========================================
  D                    Parrot  ========================================
  D    Spiny softshell turtle  ========================================
  D            Painted turtle  ========================================
               Big brown bat  ========================================
B D                    Lizard  ========================================
B D                   Megabat  ========================================
            Black flying-fox  ========================================
B D               Zebra finch  ========================================
B D       Medium ground finch  ========================================
  D       Collared flycatcher  ========================================
  D  Chinese softshell turtle  ========================================
  D              Saker falcon  ========================================
  D           Green seaturtle  ========================================
  D              Mallard duck  ========================================
B D                Budgerigar  ========================================
B D                    Turkey  ========================================
B D                   Chicken  ========================================
          Tibetan ground jay  ========================================
B D        American alligator  ========================================
B D                   Opossum  ========================================
B D                    Tenrec  ========================================
               Domestic goat  ========================================
  D          Peregrine falcon  ========================================
B D                 Armadillo  ========================================
         Cape elephant shrew  ========================================
              Golden hamster  ========================================
      Lesser Egyptian jerboa  ========================================
B D                Guinea pig  ========================================
B D                     Sheep  ========================================
            Tibetan antelope  ========================================
B D                       Cow  ========================================
B D                       Pig  ========================================
B D                       Dog  ========================================

Inserts between block 29 and 30 in window
          Chinese tree shrew 2bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 2bp
              Pacific walrus 1bp
                Weddell seal 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp

Alignment block 30 of 923 in window, 113667105 - 113667105, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
         David's myotis (bat)  a
B D                  Microbat  g
B D                  Hedgehog  a
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  a
                     Aardvark  g
             Star-nosed mole  =
B D                     Shrew  =
B D              Nile tilapia  -
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  -
B D                Coelacanth  =
          Southern platyfish  -
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  -
    Mexican tetra (cavefish)  -
      Yellowbelly pufferfish  -
B D             X. tropicalis  =
B D                      Pika  -
B D                    Rabbit  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
               Big brown bat  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
  D          Peregrine falcon  =
B D                 Armadillo  =
         Cape elephant shrew  =
              Golden hamster  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  -
B D                Guinea pig  =
                  Chinchilla  -
B D                     Sheep  =
            Tibetan antelope  =
B D                       Cow  =
B D                       Pig  =
B D                       Dog  =

Inserts between block 30 and 31 in window
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp

Alignment block 31 of 923 in window, 113667106 - 113667122, 17 bps 
B D                     Human  tttggcaatttataatt
B D                     Chimp  tttggcaatttataatt
B D                   Gorilla  tttggcaatttataatt
B D                 Orangutan  tttggcaatttataatt
B D                    Gibbon  tttggcaatttataatt
B D                    Rhesus  tttagcaatttataatt
B D       Crab-eating macaque  tttggcaatttataatt
B D                    Baboon  tttggcaatttataatt
B D              Green monkey  tttggcaatttataatt
B D                  Marmoset  tttggcaatttataatt
B D           Squirrel monkey  tttggcaatttataatt
B D                  Bushbaby  ttaaccaagtcatagtt
           Chinese tree shrew  ttcagcaaattacactt
B D                  Squirrel  ttcaacaagcttcaatt
                 Prairie vole  ttgaataagcttcagtt
B D           Chinese hamster  ttcaataagcttcaatt
B D                     Mouse  ttctataaacttcagtt
B D                       Rat  ttctgtaagattcagtt
                   Chinchilla  ------agactatagtt
B D                    Alpaca  ttcagcaagttacaatt
               Bactrian camel  ttcagcaagttacaatt
B D                   Dolphin  ttcagcaagttacaatt
                 Killer whale  ttcagcaagttacaatt
B D                     Horse  ttcaataagttacaatt
B D          White rhinoceros  ttcagcaagttacaatt
B D                       Cat  ttcacaaaattgcaatt
B D                   Ferret   ttcacaaagttacaatt
B D                     Panda  ttcacaaagttacaagt
               Pacific walrus  ttcacaaagttacaatt
                 Weddell seal  ttcacaaagttacaatt
         David's myotis (bat)  ttcagcaagttacaatt
B D                  Microbat  ttcagcaagttacaatt
B D                  Hedgehog  atcagtgag-tgcaatt
B D                  Elephant  tttgacaa---------
B D                   Manatee  tttgacaagttacaatt
             Cape golden mole  tttgacaagttagaatt
                     Aardvark  tttgacaagctacaatt
             Star-nosed mole  =================
B D                     Shrew  =================
B D              Nile tilapia  -----------------
                 Zebra mbuna  =================
B D                 Tetraodon  =================
B D               Stickleback  =================
                 Spotted gar  -----------------
         Pundamilia nyererei  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D                      Fugu  -----------------
B D                Coelacanth  =================
          Southern platyfish  -----------------
B D              Atlantic cod  =================
B D                    Medaka  =================
B D                 Zebrafish  -----------------
    Mexican tetra (cavefish)  -----------------
      Yellowbelly pufferfish  -----------------
B D             X. tropicalis  =================
B D                      Pika  -----------------
B D                    Rabbit  -----------------
B D           Tasmanian devil  =================
  D               Rock pigeon  =================
  D    White-throated sparrow  =================
  D             Scarlet macaw  =================
  D                    Parrot  =================
  D    Spiny softshell turtle  =================
  D            Painted turtle  =================
               Big brown bat  =================
B D                    Lizard  =================
B D                   Megabat  =================
            Black flying-fox  =================
B D               Zebra finch  =================
B D       Medium ground finch  =================
  D       Collared flycatcher  =================
  D  Chinese softshell turtle  =================
  D              Saker falcon  =================
  D           Green seaturtle  =================
  D              Mallard duck  =================
B D                Budgerigar  =================
B D                    Turkey  =================
B D                   Chicken  =================
          Tibetan ground jay  =================
B D        American alligator  =================
B D                   Opossum  =================
B D                    Tenrec  =================
               Domestic goat  =================
  D          Peregrine falcon  =================
B D                 Armadillo  =================
         Cape elephant shrew  =================
              Golden hamster  =================
      Lesser Egyptian jerboa  =================
            Brush-tailed rat  -----------------
B D                Guinea pig  =================
B D            Naked mole-rat  -----------------
B D                     Sheep  =================
            Tibetan antelope  =================
B D                       Cow  =================
B D                       Pig  =================
B D                       Dog  =================

Alignment block 32 of 923 in window, 113667123 - 113667127, 5 bps 
B D                     Human  ctgag
B D                     Chimp  ctgag
B D                   Gorilla  ctgag
B D                 Orangutan  ctgag
B D                    Gibbon  ctgag
B D                    Rhesus  ctgag
B D       Crab-eating macaque  ctgag
B D                    Baboon  ctgag
B D              Green monkey  ctgag
B D                  Marmoset  ctgac
B D           Squirrel monkey  ctgag
B D                  Bushbaby  ctggg
           Chinese tree shrew  ctggg
B D                  Squirrel  ctgtg
                 Prairie vole  ctggg
B D           Chinese hamster  ttggg
B D                     Mouse  ctggg
B D                       Rat  ctggg
B D                    Alpaca  ttggg
               Bactrian camel  ttggg
B D                   Dolphin  ttggg
                 Killer whale  ttggg
B D                     Horse  caagg
B D          White rhinoceros  ctagg
B D                       Cat  ctggg
B D                   Ferret   ctggg
B D                     Panda  c----
               Pacific walrus  ctggg
                 Weddell seal  ctggg
         David's myotis (bat)  ttggg
B D                  Microbat  ctggg
B D                  Hedgehog  ctagg
B D                  Elephant  ---gg
B D                   Manatee  ctggg
             Cape golden mole  ctaga
                     Aardvark  cttgg
B D                   Opossum  ccaaa
             Star-nosed mole  =====
B D                     Shrew  =====
B D              Nile tilapia  -----
                 Zebra mbuna  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
                 Spotted gar  -----
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                      Fugu  -----
B D                Coelacanth  =====
          Southern platyfish  -----
B D              Atlantic cod  =====
B D                    Medaka  =====
B D                 Zebrafish  -----
    Mexican tetra (cavefish)  -----
      Yellowbelly pufferfish  -----
B D             X. tropicalis  =====
B D                      Pika  -----
B D                    Rabbit  -----
B D           Tasmanian devil  =====
  D               Rock pigeon  =====
  D    White-throated sparrow  =====
  D             Scarlet macaw  =====
  D                    Parrot  =====
  D    Spiny softshell turtle  =====
  D            Painted turtle  =====
               Big brown bat  =====
B D                    Lizard  =====
B D                   Megabat  =====
            Black flying-fox  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
  D              Saker falcon  =====
  D           Green seaturtle  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
B D                    Turkey  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D        American alligator  =====
B D                    Tenrec  =====
               Domestic goat  =====
  D          Peregrine falcon  =====
B D                 Armadillo  =====
         Cape elephant shrew  =====
              Golden hamster  =====
      Lesser Egyptian jerboa  =====
            Brush-tailed rat  -----
B D                Guinea pig  =====
B D            Naked mole-rat  -----
                  Chinchilla  -----
B D                     Sheep  =====
            Tibetan antelope  =====
B D                       Cow  =====
B D                       Pig  =====
B D                       Dog  =====

Alignment block 33 of 923 in window, 113667128 - 113667134, 7 bps 
B D                     Human  ttcttta-
B D                     Chimp  ttcttta-
B D                   Gorilla  ttcttta-
B D                 Orangutan  ttattta-
B D                    Gibbon  ttcttta-
B D                    Rhesus  ttctttg-
B D       Crab-eating macaque  ttctttg-
B D                    Baboon  ttctttg-
B D              Green monkey  ttatttg-
B D                  Marmoset  ttcctta-
B D           Squirrel monkey  ttcctta-
B D                  Bushbaby  ttcctta-
           Chinese tree shrew  tatttta-
B D                  Squirrel  ttcttca-
                 Prairie vole  ttcctcc-
B D           Chinese hamster  ttccttc-
B D                     Mouse  ttccttt-
B D                       Rat  -gccgtc-
B D                    Alpaca  ttcctta-
               Bactrian camel  ttcctta-
B D                   Dolphin  tcccttg-
                 Killer whale  tcccttg-
B D                       Cow  ttctttg-
B D                     Horse  ttcctta-
B D          White rhinoceros  ttcctta-
B D                       Cat  cttctta-
B D                   Ferret   tttctta-
               Pacific walrus  tttctta-
                 Weddell seal  tttctta-
         David's myotis (bat)  ttcctta-
B D                  Microbat  ttcctta-
B D                  Hedgehog  tttctta-
B D                  Elephant  ttcctta-
B D                   Manatee  ttcctaa-
             Cape golden mole  ttactta-
                     Aardvark  ctcctta-
B D                   Opossum  -attttaa
             Star-nosed mole  ========
B D                     Shrew  ========