Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1161 in window, 66767625 - 66767658, 34 bps 
B D                   Human  attagttcatgaaagtggagacctcatgactggg
B D                   Chimp  attagttcatgaaagtggagacctcatgactggg
B D                 Gorilla  attagttcgtgaaagtggagacctcatgactggg
B D               Orangutan  attagttcatgaaagtggagccctcatgactggg
B D                  Gibbon  attagttcatgaaagtggagccctcatgactggg
B D                Marmoset  attagttcttgaaagtggaaccctcatagttga-
B D         Squirrel monkey  attagttcatgaaagtggagccctcataattga-
B D          Naked mole-rat  attaggtttgaggagtggagtccttattgcaag-
B D                  Rabbit  ==================================
B D                   Shrew  ==================================
B D                    Pika  ==================================
B D                Hedgehog  ==================================
B D               Armadillo  ==================================
       Cape elephant shrew  ==================================
B D        White rhinoceros  ==================================
B D                   Panda  ==================================
            Golden hamster  ==================================
              Prairie vole  ==================================
B D                     Rat  ==================================
    Lesser Egyptian jerboa  ==================================
             Domestic goat  ==================================
B D                     Cow  ==================================
B D                   Sheep  ==================================
          Tibetan antelope  ==================================
      David's myotis (bat)  ==================================
             Big brown bat  ==================================
              Killer whale  ==================================
B D                  Alpaca  ==================================
           Star-nosed mole  ==================================
B D                Microbat  ==================================
B D                 Ferret   ==================================
B D                   Horse  ==================================
B D                Squirrel  ==================================
          Black flying-fox  ==================================
B D                     Cat  ==================================
B D                 Manatee  ==================================
B D                Elephant  ==================================
            Bactrian camel  ==================================
  D            Mallard duck  ==================================
  D             Rock pigeon  ==================================
B D                Platypus  ==================================
          Cape golden mole  ==================================
                  Aardvark  ==================================
B D                 Wallaby  ==================================
B D                 Opossum  ==================================
B D         Tasmanian devil  ==================================
  D         Green seaturtle  ==================================
B D                Bushbaby  ==================================
B D                     Dog  ==================================
            Pacific walrus  ==================================
          Brush-tailed rat  ==================================
B D            Green monkey  ==================================
B D     Crab-eating macaque  ==================================
B D                  Rhesus  ==================================
        Chinese tree shrew  ==================================
                Chinchilla  ==================================
B D                     Pig  ==================================
              Weddell seal  ==================================
B D                 Dolphin  ==================================
B D              Guinea pig  ==================================
B D                  Baboon  ==================================

Alignment block 2 of 1161 in window, 66767659 - 66767662, 4 bps 
B D                   Human  ---gctt
B D                   Chimp  ---gctt
B D                 Gorilla  ---gctt
B D               Orangutan  ---gctt
B D                  Gibbon  ---gctt
B D                  Baboon  ---gctt
B D                Marmoset  ----c--
B D         Squirrel monkey  ----c--
B D          Naked mole-rat  gatg---
B D                  Rabbit  =======
B D                   Shrew  =======
B D                    Pika  =======
B D                Hedgehog  =======
B D               Armadillo  =======
       Cape elephant shrew  =======
B D        White rhinoceros  =======
B D                   Panda  =======
            Golden hamster  =======
              Prairie vole  =======
B D                     Rat  =======
    Lesser Egyptian jerboa  =======
             Domestic goat  =======
B D                     Cow  =======
B D                   Sheep  =======
          Tibetan antelope  =======
      David's myotis (bat)  =======
             Big brown bat  =======
              Killer whale  =======
B D                  Alpaca  =======
           Star-nosed mole  =======
B D                Microbat  =======
B D                 Ferret   =======
B D                   Horse  =======
B D                Squirrel  =======
          Black flying-fox  =======
B D                     Cat  =======
B D                 Manatee  =======
B D                Elephant  =======
            Bactrian camel  =======
  D            Mallard duck  =======
  D             Rock pigeon  =======
B D                Platypus  =======
          Cape golden mole  =======
                  Aardvark  =======
B D                 Wallaby  =======
B D                 Opossum  =======
B D         Tasmanian devil  =======
  D         Green seaturtle  =======
B D                Bushbaby  =======
B D                     Dog  =======
            Pacific walrus  =======
          Brush-tailed rat  =======
B D            Green monkey  =======
B D     Crab-eating macaque  =======
B D                  Rhesus  =======
        Chinese tree shrew  =======
                Chinchilla  =======
B D                     Pig  =======
              Weddell seal  =======
B D                 Dolphin  =======
B D              Guinea pig  =======

Inserts between block 2 and 3 in window
B D                 Baboon 35bp

Alignment block 3 of 1161 in window, 66767663 - 66767697, 35 bps 
B D                   Human  gtaagtgcccttataagagactgcagagag---cctag
B D                   Chimp  gtaagtgcccttataagagactgcagagag---cctag
B D                 Gorilla  gtaagtgcccttataagagactgcagagag---cctag
B D               Orangutan  gtaagtgcccttataagagactgcagagag---cctag
B D                  Gibbon  ataagtgcacttgtaagagaccgcagagag---cctag
B D                Marmoset  attagagcccttataatagactgcagagag----ctag
B D         Squirrel monkey  atcagagcccttataatagactgcagagag----ctag
B D          Naked mole-rat  --gtgggctaagaaaagagactgctgagaggttactag
B D                  Rabbit  ======================================
B D                   Shrew  ======================================
B D                    Pika  ======================================
B D                Hedgehog  ======================================
B D               Armadillo  ======================================
       Cape elephant shrew  ======================================
B D        White rhinoceros  ======================================
B D                   Panda  ======================================
            Golden hamster  ======================================
              Prairie vole  ======================================
B D                     Rat  ======================================
    Lesser Egyptian jerboa  ======================================
             Domestic goat  ======================================
B D                     Cow  ======================================
B D                   Sheep  ======================================
          Tibetan antelope  ======================================
      David's myotis (bat)  ======================================
             Big brown bat  ======================================
              Killer whale  ======================================
B D                  Alpaca  ======================================
           Star-nosed mole  ======================================
B D                Microbat  ======================================
B D                 Ferret   ======================================
B D                   Horse  ======================================
B D                Squirrel  ======================================
          Black flying-fox  ======================================
B D                     Cat  ======================================
B D                 Manatee  ======================================
B D                Elephant  ======================================
            Bactrian camel  ======================================
  D            Mallard duck  ======================================
  D             Rock pigeon  ======================================
B D                Platypus  ======================================
          Cape golden mole  ======================================
                  Aardvark  ======================================
B D                 Wallaby  ======================================
B D                 Opossum  ======================================
B D         Tasmanian devil  ======================================
  D         Green seaturtle  ======================================
B D                Bushbaby  ======================================
B D                     Dog  ======================================
            Pacific walrus  ======================================
          Brush-tailed rat  ======================================
B D            Green monkey  ======================================
B D     Crab-eating macaque  ======================================
B D                  Rhesus  ======================================
        Chinese tree shrew  ======================================
                Chinchilla  ======================================
B D                     Pig  ======================================
              Weddell seal  ======================================
B D                 Dolphin  ======================================
B D              Guinea pig  ======================================
B D                  Baboon  ======================================

Alignment block 4 of 1161 in window, 66767698 - 66767714, 17 bps 
B D                   Human  cctgtctccccctccca
B D                   Chimp  cctgtctccccctccca
B D                 Gorilla  cctgtctccccctccca
B D               Orangutan  cccgtct-cccctccca
B D                  Gibbon  tctgtct-cccctccca
B D                  Baboon  cctgtcttccgctccca
B D                Marmoset  ccagtctccccctccca
B D         Squirrel monkey  tcagtctccccctccca
B D          Naked mole-rat  ------tcctcctgccc
B D                  Rabbit  =================
B D                   Shrew  =================
B D                    Pika  =================
B D                Hedgehog  =================
B D               Armadillo  =================
       Cape elephant shrew  =================
B D        White rhinoceros  =================
B D                   Panda  =================
            Golden hamster  =================
              Prairie vole  =================
B D                     Rat  =================
    Lesser Egyptian jerboa  =================
             Domestic goat  =================
B D                     Cow  =================
B D                   Sheep  =================
          Tibetan antelope  =================
      David's myotis (bat)  =================
             Big brown bat  =================
              Killer whale  =================
B D                  Alpaca  =================
           Star-nosed mole  =================
B D                Microbat  =================
B D                 Ferret   =================
B D                   Horse  =================
B D                Squirrel  =================
          Black flying-fox  =================
B D                     Cat  =================
B D                 Manatee  =================
B D                Elephant  =================
            Bactrian camel  =================
  D            Mallard duck  =================
  D             Rock pigeon  =================
B D                Platypus  =================
          Cape golden mole  =================
                  Aardvark  =================
B D                 Wallaby  =================
B D                 Opossum  =================
B D         Tasmanian devil  =================
  D         Green seaturtle  =================
B D                Bushbaby  =================
B D                     Dog  =================
            Pacific walrus  =================
          Brush-tailed rat  =================
B D            Green monkey  =================
B D     Crab-eating macaque  =================
B D                  Rhesus  =================
        Chinese tree shrew  =================
                Chinchilla  =================
B D                     Pig  =================
              Weddell seal  =================
B D                 Dolphin  =================
B D              Guinea pig  =================

Inserts between block 4 and 5 in window
B D                 Baboon 1296bp

Alignment block 5 of 1161 in window, 66767715 - 66767932, 218 bps 
B D                   Human  ccatgtgaggacacagggagaaggtatcttcattgaaccaccagacaccaacatctgttgacttcctgat
B D                   Chimp  ccatgtgaggacacagggagaaggtaccttcattgaaccatcagacaccaacatctcttgacttcctgat
B D                 Gorilla  ccatgtgaggacacagggagaaggtaccttcattgaaccaccagacaccaacatctgttgacttcctgat
B D               Orangutan  ccatgtgaggacacagagagaaggtaccttcattgaaccaccagacaccaacatctgttgacttcttgat
B D                  Gibbon  ccatgtgaggacacggggagaaggtaccttcattgaaccaccagacaccaacatctgttgacttcttgat
B D                Marmoset  gcacgtgaggacacagggagaaggtgccttcagtgaaccaccggacaccaacatctgttgactttttgat
B D         Squirrel monkey  ccacatgaggacacagggagaaggtaccttcagtgaaccactagacactaacatctgttgactttttgat
B D          Naked mole-rat  ccagccagggacacattg-taagacaccttcagtgaacc--cggaagcaagt--------ccttccagac
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
              Killer whale  ======================================================================
B D                  Alpaca  ======================================================================
           Star-nosed mole  ======================================================================
B D                Microbat  ======================================================================
B D                 Ferret   ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
          Black flying-fox  ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
            Bactrian camel  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D            Green monkey  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D                  Rhesus  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  ======================================================================
B D                 Dolphin  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  cttgaacttgccagcttcctgcactgtgagaaataaatttctgttttttataacctacc----cagttta
                      Chimp  cttgaacttgccagcttcctgcactgtgagaaataaatttctgttttttgtaacctacc----cagttta
                    Gorilla  cttgaacttgccagcttcctgcactgtgagaaataaatttctgttttttataacctacc----cagttta
                  Orangutan  cttgaacttgccagcttcctgaactgtgagaaataaatttctgttttttataacctacc----cagttta
                     Gibbon  cttgaacttgccagcttcctgaactgtgagaaataaatttctgttttttataacctacc----cagttta
                   Marmoset  ctttaacttgccagcctcctgaaccgtgagaaataaatt--tactttttatgacctacc----cagtttg
            Squirrel monkey  ctttaacttgccagcctcctgaactgtgagaaataaatttctgttttttataacctacc----cagttta
             Naked mole-rat  accaaagccgcca------------gtgagaaactaatttatgcagtttatgagctagctatgcagttta
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
           White rhinoceros  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
               Killer whale  ======================================================================
                     Alpaca  ======================================================================
            Star-nosed mole  ======================================================================
                   Microbat  ======================================================================
                    Ferret   ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
           Black flying-fox  ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
             Bactrian camel  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
               Green monkey  ======================================================================
        Crab-eating macaque  ======================================================================
                     Rhesus  ======================================================================
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
                        Pig  ======================================================================
               Weddell seal  ======================================================================
                    Dolphin  ======================================================================
                 Guinea pig  ======================================================================
                     Baboon  ======================================================================

                      Human  tggtattttgttactgcagccagaaggaactaagatgctggcttctatcagcataaagcctttgagattc
                      Chimp  tggtattttgttactgcagccagaaggaactaagatgctggcttctatcagcataaagcctttgagattc
                    Gorilla  tggtattttgttactgcagccagaaggaactaagattctggcttctatcagcataaagcctttgagattc
                  Orangutan  tggtattttgttactgcagccagaaggtactaaggtgctggtttctatcagcataaagcctctgagattc
                     Gibbon  tggtattttgttactgcagccagaaggaactaagatgctggcttctatcagcataaagcctttgagattc
                   Marmoset  tggtattttgttactacagccagaaggaactaagatgctggcttctttcagcacaaagcttttgagattc
            Squirrel monkey  tggtattttgttactgcagccagaaggaactaagatggtgacttctttcagcatcaagcttttgagattc
             Naked mole-rat  tggtgttttgttatagcagcccaaaggaagtaagattctggcttcactcagtggaaagcctttgagattc
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
           White rhinoceros  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
               Killer whale  ======================================================================
                     Alpaca  ======================================================================
            Star-nosed mole  ======================================================================
                   Microbat  ======================================================================
                    Ferret   ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
           Black flying-fox  ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
             Bactrian camel  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
               Green monkey  ======================================================================
        Crab-eating macaque  ======================================================================
                     Rhesus  ======================================================================
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
                        Pig  ======================================================================
               Weddell seal  ======================================================================
                    Dolphin  ======================================================================
                 Guinea pig  ======================================================================
                     Baboon  ======================================================================

                      Human  atcaaagttgtt
                      Chimp  atcaaagttgtt
                    Gorilla  atcaaagttgtt
                  Orangutan  gtcgaagttgtt
                     Gibbon  atcaaagttgtt
                   Marmoset  atcagcattgtt
            Squirrel monkey  atcaacattgtt
             Naked mole-rat  atccaagctgtt
                     Rabbit  ============
                      Shrew  ============
                       Pika  ============
                   Hedgehog  ============
                  Armadillo  ============
        Cape elephant shrew  ============
           White rhinoceros  ============
                      Panda  ============
             Golden hamster  ============
               Prairie vole  ============
                        Rat  ============
     Lesser Egyptian jerboa  ============
              Domestic goat  ============
                        Cow  ============
                      Sheep  ============
           Tibetan antelope  ============
       David's myotis (bat)  ============
              Big brown bat  ============
               Killer whale  ============
                     Alpaca  ============
            Star-nosed mole  ============
                   Microbat  ============
                    Ferret   ============
                      Horse  ============
                   Squirrel  ============
           Black flying-fox  ============
                        Cat  ============
                    Manatee  ============
                   Elephant  ============
             Bactrian camel  ============
               Mallard duck  ============
                Rock pigeon  ============
                   Platypus  ============
           Cape golden mole  ============
                   Aardvark  ============
                    Wallaby  ============
                    Opossum  ============
            Tasmanian devil  ============
            Green seaturtle  ============
                   Bushbaby  ============
                        Dog  ============
             Pacific walrus  ============
           Brush-tailed rat  ============
               Green monkey  ============
        Crab-eating macaque  ============
                     Rhesus  ============
         Chinese tree shrew  ============
                 Chinchilla  ============
                        Pig  ============
               Weddell seal  ============
                    Dolphin  ============
                 Guinea pig  ============
                     Baboon  ============

Alignment block 6 of 1161 in window, 66767933 - 66767934, 2 bps 
B D                   Human  gg-
B D                   Chimp  gg-
B D                 Gorilla  gg-
B D               Orangutan  gg-
B D                  Gibbon  gg-
B D                Marmoset  gg-
B D         Squirrel monkey  ga-
B D          Naked mole-rat  gg-
B D                  Alpaca  -gt
B D                  Rabbit  ===
B D                   Shrew  ===
B D                    Pika  ===
B D                Hedgehog  ===
B D               Armadillo  ===
       Cape elephant shrew  ===
B D        White rhinoceros  ===
B D                   Panda  ===
            Golden hamster  ===
              Prairie vole  ===
B D                     Rat  ===
    Lesser Egyptian jerboa  ===
             Domestic goat  ===
B D                     Cow  ===
B D                   Sheep  ===
          Tibetan antelope  ===
      David's myotis (bat)  ===
             Big brown bat  ===
              Killer whale  ===
           Star-nosed mole  ===
B D                Microbat  ===
B D                 Ferret   ===
B D                   Horse  ===
B D                Squirrel  ===
          Black flying-fox  ===
B D                     Cat  ===
B D                 Manatee  ===
B D                Elephant  ===
            Bactrian camel  ===
  D            Mallard duck  ===
  D             Rock pigeon  ===
B D                Platypus  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Wallaby  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
  D         Green seaturtle  ===
B D                Bushbaby  ===
B D                     Dog  ===
            Pacific walrus  ===
          Brush-tailed rat  ===
B D            Green monkey  ===
B D     Crab-eating macaque  ===
B D                  Rhesus  ===
        Chinese tree shrew  ===
                Chinchilla  ===
B D                     Pig  ===
              Weddell seal  ===
B D                 Dolphin  ===
B D              Guinea pig  ===
B D                  Baboon  ===

Alignment block 7 of 1161 in window, 66767935 - 66767946, 12 bps 
B D                   Human  gtgtactgatac
B D                   Chimp  gtgtactgatac
B D                 Gorilla  gtgtactgatac
B D               Orangutan  gtgtactgatac
B D                  Gibbon  gtgtactgatac
B D                Marmoset  gtgtattaatac
B D         Squirrel monkey  gtgtactaatac
B D          Naked mole-rat  atgcactcatac
B D                     Pig  gtgtagtgacac
B D                  Alpaca  gtgtggtgatat
B D                  Rabbit  ============
B D                   Shrew  ============
B D                    Pika  ============
B D                Hedgehog  ============
B D               Armadillo  ============
       Cape elephant shrew  ============
B D        White rhinoceros  ============
B D                   Panda  ============
            Golden hamster  ============
              Prairie vole  ============
B D                     Rat  ============
    Lesser Egyptian jerboa  ============
             Domestic goat  ============
B D                     Cow  ============
B D                   Sheep  ============
          Tibetan antelope  ============
      David's myotis (bat)  ============
             Big brown bat  ============
              Killer whale  ============
           Star-nosed mole  ============
B D                Microbat  ============
B D                 Ferret   ============
B D                   Horse  ============
B D                Squirrel  ============
          Black flying-fox  ============
B D                     Cat  ============
B D                 Manatee  ============
B D                Elephant  ============
            Bactrian camel  ============
  D            Mallard duck  ============
  D             Rock pigeon  ============
B D                Platypus  ============
          Cape golden mole  ============
                  Aardvark  ============
B D                 Wallaby  ============
B D                 Opossum  ============
B D         Tasmanian devil  ============
  D         Green seaturtle  ============
B D                Bushbaby  ============
B D                     Dog  ============
            Pacific walrus  ============
          Brush-tailed rat  ============
B D            Green monkey  ============
B D     Crab-eating macaque  ============
B D                  Rhesus  ============
        Chinese tree shrew  ============
                Chinchilla  ============
              Weddell seal  ============
B D                 Dolphin  ============
B D              Guinea pig  ============
B D                  Baboon  ============

Inserts between block 7 and 8 in window
B D         Naked mole-rat 1061bp

Alignment block 8 of 1161 in window, 66767947 - 66768128, 182 bps 
B D                   Human  c---tgttgttgttgttttcctgagtagcattctgttgtatg-----ggtgcaccatagtttgtttattc
B D                   Chimp  c---tgttgttgttgttttcctgagtagcattctgttgtatg-----ggtgcaccatagtttgtttattc
B D                 Gorilla  c---tgttgttgttgttttcctgagtagcattctgttgtatg-----ggtgcaccatagtttgtttattc
B D               Orangutan  ctgttgttgttgttgttttcctgagtagcattctgttgtatg-----gatgtaccatagtttgtttattc
B D                  Gibbon  ctgttgttcttattgttttcctgagtagcattctgttgtatg-----gatgtaccatagtttgtttattc
B D                Marmoset  ttgtcgtcgtcattgttttcctgggtgacattctgttgtatg-----gatgtaccatagtttatttgt--
B D         Squirrel monkey  ccgttgttgtcattgttttcccgggtggcattctgttgtatg-----gatgtaccatagtttatttgt--
B D                     Pig  -----ctcatggtgattttaatttgtatttctctgatggatgctgctgctgaacaaccttccatgtattt
B D                  Alpaca  -----cgcctggtcgctttaatttgcatttctctaatgaatggtgatggtgaacaacttttcatgtgctt
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
              Killer whale  ======================================================================
           Star-nosed mole  ======================================================================
B D                Microbat  ======================================================================
B D                 Ferret   ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
          Black flying-fox  ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
            Bactrian camel  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D            Green monkey  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D                  Rhesus  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D                 Dolphin  ======================================================================
B D              Guinea pig  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                  Baboon  ======================================================================

                      Human  attcacc-------cattgaaggatattttagttgtcattttttgtcat-c---------acaaatattg
                      Chimp  attcacc-------cattgaaggatattttagttgtcattttttgtcat-c---------acaaatattg
                    Gorilla  actcacc-------cattgaaggatattttagttgtcattttttgtcat-c---------acaaatattg
                  Orangutan  attcacc-------catcgaaggatattttggttgtcattttttgtcat-c---------acaaataatg
                     Gibbon  attcacc-------cattgaaggatattttagttgtcattttttgtcat-c---------acaaataatg
                   Marmoset  --tcacc-------cattgaaggatattttagttgtcaatttttgtcat-t---------acaaataatg
            Squirrel monkey  --tcacc-------cattgaaggatattttagttgtcattttttgtcat-c---------acaaataatg
                        Pig  aattaccactatgtagtcaagaactgtgactgacgtgagtttttaccct-cttacaagtaacaagttagc
                     Alpaca  gtttgcc---atgttgtcaagaactgtgaaggatgtgattttttaccttacttacaagt-acaagttagc
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
           White rhinoceros  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
               Killer whale  ======================================================================
            Star-nosed mole  ======================================================================
                   Microbat  ======================================================================
                    Ferret   ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
           Black flying-fox  ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
             Bactrian camel  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
               Green monkey  ======================================================================
        Crab-eating macaque  ======================================================================
                     Rhesus  ======================================================================
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                    Dolphin  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
                     Baboon  ======================================================================

                      Human  ctac--------tataaccgtttgc---------------------------gtatagaatttt--gtaa
                      Chimp  ctac--------tataaccgtttgt---------------------------gtatagaatttt--gtaa
                    Gorilla  ctac--------tgtaaccgtttgt---------------------------gtatagaatttt--gtaa
                  Orangutan  ctac--------tataattgtttgt---------------------------gtatagaatttt--gtaa
                     Gibbon  ctac--------tataactgtttgt---------------------------gtatggcatttt--gtaa
                   Marmoset  ctac--------tataactgtttgt---------------------------atacagaattttgagtaa
            Squirrel monkey  ctac--------tataactgtttat---------------------------gtacagaattttgagtaa
                        Pig  ctgc--cagtttcatgaatgttggcagaagttgtgagattctggagttaaagacaaaggacttt--atta
                     Alpaca  ctaccacagtttcatggatgctggcagaagtcatgagattctggagtcagagacaaagcacttt--gtta
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
           White rhinoceros  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
               Killer whale  ======================================================================
            Star-nosed mole  ======================================================================
                   Microbat  ======================================================================
                    Ferret   ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
           Black flying-fox  ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
             Bactrian camel  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
               Green monkey  ======================================================================
        Crab-eating macaque  ======================================================================
                     Rhesus  ======================================================================
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                    Dolphin  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
                     Baboon  ======================================================================

                      Human  ----------------atagcaatttttatt-tctc---------------------------tagagga
                      Chimp  ----------------atagcaatttttatt-tctc---------------------------tagagga
                    Gorilla  ----------------atagcaatttttatt-tctc---------------------------tagagga
                  Orangutan  ----------------atagcagtttttatt-tctc---------------------------tagagga
                     Gibbon  ----------------atagcagtttttatt-tctc---------------------------tagagga
                   Marmoset  ----------------atagcagtttttatt-tcac---------------------------tagagga
            Squirrel monkey  ----------------atagcagtttttatt-tcac---------------------------tagagga
                        Pig  ----------gtcaacaaaacaagtttcatc-tcacatgggctacccttgcccccaggtcccttagggct
                     Alpaca  ttcacaggacatcagtaaagcaatcttcatcttcacatgggctacccttgcccctaagtcacttgggact
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
           White rhinoceros  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
               Killer whale  ======================================================================
            Star-nosed mole  ======================================================================
                   Microbat  ======================================================================
                    Ferret   ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
           Black flying-fox  ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
             Bactrian camel  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
               Green monkey  ======================================================================
        Crab-eating macaque  ======================================================================
                     Rhesus  ======================================================================
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                    Dolphin  ======================================================================
                 Guinea pig  ======================================================================
             Naked mole-rat  ======================================================================
                     Baboon  ======================================================================

                      Human  aataccca
                      Chimp  aataccca
                    Gorilla  aataccca
                  Orangutan  aataccca
                     Gibbon  aatatcca
                   Marmoset  aataccca
            Squirrel monkey  aataccca
                        Pig  aatggca-
                     Alpaca  aatgtca-
                     Rabbit  ========
                      Shrew  ========
                       Pika  ========
                   Hedgehog  ========
                  Armadillo  ========
        Cape elephant shrew  ========
           White rhinoceros  ========
                      Panda  ========
             Golden hamster  ========
               Prairie vole  ========
                        Rat  ========
     Lesser Egyptian jerboa  ========
              Domestic goat  ========
                        Cow  ========
                      Sheep  ========
           Tibetan antelope  ========
       David's myotis (bat)  ========
              Big brown bat  ========
               Killer whale  ========
            Star-nosed mole  ========
                   Microbat  ========
                    Ferret   ========
                      Horse  ========
                   Squirrel  ========
           Black flying-fox  ========
                        Cat  ========
                    Manatee  ========
                   Elephant  ========
             Bactrian camel  ========
               Mallard duck  ========
                Rock pigeon  ========
                   Platypus  ========
           Cape golden mole  ========
                   Aardvark  ========
                    Wallaby  ========
                    Opossum  ========
            Tasmanian devil  ========
            Green seaturtle  ========
                   Bushbaby  ========
                        Dog  ========
             Pacific walrus  ========
           Brush-tailed rat  ========
               Green monkey  ========
        Crab-eating macaque  ========
                     Rhesus  ========
         Chinese tree shrew  ========
                 Chinchilla  ========
               Weddell seal  ========
                    Dolphin  ========
                 Guinea pig  ========
             Naked mole-rat  ========
                     Baboon  ========

Alignment block 9 of 1161 in window, 66768129 - 66768134, 6 bps 
B D                   Human  ----ggagag
B D                   Chimp  ----ggagag
B D                 Gorilla  ----ggagag
B D               Orangutan  ----ggagag
B D                  Gibbon  ----ggagag
B D                Marmoset  ----ggagag
B D         Squirrel monkey  ----ggagag
B D          Naked mole-rat  ----gaagag
B D                     Pig  ga--tgag--
B D                  Alpaca  caactgag--
B D                  Rabbit  ==========
B D                   Shrew  ==========
B D                    Pika  ==========
B D                Hedgehog  ==========
B D               Armadillo  ==========
       Cape elephant shrew  ==========
B D        White rhinoceros  ==========
B D                   Panda  ==========
            Golden hamster  ==========
              Prairie vole  ==========
B D                     Rat  ==========
    Lesser Egyptian jerboa  ==========
             Domestic goat  ==========
B D                     Cow  ==========
B D                   Sheep  ==========
          Tibetan antelope  ==========
      David's myotis (bat)  ==========
             Big brown bat  ==========
              Killer whale  ==========
           Star-nosed mole  ==========
B D                Microbat  ==========
B D                 Ferret   ==========
B D                   Horse  ==========
B D                Squirrel  ==========
          Black flying-fox  ==========
B D                     Cat  ==========
B D                 Manatee  ==========
B D                Elephant  ==========
            Bactrian camel  ==========
  D            Mallard duck  ==========
  D             Rock pigeon  ==========
B D                Platypus  ==========
          Cape golden mole  ==========
                  Aardvark  ==========
B D                 Wallaby  ==========
B D                 Opossum  ==========
B D         Tasmanian devil  ==========
  D         Green seaturtle  ==========
B D                Bushbaby  ==========
B D                     Dog  ==========
            Pacific walrus  ==========
          Brush-tailed rat  ==========
B D            Green monkey  ==========
B D     Crab-eating macaque  ==========
B D                  Rhesus  ==========
        Chinese tree shrew  ==========
                Chinchilla  ==========
              Weddell seal  ==========
B D                 Dolphin  ==========
B D              Guinea pig  ==========
B D                  Baboon  ==========

Inserts between block 9 and 10 in window
B D                    Pig 15bp
B D                 Alpaca 35bp

Alignment block 10 of 1161 in window, 66768135 - 66768135, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D          Naked mole-rat  a
B D                     Pig  g
B D                  Alpaca  g
             Bactrian camel  g
               Killer whale  g
B D                  Rabbit  =
B D                   Shrew  =
B D                    Pika  =
B D                Hedgehog  =
B D               Armadillo  =
       Cape elephant shrew  =
B D        White rhinoceros  =
B D                   Panda  =
            Golden hamster  =
              Prairie vole  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
             Domestic goat  =
B D                     Cow  =
B D                   Sheep  =
          Tibetan antelope  =
      David's myotis (bat)  =
             Big brown bat  =
           Star-nosed mole  =
B D                Microbat  =
B D                 Ferret   =
B D                   Horse  =
B D                Squirrel  =
          Black flying-fox  =
B D                     Cat  =
B D                 Manatee  =
B D                Elephant  =
  D            Mallard duck  =
  D             Rock pigeon  =
B D                Platypus  =
          Cape golden mole  =
                  Aardvark  =
B D                 Wallaby  =
B D                 Opossum  =
B D         Tasmanian devil  =
  D         Green seaturtle  =
B D                Bushbaby  =
B D                     Dog  =
            Pacific walrus  =
          Brush-tailed rat  =
B D            Green monkey  =
B D     Crab-eating macaque  =
B D                  Rhesus  =
        Chinese tree shrew  =
                Chinchilla  =
              Weddell seal  =
B D                 Dolphin  =
B D              Guinea pig  =
B D                  Baboon  =

Alignment block 11 of 1161 in window, 66768136 - 66768139, 4 bps 
B D                   Human  gatt
B D                   Chimp  gatt
B D                 Gorilla  gatt
B D               Orangutan  gatt
B D                  Gibbon  gatt
B D                Marmoset  gact
B D         Squirrel monkey  gatt
B D          Naked mole-rat  g---
B D                     Pig  agca
B D                  Alpaca  ggcc
             Bactrian camel  ggcc
               Killer whale  ggca
           Black flying-fox  gaca
B D                  Rabbit  ====
B D                   Shrew  ====
B D                    Pika  ====
B D                Hedgehog  ====
B D               Armadillo  ====
       Cape elephant shrew  ====
B D        White rhinoceros  ====
B D                   Panda  ====
            Golden hamster  ====
              Prairie vole  ====
B D                     Rat  ====
    Lesser Egyptian jerboa  ====
             Domestic goat  ====
B D                     Cow  ====
B D                   Sheep  ====
          Tibetan antelope  ====
      David's myotis (bat)  ====
             Big brown bat  ====
           Star-nosed mole  ====
B D                Microbat  ====
B D                 Ferret   ====
B D                   Horse  ====
B D                Squirrel  ====
B D                     Cat  ====
B D                 Manatee  ====
B D                Elephant  ====
  D            Mallard duck  ====
  D             Rock pigeon  ====
B D                Platypus  ====
          Cape golden mole  ====
                  Aardvark  ====
B D                 Wallaby  ====
B D                 Opossum  ====
B D         Tasmanian devil  ====
  D         Green seaturtle  ====
B D                Bushbaby  ====
B D                     Dog  ====
            Pacific walrus  ====
          Brush-tailed rat  ====
B D            Green monkey  ====
B D     Crab-eating macaque  ====
B D                  Rhesus  ====
        Chinese tree shrew  ====
                Chinchilla  ====
              Weddell seal  ====
B D                 Dolphin  ====
B D              Guinea pig  ====
B D                  Baboon  ====

Inserts between block 11 and 12 in window
B D        Squirrel monkey 660bp

Alignment block 12 of 1161 in window, 66768140 - 66768142, 3 bps 
B D                   Human  gca
B D                   Chimp  gca
B D                 Gorilla  gca
B D               Orangutan  gca
B D                  Gibbon  gca
B D            Green monkey  gca
B D                Marmoset  gca
B D         Squirrel monkey  gca
B D          Naked mole-rat  gca
B D                     Pig  gca
B D                  Alpaca  aca
             Bactrian camel  aca
               Killer whale  gct
B D                   Horse  gca
B D        White rhinoceros  gca
           Black flying-fox  gca
              Big brown bat  gca
B D                Microbat  gca
B D                  Rabbit  ===
B D                   Shrew  ===
B D                    Pika  ===
B D                Hedgehog  ===
B D               Armadillo  ===
       Cape elephant shrew  ===
B D                   Panda  ===
            Golden hamster  ===
              Prairie vole  ===
B D                     Rat  ===
    Lesser Egyptian jerboa  ===
             Domestic goat  ===
B D                     Cow  ===
B D                   Sheep  ===
          Tibetan antelope  ===
      David's myotis (bat)  ===
           Star-nosed mole  ===
B D                 Ferret   ===
B D                Squirrel  ===
B D                     Cat  ===
B D                 Manatee  ===
B D                Elephant  ===
  D            Mallard duck  ===
  D             Rock pigeon  ===
B D                Platypus  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Wallaby  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
  D         Green seaturtle  ===
B D                Bushbaby  ===
B D                     Dog  ===
            Pacific walrus  ===
          Brush-tailed rat  ===
B D     Crab-eating macaque  ===
B D                  Rhesus  ===
        Chinese tree shrew  ===
                Chinchilla  ===
              Weddell seal  ===
B D                 Dolphin  ===
B D              Guinea pig  ===
B D                  Baboon  ===

Inserts between block 12 and 13 in window
B D               Marmoset 740bp

Alignment block 13 of 1161 in window, 66768143 - 66768152, 10 bps 
B D                   Human  agcaaacgtt
B D                   Chimp  agcaaacgtt
B D                 Gorilla  agcaaacgtt
B D               Orangutan  aacaaacgtt
B D                  Gibbon  aacaaatgtt
B D            Green monkey  aacaaacgtt
B D         Squirrel monkey  aacaaacatt
B D          Naked mole-rat  gaaaaacctg
B D                     Pig  aacaaaccca
B D                  Alpaca  aacaaaccca
             Bactrian camel  aaccaaccca
B D                 Dolphin  aacaaaccca
               Killer whale  aacaaaccca
B D                   Horse  aacaaacctg
B D        White rhinoceros  gacaaacctg
           Black flying-fox  aagggacctg
              Big brown bat  aacagacctg
B D                Microbat  aacagacctg
B D                  Rabbit  ==========
B D                   Shrew  ==========
B D                    Pika  ==========
B D                Hedgehog  ==========
B D               Armadillo  ==========
       Cape elephant shrew  ==========
B D                   Panda  ==========
            Golden hamster  ==========
              Prairie vole  ==========
B D                     Rat  ==========
    Lesser Egyptian jerboa  ==========
             Domestic goat  ==========
B D                     Cow  ==========
B D                   Sheep  ==========
          Tibetan antelope  ==========
      David's myotis (bat)  ==========
           Star-nosed mole  ==========
B D                 Ferret   ==========
B D                Squirrel  ==========
B D                     Cat  ==========
B D                 Manatee  ==========
B D                Elephant  ==========
  D            Mallard duck  ==========
  D             Rock pigeon  ==========
B D                Platypus  ==========
          Cape golden mole  ==========
                  Aardvark  ==========
B D                 Wallaby  ==========
B D                 Opossum  ==========
B D         Tasmanian devil  ==========
  D         Green seaturtle  ==========
B D                Bushbaby  ==========
B D                     Dog  ==========
            Pacific walrus  ==========
          Brush-tailed rat  ==========
B D     Crab-eating macaque  ==========
B D                  Rhesus  ==========
        Chinese tree shrew  ==========
                Chinchilla  ==========
              Weddell seal  ==========
B D              Guinea pig  ==========
B D                Marmoset  ==========
B D                  Baboon  ==========

Alignment block 14 of 1161 in window, 66768153 - 66768288, 136 bps 
B D                   Human  tcaaacctttgatgtgaagggagac-attatatttactg--tac----tggacagttaacaaa-ttgtct
B D                   Chimp  tcaaacctttgatgtgaagggagac-attatatttactg--tac----tggacagttaacaaa-ttgtct
B D                 Gorilla  tcaaacctttgatgtgaagggagac-attatatttactg--tac----tggacagttaacaaa-ttgtct
B D               Orangutan  tcaaacctttgatgtgaagggagac-attatatttactg--tac----tggacacttaacaaa-ttgtct
B D                  Gibbon  tcaaacctttgatgtgaagggagac-gttgtatttacta--tac----tggacagttaacaaa-ttgtct
B D            Green monkey  tcaaacctttgatgtgaagggagac-attatatttactg--tac----tggacagttaacaaa-ttgtct
B D                Marmoset  tcaaacctttgatgtgaagggggac-attatatttactg--tac----tggacaactaacgtgcttgtct
B D         Squirrel monkey  tcaaacctttgatgtaaagggagac-attatgtttactc--tac----tggacagttaacaaacttgtct
B D          Naked mole-rat  ccagacctttgacacagaggtggac-atcatatttactacttac----cgtgaagtacacagacttgcct
B D                     Pig  cctgacttttgaaccagaggaaaat-attacatctcttt--tac----ttgacagtaaataaccttgcct
B D                  Alpaca  cctgacttttgacccagagggaaat-attttatctattg--tac----tgaacagtaaacaaacttgccc
             Bactrian camel  cctgacttttgacccagagggaaat-attttatctattg--tac----tgaatagtaaacaaacttgccc
B D                 Dolphin  cctgacttttgacctggagggaaac-attatatctattt--tac----ttgacagtaaacaaacttgccc
               Killer whale  cctgacttttgacctggagggaaac-attatatctattt--tac----ttgacagtaaacaaacttgccc
B D                   Horse  cctgacctttgacctggagtgaaacaattctatctgttg--ttt----gggacagtaagcaaacttgctc
B D        White rhinoceros  cctgacctttgacctgcagtgaaac-attatatctattg--tac----tggacagtagacaaacttgctc
           Black flying-fox  cttgacctttgacctggagggaaac-attgtgtctttta--tactctattgatagtaaacaaacttaccc
              Big brown bat  cctgacctttgacctggagggaaac-attg----tattt--tac----tggacagtacacaaacttgtcc
B D                Microbat  cctgacctttgacctggagggaaac-attgtatctattt--tac----tggacagtacacaaacttgtcc
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                Squirrel  ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D                  Rhesus  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  tctgctgtggaag----gag---------ctgtcgtctttctcttgtaaggatgtt-caatatacaaaca
                      Chimp  tctgctgtggaag----gag---------ctgtcgtctttctcttgtaaggatgtt-caatatacaaaca
                    Gorilla  tctgctgtggaag----gag---------ctgtcgtctttctcttgtaaggatgtt-caatatacaaaca
                  Orangutan  tctgctgtggaag----gag---------ctgtcatctttctcttgtaaggatgtt-cagtatacaagca
                     Gibbon  tctgctgtggaag----gag---------ctgtcatctttctcttgtaaggatgtt-caatatacaaaca
               Green monkey  tctgctgtggaag----gaa---------ctatcatctttctcttgtaaggatgtt-caatatacaaaca
                   Marmoset  tctgctatggaag----gag---------ctatcatctttgtcttgtaaggatgtt-caatataaaaaca
            Squirrel monkey  tctggtatggaag----gag---------ctatcatctttctcttgtaaggatgtc-cagtatacaaaca
             Naked mole-rat  tcctctctggcac----tag---------atactgtcttt-tcttgtaaggccgtt-tgacataccgaca
                        Pig  tctgccctagagg----gag--------atagtgatgtgttccttctgagaatgtt-agatatgcaaaca
                     Alpaca  tctgctctgaagg----gag--------atagtcatctgtttcttctgagagtgtt-aaatatgcagaca
             Bactrian camel  tctgctctgaagg----gag--------accgtcatctgtttcttctgagagtgtt-aaatatgcagaca
                    Dolphin  ttt-ctctggagg----gag--------acagtgatctgttcctcctgagaatgtt-agatatgcaaata
               Killer whale  ttt-ctctggagg----gag--------acagtgatctgttcctcctgagaatgtt-agatatgcaaata
                      Horse  tctgctctagagg----gag--------ataatcatctatgtcttctaagaatgtt-agatacgcaaaca
           White rhinoceros  tctgctctggagg----gag--------ataatcatctatttcttctaagaatgtt-agataagcaaaca
           Black flying-fox  tctgctctaggga----gagc-----------tt---tgtatattttaagaatggt-agatactccagca
              Big brown bat  tctgctggggtgg----gagtgggggagataatta--tgtttctttgaagaatgttaagatattcaagga
                   Microbat  tctgctggggtgggaatgagtaggggagataattatgtgtttcttttaagaatgttaagatattcaagga
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                    Ferret   ======================================================================
                   Squirrel  ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
        Crab-eating macaque  ======================================================================
                     Rhesus  ======================================================================
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                 Guinea pig  ======================================================================
                     Baboon  ======================================================================

                      Human  tccttgactgcacagtat
                      Chimp  tccttgactggacagtat
                    Gorilla  tccttgactggacagtat
                  Orangutan  tccttgactggacagtat
                     Gibbon  tccttgactggacagtat
               Green monkey  ttgttgactggacagtat
                   Marmoset  cccttgactgggcgatac
            Squirrel monkey  tccttgactgggcgatat
             Naked mole-rat  cccttga-gagacaatct
                        Pig  cccttgaagagatggtct
                     Alpaca  tccttgaag--atagtcc
             Bactrian camel  tccttgaag--atagtcc
                    Dolphin  tcctt------atagtct
               Killer whale  tccttgaagagatagtct
                      Horse  tgtgcaaagagatagtct
           White rhinoceros  tgcttaaagagatagtct
           Black flying-fox  tccttgaagagataatcc
              Big brown bat  tgc---------------
                   Microbat  tgc---------------
                     Rabbit  ==================
                      Shrew  ==================
                       Pika  ==================
                   Hedgehog  ==================
                  Armadillo  ==================
        Cape elephant shrew  ==================
                      Panda  ==================
             Golden hamster  ==================
               Prairie vole  ==================
                        Rat  ==================
     Lesser Egyptian jerboa  ==================
              Domestic goat  ==================
                        Cow  ==================
                      Sheep  ==================
           Tibetan antelope  ==================
       David's myotis (bat)  ==================
            Star-nosed mole  ==================
                    Ferret   ==================
                   Squirrel  ==================
                        Cat  ==================
                    Manatee  ==================
                   Elephant  ==================
               Mallard duck  ==================
                Rock pigeon  ==================
                   Platypus  ==================
           Cape golden mole  ==================
                   Aardvark  ==================
                    Wallaby  ==================
                    Opossum  ==================
            Tasmanian devil  ==================
            Green seaturtle  ==================
                   Bushbaby  ==================
                        Dog  ==================
             Pacific walrus  ==================
           Brush-tailed rat  ==================
        Crab-eating macaque  ==================
                     Rhesus  ==================
         Chinese tree shrew  ==================
                 Chinchilla  ==================
               Weddell seal  ==================
                 Guinea pig  ==================
                     Baboon  ==================

Alignment block 15 of 1161 in window, 66768289 - 66768364, 76 bps 
B D                   Human  gtagcaaaggcctctc--atggaaatgtgggaca-------------------ccagtgtatatatcttc
B D                   Chimp  gtagcaaaggcctctc--atggaaatgtgggaca-------------------ccagtgtatatatcttc
B D                 Gorilla  gtagcaaaggcctctc--atggaaatgtgggaca-------------------ccagtgtatatatcttc
B D               Orangutan  gtagcaaaggcctctt--aaggaaatgtgggaca-------------------ccagtgtatatatcttc
B D                  Gibbon  gtagcaaaggcctctc--atggaaatgtgggaca-------------------ccagtgtatatatcttc
B D     Crab-eating macaque  gtagcaaaggcctctc--acggaaatgtgtgaca-------------------ccagtgtgtctgtcttc
B D            Green monkey  gtagcaaaggcttctc--acggaaatgtgcgaca-------------------ccagtgtgtctgtcttc
B D                Marmoset  acagcaaaggcctctc--atggaaatgggggaca-------------------ccagtgtgtatatctgc
B D         Squirrel monkey  gtagcaaaggcctctt--atggaaatgtgggaca-------------------ccagtgtctatgtcttc
B D          Naked mole-rat  gtggcaaagactctta--acagagaagtgggata-------------------cgaacaagtacatcttc
B D                     Pig  gttgtaaaggccttgtgtacagaaatgtgagact-cctgtggagaattgtctcccagtgtgtatgtcttc
B D                  Alpaca  attac-aaggcctcttgttcagaaatgtgagaca-cccatgaagaattgtctcccagcatgtataccttc
             Bactrian camel  attac-aaggcctcttgttcagaaatgtgagaca-cccatgaagaattgtctcccagcatgtataccttc
B D                 Dolphin  gtcacgaaggcctcttgtacagaaatgtgagaca-cccgtggagaattgtctcccaatgtgtatatcttc
               Killer whale  gtcacgaaggcctcttgtacagaaatgtgagaca-cccgtggagaattgtctcccaatgtgtatatcttc
B D                   Horse  gttccaaaggcctgttgtaccgaaatgtgagtcc-cccgtggagaactgtctcccagtgtatatatcctc
B D        White rhinoceros  gttacaaagtcctgttgtacagaaatgtgaggcagggcatcgagaattgtctcccagtgtgtctatcttc
           Black flying-fox  gttgcaaaggcctcttgtattgaaatat-------------gagaattgtctcccaacttgtatatcttc
              Big brown bat  -ttgcaaagacctcttggacgaaactgt-------------gagaattgtcttccagcatgtatgttttc
B D                Microbat  -ttgcaaagacctcttggacgaaactgt-------------gagaattgtctcccagcatgtatgttttc
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                Squirrel  ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Rhesus  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  tttgttaaagtgtctgtt-gaggttttt
                      Chimp  tttgttaaagtgtctgtt-gaggttttt
                    Gorilla  tttgttaaagtgtctgtt-gaggttttt
                  Orangutan  tttgttaaagtgtctctt-gaggttgtt
                     Gibbon  cttgttaaagtgtctgtt-gaggttttt
        Crab-eating macaque  tttggtaaagtgtctgtt-gaggttttt
               Green monkey  tttggtaaagtgtctgtt-gaggttttt
                   Marmoset  tttactaaagtacctgtt-taggttttt
            Squirrel monkey  tttagtaaagtacctgtt-caggttttt
             Naked mole-rat  cttggtgaagtgtctgtt-caggtcttt
                        Pig  tttggataa--gtccgtt-cacgtcttt
                     Alpaca  tttggataagtgtctgtt-gaagtcttt
             Bactrian camel  tttggataagtgtctgtt-gaagtcttt
                    Dolphin  ttcgcataa--gtctgtt-caagtcttt
               Killer whale  tttgcataa--gtctgtt-caagtcttt
                      Horse  tttggttaagtttct-tt-gaagtcttt
           White rhinoceros  tttggataagggtct-ttaaaagtcttt
           Black flying-fox  tttagataagtgtct-tt-caagtcttt
              Big brown bat  tttagatcactctct-tt-caagtcttt
                   Microbat  tttagatcactctc--tt-caagtcttt
                     Rabbit  ============================
                      Shrew  ============================
                       Pika  ============================
                   Hedgehog  ============================
                  Armadillo  ============================
        Cape elephant shrew  ============================
                      Panda  ============================
             Golden hamster  ============================
               Prairie vole  ============================
                        Rat  ============================
     Lesser Egyptian jerboa  ============================
              Domestic goat  ============================
                        Cow  ============================
                      Sheep  ============================
           Tibetan antelope  ============================
       David's myotis (bat)  ============================
            Star-nosed mole  ============================
                    Ferret   ============================
                   Squirrel  ============================
                        Cat  ============================
                    Manatee  ============================
                   Elephant  ============================
               Mallard duck  ============================
                Rock pigeon  ============================
                   Platypus  ============================
           Cape golden mole  ============================
                   Aardvark  ============================
                    Wallaby  ============================
                    Opossum  ============================
            Tasmanian devil  ============================
            Green seaturtle  ============================
                   Bushbaby  ============================
                        Dog  ============================
             Pacific walrus  ============================
           Brush-tailed rat  ============================
                     Rhesus  ============================
         Chinese tree shrew  ============================
                 Chinchilla  ============================
               Weddell seal  ============================
                 Guinea pig  ============================
                     Baboon  ============================

Inserts between block 15 and 16 in window
B D                 Gibbon 908bp

Alignment block 16 of 1161 in window, 66768365 - 66768366, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D     Crab-eating macaque  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D          Naked mole-rat  tg
B D                     Pig  tg
B D                  Alpaca  tg
             Bactrian camel  tg
B D                 Dolphin  tg
               Killer whale  tg
B D                   Horse  tg
B D        White rhinoceros  tg
           Black flying-fox  tg
              Big brown bat  tg
B D                Microbat  cg
B D                  Rabbit  ==
B D                   Shrew  ==
B D                    Pika  ==
B D                Hedgehog  ==
B D               Armadillo  ==
       Cape elephant shrew  ==
B D                   Panda  ==
            Golden hamster  ==
              Prairie vole  ==
B D                     Rat  ==
    Lesser Egyptian jerboa  ==
             Domestic goat  ==
B D                     Cow  ==
B D                   Sheep  ==
          Tibetan antelope  ==
      David's myotis (bat)  ==
           Star-nosed mole  ==
B D                 Ferret   ==
B D                Squirrel  ==
B D                     Cat  ==
B D                 Manatee  ==
B D                Elephant  ==
  D            Mallard duck  ==
  D             Rock pigeon  ==
B D                Platypus  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Wallaby  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
  D         Green seaturtle  ==
B D                Bushbaby  ==
B D                     Dog  ==
            Pacific walrus  ==
          Brush-tailed rat  ==
B D                  Rhesus  ==
        Chinese tree shrew  ==
                Chinchilla  ==
              Weddell seal  ==
B D              Guinea pig  ==
B D                  Baboon  ==

Inserts between block 16 and 17 in window
B D         Naked mole-rat 151bp

Alignment block 17 of 1161 in window, 66768367 - 66768375, 9 bps 
B D                   Human  ctca---------------------------------------------------------ttttt
B D                   Chimp  ctca---------------------------------------------------------ttttt
B D                 Gorilla  ctca---------------------------------------------------------ttttt
B D               Orangutan  ctca---------------------------------------------------------ttttt
B D                  Gibbon  ctca---------------------------------------------------------ttttt
B D     Crab-eating macaque  ctca---------------------------------------------------------ttttt
B D            Green monkey  ctca---------------------------------------------------------ttttt
B D                Marmoset  ccca---------------------------------------------------------tttct
B D         Squirrel monkey  ccca---------------------------------------------------------ttttt
B D          Naked mole-rat  ctcagcctgtagaatgctaggattacaagtgtgtgccagcatccctggctttttgctaattttttt
B D                     Pig  ctca---------------------------------------------------------ttttt
B D                  Alpaca  tcca---------------------------------------------------------ttttt
             Bactrian camel  tcca---------------------------------------------------------ttttt
B D                 Dolphin  ccca--------------------------------------------------------tttttt
               Killer whale  ccca---------------------------------------------------------ttttt
B D                   Horse  ccaa---------------------------------------------------------ttttt
B D        White rhinoceros  ccca---------------------------------------------------------ttttt
           Black flying-fox  ccca--------------------------------------------------------tttttt
              Big brown bat  ccca---------------------------------------------------------ttttg
B D                Microbat  ccca---------------------------------------------------------ttttg
B D                  Rabbit  ==================================================================
B D                   Shrew  ==================================================================
B D                    Pika  ==================================================================
B D                Hedgehog  ==================================================================
B D               Armadillo  ==================================================================
       Cape elephant shrew  ==================================================================
B D                   Panda  ==================================================================
            Golden hamster  ==================================================================
              Prairie vole  ==================================================================
B D                     Rat  ==================================================================
    Lesser Egyptian jerboa  ==================================================================
             Domestic goat  ==================================================================
B D                     Cow  ==================================================================
B D                   Sheep  ==================================================================
          Tibetan antelope  ==================================================================
      David's myotis (bat)  ==================================================================
           Star-nosed mole  ==================================================================
B D                 Ferret   ==================================================================
B D                Squirrel  ==================================================================
B D                     Cat  ==================================================================
B D                 Manatee  ==================================================================
B D                Elephant  ==================================================================
  D            Mallard duck  ==================================================================
  D             Rock pigeon  ==================================================================
B D                Platypus  ==================================================================
          Cape golden mole  ==================================================================
                  Aardvark  ==================================================================
B D                 Wallaby  ==================================================================
B D                 Opossum  ==================================================================
B D         Tasmanian devil  ==================================================================
  D         Green seaturtle  ==================================================================
B D                Bushbaby  ==================================================================
B D                     Dog  ==================================================================
            Pacific walrus  ==================================================================
          Brush-tailed rat  ==================================================================
B D                  Rhesus  ==================================================================
        Chinese tree shrew  ==================================================================
                Chinchilla  ==================================================================
              Weddell seal  ==================================================================
B D              Guinea pig  ==================================================================
B D                  Baboon  ==================================================================

Inserts between block 17 and 18 in window
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
B D                  Horse 1bp
B D       White rhinoceros 234bp

Alignment block 18 of 1161 in window, 66768376 - 66768462, 87 bps 
B D                   Human  aaattgggt----gg-tttgttttctgacatctgagttttgagagttctt-t-atacattctgggtatgt
B D                   Chimp  aaattgggt----gg-tttgttttctgacatctgagttttgagagttctt-t-atacattctgggtatgt
B D                 Gorilla  aaattgggt----gg-tttgttttctgacaactgagttttgagagttctt-t-atacattctgggtatgt
B D               Orangutan  aaattgggt----gg-tttgttttttgacaactgagttttgagagttctt-t-atacattctgggtatgt
B D                  Gibbon  aaattgggt----gg-tttgttttctgacaactgagttttgagagttctt-t-atacattctgggtatgt
B D     Crab-eating macaque  aagttgggt----gt-tttgttttctgacaactgagttttgagagttctt-t-atacattctgggtatgt
B D            Green monkey  aagttgggt----gt-tttgttttctgacaactgagttttgagagttctt-t-atacattctgggtatgt
B D                Marmoset  aaattggat----gg-tttgttttcttacaactgaattttgagagtgctt-t-atacattctggacatat
B D         Squirrel monkey  aaattgggt----gg-tttgttttcttacaactgaattttgagagtgctt-t-atacattctggacatgt
B D          Naked mole-rat  ttatttggt----gg-tttgttttcttacagctgagtcttgaaagtcttt-taatatgttctggttatgt
B D                     Pig  atattgagt----gg-t---tttcctttctattgagttatgagaattctt-t-ctatattctag--atgc
B D                  Alpaca  aaactgggt----gg-t---ttttctttctgttgagttttgataatactt-t-atatattctgg--atgc
             Bactrian camel  aaactgggt----gg-t---ttttctttctgttgagttttgataatactt-t-atatattctgg--atgc
B D                 Dolphin  taattgggt----gg-t---ttttctttctgttgagttttgagaattctt-t-atatattctgg--atgc
               Killer whale  taattgggt----gg-t---ttttctttctgttgagttttgagaattctt-t-atatattctgg--atgc
B D                   Horse  taattgggt----gg-t---ttttctcactattgtgatttgaggattcct-t-atgtattctga--atac
B D        White rhinoceros  aaattgagttttgag-a---attacttactattgagttttgagaattctt-t-atatattctgg--atac
           Black flying-fox  taattgggt----ggtt---tttttttattgttgacttttgagtgttctt-t-atatattctag--atac
              Big brown bat  taattggtt----gg-t---ttttcttacggttgatttttgagcattttaaa-atataatctag--atac
B D                Microbat  taattgggt----gg-t---ttttcttagtgttgatttttgagcatttttaa-at--------------c
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                Squirrel  ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Rhesus  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  aagttctttgccaaatatgtgatt
                      Chimp  aagttctttgccaaatatgtgatt
                    Gorilla  aagttctttgccaaatatgtgatt
                  Orangutan  aagttctttgccaaatatgtgatt
                     Gibbon  aagttctttgccaaatatgtgatt
        Crab-eating macaque  aagttctttgccaaattggtgatt
               Green monkey  aagttctttgccaaattggtgatt
                   Marmoset  gagttctttgccaaatatgtgatt
            Squirrel monkey  gaattctttgccaaatatgtgatt
             Naked mole-rat  aagttctttgtcaagtatgtgact
                        Pig  aagt-ctttgtcacatcaatgatt
                     Alpaca  aagtcctttgtcaaatatatggtt
             Bactrian camel  aagtcctttgtcaaatacatggtt
                    Dolphin  aagtcctttgtcagatatatgatt
               Killer whale  aagtcctttgtcagatatatgatt
                      Horse  aagtcctttgtgaaatatg--att
           White rhinoceros  aagtcgtttgtcaaatatg--att
           Black flying-fox  atgtccttggtcaaatatgt-gat
              Big brown bat  aggtcctttgttaaatttgt-gat
                   Microbat  tggtcatttgttaaatttgt-gat
                     Rabbit  ========================
                      Shrew  ========================
                       Pika  ========================
                   Hedgehog  ========================
                  Armadillo  ========================
        Cape elephant shrew  ========================
                      Panda  ========================
             Golden hamster  ========================
               Prairie vole  ========================
                        Rat  ========================
     Lesser Egyptian jerboa  ========================
              Domestic goat  ========================
                        Cow  ========================
                      Sheep  ========================
           Tibetan antelope  ========================
       David's myotis (bat)  ========================
            Star-nosed mole  ========================
                    Ferret   ========================
                   Squirrel  ========================
                        Cat  ========================
                    Manatee  ========================
                   Elephant  ========================
               Mallard duck  ========================
                Rock pigeon  ========================
                   Platypus  ========================
           Cape golden mole  ========================
                   Aardvark  ========================
                    Wallaby  ========================
                    Opossum  ========================
            Tasmanian devil  ========================
            Green seaturtle  ========================
                   Bushbaby  ========================
                        Dog  ========================
             Pacific walrus  ========================
           Brush-tailed rat  ========================
                     Rhesus  ========================
         Chinese tree shrew  ========================
                 Chinchilla  ========================
               Weddell seal  ========================
                 Guinea pig  ========================
                     Baboon  ========================

Alignment block 19 of 1161 in window, 66768463 - 66768465, 3 bps 
B D                   Human  tgc
B D                   Chimp  tgc
B D                 Gorilla  tgc
B D               Orangutan  tgc
B D                  Gibbon  tgc
B D     Crab-eating macaque  tgc
B D                  Baboon  tgc
B D            Green monkey  tgc
B D                Marmoset  tgc
B D         Squirrel monkey  tgc
B D          Naked mole-rat  ttc
B D                  Rabbit  ===
B D                   Shrew  ===
B D                    Pika  ===
B D                Hedgehog  ===
B D               Armadillo  ===
       Cape elephant shrew  ===
B D        White rhinoceros  ---
B D                   Panda  ===
            Golden hamster  ===
              Prairie vole  ===
B D                     Rat  ===
    Lesser Egyptian jerboa  ===
             Domestic goat  ===
B D                     Cow  ===
B D                   Sheep  ===
          Tibetan antelope  ===
      David's myotis (bat)  ===
             Big brown bat  ---
              Killer whale  ---
B D                  Alpaca  ---
           Star-nosed mole  ===
B D                Microbat  ---
B D                 Ferret   ===
B D                   Horse  ---
B D                Squirrel  ===
          Black flying-fox  ---
B D                     Cat  ===
B D                 Manatee  ===
B D                Elephant  ===
            Bactrian camel  ---
  D            Mallard duck  ===
  D             Rock pigeon  ===
B D                Platypus  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Wallaby  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
  D         Green seaturtle  ===
B D                Bushbaby  ===
B D                     Dog  ===
            Pacific walrus  ===
          Brush-tailed rat  ===
B D                  Rhesus  ===
        Chinese tree shrew  ===
                Chinchilla  ===
B D                     Pig  ---
              Weddell seal  ===
B D                 Dolphin  ---
B D              Guinea pig  ===

Inserts between block 19 and 20 in window
B D                 Baboon 202bp

Alignment block 20 of 1161 in window, 66768466 - 66768501, 36 bps 
B D                   Human  tgcaagtagtttctccc-attc-------tgtagctt-----------gtctttt
B D                   Chimp  tgcaagtagtttctccc-attc-------tgtagctt-----------gtctttt
B D                 Gorilla  tgcaagtagtttctccc-attc-------tgtagctt-----------gtctttt
B D               Orangutan  tgcaagtagtttctccc-attc-tgta--tgtagctt-----------gtctttt
B D                  Gibbon  tgcaagtagtttctccc-attc-------tgtagctt-----------gtctttt
B D     Crab-eating macaque  tgcaagtatgttctccc-attcctgtacttgtagctt-----------gtctttt
B D            Green monkey  tgcaagtatgttctccc-attc-------tgtagctt-----------gtctttt
B D                Marmoset  ----aatattttctccc-aaac-------tgtagctt-----------gtctttt
B D         Squirrel monkey  ----aatattttctccc-gttc-------tatagctt-----------gtc--tt
B D          Naked mole-rat  ---aagtattttctccc-agtc-------tgtacttt-----------gtctttt
B D                     Pig  tgcaagtattttctccc-agtc--------gtaattt-----------gtctttt
B D                  Alpaca  tgcaagtattttctccctagtc-------tgtagttt-----------gtctttt
             Bactrian camel  tgcaagtattttctccctagtc-------tgtagttt-----------gtctttt
B D                 Dolphin  tgcgagtattttctccc-agtc-------tgtagttt-----------gtgtttt
               Killer whale  tgcgagtattttctccc-agtc-------tgtagttt-----------gtgtttt
B D                   Horse  tgcaaatattttctcct-ggtc-------tgtagttt-----------atctttt
B D        White rhinoceros  tgcaagtattttcttcc-agtc-------tgtagttt-----------gcctttt
           Black flying-fox  tgcaagtattttctccc-agtt-------tgtagttttgttgttgttgttgtttt
              Big brown bat  tgcatgtattttctccc-agtc-------tgtagttt-----------gtctttt
B D                Microbat  tgcatgtattttctccc-agtc-------tgtagttt-----------gtctttt
B D                  Rabbit  =======================================================
B D                   Shrew  =======================================================
B D                    Pika  =======================================================
B D                Hedgehog  =======================================================
B D               Armadillo  =======================================================
       Cape elephant shrew  =======================================================
B D                   Panda  =======================================================
            Golden hamster  =======================================================
              Prairie vole  =======================================================
B D                     Rat  =======================================================
    Lesser Egyptian jerboa  =======================================================
             Domestic goat  =======================================================
B D                     Cow  =======================================================
B D                   Sheep  =======================================================
          Tibetan antelope  =======================================================
      David's myotis (bat)  =======================================================
           Star-nosed mole  =======================================================
B D                 Ferret   =======================================================
B D                Squirrel  =======================================================
B D                     Cat  =======================================================
B D                 Manatee  =======================================================
B D                Elephant  =======================================================
  D            Mallard duck  =======================================================
  D             Rock pigeon  =======================================================
B D                Platypus  =======================================================
          Cape golden mole  =======================================================
                  Aardvark  =======================================================
B D                 Wallaby  =======================================================
B D                 Opossum  =======================================================
B D         Tasmanian devil  =======================================================
  D         Green seaturtle  =======================================================
B D                Bushbaby  =======================================================
B D                     Dog  =======================================================
            Pacific walrus  =======================================================
          Brush-tailed rat  =======================================================
B D                  Rhesus  =======================================================
        Chinese tree shrew  =======================================================
                Chinchilla  =======================================================
              Weddell seal  =======================================================
B D              Guinea pig  =======================================================
B D                  Baboon  =======================================================

Inserts between block 20 and 21 in window
B D         Naked mole-rat 18bp

Alignment block 21 of 1161 in window, 66768502 - 66768509, 8 bps 
B D                   Human  tgttttct
B D                   Chimp  tgttttct
B D                 Gorilla  tgttttct
B D               Orangutan  tgttttct
B D                  Gibbon  tgttttct
B D            Green monkey  tattttct
B D                Marmoset  cattttat
B D         Squirrel monkey  cattttat
B D          Naked mole-rat  tttttttt
B D                     Pig  cattttcc
B D                  Alpaca  cattttcc
             Bactrian camel  cattttcc
B D                 Dolphin  cattttcc
               Killer whale  cattttcc
B D                   Horse  cattttct
B D        White rhinoceros  cattttct
           Black flying-fox  cattttat
              Big brown bat  ccttttct
B D                Microbat  cattttct
B D                  Rabbit  ========
B D                   Shrew  ========
B D                    Pika  ========
B D                Hedgehog  ========
B D               Armadillo  ========
       Cape elephant shrew  ========
B D                   Panda  ========
            Golden hamster  ========
              Prairie vole  ========
B D                     Rat  ========
    Lesser Egyptian jerboa  ========
             Domestic goat  ========
B D                     Cow  ========
B D                   Sheep  ========
          Tibetan antelope  ========
      David's myotis (bat)  ========
           Star-nosed mole  ========
B D                 Ferret   ========
B D                Squirrel  ========
B D                     Cat  ========
B D                 Manatee  ========
B D                Elephant  ========
  D            Mallard duck  ========
  D             Rock pigeon  ========
B D                Platypus  ========
          Cape golden mole  ========
                  Aardvark  ========
B D                 Wallaby  ========
B D                 Opossum  ========
B D         Tasmanian devil  ========
  D         Green seaturtle  ========
B D                Bushbaby  ========
B D                     Dog  ========
            Pacific walrus  ========
          Brush-tailed rat  ========
B D     Crab-eating macaque  NNNNNNNN
B D                  Rhesus  ========
        Chinese tree shrew  ========
                Chinchilla  ========
              Weddell seal  ========
B D              Guinea pig  ========
B D                  Baboon  ========

Inserts between block 21 and 22 in window
B D         Naked mole-rat 10bp

Alignment block 22 of 1161 in window, 66768510 - 66768510, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  g
B D          Naked mole-rat  a
B D                     Pig  t
B D                 Dolphin  a
               Killer whale  a
B D                  Rabbit  =
B D                   Shrew  =
B D                    Pika  =
B D                Hedgehog  =
B D               Armadillo  =
       Cape elephant shrew  =
B D        White rhinoceros  -
B D                   Panda  =
            Golden hamster  =
              Prairie vole  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
             Domestic goat  =
B D                     Cow  =
B D                   Sheep  =
          Tibetan antelope  =
      David's myotis (bat)  =
             Big brown bat  -
B D                  Alpaca  -
           Star-nosed mole  =
B D                Microbat  -
B D                 Ferret   =
B D                   Horse  -
B D                Squirrel  =
          Black flying-fox  -
B D                     Cat  =
B D                 Manatee  =
B D                Elephant  =
            Bactrian camel  -
  D            Mallard duck  =
  D             Rock pigeon  =
B D                Platypus  =
          Cape golden mole  =
                  Aardvark  =
B D                 Wallaby  =
B D                 Opossum  =
B D         Tasmanian devil  =
  D         Green seaturtle  =
B D                Bushbaby  =
B D                     Dog  =
            Pacific walrus  =
          Brush-tailed rat  =
B D     Crab-eating macaque  N
        Chinese tree shrew  =
                Chinchilla  =
              Weddell seal  =
B D              Guinea pig  =

Inserts between block 22 and 23 in window
B D                 Baboon 436bp

Alignment block 23 of 1161 in window, 66768511 - 66768514, 4 bps 
B D                   Human  -----------------aaca
B D                   Chimp  -----------------aaca
B D                 Gorilla  -----------------aaca
B D               Orangutan  -----------------aaca
B D                  Gibbon  -----------------aaca
B D                  Rhesus  -----------------aaca
B D            Green monkey  -----------------aaca
B D                Marmoset  -----------------aaca
B D         Squirrel monkey  -----------------a--a
B D          Naked mole-rat  -----------------agta
B D                     Pig  ggc--------------g---
B D                  Alpaca  --c--------------a---
             Bactrian camel  --c--------------a---
B D                 Dolphin  cgt--------------a---
               Killer whale  cgt--------------a---
B D                   Horse  --t--------------a---
B D        White rhinoceros  --t--------------a---
           Black flying-fox  --t--------------a---
              Big brown bat  --ttttcttttttttaaa---
B D                Microbat  --t--------------a---
B D                  Rabbit  =====================
B D                   Shrew  =====================
B D                    Pika  =====================
B D                Hedgehog  =====================
B D               Armadillo  =====================
       Cape elephant shrew  =====================
B D                   Panda  =====================
            Golden hamster  =====================
              Prairie vole  =====================
B D                     Rat  =====================
    Lesser Egyptian jerboa  =====================
             Domestic goat  =====================
B D                     Cow  =====================
B D                   Sheep  =====================
          Tibetan antelope  =====================
      David's myotis (bat)  =====================
           Star-nosed mole  =====================
B D                 Ferret   =====================
B D                Squirrel  =====================
B D                     Cat  =====================
B D                 Manatee  =====================
B D                Elephant  =====================
  D            Mallard duck  =====================
  D             Rock pigeon  =====================
B D                Platypus  =====================
          Cape golden mole  =====================
                  Aardvark  =====================
B D                 Wallaby  =====================
B D                 Opossum  =====================
B D         Tasmanian devil  =====================
  D         Green seaturtle  =====================
B D                Bushbaby  =====================
B D                     Dog  =====================
            Pacific walrus  =====================
          Brush-tailed rat  =====================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  =====================
                Chinchilla  =====================
              Weddell seal  =====================
B D              Guinea pig  =====================
B D                  Baboon  =====================

Inserts between block 23 and 24 in window
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
B D                  Horse 5bp
B D       White rhinoceros 5bp
          Black flying-fox 5bp
             Big brown bat 224bp
B D               Microbat 5bp

Alignment block 24 of 1161 in window, 66768515 - 66768533, 19 bps 
B D                   Human  gttattcccagagcaaaa-t
B D                   Chimp  gttattcccagagcaaaa-t
B D                 Gorilla  gttattcccagagcaaaa-t
B D               Orangutan  gtttttcccagagcaaaa-t
B D                  Gibbon  gttattcccagagcaaaa-t
B D                  Rhesus  gttattcccagagcaaaa--
B D            Green monkey  gttattcccagagcaaaa--
B D                Marmoset  gtcattcccagagcaaaagt
B D         Squirrel monkey  gttattcccagagcaaaaat
B D          Naked mole-rat  gtcattaacagactaaaa-t
B D                     Pig  gtcattcgcagagcaagagt
B D                  Alpaca  ttcacag----agcaaaa-t
             Bactrian camel  ttcacag----agcaaaa-t
B D                 Dolphin  gtcattggagaagcaaaagt
               Killer whale  gtcattggagaagcaaaagt
B D                   Horse  gtcatttgcaaagcaaaagt
B D        White rhinoceros  gtcattcacaaagcaaaaat
           Black flying-fox  gtcattggcagagcaaaaga
              Big brown bat  gtcatttgcagagcataatt
B D                Microbat  gtcatttgcagagcaaaatt
B D                  Rabbit  ====================
B D                   Shrew  ====================
B D                    Pika  ====================
B D                Hedgehog  ====================
B D               Armadillo  ====================
       Cape elephant shrew  ====================
B D                   Panda  ====================
            Golden hamster  ====================
              Prairie vole  ====================
B D                     Rat  ====================
    Lesser Egyptian jerboa  ====================
             Domestic goat  ====================
B D                     Cow  ====================
B D                   Sheep  ====================
          Tibetan antelope  ====================
      David's myotis (bat)  ====================
           Star-nosed mole  ====================
B D                 Ferret   ====================
B D                Squirrel  ====================
B D                     Cat  ====================
B D                 Manatee  ====================
B D                Elephant  ====================
  D            Mallard duck  ====================
  D             Rock pigeon  ====================
B D                Platypus  ====================
          Cape golden mole  ====================
                  Aardvark  ====================
B D                 Wallaby  ====================
B D                 Opossum  ====================
B D         Tasmanian devil  ====================
  D         Green seaturtle  ====================
B D                Bushbaby  ====================
B D                     Dog  ====================
            Pacific walrus  ====================
          Brush-tailed rat  ====================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ====================
                Chinchilla  ====================
              Weddell seal  ====================
B D              Guinea pig  ====================
B D                  Baboon  ====================

Inserts between block 24 and 25 in window
B D         Naked mole-rat 1bp

Alignment block 25 of 1161 in window, 66768534 - 66768600, 67 bps 
B D                   Human  gttttgttttgttgccagatttggg----atgcaggt------------tctgtgggctgtggctttaat
B D                   Chimp  gttttgttttgttgccagatttggg----atgcaggt------------tctgtgggctgtggctttaat
B D                 Gorilla  gttttgttttgttgccagatttggg----atgcaggt------------tctgtgggctgtggctttaat
B D               Orangutan  gttttgttttgttgccagatttggg----atgcaggt------------tctgtgggctgtggctttaat
B D                  Gibbon  gttttgttttgttgccaagtttggg----atgcacgt------------tctgtgggccgtggctttaat
B D                  Rhesus  ----tgttttgttgccaagtttggg----atgcagat------------tctgtgggctgtggctttaat
B D            Green monkey  ----tgttttgttgccaagttcggg----atgcagat------------tctgtgggctgtggctttaat
B D                Marmoset  tttttgttttgttgccaagtttgggatacatacaggt------------tctgtgggctgtgactttaat
B D         Squirrel monkey  tttttgtttagttgccaagtttgggatacatacaggt------------tctgtgggctgtgactttaat
B D                Squirrel  gtgttgttttgctgtcaggtttggg----aggtaagc------------tctgtgga-------------
B D          Naked mole-rat  ttttccttttgttgccaagtttggg-----tccaagt------------cctatgggctgctgttccaat
B D                     Pig  ttttagttttgctgccaagttcagg----ttgcaggtttcaacccatcttctgtgggccgtagttctgat
B D                  Alpaca  ttttagttttgct------------------gcaagttccaacccatcttctttgggctgtggttccaat
             Bactrian camel  ttttagttttgct------------------gcaagttccaacccgtcttctttgggctgtggttccgat
B D                 Dolphin  ttttagttttgctgccaagtttggg----ccgcaggttccaaccctacttctgtgagctgtggttcccac
               Killer whale  ttttagttttgctgccaagtttggg----ccgcaggttccaaccctacttctgtgagctgtggttcccac
B D                   Horse  ttttagttttgcttccaagtttggg----ctgcaagttccaacccaccttctgtgggccatggttccaat
B D        White rhinoceros  ttttagttttgctgccaagtttggg----ctgcaagttccaacccaccttctgtgggctgtggttcgaat
           Black flying-fox  ttttagttttgctgccaagttgtag----ctgcatattgtaatgcaccctttgtgggttgtaattccaat
              Big brown bat  ttttagttttgttgtccagttcggg----ctgcaagttctaacccaccctctgtg-------tttccaat
B D                Microbat  ttttagttttgttgtccagttcggg----ctgcaagttctaacccaccttctgtg-------attccaat
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  gtcagttcattgt
                      Chimp  gtcagttcattgt
                    Gorilla  gtcagttaattgt
                  Orangutan  gtcagttcgttgt
                     Gibbon  gtcagttcatcgt
                     Rhesus  gtcagttcattgt
               Green monkey  gtcagttcattgt
                   Marmoset  gtcagttcattgt
            Squirrel monkey  gtcagttcattgt
                   Squirrel  ------tcgtggc
             Naked mole-rat  gtcagttcattat
                        Pig  gccagtttatttt
                     Alpaca  gtcaattcatttt
             Bactrian camel  gtcaattcatttt
                    Dolphin  gttggttcatttt
               Killer whale  gttggttcatttt
                      Horse  ggctgttccttta
           White rhinoceros  gtcagttccttta
           Black flying-fox  gtcagttagtttt
              Big brown bat  gtcggttcatttt
                   Microbat  gtcggttcacttt
                     Rabbit  =============
                      Shrew  =============
                       Pika  =============
                   Hedgehog  =============
                  Armadillo  =============
        Cape elephant shrew  =============
                      Panda  =============
             Golden hamster  =============
               Prairie vole  =============
                        Rat  =============
     Lesser Egyptian jerboa  =============
              Domestic goat  =============
                        Cow  =============
                      Sheep  =============
           Tibetan antelope  =============
       David's myotis (bat)  =============
            Star-nosed mole  =============
                    Ferret   =============
                        Cat  =============
                    Manatee  =============
                   Elephant  =============
               Mallard duck  =============
                Rock pigeon  =============
                   Platypus  =============
           Cape golden mole  =============
                   Aardvark  =============
                    Wallaby  =============
                    Opossum  =============
            Tasmanian devil  =============
            Green seaturtle  =============
                   Bushbaby  =============
                        Dog  =============
             Pacific walrus  =============
           Brush-tailed rat  =============
        Crab-eating macaque  NNNNNNNNNNNNN
         Chinese tree shrew  =============
                 Chinchilla  =============
               Weddell seal  =============
                 Guinea pig  =============
                     Baboon  =============

Inserts between block 25 and 26 in window
B D                    Pig 2284bp

Alignment block 26 of 1161 in window, 66768601 - 66768740, 140 bps 
B D                   Human  tcagag-ttttgtagtgctgtttcc----atctgtttcatatatgtgctgatctgagacctgc---atag
B D                   Chimp  tcagag-ttttgtagtgctgtttcc----atctgtttcatatatgtgctgatctgagacctgc---atag
B D                 Gorilla  tcagag-ttttgtagtgctgtttcc----atctgtttcatgtatgtgctgatctgagacctgc---atag
B D               Orangutan  tcagag-ttttgtagtgctgtttcc----atctgtttcatgtatgtgctgatctgagacctgc---atag
B D                  Gibbon  tcagag-ttttgtagtgctgtttcc----atctgtttcatgtatgtgctgatctgagacctgc---atag
B D                  Rhesus  tcagag-ttttgtagtgctgtttcc----atctgtttcatgcatgtgctgatctgagatttgc---atag
B D            Green monkey  tcagag-ttttgtagtgctgtttcc----atctgtttcatgcatgtgctgatctgagatctgc---atag
B D                Marmoset  tcagagcttttgtagtgttgcttgc----atctgtttcatgcatgtgctgatctgagacctgc---agag
B D         Squirrel monkey  tcagagcttttggagtg--------------ctgttacatgcatgtgctgatctgagacctgc---agag
B D                Squirrel  tctaaaaccctgcagtgctgtttcc----atctagttcatacatgtgctggtctgagatct---------
B D          Naked mole-rat  tcaaagcccctttagtgctgtttcc----ttctgtttaatacttgtcc----------------------
B D                     Pig  tcagagcctttgcagtgctgttttg----atctgtttcctgcttgttccagcctgacacctgt---gcag
B D                  Alpaca  tcaaagccttcgcagtgctattttgcagcgctagtttcctg--tgtcccagtctgagacctgt---gcag
             Bactrian camel  tcaaagccttcgcagtgctattttgcagcgctagtttcctg--tgtcccagtctgagacctgt---gcag
B D                 Dolphin  tcagaggctttgcagtgctattttg----atctgtttcctgcatgtgtcagtctgaaacctgt---gcag
               Killer whale  tcagaggctttgcagtgctattttg----atctgtttcctgcgtgtgtcagtctgaaacctgt---gcag
B D                   Horse  tcaaagcctttgcagtgctgttttg----atctgtttcatg--catgccagtctgaaacctgt---gtgg
B D        White rhinoceros  tcaaagcctttgcagtgctgtttcg----gtctgtttcatg--tgtgccagtctgaaacctgt---gtgg
           Black flying-fox  tcaaaacctttgcagtactg-attg----ccccatttcatgtatgtgctagtctgaaacttgtttggcgg
              Big brown bat  tcaaagcctttacagtactattttg----atctgtttcatgtatgtgccagtttgaaacttgt---gcag
B D                Microbat  tcaaagcctttacagtgctattttg----atctgtttcacgtatgtgccagtttgaaacttgt---gcag
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                Bushbaby  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  tggtctctccattag-----ttccaatttggaagcctttggtacggaatagcgtcagatccatgcatatg
                      Chimp  tggtctctccgttag-----ttccaatttggaagcctttggtatggaatagcgtcagatccatgcatatg
                    Gorilla  tggtctctgcgttag-----ttccaatttggaagcctttggtacggagtagcatcagatccatgcatatg
                  Orangutan  tggtctct--gttag-----tcccaa-ttagaaacctttggtactcaattgcatcagatccatgcatgtg
                     Gibbon  tggtctctctgttag-----tcccaa-ttagaaacctttggtactgaatagcgtcagatccatgcatatg
                     Rhesus  tggtctctctgttag-----tcccaatttagaaacctttggtactgaatagcatcagatccatgcatatg
               Green monkey  tggtctctctgttag-----tctcaatttagaaacctttggtactgaatagcatcagatccatgcatatg
                   Marmoset  tggtctctcccttag-----ttccaatttaaaaacctttggtactgaatagcatcagatctatatgtatg
            Squirrel monkey  tggtctctcccttag-----ttccaatttaaaaacctttggtactgaatagcatcaaatctatacatatg
                   Squirrel  --ttctgcctggtat--gacttccagttttgacgtctttgatactgaatagcatcagatccata---aag
             Naked mole-rat  ---tctctccagtactgtgtttctaattttgacatctttggtactgaaagacattagacctatggctgca
                        Pig  tggtctct--gttag-----aatgcatttt--agtctttggtcctgaatagcatcaaattcacgcatgca
                     Alpaca  tggtctct--a---------tatgcatttt--aatctttggtctctaatagcatcagatccatgcacaca
             Bactrian camel  tggtctct--atc-------tatgcatttt--aatctttggtctctaatagcatcagatccatgcacaca
                    Dolphin  tggtctct--attag-----tgtgaatttt--agtctctgatcctgaatagcatcagacccatgcacaca
               Killer whale  tggtctct--attag-----tgtgaatttt--agtctctgatcctgaatagcatcagacccatgcacaca
                      Horse  tggtctcc--attaa-----tttgaatttt--agtctttggtcctgcatagcatcagatccatgcatgca
           White rhinoceros  tggtctct--gttag-----tttgaatttt--agtctttggtcctgactagcatcagatccatgcatgca
           Black flying-fox  t-ctct--------g-----tttgaatttt--agtcttttgtcctaaatagcatcagatccat-tatgca
              Big brown bat  t-gtctct--gttag-----tttgaatttt--agtcttttgtcctgaatagcatcagatccat-tataca
                   Microbat  t-gtctcg--gttag-----tttgaatttt--agtcttttgtcctgaatagcatcagatccat-tataca
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                    Ferret   ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                   Bushbaby  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
        Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                 Guinea pig  ======================================================================
                     Baboon  ======================================================================

                      Human  cagcctagg---ggta
                      Chimp  cagcctagg---ggta
                    Gorilla  cagcctagg---ggta
                  Orangutan  cagcttaag---agta
                     Gibbon  cagcctaag---agta
                     Rhesus  cagcctaag---ggta
               Green monkey  cagcctaag---ggta
                   Marmoset  cagcctagg---ggtg
            Squirrel monkey  caggctagg---ggca
                   Squirrel  tagcttagg---gctg
             Naked mole-rat  tagcctagg---ggtg
                        Pig  cagcctagg---ggtg
                     Alpaca  tggttt-gg---ggtg
             Bactrian camel  tggttt-gg---ggtg
                    Dolphin  ----------------
               Killer whale  ----------------
                      Horse  cagcctag----gggg
           White rhinoceros  cagcctag----gggg
           Black flying-fox  cagcctaga---ggtg
              Big brown bat  cagctaggagtggatg
                   Microbat  cagctaggggtgggtg
                     Rabbit  ================
                      Shrew  ================
                       Pika  ================
                   Hedgehog  ================
                  Armadillo  ================
        Cape elephant shrew  ================
                      Panda  ================
             Golden hamster  ================
               Prairie vole  ================
                        Rat  ================
     Lesser Egyptian jerboa  ================
              Domestic goat  ================
                        Cow  ================
                      Sheep  ================
           Tibetan antelope  ================
       David's myotis (bat)  ================
            Star-nosed mole  ================
                    Ferret   ================
                        Cat  ================
                    Manatee  ================
                   Elephant  ================
               Mallard duck  ================
                Rock pigeon  ================
                   Platypus  ================
           Cape golden mole  ================
                   Aardvark  ================
                    Wallaby  ================
                    Opossum  ================
            Tasmanian devil  ================
            Green seaturtle  ================
                   Bushbaby  ================
                        Dog  ================
             Pacific walrus  ================
           Brush-tailed rat  ================
        Crab-eating macaque  NNNNNNNNNNNNNNNN
         Chinese tree shrew  ================
                 Chinchilla  ================
               Weddell seal  ================
                 Guinea pig  ================
                     Baboon  ================

Alignment block 27 of 1161 in window, 66768741 - 66768753, 13 bps 
B D                   Human  agcctagaaattg---------------------
B D                   Chimp  agcctagaaattg---------------------
B D                 Gorilla  agcctagaaattg---------------------
B D               Orangutan  agcctagaaattg---------------------
B D                  Gibbon  agcctagaaattg---------------------
B D                  Rhesus  agcctagaaattg---------------------
B D            Green monkey  agcctagaaattg---------------------
B D                Marmoset  agtgtagataatg---------------------
B D         Squirrel monkey  agtgtagataatg---------------------
B D                Squirrel  agcccagaaattg---------------------
             Golden hamster  agtttagaaa--g---------------------
B D          Naked mole-rat  agcccagaaattg---------------------
B D                     Pig  agtctgcacgttcacagacagccttttcagcttg
B D                  Alpaca  agtccagaagttcacagacaacgtttttagctta
             Bactrian camel  agtccagaagttcacagacaacgttttcagcttg
B D                 Dolphin  -----------------------ttttcagcttg
               Killer whale  -----------------------ttttcagcttg
B D                   Horse  agcccaggagtgcacaaacaacattttcaggttg
B D        White rhinoceros  agcccaggagttcaca---aacattttcaggttg
           Black flying-fox  agcccaggagttcaca---gacattttcaggttg
              Big brown bat  agcccaggagttcacaaacaacattttcaggttg
B D                Microbat  agcccaggagttcacaaacaacattttcaggttg
B D                  Rabbit  ==================================
B D                   Shrew  ==================================
B D                    Pika  ==================================
B D                Hedgehog  ==================================
B D               Armadillo  ==================================
       Cape elephant shrew  ==================================
B D                   Panda  ==================================
              Prairie vole  ==================================
B D                     Rat  ==================================
    Lesser Egyptian jerboa  ==================================
             Domestic goat  ==================================
B D                     Cow  ==================================
B D                   Sheep  ==================================
          Tibetan antelope  ==================================
      David's myotis (bat)  ==================================
           Star-nosed mole  ==================================
B D                 Ferret   ==================================
B D                     Cat  ==================================
B D                 Manatee  ==================================
B D                Elephant  ==================================
  D            Mallard duck  ==================================
  D             Rock pigeon  ==================================
B D                Platypus  ==================================
          Cape golden mole  ==================================
                  Aardvark  ==================================
B D                 Wallaby  ==================================
B D                 Opossum  ==================================
B D         Tasmanian devil  ==================================
  D         Green seaturtle  ==================================
B D                Bushbaby  ==================================
B D                     Dog  ==================================
            Pacific walrus  ==================================
          Brush-tailed rat  ==================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ==================================
                Chinchilla  ==================================
              Weddell seal  ==================================
B D              Guinea pig  ==================================
B D                  Baboon  ==================================

Alignment block 28 of 1161 in window, 66768754 - 66768788, 35 bps 
B D                   Human  ctt--------------------tcttgagtt---c---t---c---ctcagcaatttttcccaca----
B D                   Chimp  ctt--------------------tcttgagtt---c---t---c---ctcagcaatttttcccaca----
B D                 Gorilla  ctt--------------------tcttgagtt---c---t---c---ctcagcaatttttcccaca----
B D               Orangutan  ctt--------------------tcttgagtt---c---t---c---ctcagcaatttttccgaca----
B D                  Gibbon  cct--------------------tcttgagtt---c---t---c---ctcagcaatttttct--ca----
B D                  Rhesus  ctt--------------------tcttgagtt---c---t---c---ctcagcagtttttcccata----
B D            Green monkey  ctt--------------------tcctgagtt---c---t---c---ctcagcaatttttcccata----
B D                Marmoset  ctt--------------------tcttgaatt---c---t---c---ctcagcaattttccccata----
B D         Squirrel monkey  ctt--------------------tgttgagtt---c---t---c---ctcagcaatttttcccata----
B D                Bushbaby  cct--------------------tcttgagtt---tttat---t---ctcagccattttc----------
B D                Squirrel  ctt--------------------tcttgagtt---c---tttgt---ctctgcagtttctcatgta----
             Golden hamster  ttt--------------------tcttgagag---t---tgtgc---ctcagaaatttttcctgta----
B D          Naked mole-rat  cttgtgtgtgtggtgggagtggctgttgggga---t---tgaac---c-caggaccttcacattgagcta
B D                     Pig  ctt--------------------tcttgagtt---------------ctcagtgatgtctcctgta----
B D                  Alpaca  ctt--------------------tcttgagtt---c---t---ccttctcagtgatttctcttgta----
             Bactrian camel  ctt--------------------tcttgagtt---c---t---ccttctcagtgatttctcttgta----
B D                 Dolphin  ctt--------------------tcttgagtt---c---t---c---ctcattgattcctcctgta----
               Killer whale  ctt--------------------tcttgagtt---c---t---c---ctcattgattcctcctgta----
B D                   Horse  ctt--------------------tcttgagta---c---t---c---ctcaatgatttcttctgta----
B D        White rhinoceros  ctt--------------------tcttgagtt---c---t---ctttctcaatgacttctcctgta----
           Black flying-fox  ctc--------------------tcttgagttctcc---t---t---ttcagtgatttctcctgta----
              Big brown bat  ttt--------------------tcttgagtt---c---t---t---gtcagtgtgttctcctata----
B D                Microbat  ctt--------------------tcttgagtt---c---t---t---gtcagtgtgttctcctata----
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  --------------------c
                      Chimp  --------------------c
                    Gorilla  --------------------c
                  Orangutan  --------------------c
                     Gibbon  --------------------c
                     Rhesus  --------------------c
               Green monkey  --------------------c
                   Marmoset  --------------------c
            Squirrel monkey  --------------------c
                   Bushbaby  ---------------------
                   Squirrel  --------------------c
             Golden hamster  --------------------t
             Naked mole-rat  cattcccagcacccccccccc
                        Pig  --------------------c
                     Alpaca  --------------------t
             Bactrian camel  --------------------t
                    Dolphin  --------------------t
               Killer whale  --------------------t
                      Horse  --------------------c
           White rhinoceros  --------------------c
           Black flying-fox  --------------------t
              Big brown bat  --------------------t
                   Microbat  --------------------t
                     Rabbit  =====================
                      Shrew  =====================
                       Pika  =====================
                   Hedgehog  =====================
                  Armadillo  =====================
        Cape elephant shrew  =====================
                      Panda  =====================
               Prairie vole  =====================
                        Rat  =====================
     Lesser Egyptian jerboa  =====================
              Domestic goat  =====================
                        Cow  =====================
                      Sheep  =====================
           Tibetan antelope  =====================
       David's myotis (bat)  =====================
            Star-nosed mole  =====================
                    Ferret   =====================
                        Cat  =====================
                    Manatee  =====================
                   Elephant  =====================
               Mallard duck  =====================
                Rock pigeon  =====================
                   Platypus  =====================
           Cape golden mole  =====================
                   Aardvark  =====================
                    Wallaby  =====================
                    Opossum  =====================
            Tasmanian devil  =====================
            Green seaturtle  =====================
                        Dog  =====================
             Pacific walrus  =====================
           Brush-tailed rat  =====================
        Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNN
         Chinese tree shrew  =====================
                 Chinchilla  =====================
               Weddell seal  =====================
                 Guinea pig  =====================
                     Baboon  =====================

Inserts between block 28 and 29 in window
B D                  Horse 3bp
B D       White rhinoceros 3bp
          Black flying-fox 4bp
             Big brown bat 2bp
B D               Microbat 2bp

Alignment block 29 of 1161 in window, 66768789 - 66768802, 14 bps 
B D                   Human  ttttt---gttctcaaa
B D                   Chimp  ttttt---gttctcaaa
B D                 Gorilla  ttttt---gttctcaaa
B D               Orangutan  ttttt---gttccccag
B D                  Gibbon  ttttt---attccccag
B D                  Rhesus  ttttt---gttccccag
B D            Green monkey  ttttt---gttccccag
B D                Marmoset  ttttt---cttccctag
B D         Squirrel monkey  ttttt---gttccctag
B D                Bushbaby  -tttt---gttccgtag
B D                Squirrel  ttttt---ttttttaac
             Golden hamster  ttttt---ttttt----
B D          Naked mole-rat  ttttc---ttttgagac
B D                     Pig  -tttttaacctccccag
B D                  Alpaca  -tttt----ttccctat
             Bactrian camel  -tttt----ttccctat
B D                 Dolphin  -ttttaaagttctcttg
               Killer whale  -ttttaaagttctcttg
B D                   Horse  ttttt---gttccttag
B D        White rhinoceros  ttttt---gttccgtag
           Black flying-fox  ttttt---gttccctag
B D                 Megabat  ttttt---gtt-cctag
              Big brown bat  ttttt---gtttcctag
B D                Microbat  ttttt---ggttcctag
B D                  Rabbit  =================
B D                   Shrew  =================
B D                    Pika  =================
B D                Hedgehog  =================
B D               Armadillo  =================
       Cape elephant shrew  =================
B D                   Panda  =================
              Prairie vole  =================
B D                     Rat  =================
    Lesser Egyptian jerboa  =================
             Domestic goat  =================
B D                     Cow  =================
B D                   Sheep  =================
          Tibetan antelope  =================
      David's myotis (bat)  =================
           Star-nosed mole  =================
B D                 Ferret   =================
B D                     Cat  =================
B D                 Manatee  =================
B D                Elephant  =================
  D            Mallard duck  =================
  D             Rock pigeon  =================
B D                Platypus  =================
          Cape golden mole  =================
                  Aardvark  =================
B D                 Wallaby  =================
B D                 Opossum  =================
B D         Tasmanian devil  =================
  D         Green seaturtle  =================
B D                     Dog  =================
            Pacific walrus  =================
          Brush-tailed rat  =================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNN
        Chinese tree shrew  =================
                Chinchilla  =================
              Weddell seal  =================
B D              Guinea pig  =================
B D                  Baboon  =================

Inserts between block 29 and 30 in window
B D               Squirrel 156bp
B D         Naked mole-rat 69bp

Alignment block 30 of 1161 in window, 66768803 - 66768952, 150 bps 
B D                   Human  gggc------------------------------------------tcatat-----tttct--------
B D                   Chimp  ggac------------------------------------------tcatat-----tttct--------
B D                 Gorilla  gggc------------------------------------------tcatat-----tttct--------
B D               Orangutan  aagc------------------------------------------tcatat-----tttct--------
B D                  Gibbon  gagc------------------------------------------tcatat-----tttct--------
B D                  Rhesus  gagc------------------------------------------tcatat-----ttcct--------
B D            Green monkey  gagc------------------------------------------tcatat-----ttcct--------
B D                Marmoset  gagt------------------------------------------tcatat-----tttct--------
B D         Squirrel monkey  gagt------------------------------------------tcatac-----tttct--------
B D                Bushbaby  aggc------------------------------------------tcatct-----tttct--------
B D                Squirrel  gggc------------------------------------------tcatct-----tttttc-------
             Golden hamster  ----------------------------------------------ttgtct-----ttact--------
B D          Naked mole-rat  aggcatataccaatgcacctggctagaaattattttcttgagttttttgtcttgcactttctcctgtact
B D                     Pig  gggc------------------------------------------tcctct-----t--ct--------
B D                  Alpaca  gggc------------------------------------------ttatct-----t------------
             Bactrian camel  gggc------------------------------------------ttatct-----t------------
B D                 Dolphin  gggc------------------------------------------tcatct-----t--ct--------
               Killer whale  gggc------------------------------------------tcatct-----t--ct--------
B D                   Horse  ggac------------------------------------------tcacct-----tttct--------
B D        White rhinoceros  ggac------------------------------------------tcatct-----tttct--------
           Black flying-fox  gttc------------------------------------------tcatct-----tttct--------
B D                 Megabat  g-tc------------------------------------------tcatct-----tttct--------
              Big brown bat  gttc------------------------------------------tcatct-----t------------
B D                Microbat  gttc------------------------------------------tcatct-----t------------
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  --ttctttt-gtccagaaaactgtgg--------atttagttactccactc-tgcca-------tgtctt
                      Chimp  --ttctttt-gtccagaaaactgtgg--------atttagttactccactc-tgcca-------tgtctt
                    Gorilla  --ttctttt-gtccagaaaactgtgg--------atttagttactccactc-tgcca-------tgtgtt
                  Orangutan  --ttctttt-gtccagaaaactgtgg--------attcagttaccccactc-tgcca-------tgtctt
                     Gibbon  --ttctttt-gtccagaaaactgtgg--------atttagttaccgcactc-tgcca-------tgtcct
                     Rhesus  --ttc-ttt-gtccagaaaactgtgg--------atttagttatcccactc-tgtca-------tgtcct
               Green monkey  --ttc-ttt-gtccagaaaactgtgg--------atttagttatcccactc-tgtca-------tgtcct
                   Marmoset  --ttctttt-gtacagaaaac--tgc--------atttagttaccccactc-tgcca-------agtcct
            Squirrel monkey  --ttctttt-gtccagaaaac--tgg--------atttagttaccccactc-tgcca-------tgtcct
                   Bushbaby  --ttcctgt-atccagaaaactgtaa--------atgtagtcatgtcactc-agcca-------tgtact
                   Squirrel  --cccctct-ctccataaaattgtga--------atttaattatcccactc-ttcca-------tgaacc
             Golden hamster  --ttcttct-gtctaagaaactggg-----------tttagtgttctgctt-tgcca-------tacact
             Naked mole-rat  ttttgttcc-ctttgcagggtgggggtgggaggcttttcttttctctaccc-tgcca-------tgtact
                        Pig  --ctcctctggggtggaaaactgtgg--------agttaattaccctgctc-tgtgc-------tgtact
                     Alpaca  ---tcctct-gggtgggaaactttgg--------agttagttaccccactt-tgtct-------tgtact
             Bactrian camel  ---tcctct-gggtggtgaactttgg--------agttagttaccccactt-tgtct-------tgtact
                    Dolphin  --ctcctct-gggtggaaagctgtgg--------aattagttaccccactc-tgtct-------tgtact
               Killer whale  --ctcctct-gggtggaaagctgtgg--------aattagttaccccactc-tgtct-------tgtact
                      Horse  --ttcctct-ggccagaaaactgtgg--------agttctttaccctactc-tgtta-------tgtatt
           White rhinoceros  --ttcctct-ggccagaaaactgtgg--------agttctttatcccactcttgtta-------tatact
           Black flying-fox  --ttcctct-ggccagaaaactgtgg--------agttagttaccctactc-tgtcatgtacactgtact
                    Megabat  --tt-ctct-gacagaaaaactgtgg--------agttagtta-cctactc-tgtcatgtacactgtact
              Big brown bat  -----ttct-ggccagaaaacagtgg--------agttagttatcctactc-tgtcatatacactgtact
                   Microbat  -----ttct-ggccagaaaacagtgg--------agtgagttatgctactc-tgtcatatacactgtact
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
                      Panda  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                    Ferret   ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
        Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                 Guinea pig  ======================================================================
                     Baboon  ======================================================================

                      Human  tccaccactgcctgcacatttga---gacca---------aggatagagatt--gggaaaaattgatagt
                      Chimp  tccaccactgcctgcacatttga---gacca---------aggatagagatt--gggaaaaattgatagt
                    Gorilla  tccaccactgcctgcacatttga---gacca---------aggatagagatt--gggaaaaattgatagt
                  Orangutan  tccaccactgccggcatatttga---ggcca---------aggatggagatt--gggaaaaattgatagt
                     Gibbon  tccaccattgccggcatatttga---ggcca---------aggatagagatt--gggaaaaatcggtagt
                     Rhesus  tccaccactgcctatacgtttga---gacca---------aggatagagatt--gggaaaaatcgatagt
               Green monkey  tccaccactgcctgtacgtttga---gacca---------aggatagatatt--gggaaaaatccatagt
                   Marmoset  tccaccactgcatgcacattcga---ggcca---------aggatagagcgt--ggggaaaatcaatagt
            Squirrel monkey  tccaccactgcatgcacattaga---ggcca---------aagatagagagt--ggggaaaatgaacact
                   Bushbaby  tccactgctgtctatgtatttga---ggctaagcagttggaggatagagagtgagggaaaaatcaatagt
                   Squirrel  tttgcatctgtctgcacttctgg---gcctaagcagtggaaagacag----t--atgtgaaaatccatgt
             Golden hamster  tccgtaagtgtctgtacatttgacacctcccaggagtacagagccag-----------aagaacccaagt
             Naked mole-rat  tccacatgc-tctgcacctttgg----gctagtcagtgggaggatagagaat--gtggagtagccagagt
                        Pig  cccatcaatactgccgcactgag---gcccaagaaataggcacctagaaagt--gagaaagatggatatt
                     Alpaca  tccgtcactgtctgcacatttgg---ggcctagaaatgggaggatagagagt--gggaaaaatggatagt
             Bactrian camel  tccgtcactgtctgcacatttgg---ggccaagaaatgggaggatagagagt--gggaaaaatggatagt
                    Dolphin  cccatcgctgtc------------------------taggagactagagagt--gggaaaaatggatagt
               Killer whale  cccatcactgtc------------------------taggagactagagagt--gggaaaaatggatagt
                      Horse  tccacaacagtctgcacatttgg---ggccaagaaataggaggatagaacat--aggaaaaactgatagt
           White rhinoceros  tccataacagtctgtgcatttgg---ggccaagaaatgggaggatagaacat--gggaaaaattgatagt
           Black flying-fox  tccacaactgtctgcacatttga---ggccaagaaatgggaggatagacagt--gaagaaaatcagtagt
                    Megabat  tccacaactgtctgcacatttgg---gg-caagaaatgggaggatagacagt--gaagaaaatcagtagt
              Big brown bat  tccatgactgtct-cacatttgg---ggccaagaaatgggaggatagagagt--ggggaaaattgataat
                   Microbat  tccatgactgtct-cacagttgg---ggccaagaaatgggaggatagagagc--ggagaaaattgataat
                     Rabbit  ======================================================================
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
                      Panda  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                    Ferret   ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
               Mallard duck  ======================================================================
                Rock pigeon  ======================================================================
                   Platypus  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
                        Dog  ======================================================================
             Pacific walrus  ======================================================================
           Brush-tailed rat  ======================================================================
        Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         Chinese tree shrew  ======================================================================
                 Chinchilla  ======================================================================
               Weddell seal  ======================================================================
                 Guinea pig  ======================================================================
                     Baboon  ======================================================================

                      Human  t-ctcctgcctcagagtttggctcctgca
                      Chimp  t-ctcctgcctcagagtttggctcctgca
                    Gorilla  t-ctcctgcctcagagtttggctcctgca
                  Orangutan  t-ctcctgcttcagggtttggctcctgca
                     Gibbon  t-ctcctgcctcagagtttggctcctgca
                     Rhesus  t-ctcctgcctcagagtttggctgctgta
               Green monkey  t-ctcctgcctcagagtttggctgctgta
                   Marmoset  t-ctcctgcttcagagtttggctcctgta
            Squirrel monkey  ---tcctgcctcagagtttggctcctgta
                   Bushbaby  t-ctccttgcttagagtttggctcctgaa
                   Squirrel  t-ctccttccccagggctaggctcctgca
             Golden hamster  t-t----------------ggctcctatg
             Naked mole-rat  t-gggctcctgca------gtctcttatt
                        Pig  taccccctgctcagagttgagctcctgct
                     Alpaca  t-ccgcttcctcagagtttaggtcctgca
             Bactrian camel  t-ccgcttcctcggagtttaggtcctgca
                    Dolphin  t-ccccttcctccgagtttagctcctgca
               Killer whale  t-ccccttcctccgcgtttagctcctgca
                      Horse  t-cctcttcctcagagtttggctcctgca
           White rhinoceros  t-ccccttcctcagagttgggctcctgca
           Black flying-fox  t-ccccttactcagag-ttagctcctgca
                    Megabat  t-ccccatactcagag-ttagctcgtgca
              Big brown bat  t-ccccttcctcagagtttgatttctgca
                   Microbat  t-ccccttcctcagagtttggtttctgca
                     Rabbit  =============================
                      Shrew  =============================
                       Pika  =============================
                   Hedgehog  =============================
                  Armadillo  =============================
        Cape elephant shrew  =============================
                      Panda  =============================
               Prairie vole  =============================
                        Rat  =============================
     Lesser Egyptian jerboa  =============================
              Domestic goat  =============================
                        Cow  =============================
                      Sheep  =============================
           Tibetan antelope  =============================
       David's myotis (bat)  =============================
            Star-nosed mole  =============================
                    Ferret   =============================
                        Cat  =============================
                    Manatee  =============================
                   Elephant  =============================
               Mallard duck  =============================
                Rock pigeon  =============================
                   Platypus  =============================
           Cape golden mole  =============================
                   Aardvark  =============================
                    Wallaby  =============================
                    Opossum  =============================
            Tasmanian devil  =============================
            Green seaturtle  =============================
                        Dog  =============================
             Pacific walrus  =============================
           Brush-tailed rat  =============================
        Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         Chinese tree shrew  =============================
                 Chinchilla  =============================
               Weddell seal  =============================
                 Guinea pig  =============================
                     Baboon  =============================

Inserts between block 30 and 31 in window
B D                 Gibbon 2bp
B D               Marmoset 2bp
B D        Squirrel monkey 2bp
B D               Bushbaby 2bp
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
B D                  Horse 2bp
B D       White rhinoceros 2bp
          Black flying-fox 2bp
B D                Megabat 2bp
             Big brown bat 2bp
B D               Microbat 2bp

Alignment block 31 of 1161 in window, 66768953 - 66768954, 2 bps 
B D                   Human  ct
B D                   Chimp  ct
B D                 Gorilla  ct
B D               Orangutan  ct
B D                  Gibbon  ct
B D                  Rhesus  ct
B D                  Baboon  ct
B D            Green monkey  ct
B D                Marmoset  ct
B D         Squirrel monkey  ct
B D                Bushbaby  ct
B D                Squirrel  gc
             Golden hamster  ct
B D          Naked mole-rat  ct
B D                     Pig  ct
B D                  Alpaca  ct
             Bactrian camel  ct
B D                 Dolphin  ct
               Killer whale  ct
B D                   Horse  ct
B D        White rhinoceros  ct
           Black flying-fox  ct
B D                 Megabat  ct
              Big brown bat  ct
B D                Microbat  ct
B D                  Rabbit  ==
B D                   Shrew  ==
B D                    Pika  ==
B D                Hedgehog  ==
B D               Armadillo  ==
       Cape elephant shrew  ==
B D                   Panda  ==
              Prairie vole  ==
B D                     Rat  ==
    Lesser Egyptian jerboa  ==
             Domestic goat  ==
B D                     Cow  ==
B D                   Sheep  ==
          Tibetan antelope  ==
      David's myotis (bat)  ==
           Star-nosed mole  ==
B D                 Ferret   ==
B D                     Cat  ==
B D                 Manatee  ==
B D                Elephant  ==
  D            Mallard duck  ==
  D             Rock pigeon  ==
B D                Platypus  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Wallaby  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
  D         Green seaturtle  ==
B D                     Dog  ==
            Pacific walrus  ==
          Brush-tailed rat  ==
B D     Crab-eating macaque  NN
        Chinese tree shrew  ==
                Chinchilla  ==
              Weddell seal  ==
B D              Guinea pig  ==

Inserts between block 31 and 32 in window
B D                 Rhesus 2bp
B D                 Baboon 312bp
B D           Green monkey 2bp

Alignment block 32 of 1161 in window, 66768955 - 66769037, 83 bps 
B D                   Human  ctcatttcagccata--gctgcag---acaaagcacacgattgc-t-gggcactgtggctcaagagaagg
B D                   Chimp  ctcatttcagccata--gctgcag---acaaagcacacgattgc-t-gagcactgtggctcaagagaagg
B D                 Gorilla  ctcatttcagccata--gctgcag---acaaagcacacgattgc-t-gggcactgtggctcaagataagg
B D               Orangutan  cttatttcagccata--gctgcag---acaaagcgcacgattgc-t-gggcactgtggctcaagagaagg
B D                  Gibbon  ctcatttcagccaca--gctgcag---acaaagcacacgtttgc-t-gggcactgtggctcaagagaagg
B D                  Rhesus  ctcatttcagccata--gctgcaa---acaaagcacacgattgc-t-gggcactgtggctcaagagaaag
B D            Green monkey  ctcctttcagccata--gctgcag---acaaagcacacgattgc-t-gggcac--tggctcaagagaaag
B D                Marmoset  ctcagttcagccata--gctgcag---gcaaagcacatgattcc-g-gggcactgtggctcacgagaagg
B D         Squirrel monkey  ctcatttcaggcata--gctgcag---acaaagcacatgattac-a-gggcactgtggctcaagagaagg
B D                Bushbaby  ctcattctagtcttt--gctgcag---atacactgcatggttgctt-gggcactatatctcaagagaagg
B D                Squirrel  --------agccgctcacctgcggaagacacgccatagaactgt-a-tggctctgtggctcacgag-ggg
             Golden hamster  --------agccact--gctgcagatgtc-------aggattgt-t-tgtccctgtggcttaagagcggg
B D          Naked mole-rat  --------agccatt--gctgcag------tgccacctgatcgc-t-tggctct---gctcaggagaaag
B D                     Pig  atcattctagctgtt--tctgtgg---ac--actgtgtgattgc-t-------tttgacttaggaggagg
B D                  Alpaca  ctcattccagccact--gctatgg---ac--accatgtgattgc-ttggatgctgtggctcaagagaagg
             Bactrian camel  ctcattccagccact--gctgtgg---ac--accatgtgattgc-ttggatgctgtggctcaagagaagg
B D                 Dolphin  ctcattccagccgct--tctgtga---ac--accatgtgattgc-t-------catggctcaagagaagg
               Killer whale  ctcattccagccgct--tctgtga---ac--accatgtgattgc-t-------catggctcaagagaagg
B D                   Horse  ctcactccaaccatt--gctgcag---ac--accacgtgattgc-ttaggtgctgtggctcaagagaagg
B D        White rhinoceros  ctcactcctgccatt--gctgcgg---ac--acaacatgattgc-ttaggttctgtggctcaagagaaga
           Black flying-fox  gtctttccagtcact--atttt------------atgtggttgc-ttgggtgctatggctcaagagaagg
B D                 Megabat  gtctttccagtcact--atttt------------atgtggttgc-ttgggtgctatggctcaagagaagg
              Big brown bat  gtcttttcaggcatt--gctgt------------atgtggttgc-ttgggtgctgtgtctcaggagaaga
B D                Microbat  gtcttttcaggcatt--gctgt------------atgtggttgc-ttgggtgctgtagctcaggagaaga
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  agg--------agatggt-aagtgggggg-
                      Chimp  agg--------agatggt-aagtgggggg-
                    Gorilla  agg--------agatggt-aagtgggggg-
                  Orangutan  ggg--------agatggt-aagtgggggg-
                     Gibbon  ggg--------agatggt-aagtgggggg-
                     Rhesus  tgg--------ggatggt-aagtggagag-
               Green monkey  tgg--------ggatggt-aagtggagag-
                   Marmoset  ggg--------agatggc-aaatgggggg-
            Squirrel monkey  ggg--------agatggt-aaatgggggg-
                   Bushbaby  gag------aaagacagtaaaatggaaga-
                   Squirrel  gac--------tgacaat-aaaatggaaa-
             Golden hamster  gaa--------tggcagt-aaactagggg-
             Naked mole-rat  ggc--------gtagggc-aggcagaggg-
                        Pig  agg--aggaaaagataag-aaaatggaggg
                     Alpaca  gag------aaagacaat-aaagtggaggg
             Bactrian camel  gag------aaagacaat-aaagtggaggg
                    Dolphin  aggaaaaaaaaagacaag-aaaatggaggg
               Killer whale  aggaaaaaaaaagacaag-aaaatggaggg
                      Horse  tgg-----ggaagacagt-aaaatggaggg
           White rhinoceros  ggg--aaagaaagacaat-aaaatggagag
           Black flying-fox  tgg-----aaaagacaat-aaaattgagac
                    Megabat  tgg-----aaaagacaat-aaaattgagac
              Big brown bat  gat-----taaaaacaat-aaaatagagag
                   Microbat  ggt-----taaaaataat-aaattggaggg
                     Rabbit  ==============================
                      Shrew  ==============================
                       Pika  ==============================
                   Hedgehog  ==============================
                  Armadillo  ==============================
        Cape elephant shrew  ==============================
                      Panda  ==============================
               Prairie vole  ==============================
                        Rat  ==============================
     Lesser Egyptian jerboa  ==============================
              Domestic goat  ==============================
                        Cow  ==============================
                      Sheep  ==============================
           Tibetan antelope  ==============================
       David's myotis (bat)  ==============================
            Star-nosed mole  ==============================
                    Ferret   ==============================
                        Cat  ==============================
                    Manatee  ==============================
                   Elephant  ==============================
               Mallard duck  ==============================
                Rock pigeon  ==============================
                   Platypus  ==============================
           Cape golden mole  ==============================
                   Aardvark  ==============================
                    Wallaby  ==============================
                    Opossum  ==============================
            Tasmanian devil  ==============================
            Green seaturtle  ==============================
                        Dog  ==============================
             Pacific walrus  ==============================
           Brush-tailed rat  ==============================
        Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         Chinese tree shrew  ==============================
                 Chinchilla  ==============================
               Weddell seal  ==============================
                 Guinea pig  ==============================
                     Baboon  ==============================

Inserts between block 32 and 33 in window
B D               Squirrel 1bp
            Golden hamster 5032bp
B D         Naked mole-rat 4bp

Alignment block 33 of 1161 in window, 66769038 - 66769109, 72 bps 
B D                   Human  atccccatattc-tc-----tctggctgttag-gagttccctttcacatggctggagcccaaactagagg
B D                   Chimp  atccccatattc-tc-----tctggctgttag-gagttccctttcacatggctggagcccaaactagagg
B D                 Gorilla  atccccatattc-tc-----tctggctgttag-gagttccctttcacatggctggagcccaaactagagg
B D               Orangutan  atccccatattc-tt-----tctggctgttag-gagttccctttcacatgcctggagcccaaactagagg
B D                  Gibbon  atccccatattc-tc-----tctggctgctag-gagtcccctttcacatgcctggagcccaaactagagg
B D                  Rhesus  atccccatattc-tc-----tctggctgttat-gagttccctttcacatgcctagagcccgatctagagg
B D            Green monkey  atccccatattc-tc-----cctggctgttat-gagttccctttcacatgcctggagcccgatctagagg
B D                Marmoset  attcccatattg-tc-----tctgactgttag-gacttccctttcttgtgcctggagcccaaattggagg
B D         Squirrel monkey  atccgcatattc-tc-----tctgactgttag-gagttccctttctcatgcctggagcccaaactggagg
B D                Bushbaby  atccccatattc-tc-----tctgaatgttag-gaattccctttctcatgccttgagcccaaactaaagg
B D                Squirrel  ctctccttattt-tc-----tctgaatgtttg-gacttggctttctcatgttttgaaccag-acttggag
B D          Naked mole-rat  gtctctgcattc-tctcttgtctgcttgtcag-aagttccctttctcttgccttgagtcagaactcgaag
B D                     Pig  attttcatattt---------tttagtgttaa-gagtgcccgttttcattctttgagccagaactagagg
B D                  Alpaca  attttcatattt-tc-----tctcactgttagagagtttcctttctcattccttgagccaggactagagg
             Bactrian camel  attttcatattt-tc-----tctcactgttagagagtttcctttctcattccttgagccaggactagagg
B D                 Dolphin  attttcatattt-cc-----tctcagtattag-gagttctttttctcattctttgagccagagctagagg
               Killer whale  attttcatatttccc-----tctcagtgttag-gagttctctttctcattctttgagccagagctagagg
B D                   Horse  atttccatattt-tc-----tca--gtgctag-gaattccctttctctttccttgaacaaaaaccagagg
B D        White rhinoceros  atttccatattt-tc-----tca--gtgttag-gagttcactttctctttccttgaaccagaaccggagg
           Black flying-fox  attttcatattt-tc-----tctcagtgttag--ggttccctttctccttccttgagccagaactagagg
B D                 Megabat  attttcatattt-tc-----tctcagtgttag--ggttccctttctccttccttgagccagaactagagg
              Big brown bat  attttcatattt-cc-----tct--gcgttag-aagttccctttctccttccttgagtccgaactagagg
B D                Microbat  attttcatattt-tc-----tctcagtgttag-aagttccctttctccttccttgagcccgaagtagagg
B D                  Rabbit  ======================================================================
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
B D     Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  agctttctc
                      Chimp  agctttctc
                    Gorilla  agctttctc
                  Orangutan  agctttctc
                     Gibbon  agctttctc
                     Rhesus  agctttctg
               Green monkey  agctttctg
                   Marmoset  agctttctc
            Squirrel monkey  agctttctc
                   Bushbaby  aactctctc
                   Squirrel  -gctctctc
             Naked mole-rat  agatccctc
                        Pig  agctctctc
                     Alpaca  agcttcctc
             Bactrian camel  agctccctc
                    Dolphin  agctctctc
               Killer whale  agctctctc
                      Horse  agc------
           White rhinoceros  agc------
           Black flying-fox  cactctttg
                    Megabat  cactctttg
              Big brown bat  atctatctc
                   Microbat  atctatctc
                     Rabbit  =========
                      Shrew  =========
                       Pika  =========
                   Hedgehog  =========
                  Armadillo  =========
        Cape elephant shrew  =========
                      Panda  =========
             Golden hamster  =========
               Prairie vole  =========
                        Rat  =========
     Lesser Egyptian jerboa  =========
              Domestic goat  =========
                        Cow  =========
                      Sheep  =========
           Tibetan antelope  =========
       David's myotis (bat)  =========
            Star-nosed mole  =========
                    Ferret   =========
                        Cat  =========
                    Manatee  =========
                   Elephant  =========
               Mallard duck  =========
                Rock pigeon  =========
                   Platypus  =========
           Cape golden mole  =========
                   Aardvark  =========
                    Wallaby  =========
                    Opossum  =========
            Tasmanian devil  =========
            Green seaturtle  =========
                        Dog  =========
             Pacific walrus  =========
           Brush-tailed rat  =========
        Crab-eating macaque  NNNNNNNNN
         Chinese tree shrew  =========
                 Chinchilla  =========
               Weddell seal  =========
                 Guinea pig  =========
                     Baboon  =========

Alignment block 34 of 1161 in window, 66769110 - 66769166, 57 bps 
B D                   Human  tgtgctgtggggcccatttccaggttggc-tggtggtattggttggaagaaa-g--------tggta
B D                   Chimp  tgtgctgtggggcccatttccaggttggc-tggtggtattggttggaagaaa-g--------tggta
B D                 Gorilla  tgtgctgtggggcccatttccaggttggc-tggtggtattggttggaagaaa-g--------tggta
B D               Orangutan  tgtgctgtggggcccatttccagtttggc-tggtggtattggatgggagaaa-g--------tggta
B D                  Gibbon  tgtgctgtggggcccatttccagtttggc-tggtggtattggatgggagaaa-g--------tggta
B D                  Rhesus  tgtgctgtggggcccatttccaggttggc-tggtggtattggatgggagaag-g--------aggta
B D     Crab-eating macaque  tgtgctgtggggcccatttccaggttggc-tggtggtattggatgggagaag-g--------aggta
B D            Green monkey  tgtgctgtggggcccatttccaggttggc-tggtggtattggatgggagaag-g--------aggta
B D                Marmoset  tgtgctgtggggtccatttccaggttggcttggtggtattggatgggagaac-g--------tggta
B D         Squirrel monkey  tgtgctgtcgggtccacttccaggttggcccggtggtactagatgggagaaa-g--------tggta
B D                Bushbaby  tctctctctgtttccatttctgagttgattccatgatgctag--ggaaaaaa-a--------ttata
B D                Squirrel  ca-accctactccctatttttgagttgattcagtgattctgg--agaggaaa-t--------tggta
B D          Naked mole-rat  tgtgccccactctc-atttct-acttggcctggtaacactag--agggagaa-a--------tggtc
B D                     Pig  tgtgccctggtgtccatttctaggttggcttcatgacactggaggggggaaa----------tggta
B D                  Alpaca  tgtgccctgctgtccatttctggcttgacttggtgatactggagaggaaaaa-a--------cgcta
             Bactrian camel  tgtgccctgctgtccatttctggcttgacttggtgatactggagagaaaaaa-aaaaaaaagaggta
B D                 Dolphin  tgtgccctggtgtccatttctgggttggcttggtgatactggaggggaaaaa-a--------gggta
               Killer whale  tgtgccctggtgtccatttctgggttggcttggtgatactggaggggaaaaa-a--------gggta
B D                   Horse  ----------------------------------------ggagggg-aaaa-a--------tggta
B D        White rhinoceros  ----------------------------------------agaggggaaaaa-a--------tggta
           Black flying-fox  --tgccttggtgtccatttctgggttggcttggtgatactggagggggaaaaca--------tggta
B D                 Megabat  --tgccttggtgtccatttctgggttggcttggtgatactggagggggaaaaca--------tggta
              Big brown bat  tgtgccttggtgtgcgtttctgggttggctcagtgatactggagggaaaa---a--------tgata
B D                Microbat  --tgccttggtgtgcgtttctgggttggctcagtgatactggaggggaaa---a--------tgata
B D                  Rabbit  ===================================================================
B D                   Shrew  ===================================================================
B D                    Pika  ===================================================================
B D                Hedgehog  ===================================================================
B D               Armadillo  ===================================================================
       Cape elephant shrew  ===================================================================
B D                   Panda  ===================================================================
            Golden hamster  ===================================================================
              Prairie vole  ===================================================================
B D                     Rat  ===================================================================
    Lesser Egyptian jerboa  ===================================================================
             Domestic goat  ===================================================================
B D                     Cow  ===================================================================
B D                   Sheep  ===================================================================
          Tibetan antelope  ===================================================================
      David's myotis (bat)  ===================================================================
           Star-nosed mole  ===================================================================
B D                 Ferret   ===================================================================
B D                     Cat  ===================================================================
B D                 Manatee  ===================================================================
B D                Elephant  ===================================================================
  D            Mallard duck  ===================================================================
  D             Rock pigeon  ===================================================================
B D                Platypus  ===================================================================
          Cape golden mole  ===================================================================
                  Aardvark  ===================================================================
B D                 Wallaby  ===================================================================
B D                 Opossum  ===================================================================
B D         Tasmanian devil  ===================================================================
  D         Green seaturtle  ===================================================================
B D                     Dog  ===================================================================
            Pacific walrus  ===================================================================
          Brush-tailed rat  ===================================================================
        Chinese tree shrew  ===================================================================
                Chinchilla  ===================================================================
              Weddell seal  ===================================================================
B D              Guinea pig  ===================================================================
B D                  Baboon  ===================================================================

Inserts between block 34 and 35 in window
B D               Squirrel 143bp

Alignment block 35 of 1161 in window, 66769167 - 66769199, 33 bps 
B D                   Human  at-ctcttagacagctgggtgat-acttccaattc
B D                   Chimp  at-ctcttagacagctgggtgat-acttccaattc
B D                 Gorilla  at-ctcttagacggctgggtgat-acttccaattc
B D               Orangutan  at-ctcttagacggctgggtgataacttccaattc
B D                  Gibbon  at-ctctttgacggctgggtgat-acttccaattc
B D                  Rhesus  at-ctcttagacggctgggtagt-acttccaattc
B D     Crab-eating macaque  at-ctcttagacggctgggtagt-acttccaattc
B D            Green monkey  at-ctcttagacggctgggtgat-acttccaattc
B D                Marmoset  ct-ctcttagacagctgggtgat-actttgaattc
B D         Squirrel monkey  at-ctcttagacagctgggtgat-actttgaattc
B D                Bushbaby  at-ctcagcgagggttcagtgat-actttaaattc
B D          Naked mole-rat  at-ctcacttagggtttagtagt-aggttgactc-
B D                     Pig  aa-ctccctgagagttcggtgat-gcatggaattc
B D                  Alpaca  aa-ctcaccaagg-ttcagtcat-acattgagttc
             Bactrian camel  aa-ctcaccgagg-ttcagtcat-acattgagttc
B D                 Dolphin  aa-ctcactgaggattcagtgat-attctgaattc
               Killer whale  aa-ctcaccgaggattcagtgat-atactgaattc
B D                   Horse  aa-cttact-agggttcggtgat-ttgttgacttg
B D        White rhinoceros  aa-ctcactgagggttcggtgat-ttattgcattc
           Black flying-fox  aa-ctcactgagggtttggtgat-atgttgaattc
B D                 Megabat  aa-ctcactgagggtttggtgat-atgttgaattc
              Big brown bat  aa-cttacccagggtttggtgat-atattgaattc
B D                Microbat  aattttacccagggtttggtgat-atattgaattc
B D                  Rabbit  ===================================
B D                   Shrew  ===================================
B D                    Pika  ===================================
B D                Hedgehog  ===================================
B D               Armadillo  ===================================
       Cape elephant shrew  ===================================
B D                   Panda  ===================================
            Golden hamster  ===================================
              Prairie vole  ===================================
B D                     Rat  ===================================
    Lesser Egyptian jerboa  ===================================
             Domestic goat  ===================================
B D                     Cow  ===================================
B D                   Sheep  ===================================
          Tibetan antelope  ===================================
      David's myotis (bat)  ===================================
           Star-nosed mole  ===================================
B D                 Ferret   ===================================
B D                Squirrel  ===================================
B D                     Cat  ===================================
B D                 Manatee  ===================================
B D                Elephant  ===================================
  D            Mallard duck  ===================================
  D             Rock pigeon  ===================================
B D                Platypus  ===================================
          Cape golden mole  ===================================
                  Aardvark  ===================================
B D                 Wallaby  ===================================
B D                 Opossum  ===================================
B D         Tasmanian devil  ===================================
  D         Green seaturtle  ===================================
B D                     Dog  ===================================
            Pacific walrus  ===================================
          Brush-tailed rat  ===================================
        Chinese tree shrew  ===================================
                Chinchilla  ===================================
              Weddell seal  ===================================
B D              Guinea pig  ===================================
B D                  Baboon  ===================================

Alignment block 36 of 1161 in window, 66769200 - 66769201, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D                Bushbaby  tg
B D                Squirrel  tg
B D          Naked mole-rat  ca
B D                     Pig  tg
B D                  Alpaca  tg
             Bactrian camel  tg
B D                 Dolphin  tg
               Killer whale  tg
B D                   Horse  ag
B D        White rhinoceros  tg
           Black flying-fox  tg
B D                 Megabat  tg
              Big brown bat  tg
B D                Microbat  tg
B D                  Rabbit  ==
B D                   Shrew  ==
B D                    Pika  ==
B D                Hedgehog  ==
B D               Armadillo  ==
       Cape elephant shrew  ==
B D                   Panda  ==
            Golden hamster  ==
              Prairie vole  ==
B D                     Rat  ==
    Lesser Egyptian jerboa  ==
             Domestic goat  ==
B D                     Cow  ==
B D                   Sheep  ==
          Tibetan antelope  ==
      David's myotis (bat)  ==
           Star-nosed mole  ==
B D                 Ferret   ==
B D                     Cat  ==
B D                 Manatee  ==
B D                Elephant  ==
  D            Mallard duck  ==
  D             Rock pigeon  ==
B D                Platypus  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Wallaby  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
  D         Green seaturtle  ==
B D                     Dog  ==
            Pacific walrus  ==
          Brush-tailed rat  ==
        Chinese tree shrew  ==
                Chinchilla  ==
              Weddell seal  ==
B D              Guinea pig  ==
B D                  Baboon  ==

Inserts between block 36 and 37 in window
B D               Squirrel 3bp
B D         Naked mole-rat 3bp

Alignment block 37 of 1161 in window, 66769202 - 66769264, 63 bps 
B D                   Human  gtcttc---cccactt------ctccattttgcttttcagaatcctcaaaaatagtgcacagtgcatact
B D                   Chimp  gtcttc---cccactt------ctccattttgcttttcagaatcctcaaaaatagtgcacagtgcatact
B D                 Gorilla  gtcttc---cctactt------ctccattttgcttttcagaatcctcaaaaatagtgcacagtgcatact
B D               Orangutan  gtcttc---cccactt------ctccattttgcctttcagaatcctcaaaaatagtgcacagtgcatact
B D                  Gibbon  gtcttc---cccactt------ctccattttgcttttcagaatcctcaaaaatagtgcacagtgcatact
B D                  Rhesus  gtcttc---cccactt------ctccattttgcttttcagaatcctcaaaagtagtgcacagtgcatact
B D     Crab-eating macaque  gtcttc---cccactt------ctccattttgcttttcagaatcctcaaaagtagtgcacagtgcatact
B D            Green monkey  gtcttc---cccactt------ctgcattttgcttttcagaatcctcaaaagtagtgcacagtgcatact
B D                Marmoset  gtcttc---cccactt------ctccattttgcttttcagaatcttcaaaagcagtgcacagtgcattct
B D         Squirrel monkey  gtcttc---cccactt------ctccgttttgcttttcaaaatcctcaaaagtagttcacagtgcattct
B D                Bushbaby  gtcttcttgcccaatt------ctcc-ttttgcttttcagaatcctcaaaagtggtgctccctgtgtact
B D                Squirrel  tttatc---cccaatt---catctcctttttgcttttgagc-------------------------aatc
B D          Naked mole-rat  ttcttt---cccagtt---------ttgttcgcttttgagcttcctctaaggtagtgttcagtgtgtgcc
B D                  Rabbit  gtattc---tccaatt------ctcccttttgcttttgagaattctcaaaagtagtggttgatgcatgtt
B D                     Pig  gtctccttcccccgttctcctcct----------------------ctaaagtggtgcttagcacgtgcc
B D                  Alpaca  gtctt----ctcaattctcctctttccttttgcctttgagaaaccgccaaagtagtgcttagtgcatacc
             Bactrian camel  gtctt----ctcaattctcctctttccttttgcctttgagaaaccgccaaagtagtgcttagtgcatgcc
B D                 Dolphin  gtcttcttccttaattcttctcctcccttttgcctttgaaaatcctcaaaaatagtgcttagcgcatgcc
               Killer whale  gtcttcttccttaattcttctcctcccttttgcctttgaaaatcctcaaaaatagtgcttagcgcgtgcc
B D                   Horse  gtcatcttctccaattctccttctcccttttgcctttgagaatcctcaaaagtagtgcttgatgcaaacc
B D        White rhinoceros  gtcttcttccccaattttccttctcccctttgcctttgagaattctcaaaagtagttctcaatgcaaacc
           Black flying-fox  gtcttc---cctaattctactcctcccttttgcctttgagaatctccaaaagtggtgctcagtatatact
B D                 Megabat  gtcttc---cctaattctactcctcccttttgcctttgagaatctccaaaagtggtgctcagtatatact
              Big brown bat  gtcttcttccccaattctcctcctcccttttgctgttgagaatcccc-aaagtagtgctcaatgtatatc
B D                Microbat  gtcttctttcccaattctcctcctcccttttgccgttgagaatcccc--aagtagtgcttagtgtatacc
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================

                      Human  gt
                      Chimp  gt
                    Gorilla  gt
                  Orangutan  gt
                     Gibbon  gt
                     Rhesus  ga
        Crab-eating macaque  ga
               Green monkey  gt
                   Marmoset  gt
            Squirrel monkey  gt
                   Bushbaby  gt
                   Squirrel  ct
             Naked mole-rat  ct
                     Rabbit  gt
                        Pig  at
                     Alpaca  at
             Bactrian camel  at
                    Dolphin  at
               Killer whale  at
                      Horse  at
           White rhinoceros  at
           Black flying-fox  at
                    Megabat  at
              Big brown bat  at
                   Microbat  at
                      Shrew  ==
                       Pika  ==
                   Hedgehog  ==
                  Armadillo  ==
        Cape elephant shrew  ==
                      Panda  ==
             Golden hamster  ==
               Prairie vole  ==
                        Rat  ==
     Lesser Egyptian jerboa  ==
              Domestic goat  ==
                        Cow  ==
                      Sheep  ==
           Tibetan antelope  ==
       David's myotis (bat)  ==
            Star-nosed mole  ==
                    Ferret   ==
                        Cat  ==
                    Manatee  ==
                   Elephant  ==
               Mallard duck  ==
                Rock pigeon  ==
                   Platypus  ==
           Cape golden mole  ==
                   Aardvark  ==
                    Wallaby  ==
                    Opossum  ==
            Tasmanian devil  ==
            Green seaturtle  ==
                        Dog  ==
             Pacific walrus  ==
           Brush-tailed rat  ==
         Chinese tree shrew  ==
                 Chinchilla  ==
               Weddell seal  ==
                 Guinea pig  ==
                     Baboon  ==

Alignment block 38 of 1161 in window, 66769265 - 66769265, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  c
B D                Squirrel  a
B D          Naked mole-rat  t
B D                  Rabbit  c
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
B D                   Horse  c
B D        White rhinoceros  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  a
B D                Microbat  a
B D                   Shrew  =
B D                    Pika  =
B D                Hedgehog  =
B D               Armadillo  =
       Cape elephant shrew  =
B D                   Panda  =
            Golden hamster  =
              Prairie vole  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
             Domestic goat  =
B D                     Cow  =
B D                   Sheep  =
          Tibetan antelope  =
      David's myotis (bat)  =
           Star-nosed mole  =
B D                 Ferret   =
B D                     Cat  =
B D                 Manatee  =
B D                Elephant  =
  D            Mallard duck  =
  D             Rock pigeon  =
B D                Platypus  =
          Cape golden mole  =
                  Aardvark  =
B D                 Wallaby  =
B D                 Opossum  =
B D         Tasmanian devil  =
  D         Green seaturtle  =
B D                     Dog  =
            Pacific walrus  =
          Brush-tailed rat  =
        Chinese tree shrew  =
                Chinchilla  =
              Weddell seal  =
B D              Guinea pig  =

Inserts between block 38 and 39 in window
B D                 Baboon 16bp

Alignment block 39 of 1161 in window, 66769266 - 66769281, 16 bps 
B D                   Human  cagatttgatagctgg
B D                   Chimp  cagatttgacagctgg
B D                 Gorilla  cagatttgatagctgg
B D               Orangutan  caggtttgatagctgg
B D                  Gibbon  caggtttgatagctgg
B D                  Rhesus  caggtttgatagctgg
B D     Crab-eating macaque  caggtttgatagctgg
B D            Green monkey  caggtttgatagctgg
B D                Marmoset  cag-------------
B D         Squirrel monkey  cag-------------
B D                Bushbaby  caggttttatagctga
B D                Squirrel  caggttttctagctgg
B D          Naked mole-rat  caggctttatagctgg
B D                  Rabbit  ca---tttatagctgg
B D                     Pig  taggttttatagctgg
B D                  Alpaca  tagg-tttatagctgg
             Bactrian camel  tagg-tttgtagctgg
B D                 Dolphin  taggttttatagctgg
               Killer whale  taggttttatagctgg
B D                   Horse  caggttttatagctgg
B D        White rhinoceros  caggttttatagctgg
           Black flying-fox  caggttttatagctgg
B D                 Megabat  caggttttatagctgg
              Big brown bat  catattttatagctgg
B D                Microbat  cacattttatagctgg
B D                   Shrew  ================
B D                    Pika  ================
B D                Hedgehog  ================
B D               Armadillo  ================
       Cape elephant shrew  ================
B D                   Panda  ================
            Golden hamster  ================
              Prairie vole  ================
B D                     Rat  ================
    Lesser Egyptian jerboa  ================
             Domestic goat  ================
B D                     Cow  ================
B D                   Sheep  ================
          Tibetan antelope  ================
      David's myotis (bat)  ================
           Star-nosed mole  ================
B D                 Ferret   ================
B D                     Cat  ================
B D                 Manatee  ================
B D                Elephant  ================
  D            Mallard duck  ================
  D             Rock pigeon  ================
B D                Platypus  ================
          Cape golden mole  ================
                  Aardvark  ================
B D                 Wallaby  ================
B D                 Opossum  ================
B D         Tasmanian devil  ================
  D         Green seaturtle  ================
B D                     Dog  ================
            Pacific walrus  ================
          Brush-tailed rat  ================
        Chinese tree shrew  ================
                Chinchilla  ================
              Weddell seal  ================
B D              Guinea pig  ================
B D                  Baboon  ================

Alignment block 40 of 1161 in window, 66769282 - 66769387, 106 bps 
B D                   Human  atgaaatctgtgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcag---t
B D                   Chimp  atgaaatctgtgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcag---t
B D                 Gorilla  atgaaatctgtgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcag---t
B D               Orangutan  atgaaatctgtgaggcctctcac-------ctcagcaac-tgcagtcgctg--------tgctcag---t
B D                  Gibbon  atgaaatctgtgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcag---t
B D                  Rhesus  gtgaaatctgtgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcaa---t
B D     Crab-eating macaque  gtgaaatctgtgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcaa---t
B D                  Baboon  atgaaatctgcgaggcctctctc-------cccagcaac-tgcagtcgctg--------tgctcaa---t
B D            Green monkey  gtgaaatctgtgaggcctctctc-------cccagcaac-tgcaatcgctg--------tgctcaa---t
B D                Marmoset  ----ggtctgtgaggtctctctc-------cccagcaac-tgcagtcactg--------tgct--g---t
B D         Squirrel monkey  ----gatctgtgaggtctctctc-------cccagcaac-tgcagtcactg--------tgctcag---t
B D                Bushbaby  aagaaacctgcaacatttctttc-------cttgacaac-tgcagccactga-tgtttctgctcag---t
B D                Squirrel  tctaagtctgtgaaatctctctctctctctctctgtctc-cgtaggcactga-tgtccatgttcag---t
B D          Naked mole-rat  agtaag--tgtcaagtgtc-----------ccctttctc-tgcagctgctga-tgtctgtgttcca---t
B D                  Rabbit  atgaagtctatctaag------------------------tgcagctgctga-tgtctctgctcag---t
B D                     Pig  actgcccctgtgaag--tctctc-------ccacactgggtg-ggccgctca-tgtctgtcctc-----a
B D                  Alpaca  actaaacctgtgaaa--tctctc-------ccccacaacatctggtcactga-tgtctgtcc-------t
             Bactrian camel  actaaacctgtgaaatctctctc-------ccccacaacatctggtcactga-tgtctgtcc-------t
B D                 Dolphin  actacacctgtgaggtctctctt-------ccccacaccctgtggctgcttattgtctgtcctca----t
               Killer whale  actacacctgtgaagtctctctt-------ccccacaccctgcggctgctca--gtctgtcctca----t
B D                   Horse  actaaatctgtgaggtttctctc-------tcccacaaggtgtggcccctga-tatctgtgctcaatttt
B D        White rhinoceros  attaaatctgtgaggtctctgcc-------ctccacaacgtgtggcctctga-tgtctgtgctcagtttt
           Black flying-fox  actaaatctgtgaagtctgtctc-------tctcatagcatgtggcccttga-tgtctgtgttcaatttt
B D                 Megabat  actaaatctgtgaagtctgtctc-------tctcatagcatatggcccttga-tgtctgtgttcaatttt
              Big brown bat  actaagact----------------------------tcacatggcccttga-tgtc----------tgt
B D                Microbat  actaagact----------------------------tcatgtggcccttga-tgtctg-------ttgt
B D                   Shrew  ======================================================================
B D                    Pika  ======================================================================
B D                Hedgehog  ======================================================================
B D               Armadillo  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
      David's myotis (bat)  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Ferret   ======================================================================
B D                     Cat  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
  D            Mallard duck  ======================================================================
  D             Rock pigeon  ======================================================================
B D                Platypus  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D                     Dog  ======================================================================
            Pacific walrus  ======================================================================
          Brush-tailed rat  ======================================================================
        Chinese tree shrew  ======================================================================
                Chinchilla  ======================================================================
              Weddell seal  ======================================================================
B D              Guinea pig  ======================================================================

                      Human  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
                      Chimp  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
                    Gorilla  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
                  Orangutan  t---tttctt----------------------------------ccatgttttca--ttt-atgcctgac
                     Gibbon  t---tttctt----------------------------------tcttgtttttg--ctt-acgcctgac
                     Rhesus  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
        Crab-eating macaque  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
                     Baboon  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
               Green monkey  t---tttctt----------------------------------ccttgttttca--ttt-atgcctgac
                   Marmoset  t---tttctt-------------------------------------tgttttca--ttt-atgcctgac
            Squirrel monkey  t---tttctt-------------------------------------tgttttca--ttt-atgcctgac
                   Bushbaby  t---tttctt----------------------------------ccttgtcttta-tttt-atgcctgcc
                   Squirrel  t---ttctcc-----------------------------------------ccta--tttgatgcctg--
             Naked mole-rat  t---tcccct--------------------------------------gagttta--ttt-aggcctaac
                     Rabbit  t---ttttccctttgttttattttgtgctctgctcagttttttccctttgtttta--ttttgtgcccggc
                        Pig  t---ttctgt----------------------------------tcttgttttaattttt-accctgaac
                     Alpaca  t---ttttcc----------------------------------tcttgtttttattttt-atccttgac
             Bactrian camel  t---ttttcc----------------------------------tcttgtttttattttt-atccttgac
                    Dolphin  t---tttttt----------------------------------tcttatatttattttt-atccttgat
               Killer whale  t---tttttt----------------------------------tcttatatttattttt-atccttgat
                      Horse  tttcttgttt----------------------------------ttacttttttagtttt-attc-----
           White rhinoceros  t---ttattt----------------------------------ttatttttttagtttt-attc-----
           Black flying-fox  t---gtttgt----------------------------------ttgtttgtttgttttt-atgcttga-
                    Megabat  t---gtttgt----------------------------------ttgtttgtttgttttt-atgcttga-
              Big brown bat  t---gctttt----------------------------------tcttgtttttattttt-atgcttgac
                   Microbat  t---gctttt----------------------------------tcttgtttttattttt-atgcttgac
                      Shrew  ======================================================================
                       Pika  ======================================================================
                   Hedgehog  ======================================================================
                  Armadillo  ======================================================================
        Cape elephant shrew  ======================================================================
                      Panda  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
       David's myotis (bat)  ======================================================================
            Star-nosed mole  ======================================================================
                    Ferret   ======================================================================
                        Cat  ======================================================================
                    Manatee  ======================================================================