Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1260 in window, 23070574 - 23070583, 10 bps 
B D                     Human  ag----------------tgagccga-------
B D                    Gibbon  ag----------------tgagcaga-------
B D       Crab-eating macaque  ag----------------tgagccga-------
B D                    Baboon  ag----------------tgagccga-------
B D              Green monkey  ag----------------tgagccga-------
B D                  Marmoset  ag----------------tgagccga-------
B D                  Bushbaby  ag----------------tgagtgga-------
B D                  Squirrel  ag----------------tgagcgca-------
       Lesser Egyptian jerboa  ag----------------cggac----------
                 Prairie vole  ag----------------tgagcgca-------
               Golden hamster  ag----------------tgagcgca-------
B D                     Mouse  ag----------------tgagcgca-------
B D                       Rat  ag----------------tgagcgca-------
B D            Naked mole-rat  ag----------------taagcgga-------
B D                Guinea pig  ag----------------tgagcgga-------
                   Chinchilla  ag----------------tgagcgga-------
             Brush-tailed rat  ag----------------tgagcgga-------
B D                      Pika  ag----------------tgaaagcg-------
                 Killer whale  ag----------------tgagcggc-------
               Pacific walrus  ag----------------tgagcgga-------
                 Weddell seal  ag----------------tgagcgga-------
B D                   Megabat  ag----------------tgagcgca-------
B D                  Hedgehog  ag----------------tgagcgga-------
B D                     Shrew  ag----------------taagcgga-------
B D                  Elephant  ag----------------tgtg-----------
             Cape golden mole  ag----------------tgca-----------
                     Aardvark  ag----------------tgtg-----------
B D                 Armadillo  ag----------------tgaa-----------
B D                   Opossum  aa----------------agctcggc-------
B D           Tasmanian devil  ag----------------agc------------
B D                  Platypus  aa----------------tcga-----------
  D               Rock pigeon  gc--------------gcagatccagcacctgc
  D       Collared flycatcher  ggtctaaccccgcgggagtggtcccggggcggg
B D               Zebra finch  aa-----------------------aaggcggc
           Tibetan ground jay  ag------------cgacttggccggcggccg-
B D                   Chicken  gg----------------tcgggatgcggccgg
B D        American alligator  gg----------------agcgcccgccggtgc
  D            Painted turtle  gg--------------------atctgagccgc
  D  Chinese softshell turtle  gg----------------------------cgc
             Star-nosed mole  =================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  =================================
B D       Medium ground finch  =================================
B D                Budgerigar  =================================
B D                    Turkey  =================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  =================================
B D                     Panda  =================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  =================================
                 Spotted gar  =================================
B D                Coelacanth  =================================
  D    White-throated sparrow  =================================
  D          Peregrine falcon  =================================
B D                   Lamprey  =================================
  D              Saker falcon  =================================
B D                    Lizard  =================================
B D                       Pig  =================================
B D                   Dolphin  =================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  =================================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  =================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Orangutan  =================================
B D                     Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 1 and 2 in window
B D               Guinea pig 1bp
B D                  Opossum 4bp

Alignment block 2 of 1260 in window, 23070584 - 23070592, 9 bps 
B D                     Human  -------cccgcgg-cc
B D                     Chimp  -------cccgcgg-cc
B D                    Gibbon  -------cccgcgg-cc
B D       Crab-eating macaque  -------cccgcgg-cc
B D                    Baboon  -------cccgcgg-cc
B D              Green monkey  -------cccgcgg-cc
B D                  Marmoset  -------cccgcgg-cc
B D                  Bushbaby  -------cccgcggccc
B D                  Squirrel  -------cccgcga-cc
       Lesser Egyptian jerboa  -------cccggaa-cc
                 Prairie vole  -------ccagcgg-cc
               Golden hamster  -------ccagcgg-cc
B D                     Mouse  -------ccagcgg-cc
B D                       Rat  -------ccagcgg-cc
B D            Naked mole-rat  -------ccctcgg-ct
B D                Guinea pig  -------ccctcag-ct
                   Chinchilla  -------cccgcgg-ct
             Brush-tailed rat  -------ccctctg-ct
B D                      Pika  ----------gcgg-tt
                 Killer whale  -------cccgcgg-cc
               Pacific walrus  -------cccgcgg-cc
                 Weddell seal  -------cccgcgg-cc
B D                   Megabat  -------cctgcgg-cc
B D                  Hedgehog  -------ccagcgg-ct
B D                     Shrew  -------ccagctg-cc
B D                  Elephant  ---------------c-
             Cape golden mole  ---------------c-
                     Aardvark  ---------------c-
B D                 Armadillo  ---------------c-
B D                   Opossum  -------ctcgggg-t-
B D           Tasmanian devil  -------ctgggtg-t-
B D                  Platypus  -------ccgaggg-c-
  D               Rock pigeon  g-----gagggtcc---
  D       Collared flycatcher  g-----ctgagccg---
B D               Zebra finch  g-----cagagcgc---
           Tibetan ground jay  g-----ccgagcac---
B D                   Chicken  g-----gcggataa---
B D        American alligator  gcttttctgggtcg---
  D            Painted turtle  t-----cgccgctg---
  D  Chinese softshell turtle  a-----cgcagc-----
             Star-nosed mole  =================
B D           Chinese hamster  NNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNN
  D              Mallard duck  =================
B D       Medium ground finch  =================
B D                Budgerigar  =================
B D                    Turkey  =================
          Chinese tree shrew  NNNNNNNNNNNNNNNNN
B D                    Rabbit  NNNNNNNNNNNNNNNNN
B D                   Manatee  =================
B D                     Panda  =================
               Domestic goat  NNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNN
            Tibetan antelope  =================
                 Spotted gar  =================
B D                Coelacanth  =================
  D    White-throated sparrow  =================
  D          Peregrine falcon  =================
B D                   Lamprey  =================
  D              Saker falcon  =================
B D                    Lizard  =================
B D                       Pig  =================
B D                   Dolphin  =================
B D                   Gorilla  NNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNN
            Black flying-fox  =================
B D                   Ferret   NNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNN
B D                     Horse  =================
              Bactrian camel  NNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNN
B D                 Orangutan  =================

Inserts between block 2 and 3 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                     Pika 1bp

Alignment block 3 of 1260 in window, 23070593 - 23070598, 6 bps 
B D                     Human  ggccgc-
B D                     Chimp  ggccgc-
B D                    Gibbon  gggcgc-
B D       Crab-eating macaque  gggcgc-
B D                    Baboon  gggcgc-
B D              Green monkey  aggcgc-
B D                  Marmoset  ggacgc-
B D                  Bushbaby  aggagc-
           Chinese tree shrew  gggcga-
B D                  Squirrel  cgatga-
       Lesser Egyptian jerboa  gggcgc-
                 Prairie vole  cggcgc-
               Golden hamster  cggcgc-
B D                     Mouse  cggcgc-
B D                       Rat  cggcgc-
B D            Naked mole-rat  gagcgc-
B D                Guinea pig  gagcgc-
                   Chinchilla  gagcgc-
             Brush-tailed rat  gagcgc-
B D                      Pika  g---gt-
                 Killer whale  -ggggc-
               Pacific walrus  -ggggc-
                 Weddell seal  -ggggc-
B D                   Megabat  -gggag-
B D                  Hedgehog  -g-----
B D                     Shrew  -ggggc-
B D                  Elephant  ggccgc-
             Cape golden mole  ggccgt-
                     Aardvark  agtcac-
B D                 Armadillo  gacccg-
B D                   Opossum  -ggctc-
B D           Tasmanian devil  -ag----
  D               Rock pigeon  -tgtgcc
  D       Collared flycatcher  -ggtcta
B D               Zebra finch  -gatgcc
           Tibetan ground jay  -ggcgcc
B D                   Chicken  -ggcgct
B D        American alligator  -ttcgtc
  D            Painted turtle  -ggcccc
  D  Chinese softshell turtle  -agcccc
             Star-nosed mole  =======
B D           Chinese hamster  NNNNNNN
B D                    Alpaca  NNNNNNN
  D              Mallard duck  =======
B D       Medium ground finch  =======
B D                Budgerigar  =======
B D                    Turkey  =======
B D                    Rabbit  NNNNNNN
B D                   Manatee  =======
B D                     Panda  =======
               Domestic goat  NNNNNNN
B D                     Sheep  NNNNNNN
B D                       Cow  NNNNNNN
            Tibetan antelope  =======
                 Spotted gar  =======
B D                Coelacanth  =======
B D                  Platypus  -------
  D    White-throated sparrow  =======
  D          Peregrine falcon  =======
B D                   Lamprey  =======
  D              Saker falcon  =======
B D                    Lizard  =======
B D                       Pig  =======
B D                   Dolphin  =======
B D                   Gorilla  NNNNNNN
               Big brown bat  NNNNNNN
B D                       Cat  NNNNNNN
        David's myotis (bat)  NNNNNNN
            Black flying-fox  =======
B D                   Ferret   NNNNNNN
B D                       Dog  NNNNNNN
B D          White rhinoceros  NNNNNNN
B D                     Horse  =======
              Bactrian camel  NNNNNNN
B D           Squirrel monkey  NNNNNNN
B D                    Rhesus  NNNNNNN
B D                 Orangutan  =======

Inserts between block 3 and 4 in window
                    Aardvark 5923bp
B D                Armadillo 11bp
B D                  Opossum 1bp

Alignment block 4 of 1260 in window, 23070599 - 23070602, 4 bps 
B D                     Human  gcg-----------c
B D                     Chimp  gcg-----------c
B D                    Gibbon  gcg-----------c
B D       Crab-eating macaque  gcg-----------c
B D                    Baboon  gcg-----------c
B D              Green monkey  gcg-----------c
B D                  Marmoset  gcg-----------c
B D                  Bushbaby  gcg-----------c
           Chinese tree shrew  gcg-----------c
B D                  Squirrel  gcg-----------a
       Lesser Egyptian jerboa  gcg-----------c
                 Prairie vole  gca-----------c
               Golden hamster  gca-----------c
B D                     Mouse  gca-----------c
B D                       Rat  gca-----------c
B D            Naked mole-rat  ccg-----------g
B D                Guinea pig  gcg-----------c
                   Chinchilla  gcg-----------c
             Brush-tailed rat  gcg-----------c
B D                      Pika  gcg-----------g
                 Killer whale  gcg-----------c
               Pacific walrus  gcg-----------c
                 Weddell seal  gcg-----------c
B D                   Megabat  gtg-----------c
B D                     Shrew  gcg-----------c
B D                  Elephant  gcg-----------c
             Cape golden mole  gcg-----------c
                     Aardvark  cca-----------c
B D                 Armadillo  gcg-----------c
B D                   Opossum  gcg-----------t
B D           Tasmanian devil  --g-----------c
B D                  Platypus  gcc-----------c
  D               Rock pigeon  accgcctggggctgc
  D       Collared flycatcher  acc-----------c
B D               Zebra finch  g-c-----------c
           Tibetan ground jay  ctc-----------c
B D                   Chicken  gtg-----------c
B D        American alligator  gtg-----------c
  D            Painted turtle  ccg-----------c
  D  Chinese softshell turtle  ttc-----------c
B D                  Hedgehog  ---------------
             Star-nosed mole  ===============
B D           Chinese hamster  NNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNN
  D              Mallard duck  ===============
B D       Medium ground finch  ===============
B D                Budgerigar  ===============
B D                    Turkey  ===============
B D                    Rabbit  NNNNNNNNNNNNNNN
B D                   Manatee  ===============
B D                     Panda  ===============
               Domestic goat  NNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNN
            Tibetan antelope  ===============
                 Spotted gar  ===============
B D                Coelacanth  ===============
  D    White-throated sparrow  ===============
  D          Peregrine falcon  ===============
B D                   Lamprey  ===============
  D              Saker falcon  ===============
B D                    Lizard  ===============
B D                       Pig  ===============
B D                   Dolphin  ===============
B D                   Gorilla  NNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNN
            Black flying-fox  ===============
B D                   Ferret   NNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNN
B D                     Horse  ===============
              Bactrian camel  NNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNN
B D                 Orangutan  ===============

Inserts between block 4 and 5 in window
B D                Armadillo 99bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 5 of 1260 in window, 23070603 - 23070609, 7 bps 
B D                     Human  cgctgag-----
B D                     Chimp  cgctgag-----
B D                    Gibbon  cgctgag-----
B D       Crab-eating macaque  cgctgag-----
B D                    Baboon  cgctgag-----
B D              Green monkey  cgctgag-----
B D                  Marmoset  cgcagag-----
B D                  Bushbaby  ggc---------
           Chinese tree shrew  ggctgag-----
B D                  Squirrel  ggttgag-----
       Lesser Egyptian jerboa  cgcggag-----
                 Prairie vole  gg-tgaa-----
               Golden hamster  agctgaa-----
B D                     Mouse  agctgaa-----
B D                       Rat  agctgaa-----
B D            Naked mole-rat  gactgag-----
B D                Guinea pig  tactgaa-----
                   Chinchilla  gactgag-----
             Brush-tailed rat  gaccgag-----
B D                      Pika  agctcaa-----
                 Killer whale  ggcgga------
               Pacific walrus  ggcagaa-----
                 Weddell seal  ggcagaa-----
B D                   Megabat  ggctgag-----
B D                  Hedgehog  -----ag-----
B D                     Shrew  agcgaag-----
B D                  Elephant  ggtgaag-----
             Cape golden mole  ggtggag-----
                     Aardvark  tgggtgc-----
B D                   Opossum  cccgga------
B D           Tasmanian devil  cccggg------
B D                  Platypus  cgccgag-----
  D               Rock pigeon  ---cgctgcagc
  D       Collared flycatcher  ---cgcg-----
B D               Zebra finch  ---tgc------
           Tibetan ground jay  ---gacttcagc
B D                   Chicken  ---tgag--cgc
B D        American alligator  ---agggctggc
  D            Painted turtle  ---catg-----
  D  Chinese softshell turtle  ---cagg-----
             Star-nosed mole  ============
B D           Chinese hamster  NNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNN
  D              Mallard duck  ============
B D       Medium ground finch  ============
B D                Budgerigar  ============
B D                    Turkey  ============
B D                 Armadillo  ============
B D                    Rabbit  NNNNNNNNNNNN
B D                   Manatee  ============
B D                     Panda  ============
               Domestic goat  NNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNN
            Tibetan antelope  ============
                 Spotted gar  ============
B D                Coelacanth  ============
  D    White-throated sparrow  ============
  D          Peregrine falcon  ============
B D                   Lamprey  ============
  D              Saker falcon  ============
B D                    Lizard  ============
B D                       Pig  ============
B D                   Dolphin  ============
B D                   Gorilla  NNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNN
            Black flying-fox  ============
B D                   Ferret   NNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNN
B D                     Horse  ============
              Bactrian camel  NNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNN
B D                 Orangutan  ============

Inserts between block 5 and 6 in window
B D                  Opossum 2bp
B D          Tasmanian devil 2bp

Alignment block 6 of 1260 in window, 23070610 - 23070632, 23 bps 
B D                     Human  cctca----gggg--tc----------------------------g-------------------ggggc
B D                     Chimp  cctca----gggg--tc----------------------------g-------------------gggtc
B D                 Orangutan  cctcg----gggg--tc----------------------------g-------------------agggc
B D                    Gibbon  cctcg----gggg--tc----------------------------g-------------------ggggc
B D       Crab-eating macaque  cctcg----gggg--tc----------------------------g-------------------ggagc
B D                    Baboon  cctcg----gggg--tc----------------------------g-------------------ggggc
B D              Green monkey  cctcg----gggg--tc----------------------------g-------------------ggggc
B D                  Marmoset  cctca----gggg--tc----------------------------g-------------------ggggc
B D                  Bushbaby  ----------gga--tc----------------------------a-------------------gggtc
           Chinese tree shrew  cctcc----ccgg--t-----------------------------g-------------------ggggc
B D                  Squirrel  atcca----gggg--tc----------------------------a-------------------ggggc
       Lesser Egyptian jerboa  --ccc----tgga--tcccgcggataagaggtggcggcgcgggggg-------------------ggggc
                 Prairie vole  --ccc----tggg--ct----------------------------g-------------------ggggc
               Golden hamster  --ccc----aggg--ct----------------------------g-------------------ggggc
B D                     Mouse  --ccc----gggg--ct----------------------------g-------------------ggggc
B D                       Rat  --ccc----gggg--ct----------------------------g-------------------ggggc
B D            Naked mole-rat  accct----gggg--tc----------------------------g-------------------ggggt
B D                Guinea pig  cccct----aggg--tc----------------------------g-------------------ggggt
                   Chinchilla  accct----gggg--tc----------------------------g-------------------ggggc
             Brush-tailed rat  accca----gggg--tc----------------------------g-------------------ggggc
B D                      Pika  --tccgagagggg--tc--------------------------gtg-------------------ggggc
                 Killer whale  --cct----gggga-cg----------------------------g-------------------ggggc
               Pacific walrus  cctcg----ggggg-ct----------------------------g-------------------gggga
                 Weddell seal  cctcg----ggggg-ct----------------------------g-------------------gggga
B D                   Megabat  cctca----ggggg-cc----------------------------g-------------------ggggc
B D                  Hedgehog  ccccg----ggggagca----------------------------g-------------------ggggt
B D                     Shrew  cctct----ggggaccc----------------------------g-------------------ggagt
B D                  Elephant  ----------------c----------------------------t-------------------tggcc
             Cape golden mole  ----------------c----------------------------c-------------------agg-t
                     Aardvark  ----------------c----------------------------c-------------------gggtc
B D                   Opossum  tcctt----cgat--tt----------------------------gcgtcaccacctgaac----aggcc
B D           Tasmanian devil  agcct----gtgg--tg----------------------------g-----------gggc----tggga
B D                  Platypus  gctca----gggg--ac----------------------------g-------------------gggac
  D               Rock pigeon  -----------------------------------------------------acgtgagt---ctgggc
  D       Collared flycatcher  -----------------------------------------------------------------ggagt
B D               Zebra finch  -----------------------------------------------------------------ggagc
           Tibetan ground jay  -----------------------------------------------------cc---------cggggc
B D                   Chicken  -----------------------------------------------------acggggga---ggtgac
B D        American alligator  -----------------------------------------------------gtgcaagagccgaaggc
  D            Painted turtle  -----------------------------------------------------------------tgggc
  D  Chinese softshell turtle  -----------------------------------------------------------------ccagt
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  ======================================================================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  a--------cgg-----cc
                        Chimp  a--------cgg-----cc
                    Orangutan  a--------cgg-----cc
                       Gibbon  a--------cgg-----cc
          Crab-eating macaque  a--------tga-----cc
                       Baboon  a--------tga-----cc
                 Green monkey  a--------tga-----cc
                     Marmoset  a--------cgg-----cc
                     Bushbaby  g--------cgg-----cc
           Chinese tree shrew  g--------cgg-----ca
                     Squirrel  g--------ctg-----cc
       Lesser Egyptian jerboa  gcggtcggacgg-----tc
                 Prairie vole  g--------cgg-----ct
               Golden hamster  g--------cgg-----ct
                        Mouse  g--------cgg-----ct
                          Rat  g--------cgg-----ct
               Naked mole-rat  g--------cgg-----cc
                   Guinea pig  g--------cgg-----cc
                   Chinchilla  g--------cgg-----cc
             Brush-tailed rat  g--------cgg-----cc
                         Pika  g--------cgg-----cc
                 Killer whale  g--------cgg-----cc
               Pacific walrus  g--------cgg-----ct
                 Weddell seal  g--------cgg-----ct
                      Megabat  g--------cgg-----ct
                     Hedgehog  g--------cga------c
                        Shrew  g--------cga-----cc
                     Elephant  g--------tgg-----gc
             Cape golden mole  g--------ggg-----gc
                     Aardvark  c--------ctg-----ac
                      Opossum  g--------cag-----cc
              Tasmanian devil  g--------ggg-----aa
                     Platypus  g--------gga-----cg
                  Rock pigeon  g--------ctg-----gg
          Collared flycatcher  g--------gtc-----cc
                  Zebra finch  g--------ctc-----tc
           Tibetan ground jay  g--------cca-----cc
                      Chicken  g--------ctg-----cc
           American alligator  a--------att-----tc
               Painted turtle  a--------act-----cc
     Chinese softshell turtle  g--------gccgctcgcc
              Star-nosed mole  ===================
              Chinese hamster  NNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNN
                 Mallard duck  ===================
          Medium ground finch  ===================
                   Budgerigar  ===================
                       Turkey  ===================
                    Armadillo  ===================
                       Rabbit  NNNNNNNNNNNNNNNNNNN
                      Manatee  ===================
                        Panda  ===================
                Domestic goat  NNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ===================
                  Spotted gar  ===================
                   Coelacanth  ===================
       White-throated sparrow  ===================
             Peregrine falcon  ===================
                      Lamprey  ===================
                 Saker falcon  ===================
                       Lizard  ===================
                          Pig  ===================
                      Dolphin  ===================
                      Gorilla  NNNNNNNNNNNNNNNNNNN
                Big brown bat  NNNNNNNNNNNNNNNNNNN
                          Cat  NNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNN
             Black flying-fox  ===================
                      Ferret   NNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNN
             White rhinoceros  NNNNNNNNNNNNNNNNNNN
                        Horse  ===================
               Bactrian camel  NNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNN

Inserts between block 6 and 7 in window
          Chinese tree shrew 2bp
B D                     Pika 6bp
  D              Rock pigeon 17bp
  D      Collared flycatcher 16bp
B D              Zebra finch 139bp
          Tibetan ground jay 33bp
B D       American alligator 4bp
  D           Painted turtle 3bp
  D Chinese softshell turtle 8bp

Alignment block 7 of 1260 in window, 23070633 - 23070636, 4 bps 
B D                     Human  gggg
B D                     Chimp  gggg
B D                 Orangutan  gggt
B D                    Gibbon  gggg
B D       Crab-eating macaque  gggg
B D                    Baboon  gggg
B D              Green monkey  gggg
B D                  Marmoset  cggg
B D                  Bushbaby  gggg
           Chinese tree shrew  gggg
B D                  Squirrel  gggg
       Lesser Egyptian jerboa  ggg-
                 Prairie vole  ggg-
               Golden hamster  ggg-
B D                     Mouse  ggg-
B D                       Rat  ggg-
B D            Naked mole-rat  gggg
B D                Guinea pig  -agg
                   Chinchilla  gggg
             Brush-tailed rat  gggg
B D                      Pika  aggg
                 Killer whale  ggga
               Pacific walrus  gggg
                 Weddell seal  gggg
B D                   Megabat  gggg
B D                  Hedgehog  gggg
B D                     Shrew  cggg
B D                  Elephant  gcgg
             Cape golden mole  gcgg
                     Aardvark  agtg
B D                   Opossum  gggc
B D           Tasmanian devil  gggg
B D                  Platypus  gggg
  D               Rock pigeon  -ggg
  D       Collared flycatcher  -ggg
B D               Zebra finch  -ggg
           Tibetan ground jay  -ctg
B D                   Chicken  ccgg
B D        American alligator  ---g
  D  Chinese softshell turtle  --gg
             Star-nosed mole  ====
B D           Chinese hamster  NNNN
B D                    Alpaca  NNNN
  D              Mallard duck  ====
B D       Medium ground finch  ====
B D                Budgerigar  ====
B D                    Turkey  ====
B D                 Armadillo  ====
B D                    Rabbit  NNNN
B D                   Manatee  ====
B D                     Panda  ====
               Domestic goat  NNNN
B D                     Sheep  NNNN
B D                       Cow  NNNN
            Tibetan antelope  ====
                 Spotted gar  ====
  D            Painted turtle  ====
B D                Coelacanth  ====
  D    White-throated sparrow  ====
  D          Peregrine falcon  ====
B D                   Lamprey  ====
  D              Saker falcon  ====
B D                    Lizard  ====
B D                       Pig  ====
B D                   Dolphin  ====
B D                   Gorilla  NNNN
               Big brown bat  NNNN
B D                       Cat  NNNN
        David's myotis (bat)  NNNN
            Black flying-fox  ====
B D                   Ferret   NNNN
B D                       Dog  NNNN
B D          White rhinoceros  NNNN
B D                     Horse  ====
              Bactrian camel  NNNN
B D           Squirrel monkey  NNNN
B D                    Rhesus  NNNN

Inserts between block 7 and 8 in window
  D              Rock pigeon 1bp
  D      Collared flycatcher 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D       American alligator 3bp
  D Chinese softshell turtle 2bp

Alignment block 8 of 1260 in window, 23070637 - 23070659, 23 bps 
B D                     Human  catccacctt----gcc--cccactt--------------ggg
B D                     Chimp  catccacctt----gcc--cccactt--------------ggg
B D                 Orangutan  catccacctt----gcc--cccactc--------------ggt
B D                    Gibbon  catccacctt----gcc--cccactt--------------ggg
B D       Crab-eating macaque  cgtccacctt----gcc--ctcactt--------------ggt
B D                    Baboon  cgtccacctt----gcc--ctcactt--------------ggt
B D              Green monkey  cgtccacctt----gcc--ctcactt--------------ggt
B D                  Marmoset  cgtccacctc----gcc--cccactc--------------ggg
B D                  Bushbaby  catccacccc----acc--ctcaccc--------------gag
           Chinese tree shrew  ggtccacccc----atc--cccacct--------------ggg
B D                  Squirrel  tgttcatccc----acc--cccacct--------------ggg
       Lesser Egyptian jerboa  -gctcacccc----acc--cccaacccggaggggatggctgga
                 Prairie vole  -gctcacccc----acc--cccaccc--------------gga
               Golden hamster  -gctcacccc----acc--cccaccc--------------ggg
B D                     Mouse  -gcgcacccc----acc--cccaccc--------------ggg
B D                       Rat  -gcgcacccc----acc--cccaccc--------------ggg
B D            Naked mole-rat  cgtccacccc----acc--cccaccc--------------agg
B D                Guinea pig  cgtccacccc----acc--ccca-cc--------------agg
                   Chinchilla  cgtccacccc----acc--cccaccc--------------agg
             Brush-tailed rat  catccacccc----acc--cccaccc--------------agg
B D                      Pika  cgtctgccgc----acc--gcacccc--------------ctt
                 Killer whale  -gcccaccc-----gcc--cgcaccg--------------a--
               Pacific walrus  cgtccacccc----acc--cccaccc--------------ggg
                 Weddell seal  cgtccacccc----acc--cccaccc--------------ggg
B D                   Megabat  cgtctaccca----acc--cccactc--------------gga
B D                  Hedgehog  cgtccgcccc----acc--ccccat------------------
B D                     Shrew  cggccacccc----acc--ccca--------------------
B D                  Elephant  cagcccccgt----ccccgcctgcc------------------
             Cape golden mole  cgtcccctgc----ccc--ccaact------------------
                     Aardvark  ccacccctcc----ccc--------------------------
B D                   Opossum  agtt---------------ttcacag--------------ggg
B D           Tasmanian devil  ggct---------------ccagaag--------------gga
B D                  Platypus  ----catcgc----gcc--gacggtc--------------ggg
  D               Rock pigeon  --------catgagccc--cctgtga--------------cgc
  D       Collared flycatcher  --------ct----aac--cccgcgg--------------gag
B D               Zebra finch  --------tttttcacc--ccttctt--------------gcc
           Tibetan ground jay  --------cc----ctc--cctgctg--------------ggg
B D                   Chicken  -----ccgcccgcgcgc--gccacag--------------tgc
B D        American alligator  -------------------catccag--------------gtc
  D            Painted turtle  ---gcacccc----cgc--ca-gcag--------------ccc
  D  Chinese softshell turtle  -atggaatct----cgc--cgtgcag--------------ata
             Star-nosed mole  ===========================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ===========================================
B D       Medium ground finch  ===========================================
B D                Budgerigar  ===========================================
B D                    Turkey  ===========================================
B D                 Armadillo  ===========================================
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  ===========================================
B D                     Panda  ===========================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ===========================================
                 Spotted gar  ===========================================
B D                Coelacanth  ===========================================
  D    White-throated sparrow  ===========================================
  D          Peregrine falcon  ===========================================
B D                   Lamprey  ===========================================
  D              Saker falcon  ===========================================
B D                    Lizard  ===========================================
B D                       Pig  ===========================================
B D                   Dolphin  ===========================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  ===========================================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ===========================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 8 and 9 in window
B D                 Elephant 2bp
            Cape golden mole 2bp
                    Aardvark 2bp
B D                 Platypus 2bp

Alignment block 9 of 1260 in window, 23070660 - 23070688, 29 bps 
B D                     Human  --actcttc-------------------cca------------gg----cctt----------tg-----
B D                     Chimp  --actcttc-------------------cca------------gg----cctt----------tg-----
B D                 Orangutan  --actcttc-------------------cca------------gg----cctt----------tg-----
B D                    Gibbon  --actcttc-------------------ccg------------gg----cctt----------tg-----
B D       Crab-eating macaque  --actcctc-------------------ccg------------gg----cctt----------tg-----
B D                    Baboon  --actcctc-------------------ccg------------gg----cctt----------tg-----
B D              Green monkey  --actcctc-------------------ccg------------gg----cctt----------tg-----
B D                  Marmoset  --attcctc-------------------ccg------------gg----cctt----------tg-----
B D                  Bushbaby  --actcct--------------------ccg------------gg----ccat----------tactggg
           Chinese tree shrew  --gccttgc-------------------cag------------gg----cctt----------tg-----
B D                  Squirrel  --gcccctc-------------------ctg------------ga----cctt----------tg-----
       Lesser Egyptian jerboa  --gagggga-------------------ggg-----------gga----gctt----------tg-----
                 Prairie vole  --accgagc-------------------ttg-----------tgg----cctt----------tg-----
               Golden hamster  --cccgagc-------------------ctg-----------ggg----cctt----------tg-----
B D                     Mouse  --tcggggc-------------------ctg-----------ggg----cctt----------tg-----
B D                       Rat  --tcggggc-------------------ctg-----------ggg----cctt----------tg-----
B D            Naked mole-rat  --gccccgc-------------------ccg------------gg----cctt----------tg-----
B D                Guinea pig  --gccccgc-------------------ccg------------gg----cctt----------tg-----
                   Chinchilla  --gccccgc-------------------ccg------------gg----cctt----------tg-----
             Brush-tailed rat  --gccccgc-------------------ccg------------gg----cctt----------tg-----
B D                      Pika  --aaccccc-------------------tag------------gg----cctt----------tg-----
                 Killer whale  --accccgc-------------------ccg------------gg----cctt----------tg-----
               Pacific walrus  --gccccgc-------------------ccg------------gg----cctt----------tg-----
                 Weddell seal  --gccccgc-------------------ccg------------gg----cctt----------tg-----
             Black flying-fox  --acatttc-------------------cca------------gtgacccctg----------tg-----
B D                   Megabat  --gccccgc-------------------ccg------------gg----tctt----------tg-----
B D                  Hedgehog  ----------------------------cgg------------gg----cctt----------tg-----
B D                     Shrew  ----------------------------cta------------gg----cctt----------tg-----
B D                  Elephant  --ccccacc-------------------cccagccccccgcgcga----ccac----------tg-----
             Cape golden mole  --cctcacc-------------------ccc------------------ccat----------tg-----
                     Aardvark  --tccttcc-------------------cct------------------ccgc----------tg-----
B D                   Opossum  -----------------------------------------gcgg----cgcc----------tg-----
B D           Tasmanian devil  -----------------------------------------aagc----tgccatcagacacatg-----
B D                  Platypus  --agggccc-------------------ccg------------ga----ccgt----------gg-----
  D               Rock pigeon  agcctcccg----------------------------------tg----cgta----------gg-----
  D       Collared flycatcher  tggtcccgg----------------------------------gg----cggg----------gc-----
B D               Zebra finch  tacttctgt-------------------c--------------tg----cccg----------gt-----
           Tibetan ground jay  gagctgggg-------------------c--------------cg----accg----------gc-----
B D                   Chicken  tctctctg-----------------------------------cg----ccct----------cc-----
B D        American alligator  cggtctcgcgcaggacacgtcacccaccc--------------aa----cgtg----------cg-----
  D            Painted turtle  agcctgggg-------------------ccg------------ag----cccc----------gc-----
  D  Chinese softshell turtle  agtcagggc-------------------ctg------------tg----cgtt----------ac-----
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --------tgcc----------cc------gg--at-c
                        Chimp  --------tgcc----------cc------gg--at-c
                    Orangutan  --------tgcc----------cc------gg--at-c
                       Gibbon  --------tgcc----------cc------gg--at-c
          Crab-eating macaque  --------tgcc----------cc------ga--at-c
                       Baboon  --------tgcc----------cc------ga--at-c
                 Green monkey  --------tgcc----------cc------ga--at-c
                     Marmoset  --------tgcc----------cc------g---at-t
                     Bushbaby  gagccgcctggg----------ct------gg--cg-g
           Chinese tree shrew  --------tgct----------gg------gg--at-c
                     Squirrel  --------tgct--------------------------
       Lesser Egyptian jerboa  --------tgtgctccggatcccg------gg--at-c
                 Prairie vole  --------tgct--gggggacccg------ag--at-c
               Golden hamster  --------tgct---ggggacccg------ag--at-c
                        Mouse  --------tgct---ggggacccg------ag--at-c
                          Rat  --------tgca---ggggaccag------ag--at-c
               Naked mole-rat  --------tgct----------cg------ag--at-c
                   Guinea pig  --------tact----------tg------gc--gt-c
                   Chinchilla  --------tgct----------gg------gg--at-c
             Brush-tailed rat  --------tgct----------cg------gg--at-c
                         Pika  --------tgtt----------gg------gg--ct-c
                 Killer whale  --------tgcc----------gg------gg--cc--
               Pacific walrus  --------tgct----------ag------gg--at-c
                 Weddell seal  --------tgct----------ag------gg--at-c
             Black flying-fox  --------tgca----------gg------gg--at-c
                      Megabat  --------tgca----------gg------gg--at-c
                     Hedgehog  --------tgct----------gg------ga--tc-c
                        Shrew  --------tgcc----------gg------gg--at-c
                     Elephant  --------tgcc----------cg------gg--tt--
             Cape golden mole  --------tgcg----------cg------gg--gt--
                     Aardvark  --------tgcc----------tg------gg--gct-
                      Opossum  --------gggc----------ag------gg------
              Tasmanian devil  --------ggat----------ag------gg------
                     Platypus  --------cgcc----------cc------ag--ga-g
                  Rock pigeon  --------tgc-------------------ag--at-c
          Collared flycatcher  --------tgag----------cc------gg--gt-c
                  Zebra finch  --------tacg----------gt------gg------
           Tibetan ground jay  --------tccg----------acaccgagag--ct-t
                      Chicken  --------ggcg----------ct------ggaaat-g
           American alligator  --------tgtg----------ct------ag--ca-c
               Painted turtle  ---------gcc----------ca------ag--ga-g
     Chinese softshell turtle  --------tgtc----------cg------gg--gg-a
              Star-nosed mole  ======================================
              Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ======================================
          Medium ground finch  ======================================
                   Budgerigar  ======================================
                       Turkey  ======================================
                    Armadillo  ======================================
                       Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Manatee  ======================================
                        Panda  ======================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ======================================
                  Spotted gar  ======================================
                   Coelacanth  ======================================
       White-throated sparrow  ======================================
             Peregrine falcon  ======================================
                      Lamprey  ======================================
                 Saker falcon  ======================================
                       Lizard  ======================================
                          Pig  ======================================
                      Dolphin  ======================================
                      Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  ======================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 9 and 10 in window
              Pacific walrus 15bp
                Weddell seal 15bp
            Black flying-fox 15bp
B D                  Megabat 15bp
B D                 Hedgehog 14bp
B D                    Shrew 16bp
B D                 Platypus 1bp

Alignment block 10 of 1260 in window, 23070689 - 23070705, 17 bps 
B D                     Human  cgc--------------c----------------------ag--------------gac-----gcagc-
B D                     Chimp  cgc--------------c----------------------ag--------------gac-----gcagc-
B D                 Orangutan  cgc--------------c----------------------ag--------------gac-----ccaac-
B D                    Gibbon  cgc--------------c----------------------ag--------------gac-----gcagc-
B D       Crab-eating macaque  cgc--------------c----------------------ag--------------gac-----gcagc-
B D                    Baboon  cgc--------------c----------------------ag--------------gac-----gcagc-
B D              Green monkey  cgc--------------c----------------------ag--------------gac-----gcagc-
B D                  Marmoset  cgc--------------c----------------------gg--------------ggc-----gcagc-
B D                  Bushbaby  cgc--------------a----------------------gg--------------ggc-----gcagc-
           Chinese tree shrew  tgc--------------c----------------------aggctgggggcaccctggc-----gtggt-
B D                  Squirrel  -----------------------t----------------------------------------------
       Lesser Egyptian jerboa  cgt--------------c-tgggttttgggggggtggaggagg-------------gat-----gcaga-
                 Prairie vole  tat--------------a-gggct----------------agg-------------ggt-----gcaga-
               Golden hamster  tct--------------a-gggct----------------agg-------------ggt-----acaga-
B D                     Mouse  tat--------------a-gggct----------------agg-------------ggt-----gcaga-
B D                       Rat  tat--------------a-gggat----------------agg-------------ggt-----gcaga-
B D            Naked mole-rat  cgt--------------ccaggcc----------------ggg-------------ggc-----gacac-
B D                Guinea pig  cat--------------ctggggt----------------ggg-------------ggc-----gccat-
                   Chinchilla  cat--------------ctgggct----------------ggg-------------ggc-----gccat-
             Brush-tailed rat  cat--------------ctgggct----------------ggg-------------ggc-----gccac-
B D                      Pika  tgc--------------c-ag-------------------ggg-------------ggc-----gcagc-
                 Killer whale  cgcccgggcggggggcgc----------------------cg--------------ggc-----gcgac-
B D                   Ferret   cgc--------------c----------------------gg--------------gga-----gcagc-
               Pacific walrus  cgc--------------c----------------------gg--------------gga-----gcagc-
                 Weddell seal  cgc--------------c----------------------gg--------------gga-----gcagc-
             Black flying-fox  cgc--------------c----------------------cg--------------ggt-----gcagt-
B D                   Megabat  cgc--------------c----------------------cg--------------ggt-----gcagt-
B D                  Hedgehog  cgc--------------c----------------------gg--------------ggc-----tcagc-
B D                     Shrew  tgc--------------g----------------------gg--------------ggc-----gctgc-
B D                  Elephant  ----------------------------------------------------------------aaggc-
             Cape golden mole  ----------------------------------------------------------------gcacc-
                     Aardvark  ----------------------------------------------------------ctggaagcagg-
B D                   Opossum  ----------------------------------------------------------------ccagg-
B D           Tasmanian devil  -----------------------------------------------------------------tagg-
B D                  Platypus  ----------------------------------------------------------c-----gtcgg-
  D               Rock pigeon  -----------------------------------------------------------------ctgt-
  D       Collared flycatcher  -----------------------------------------------------------------taac-
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  -----------------------------------------------------------------cagc-
B D                   Chicken  -----------------------------------------------------------------aagg-
B D        American alligator  -----------------------------------------------------------------caaa-
  D            Painted turtle  -----------------------------------------------------------------cggc-
  D  Chinese softshell turtle  -----------------------------------------------------------------tgaca
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -gtc-----------------------
                        Chimp  -gtc-----------------------
                    Orangutan  -gtc-----------------------
                       Gibbon  -gtc-----------------------
          Crab-eating macaque  -gtc-----------------------
                       Baboon  -gtc-----------------------
                 Green monkey  -gtc-----------------------
                     Marmoset  -gtc-----------------------
                     Bushbaby  -gtc-----------------------
           Chinese tree shrew  -gtc-----------------------
                     Squirrel  ---------------------------
       Lesser Egyptian jerboa  -ggc-----------------------
                 Prairie vole  -gac-----------------------
               Golden hamster  -ggc-----------------------
                        Mouse  -ggc-----------------------
                          Rat  -ggc-----------------------
               Naked mole-rat  -ggc-----------------------
                   Guinea pig  -ggc-----------------------
                   Chinchilla  -ggc-----------------------
             Brush-tailed rat  -ggc-----------------------
                         Pika  -gtc-----------------------
                 Killer whale  -ggc-----------------------
                      Ferret   -gaa-----------------------
               Pacific walrus  -gaa-----------------------
                 Weddell seal  -gaa-----------------------
             Black flying-fox  -gac-----------------------
                      Megabat  -gac-----------------------
                     Hedgehog  -ggc-----------------------
                        Shrew  -acc-----------------------
                     Elephant  -ctc-----------------------
             Cape golden mole  -ctc-----------------------
                     Aardvark  -ctc-----------------------
                      Opossum  -gcc-----------------------
              Tasmanian devil  -agt-----------------------
                     Platypus  -gc------------------------
                  Rock pigeon  -tcaa-----c-------------aac
          Collared flycatcher  -cccg---------------------c
                  Zebra finch  -ccca---------------------g
           Tibetan ground jay  -ccca----gt-------------gcc
                      Chicken  -ccgggggggg-------------cgc
           American alligator  -ccca----------------------
               Painted turtle  -cgct----gc-------------agc
     Chinese softshell turtle  tcacc----gccagccaatcagcaagc
              Star-nosed mole  ===========================
              Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ===========================
          Medium ground finch  ===========================
                   Budgerigar  ===========================
                       Turkey  ===========================
                    Armadillo  ===========================
                       Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Manatee  ===========================
                        Panda  ===========================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ===========================
                  Spotted gar  ===========================
                   Coelacanth  ===========================
       White-throated sparrow  ===========================
             Peregrine falcon  ===========================
                      Lamprey  ===========================
                 Saker falcon  ===========================
                       Lizard  ===========================
                          Pig  ===========================
                      Dolphin  ===========================
                      Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNN
             White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  ===========================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 10 and 11 in window
      Lesser Egyptian jerboa 2bp
B D                  Opossum 3bp
B D          Tasmanian devil 2bp

Alignment block 11 of 1260 in window, 23070706 - 23070742, 37 bps 
B D                     Human  a-gggatgcccct---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D                     Chimp  a-gggatgcccct---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D                 Orangutan  g-gggatgcccgt---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D                    Gibbon  a-gggatgcccgt---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D       Crab-eating macaque  a-gggatgcccgt---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D                    Baboon  a-gggatgcccgt---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D              Green monkey  a-gggatgcccgt---ca--ggggtg---g--gggaca--ccaagggcgg----------
B D                  Marmoset  a-gggatgcccgg---ca--gggatg---g--gggaca--ccaagggcgg----------
B D                  Bushbaby  aggggatgcccgg---cc--ggtgtt---g--gggccg--gcaaaagtgg----------
           Chinese tree shrew  a-gggatgcccag---cc--cgggtt---g--ggggtg--gcgagggcag----------
B D                  Squirrel  a-ggaacattcc--------gggttg---g--gg-gtc--gccttggcag----------
       Lesser Egyptian jerboa  a-gggatgtctgg---ccaggggttg---a--ggagcg--gcgagggcgg----------
                 Prairie vole  a-gggatgccccg---cc--gggttg---g--agagcc--gcgagggtgg----------
               Golden hamster  g-ggaatgaccca---cc--gggtgg---g--agagcc--gcgagggtgg----------
B D                     Mouse  a-gggatgcccct---cc--gggtgg---g--agagcccgctaggggtgg----------
B D                       Rat  a-gggatgccccg---cc--gggtgg---g--agagcc--gcgagggtgg----------
B D            Naked mole-rat  a-gggatgccctg---cc--cgggtg---g--ggggta--gcgaaggcag----------
B D                Guinea pig  a-gggatgccctg---cc--agggtg---g--agggca--gcaaaggcag----------
                   Chinchilla  a-ggaatgccctg---cc--aggatg---g--agggca--gcgaaggcgg----------
             Brush-tailed rat  a-gggatgccctg---cc--aggtta---g--agggca--gcgaaggcgg----------
B D                      Pika  g-aggatgcccga---ccccgggttg---g--gagaag--gtggcggctg----------
                 Killer whale  c-gggatgc--gg---gc--caggt----g--ggggcg--gc-gcggcgg----------
B D                   Ferret   a-gggatgcctga---cc--ggggt----g--tgggcg--accgggacgg----------
               Pacific walrus  a-gggatgcccgg---cc--ggggt----g--tgggcg--accggggcgg----------
                 Weddell seal  a-gggatgcccgg---cc--ggggt----g--ggggcg--accggggcgg----------
             Black flying-fox  t-gggatgccggg---cc--gggatg---g--ggggcg--gcgaaggcgg----------
B D                   Megabat  t-gggatgccggg---cc--gggatg---g--ggggcg--gcgagggcgg----------
B D                  Hedgehog  t-gggata---------t--gggacg---g--ggaccg--ac------------------
B D                     Shrew  c-gggatgcccgg---cc--ggggtg---g--ggagtg--gcgagggcgg----------
B D                  Elephant  ---------gggg---gc--ggcag-----------------------------------
             Cape golden mole  ---------ccgg---gc------------------------------------------
                     Aardvark  ---------tgcg---cc--tggaag---g--gg---c--acgtgcccag----------
B D                 Armadillo  a-gggatgcccgg---cc--ggggtg---g--gg-gcg--gcggggccgg----------
B D                   Opossum  --gaatcgctccc---ca--agccga---g--aggaga--gccgggctgc----------
B D           Tasmanian devil  -------gctcct---ca--ctgggg---c--aggggt--cacacactgg----------
B D                  Platypus  ---gggtaccccc---gg--gggacg---g--ggggtc--c---gggcgg----------
  D               Rock pigeon  ----gaggccctt---cc--cgaccacatg--acgatg------aagcagct-------c
  D       Collared flycatcher  ----gggagtggt---cc--cggggc---g--gggctg------agccgggt-------c
B D               Zebra finch  ----gggagtttc---ca--tggctg---g--aggccc------ggctggga-------g
           Tibetan ground jay  ----gagagcgtt---tc--cgaccg---gctggaccc------ctacagca-------g
B D                   Chicken  ----ggcggcggc---gg--cggcct---g--agggtc------gggggggt-------g
B D        American alligator  ------gcgcccg---cc--tagccc---a--gggagc------gggcacct--tgcagg
  D            Painted turtle  ----ggtagccgt---cc--cggttgc--a--gtgccc------agcccact--------
  D  Chinese softshell turtle  ----ggcagttgtgcccc--cg-------a--gttccc------gagccgtttctcaagt
             Star-nosed mole  ============================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ============================================================
B D       Medium ground finch  ============================================================
B D                Budgerigar  ============================================================
B D                    Turkey  ============================================================
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  ============================================================
B D                     Panda  ============================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ============================================================
                 Spotted gar  ============================================================
B D                Coelacanth  ============================================================
  D    White-throated sparrow  ============================================================
  D          Peregrine falcon  ============================================================
B D                   Lamprey  ============================================================
  D              Saker falcon  ============================================================
B D                    Lizard  ============================================================
B D                       Pig  ============================================================
B D                   Dolphin  ============================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ============================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 11 and 12 in window
B D                     Pika 3bp

Alignment block 12 of 1260 in window, 23070743 - 23070745, 3 bps 
B D                     Human  -gga
B D                     Chimp  -gga
B D                 Orangutan  -gga
B D                    Gibbon  -gga
B D       Crab-eating macaque  -gga
B D                    Baboon  -gga
B D              Green monkey  -gga
B D                  Marmoset  -aga
B D                  Bushbaby  -gca
           Chinese tree shrew  -gcg
B D                  Squirrel  -gga
       Lesser Egyptian jerboa  -ggt
                 Prairie vole  -ggt
               Golden hamster  -ggt
B D                     Mouse  -ggt
B D                       Rat  -ggt
B D            Naked mole-rat  -agt
B D                Guinea pig  -ag-
                   Chinchilla  -agt
             Brush-tailed rat  -agt
B D                      Pika  -ggt
                 Killer whale  -gtg
B D                   Ferret   -aga
               Pacific walrus  -aga
                 Weddell seal  -aga
             Black flying-fox  -gga
B D                   Megabat  -gga
B D                     Shrew  -gga
                     Aardvark  -ggt
B D                 Armadillo  -ggc
B D                   Opossum  -ggg
B D           Tasmanian devil  -agg
B D                  Platypus  -ggg
  D               Rock pigeon  tgg-
  D       Collared flycatcher  taa-
B D               Zebra finch  cag-
           Tibetan ground jay  cgg-
B D                   Chicken  cgg-
B D        American alligator  cag-
  D            Painted turtle  -ag-
  D  Chinese softshell turtle  cag-
B D                  Hedgehog  ----
             Star-nosed mole  ====
B D           Chinese hamster  NNNN
B D                    Alpaca  NNNN
  D              Mallard duck  ====
B D       Medium ground finch  ====
B D                Budgerigar  ====
B D                    Turkey  ====
B D                  Elephant  ----
B D                    Rabbit  NNNN
B D                   Manatee  ====
B D                     Panda  ====
               Domestic goat  NNNN
B D                     Sheep  NNNN
B D                       Cow  NNNN
            Tibetan antelope  ====
                 Spotted gar  ====
B D                Coelacanth  ====
  D    White-throated sparrow  ====
  D          Peregrine falcon  ====
B D                   Lamprey  ====
  D              Saker falcon  ====
B D                    Lizard  ====
            Cape golden mole  ----
B D                       Pig  ====
B D                   Dolphin  ====
B D                   Gorilla  NNNN
               Big brown bat  NNNN
B D                       Cat  NNNN
        David's myotis (bat)  NNNN
B D                       Dog  NNNN
B D          White rhinoceros  NNNN
B D                     Horse  ====
              Bactrian camel  NNNN
B D           Squirrel monkey  NNNN
B D                    Rhesus  NNNN

Inserts between block 12 and 13 in window
B D                  Opossum 9bp
B D          Tasmanian devil 6bp

Alignment block 13 of 1260 in window, 23070746 - 23070770, 25 bps 
B D                     Human  cgcctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                     Chimp  cgcctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                 Orangutan  cgtctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                    Gibbon  tgtctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D       Crab-eating macaque  cgtctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                    Baboon  cgtctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D              Green monkey  cgtctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                  Marmoset  cgtctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                  Bushbaby  tgcctg-----cg--acccgg----gcag------------------g------------ggg-------
           Chinese tree shrew  tgcctg------g--aggtgg----gca-------------------g------------gag-------
B D                  Squirrel  tgactg---gcct--aggtgg--------------------------g------------agg-------
       Lesser Egyptian jerboa  tggttgtcttccg--aggtgg----gca-------------------g------------tggctgctgg
                 Prairie vole  tgtctg-----cg--aggtgg----gca-------------------g------------ggg-------
               Golden hamster  tgtctg-----cg--aggtgg----gca-------------------g------------ggg-------
B D                     Mouse  tgtctg-----ct--aggtgg----gcag------------------g------------ggg-------
B D                       Rat  tgtctg-----cg--aggtgg----gcaa------------------g------------ggg-------
B D            Naked mole-rat  tggctg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                Guinea pig  tgcctg-----gg-aaggtgg----gcac------------------g------------ggg-------
                   Chinchilla  tgcctg-----ca-aaggtgg----gcag------------------g------------ggg-------
             Brush-tailed rat  tgcctg-----ta-aaggtgg----gcag------------------g------------ggg-------
B D                      Pika  tgcctg-----ct--ctgtgg----gcac------------------g------------gga-------
                 Killer whale  tgcccg-----cg--cgatgg----gcag------------------g------------gg--------
B D                   Ferret   tgtccg-----cg--aggtgg----gcag------------------g------------ggg-------
               Pacific walrus  tgcccg-----cg--aggtgg----gcag------------------g------------ggg-------
                 Weddell seal  tgcccg-----tg--acgtgg----gcag------------------g------------ggg-------
             Black flying-fox  tgcccg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                   Megabat  tgcccg-----cg--aggtgg----gcag------------------g------------ggg-------
B D                  Hedgehog  ----------------------------a------------------g------------ggg-------
B D                     Shrew  tgcccg-----cg--aggtgg----gcaa------------------g------------ggg-------
B D                  Elephant  ------------g--ttgcgg----gcgg------------------g------------ggg-------
             Cape golden mole  ----------------------------------------------------------------------
B D                 Armadillo  tgcccg-----cg--aggtgg----gcgg------------------g------------ggg-------
B D                   Opossum  ggccca-----gc--aggcag----gagg------------------gagtcccttcgctgcg-------
B D           Tasmanian devil  ggtcaa-----gc--aggcgg----cggg------------------g------------gag-------
B D                  Platypus  ---ccc-----cg--gcgtggggccgcgg------------------g------------gag-------
  D               Rock pigeon  ctctca-----cgctggtttg----gc--------------------a------------agg-------
  D       Collared flycatcher  c-cccg-----cgggag-tgg----tccc------------------g------------ggg-------
B D               Zebra finch  t-gcgg-----c--------g----cccc------------------g------------cgg-------
           Tibetan ground jay  cggcgg-----cggtggctcg----tcctctt-cggacgag---ctgg------------agg-------
B D                   Chicken  gaccgg-----cgggagcggg----gccttgtatgtaggagcgtctgc------------ggg-------
B D        American alligator  cccccg-----cg-----cag----cccgc-----------------a------------gga-------
  D            Painted turtle  ctccgg-----cg------cg----gccg------------------g------------tgg-------
  D  Chinese softshell turtle  atttga-----tg------cg----tctgcggttgga----------c------------tgg-------
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
                    Aardvark  ======================================================================
B D                    Rabbit  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Manatee  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ------------------cgg
                        Chimp  ------------------cgg
                    Orangutan  ------------------cgg
                       Gibbon  ------------------cgg
          Crab-eating macaque  ------------------cgg
                       Baboon  ------------------cgg
                 Green monkey  ------------------cgg
                     Marmoset  ------------------cgg
                     Bushbaby  ------------------cag
           Chinese tree shrew  ------------------cgg
                     Squirrel  ------------------cgg
       Lesser Egyptian jerboa  ctggtggttggagggacacgt
                 Prairie vole  ------------------tgg
               Golden hamster  ------------------tgg
                        Mouse  ------------------tgg
                          Rat  ------------------tgg
               Naked mole-rat  ------------------cgg
                   Guinea pig  ------------------cgg
                   Chinchilla  ------------------cgg
             Brush-tailed rat  ------------------cgg
                         Pika  ------------------gga
                 Killer whale  -------------------cg
                      Ferret   ------------------cga
               Pacific walrus  ------------------cga
                 Weddell seal  ------------------cga
             Black flying-fox  ------------------cgg
                      Megabat  ------------------cgg
                     Hedgehog  ------------------cgg
                        Shrew  ------------------cgg
                     Elephant  ------------------cgg
             Cape golden mole  ------------------tgg
                    Armadillo  ------------------cgg
                      Opossum  ------------------cat
              Tasmanian devil  ------------------gag
                     Platypus  ------------------ggg
                  Rock pigeon  ------------------tgg
          Collared flycatcher  ------------------cgg
                  Zebra finch  ------------------ccg
           Tibetan ground jay  ------------------tgg
                      Chicken  ------------------cgg
           American alligator  ------------------cgg
               Painted turtle  ------------------cag
     Chinese softshell turtle  ------------------agg
              Star-nosed mole  =====================
              Chinese hamster  NNNNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  =====================
          Medium ground finch  =====================
                   Budgerigar  =====================
                       Turkey  =====================
                     Aardvark  =====================
                       Rabbit  NNNNNNNNNNNNNNNNNNNNN
                      Manatee  =====================
                        Panda  =====================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  =====================
                  Spotted gar  =====================
                   Coelacanth  =====================
       White-throated sparrow  =====================
             Peregrine falcon  =====================
                      Lamprey  =====================
                 Saker falcon  =====================
                       Lizard  =====================
                          Pig  =====================
                      Dolphin  =====================
                      Gorilla  NNNNNNNNNNNNNNNNNNNNN
                Big brown bat  NNNNNNNNNNNNNNNNNNNNN
                          Cat  NNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNNNN
             White rhinoceros  NNNNNNNNNNNNNNNNNNNNN
                        Horse  =====================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNN

Inserts between block 13 and 14 in window
  D              Rock pigeon 4bp
  D      Collared flycatcher 59bp
          Tibetan ground jay 9bp
B D       American alligator 1bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 4bp

Alignment block 14 of 1260 in window, 23070771 - 23070780, 10 bps 
B D                     Human  ----cctctgg-tc--g
B D                     Chimp  ----cctctgg-tc--g
B D                 Orangutan  ----cctctgg-tc--g
B D                    Gibbon  ----cctctgg-tc--g
B D       Crab-eating macaque  ----cctctgg-tc--g
B D                    Baboon  ----cctctgg-tc--g
B D              Green monkey  ----cctctgg-tc--g
B D                  Marmoset  ----cctccgg-tc--a
B D                  Bushbaby  ----cctcacg--c--g
           Chinese tree shrew  ----ccgcagg-cc--c
B D                  Squirrel  ----ccgccgg-cc--g
       Lesser Egyptian jerboa  ----ctgcggc-ccaga
                 Prairie vole  ----ccacggc-cc--a
               Golden hamster  ----ccacggc-cc--a
B D                     Mouse  ----ctatggc-cc--a
B D                       Rat  ----ccacggc-cc--a
B D            Naked mole-rat  ----ccacggg-ca--g
B D                Guinea pig  ----ccacgag-ct--g
                   Chinchilla  ----ccacggg-ta--g
             Brush-tailed rat  ----ccacggg-ca--g
B D                      Pika  ----aggagga-tg--g
                 Killer whale  ----ccgcggg--t--a
B D                   Ferret   ----ccgcagg-cc--c
               Pacific walrus  ----ccgcggg-cc--c
                 Weddell seal  ----ccgcggg-cc--c
             Black flying-fox  ----ctgcggg-cc--c
B D                   Megabat  ----ctgcggg-cc--c
B D                  Hedgehog  ----cggcggg-cc--t
B D                     Shrew  ----ccggagg-cc--a
B D                  Elephant  ----c---ggg-cc--g
             Cape golden mole  ----c---gga-cg--g
B D                 Armadillo  ----c---ggaccc--g
B D                   Opossum  ----cttg---------
B D           Tasmanian devil  ----ctcg---------
B D                  Platypus  ----gtcccgg-tg--g
  D               Rock pigeon  ccccccgtgg-------
  D       Collared flycatcher  --ccccgcgg-------
B D               Zebra finch  --cctcgcgt-------
           Tibetan ground jay  -cccccgacg-------
B D                   Chicken  -ctcctgtat-------
             Star-nosed mole  =================
B D           Chinese hamster  NNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNN
  D              Mallard duck  =================
B D       Medium ground finch  =================
B D                Budgerigar  =================
  D  Chinese softshell turtle  =================
B D                    Turkey  =================
                    Aardvark  =================
B D                    Rabbit  NNNNNNNNNNNNNNNNN
B D                   Manatee  =================
B D                     Panda  =================
               Domestic goat  NNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNN
            Tibetan antelope  =================
                 Spotted gar  =================
  D            Painted turtle  =================
B D        American alligator  =================
B D                Coelacanth  =================
  D    White-throated sparrow  =================
  D          Peregrine falcon  =================
B D                   Lamprey  =================
  D              Saker falcon  =================
B D                    Lizard  =================
B D                       Pig  =================
B D                   Dolphin  =================
B D                   Gorilla  NNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNN
B D                     Horse  =================
              Bactrian camel  NNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNN

Inserts between block 14 and 15 in window
B D                     Pika 20bp

Alignment block 15 of 1260 in window, 23070781 - 23070798, 18 bps 
B D                     Human  -----------------------ggcaggtgc-----tg----gggg--agg
B D                     Chimp  -----------------------ggcaggtgc-----tg----gggg--agg
B D                 Orangutan  -----------------------agcaggtgc-----tg----gggg--agg
B D                    Gibbon  -----------------------ggcaggtgc-----tg----gggg--agg
B D       Crab-eating macaque  -----------------------ggcaggtgc-----tg----gggg--agg
B D                    Baboon  -----------------------ggcaggtgc-----ta----gggg--aag
B D              Green monkey  -----------------------ggcaggtgt-----tg----gggg--agg
B D                  Marmoset  -----------------------ggcaggtgc-----tg----gaag--agg
B D                  Bushbaby  -----------------------ggcaggtgc-----tg----cgga--aga
           Chinese tree shrew  -----------------------agcaggtgc-----ta----aggg--agg
B D                  Squirrel  -----------------------agcaggtgc-----ca----agga--agg
       Lesser Egyptian jerboa  -----------------------gacaggtgc-----cg----ggag--aga
                 Prairie vole  -----------------------gacaggtgc-----ct-----ggg--agg
               Golden hamster  -----------------------gacaggtgc-----ct----gggg--agg
B D                     Mouse  -----------------------gacaggtgc-----ct----tggg--agg
B D                       Rat  -----------------------gacaggtgc-----ct---aaggg--agg
B D            Naked mole-rat  -----------------------ggcaggtgc-----gg-----ggg----a
B D                Guinea pig  -----------------------ggcaggtgc-----gg-----ggg--aga
                   Chinchilla  -----------------------ggcaggtgc-----gg-----ggg--aga
             Brush-tailed rat  -----------------------ggcaggtgc-----gg-----gggaaaga
B D                    Rabbit  -----------------------ggcaggtgc-----tg----gggg--agc
B D                      Pika  -----------------------agcaggtgc-----tgctgagggg--agg
                 Killer whale  -----------------------ggcaggtgc-----tg----ggag--ggg
B D                   Ferret   -----------------------ggcaggtgc-----tg----ggaa--ggg
               Pacific walrus  -----------------------ggcaggtgc-----tg----ggaa--ggg
                 Weddell seal  -----------------------ggcaggtgc-----tg----ggaa--ggg
             Black flying-fox  -----------------------agcaggtgc-----tg----ggga--cgg
B D                   Megabat  -----------------------agcaggtgc-----tg----ggga--cgg
B D                  Hedgehog  -----------------------ggctggtgcgggggtg----ga-------
B D                     Shrew  -----------------------ggcaggtgc-----ta----gg-------
B D                  Elephant  -----------------------tgcaggtgc-----ca----gtga--cgt
             Cape golden mole  -----------------------gacaggtgc-----gg----gtga--cgt
B D                 Armadillo  -----------------------ggcaggtgc-----cg----gggc--ggg
B D                   Opossum  ---------------------------gg--t-----ca----gagg--cgg
B D           Tasmanian devil  ---------------------------ggctt-----tg----gagg--c--
B D                  Platypus  ----------------------------gagc-----tt----gggt--ggg
  D               Rock pigeon  ga---------------------tgg--------------------------
  D       Collared flycatcher  ga----------------gtggtccc--------------------------
B D               Zebra finch  tg---------------------cac--------------------------
           Tibetan ground jay  gg----------------gtg--gaa--------------------------
B D                   Chicken  gtgcaccaggatggccgagtggttaa--------------------------
B D        American alligator  ----------------------tggc--------------------------
  D            Painted turtle  -----------------------cgc--------------------------
  D  Chinese softshell turtle  -----------------------cgc--------------------------
             Star-nosed mole  ====================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ====================================================
B D       Medium ground finch  ====================================================
B D                Budgerigar  ====================================================
B D                    Turkey  ====================================================
                    Aardvark  ====================================================
B D                   Manatee  ====================================================
B D                     Panda  ====================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ====================================================
                 Spotted gar  ====================================================
B D                Coelacanth  ====================================================
  D    White-throated sparrow  ====================================================
  D          Peregrine falcon  ====================================================
B D                   Lamprey  ====================================================
  D              Saker falcon  ====================================================
B D                    Lizard  ====================================================
B D                       Pig  ====================================================
B D                   Dolphin  ====================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ====================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 15 and 16 in window
B D                  Opossum 6bp
B D                 Platypus 5bp

Alignment block 16 of 1260 in window, 23070799 - 23070843, 45 bps 
B D                     Human  gat------gcgcc-----gc---caa----------gccgat---gaccc-------------------
B D                     Chimp  gat------gcgcc-----gc---caa----------gccgat---gaccc-------------------
B D                 Orangutan  gat------gcgca-----gc---cga----------gccgat---gaccc-------------------
B D                    Gibbon  gag------gcgcc-----gc---cga----------gccgat---gaccc-------------------
B D       Crab-eating macaque  gag------gcgcc-----gc---caa----------gcccat---gaccc-------------------
B D                    Baboon  gag------gcgcc-----gc---caa----------gcccat---gaccc-------------------
B D              Green monkey  gag------gcgcc-----gc---caa----------gcccat---gaccc-------------------
B D                  Marmoset  gtg------gcgcc-----gc---caa----------gccgag---gactc-------------------
B D                  Bushbaby  gag------gcgct-----gc---cgctgt-------gccaag---gagct-------------------
           Chinese tree shrew  gag------gcgc------gc---t------------gcagga---gggcc-------------------
B D                  Squirrel  gag------gcgc------gc---cgg----------gccgag---gaacc-------------------
       Lesser Egyptian jerboa  ggg------tgac------atgccc-g----------gcccag---gggcc-------------------
                 Prairie vole  gag------gcac------gg---c-g----------gcccag---taacc-------------------
               Golden hamster  gag------gcac------gg---c-g----------gcccaa---taacc-------------------
B D                     Mouse  gag------gagc------gg---c-g----------gcccag---taacc-------------------
B D                       Rat  gag------gagc------gg---t-g----------gcccag---taacc-------------------
B D            Naked mole-rat  gag------gcac------gc---cgg----------gctgag---gatcc-------------------
B D                Guinea pig  gag------gcgc------gc---ggg----------actgag---gatcc-------------------
                   Chinchilla  gag------gcgc------ac---cag----------actgag---gatcc-------------------
             Brush-tailed rat  gag------acgc------ac---cgg----------gctaag---gatcc-------------------
B D                    Rabbit  gag------gtgc------gc---tgg----------gccgag---ga----------------------
B D                      Pika  aag------gcgc------gt---cgg----------gccgag---ca----------------------
                 Killer whale  ----------cgcc--------------------------------------------------------
B D                   Ferret   ---------gcacc-----ac---tcg----------gccgag---gagcc-------------------
               Pacific walrus  ---------gcgcc------c---tcg----------gcagag---gagcc-------------------
                 Weddell seal  ---------gcgcc-----ac---tcg----------gcagag---gagcc-------------------
B D                   Megabat  --------ggcgcc-----gc---tgg----------gcctat---gagct-------------------
B D                  Hedgehog  gatcggggggcgcccctaggc---cag----------gtgtcg---ctg---------------------
B D                     Shrew  gat---gggtcgccc----gc---cgg----------gcggag---cagcc-------------------
B D                  Elephant  ----------cg----------------------------------------------------------
             Cape golden mole  -----------a----------------------------------------------------------
B D                 Armadillo  ---------gcc----------------------------------------------------------
B D                   Opossum  -------------------------------------gagcct---ggcca-------------------
B D           Tasmanian devil  ----------------------------------------------tgccc-------------------
B D                  Platypus  ---------------------------ggtta-----ggctcc---gagcc-------------------
  D               Rock pigeon  ------------------------------gacgc--attgcc---caccc----------------cac
  D       Collared flycatcher  ------------------------------ggggc--ggggct---gagcc-------------------
B D               Zebra finch  ------------------------------agagc--agggca---gagc--------------------
           Tibetan ground jay  ------------------------------gaagc--aggtgc---gggcc-------------------
B D                   Chicken  ------------------------------ggcgt--tggacttaagatccaatggacgtatgtccgcgt
B D        American alligator  ------------------------------cgggc--agtgcc---aagcc-------------------
  D            Painted turtle  ------------------------------ccggcgacctgcg---ggacc-------------------
  D  Chinese softshell turtle  ------------------------------caggc--tctgcg---gg----------------------
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
                    Aardvark  ======================================================================
B D                   Manatee  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --------------cgc-----------gggaggg-ggc-------------------------------
                        Chimp  --------------cgc-----------gggaggg-ggc-------------------------------
                    Orangutan  --------------cgc-----------gggaggg-ggc-------------------------------
                       Gibbon  --------------cgc-----------gggaggg-ggc-------------------------------
          Crab-eating macaque  --------------cgc-----------gggaggg-ggc-------------------------------
                       Baboon  --------------cgc-----------gggaggg-ggc-------------------------------
                 Green monkey  --------------cgc-----------gggaggg-ggc-------------------------------
                     Marmoset  --------------cgt-----------gggaggg-ggc-------------------------------
                     Bushbaby  --------------cgc-----------agga-gg-ggc-------------------------------
           Chinese tree shrew  --------------cgc-----------tggaggg-ggt-------------------------------
                     Squirrel  --------------cgc-----------ggga-gatggt-------------------------------
       Lesser Egyptian jerboa  --------------ccc-----------ggga-gg-ggc-------------------------------
                 Prairie vole  --------------ttt-----------agat-gg-gct-------------------------------
               Golden hamster  --------------ctc-----------ggga-gg-gct-------------------------------
                        Mouse  --------------ctt-----------ggaa-gg-ggt-------------------------------
                          Rat  --------------ctt-----------ggaa-gg-gtt-------------------------------
               Naked mole-rat  --------------cgc-----------aggg-gg-g---------------------------------
                   Guinea pig  --------------tgc-----------agga-gg-g---------------------------------
                   Chinchilla  --------------tgc-----------agga-gg-g---------------------------------
             Brush-tailed rat  --------------tgc-----------agga-gg-g---------------------------------
                       Rabbit  ----------------------------------g-agc-------------------------------
                         Pika  ----------------------------------g-ggc-------------------------------
                 Killer whale  ----------------------------------------------------------------------
                      Ferret   --------------gga-----------gggatgg-ggc-------------------------------
               Pacific walrus  --------------ggc-----------gggaggg-ggc-------------------------------
                 Weddell seal  --------------ggc-----------gggaggg-ggc-------------------------------
                      Megabat  --------------ggt-----------gggaggg-ggt-------------------------------
                     Hedgehog  --------------ggt-----------gggcagg-ggc-------------------------------
                        Shrew  --------------ggt-----------gggaggg-ggc-------------------------------
                     Elephant  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                      Opossum  --------------cgcccacatttccttgggcgg-gaggggggagaatctgcgccctccccctccaccc
              Tasmanian devil  --------------cgc-----------tgagcgg-gag-------------------------------
                     Platypus  --------------gac-----------ggaaaga-ggc-------------------------------
                  Rock pigeon  tgtggcccccacagcac-----------ag----------------------------------------
          Collared flycatcher  -gggtctaaccccgc---------------gggag--tg-------------------------------
                  Zebra finch  ----tct---------------------------------------------------------------
           Tibetan ground jay  -ggggccccccctgccc-----------aggggag-ctg-------------------------------
                      Chicken  gggttcgaaccccactc-----------ctggtaa-atgacgaatttttttcgggaatgccgagaat---
           American alligator  --cggccagccctgcgc-----------tg----------------------------------------
               Painted turtle  --------------ccc-----------aggaggg-----------------------------------
     Chinese softshell turtle  --------------ctc-----------ggggggg-ggggcag---------------------------
              Star-nosed mole  ======================================================================
              Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ======================================================================
          Medium ground finch  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                     Aardvark  ======================================================================
                      Manatee  ======================================================================
                        Panda  ======================================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                      Lamprey  ======================================================================
                 Saker falcon  ======================================================================
                       Lizard  ======================================================================
                          Pig  ======================================================================
                      Dolphin  ======================================================================
                      Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  ======================================================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ggtt---g---------agg-------------
                        Chimp  ggct---g---------agg-------------
                    Orangutan  ggct---g---------cgg-------------
                       Gibbon  ggct---g---------cgg-------------
          Crab-eating macaque  ggct---g---------cgg-------------
                       Baboon  ggct---g---------cgg-------------
                 Green monkey  ggct---g---------cgg-------------
                     Marmoset  ggct---g---------cgg-------------
                     Bushbaby  agcc---g---------cgg-------------
           Chinese tree shrew  gtct---g---------cgg-------------
                     Squirrel  agct---g---------cgg-------------
       Lesser Egyptian jerboa  ggct---g---catcccccc-------------
                 Prairie vole  gacc---g---------ccg-------------
               Golden hamster  ggcc---g---------ccg-------------
                        Mouse  ggct---g---------cca-------------
                          Rat  ggct---g---------ccg-------------
               Naked mole-rat  ggct---g-------------------------
                   Guinea pig  ggcg---g-------------------------
                   Chinchilla  ggcg---g-------------------------
             Brush-tailed rat  ggca---g-------------------------
                       Rabbit  ggct---g-------------------------
                         Pika  ggctgccg-------------------------
                 Killer whale  -----------------cgg-------------
                      Ferret   ggct---g---------cgg-------------
               Pacific walrus  ggct---g---------cgg-------------
                 Weddell seal  ggct---g---------cgg-------------
                      Megabat  ggct---g---------cgg-------------
                     Hedgehog  ggct---g---------cag-------------
                        Shrew  agct---g---------ctg-------------
                     Elephant  ---------------------------------
             Cape golden mole  ---------------------------------
                    Armadillo  ---------------------------------
                      Opossum  cccc---gcactgtcttagg-------------
              Tasmanian devil  ctcc---g---------agg-------------
                     Platypus  cggg---g---------agg-------------
                  Rock pigeon  --ct---c---------ggg------------g
          Collared flycatcher  gtcc---c---------ggg------------g
                  Zebra finch  gctc---c---------gtg------------g
           Tibetan ground jay  cccc---c---------ggg------------g
                      Chicken  ttgt---c---------ggg------------g
           American alligator  gcac---c---------gtg------------g
               Painted turtle  ---c---t---------gtg-----------tg
     Chinese softshell turtle  atcc---t---------gcgactgagaatcctg
              Star-nosed mole  =================================
              Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  =================================
          Medium ground finch  =================================
                   Budgerigar  =================================
                       Turkey  =================================
                     Aardvark  =================================
                      Manatee  =================================
                        Panda  =================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  =================================
                  Spotted gar  =================================
                   Coelacanth  =================================
       White-throated sparrow  =================================
             Peregrine falcon  =================================
                      Lamprey  =================================
                 Saker falcon  =================================
                       Lizard  =================================
                          Pig  =================================
                      Dolphin  =================================
                      Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Big brown bat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  =================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 16 and 17 in window
B D                  Opossum 5bp
B D          Tasmanian devil 1bp

Alignment block 17 of 1260 in window, 23070844 - 23070846, 3 bps 
B D                     Human  acc--
B D                     Chimp  acc--
B D                   Gorilla  acc--
B D                 Orangutan  acc--
B D                    Gibbon  acc--
B D       Crab-eating macaque  acc--
B D                    Baboon  acc--
B D              Green monkey  acc--
B D                  Marmoset  gcc--
B D                  Bushbaby  gcc--
           Chinese tree shrew  aat--
B D                  Squirrel  gcc--
       Lesser Egyptian jerboa  ctc--
                 Prairie vole  cct--
               Golden hamster  cct--
B D                     Mouse  cct--
B D                       Rat  cct--
                 Killer whale  gcc--
B D                   Ferret   gcc--
               Pacific walrus  gcc--
                 Weddell seal  gcc--
B D                   Megabat  gcc--
B D                  Hedgehog  gcc--
B D                     Shrew  gcc--
B D                  Elephant  gcc--
             Cape golden mole  gcc--
B D                 Armadillo  gcc--
B D                   Opossum  aca--
B D           Tasmanian devil  acg--
B D                  Platypus  gcc--
  D               Rock pigeon  --t--
  D       Collared flycatcher  --c--
B D               Zebra finch  --c--
           Tibetan ground jay  --cga
B D                   Chicken  --a--
B D        American alligator  --a-t
  D            Painted turtle  --t--
  D  Chinese softshell turtle  --c--
B D                      Pika  -----
             Star-nosed mole  =====
B D           Chinese hamster  NNNNN
B D                    Alpaca  NNNNN
                  Chinchilla  -----
B D                Guinea pig  -----
            Brush-tailed rat  -----
  D              Mallard duck  =====
B D       Medium ground finch  =====
B D                Budgerigar  =====
B D                    Turkey  =====
                    Aardvark  =====
B D            Naked mole-rat  -----
B D                    Rabbit  -----
B D                   Manatee  =====
B D                     Panda  =====
               Domestic goat  NNNNN
B D                     Sheep  NNNNN
B D                       Cow  NNNNN
            Tibetan antelope  =====
                 Spotted gar  =====
B D                Coelacanth  =====
  D    White-throated sparrow  =====
  D          Peregrine falcon  =====
B D                   Lamprey  =====
  D              Saker falcon  =====
B D                    Lizard  =====
B D                       Pig  =====
B D                   Dolphin  =====
               Big brown bat  NNNNN
B D                       Cat  NNNNN
        David's myotis (bat)  NNNNN
            Black flying-fox  NNNNN
B D                       Dog  NNNNN
B D          White rhinoceros  NNNNN
B D                     Horse  =====
              Bactrian camel  NNNNN
B D           Squirrel monkey  NNNNN
B D                    Rhesus  NNNNN

Inserts between block 17 and 18 in window
B D                  Opossum 4bp
B D          Tasmanian devil 4bp

Alignment block 18 of 1260 in window, 23070847 - 23070855, 9 bps 
B D                     Human  ----cgggagggt
B D                     Chimp  ----cgggagggt
B D                   Gorilla  ----cgggagggt
B D                 Orangutan  ----cgggagggt
B D                    Gibbon  ----cgggagggt
B D       Crab-eating macaque  ----cgggacgat
B D                    Baboon  ----cgggacgat
B D              Green monkey  ----cgggaggat
B D                  Marmoset  ----cgggatggt
B D                  Bushbaby  ----ctggagggt
           Chinese tree shrew  ----ccggcgggt
B D                  Squirrel  ----tgcagggtt
       Lesser Egyptian jerboa  ----cgtgagatg
                 Prairie vole  ----gacgagatt
               Golden hamster  ----gacgggatt
B D                     Mouse  ----gacgaaatt
B D                       Rat  ----gacgagatt
B D            Naked mole-rat  ------------t
B D                Guinea pig  ------------t
                   Chinchilla  ------------t
             Brush-tailed rat  ------------t
B D                    Rabbit  ------------c
B D                      Pika  ------------c
                 Killer whale  ----caggagggc
B D          White rhinoceros  ----cgggagggt
B D                   Ferret   ----cggga-ggt
               Pacific walrus  ----cggga-ggt
                 Weddell seal  ----cggga-ggt
B D                   Megabat  ----cgggagagt
B D                  Hedgehog  ----cgcgc-ggt
B D                     Shrew  ----cgcga-agg
B D                  Elephant  ----cgggagggt
             Cape golden mole  ----cgggacagt
B D                 Armadillo  ----ggcgagggt
B D                   Opossum  ----ctgga----
B D           Tasmanian devil  ----cgggt----
B D                  Platypus  ----cggg-----
  D               Rock pigeon  ---gggggt----
  D       Collared flycatcher  ---ggggct----
B D               Zebra finch  ---gtgggc----
           Tibetan ground jay  gcagtgggg----
B D                   Chicken  ---gggcgc----
B D        American alligator  gcagcgctc----
  D            Painted turtle  ---cggccg----
  D  Chinese softshell turtle  ---gggagg----
             Star-nosed mole  =============
B D           Chinese hamster  NNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNN
  D              Mallard duck  =============
B D       Medium ground finch  =============
B D                Budgerigar  =============
B D                    Turkey  =============
                    Aardvark  =============
B D                   Manatee  =============
B D                     Panda  =============
               Domestic goat  NNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNN
            Tibetan antelope  =============
                 Spotted gar  =============
B D                Coelacanth  =============
  D    White-throated sparrow  =============
  D          Peregrine falcon  =============
B D                   Lamprey  =============
  D              Saker falcon  =============
B D                    Lizard  =============
B D                       Pig  =============
B D                   Dolphin  =============
               Big brown bat  NNNNNNNNNNNNN
B D                       Cat  NNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNN
            Black flying-fox  NNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNN
B D                     Horse  =============
              Bactrian camel  NNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNN

Inserts between block 18 and 19 in window
B D                 Hedgehog 1bp
B D                    Shrew 1bp

Alignment block 19 of 1260 in window, 23070856 - 23070860, 5 bps 
B D                     Human  ggaca
B D                     Chimp  ggaca
B D                   Gorilla  ggaca
B D                 Orangutan  ggaca
B D                    Gibbon  ggacg
B D       Crab-eating macaque  ggaca
B D                    Baboon  ggaca
B D              Green monkey  ggaca
B D                  Marmoset  ggaca
B D                  Bushbaby  gtgca
           Chinese tree shrew  gggca
B D                  Squirrel  gggca
       Lesser Egyptian jerboa  gagca
                 Prairie vole  gggca
               Golden hamster  gggca
B D                     Mouse  gggca
B D                       Rat  gggca
B D            Naked mole-rat  gggca
B D                Guinea pig  gggca
                   Chinchilla  gggca
             Brush-tailed rat  ggaca
B D                    Rabbit  gggcc
B D                      Pika  gggcc
                 Killer whale  tgaca
B D          White rhinoceros  gggca
B D                   Ferret   gggca
               Pacific walrus  aggca
                 Weddell seal  aggca
B D                   Megabat  gggca
                Big brown bat  ggaca
B D                  Hedgehog  -ggca
B D                     Shrew  -ggca
B D                  Elephant  gggca
             Cape golden mole  gggca
B D                 Armadillo  gggca
B D                   Opossum  actcg
B D           Tasmanian devil  gggca
  D               Rock pigeon  gtccc
  D       Collared flycatcher  gagcc
B D               Zebra finch  gtgct
           Tibetan ground jay  gtgcc
B D                   Chicken  gggcc
B D        American alligator  ctccc
  D            Painted turtle  gagac
  D  Chinese softshell turtle  gggct
             Star-nosed mole  =====
B D           Chinese hamster  NNNNN
B D                    Alpaca  NNNNN
  D              Mallard duck  =====
B D       Medium ground finch  =====
B D                Budgerigar  =====
B D                    Turkey  =====
                    Aardvark  =====
B D                   Manatee  =====
B D                     Panda  =====
               Domestic goat  NNNNN
B D                     Sheep  NNNNN
B D                       Cow  NNNNN
            Tibetan antelope  =====
                 Spotted gar  =====
B D                Coelacanth  =====
B D                  Platypus  -----
  D    White-throated sparrow  =====
  D          Peregrine falcon  =====
B D                   Lamprey  =====
  D              Saker falcon  =====
B D                    Lizard  =====
B D                       Pig  =====
B D                   Dolphin  =====
B D                       Cat  NNNNN
        David's myotis (bat)  NNNNN
            Black flying-fox  NNNNN
B D                       Dog  NNNNN
B D                     Horse  =====
              Bactrian camel  NNNNN
B D           Squirrel monkey  NNNNN
B D                    Rhesus  NNNNN

Inserts between block 19 and 20 in window
B D                Armadillo 2bp

Alignment block 20 of 1260 in window, 23070861 - 23070901, 41 bps 
B D                     Human  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D                     Chimp  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D                   Gorilla  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D                 Orangutan  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D                    Gibbon  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D       Crab-eating macaque  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D                    Baboon  ------------------ga---gggc-----gcc------gggga----t-gc---cgtg--cgggg--
B D              Green monkey  ------------------ga---gggc-----gcc------gggga----t-gc---agcg--cgggg--
B D                  Marmoset  ------------------ga---gggc-----gcc------gggga----t-gc---cgcg--cgggg--
B D                  Bushbaby  ------------------gg---gggc-----gct------gggga----t-gt---caag--tgggt--
           Chinese tree shrew  ------------------gg---gggc-----gcc------ccggc---tt-gc---agcg--ctggg--
B D                  Squirrel  ------------------gg---gggc-----gcc------gggga----t-gc---cgcg--ccgaa--
       Lesser Egyptian jerboa  ------------------ggggagggc-----tcc------gggga----tgga---tgtg----ggggg
                 Prairie vole  ------------------gg---gggc-----gcc------gagga----t-gg---tgtg----ggg--
               Golden hamster  ------------------gg---gggc-----gcc------gagga----t-ga---tgtg----gga--
B D                     Mouse  ------------------gg---gggt-----gca------gagga----t-ga---tgtg----gga--
B D                       Rat  ------------------gg---gggt-----acc------gagga----t-ga---tgtg----gga--
B D            Naked mole-rat  ------------------ga---gggc-----agg------ggggt----t-gc---cgcg--cgggg--
B D                Guinea pig  ------------------ga---aggc-----acg------gggga----t-gt---cgca--cgggg--
                   Chinchilla  ------------------ga---gggc-----ac-------gggga----t-gc---cgcg--cgggg--
             Brush-tailed rat  ------------------ga---gggt-----ac--------agga----t-gc---cgcg--cgggg--
B D                    Rabbit  ------------------gg---gggt----------------gga----t-gg---gccg----ggg--
B D                      Pika  ------------------gg---gggt----------------gga----t-gg---gcag----tgg--
                 Killer whale  ------------------gg---ggcc-----ca------------------------------------
B D          White rhinoceros  ------------------gg---ggcc-----a-------------------------------------
B D                   Ferret   ------------------gg---ggct-----gcc------aggga----t-gc---cgtg---------
               Pacific walrus  ------------------gg---ggct-----gct------gggga----t-gc---cgcg---------
                 Weddell seal  ------------------gg---ggct-----gct------gggga----t-gc---cgcg---------
B D                   Megabat  ------------------gc---ggtc-----gct------gggga----t-gc---cgtg---------
                Big brown bat  ------------------gc---ggcc-----gct------gggga----t-gc---cgcg---------
B D                  Hedgehog  ------------------cg---g--------gcc------gggga----t-gc---agcg---------
B D                     Shrew  ------------------gg---ggcc-----gcc------ggaga----t-gc---ggtg---------
B D                   Manatee  ------------------gg---gggc-----ggc------aggat----g-cg---ggcg--ggggg--
B D                 Armadillo  ------------------gg---gggc-----ggc------ggggc-----------------cgagg--
B D                   Opossum  ------------------gg---acgcccgaggcc------gcggg----a-gc---cttt--tcttt--
B D           Tasmanian devil  ------------------ga---gggcagctgccc------ccagc----g-gcccgcctg--ccttg--
B D                  Platypus  ------------------------gcc-----cccctccgatcggt----c-gc---tccg--ccgtc--
  D               Rock pigeon  --------------catccg---gacc-----ggg------gagctccacg-gc---tccc---------
  D       Collared flycatcher  g-------------ggtcta---accc-----cgc------gggag----t-gg---tccc---------
B D               Zebra finch  --------------gctcgc---agcc-----cgc------tgccg----g-g-----------------
           Tibetan ground jay  g-----------gcgggcgc---ggcc-----ggc------gggcg----g-ga---gcag---------
B D                   Chicken  gagg-------cggaagcgt---ggcc-----cgg------ccgcg----g-gc---tgc----------
B D        American alligator  agaagtgct--gggggctgc---acac-----ggg------tcccc----g-ga----------------
  D            Painted turtle  cctggcacctgtggag----------c-----ggc------ccacg----g-gc---tccatt-------
  D  Chinese softshell turtle  gttgagaactgcggaggcag---gaca-----gat------gaaca----g-ac---tcccct-------
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -------------------ccg-ccgggcg------------cccc----c
                        Chimp  -------------------ccg-ccgggcg------------cccc----c
                      Gorilla  -------------------ccg-ccgggcg------------cccc----c
                    Orangutan  -------------------ccg-ccgggcg------------cccc----c
                       Gibbon  -------------------ccg-ccaggcg------------cccc----c
          Crab-eating macaque  -------------------ctg-ccgggcg------------cccc----c
                       Baboon  -------------------ctg-ccgggcg------------cccc----c
                 Green monkey  -------------------ctg-ccgggcg------------cccc----c
                     Marmoset  -------------------ccg-ccgggcg------------cccc----c
                     Bushbaby  -------------------ccg-ccgggcg------------cgcc----c
           Chinese tree shrew  -------------------ccg-ccaggcg------------tccc----c
                     Squirrel  -------------------ccagcggagcg------------ttct-----
       Lesser Egyptian jerboa  tggatggaggatgcggtgctgc-ctgggcg------------cccc-----
                 Prairie vole  -------------------cca-ctgcaag------------ccct-----
               Golden hamster  -------------------cca-ctgcacg------------ccct-----
                        Mouse  -------------------cca-ctgcacg------------ccct-----
                          Rat  -------------------cca-ctgcacg------------ccct-----
               Naked mole-rat  -------------------ctg-ccaggcg------------ccctgccct
                   Guinea pig  -------------------ccg-ccaggcg------------ccctgccct
                   Chinchilla  -------------------ccg-ccgggcg------------cccttccct
             Brush-tailed rat  -------------------cgg-ccaggcg------------cccttcccg
                       Rabbit  -------------------gca-ccggtct------------ctcc----t
                         Pika  -------------------gta-acagccg------------ttc------
                 Killer whale  ---------------------------------------------------
             White rhinoceros  ---------------------------------------------------
                      Ferret   -------------------tcc-ccccccccgccccccccctcc-------
               Pacific walrus  -------------------tcc-gggggcc------------cc-------
                 Weddell seal  -------------------tct-gggggcc------------cc-------
                      Megabat  -------------------ccg-aaggccc------------cc-------
                Big brown bat  -------------------ccg-cccaccc------------cc-------
                     Hedgehog  -------------------cag-tgcggag------------c--------
                        Shrew  -------------------cca-ggcgggg------------cg-------
                      Manatee  -------------------cgg-cagg------------------------
                    Armadillo  -------------------ccg-cccg------------------------
                      Opossum  -------------------cct-cc--------------------------
              Tasmanian devil  -------------------tcc-ct--------------------------
                     Platypus  -------------------cca-cccgc-----------------------
                  Rock pigeon  ---------------------------------------------------
          Collared flycatcher  ---------------------------------------------------
                  Zebra finch  ---------------------------------------------------
           Tibetan ground jay  ---------------------------------------------------
                      Chicken  ---------------------------------------------------
           American alligator  ---------------------------------------------------
               Painted turtle  ---------------------------------------------------
     Chinese softshell turtle  ---------------------------------------------------
              Star-nosed mole  ===================================================
              Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ===================================================
          Medium ground finch  ===================================================
                   Budgerigar  ===================================================
                       Turkey  ===================================================
                     Aardvark  ===================================================
                     Elephant  ---------------------------------------------------
                        Panda  ===================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ===================================================
                  Spotted gar  ===================================================
                   Coelacanth  ===================================================
       White-throated sparrow  ===================================================
             Peregrine falcon  ===================================================
                      Lamprey  ===================================================
                 Saker falcon  ===================================================
                       Lizard  ===================================================
             Cape golden mole  ---------------------------------------------------
                          Pig  ===================================================
                      Dolphin  ===================================================
                          Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  ===================================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 20 and 21 in window
B D                  Ferret  2bp
              Pacific walrus 2bp
                Weddell seal 2bp
B D                  Megabat 2bp
               Big brown bat 6bp
B D                    Shrew 5bp
B D                  Opossum 5bp
B D          Tasmanian devil 6bp

Alignment block 21 of 1260 in window, 23070902 - 23070917, 16 bps 
B D                     Human  aagca--------------gcg---gctgatgc-------------------------------------
B D                     Chimp  aagca--------------gcg---gctgatgc-------------------------------------
B D                   Gorilla  aagca--------------gcg---gctgatgc-------------------------------------
B D                 Orangutan  gagca--------------gcg---gctgatgc-------------------------------------
B D                    Gibbon  gagca--------------gcg---gctgatgc-------------------------------------
B D       Crab-eating macaque  gagca--------------gcg---gctggtgc-------------------------------------
B D                    Baboon  gagca--------------gcg---gctggtgc-------------------------------------
B D              Green monkey  gagca--------------gcg---gctggtgc-------------------------------------
B D                  Marmoset  gagca--------------gcg---gctggtgc-------------------------------------
B D                  Bushbaby  aagca--------------gcg---gctggtgc-------------------------------------
           Chinese tree shrew  gagca--------------ggc---actggtac-------------------------------------
B D                  Squirrel  gggcg--------------gct---gccagtgc-------------------------------------
       Lesser Egyptian jerboa  gaccg--------------gctctgggggatgc-------------------------------------
                 Prairie vole  gagca--------------gct---gcgggtgc-------------------------------------
               Golden hamster  gagca--------------gct---gcgggtgc-------------------------------------
B D                     Mouse  ga-----------------------gcgggtgc-------------------------------------
B D                       Rat  gagca--------------gct---gcgggtgc-------------------------------------
B D            Naked mole-rat  gactg--------------gcc---gctagtgc-------------------------------------
B D                Guinea pig  gaccc--------------gcc---gctagtgt-------------------------------------
                   Chinchilla  gactg--------------gcc---gctagtgc-------------------------------------
             Brush-tailed rat  gactg--------------gcc---gctagtgc-------------------------------------
B D                    Rabbit  gagca--------------acc---agtggtgc-------------------------------------
B D                      Pika  --------------------------gttccgc-------------------------------------
                 Killer whale  gggca--------------gct---gctggtgc-------------------------------------
B D          White rhinoceros  gagga--------------gct---gctggtgc-------------------------------------
B D                       Cat  aaaaa--------------gcc---gcccgtgc-------------------------------------
B D                   Ferret   gaaca--------------gcc---gcgggtgc-------------------------------------
               Pacific walrus  aaaca--------------gcc---gccggtgc-------------------------------------
                 Weddell seal  gaaca--------------gcc---gccggtgc-------------------------------------
B D                   Megabat  gagca--------------gcc---gctggtgc-------------------------------------
                Big brown bat  cagca--------------gtt---gcgggtgc-------------------------------------
B D                     Shrew  gcgaa--------------ggc---gctggcgc-------------------------------------
B D                   Manatee  ---------------------------cggtgc-------------------------------------
B D                 Armadillo  ---------------------------cgccgc-------------------------------------
B D                   Opossum  cgccg--------------gag---accggagc-------------------------------------
B D           Tasmanian devil  ctgcg--------------gga---actacaac-------------------------------------
B D                  Platypus  tctcc--------------gtg---gacggagc-------------------------------------
  D               Rock pigeon  -------------------gcg---gggggaccgt-c---------cccagg------------------
  D       Collared flycatcher  -------------------ggg---gcggggctgagccgggtctaaccccgcgggagtggtcccggggcg
B D               Zebra finch  -------------------ggg---gcgaggacgggctg-------ccctgc------------------
           Tibetan ground jay  -------------------cca---gcggggccgc-ccg-------ccctgt------------------
B D                   Chicken  -------------------gag---cagcggctgtgccgggca---ctcggc------------------
B D        American alligator  -------------------gcg---acaaggac---c---------ccctgc------------------
  D            Painted turtle  ---cgcacgatgggccaccgga---gcgaaggcgaacgagtgg---cactgc------------------
  D  Chinese softshell turtle  ---gg--------------ggg---gggtaggtcattcaaaca---gactgg------------------
B D                  Hedgehog  ----------------------------------------------------------------------
             Star-nosed mole  ======================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ----
                        Chimp  ----
                      Gorilla  ----
                    Orangutan  ----
                       Gibbon  ----
          Crab-eating macaque  ----
                       Baboon  ----
                 Green monkey  ----
                     Marmoset  ----
                     Bushbaby  ----
           Chinese tree shrew  ----
                     Squirrel  ----
       Lesser Egyptian jerboa  ----
                 Prairie vole  ----
               Golden hamster  ----
                        Mouse  ----
                          Rat  ----
               Naked mole-rat  ----
                   Guinea pig  ----
                   Chinchilla  ----
             Brush-tailed rat  ----
                       Rabbit  ----
                         Pika  ----
                 Killer whale  ----
             White rhinoceros  ----
                          Cat  ----
                      Ferret   ----
               Pacific walrus  ----
                 Weddell seal  ----
                      Megabat  ----
                Big brown bat  ----
                        Shrew  ----
                      Manatee  ----
                    Armadillo  ----
                      Opossum  ----
              Tasmanian devil  ----
                     Platypus  ----
                  Rock pigeon  --ac
          Collared flycatcher  gggc
                  Zebra finch  --ac
           Tibetan ground jay  --ac
                      Chicken  --gc
           American alligator  --ac
               Painted turtle  --ac
     Chinese softshell turtle  --gc
                     Hedgehog  ----
              Star-nosed mole  ====
              Chinese hamster  NNNN
                       Alpaca  NNNN
                 Mallard duck  ====
          Medium ground finch  ====
                   Budgerigar  ====
                       Turkey  ====
                     Aardvark  ====
                     Elephant  ----
                        Panda  ====
                Domestic goat  NNNN
                        Sheep  NNNN
                          Cow  NNNN
             Tibetan antelope  ====
                  Spotted gar  ====
                   Coelacanth  ====
       White-throated sparrow  ====
             Peregrine falcon  ====
                      Lamprey  ====
                 Saker falcon  ====
                       Lizard  ====
             Cape golden mole  ----
                          Pig  ====
                      Dolphin  ====
         David's myotis (bat)  NNNN
             Black flying-fox  NNNN
                          Dog  NNNN
                        Horse  ====
               Bactrian camel  NNNN
              Squirrel monkey  NNNN
                       Rhesus  NNNN

Inserts between block 21 and 22 in window
B D                  Opossum 17bp
B D                 Platypus 9bp
  D           Painted turtle 19bp
  D Chinese softshell turtle 12bp

Alignment block 22 of 1260 in window, 23070918 - 23070935, 18 bps 
B D                     Human  ggagccc---------------ggg-cgggccag------------
B D                     Chimp  ggagccc---------------ggg-cgggccag------------
B D                   Gorilla  ggagccc---------------ggg-cgggccag------------
B D                 Orangutan  ggagccc---------------ggg-cgggccag------------
B D                    Gibbon  ggagccc---------------ggg-cgggccag------------
B D       Crab-eating macaque  ggagcct---------------ggg-cgggcaag------------
B D                    Baboon  ggagcct---------------ggg-cgggcaag------------
B D              Green monkey  ggagcct---------------ggg-ctggcaag------------
B D                  Marmoset  ggagccc---------------ggg-ctggcggg------------
B D           Squirrel monkey  ggagccc---------------agg-cgggccg-------------
B D                  Bushbaby  ggagccg---------------gggccaggccag------------
           Chinese tree shrew  ggagccc---------------gga-ctgg----------------
B D                  Squirrel  ggaaccc---------------ggc------cgg------------
       Lesser Egyptian jerboa  ggagtct---------------gag------ccg------------
                 Prairie vole  ggagccc---------------agg------cgg------------
               Golden hamster  gaagccc---------------agg------cgg------------
B D                     Mouse  ggagtgc---------------agg------cgg------------
B D                       Rat  ggagtcc---------------agg------cag------------
B D            Naked mole-rat  agagctc---------------cgg-----ccgg------------
B D                Guinea pig  ggagctc---------------cag-----cccg------------
                   Chinchilla  ggagccc---------------cag------ccg------------
             Brush-tailed rat  ggagccc---------------cag-----ccca------------
B D                    Rabbit  ggagcct---------------ggg-----ccgg------------
B D                      Pika  ggtggcc---------------ggg-----gcg-------------
                 Killer whale  ggagcca----------------gg-----ccg-------------
B D          White rhinoceros  ggagccgg------gccgggccggg-----ccgg------------
B D                       Cat  ggagccg---------------ggg-----ccag------------
B D                   Ferret   ggagacg---------------ggg-----ccag------------
               Pacific walrus  ggagccg---------------ggg-----ccag------------
                 Weddell seal  ggagcga---------------ggg-----ccag------------
B D                   Megabat  ggagccg---------------ggg-----ccgg------------
                Big brown bat  ggagcag---------------ggg-----ccgg------------
B D                  Hedgehog  --------------------ccgag-----cggg------------
B D                     Shrew  ggacccg----------gggctggg-----ccgg------------
B D                   Manatee  -------aggtgccggtgacatcgg-----cctg------------
B D                 Armadillo  -------g--------------cga-----cctg------------
B D                   Opossum  ggaaccc---------------agg------cag------------
B D           Tasmanian devil  ggagaca---------------cga------cag------------
B D                  Platypus  ggcgccc---------------gg----------------------
  D               Rock pigeon  gcagctc---------------ggt-----gcggcgc---------
  D       Collared flycatcher  tgagccg---------------ggt-----ctaaccc--------c
B D               Zebra finch  ggacacc---------------ggc-----ctggccc--------c
           Tibetan ground jay  -----------------------gt-----acagctg--------c
B D                   Chicken  ------c---------------ggc-----cggggcc--------t
B D        American alligator  gcatcac---------------agg-----cagaaccgctgctcgc
  D            Painted turtle  ggagcgc---------------ggc-----cgcctcc--------c
  D  Chinese softshell turtle  ggagacc-----------------c-----cgctgcc--------c
             Star-nosed mole  ==============================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ==============================================
B D       Medium ground finch  ==============================================
B D                Budgerigar  ==============================================
B D                    Turkey  ==============================================
                    Aardvark  ==============================================
B D                  Elephant  ----------------------------------------------
B D                     Panda  ==============================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ==============================================
                 Spotted gar  ==============================================
B D                Coelacanth  ==============================================
  D    White-throated sparrow  ==============================================
  D          Peregrine falcon  ==============================================
B D                   Lamprey  ==============================================
  D              Saker falcon  ==============================================
B D                    Lizard  ==============================================
            Cape golden mole  ----------------------------------------------
B D                       Pig  ==============================================
B D                   Dolphin  ==============================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ==============================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 22 and 23 in window
B D                  Manatee 10bp
B D                Armadillo 1bp
B D                  Opossum 11bp
B D          Tasmanian devil 8bp
B D                 Platypus 6bp

Alignment block 23 of 1260 in window, 23070936 - 23070944, 9 bps 
B D                     Human  gcgagctgc------
B D                     Chimp  gcgagctgc------
B D                   Gorilla  gcgagctgc------
B D                 Orangutan  gcgagctgc------
B D                    Gibbon  gcgagctgc------
B D       Crab-eating macaque  gcgagctgc------
B D                    Baboon  gcgagctgc------
B D              Green monkey  gcgagctgc------
B D                  Marmoset  gcgacctgc------
B D                  Bushbaby  gcgacctgc------
           Chinese tree shrew  gcgacttgc------
B D                  Squirrel  gagacctgc------
       Lesser Egyptian jerboa  gcgacctgc------
                 Prairie vole  gcgacctgc------
               Golden hamster  gcgacctgc------
B D                     Mouse  gcgatctgc------
B D                       Rat  gcgacctgc------
B D            Naked mole-rat  gcgacctgt------
B D                Guinea pig  gcgacctgt------
                   Chinchilla  gcgacctgt------
             Brush-tailed rat  gcgacctgt------
B D                    Rabbit  gcggcttgc------
B D                      Pika  --gacctgc------
                 Killer whale  gcgacctgc------
B D          White rhinoceros  gcgagctgc------
B D                       Cat  gagacctgc------
B D                   Ferret   acgacctgc------
               Pacific walrus  ccaacctag------
                 Weddell seal  acaacctgc------
             Black flying-fox  gcgacctgc------
B D                   Megabat  gcgacctgc------
                Big brown bat  gcgacctgc------
B D                  Hedgehog  gcgacctgc------
B D                     Shrew  gcgacctgc------
B D                   Manatee  cagggcagc------
B D                   Opossum  ggagccag-------
B D           Tasmanian devil  ctgaccag-------
B D                  Platypus  gcgac----------
  D               Rock pigeon  ------tgggc-tga
  D       Collared flycatcher  -----gcggg-----
B D               Zebra finch  -----atgggc-tgc
           Tibetan ground jay  -----acggg-----
B D                   Chicken  -----gcggg-----
B D        American alligator  -----acgtgc-ccg
  D            Painted turtle  -----ccgcacacgg
  D  Chinese softshell turtle  -----ccaagc----
             Star-nosed mole  ===============
B D           Chinese hamster  NNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNN
  D              Mallard duck  ===============
B D       Medium ground finch  ===============
B D                Budgerigar  ===============
B D                    Turkey  ===============
                    Aardvark  ===============
B D                 Armadillo  ===============
B D                  Elephant  ---------------
B D                     Panda  ===============
               Domestic goat  NNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNN
            Tibetan antelope  ===============
                 Spotted gar  ===============
B D                Coelacanth  ===============
  D    White-throated sparrow  ===============
  D          Peregrine falcon  ===============
B D                   Lamprey  ===============
  D              Saker falcon  ===============
B D                    Lizard  ===============
            Cape golden mole  ---------------
B D                       Pig  ===============
B D                   Dolphin  ===============
        David's myotis (bat)  NNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNN
B D                     Horse  ===============
              Bactrian camel  NNNNNNNNNNNNNNN
B D           Squirrel monkey  ---------------
B D                    Rhesus  NNNNNNNNNNNNNNN

Inserts between block 23 and 24 in window
              Golden hamster 6bp
B D                  Manatee 11bp
B D          Tasmanian devil 1bp

Alignment block 24 of 1260 in window, 23070945 - 23070961, 17 bps 
B D                     Human  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                     Chimp  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                   Gorilla  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                 Orangutan  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                    Gibbon  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D       Crab-eating macaque  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                    Baboon  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D              Green monkey  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                  Marmoset  aggagc-----g---------gc-----g--ctga-g-g------------t----------
B D           Squirrel monkey  -----------g---------gc-----g--ctga-g-g------------c----------
B D                  Bushbaby  -ggagc-----g---------gc-----g--ctga-g-t------------c----------
           Chinese tree shrew  gggagc-----g---------tt-----g--ctga-g-g------------c----------
B D                  Squirrel  gggagc-----t---------ac-----g--ctga-g-g------------t----------
       Lesser Egyptian jerboa  gagagt-----g---------gc-----g--cctg-g-cggtggggaggggg----------
                 Prairie vole  gggagc-----g---------ac-----g--ccag-g-c------------g----------
               Golden hamster  ggcagc-----g---------ac-----g--ccag-g-c-----------gg----------
B D                     Mouse  aggagc-----g---------ac-----g--ccag-g-c-----------gg----------
B D                       Rat  ggcagc-----g---------ac-----g--ccag-g-c------------g----------
B D            Naked mole-rat  gagagc-----g---------gc-----g--ctga-g-g------------c----------
B D                Guinea pig  gggagc-----g---------gc-----g--ctga-g-g------------c----------
                   Chinchilla  gggagc-----g---------gc-----g--ctga-g-g------------c----------
             Brush-tailed rat  gggagc-----g---------gc-----g--ctga-g-g------------c----------
B D                    Rabbit  gggagc-----g---------gt-----g--ccga-g-g------------c----------
B D                      Pika  cggagc-----g---------gc-----gccccga-g-g------------c----------
                 Killer whale  gggaga-----g---------gc-----g--cc-c-g-g------------c----------
B D          White rhinoceros  gggag------g---------gc-----c--ccga-g-g------------c----------
B D                       Cat  cggaga-----g---------gc-----g--ctga-g-g------------c----------
B D                   Ferret   aggaga-----g---------gc-----t--ctga-g-g------------c----------
               Pacific walrus  aggaga-----g---------ac-----g--ctga-g-g------------c----------
                 Weddell seal  aggaga-----g---------gc-----g--ctga-g-g------------c----------
             Black flying-fox  tagatc-----a---------gc-----g--ctga-g-g------------c----------
B D                   Megabat  tagatc-----a---------gc-----g--ctga-g-g------------c----------
                Big brown bat  gggcgc-----g---------gc-----g--ctga-g-g------------c----------
B D                  Hedgehog  ggaagc-----g---------gg-----g--ccga-g-g--------gggac----------
B D                     Shrew  gggagc---------------ag-----c--ctga-g-g------------t----------
B D                  Elephant  --gggc-----g---------gc---------------------------------------
B D                   Manatee  --gggc-----g---------gc---------------------------------------
             Cape golden mole  --gggt-----g---------ga---------------------------------------
                     Aardvark  --gggt-----gcgtcct---ga---------------------------------------
B D                 Armadillo  --ggga-----gcgggctgggga---------------------------------------
B D                   Opossum  aggggc-----g---------gg-----g--cgga-g-g------------c----------
B D           Tasmanian devil  atgaac-----a---------tc-----a--ttgagg-g------------c----------
B D                  Platypus  -ggaaccggtag---------ac-----g--c------------------------------
  D               Rock pigeon  ggccgt-----g---------ag-----g--ctga-g-----------------------tc
  D       Collared flycatcher  ---agt-----g---------gt-----c--ccgg-g-----------------------gc
B D               Zebra finch  gacact-----g---------gt-----g--ctgc-a-g------------cct------gc
           Tibetan ground jay  gagacc-----a---------gccggcgg--ctgg-agg------------ccc------ac
B D                   Chicken  ---agc-----g---------gc-----g--ctga-g-g------------ccg------gc
B D        American alligator  ctcacc-----c---------gg-----g--c------------------------------
  D            Painted turtle  cgcggc-----a---------gc-----t--cccc-t-c------------ctcctgtgagc
  D  Chinese softshell turtle  -----c-----a---------gc-----c--ccac-c-c------------ctc--------
             Star-nosed mole  ==============================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ==============================================================
B D       Medium ground finch  ==============================================================
B D                Budgerigar  ==============================================================
B D                    Turkey  ==============================================================
B D                     Panda  ==============================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ==============================================================
                 Spotted gar  ==============================================================
B D                Coelacanth  ==============================================================
  D    White-throated sparrow  ==============================================================
  D          Peregrine falcon  ==============================================================
B D                   Lamprey  ==============================================================
  D              Saker falcon  ==============================================================
B D                    Lizard  ==============================================================
B D                       Pig  ==============================================================
B D                   Dolphin  ==============================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  ==============================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
                Killer whale 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
  D Chinese softshell turtle 5bp

Alignment block 25 of 1260 in window, 23070962 - 23070965, 4 bps 
B D                     Human  g-g-gt-
B D                     Chimp  g-g-gt-
B D                   Gorilla  g-g-gt-
B D                 Orangutan  g-g-gt-
B D                    Gibbon  g-g-gt-
B D       Crab-eating macaque  g-g-gt-
B D                    Baboon  g-g-gt-
B D              Green monkey  g-g-gt-
B D                  Marmoset  g-g-gt-
B D           Squirrel monkey  g-g-gt-
B D                  Bushbaby  g-gtgt-
           Chinese tree shrew  a---gt-
B D                  Squirrel  g-ggat-
       Lesser Egyptian jerboa  a-gggt-
                 Prairie vole  g-gggt-
               Golden hamster  g-gggt-
B D                     Mouse  g-gggt-
B D                       Rat  g-gggt-
B D            Naked mole-rat  g-gggt-
B D                Guinea pig  g-gggt-
                   Chinchilla  g-gggt-
             Brush-tailed rat  g-aggt-
B D                    Rabbit  g-gggt-
B D                      Pika  accggt-
B D                    Alpaca  ---ggg-
                 Killer whale  ---ggg-
B D          White rhinoceros  ---ggg-
B D                       Cat  ---ggg-
B D                   Ferret   ---ggg-
               Pacific walrus  ---ggg-
                 Weddell seal  ---ggg-
             Black flying-fox  ---ggg-
B D                   Megabat  ---ggg-
                Big brown bat  ---ggg-
B D                  Hedgehog  ---ggg-
B D                     Shrew  ---ggg-
B D                  Elephant  ---ggg-
B D                   Manatee  ---ggg-
             Cape golden mole  ---ggg-
                     Aardvark  ---ggg-
B D                 Armadillo  ---ggg-
B D                   Opossum  -ggggc-
B D           Tasmanian devil  -acggc-
B D                  Platypus  ---gat-
  D               Rock pigeon  ---ggg-
  D       Collared flycatcher  ---gggg
B D               Zebra finch  ---agga
           Tibetan ground jay  ---gaga
  D            Painted turtle  ---aggt
             Star-nosed mole  =======
B D           Chinese hamster  NNNNNNN
  D              Mallard duck  =======
B D       Medium ground finch  =======
B D                Budgerigar  =======
  D  Chinese softshell turtle  =======
B D                    Turkey  =======
B D                     Panda  =======
               Domestic goat  NNNNNNN
B D                     Sheep  NNNNNNN
B D                       Cow  NNNNNNN
            Tibetan antelope  =======
                 Spotted gar  =======
B D                   Chicken  -------
B D        American alligator  -------
B D                Coelacanth  =======
  D    White-throated sparrow  =======
  D          Peregrine falcon  =======
B D                   Lamprey  =======
  D              Saker falcon  =======
B D                    Lizard  =======
B D                       Pig  =======
B D                   Dolphin  =======
        David's myotis (bat)  NNNNNNN
B D                       Dog  NNNNNNN
B D                     Horse  =======
              Bactrian camel  NNNNNNN
B D                    Rhesus  NNNNNNN

Inserts between block 25 and 26 in window
B D                   Alpaca 5bp
                Killer whale 1bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                  Ferret  5bp
              Pacific walrus 5bp
                Weddell seal 5bp
            Black flying-fox 5bp
B D                  Megabat 5bp
               Big brown bat 5bp
B D                 Hedgehog 6bp
B D                    Shrew 6bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 6bp
B D                 Platypus 3bp
  D              Rock pigeon 24bp
  D      Collared flycatcher 57bp
          Tibetan ground jay 26bp
  D           Painted turtle 6bp

Alignment block 26 of 1260 in window, 23070966 - 23070971, 6 bps 
B D                     Human  --ctc-cct
B D                     Chimp  --ctc-cct
B D                   Gorilla  --ctc-cct
B D                 Orangutan  --ctc-cc-
B D                    Gibbon  --ctc-cct
B D       Crab-eating macaque  --ctc-cct
B D                    Baboon  --ctc-cct
B D              Green monkey  --ctc-cct
B D                  Marmoset  --ctc-cct
B D           Squirrel monkey  --ctc-tct
B D                  Bushbaby  --ctc-ctt
           Chinese tree shrew  --ctc-tct
B D                  Squirrel  --ctc-cct
       Lesser Egyptian jerboa  --cttgtcc
                 Prairie vole  --ctc-tct
               Golden hamster  --ctc-tct
B D                     Mouse  --ctc-tct
B D                       Rat  --ctc-tct
B D            Naked mole-rat  --ctc-cct
B D                Guinea pig  --cgc-tcc
                   Chinchilla  --ccc-ctt
             Brush-tailed rat  --ctt-cct
B D                    Rabbit  --ctc-cct
B D                      Pika  --ctc-cct
B D                    Alpaca  --ctc-ccg
                 Killer whale  --ctc-ccg
B D                     Horse  --ctc-ccg
B D          White rhinoceros  --ctc-ccg
B D                       Cat  --ctc-cca
B D                   Ferret   --ctc-cca
B D                     Panda  --ctc-cca
               Pacific walrus  --ctc-cca
                 Weddell seal  --ctc-cca
             Black flying-fox  --ctc-ccg
B D                   Megabat  --ctc-ccg
                Big brown bat  --cccttcg
B D                  Hedgehog  --ctc-ccg
B D                     Shrew  --ccc-ccg
B D                  Elephant  --ctc-cct
B D                   Manatee  --ctc-ccc
             Cape golden mole  --ggc-agt
                     Aardvark  --gcg-cca
B D                 Armadillo  --ctc-ccg
B D                   Opossum  --ctc-cgt
B D           Tasmanian devil  --ctc-cct
B D                  Platypus  --ctg-ccc
  D               Rock pigeon  tgtcg-c--
  D       Collared flycatcher  c-ccc-g--
           Tibetan ground jay  ctctc-c--
B D                   Chicken  --cag-c--
B D        American alligator  cgccc-g--
  D            Painted turtle  --cct-c--
  D  Chinese softshell turtle  --cct-c--
             Star-nosed mole  =========
B D           Chinese hamster  NNNNNNNNN
  D              Mallard duck  =========
B D       Medium ground finch  =========
B D                Budgerigar  =========
B D                    Turkey  =========
               Domestic goat  NNNNNNNNN
B D                     Sheep  NNNNNNNNN
B D                       Cow  NNNNNNNNN
            Tibetan antelope  =========
                 Spotted gar  =========
B D                Coelacanth  =========
  D    White-throated sparrow  =========
  D          Peregrine falcon  =========
B D                   Lamprey  =========
B D               Zebra finch  =========
  D              Saker falcon  =========
B D                    Lizard  =========
B D                       Pig  =========
B D                   Dolphin  =========
        David's myotis (bat)  NNNNNNNNN
B D                       Dog  NNNNNNNNN
              Bactrian camel  NNNNNNNNN
B D                    Rhesus  NNNNNNNNN

Inserts between block 26 and 27 in window
  D           Painted turtle 2bp
  D Chinese softshell turtle 3bp

Alignment block 27 of 1260 in window, 23070972 - 23070989, 18 bps 
B D                     Human  ----------------------------a---gggggaggat------------------cagggag
B D                     Chimp  ----------------------------a---gggggaggat------------------cagggag
B D                   Gorilla  ----------------------------a---ggggggggat------------------cagggag
B D                 Orangutan  ----------------------------a---aggaggggat------------------cagggag
B D                    Gibbon  ----------------------------a---ggggggggat------------------cagggag
B D       Crab-eating macaque  ----------------------------a---gaggg-ggat------------------cagggag
B D                    Baboon  ----------------------------a---gaggg-ggat------------------cagggag
B D              Green monkey  ----------------------------a---gaggg-ggat------------------cagggag
B D                  Marmoset  ----------------------------a---aggg--gaat------------------cagggag
B D           Squirrel monkey  ----------------------------a---gggg--ggat------------------cagggag
B D                  Bushbaby  ----------------------------t---ggggg-agac--------------------gggag
           Chinese tree shrew  ----------------------------a---cgagggggat------------------caggaag
B D                  Squirrel  ----------------------------c---tagggataac------------------taaaagg
       Lesser Egyptian jerboa  ----------------------------c---ccggggtgtg------------------ggtgggg
                 Prairie vole  ----------------------------c---tggggg-cca------------------ggggtgc
               Golden hamster  ----------------------------cccgcggggg-gca------------------ggggttc
B D                     Mouse  ----------------------------c---cgggggtcca------------------ggggtac
B D                       Rat  ----------------------------c---cgggggtcca------------------tgggtac
B D            Naked mole-rat  ----------------------------c---tgggggttcg-------------------ggaagg
B D                Guinea pig  ----------------------------c---tgaagatgca-------------------gggtgg
                   Chinchilla  ----------------------------c---tgcggctgcg-------------------gggagg
             Brush-tailed rat  ----------------------------c---tgggggttca-------------------gggagg
B D                    Rabbit  ----------------------------c---gggggatgctgggcggcggaggagggaggggaagg
B D                      Pika  ----------------------------t---taggaaggtgggaaggtg--ggatgacagggaagg
B D                    Alpaca  ----------------------------g---g----------------------------------
                 Killer whale  ----------------------------g---g----------------------------------
B D                     Horse  ----------------------------g---gggag-----------------------agggaag
B D          White rhinoceros  ----------------------------g---gggag-----------------------cgggaag
B D                       Cat  ----------------------------g---gggag-----------------------cggggag
B D                   Ferret   ----------------------------g---gggag-----------------------cggggag
B D                     Panda  ----------------------------g---gggag-----------------------cggggag
               Pacific walrus  ----------------------------g---gggag-----------------------cggggag
                 Weddell seal  ----------------------------a---gggag-----------------------cggggag
             Black flying-fox  ----------------------------g---gaaag-----------------------cggggag
B D                   Megabat  ----------------------------g---gaaag-----------------------cggggag
                Big brown bat  ----------------------------g---gggag-----------------------cggggag
B D                  Hedgehog  ----------------------------g---gggt------------------------tggcggg
B D                     Shrew  ----------------------------g---gggga-----------------------agggagg
B D                  Elephant  ----------------------------g---ggcg------------------------cgaggag
B D                   Manatee  ----------------------------g---gacg------------------------cgagagg
             Cape golden mole  ----------------------------g---ga-g------------------------ggagagg
                     Aardvark  ----------------------------g---ggtg------------------------caggtgg
B D                 Armadillo  ----------------------------g---tgcg------------------------cggggcg
B D                   Opossum  ----------------------------a---ggtgaggcgc------------------aatgaag
B D           Tasmanian devil  ----------------------------c---tttgtggact------------------cctggag
B D                  Platypus  ----------------------------g---cggggagc--------------------cggaga-
  D               Rock pigeon  ----------------------------t---cgct-------------------------------
  D       Collared flycatcher  ----------------------------c---ggga-------------------------------
           Tibetan ground jay  ----------------------------c---agct-------------------------------
B D        American alligator  ---------------------acgcaccg---agct-------------------------------
  D            Painted turtle  ctcgcggcgat---ccagccagaataaca---acag-------------------------------
  D  Chinese softshell turtle  gtgggggggacacgcaatctagaatggct---agaa-------------------------------
             Star-nosed mole  ===================================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ===================================================================
B D       Medium ground finch  ===================================================================
B D                Budgerigar  ===================================================================
B D                    Turkey  ===================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ===================================================================
                 Spotted gar  ===================================================================
B D                   Chicken  ===================================================================
B D                Coelacanth  ===================================================================
  D    White-throated sparrow  ===================================================================
  D          Peregrine falcon  ===================================================================
B D                   Lamprey  ===================================================================
B D               Zebra finch  ===================================================================
  D              Saker falcon  ===================================================================
B D                    Lizard  ===================================================================
B D                       Pig  ===================================================================
B D                   Dolphin  ===================================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 27 and 28 in window
          Chinese tree shrew 11bp
B D                    Horse 10bp
B D         White rhinoceros 10bp
B D                      Cat 11bp
B D                  Ferret  11bp
B D                    Panda 11bp
              Pacific walrus 11bp
                Weddell seal 11bp
            Black flying-fox 10bp
B D                  Megabat 10bp
               Big brown bat 10bp
B D                 Hedgehog 10bp
B D                    Shrew 10bp
B D                  Opossum 3bp
B D          Tasmanian devil 3bp

Alignment block 28 of 1260 in window, 23070990 - 23071005, 16 bps 
B D                     Human  gggcgg---cc------------gg---ag--ccga-----------------------
B D                     Chimp  gggcgg---cc------------gg---ag--ccga-----------------------
B D                   Gorilla  gggcgg---cc------------gg---ag--ccga-----------------------
B D                 Orangutan  gggcgg---cc------------gg---ag--ccga-----------------------
B D                    Gibbon  gggcgg---cc------------gg---ag--ccga-----------------------
B D       Crab-eating macaque  gggcgg---cc------------gg---ag--ccga-----------------------
B D                    Baboon  gggcgg---cc------------gg---ag--ccga-----------------------
B D              Green monkey  gggcgg---cc------------gg---ag--cgga-----------------------
B D                  Marmoset  aggcgg---cc------------gg---ag--ccga-----------------------
B D           Squirrel monkey  gggctg---cc------------gg---ag--ccaa-----------------------
B D                  Bushbaby  gggcga---tcccggacggcccaag---gg--ccaa-----------------------
           Chinese tree shrew  gggcgg---cc------------tg---agcacgaa-----------------------
B D                  Squirrel  agacga---cc------------cc---ag--ttgg-----------------------
       Lesser Egyptian jerboa  atgggg---gt------------cc---ag--gggt-----------------------
                 Prairie vole  aggcag---cc------------gc---ag--gtgt-----------------------
               Golden hamster  aggcag---cc------------gc---ag--gtgt-----------------------
B D                     Mouse  aggcag---cc------------gc---ag--gtgt-----------------------
B D                       Rat  aggcag---cc------------gc---ag--gtgt-----------------------
B D            Naked mole-rat  aggcaa---cc------------cc---gg--gtgg-----------------------
B D                Guinea pig  aggcga---cc------------cc---gg--gtgg-----------------------
                   Chinchilla  aggcga---cc------------cc---gg--gtgg-----------------------
             Brush-tailed rat  cggcga---cc------------cc---cg--gtgg-----------------------
B D                    Rabbit  aggcga---cc------------cc---gg--gtgg-----------------------
B D                      Pika  cggccgactcc------------cc---gg--gtgg-----------------------
B D                    Alpaca  ggtagg---cg------------gg---agcgccgg-----------------------
                 Killer whale  ggacgg---cg------------gg---agcgccgg-----------------------
B D                     Horse  gagcag---cg------------gg---ggcgccga-----------------------
B D          White rhinoceros  ggacag---cg------------gg---ggcgccga-----------------------
B D                       Cat  gggccg---ca------------gg---agcgccga-----------------------
B D                       Dog  gagcgg---ct------------gc---agagccaa-----------------------
B D                   Ferret   gggcgg---ct------------gg---agcgccga-----------------------
B D                     Panda  gggcgg---ct------------gg---agcgccga-----------------------
               Pacific walrus  gggcgg---ct------------gg---agcgccga-----------------------
                 Weddell seal  gggcgg---ct------------gg---agcgccga-----------------------
             Black flying-fox  gggcgg---cg------------gg---agcgccga-----------------------
B D                   Megabat  gggcgg---cg------------gg---agcgccga-----------------------
                Big brown bat  gggcgg---cg------------gg---tgcgccag-----------------------
B D                  Hedgehog  gct--g---cg------------gc---cgcgccga-----------------------
B D                     Shrew  gaggag---ct------------gt---cgcgctga-----------------------
B D                  Elephant  ----------------------------------gg-----------------------
B D                   Manatee  ----------------------------------gg-----------------------
             Cape golden mole  ----------------------------------ga-----------------------
                     Aardvark  ----------------------------------gg-----------------------
B D                 Armadillo  ----------------------------------gg-----------------------
B D                   Opossum  gggcgg---gg------------gcggg-------------------------------
B D           Tasmanian devil  gggaaa---ct------------gc----------------------------------
B D                  Platypus  --tcta---ct------------gg---at--tcgg-----------------------
  D               Rock pigeon  ----------------------------------ggtgacccgggttgc-------cca
  D       Collared flycatcher  ----------------------------------gtggtcccggg--gc---ggggctg
           Tibetan ground jay  ----------------------------------gggcttccggg--ac-------ctg
B D        American alligator  ----------------------------------gggcgcgcacg-cgctagtgagtca
  D            Painted turtle  ----------------------------------ggcgctccccc--tc-------ccc
  D  Chinese softshell turtle  ----------------------------------agcgcccccca--gc-------ccg
             Star-nosed mole  ===========================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ===========================================================
B D       Medium ground finch  ===========================================================
B D                Budgerigar  ===========================================================
B D                    Turkey  ===========================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ===========================================================
                 Spotted gar  ===========================================================
B D                   Chicken  ===========================================================
B D                Coelacanth  ===========================================================
  D    White-throated sparrow  ===========================================================
  D          Peregrine falcon  ===========================================================
B D                   Lamprey  ===========================================================
B D               Zebra finch  ===========================================================
  D              Saker falcon  ===========================================================
B D                    Lizard  ===========================================================
B D                       Pig  ===========================================================
B D                   Dolphin  ===========================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 28 and 29 in window
B D                 Squirrel 12bp
      Lesser Egyptian jerboa 17bp
                Prairie vole 12bp
              Golden hamster 12bp
B D                    Mouse 4bp
B D                      Rat 4bp
B D           Naked mole-rat 12bp
B D               Guinea pig 12bp
                  Chinchilla 12bp
            Brush-tailed rat 12bp
B D                   Rabbit 12bp
B D                     Pika 13bp
B D                 Elephant 7bp
B D                  Manatee 7bp
            Cape golden mole 3bp
                    Aardvark 27bp
B D                Armadillo 30bp
B D                  Opossum 5bp

Alignment block 29 of 1260 in window, 23071006 - 23071010, 5 bps 
B D                     Human  t---------gca----------------------g
B D                     Chimp  t---------gca----------------------g
B D                   Gorilla  t---------gca----------------------g
B D                 Orangutan  t---------gca----------------------g
B D                    Gibbon  t---------gca----------------------a
B D       Crab-eating macaque  t---------gca----------------------g
B D                    Baboon  t---------gca----------------------g
B D              Green monkey  t---------gca----------------------g
B D                  Marmoset  c---------gca----------------------g
B D           Squirrel monkey  c---------gca----------------------g
B D                  Bushbaby  c---------gcg----------------------t
           Chinese tree shrew  c---------gcg----------------------t
B D                  Squirrel  c---------gcg----------------------t
       Lesser Egyptian jerboa  c---------gcaggtggcaggagcggcgggctctt
                 Prairie vole  c---------gtt----------------------t
B D           Chinese hamster  t---------gct----------------------t
               Golden hamster  c---------gct----------------------t
B D                     Mouse  a---------gct----------------------t
B D                       Rat  a---------gct----------------------t
B D            Naked mole-rat  c---------gtg----------------------t
B D                Guinea pig  c---------gtg----------------------t
                   Chinchilla  c---------gtg----------------------t
             Brush-tailed rat  c---------gtg----------------------t
B D                    Rabbit  c---------gcg----------------------t
B D                      Pika  c---------gct----------------------t
B D                    Alpaca  c---------gcg----------------------t
                 Killer whale  c---------gcg----------------------t
B D                     Horse  c---------gcg----------------------g
B D          White rhinoceros  c---------gcg----------------------g
B D                       Cat  c---------ctg----------------------t
B D                       Dog  g---------acg----------------------t
B D                   Ferret   c---------gcg----------------------t
B D                     Panda  c---------gcg----------------------t
               Pacific walrus  c---------gcg----------------------t
                 Weddell seal  c---------gcg----------------------t
             Black flying-fox  c---------gcg----------------------t
B D                   Megabat  c---------gcg----------------------t
                Big brown bat  c---------gcg----------------------t
B D                  Hedgehog  c---------gtg----------------------t
B D                     Shrew  c---------gcg----------------------g
B D                  Elephant  c---------gcg----------------------g
B D                   Manatee  c---------gtg----------------------g
             Cape golden mole  ------------g----------------------g
                     Aardvark  c---------gtg----------------------g
B D                 Armadillo  c---------gcg----------------------t
B D                   Opossum  c---------act----------------------g
B D           Tasmanian devil  c---------cca----------------------g
B D                  Platypus  a---------gc------------------------
  D               Rock pigeon  c---------ggc----------------------c
  D       Collared flycatcher  a---------gcc----------------------g
           Tibetan ground jay  t---------ggc----------------------g
B D        American alligator  c---------ggc----------------------a
  D            Painted turtle  c---------gcc----------------------c
  D  Chinese softshell turtle  cagggtgggggag----------------------t
             Star-nosed mole  ====================================
  D              Mallard duck  ====================================
B D       Medium ground finch  ====================================
B D                Budgerigar  ====================================
B D                    Turkey  ====================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ====================================
                 Spotted gar  ====================================
B D                   Chicken  ====================================
B D                Coelacanth  ====================================
  D    White-throated sparrow  ====================================
  D          Peregrine falcon  ====================================
B D                   Lamprey  ====================================
B D               Zebra finch  ====================================
  D              Saker falcon  ====================================
B D                    Lizard  ====================================
B D                       Pig  ====================================
B D                   Dolphin  ====================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 30 of 1260 in window, 23071011 - 23071066, 56 bps 
B D                     Human  ggc-----ct----------------tgc-ctga----------------aa-----------------c
B D                     Chimp  ggc-----cc----------------tgc-ctga----------------aa-----------------c
B D                   Gorilla  ggc-----ct----------------tgc-ctga----------------aa-----------------c
B D                 Orangutan  ggc-----ct----------------tgc-ccga----------------aa-----------------c
B D                    Gibbon  ggc-----ct----------------tgc-ccga----------------aa-----------------c
B D                    Rhesus  ggc-----ct----------------ttc-ccga----------------aa-----------------c
B D       Crab-eating macaque  ggc-----ct----------------ttc-ccga----------------aa-----------------c
B D                    Baboon  ggc-----ct----------------ttc-ccga----------------aa-----------------c
B D              Green monkey  ggc-----ct----------------ttc-ccga----------------aa-----------------c
B D                  Marmoset  ggc-----ct----------------tgc-ccta----------------aa-----------------c
B D           Squirrel monkey  ggc-----ct----------------tgc-ccta----------------aa-----------------c
B D                  Bushbaby  -tg-----cc----------------tgg-ctga----------------ga-----------------c
           Chinese tree shrew  ggt-----ct----------------ggg-ctga----------------ga-----------------c
B D                  Squirrel  ggc-----ct----------------tca-ccgg----------------aa-----------------a
       Lesser Egyptian jerboa  ggc-----ct----------------tgg-ccga----------------ag-----------------g
                 Prairie vole  ggc-----ct----------------tga-taga----------------aa-----------------g
B D           Chinese hamster  ggc-----ct----------------tgattaga----------------ac-----------------g
               Golden hamster  ggc-----ct----------------tga-taga----------------ac-----------------g
B D                     Mouse  ggc-----ct----------------tgggtaaa----------------aaaataaaaaaataaaaacg
B D                       Rat  ggc-----ct----------------tgggtaaa----------------aa-----------------g
B D            Naked mole-rat  cgc-----ct----------------cgg-ccga----------------aa-----------------c
B D                Guinea pig  ggt-----ct----------------cgg-ccga----------------aa-----------------a
                   Chinchilla  ggc-----ct----------------tgg-ccga----------------aa-----------------c
             Brush-tailed rat  ggc-----ct----------------tgg-ccaa----------------aa-----------------c
B D                    Rabbit  ggc-----ct----------------tgg-ctga----------------aa-----------------c
B D                      Pika  gaccccctcc----------------cgg-ctga----------------aa-----------------c
B D                    Alpaca  ggc-----ct----------------tgg-ctga----------------aa-----------------c
                 Killer whale  ggc-----ct----------------ggg-ctga----------------aa-----------------c
B D                     Horse  gtc-----tt----------------tgg-ctaa----------------aa-----------------c
B D          White rhinoceros  ggc-----tt----------------tgg-ctaa----------------aa-----------------c
B D                       Cat  ggc-----ct----------------tgg-ctga----------------aa-----------------c
B D                       Dog  ggc-----ct----------------tgg-ccga----------------at-----------------c
B D                   Ferret   ggc-----ct----------------tgg-ctga----------------aa-----------------c
B D                     Panda  ggc-----ct----------------tgg-ctga----------------aa-----------------c
               Pacific walrus  ggc-----ct----------------tgg-ctga----------------aa-----------------c
                 Weddell seal  ggc-----ct----------------tgg-ctga----------------aa-----------------c
             Black flying-fox  ggc-----ct----------------tgg-ctga----------------aa-----------------c
B D                   Megabat  ggc-----ct----------------tgg-ctga----------------aa-----------------c
                Big brown bat  ggc-----cg----------------tgg-cgga----------------gc-----------------c
B D                  Hedgehog  ggc-----cc----------------ggg-ctgg----------------ag------------------
B D                     Shrew  ggc-----cc----------------ggg-gccg----------------ag-----------------g
B D                  Elephant  -gg-----cc----------------tgt-cgga----------------ga-----------------c
B D                   Manatee  -gg-----cc----------------tgt-cgga----------------ga-----------------c
             Cape golden mole  -gg-----aa----------------aga-cgga----------------gg-----------------a
                     Aardvark  -gc-----ccgagagggtgggcagggcgt-cagg----------------cc-----------------c
B D                 Armadillo  -gg-----cc------ttggcccgcacgc-cggc----------------ga-----------gggcccc
B D                   Opossum  ------------------------gacac-tgga----------------aa-----------------g
B D           Tasmanian devil  ------------------------tgcgc-tgga----------------gc-----------------g
B D                  Platypus  -gc-----tc----------------ttc-cgag----------------ca-----------------c
  D               Rock pigeon  --------------------------gcc-ccacagc-------------cg-----------------c
  D       Collared flycatcher  --------------------------ggc-ctaa----------------cc-----------------c
           Tibetan ground jay  --------------------------ggt-gcag------------------------------------
B D        American alligator  --------------------------ggg-tccc----------------at-----------------c
  D            Painted turtle  --------------------------gtc-tccc----------------ct-----------------c
  D  Chinese softshell turtle  --------------------------gtt-acccagtggctggagccagact-----------------c
             Star-nosed mole  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================================================================
                 Spotted gar  ======================================================================
B D                   Chicken  ======================================================================
B D                Coelacanth  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Lamprey  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Lizard  ======================================================================
B D                       Pig  ======================================================================
B D                   Dolphin  ======================================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  c-gagga-------------------------------ga----------gggc---------------c
                        Chimp  c-gagga-------------------------------ga----------gggc---------------c
                      Gorilla  c-gagga-------------------------------ga----------gggc---------------c
                    Orangutan  c-gagga-------------------------------ga----------gggc---------------c
                       Gibbon  c-gagga-------------------------------ga----------gggc---------------c
                       Rhesus  c-aagga-------------------------------aa----------gggc---------------c
          Crab-eating macaque  c-aagga-------------------------------aa----------gggc---------------c
                       Baboon  c-aagga-------------------------------aa----------gggc---------------c
                 Green monkey  c-aagga-------------------------------aa----------gggc---------------c
                     Marmoset  c-gagga-------------------------------aa----------gggc---------------c
              Squirrel monkey  c-gagga-------------------------------aa----------gggc---------------c
                     Bushbaby  c-gaaaa-------------------------------ga----------gggc---------------c
           Chinese tree shrew  g-gtgaa-------------------------------ga----------gggc---------------c
                     Squirrel  g-gaaga-------------------------------ta----------gggc---------------c
       Lesser Egyptian jerboa  g-gaagc-------------------------------gc----------gggc---------------c
                 Prairie vole  g-gaaga-------------------------------ga----------gggc---------------c
              Chinese hamster  g-gaaga-------------------------------ga----------gggc---------------c
               Golden hamster  g-gaaga-------------------------------ga----------gggc---------------c
                        Mouse  g-gaaga-------------------------------ga----------gggc---------------c
                          Rat  g-gaaga-------------------------------ga----------gggc---------------c
               Naked mole-rat  g-gaaga-------------------------------ga----------gggc---------------c
                   Guinea pig  g-gaaga-------------------------------ga----------gggc---------------c
                   Chinchilla  g-gaaga-------------------------------ga----------gggc---------------c
             Brush-tailed rat  g-gaaga-------------------------------ga----------gggc---------------c
                       Rabbit  c-tagca-------------------------------ga----------agag---------------c
                         Pika  c-gagca-------------------------------ga----------ggag---------------g
                       Alpaca  g-gaggc-------------------------------ga----------gggc---------------c
                 Killer whale  g-gaggc-------------------------------ga----------gggc---------------c
                        Horse  g-aaggc-------------------------------gc----------gggc---------------c
             White rhinoceros  g-gaggc-------------------------------ga----------gggc---------------t
                          Cat  g-aagga-------------------------------ga----------gggc---------------c
                          Dog  c-gggga-------------------------------gc----------ggac---------------c
                      Ferret   g-gagga-------------------------------ga----------gggc---------------c
                        Panda  g-gagga-------------------------------ga----------gggc---------------c
               Pacific walrus  g-gagga-------------------------------ga----------gggc---------------c
                 Weddell seal  g-gagga-------------------------------ga----------gggc---------------c
             Black flying-fox  g-gagga-------------------------------ga----------gggc---------------c
                      Megabat  a-gagga-------------------------------ga----------gggc---------------c
                Big brown bat  g-gggga-------------------------------ga----------gggc---------------c
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  a-ggacg-------------------------------ag----------aggc---------------c
                     Elephant  c-gaggc-------------------------------ct-----------ggc---------------t
                      Manatee  a-gaggc-------------------------------ct----------gggc---------------t
             Cape golden mole  g-ggggc-------------------------------ttccacatatgcaagc---------------t
                     Aardvark  c-ggggc-------------------------------ct----------gggg---------------c
                    Armadillo  g-gaggc-------------------------------ct----------gggc---------------c
                      Opossum  c-gaggc--------------------------gcggaga----------ggg-----------------
              Tasmanian devil  c-gagaccgacccctgctccatgagccagctcaacagtga----------gtgc---------------c
                     Platypus  c-tggga-------------------------------ga----------ggacggtcccagtgagtagt
                  Rock pigeon  c-cagcc-------------------------------cg----------cggc---------------t
          Collared flycatcher  c-gaggg-------------------------------ag----------gggt---------------c
           Tibetan ground jay  --gagga-------------------------------gg----------gcat----------------
           American alligator  t-cagac-------------------------------ag----------tgca---------------c
               Painted turtle  tccgcgc-------------------------------tt----------cctg---------------c
     Chinese softshell turtle  t-agggt-------------------------------tc----------ccct---------------c
              Star-nosed mole  ======================================================================
                 Mallard duck  ======================================================================
          Medium ground finch  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ======================================================================
                  Spotted gar  ======================================================================
                      Chicken  ======================================================================
                   Coelacanth  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                      Lamprey  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                       Lizard  ======================================================================
                          Pig  ======================================================================
                      Dolphin  ======================================================================
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  cca-------gaggc---c---t----------gg----------------------g------------
                        Chimp  cca-------gaggc---c---t----------gg----------------------g------------
                      Gorilla  cca-------gaggc---c---t----------gg----------------------g------------
                    Orangutan  cca-------gaggc---c---t----------gg----------------------g------------
                       Gibbon  cca-------gaggc---c---t----------gg----------------------g------------
                       Rhesus  cca-------gaggc---c---t----------gg----------------------g------------
          Crab-eating macaque  cca-------gaggc---c---t----------gg----------------------g------------
                       Baboon  cca-------gaggc---c---t----------gg----------------------g------------
                 Green monkey  cca-------gaggc---c---t----------gg----------------------g------------
                     Marmoset  cca-------gaggc---c---t----------gg----------------------g------------
              Squirrel monkey  cca-------gaggc---c---t----------gg----------------------g------------
                     Bushbaby  gag-------gaggc---c---t----------gg----------------------g------------
           Chinese tree shrew  ccg-------gaggc---c---t----------gg----------------------g------------
                     Squirrel  cca-------gaggc---c---t----------gg----------------------g------------
       Lesser Egyptian jerboa  tgg------------------------------ag----------------------g------------
                 Prairie vole  ctg------------------------------ag----------------------g------------
              Chinese hamster  ctg------------------------------ag----------------------g------------
               Golden hamster  ctg------------------------------ag----------------------g------------
                        Mouse  ctg------------------------------ag----------------------g------------
                          Rat  ctg------------------------------ag----------------------g------------
               Naked mole-rat  ccc-------aaggc---c---t----------gg----------------------g------------
                   Guinea pig  ccc-------gaggc---c---t----------gg----------------------g------------
                   Chinchilla  ccc-------gaggc---c---t----------gg----------------------g------------
             Brush-tailed rat  ccc-------gaggc---c---t----------gg----------------------g------------
                       Rabbit  cagggaaagggaggc---c---t----------gg----------------------g------------
                         Pika  gccgaggagggaggc---c---t----------gg----------------------g------------
                       Alpaca  ccg-------gaggc---c---t----------gg----------------------g------------
                 Killer whale  ccg-------gaggc---c---t----------gg----------------------g------------
                        Horse  ccg-------gaggc---c---t----------gg----------------------g------------
             White rhinoceros  ccg-------gaggc---t---t----------gg----------------------g------------
                          Cat  ccg-------gaggc---c---t----------gg----------------------g------------
                          Dog  cca-------tagcc---c---t----------gg----------------------c------------
                      Ferret   ccg-------gaggc---c---t----------gg----------------------g------------
                        Panda  ccg-------gaggc---c---t----------gg----------------------g------------
               Pacific walrus  ccg-------gaggc---c---t----------gg----------------------g------------
                 Weddell seal  ccg-------gaggc---c---t----------gg----------------------g------------
             Black flying-fox  ccg-------gaggc---c---t----------gg----------------------g------------
                      Megabat  ccg-------gaggc---c---t----------gg----------------------g------------
                Big brown bat  ccg-------gaggc---c---t----------gc----------------------g------------
                     Hedgehog  -cg-------gaggc---c---t----------gc----------------------g------------
                        Shrew  ccg-------gaggc---c---t----------ga----------------------g------------
                     Elephant  t---------gggac---g---c----------gg----------------------a------------
                      Manatee  c---------gggac---g---c----------gg----------------------a------------
             Cape golden mole  g---------gagac---g---t----------gg----------------------g------------
                     Aardvark  g---------gaggc---c---g----------ag----------------------g------------
                    Armadillo  c---------ggcgc---ggact----------gg----------------------g------------
                      Opossum  --g-------gaggc---t---c----------ag----------------ccccaag------------
              Tasmanian devil  ccc-------aaggc---c---c----------aggccgtccctggggcccccttggg------------
                     Platypus  cgg-------gatcc---c---tgccccttaaaga----------------------g------------
                  Rock pigeon  cct-------cacgg---g---t----------ca----------------------g------------
          Collared flycatcher  ccg-------ggggg---c---t----------cg----------------------g------ctcgcc
           Tibetan ground jay  ------------gga---c---t----------cg----------------------g------------
           American alligator  aca-------gagag---c---c----------ca----------------------gccctgccccgcc
               Painted turtle  ccg-------ccggcaggc---t----------ct----------------------g------------
     Chinese softshell turtle  cca-------ctggt---c---a----------ct----------------------a------------
              Star-nosed mole  ======================================================================
                 Mallard duck  ======================================================================
          Medium ground finch  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ======================================================================
                  Spotted gar  ======================================================================
                      Chicken  ======================================================================
                   Coelacanth  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                      Lamprey  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                       Lizard  ======================================================================
                          Pig  ======================================================================
                      Dolphin  ======================================================================
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ------------ccc-ga---gg-------------------------------acctgggc
                        Chimp  ------------ccc-ga---gg-------------------------------acctgggc
                      Gorilla  ------------ccc-ga---gg-------------------------------acctgggc
                    Orangutan  ------------ccc-ga---gg-------------------------------acctgggc
                       Gibbon  ------------ccc-ga---gg-------------------------------accggggc
                       Rhesus  ------------ccc-ga---gg-------------------------------acctgggc
          Crab-eating macaque  ------------ccc-ga---gg-------------------------------acctgggc
                       Baboon  ------------ccc-ga---gg-------------------------------acctgggc
                 Green monkey  ------------ccc-ga---gg-------------------------------acctgggc
                     Marmoset  ------------ccg-ga---gg-------------------------------accggggc
              Squirrel monkey  ------------ccg-ga---gg-------------------------------accggggc
                     Bushbaby  ------------ccc-ag---gg-------------------------------acc-----
           Chinese tree shrew  ------------ccc-gg---gt-------------------------------ac------
                     Squirrel  ------------ccc-gg---gg-------------------------------aca-----
       Lesser Egyptian jerboa  ------------ccccag---gt-------------------------------cag-----
                 Prairie vole  ------------ccc-gg---gt-------------------------------aca-----
              Chinese hamster  ------------ccc-gg---gt-------------------------------aca-----
               Golden hamster  ------------ccc-gg---gt-------------------------------aca-----
                        Mouse  ------------ccc--g---gt-------------------------------aca-----
                          Rat  ------------ccc--g---gt-------------------------------aca-----
               Naked mole-rat  ------------ccc-gg---gg-------------------------------acg-----
                   Guinea pig  ------------ccc-gg---ga-------------------------------aca-----
                   Chinchilla  ------------ccc-gg---ga-------------------------------acg-----
             Brush-tailed rat  ------------ccc-ag---ga-------------------------------acg-----
                       Rabbit  ------------ccc-gg---ga-------------------------------ctg-----
                         Pika  ---------attctg-gg---ga-------------------------------ctg-----
                       Alpaca  ------------cct-gg---gg---------------------------------------
                 Killer whale  ------------ccc-gg---gg---------------------------------------
                        Horse  ------------ccc-gg---gg---------------------------------------
             White rhinoceros  ------------ccc-gt---ag---------------------------------------
                          Cat  ------------ccc-gg---ggc----------------c---------------------
                          Dog  ------------acc-gg---ggc---------------c----------------------
                      Ferret   ------------ccc-cg---ggc--------------------------------------
                        Panda  ------------ccc-cg---gggccgagtggctcgcag-----------------------
               Pacific walrus  -------------cc-cg---ggg--------------------------------------
                 Weddell seal  ------------ccc-cg---ggg--------------------------------------
             Black flying-fox  ------------ccc-ga---gg---------------------------------------
                      Megabat  ------------ccc-ga---gg---------------------------------------
                Big brown bat  ------------ccc-ga---gc---------------------------------------
                     Hedgehog  ------------cct-ggcacgg------------------c---ggctggcag--------
                        Shrew  ------------ccc-ag-gcgg------------------cgaggactcgcag--------
                     Elephant  ------------c-------------------------------------------------
                      Manatee  ------------t-------------------------------------------------
             Cape golden mole  ------------t-------------------------------------------------
                     Aardvark  ------------c-------------------------------------------------
                    Armadillo  ------------c-------------------------------------------------
                      Opossum  ------------ccc-gg---ag---------------------------------------
              Tasmanian devil  ------------cct-gc---ag---------------------------------------
                     Platypus  ------------ccg-----------------------------------------------
                  Rock pigeon  --------------------------------------------------------------
          Collared flycatcher  --------------------------------------------------------------
           Tibetan ground jay  --------------------------------------------------------------
           American alligator  actccgggc-----------------------------------------------------
               Painted turtle  --------------------------------------------------------------
     Chinese softshell turtle  --------------------------------------------------------------
              Star-nosed mole  ==============================================================
                 Mallard duck  ==============================================================
          Medium ground finch  ==============================================================
                   Budgerigar  ==============================================================
                       Turkey  ==============================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                          Cow  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ==============================================================
                  Spotted gar  ==============================================================
                      Chicken  ==============================================================
                   Coelacanth  ==============================================================
       White-throated sparrow  ==============================================================
             Peregrine falcon  ==============================================================
                      Lamprey  ==============================================================
                  Zebra finch  ==============================================================
                 Saker falcon  ==============================================================
                       Lizard  ==============================================================
                          Pig  ==============================================================
                      Dolphin  ==============================================================
         David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 30 and 31 in window
B D                  Ferret  1bp
B D       American alligator 4407bp
  D           Painted turtle 10bp
  D Chinese softshell turtle 8bp

Alignment block 31 of 1260 in window, 23071067 - 23071072, 6 bps 
B D                     Human  ccgcag
B D                     Chimp  ccgcag
B D                   Gorilla  ccgcag
B D                 Orangutan  ccgcag
B D                    Gibbon  cc-cag
B D                    Rhesus  ccggag
B D       Crab-eating macaque  ccggag
B D                    Baboon  ccggag
B D              Green monkey  ccggag
B D                  Marmoset  ccggag
B D           Squirrel monkey  ccggag
  D               Rock pigeon  ---cag
  D       Collared flycatcher  ctccaa
           Tibetan ground jay  ----ag
B D        American alligator  ccgtgg
  D            Painted turtle  cgaggc
  D  Chinese softshell turtle  tgatgt
B D                     Shrew  ------
B D                  Hedgehog  ------
B D                      Pika  ------
             Star-nosed mole  ======
B D                       Rat  ------
B D                     Mouse  ------
              Golden hamster  ------
B D           Chinese hamster  ------
                Prairie vole  ------
      Lesser Egyptian jerboa  ------
B D                    Alpaca  ------
                  Chinchilla  ------
B D                Guinea pig  ------
            Brush-tailed rat  ------
B D                   Megabat  ------
  D              Mallard duck  ======
B D       Medium ground finch  ======
B D                Budgerigar  ======
B D                    Turkey  ======
                    Aardvark  ------
B D           Tasmanian devil  ------
B D                 Armadillo  ------
          Chinese tree shrew  ------
B D            Naked mole-rat  ------
B D                  Elephant  ------
B D                    Rabbit  ------
B D                   Manatee  ------
B D                     Panda  ------
               Domestic goat  NNNNNN
B D                     Sheep  NNNNNN
B D                       Cow  NNNNNN
            Tibetan antelope  ======
                 Spotted gar  ======
B D                   Chicken  ======
B D                Coelacanth  ======
B D                  Platypus  ------
  D    White-throated sparrow  ======
  D          Peregrine falcon  ======
B D                   Lamprey  ======
B D               Zebra finch  ======
  D              Saker falcon  ======
B D                    Lizard  ======
            Cape golden mole  ------
B D                   Opossum  ------
B D                       Pig  ======
B D                   Dolphin  ======
                Weddell seal  ------
              Pacific walrus  ------
               Big brown bat  ------
B D                       Cat  ------
B D                  Bushbaby  ------
B D                  Squirrel  ------
        David's myotis (bat)  NNNNNN
            Black flying-fox  ------
B D                   Ferret   ======
B D                       Dog  ------
B D          White rhinoceros  ------
B D                     Horse  ------
                Killer whale  ------
              Bactrian camel  NNNNNN

Alignment block 32 of 1260 in window, 23071073 - 23071073, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                    Alpaca  a
                 Killer whale  a
B D                     Horse  a
B D          White rhinoceros  a
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
B D           Tasmanian devil  a
B D                  Platypus  a
  D               Rock pigeon  g
  D       Collared flycatcher  a
           Tibetan ground jay  a
B D        American alligator  g
  D            Painted turtle  g
  D  Chinese softshell turtle  c
B D                     Shrew  -
B D                  Hedgehog  -
B D                      Pika  -
             Star-nosed mole  =
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  -
B D           Chinese hamster  -
                Prairie vole  -
      Lesser Egyptian jerboa  -
                  Chinchilla  -
B D                Guinea pig  -
            Brush-tailed rat  -
  D              Mallard duck  =
B D       Medium ground finch  =
B D                Budgerigar  =
B D                    Turkey  =
                    Aardvark  -
B D                 Armadillo  -
          Chinese tree shrew  -
B D            Naked mole-rat  -
B D                  Elephant  -
B D                    Rabbit  -
B D                   Manatee  -
B D                     Panda  -
               Domestic goat  N
B D                     Sheep  N
B D                       Cow  N
            Tibetan antelope  =
                 Spotted gar  =
B D                   Chicken  =
B D                Coelacanth  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
B D                   Lamprey  =
B D               Zebra finch  =
  D              Saker falcon  =
B D                    Lizard  =
            Cape golden mole  -
B D                   Opossum  -
B D                       Pig  =
B D                   Dolphin  =
B D                       Cat  -
B D                  Bushbaby  -
B D                  Squirrel  -
        David's myotis (bat)  N
B D                   Ferret   =
B D                       Dog  -
              Bactrian camel  N

Alignment block 33 of 1260 in window, 23071074 - 23071080, 7 bps 
B D                     Human  cggac-ag
B D                     Chimp  cggac-ag
B D                   Gorilla  cggac-ag
B D                 Orangutan  cggac-ag
B D                    Gibbon  cggac-ag
B D                    Rhesus  cggac-gg
B D       Crab-eating macaque  cggac-gg
B D                    Baboon  cggac-gg
B D              Green monkey  cggac-gg
B D                  Marmoset  cagac-gg
B D           Squirrel monkey  cagac-gg
B D                  Bushbaby  --gac-ag
           Chinese tree shrew  -ggac-gg
B D                  Squirrel  ---gaagg
       Lesser Egyptian jerboa  ---ac-ag
                 Prairie vole  ---ac-ag
B D           Chinese hamster  ---ac-ag
               Golden hamster  ---acaag
B D                     Mouse  ---ac-ag
B D                       Rat  ---ac-ag
B D            Naked mole-rat  --gac-tc
B D                Guinea pig  --gac-cg
                   Chinchilla  --gac-cg
             Brush-tailed rat  --gac-cg
B D                    Rabbit  ---ac-ga
B D                      Pika  ---ac-gg
B D                    Alpaca  cgcac-gg
                 Killer whale  cgcac-gg
B D                     Horse  cggac-gg
B D          White rhinoceros  cggac-gg
B D                       Cat  -gagt-gg
B D                       Dog  -ggtc-gg
B D                   Ferret   -gagt-gg
               Pacific walrus  cgagt-gg
                 Weddell seal  cgagt-gg
             Black flying-fox  cagac-gg
B D                   Megabat  cagac-gg
                Big brown bat  cggat-gg
B D                   Opossum  caggc-gg
B D                  Platypus  ccgtc-tg
  D               Rock pigeon  gggac-gg
  D       Collared flycatcher  gggac-ag
           Tibetan ground jay  ccggc-tg