Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 131 in window, 227659726 - 227659823, 98 bps 
B D                     Human  tcagtgaaca-tat--act--gg--atg----aat----taatattttcaaagtatagaaca--------
B D                     Chimp  tcagtgaaca-tat--act--gg--ata----aat----taatattttcaaagtatagaaca--------
B D                   Gorilla  tcagtgaaca-tat--act--gg--ttg----aat----taatattttcaaagtatagaaca--------
B D                 Orangutan  tcagtgaaca-tac--act--gg--atg----aat----taatattttcaaagtatagaaca--------
B D                    Gibbon  tcagtgaaca-tac--actg-gg--atg----aat----taatattttcaaagtatataaca--------
B D                    Rhesus  tcaatgaaca-tat--act--gg--atg----aat----taatattttcaaagtatataaca--------
B D       Crab-eating macaque  tcaatgaaca-tat--act--gg--atg----aat----taatattttcaaagtatataaca--------
B D                    Baboon  tcaatgaaca-tat--act--gg--atg----aat----taatattttcaaagtatataacg--------
B D              Green monkey  tcaatgaaca-tat--act--gg--atg----aat----taatattttcaaagtatataaca--------
B D                  Marmoset  tcagtgaaca-tat--act--gg--atg----aaa----taatagtttcaaagcatataaca--------
B D           Squirrel monkey  tcaatgagca-tat--act--gg--atg----aat----taatatttgcaaagcatataaca--------
B D                  Bushbaby  gcagttaacc-tat--att--ga--gtg----atttagctaatgttatcaaagtatataaca--------
           Chinese tree shrew  tcagttaata-tattaggt--ga--acc----aat----ttatgctactaaagaacattgca--------
B D                  Squirrel  tcaattaaca-cat--gtt--tgtatta-attaac----taatgatatcaaggtacatgaca--------
       Lesser Egyptian jerboa  tcaat--tca-cat--att--gg--atg-attaac----tgatgctatcaaaatatatgacacaataaac
                 Prairie vole  tcagcttaaa-tat--atc--ag--atg-ggtaat----gagtactgtggaaatataggaca--------
B D           Chinese hamster  ttca-tgaca-tat--ctc--ag--atg-ggtcgt----gaatgctgtggaaatacaggaca--------
B D                     Mouse  tcagctagca-tag--atc--ag--atg-gttaat----gcatgctatgaaagtgtaggaca--------
B D                       Rat  tcagc--gaa-cag--atc--ag--atg-tctaat----gcacactatggaaatataggaca--------
B D                Guinea pig  acacctagct-tat--att--gg--atgggttaat----taattctactaaagtatatgata--------
                   Chinchilla  tcaattagct-tat--att--gg--atgagttaat----taatgctactaaagtatatgatc--------
             Brush-tailed rat  ttgattagct-tat--att--gg--ataaattaat----taatgctactaatgtatatgagc--------
B D                       Pig  tgtttaacca--tt--ttt--gg--ttaaatgaac----tagtgctatccaagtacat------------
B D                    Alpaca  aaatttactt--tt--ttt--gg--ataaattaac----taatactatccaagtatgtaaca--------
               Bactrian camel  ---------------------gg--ataaattaac----taatactatccaagtatgtaaca--------
B D                   Dolphin  ttattaacct--tt--ttt--gg--ataaattaac----taatgctatccaagtatat------------
                 Killer whale  ttattaacct--tt--ttt--gg--ataaattaac----tcatgctatctaagtatat------------
             Tibetan antelope  tcactaatct-att--tct--gg--ataaattaat----taatggtatgcaagtatgt------------
B D                       Cow  tcattaacct-att--tct--gg--ataaattaat----taatggtacgcaagtatat------------
B D                     Sheep  tcactaatct-att--tct--gg--ataaattaat----taattgtatgcaagtatat------------
                Domestic goat  tcattaatct-att--tct--gg--ataaattaat----taatggtatgcaagtatac------------
B D                       Cat  tcaattagca-ttt--ttttagg--ataaattacc----tagtgctatcaaagaatatagca--------
B D                       Dog  tcaatgaacatttt--ttt--gg--atacattacc----tagtgctagcaaagtatataagc--------
B D                   Ferret   tcaattaaca-ttt--ttt--gg--ataaattatc----tagtgttggcaaagtatataacc--------
B D                     Panda  tcgatgaaca-ttt--ttt--gg--ataaattacc----cagtgctggcaaagtgtataacc--------
               Pacific walrus  tcaattaaca-ttt--ttt--gg--ataaattacc----tagtgctagcaaagtatataacc--------
                 Weddell seal  tcaattaaca-ttt--ttt--gg--ataaattacc----tagtgctagcaaagtatataacc--------
             Black flying-fox  tcaatgaaca--tt--ttt--gg--ataaattaaa----taatgctatcaaagtataaaata--------
B D                   Megabat  tcaatgaaca--tt--ttt--gg--atagattaaa----taatgctatcaaagtataaaata--------
              Star-nosed mole  tccatgaata-atg--tat--at--acaagttaag----tgatgctaacagagtatgtaata--------
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
  D              Mallard duck  ======================================================================
B D                   Lamprey  ----------------------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ----------------------------------------------------------------------
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ----------------------------------------------------------------------
B D            Naked mole-rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
            Cape golden mole  ======================================================================

                        Human  -------------taaga--ttggttattctatca-----------------------------------
                        Chimp  -------------taaga--ttggttattctatta-----------------------------------
                      Gorilla  -------------taaga--ttggttattctatta-----------------------------------
                    Orangutan  -------------taaga--ttggttattctatca-----------------------------------
                       Gibbon  -------------taaga--ttggctattttttca-----------------------------------
                       Rhesus  -------------taaga--ttggttattctatca-----------------------------------
          Crab-eating macaque  -------------taaga--ttggttattctatca-----------------------------------
                       Baboon  -------------taaga--ttggttattctatca-----------------------------------
                 Green monkey  -------------taaga--ttggttattctgtca-----------------------------------
                     Marmoset  -------------taaga--ttgattattctatca-----------------------------------
              Squirrel monkey  -------------taaga--ttgattattct---------------------------------------
                     Bushbaby  -------------tccaa--ttatttattgt---------------------------------------
           Chinese tree shrew  -------------taaga--ttgattattgaatca-----------------------------------
                     Squirrel  -------------gaaga--ctgtatgtcaaatta-----------------------------------
       Lesser Egyptian jerboa  caggaagggtggttcaca--tctgtaatcccagtacttgaaatgctgaggtaagaggattgctgttagtt
                 Prairie vole  -------------tgaga--ttggtaatggtagca-----------------------------------
              Chinese hamster  -------------tgaga--ttagtaatggtagta-----------------------------------
                        Mouse  -------------tgaga--ttggtaattctagca-----------------------------------
                          Rat  -------------tgaga--ctggtaattctagca-----------------------------------
                   Guinea pig  -------------taaggtcttttttattgc---------------------------------------
                   Chinchilla  -------------taaga--ttgtttattgc---------------------------------------
             Brush-tailed rat  -------------taaag--ttatttattac---------------------------------------
                          Pig  --------------aaga--ttgattattgtgtca-----------------------------------
                       Alpaca  -------------taaga--gtgattattaaatca-----------------------------------
               Bactrian camel  -------------gaaga--ttgattattaaatca-----------------------------------
                      Dolphin  --------------aaga--ttgattattgtatca-----------------------------------
                 Killer whale  --------------aaga--ttgattattgtatca-----------------------------------
             Tibetan antelope  --------------aaga--ttcgctattgtatca-----------------------------------
                          Cow  --------------aaga--ttcattattgtatca-----------------------------------
                        Sheep  --------------aaga--ttcattattgtatca-----------------------------------
                Domestic goat  --------------aaga--ttcattattgtatca-----------------------------------
                          Cat  -------------taaga--ttgactattgtaccc-----------------------------------
                          Dog  -------------taaga--ttgattattgtatca-----------------------------------
                      Ferret   -------------tgaga--ttgattattgtatca-----------------------------------
                        Panda  -------------taaga--ttgattattgtatca-----------------------------------
               Pacific walrus  -------------taaga--ttgattattgtatca-----------------------------------
                 Weddell seal  -------------taaga--ttgattattgtatca-----------------------------------
             Black flying-fox  -------------taaga--ccgattattgtgcca-----------------------------------
                      Megabat  -------------taaga--ccgattattgtgcca-----------------------------------
              Star-nosed mole  -------------taaca--ttgattattttatc------------------------------------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------------------------gccagagttctc------------------------
                        Chimp  ----------------------------------gccagagttctc------------------------
                      Gorilla  ----------------------------------gccagagttctc------------------------
                    Orangutan  ----------------------------------gccagagttctc------------------------
                       Gibbon  ----------------------------------gccagagttctc------------------------
                       Rhesus  ----------------------------------gccagagttctc------------------------
          Crab-eating macaque  ----------------------------------gccagagttctc------------------------
                       Baboon  ----------------------------------gccagagttctc------------------------
                 Green monkey  ----------------------------------gccagagttctccagagaaatggaaccagcatattg
                     Marmoset  ----------------------------------gccagagttctc------------------------
              Squirrel monkey  -----------------------------------tcagagttatt------------------------
                     Bushbaby  ----------------------------------gtccaagttctc------------------------
           Chinese tree shrew  ----------------------------------gttgaagttttc------------------------
                     Squirrel  ----------------------------------ttcagaggtctc------------------------
       Lesser Egyptian jerboa  cgagatacagcttaggctacagagtgaattccaggtcagtctgggc------------------------
                 Prairie vole  ----------------------------------gccagtgttctc------------------------
              Chinese hamster  ----------------------------------gtc--tgttctc------------------------
                        Mouse  ----------------------------------gtcagtgttttc------------------------
                          Rat  ----------------------------------gtcggtgctctc------------------------
                   Guinea pig  ----------------------------------atcagagctatc------------------------
                   Chinchilla  ----------------------------------atcagagttctc------------------------
             Brush-tailed rat  ----------------------------------atcagagtgctc------------------------
                          Pig  ----------------------------------gtcagtgttctc------------------------
                       Alpaca  ----------------------------------gtcagggttctc------------------------
               Bactrian camel  ----------------------------------gtcagggttctc------------------------
                      Dolphin  ----------------------------------gtcagggttctc------------------------
                 Killer whale  ----------------------------------gtcagggttctc------------------------
             Tibetan antelope  ----------------------------------gttagggttctc------------------------
                          Cow  ----------------------------------gttagggttctc------------------------
                        Sheep  ----------------------------------gttagagttctc------------------------
                Domestic goat  ----------------------------------gttacggttctc------------------------
                          Cat  ----------------------------------aacagggttctc------------------------
                          Dog  ----------------------------------g----agttctc------------------------
                      Ferret   ----------------------------------gtcagggttctc------------------------
                        Panda  ----------------------------------gtcaaggttctc------------------------
               Pacific walrus  ----------------------------------gtca-ggttctc------------------------
                 Weddell seal  ----------------------------------gtcagggttctc------------------------
             Black flying-fox  ----------------------------------gtgagggttctc------------------------
                      Megabat  ----------------------------------gtgagggttctc------------------------
              Star-nosed mole  -----------------------------------tttaggt----------------------------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ---------------------------------------cagagaaatgg--------------------
                        Chimp  ---------------------------------------cagagaaatgg--------------------
                      Gorilla  ---------------------------------------cagagaaatgg--------------------
                    Orangutan  ---------------------------------------cagagaaatgg--------------------
                       Gibbon  ---------------------------------------cagagaaatgg--------------------
                       Rhesus  ---------------------------------------cagagaaatgg--------------------
          Crab-eating macaque  ---------------------------------------cagagaaatgg--------------------
                       Baboon  ---------------------------------------cagagaaatgg--------------------
                 Green monkey  atatatatataattggttattctatcagccagagttctccagagaaatgg--------------------
                     Marmoset  ---------------------------------------ccaataaatgg--------------------
              Squirrel monkey  ---------------------------------------ccaagaaatgg--------------------
                     Bushbaby  ---------------------------------------cagagaaacag--------------------
           Chinese tree shrew  ---------------------------------------tagggaaacag--------------------
                     Squirrel  ---------------------------------------caaggaaatag--------------------
       Lesser Egyptian jerboa  ---------------------------------------tagagtaagaccctgccttgaaacagctaca
                 Prairie vole  ---------------------------------------cagagaaata---------------------
              Chinese hamster  ---------------------------------------tagagaaatc---------------------
                        Mouse  ---------------------------------------cagagaaatataat-----------------
                          Rat  ---------------------------------------cagagaaatat--------------------
                   Guinea pig  ---------------------------------------cagaaaagaag--------------------
                   Chinchilla  ---------------------------------------tagaaaagaag--------------------
             Brush-tailed rat  ---------------------------------------cagaagagaaa--------------------
                          Pig  ---------------------------------------cagacaaacaa--------------------
                       Alpaca  ---------------------------------------caaagaaagag--------------------
               Bactrian camel  ---------------------------------------caaagaaagag--------------------
                      Dolphin  ---------------------------------------cagagaaacag--------------------
                 Killer whale  ---------------------------------------cagagaaacag--------------------
             Tibetan antelope  ---------------------------------------cagagaaacag--------------------
                          Cow  ---------------------------------------cagagaaacag--------------------
                        Sheep  ---------------------------------------cagagaaacag--------------------
                Domestic goat  ---------------------------------------cagagaaacag--------------------
                          Cat  ---------------------------------------cagagaaatag--------------------
                          Dog  ---------------------------------------cagagaaatag--------------------
                      Ferret   ---------------------------------------cagagaaatag--------------------
                        Panda  ---------------------------------------cagagaaatag--------------------
               Pacific walrus  ---------------------------------------cagagaaatga--------------------
                 Weddell seal  ---------------------------------------cagagaaatag--------------------
             Black flying-fox  ---------------------------------------cagagaaacag--------------------
                      Megabat  ---------------------------------------cagagaaacag--------------------
              Star-nosed mole  ----------------------------------------agaaaaacca--------------------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  gccacaacaacaacagacaatacatatatatatatatgtataaaatataaaatatgatatatgtcatata
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
                        Mouse  -------taataagagatgtagca---gtttgtgttctccagagaaat----------------------
                          Rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------------------------aacca--------aca
                        Chimp  ----------------------------------aacca--------aca
                      Gorilla  ----------------------------------aacca--------aca
                    Orangutan  ----------------------------------aacca--------aca
                       Gibbon  ----------------------------------aacca--------aca
                       Rhesus  ----------------------------------aacca--------gca
          Crab-eating macaque  ----------------------------------aacca--------gca
                       Baboon  ----------------------------------aacca--------gca
                 Green monkey  ----------------------------------aacca--------gca
                     Marmoset  ----------------------------------aacca--------ata
              Squirrel monkey  ----------------------------------aacca--------ata
                     Bushbaby  ----------------------------------aacca--------ata
           Chinese tree shrew  ----------------------------------aacca--------aca
                     Squirrel  ----------------------------------aacca--------ata
       Lesser Egyptian jerboa  tggtaattgtagtcaaggttcttcaaaaaaatagaatca--------ata
                 Prairie vole  ----------------------------------aa--a--------tca
              Chinese hamster  ----------------------------------aatca--------gta
                        Mouse  --------------------------------agaatca--------gta
                          Rat  ----------------------------------aatca--------gca
                   Guinea pig  ----------------------------------aacca--------gtt
                   Chinchilla  ----------------------------------aacca--------ata
             Brush-tailed rat  ----------------------------------aacca--------gta
                          Pig  ----------------------------------aactg--------aca
                       Alpaca  ----------------------------------aactg--------ata
               Bactrian camel  ----------------------------------aaccg--------gta
                      Dolphin  ----------------------------------aaccg--------ata
                 Killer whale  ----------------------------------aacca--------ata
             Tibetan antelope  ----------------------------------aa-ca--------ata
                          Cow  ----------------------------------aa-ca--------ata
                        Sheep  ----------------------------------aa-ca--------ata
                Domestic goat  ----------------------------------aa-ca--------ata
                          Cat  ----------------------------------aacca----a------
                          Dog  ----------------------------------gacca-----------
                      Ferret   ----------------------------------aatta---g-------
                        Panda  ----------------------------------aatccata--------
               Pacific walrus  ----------------------------------aatca-----------
                 Weddell seal  ----------------------------------aatca-----------
             Black flying-fox  ----------------------------------aatca-----aaa---
                      Megabat  ----------------------------------aatca-----aaa---
              Star-nosed mole  ----------------------------------aacca--------gta
               Golden hamster  ==================================================
                     Hedgehog  ==================================================
                  Zebra mbuna  ==================================================
          Pundamilia nyererei  ==================================================
        Burton's mouthbreeder  ==================================================
          Princess of Burundi  --------------------------------------------------
                 Nile tilapia  ==================================================
             Peregrine falcon  ==================================================
                 Saker falcon  ==================================================
     Mexican tetra (cavefish)  --------------------------------------------------
                  Spotted gar  --------------------------------------------------
                   Coelacanth  ==================================================
                    Zebrafish  --------------------------------------------------
                       Parrot  --------------------------------------------------
                   Budgerigar  --------------------------------------------------
                  Rock pigeon  --------------------------------------------------
           Southern platyfish  --------------------------------------------------
                       Medaka  --------------------------------------------------
                 Mallard duck  ==================================================
                      Lamprey  --------------------------------------------------
                    Tetraodon  --------------------------------------------------
     Chinese softshell turtle  --------------------------------------------------
       Yellowbelly pufferfish  --------------------------------------------------
                         Fugu  --------------------------------------------------
                      Chicken  ==================================================
          Medium ground finch  ==================================================
                       Turkey  ==================================================
                X. tropicalis  ==================================================
               Painted turtle  --------------------------------------------------
                  Zebra finch  ==================================================
                 Atlantic cod  --------------------------------------------------
          Collared flycatcher  ==================================================
           American alligator  --------------------------------------------------
           Tibetan ground jay  ==================================================
                Scarlet macaw  --------------------------------------------------
                       Lizard  --------------------------------------------------
       White-throated sparrow  ==================================================
                  Stickleback  --------------------------------------------------
               Naked mole-rat  ==================================================
          Cape elephant shrew  ==================================================
                      Wallaby  --------------------------------------------------
              Tasmanian devil  ==================================================
                     Platypus  --------------------------------------------------
              Green seaturtle  ==================================================
                     Microbat  --------------------------------------------------
         David's myotis (bat)  --------------------------------------------------
                Big brown bat  --------------------------------------------------
                       Rabbit  ==================================================
                      Opossum  ==================================================
                         Pika  ==================================================
                       Tenrec  ==================================================
                    Armadillo  ==================================================
                     Aardvark  ==================================================
                     Elephant  ==================================================
                        Horse  --------------------------------------------------
             White rhinoceros  --------------------------------------------------
                      Manatee  ==================================================
             Cape golden mole  ==================================================

Inserts between block 1 and 2 in window
          Chinese tree shrew 45bp
B D                      Pig 9bp
B D                   Alpaca 9bp
              Bactrian camel 9bp
B D                  Dolphin 9bp
                Killer whale 9bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                      Dog 1bp
B D                    Panda 250bp
              Pacific walrus 1bp
                Weddell seal 1bp
             Star-nosed mole 46bp

Alignment block 2 of 131 in window, 227659824 - 227659889, 66 bps 
B D                     Human  tattgatatataagtatacat-------a-----------------------------acacat------
B D                     Chimp  tattgatatataagtatacat-------a-----------------------------acacattatata
B D                   Gorilla  tattgatatataagtatacat-------a-----------------------------acacat------
B D                 Orangutan  tattgatatataagtatacat-------a-----------------------------acacat------
B D                    Gibbon  tattgatatataagtatacat-------a-----------------------------acacattatata
B D                    Rhesus  tgttgatatgtaagtatacat-------a-----------------------------acacat------
B D       Crab-eating macaque  tgttgatatgtaagtatacat-------a-----------------------------acacat------
B D                    Baboon  tgttgatgtgtaagtatacat-------a-----------------------------acacat------
B D              Green monkey  tgttgatatgtaagtatacat-------a-----------------------------acacat------
B D                  Marmoset  gattgatatataagtatacat-------a-----------------------------acacat------
B D           Squirrel monkey  tattgatatgtaagtatacat-------a-----------------------------acacat------
B D                  Bushbaby  tatttatatgcaaatatacat-------a-----------------------------acacat------
           Chinese tree shrew  tattatgaaaaaactatgcat-------aggcttaaaaatttgtgccaaaattaactcatacattaattc
B D                  Squirrel  ---------gtagataagtat-------g-----------------------------------------
       Lesser Egyptian jerboa  ---------ggagatacatac-------a-----------------------------------------
                 Prairie vole  ---------agagacaaacac-------a-----------------------------------------
B D           Chinese hamster  ---------aaagacaaacac-------a-----------------------------------------
B D                     Mouse  ---------agagacaaacac-------a-----------------------------------------
B D                       Rat  ---------agagacaaacac-------a-----------------------------------------
B D                Guinea pig  ---------ggagataaatataat----a-----------------------------------------
                   Chinchilla  ---------gtaggtaaaaataatgtaca-----------------------------------------
             Brush-tailed rat  ---------gaagataaatataacctgca-----------------------------------------
B D                       Pig  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
  D              Mallard duck  ======================================================================
B D                   Lamprey  ----------------------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ----------------------------------------------------------------------
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ----------------------------------------------------------------------
B D            Naked mole-rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
            Cape golden mole  ======================================================================

                        Human  --------------------------ta--tata------------------------------------
                        Chimp  tatat----atatatatatatatatata--tata------------------------------------
                      Gorilla  --------------------------ta--tata------------------------------------
                    Orangutan  --------------------tatatata--tata------------------------------------
                       Gibbon  tatat----atatatatatatatatata--tata------------------------------------
                       Rhesus  --------------------------ta--taca------------------------------------
          Crab-eating macaque  --------------------------ta--taca------------------------------------
                       Baboon  --------------------------ta--taca------------------------------------
                 Green monkey  --------------------------ta--taca------------------------------------
                     Marmoset  --------------------------ta--tata------------------------------------
              Squirrel monkey  --------------------------ta--tata------------------------------------
                     Bushbaby  ------------------------------taca------------------------------------
           Chinese tree shrew  cactttcccacaaagtttttaaagaata--tgca------------------------------------
                     Squirrel  --------------------------taactcta------------------------------------
       Lesser Egyptian jerboa  --------------------------ta--tgcc------------------------------------
                 Prairie vole  --------------------------ga--tcca------------------------------------
              Chinese hamster  --------------------------ga----ca------------------------------------
                        Mouse  --------------------------ga--caca------------------------------------
                          Rat  --------------------------ga--caca------------------------------------
                   Guinea pig  --------------------------ta--tatc------------------------------------
                   Chinchilla  --------------------------ta--tata------------------------------------
             Brush-tailed rat  --------------------------tg--tatattttttcttttattcattttattgagaaagaaatag
                          Pig  --------------------------------ga------------------------------------
                       Alpaca  --------------------------------ta------------------------------------
               Bactrian camel  --------------------------------ta------------------------------------
                      Dolphin  --------------------------------ta------------------------------------
                 Killer whale  --------------------------------ta------------------------------------
             Tibetan antelope  --------------------------------ta------------------------------------
                          Cow  --------------------------------ta------------------------------------
                        Sheep  --------------------------------ta------------------------------------
                Domestic goat  --------------------------------ta------------------------------------
                          Cat  --------------------------------ta------------------------------------
                          Dog  --------------------------------ta------------------------------------
                      Ferret   --------------------------------ta------------------------------------
               Pacific walrus  --------------------------------ta------------------------------------
                 Weddell seal  --------------------------------ta------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
              Star-nosed mole  --------------------------------tg------------------------------------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Panda  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  caatgagacagtttcaaaacaggttagtaggacagtttcaataatcaatacactgcatattgttgtcttc
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Panda  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------------------------------ta---------------ta-tat-------
                        Chimp  ----------------------------------------ta---------------ta-tat-------
                      Gorilla  ----------------------------------------ta---------------ta-tat-------
                    Orangutan  ----------------------------------------ta---------------ta-tat-------
                       Gibbon  ----------------------------------------ta---------------ta-tat-------
                       Rhesus  ----------------------------------------ta---------------ta-tat-------
          Crab-eating macaque  ----------------------------------------ta---------------ta-tat-------
                       Baboon  ----------------------------------------ta---------------ta-tat-------
                 Green monkey  ----------------------------------------ta---------------ta-tat-------
                     Marmoset  ----------------------------------------ta---------------ta--at-------
              Squirrel monkey  ----------------------------------------ta---------------ta--at-------
                     Bushbaby  ----------------------------------------ta---------------ta-aat-------
           Chinese tree shrew  ----------------------------------------ta---------------ca-tgtcaccata
                     Squirrel  ----------------------------------------ta---------------ta-aat-------
       Lesser Egyptian jerboa  ----------------------------------------ta---------------ta-aat-------
                 Prairie vole  ----------------------------------------ca---------------ta-aat-------
              Chinese hamster  ----------------------------------------ta---------------ta-aac-------
                        Mouse  ----------------------------------------ta---------------ta-agt-------
                          Rat  ----------------------------------------ta---------------ta-agt-------
                   Guinea pig  ----------------------------------------ta---------------ta-aat-------
                   Chinchilla  ----------------------------------------tg---------------ta-aat-------
             Brush-tailed rat  gtaatagttattcaaagtacaagatgcagacatctacatgta---------------ta-aat-------
                          Pig  ----------------------------------------ga---------------ta-gga-------
                       Alpaca  ----------------------------------------ta---------------ta-tta-------
               Bactrian camel  ----------------------------------------ta---------------ta-tta-------
                      Dolphin  ----------------------------------------tt----------------------------
                 Killer whale  ----------------------------------------tt----------------------------
             Tibetan antelope  ----------------------------------------ttgttagcatataagaata-tta-------
                          Cow  ----------------------------------------ttgttagcatataagaata-tta-------
                        Sheep  ----------------------------------------ttgttagcatataagacta-tta-------
                Domestic goat  ----------------------------------------ttgttagcatataagaata-tta-------
                          Cat  ----------------------------------------gg---------------agtttt-------
                          Dog  ----------------------------------------ga---------------ag-tta-------
                      Ferret   ----------------------------------------gg---------------ag-tta-------
               Pacific walrus  ----------------------------------------gg---------------ag-tta-------
                 Weddell seal  ----------------------------------------gg---------------ag-tta-------
             Black flying-fox  ----------------------------------------tc---------------ag-ttg-------
                      Megabat  ----------------------------------------tc---------------ag-ttg-------
              Star-nosed mole  ----------------------------------------tt---------------at-tta-------
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
               Naked mole-rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Panda  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ------aatg-------ttaaatatgttaaaatggt-aa
                        Chimp  ------aatg-------ttaaatatgtt-aaatggt-aa
                      Gorilla  ------aatg-------ttaaatatgttaaaatggt-aa
                    Orangutan  ------aatg-------ttaaatacgttaaaatggt-aa
                       Gibbon  ------aatg-------ttaaatatgttaaaatggt-aa
                       Rhesus  ------aatg-------ttaaatatgttaaaatggt-aa
          Crab-eating macaque  ------aatg-------ttaaatatgttaaaatggt-aa
                       Baboon  ------aatg-------ttaaatatgttaaaatggt-aa
                 Green monkey  ------aatg-------ttaaatatgttaaaatggt-aa
                     Marmoset  ------aatg-------ttaaatatgttaaaatggt-aa
              Squirrel monkey  ------aatg-------ttaaatatgttaaaatggt-aa
                     Bushbaby  ------accg-------tcaaatgtgtt----cggt-aa
           Chinese tree shrew  tatgtaagtg-------ttaaatg---taaaaaaaa-aa
                     Squirrel  ------aatg-------ttaaatgtgcttaaattgt-ta
       Lesser Egyptian jerboa  ------aatg-------ttaaatatgttaaaatggtgaa
                 Prairie vole  ------aata-------ttaaatatgttaacacagt-ag
              Chinese hamster  ------aata-------ctaaatgcataaaaatggt-gg
                        Mouse  ------acta-------ttaaatacatttaagtggt-ag
                          Rat  ------aata-------t-----------------t-ag
                   Guinea pig  ------aatg-------ttggatgtgttaaaatgat-ga
                   Chinchilla  ------aatg-------ttgggtgtgtaaaaatggt-ga
             Brush-tailed rat  ------catg-------ttggatgtgt-taaatgct-ga
                          Pig  ------tatg-------ttaaatgtgtcaaaatggt-aa
                       Alpaca  ------tgtg-------ttaaatgtgttagaatggt-aa
               Bactrian camel  ------tgtg-------ttaaatgtgttaaaatggt-aa
                      Dolphin  ---------------------atgtgttaaaatggt-aa
                 Killer whale  ---------------------atgtgttaaaatggt-aa
             Tibetan antelope  ------aatg-------ttaaatatgtttagatggt-aa
                          Cow  ------aatg-------ttaaatatgtttagatggt-aa
                        Sheep  ------aatg-------ttaaatatgcttagatggt-aa
                Domestic goat  ------aatg-------ttaaatatgtttagatggt-aa
                          Cat  ------tata-------tattgcgtgttaaaatggc-aa
                          Dog  ------cata-------tgttatgtgctaaaatggc-aa
                      Ferret   ------tata-------tgttatgggttaaaatggc-aa
               Pacific walrus  ------tata-------tgttatgggttaaaatggc-aa
                 Weddell seal  ------tata-------tgttatgggttaaaatggc-aa
             Black flying-fox  ------caag-------ttaagtgtgtgaaaatggt-aa
                      Megabat  ------caag-------ttaagtgtgtgaaaatggt-aa
              Star-nosed mole  ------tatgtattatataaaatacgttaaaatggt-aa
               Golden hamster  =======================================
                     Hedgehog  =======================================
                  Zebra mbuna  =======================================
          Pundamilia nyererei  =======================================
        Burton's mouthbreeder  =======================================
          Princess of Burundi  ---------------------------------------
                 Nile tilapia  =======================================
             Peregrine falcon  =======================================
                 Saker falcon  =======================================
     Mexican tetra (cavefish)  ---------------------------------------
                  Spotted gar  ---------------------------------------
                   Coelacanth  =======================================
                    Zebrafish  ---------------------------------------
                       Parrot  ---------------------------------------
                   Budgerigar  ---------------------------------------
                  Rock pigeon  ---------------------------------------
           Southern platyfish  ---------------------------------------
                       Medaka  ---------------------------------------
                 Mallard duck  =======================================
                      Lamprey  ---------------------------------------
                    Tetraodon  ---------------------------------------
     Chinese softshell turtle  ---------------------------------------
       Yellowbelly pufferfish  ---------------------------------------
                         Fugu  ---------------------------------------
                      Chicken  =======================================
          Medium ground finch  =======================================
                       Turkey  =======================================
                X. tropicalis  =======================================
               Painted turtle  ---------------------------------------
                  Zebra finch  =======================================
                 Atlantic cod  ---------------------------------------
          Collared flycatcher  =======================================
           American alligator  ---------------------------------------
           Tibetan ground jay  =======================================
                Scarlet macaw  ---------------------------------------
                       Lizard  ---------------------------------------
       White-throated sparrow  =======================================
                  Stickleback  ---------------------------------------
               Naked mole-rat  =======================================
          Cape elephant shrew  =======================================
                        Panda  =======================================
                      Wallaby  ---------------------------------------
              Tasmanian devil  =======================================
                     Platypus  ---------------------------------------
              Green seaturtle  =======================================
                     Microbat  ---------------------------------------
         David's myotis (bat)  ---------------------------------------
                Big brown bat  ---------------------------------------
                       Rabbit  =======================================
                      Opossum  =======================================
                         Pika  =======================================
                       Tenrec  =======================================
                    Armadillo  =======================================
                     Aardvark  =======================================
                     Elephant  =======================================
                        Horse  ---------------------------------------
             White rhinoceros  ---------------------------------------
                      Manatee  =======================================
             Cape golden mole  =======================================

Alignment block 3 of 131 in window, 227659890 - 227659960, 71 bps 
B D                     Human  aaactggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D                     Chimp  aaactgatatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D                   Gorilla  aaactggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D                 Orangutan  aaactggtatcttt-ta------------ttaaa--tggt-----------tctgacagtacccagataa
B D                    Gibbon  gaactggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D                    Rhesus  aaattggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D       Crab-eating macaque  aaattggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D                    Baboon  aaattggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D              Green monkey  aaattggtatcttt-ta------------ttaaa--tggt-----------tctaacagtacccagataa
B D                  Marmoset  aaactggtatattt-ta------------ttaag--tggt-----------tctaatggtacccagataa
B D           Squirrel monkey  aaactggtatattt-ta------------taaag--tggt-----------tctaatggtacccagataa
B D                  Bushbaby  aaactggtatctttata------------tgaaa--tggt-----------tctaacaataccccaataa
           Chinese tree shrew  aaactggtatcttc-ta------------tgaaa--tggt-----------tgtaatagtacctagataa
B D                  Squirrel  aaaa-agtgtcttt-tagttaaatgtgcttaaa---ttgttaaaaaaagtgtctaatagtacacagatta
       Lesser Egyptian jerboa  aagccagtgtgttt-ta------------tgaa---tagt-----------tctactaatacccagatga
                 Prairie vole  aaggcaatgtcttt-ta------------tgaa---tggt-----------tctaacagcaccttgataa
B D           Chinese hamster  aagccaatgtcctt-ta------------tgaa---tggt-----------tctaacagcaccctgataa
B D                     Mouse  aaaccagtatcttt-ta------------tgaa---tggt-----------tctaacagtaccttaagaa
B D                       Rat  aagccggtatcttt-ta------------tgaa---tggt-----------tctaatggtgccctgagaa
B D                Guinea pig  aagccagtgtcttt-ta------------caaaa--cagc-----------tctaatagtacccagataa
                   Chinchilla  aa----------------------------------tggc-----------tctaacagtacccagataa
             Brush-tailed rat  aaaccaatatcttt-ta------------tgcaatgtttc-----------tataatagaacccagataa
B D                       Pig  aaacaggagtgctt-ta------------agaaa--cagt-----------tctaataggacacagataa
B D                    Alpaca  aaactggagtgctt-ta------------tgaaa--tagt-----------ttaaacaggatccagataa
               Bactrian camel  aaactggggtgctt-ta------------tgaaa--tagt-----------ttaaacaggatccagataa
B D                   Dolphin  aaactggagtgctt-ta------------tgaaa--tagt-----------tctaacaggatccagataa
                 Killer whale  aaactggagtgctt-ta------------tgaaa--tagt-----------tctaacaggatccagataa
             Tibetan antelope  aaactggaatgcct-ta------------tgaaa--tagt-----------tctaatagggcctagataa
B D                       Cow  aaactggagtgcct-ta------------cgaaa--tagt-----------tccaataggacctagataa
B D                     Sheep  aaactggagtgcct-ta------------tgaaa--tagt-----------tctaataggacctagataa
                Domestic goat  acactggagtgcct-ta------------tgaaa--tagt-----------tctaataggacctagataa
B D                       Cat  aaactagtgtgttt-ta------------tgaaa--tagt-----------tctgacaggacccagagag
B D                       Dog  aaactagtgtgttt-tc------------taaaa--tggt-----------tctaataagactcagataa
B D                   Ferret   aagctagtgtgttt-ta------------tgaaa--tggt-----------tctaataggacccagataa
B D                     Panda  aaactaatgtgttt-ta------------taaaa--tagt-----------tctaataggacccagataa
               Pacific walrus  aaactagtgtgttt-ta------------taaaa--tagt-----------tctaataggacccagatga
                 Weddell seal  aaaccagtgtgttt-ta------------taaaa--tagt-----------tctaataggacccagataa
             Black flying-fox  aaactagtgtgttt-ta------------tgaaa--tagt-----------tctaacagggcccagatat
B D                   Megabat  aaactagtgtgttt-ta------------tgtaa--tagt-----------tctaacagggcccagatat
              Star-nosed mole  aaactgttat-ttt-ta------------taaaa--ta-t-----------tctaatgtgatctacataa
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
  D              Mallard duck  ======================================================================
B D                   Lamprey  ----------------------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ----------------------------------------------------------------------
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ----------------------------------------------------------------------
B D            Naked mole-rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
            Cape golden mole  ======================================================================

                        Human  tgtgaacattatatacatttacagaaa
                        Chimp  tgtgaacattatatacatttacagaaa
                      Gorilla  tgtgaacattatatacatttacagaaa
                    Orangutan  tgtgaacattatatacatttacagaaa
                       Gibbon  tgtgaacattatatacatttacagaaa
                       Rhesus  tctgaacattatatacatttacagaaa
          Crab-eating macaque  tctgaacattatatacatttacagaaa
                       Baboon  tctgaacattatatacatttacagaaa
                 Green monkey  tctgaacattatatacatttacagaaa
                     Marmoset  tctgaacattatatacatttatagaaa
              Squirrel monkey  tctgaacattatatacatttacagaaa
                     Bushbaby  tctgaatgtctta-----------aaa
           Chinese tree shrew  tctgaatattgtatgattttacagaaa
                     Squirrel  attgaacattatataaatttgtagaaa
       Lesser Egyptian jerboa  tctgaacattaaatgaatttatagaac
                 Prairie vole  cctaaa-attgtattaattcaaagaaa
              Chinese hamster  tctaaa-attgtaataattcatagaaa
                        Mouse  tctaaa-attgtatgaattcataggaa
                          Rat  tctaaa-attgtataaattcatagaaa
                   Guinea pig  tatgaatgctgtatatatgtatagaaa
                   Chinchilla  tctgaacactacatacatttatagaag
             Brush-tailed rat  tctgaacactacatacacttacggaaa
                          Pig  tctgatcactctttgaatttctaggaa
                       Alpaca  tctgaacactct--gaatttataggaa
               Bactrian camel  tctgaacactct--gaatttataggaa
                      Dolphin  tctgaacactctttaaatttataagaa
                 Killer whale  tctgaacactctttaaatttataagaa
             Tibetan antelope  tatgaacactcttgaaatttatatgaa
                          Cow  catgaacactcttagaatttat---aa
                        Sheep  tatgaacactcttggaatttatacgaa
                Domestic goat  tatgaacactcttggaatttatacgaa
                          Cat  tccaaacactatatgaatttatggaaa
                          Dog  tctaagcactatatgaatgtgcagaca
                      Ferret   cctaagtgttatatgaatttacagaca
                        Panda  cctaggtgctatgggaatttacagaca
               Pacific walrus  tctaagtgctatatgaatttacagaca
                 Weddell seal  tcgaagtgctataagaatttacagaca
             Black flying-fox  tctgaacactatatgaatttatagaaa
                      Megabat  tctgaacactatatgaatttatagaaa
              Star-nosed mole  tctcaacaccatagaaacctttagaga
               Golden hamster  ===========================
                     Hedgehog  ===========================
                  Zebra mbuna  ===========================
          Pundamilia nyererei  ===========================
        Burton's mouthbreeder  ===========================
          Princess of Burundi  ---------------------------
                 Nile tilapia  ===========================
             Peregrine falcon  ===========================
                 Saker falcon  ===========================
     Mexican tetra (cavefish)  ---------------------------
                  Spotted gar  ---------------------------
                   Coelacanth  ===========================
                    Zebrafish  ---------------------------
                       Parrot  ---------------------------
                   Budgerigar  ---------------------------
                  Rock pigeon  ---------------------------
           Southern platyfish  ---------------------------
                       Medaka  ---------------------------
                 Mallard duck  ===========================
                      Lamprey  ---------------------------
                    Tetraodon  ---------------------------
     Chinese softshell turtle  ---------------------------
       Yellowbelly pufferfish  ---------------------------
                         Fugu  ---------------------------
                      Chicken  ===========================
          Medium ground finch  ===========================
                       Turkey  ===========================
                X. tropicalis  ===========================
               Painted turtle  ---------------------------
                  Zebra finch  ===========================
                 Atlantic cod  ---------------------------
          Collared flycatcher  ===========================
           American alligator  ---------------------------
           Tibetan ground jay  ===========================
                Scarlet macaw  ---------------------------
                       Lizard  ---------------------------
       White-throated sparrow  ===========================
                  Stickleback  ---------------------------
               Naked mole-rat  ===========================
          Cape elephant shrew  ===========================
                      Wallaby  ---------------------------
              Tasmanian devil  ===========================
                     Platypus  ---------------------------
              Green seaturtle  ===========================
                     Microbat  ---------------------------
         David's myotis (bat)  ---------------------------
                Big brown bat  ---------------------------
                       Rabbit  ===========================
                      Opossum  ===========================
                         Pika  ===========================
                       Tenrec  ===========================
                    Armadillo  ===========================
                     Aardvark  ===========================
                     Elephant  ===========================
                        Horse  ---------------------------
             White rhinoceros  ---------------------------
                      Manatee  ===========================
             Cape golden mole  ===========================

Inserts between block 3 and 4 in window
B D          Squirrel monkey 599bp

Alignment block 4 of 131 in window, 227659961 - 227659964, 4 bps 
B D                     Human  aatt
B D                     Chimp  aatt
B D                   Gorilla  aatt
B D                 Orangutan  aatt
B D                    Gibbon  aatt
B D                    Rhesus  aatt
B D       Crab-eating macaque  aatt
B D                    Baboon  aatt
B D              Green monkey  aatt
B D                  Marmoset  aatt
B D           Squirrel monkey  aatt
B D                  Bushbaby  aatt
           Chinese tree shrew  catt
B D                  Squirrel  aaaa
       Lesser Egyptian jerboa  aatt
                 Prairie vole  caat
B D           Chinese hamster  aaat
B D                     Mouse  at--
B D                       Rat  aca-
B D                Guinea pig  aatt
                   Chinchilla  aatt
             Brush-tailed rat  aagt
B D                       Pig  aatt
B D                    Alpaca  aatt
               Bactrian camel  aatt
B D                   Dolphin  aatt
                 Killer whale  aatt
             Tibetan antelope  catt
B D                       Cow  catt
B D                     Sheep  catt
                Domestic goat  caat
B D                       Cat  aatc
B D                       Dog  aatt
B D                   Ferret   aatt
B D                     Panda  aatt
               Pacific walrus  aatt
                 Weddell seal  aatt
             Black flying-fox  catt
B D                   Megabat  catt
              Star-nosed mole  -att
              Golden hamster  ====
B D                  Hedgehog  ====
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ----
B D              Nile tilapia  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
    Mexican tetra (cavefish)  ----
                 Spotted gar  ----
B D                Coelacanth  ====
B D                 Zebrafish  ----
  D                    Parrot  ----
B D                Budgerigar  ----
  D               Rock pigeon  ----
          Southern platyfish  ----
B D                    Medaka  ----
  D              Mallard duck  ====
B D                   Lamprey  ----
B D                 Tetraodon  ----
  D  Chinese softshell turtle  ----
      Yellowbelly pufferfish  ----
B D                      Fugu  ----
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
B D             X. tropicalis  ====
  D            Painted turtle  ----
B D               Zebra finch  ====
B D              Atlantic cod  ----
  D       Collared flycatcher  ====
B D        American alligator  ----
          Tibetan ground jay  ====
  D             Scarlet macaw  ----
B D                    Lizard  ----
  D    White-throated sparrow  ====
B D               Stickleback  ----
B D            Naked mole-rat  ====
         Cape elephant shrew  ====
B D                   Wallaby  ----
B D           Tasmanian devil  ====
B D                  Platypus  ----
  D           Green seaturtle  ====
B D                  Microbat  ----
        David's myotis (bat)  ----
               Big brown bat  ----
B D                    Rabbit  ====
B D                   Opossum  ====
B D                      Pika  ====
B D                    Tenrec  ====
B D                 Armadillo  ====
                    Aardvark  ====
B D                  Elephant  ====
B D                     Horse  ----
B D          White rhinoceros  ----
B D                   Manatee  ====
            Cape golden mole  ====

Inserts between block 4 and 5 in window
B D                 Marmoset 908bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
B D               Guinea pig 382bp

Alignment block 5 of 131 in window, 227659965 - 227659988, 24 bps 
B D                     Human  tccacttg-----cacttctgggtttaaa
B D                     Chimp  tccacttg-----cacttctgggtttaaa
B D                   Gorilla  tccacttg-----cacttctgggtttaaa
B D                 Orangutan  tccacttg-----cacttctgggtttaaa
B D                    Gibbon  tccacttg-----cacttctgggtttaaa
B D                    Rhesus  tccacttg-----cacttctgggtttaaa
B D       Crab-eating macaque  tccacttg-----cacttctgggtttaaa
B D                    Baboon  tccacttg-----cactgctgggtttaaa
B D              Green monkey  tccacttg-----cacttctgggtttaaa
B D                  Marmoset  tccacttg-----cacttctgggtgtaaa
B D           Squirrel monkey  tccacttg-----cacttctgggtttaaa
B D                  Bushbaby  tccatttg-----catttctgggataaaa
           Chinese tree shrew  tctattta-----tatttctggg-ttaaa
B D                  Squirrel  cccatttg-----catttctcagtttaaa
       Lesser Egyptian jerboa  -ccaattg-----tatttctgggtataaa
                 Prairie vole  --cttttg-----tatttttgagtttaag
B D           Chinese hamster  --catttg-----tatttttgagtttaaa
B D                     Mouse  -------------tttttttgaatttaaa
B D                       Rat  -------------aaattttgaatttaga
                   Chinchilla  tccacttg-----tatttctgggttggaa
             Brush-tailed rat  tccactgg-----tatttctgggtttgaa
B D                       Pig  tccacttt-----catttctggagttaaa
B D                    Alpaca  tccacttg-----catttttgaggtgaaa
               Bactrian camel  tccgcttg-----catttttgaggtgaaa
B D                   Dolphin  tccacttg-----cgtttctggggttaaa
                 Killer whale  tccacttg-----catttctggggttaaa
             Tibetan antelope  tccacttg-----catttcgggcattaaa
B D                       Cow  tccacttg-----catttctggcattaaa
B D                     Sheep  tccactcg-----tatttcgggcattaaa
                Domestic goat  tccactcg-----tatttcgggcattaaa
B D                       Cat  tccacttg-----catttctgggtttaaa
B D                       Dog  tctacttgcatttcatttctggggttaaa
B D                   Ferret   tccacttg-----catttctgggcttaaa
B D                     Panda  tctatttg-----catttctgggttttaa
               Pacific walrus  tctgcttg-----catttctgggcttaaa
                 Weddell seal  tccacttg-----catttctgggcttaaa
             Black flying-fox  tccactta-----cattgctgggtttaag
B D                   Megabat  tccactta-----cattgctgggtttaag
              Star-nosed mole  tccact-g-----catttctggtgttaaa
              Golden hamster  =============================
B D                  Hedgehog  =============================
                 Zebra mbuna  =============================
         Pundamilia nyererei  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  -----------------------------
B D              Nile tilapia  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
    Mexican tetra (cavefish)  -----------------------------
                 Spotted gar  -----------------------------
B D                Coelacanth  =============================
B D                 Zebrafish  -----------------------------
  D                    Parrot  -----------------------------
B D                Budgerigar  -----------------------------
  D               Rock pigeon  -----------------------------
          Southern platyfish  -----------------------------
B D                    Medaka  -----------------------------
  D              Mallard duck  =============================
B D                   Lamprey  -----------------------------
B D                 Tetraodon  -----------------------------
  D  Chinese softshell turtle  -----------------------------
      Yellowbelly pufferfish  -----------------------------
B D                      Fugu  -----------------------------
B D                   Chicken  =============================
B D       Medium ground finch  =============================
B D                    Turkey  =============================
B D             X. tropicalis  =============================
  D            Painted turtle  -----------------------------
B D               Zebra finch  =============================
B D              Atlantic cod  -----------------------------
  D       Collared flycatcher  =============================
B D        American alligator  -----------------------------
          Tibetan ground jay  =============================
  D             Scarlet macaw  -----------------------------
B D                    Lizard  -----------------------------
  D    White-throated sparrow  =============================
B D               Stickleback  -----------------------------
B D                Guinea pig  =============================
B D            Naked mole-rat  =============================
         Cape elephant shrew  =============================
B D                   Wallaby  -----------------------------
B D           Tasmanian devil  =============================
B D                  Platypus  -----------------------------
  D           Green seaturtle  =============================
B D                  Microbat  -----------------------------
        David's myotis (bat)  -----------------------------
               Big brown bat  -----------------------------
B D                    Rabbit  =============================
B D                   Opossum  =============================
B D                      Pika  =============================
B D                    Tenrec  =============================
B D                 Armadillo  =============================
                    Aardvark  =============================
B D                  Elephant  =============================
B D                     Horse  -----------------------------
B D          White rhinoceros  -----------------------------
B D                   Manatee  =============================
            Cape golden mole  =============================

Inserts between block 5 and 6 in window
             Star-nosed mole 12108bp

Alignment block 6 of 131 in window, 227659989 - 227659993, 5 bps 
B D                     Human  agt----gc
B D                     Chimp  agt----gc
B D                   Gorilla  agt----gc
B D                 Orangutan  agt----gc
B D                    Gibbon  agt----gc
B D                    Rhesus  agt----gc
B D       Crab-eating macaque  agt----gc
B D                    Baboon  agt----gc
B D              Green monkey  agt----gc
B D                  Marmoset  agt----gc
B D           Squirrel monkey  agt----gc
B D                  Bushbaby  agt----at
           Chinese tree shrew  agt----ac
B D                  Squirrel  agt----aa
       Lesser Egyptian jerboa  ggc----ac
                 Prairie vole  agcgtgtat
B D           Chinese hamster  ggc-----t
B D                     Mouse  aac----at
B D                       Rat  agc----at
                   Chinchilla  agc----ac
             Brush-tailed rat  agc----ac
B D                       Pig  agt----ac
B D                    Alpaca  agt----ac
               Bactrian camel  agt----ac
B D                   Dolphin  agt----cc
                 Killer whale  agt----cc
             Tibetan antelope  aat----ac
B D                       Cow  agt----ac
B D                     Sheep  aat----ac
                Domestic goat  aat----ac
B D                       Cat  att----cc
B D                       Dog  agt----ac
B D                   Ferret   agt----ac
B D                     Panda  agt----at
               Pacific walrus  agt----ac
                 Weddell seal  agt----ac
             Black flying-fox  ggt----ac
B D                   Megabat  ggt----ac
             Star-nosed mole  =========
              Golden hamster  =========
B D                  Hedgehog  =========
                 Zebra mbuna  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  ---------
B D              Nile tilapia  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
    Mexican tetra (cavefish)  ---------
                 Spotted gar  ---------
B D                Coelacanth  =========
B D                 Zebrafish  ---------
  D                    Parrot  ---------
B D                Budgerigar  ---------
  D               Rock pigeon  ---------
          Southern platyfish  ---------
B D                    Medaka  ---------
  D              Mallard duck  =========
B D                   Lamprey  ---------
B D                 Tetraodon  ---------
  D  Chinese softshell turtle  ---------
      Yellowbelly pufferfish  ---------
B D                      Fugu  ---------
B D                   Chicken  =========
B D       Medium ground finch  =========
B D                    Turkey  =========
B D             X. tropicalis  =========
  D            Painted turtle  ---------
B D               Zebra finch  =========
B D              Atlantic cod  ---------
  D       Collared flycatcher  =========
B D        American alligator  ---------
          Tibetan ground jay  =========
  D             Scarlet macaw  ---------
B D                    Lizard  ---------
  D    White-throated sparrow  =========
B D               Stickleback  ---------
B D                Guinea pig  =========
B D            Naked mole-rat  =========
         Cape elephant shrew  =========
B D                   Wallaby  ---------
B D           Tasmanian devil  =========
B D                  Platypus  ---------
  D           Green seaturtle  =========
B D                  Microbat  ---------
        David's myotis (bat)  ---------
               Big brown bat  ---------
B D                    Rabbit  =========
B D                   Opossum  =========
B D                      Pika  =========
B D                    Tenrec  =========
B D                 Armadillo  =========
                    Aardvark  =========
B D                  Elephant  =========
B D                     Horse  ---------
B D          White rhinoceros  ---------
B D                   Manatee  =========
            Cape golden mole  =========

Inserts between block 6 and 7 in window
          Chinese tree shrew 286bp

Alignment block 7 of 131 in window, 227659994 - 227659996, 3 bps 
B D                     Human  aa-t
B D                     Chimp  aa-t
B D                   Gorilla  aa-t
B D                 Orangutan  aa-c
B D                    Gibbon  ag-t
B D                    Rhesus  aa-t
B D       Crab-eating macaque  aa-t
B D                    Baboon  aatt
B D              Green monkey  aa-t
B D                  Marmoset  aa-t
B D           Squirrel monkey  aa-t
B D                  Bushbaby  aa--
B D                  Squirrel  aa-t
       Lesser Egyptian jerboa  aa-t
                 Prairie vole  aa-t
B D           Chinese hamster  ac-t
B D                     Mouse  gg-t
B D                       Rat  gg-c
                   Chinchilla  aa-t
             Brush-tailed rat  aa-t
B D                       Pig  ag-t
B D                    Alpaca  aa-t
               Bactrian camel  aa-t
B D                   Dolphin  aa-t
                 Killer whale  aa-t
             Tibetan antelope  ac-t
B D                       Cow  ac-t
B D                     Sheep  ac-t
                Domestic goat  ac-t
B D                       Cat  aa-c
B D                       Dog  aa-t
B D                   Ferret   aa-t
B D                     Panda  ag-t
               Pacific walrus  aa-t
                 Weddell seal  aa-t
             Black flying-fox  aa-t
B D                   Megabat  aa-t
             Star-nosed mole  ====
              Golden hamster  ====
B D                  Hedgehog  ====
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ----
B D              Nile tilapia  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
    Mexican tetra (cavefish)  ----
                 Spotted gar  ----
B D                Coelacanth  ====
B D                 Zebrafish  ----
  D                    Parrot  ----
B D                Budgerigar  ----
  D               Rock pigeon  ----
          Southern platyfish  ----
B D                    Medaka  ----
  D              Mallard duck  ====
B D                   Lamprey  ----
B D                 Tetraodon  ----
  D  Chinese softshell turtle  ----
      Yellowbelly pufferfish  ----
B D                      Fugu  ----
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
B D             X. tropicalis  ====
  D            Painted turtle  ----
B D               Zebra finch  ====
B D              Atlantic cod  ----
  D       Collared flycatcher  ====
B D        American alligator  ----
          Tibetan ground jay  ====
  D             Scarlet macaw  ----
B D                    Lizard  ----
  D    White-throated sparrow  ====
B D               Stickleback  ----
B D                Guinea pig  ====
B D            Naked mole-rat  ====
         Cape elephant shrew  ====
B D                   Wallaby  ----
B D           Tasmanian devil  ====
B D                  Platypus  ----
  D           Green seaturtle  ====
B D                  Microbat  ----
        David's myotis (bat)  ----
               Big brown bat  ----
          Chinese tree shrew  ====
B D                    Rabbit  ====
B D                   Opossum  ====
B D                      Pika  ====
B D                    Tenrec  ====
B D                 Armadillo  ====
                    Aardvark  ====
B D                  Elephant  ====
B D                     Horse  ----
B D          White rhinoceros  ----
B D                   Manatee  ====
            Cape golden mole  ====

Alignment block 8 of 131 in window, 227659997 - 227659997, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
B D                     Mouse  g
B D                       Rat  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                       Pig  a
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
B D            Naked mole-rat  =
B D                  Squirrel  -
         Cape elephant shrew  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
B D                      Pika  =
B D                    Tenrec  =
B D                 Armadillo  =
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
B D          White rhinoceros  -
B D                   Manatee  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 8 and 9 in window
B D                  Dolphin 25bp
                Killer whale 25bp

Alignment block 9 of 131 in window, 227659998 - 227659998, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
B D            Naked mole-rat  =
B D                  Squirrel  -
         Cape elephant shrew  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
B D                      Pika  =
B D                    Tenrec  =
B D                 Armadillo  =
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 9 and 10 in window
                  Chinchilla 31bp

Alignment block 10 of 131 in window, 227659999 - 227659999, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
             Brush-tailed rat  t
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  -
         Cape elephant shrew  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
B D                      Pika  =
B D                    Tenrec  =
B D                 Armadillo  =
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 10 and 11 in window
      Lesser Egyptian jerboa 32bp
                Prairie vole 3bp
B D          Chinese hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp

Alignment block 11 of 131 in window, 227660000 - 227660001, 2 bps 
B D                     Human  t-g
B D                     Chimp  t-g
B D                   Gorilla  t-g
B D                 Orangutan  t-g
B D                    Gibbon  t-g
B D                    Rhesus  t-g
B D       Crab-eating macaque  t-g
B D                    Baboon  t-g
B D              Green monkey  t-a
B D                  Marmoset  t-g
B D           Squirrel monkey  t-g
                 Prairie vole  t-a
B D           Chinese hamster  t-a
B D                     Mouse  taa
B D                       Rat  t-a
             Brush-tailed rat  t-g
B D                       Pig  t-g
B D                    Alpaca  t-g
               Bactrian camel  t-g
             Tibetan antelope  t-g
B D                       Cow  t-g
B D                     Sheep  t-g
                Domestic goat  t-g
B D                       Cat  t-g
B D                       Dog  t-g
B D                   Ferret   t-g
B D                     Panda  t-g
               Pacific walrus  t-g
                 Weddell seal  t-g
             Black flying-fox  t-g
B D                   Megabat  t-g
             Star-nosed mole  ===
              Golden hamster  ===
B D                  Hedgehog  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ---
B D              Nile tilapia  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ---
                 Spotted gar  ---
B D                Coelacanth  ===
B D                 Zebrafish  ---
  D                    Parrot  ---
B D                Budgerigar  ---
  D               Rock pigeon  ---
          Southern platyfish  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                   Lamprey  ---
B D                 Tetraodon  ---
  D  Chinese softshell turtle  ---
      Yellowbelly pufferfish  ---
B D                      Fugu  ---
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D             X. tropicalis  ===
  D            Painted turtle  ---
B D               Zebra finch  ===
B D              Atlantic cod  ---
  D       Collared flycatcher  ===
B D        American alligator  ---
          Tibetan ground jay  ===
  D             Scarlet macaw  ---
B D                    Lizard  ---
  D    White-throated sparrow  ===
B D               Stickleback  ---
B D                Guinea pig  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                  Squirrel  ---
         Cape elephant shrew  ===
B D                   Wallaby  ---
B D           Tasmanian devil  ===
B D                  Platypus  ---
  D           Green seaturtle  ===
B D                  Microbat  ---
        David's myotis (bat)  ---
               Big brown bat  ---
          Chinese tree shrew  ===
B D                    Rabbit  ===
B D                   Opossum  ===
B D                      Pika  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                 Armadillo  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                     Horse  ---
B D          White rhinoceros  ---
B D                   Manatee  ===
                Killer whale  ===
B D                   Dolphin  ===
            Cape golden mole  ===
B D                  Bushbaby  ---

Inserts between block 11 and 12 in window
            Brush-tailed rat 29bp
B D                      Dog 28bp

Alignment block 12 of 131 in window, 227660002 - 227660002, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  g
                 Prairie vole  a
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                       Cat  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  -
         Cape elephant shrew  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
B D                      Pika  =
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                 Armadillo  =
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  -

Alignment block 13 of 131 in window, 227660003 - 227660003, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
             Black flying-fox  c
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  -
         Cape elephant shrew  =
B D                     Panda  -
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
B D                   Megabat  -
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
              Pacific walrus  -
B D                      Pika  =
B D                   Ferret   -
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                 Armadillo  =
B D                       Cat  -
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
                Weddell seal  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 13 and 14 in window
B D                      Pig 26bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp

Alignment block 14 of 131 in window, 227660004 - 227660004, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
             Black flying-fox  c
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  -
         Cape elephant shrew  =
B D                     Panda  -
               Domestic goat  =
B D                     Sheep  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
B D                   Megabat  -
B D                       Pig  =
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
              Pacific walrus  -
B D                      Pika  =
B D                   Ferret   -
              Bactrian camel  =
B D                    Alpaca  =
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                 Armadillo  =
B D                       Cat  -
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
                Weddell seal  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 14 and 15 in window
            Black flying-fox 26bp

Alignment block 15 of 131 in window, 227660005 - 227660017, 13 bps 
B D                     Human  aggcgcggtagct
B D                     Chimp  aggcgcggtagct
B D                   Gorilla  aggcgcggtagct
B D                 Orangutan  aggcgcagtagct
B D                    Gibbon  aggcgcggtagct
B D                    Rhesus  aggcacagtggct
B D       Crab-eating macaque  aggcacagtggct
B D                    Baboon  aggcacagtggct
B D              Green monkey  aggcacagtggct
B D                  Marmoset  aggcgcagtggct
B D           Squirrel monkey  aggtgcagttgtt
B D                  Bushbaby  --gtacagtatct
                 Prairie vole  gggca--tggatg
B D           Chinese hamster  gggcaagttggtg
B D                     Mouse  gggcatggtggta
B D                       Rat  gggcctggtggtg
B D                    Alpaca  atttacagtaatt
               Bactrian camel  atttacagtaatt
             Tibetan antelope  ctgtgcagtaatt
B D                       Cow  ctgtgcagtaatt
B D                     Sheep  ctgtgcagtaatt
                Domestic goat  ctgtgcagtaatt
             Star-nosed mole  =============
              Golden hamster  =============
B D                  Hedgehog  =============
                 Zebra mbuna  =============
         Pundamilia nyererei  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  -------------
B D              Nile tilapia  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
    Mexican tetra (cavefish)  -------------
                 Spotted gar  -------------
B D                Coelacanth  =============
B D                 Zebrafish  -------------
  D                    Parrot  -------------
B D                Budgerigar  -------------
  D               Rock pigeon  -------------
          Southern platyfish  -------------
B D                    Medaka  -------------
  D              Mallard duck  =============
B D                   Lamprey  -------------
B D                 Tetraodon  -------------
  D  Chinese softshell turtle  -------------
      Yellowbelly pufferfish  -------------
B D                      Fugu  -------------
B D                   Chicken  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
B D             X. tropicalis  =============
  D            Painted turtle  -------------
B D               Zebra finch  =============
B D              Atlantic cod  -------------
  D       Collared flycatcher  =============
B D        American alligator  -------------
          Tibetan ground jay  =============
  D             Scarlet macaw  -------------
B D                    Lizard  -------------
  D    White-throated sparrow  =============
B D               Stickleback  -------------
B D                Guinea pig  =============
            Brush-tailed rat  =============
B D            Naked mole-rat  =============
                  Chinchilla  =============
B D                  Squirrel  -------------
         Cape elephant shrew  =============
B D                     Panda  -------------
B D                   Wallaby  -------------
B D           Tasmanian devil  =============
B D                  Platypus  -------------
  D           Green seaturtle  =============
B D                  Microbat  -------------
        David's myotis (bat)  -------------
               Big brown bat  -------------
            Black flying-fox  =============
B D                   Megabat  -------------
B D                       Pig  =============
          Chinese tree shrew  =============
B D                    Rabbit  =============
B D                   Opossum  =============
              Pacific walrus  -------------
B D                      Pika  =============
B D                   Ferret   -------------
B D                       Dog  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
B D                 Armadillo  =============
B D                       Cat  -------------
                    Aardvark  =============
B D                  Elephant  =============
B D                     Horse  -------------
                Weddell seal  -------------
B D          White rhinoceros  -------------
B D                   Manatee  =============
                Killer whale  =============
B D                   Dolphin  =============
            Cape golden mole  =============

Inserts between block 15 and 16 in window
B D                   Alpaca 10bp
              Bactrian camel 10bp
            Tibetan antelope 18bp
B D                      Cow 18bp
B D                    Sheep 19bp
               Domestic goat 18bp

Alignment block 16 of 131 in window, 227660018 - 227660040, 23 bps 
B D                     Human  cacacctgtaatcctagcaattt
B D                     Chimp  cacacctgtaatcctagcaatct
B D                   Gorilla  cacacctgtaatcctagcaattt
B D                 Orangutan  cacacctataatcctagcaattt
B D                    Gibbon  cacacctgtaatcctggcaattt
B D                    Rhesus  cacacctgtaaccgtagcacttt
B D       Crab-eating macaque  cacacctgtaaccatagcacttt
B D                    Baboon  cacacctgtaatcgtagcacttt
B D              Green monkey  cacacctgtaatcgtagcacttt
B D                  Marmoset  catacttataatcctagcactta
B D           Squirrel monkey  catacctataaccctagcacttt
B D                  Bushbaby  aacactttc--tcctaattattt
                 Prairie vole  tacattcttacttctaccactc-
B D           Chinese hamster  cgcaaccttaatcctaccactc-
B D                     Mouse  catacccttaatcctaccactc-
B D                       Rat  cacacccttaaccctgccactc-
             Star-nosed mole  =======================
              Golden hamster  =======================
B D                  Hedgehog  =======================
                 Zebra mbuna  =======================
         Pundamilia nyererei  =======================
       Burton's mouthbreeder  =======================
         Princess of Burundi  -----------------------
B D              Nile tilapia  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
    Mexican tetra (cavefish)  -----------------------
                 Spotted gar  -----------------------
B D                Coelacanth  =======================
B D                 Zebrafish  -----------------------
  D                    Parrot  -----------------------
B D                Budgerigar  -----------------------
  D               Rock pigeon  -----------------------
          Southern platyfish  -----------------------
B D                    Medaka  -----------------------
  D              Mallard duck  =======================
B D                   Lamprey  -----------------------
B D                 Tetraodon  -----------------------
  D  Chinese softshell turtle  -----------------------
      Yellowbelly pufferfish  -----------------------
B D                      Fugu  -----------------------
B D                   Chicken  =======================
B D       Medium ground finch  =======================
B D                    Turkey  =======================
B D             X. tropicalis  =======================
  D            Painted turtle  -----------------------
B D               Zebra finch  =======================
B D              Atlantic cod  -----------------------
  D       Collared flycatcher  =======================
B D        American alligator  -----------------------
          Tibetan ground jay  =======================
  D             Scarlet macaw  -----------------------
B D                    Lizard  -----------------------
  D    White-throated sparrow  =======================
B D               Stickleback  -----------------------
B D                Guinea pig  =======================
            Brush-tailed rat  =======================
B D            Naked mole-rat  =======================
                  Chinchilla  =======================
B D                  Squirrel  -----------------------
         Cape elephant shrew  =======================
B D                     Panda  -----------------------
               Domestic goat  =======================
B D                     Sheep  =======================
B D                   Wallaby  -----------------------
B D           Tasmanian devil  =======================
B D                  Platypus  -----------------------
  D           Green seaturtle  =======================
B D                       Cow  =======================
            Tibetan antelope  =======================
B D                  Microbat  -----------------------
        David's myotis (bat)  -----------------------
               Big brown bat  -----------------------
            Black flying-fox  =======================
B D                   Megabat  -----------------------
B D                       Pig  =======================
          Chinese tree shrew  =======================
B D                    Rabbit  =======================
B D                   Opossum  =======================
              Pacific walrus  -----------------------
B D                      Pika  =======================
B D                   Ferret   -----------------------
              Bactrian camel  =======================
B D                    Alpaca  =======================
B D                       Dog  =======================
      Lesser Egyptian jerboa  =======================
B D                    Tenrec  =======================
B D                 Armadillo  =======================
B D                       Cat  -----------------------
                    Aardvark  =======================
B D                  Elephant  =======================
B D                     Horse  -----------------------
                Weddell seal  -----------------------
B D          White rhinoceros  -----------------------
B D                   Manatee  =======================
                Killer whale  =======================
B D                   Dolphin  =======================
            Cape golden mole  =======================

Inserts between block 16 and 17 in window
B D                 Bushbaby 10bp

Alignment block 17 of 131 in window, 227660041 - 227660106, 66 bps 
B D                     Human  gggaggtcggggcaggcggatcttttaagcccatgagttcaagaccagcttgggcaacacggcaag
B D                     Chimp  gggaggtcggggcaggcggatcttttaagcccatgagttcaagaccagcttgggcaacatggcaag
B D                   Gorilla  gggaggttggggcaggcggatcttttcagcccgtgagttcaagaccagcttgggcaacatggcaag
B D                 Orangutan  gggaggtcaaggcaggcggatcttttgagcccatgagttcaagaccagcttgggcaacatgacaaa
B D                    Gibbon  gggaggtcgggacaggcggatcttttgagcccatgagttcaagaccagctagggcaacatggcaaa
B D                    Rhesus  gggaggtcagggcaggcagctcttttgagcccgggagtttgagaccagcctgggcaacatggtaaa
B D       Crab-eating macaque  gggaggtcagggcaggcagctcttttgagctcgggagtttgagaccagcctgggcaacatggtaaa
B D                    Baboon  gggaggtcagggcaggcagatcttttgagcccgggagtttgagaccagcctgggcaacatggtaaa
B D              Green monkey  gggaggtcagggcaggcagatcttttgagcccgggagtttgagaccagcctgggcaacatggtaaa
B D                  Marmoset  tggaggttcagg-gggtggattttttgagc-caggagttcgagaccagcctgggcaacatggtaaa
B D           Squirrel monkey  gggaggctgaggagggtggattttttgagc-caggagtttgagaccagcctgggcaacatggt-aa
                 Prairie vole  aggaggtagaggcaggcagatttc-------tgtgagtttgagggtagtct---------------
B D           Chinese hamster  aggaggtggaggcaggtggataaa-------tgtgagtttgagggcagtctgttctatatagtaaa
B D                     Mouse  aggaggtggaggcagg---------------tgtgagtttgagggcagtctggtctacgtagaaag
B D                       Rat  aggaggtggaggcaggtgaatctc-------tgtgaatttgagggctgtctggtctacacagcaag
             Star-nosed mole  ==================================================================
              Golden hamster  ==================================================================
B D                  Hedgehog  ==================================================================
                 Zebra mbuna  ==================================================================
         Pundamilia nyererei  ==================================================================
       Burton's mouthbreeder  ==================================================================
         Princess of Burundi  ------------------------------------------------------------------
B D              Nile tilapia  ==================================================================
  D          Peregrine falcon  ==================================================================
  D              Saker falcon  ==================================================================
    Mexican tetra (cavefish)  ------------------------------------------------------------------
                 Spotted gar  ------------------------------------------------------------------
B D                Coelacanth  ==================================================================
B D                 Zebrafish  ------------------------------------------------------------------
  D                    Parrot  ------------------------------------------------------------------
B D                Budgerigar  ------------------------------------------------------------------
  D               Rock pigeon  ------------------------------------------------------------------
          Southern platyfish  ------------------------------------------------------------------
B D                    Medaka  ------------------------------------------------------------------
  D              Mallard duck  ==================================================================
B D                   Lamprey  ------------------------------------------------------------------
B D                 Tetraodon  ------------------------------------------------------------------
  D  Chinese softshell turtle  ------------------------------------------------------------------
      Yellowbelly pufferfish  ------------------------------------------------------------------
B D                      Fugu  ------------------------------------------------------------------
B D                   Chicken  ==================================================================
B D       Medium ground finch  ==================================================================
B D                    Turkey  ==================================================================
B D             X. tropicalis  ==================================================================
  D            Painted turtle  ------------------------------------------------------------------
B D               Zebra finch  ==================================================================
B D              Atlantic cod  ------------------------------------------------------------------
  D       Collared flycatcher  ==================================================================
B D        American alligator  ------------------------------------------------------------------
          Tibetan ground jay  ==================================================================
  D             Scarlet macaw  ------------------------------------------------------------------
B D                    Lizard  ------------------------------------------------------------------
  D    White-throated sparrow  ==================================================================
B D               Stickleback  ------------------------------------------------------------------
B D                Guinea pig  ==================================================================
            Brush-tailed rat  ==================================================================
B D            Naked mole-rat  ==================================================================
                  Chinchilla  ==================================================================
B D                  Squirrel  ------------------------------------------------------------------
         Cape elephant shrew  ==================================================================
B D                     Panda  ------------------------------------------------------------------
               Domestic goat  ==================================================================
B D                     Sheep  ==================================================================
B D                   Wallaby  ------------------------------------------------------------------
B D           Tasmanian devil  ==================================================================
B D                  Platypus  ------------------------------------------------------------------
  D           Green seaturtle  ==================================================================
B D                       Cow  ==================================================================
            Tibetan antelope  ==================================================================
B D                  Microbat  ------------------------------------------------------------------
        David's myotis (bat)  ------------------------------------------------------------------
               Big brown bat  ------------------------------------------------------------------
            Black flying-fox  ==================================================================
B D                   Megabat  ------------------------------------------------------------------
B D                       Pig  ==================================================================
          Chinese tree shrew  ==================================================================
B D                    Rabbit  ==================================================================
B D                   Opossum  ==================================================================
              Pacific walrus  ------------------------------------------------------------------
B D                      Pika  ==================================================================
B D                   Ferret   ------------------------------------------------------------------
              Bactrian camel  ==================================================================
B D                    Alpaca  ==================================================================
B D                       Dog  ==================================================================
      Lesser Egyptian jerboa  ==================================================================
B D                    Tenrec  ==================================================================
B D                 Armadillo  ==================================================================
B D                       Cat  ------------------------------------------------------------------
                    Aardvark  ==================================================================
B D                  Elephant  ==================================================================
B D                     Horse  ------------------------------------------------------------------
                Weddell seal  ------------------------------------------------------------------
B D          White rhinoceros  ------------------------------------------------------------------
B D                   Manatee  ==================================================================
                Killer whale  ==================================================================
B D                   Dolphin  ==================================================================
            Cape golden mole  ==================================================================
B D                  Bushbaby  ==================================================================

Inserts between block 17 and 18 in window
B D                      Rat 17bp

Alignment block 18 of 131 in window, 227660107 - 227660109, 3 bps 
B D                     Human  acc
B D                     Chimp  acc
B D                   Gorilla  acc
B D                 Orangutan  acc
B D                    Gibbon  acc
B D                    Rhesus  acc
B D       Crab-eating macaque  acc
B D                    Baboon  acc
B D              Green monkey  acc
B D                  Marmoset  acg
B D           Squirrel monkey  acg
B D           Chinese hamster  acc
B D                     Mouse  tcc
             Star-nosed mole  ===
              Golden hamster  ===
B D                  Hedgehog  ===
B D                       Rat  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ---
B D              Nile tilapia  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ---
                 Spotted gar  ---
B D                Coelacanth  ===
B D                 Zebrafish  ---
  D                    Parrot  ---
B D                Budgerigar  ---
  D               Rock pigeon  ---
          Southern platyfish  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                   Lamprey  ---
B D                 Tetraodon  ---
  D  Chinese softshell turtle  ---
      Yellowbelly pufferfish  ---
B D                      Fugu  ---
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D             X. tropicalis  ===
  D            Painted turtle  ---
B D               Zebra finch  ===
B D              Atlantic cod  ---
  D       Collared flycatcher  ===
B D        American alligator  ---
          Tibetan ground jay  ===
  D             Scarlet macaw  ---
B D                    Lizard  ---
  D    White-throated sparrow  ===
B D               Stickleback  ---
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                  Squirrel  ---
                Prairie vole  ---
         Cape elephant shrew  ===
B D                     Panda  ---
               Domestic goat  ===
B D                     Sheep  ===
B D                   Wallaby  ---
B D           Tasmanian devil  ===
B D                  Platypus  ---
  D           Green seaturtle  ===
B D                       Cow  ===
            Tibetan antelope  ===
B D                  Microbat  ---
        David's myotis (bat)  ---
               Big brown bat  ---
            Black flying-fox  ===
B D                   Megabat  ---
B D                       Pig  ===
          Chinese tree shrew  ===
B D                    Rabbit  ===
B D                   Opossum  ===
              Pacific walrus  ---
B D                      Pika  ===
B D                   Ferret   ---
              Bactrian camel  ===
B D                    Alpaca  ===
B D                       Dog  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                 Armadillo  ===
B D                       Cat  ---
                    Aardvark  ===
B D                  Elephant  ===
B D                     Horse  ---
                Weddell seal  ---
B D          White rhinoceros  ---
B D                   Manatee  ===
                Killer whale  ===
B D                   Dolphin  ===
            Cape golden mole  ===
B D                  Bushbaby  ===

Inserts between block 18 and 19 in window
B D          Chinese hamster 65bp
B D                    Mouse 76bp

Alignment block 19 of 131 in window, 227660110 - 227660303, 194 bps 
B D                     Human  tcatctctacgaaaaaatacaaaaagtagccgggtgttgtggcgggcgcctgtggtcctagctacacggc
B D                     Chimp  tcatctctatgaaaaaatacaaaaagtagccgggtgttgtggtgggcgcctgtggtcctagctacacggc
B D                   Gorilla  tcatctctacgaaaaaatacaaaaagtagccgggtgttgtggcgggcgcctgtggtcctagctacatggc
B D                 Orangutan  tcatctgtacgaaaagatacaaaaagtagccgggtgttgtggtgggcgcctgtggtcctagctacacggc
B D                    Gibbon  tcatctctacgaaaaaatacaaaaagtagccgggtgttgtggcgggcgcctgtggtcctagctacacagc
B D                    Rhesus  tcatctctatgaaaaaatacaaaaactagccggatattgtggcgggcgcctgtggtcctagctacaggac
B D       Crab-eating macaque  ttatctctatgaaaaaatacaaaaactagccggatattgtggcgggcgcctgtggtcctagctacaggac
B D                    Baboon  tcatctctacgaaaaaatacaaaaactagccggatattgtggccggcgcctgtggtcctagctacaggac
B D              Green monkey  tcatctgtacgaaaaaatataaaaactagccggatattgtgacaggcgcctgtggtcctagctacaggac
B D                  Marmoset  ttctctctacaaa-atatacaaaaattagccagatgtagtggtgggtgcctgtggtcccagctacaggac
B D           Squirrel monkey  tcatctctacaaacaaatacaaaaattagccagatgcagtggtgggtgcctgtggtcctagctacaagac
                 Prairie vole  --atctctgtagtaag------------------------------------------------------
             Star-nosed mole  ======================================================================
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
  D              Mallard duck  ======================================================================
B D                   Lamprey  ----------------------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ----------------------------------------------------------------------
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ----------------------------------------------------------------------
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                  Squirrel  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Panda  ----------------------------------------------------------------------
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
            Black flying-fox  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
          Chinese tree shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
              Pacific walrus  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                   Ferret   ----------------------------------------------------------------------
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
B D                       Cat  ----------------------------------------------------------------------
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
                Killer whale  ======================================================================
B D                   Dolphin  ======================================================================
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================

                        Human  taagattataccta----------------------------------gacctacactacacctatgctg
                        Chimp  taagattataccta----------------------------------gacctacactacacctatgcct
                      Gorilla  taagattataccta----------------------------------gacctacactacacctatgctg
                    Orangutan  taagattataccta----------------------------------gacctacactacacctatgctg
                       Gibbon  taagattataccta----------------------------------gacctacactacacctatgctg
                       Rhesus  taggattataccta----------------------------------gacctacactacacctatgctg
          Crab-eating macaque  taggattataccta----------------------------------gacctacactacacctatgctg
                       Baboon  taggattataccta----------------------------------gacctaccctacacctatgctg
                 Green monkey  taggattataccta----------------------------------gacctacactacacctacgctg
                     Marmoset  taggactatacctagtcctacactatactgagaactacattgtacctcgtcctacactagacctacactg
              Squirrel monkey  taggactatacctagtcctacaccatactgagaactacattgtacctcgtcctacactacacctatgctg
                 Prairie vole  ---------accca----------------------------------gtcc------------------
              Star-nosed mole  ======================================================================
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
              Chinese hamster  ======================================================================
                        Panda  ----------------------------------------------------------------------
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                      Megabat  ----------------------------------------------------------------------
                          Pig  ======================================================================
           Chinese tree shrew  ======================================================================
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
                         Pika  ======================================================================
                      Ferret   ----------------------------------------------------------------------
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                          Dog  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
                 Killer whale  ======================================================================
                      Dolphin  ======================================================================
             Cape golden mole  ======================================================================
                     Bushbaby  ======================================================================

                        Human  aggtgggaggatcacctgagcctgggaagttgaggctgcagag--agccatgattgtgccattgcactcc
                        Chimp  aggcgggaggatcacctgagcctgggaagttgaggctgcagag--agccatgattgtgccattgcactcc
                      Gorilla  aggtgggaggatcacctgagcctgggaagttgaggctgcagag--agccatgattgtgccattgcactcc
                    Orangutan  aggtgggaggatcacctgagcctgggaagttgaggctgcagag--agccatgattgtgccattgcactct
                       Gibbon  aggtgggaggatcacctgagcctgggaaattgaggctacagag--agccatgactgtgccattgcactcc
                       Rhesus  aggtgggaggatcacctgagcctgggaagttgaggttgcatcg--agccatgattgggccgttgcactcc
          Crab-eating macaque  aggtgggaggatcacctgagcctgggaagttgaggttgcatcg--agccatgattgggccgttgcactcc
                       Baboon  aggtgggaggatcacctgagcctgggaagttcaggctgcatcg--agccatgattgggccgttgcactcc
                 Green monkey  aggtgggaggatcacctgagcctgggaagttgaggctgcatca--agccatggttgggccattgcactcc
                     Marmoset  aggtgggaggatcacctgagcctgggaagttaaggctgcagtgatagccataattttgccattgcactct
              Squirrel monkey  aggtgggaggatcacctgagcctgggaacttgaggctgcagtg--agccataattttgccatcgcactct
                 Prairie vole  ------------------atccaggg--------------------------------------------
              Star-nosed mole  ======================================================================
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                    Zebrafish  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Mallard duck  ======================================================================
                      Lamprey  ----------------------------------------------------------------------
                    Tetraodon  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
       Yellowbelly pufferfish  ----------------------------------------------------------------------
                         Fugu  ----------------------------------------------------------------------
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ----------------------------------------------------------------------
                  Zebra finch  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
           American alligator  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
                  Stickleback  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
              Chinese hamster  ======================================================================
                        Panda  ----------------------------------------------------------------------
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                     Platypus  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                      Megabat  ----------------------------------------------------------------------
                          Pig  ======================================================================
           Chinese tree shrew  ======================================================================
                       Rabbit  ======================================================================
                      Opossum  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
                         Pika  ======================================================================
                      Ferret   ----------------------------------------------------------------------
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                          Dog  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                        Horse  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                      Manatee  ======================================================================
                 Killer whale  ======================================================================
                      Dolphin  ======================================================================
             Cape golden mole  ======================================================================
                     Bushbaby  ======================================================================

                        Human  agcctggatgacagagtgac
                        Chimp  agcctggatgacagagtgac
                      Gorilla  agcttggatgacagagtgac
                    Orangutan  agcctggatgacagagtgac
                       Gibbon  agcctggatgacagagtgag
                       Rhesus  agcctggatgacagagtgag
          Crab-eating macaque  agcctggatgacagagtgag
                       Baboon  agcctggatgacagagtgag
                 Green monkey  agcctggatgacagagtcag
                     Marmoset  agcctaggtgacagagtgag
              Squirrel monkey  agcctgggtgacagagtgag
                 Prairie vole  --------------------
              Star-nosed mole  ====================
               Golden hamster  ====================
                     Hedgehog  ====================
                          Rat  ====================
                        Mouse  ====================
                  Zebra mbuna  ====================
          Pundamilia nyererei  ====================
        Burton's mouthbreeder  ====================
          Princess of Burundi  --------------------
                 Nile tilapia  ====================
             Peregrine falcon  ====================
                 Saker falcon  ====================
     Mexican tetra (cavefish)  --------------------
                  Spotted gar  --------------------
                   Coelacanth  ====================
                    Zebrafish  --------------------
                       Parrot  --------------------
                   Budgerigar  --------------------
                  Rock pigeon  --------------------
           Southern platyfish  --------------------
                       Medaka  --------------------
                 Mallard duck  ====================
                      Lamprey  --------------------
                    Tetraodon  --------------------
     Chinese softshell turtle  --------------------
       Yellowbelly pufferfish  --------------------
                         Fugu  --------------------
                      Chicken  ====================
          Medium ground finch  ====================
                       Turkey  ====================
                X. tropicalis  ====================
               Painted turtle  --------------------
                  Zebra finch  ====================
                 Atlantic cod  --------------------
          Collared flycatcher  ====================
           American alligator  --------------------
           Tibetan ground jay  ====================
                Scarlet macaw  --------------------
                       Lizard  --------------------
       White-throated sparrow  ====================
                  Stickleback  --------------------
                   Guinea pig  ====================
             Brush-tailed rat  ====================
               Naked mole-rat  ====================
                   Chinchilla  ====================
                     Squirrel  --------------------
          Cape elephant shrew  ====================
              Chinese hamster  ====================
                        Panda  --------------------
                Domestic goat  ====================
                        Sheep  ====================
                      Wallaby  --------------------
              Tasmanian devil  ====================
                     Platypus  --------------------
              Green seaturtle  ====================
                          Cow  ====================
             Tibetan antelope  ====================
                     Microbat  --------------------
         David's myotis (bat)  --------------------
                Big brown bat  --------------------
             Black flying-fox  ====================
                      Megabat  --------------------
                          Pig  ====================
           Chinese tree shrew  ====================
                       Rabbit  ====================
                      Opossum  ====================
               Pacific walrus  --------------------
                         Pika  ====================
                      Ferret   --------------------
               Bactrian camel  ====================
                       Alpaca  ====================
                          Dog  ====================
       Lesser Egyptian jerboa  ====================
                       Tenrec  ====================
                    Armadillo  ====================
                          Cat  --------------------
                     Aardvark  ====================
                     Elephant  ====================
                        Horse  --------------------
                 Weddell seal  --------------------
             White rhinoceros  --------------------
                      Manatee  ====================
                 Killer whale  ====================
                      Dolphin  ====================
             Cape golden mole  ====================
                     Bushbaby  ====================

Alignment block 20 of 131 in window, 227660304 - 227660328, 25 bps 
B D                     Human  accctgtctc------------------------------------------------------------
B D                     Chimp  accatgtcac------------------------------------------------------------
B D                   Gorilla  accgtgtctc------------------------------------------------------------
B D                 Orangutan  accctgtctc------------------------------------------------------------
B D                    Gibbon  accctgtctc------------------------------------------------------------
B D                    Rhesus  accctgtctc-----------------------------------ataaaataaaataaaataaaataaa
B D       Crab-eating macaque  accctgtctcaaaaaataaaata--------------------aaataaaataaaataaaataaaataaa
B D                    Baboon  acgctgtctcaaaaaataaaataaaataaaataaaataaaataaaataaaataaaataaaataaaataaa
B D              Green monkey  accctgtctc-------------------------------------------------------aaaaa
B D                  Marmoset  accctgtctc--------------------------------------------------aaaaa--aaa
B D           Squirrel monkey  accctgcctc--------------------------------------------------aaaaaataaa
                 Prairie vole  actctctctc------------------------------------------------------------
B D                       Rat  actctgtctc------------------------------------------------------------
             Star-nosed mole  ======================================================================
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Mouse  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
  D              Mallard duck  ======================================================================
B D                   Lamprey  ----------------------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ----------------------------------------------------------------------
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ----------------------------------------------------------------------
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                  Squirrel  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Panda  ----------------------------------------------------------------------
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
            Black flying-fox  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
          Chinese tree shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
              Pacific walrus  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                   Ferret   ----------------------------------------------------------------------
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
B D                       Cat  ----------------------------------------------------------------------
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                   Manatee  ======================================================================
                Killer whale  ======================================================================
B D                   Dolphin  ======================================================================
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================

                        Human  aaaaaataagataat
                        Chimp  aaaaa-----ataat
                      Gorilla  aaaaaataagataat
                    Orangutan  aaaaaataaaataat
                       Gibbon  aaaaaataatataat
                       Rhesus  ataaaataaaataat
          Crab-eating macaque  ataaaataaaataat
                       Baboon  ataaaataaaataat
                 Green monkey  ataaaataaaataat
                     Marmoset  aaaaaaaaaaataat
              Squirrel monkey  ataaaataaaataat
                 Prairie vole  aaaaaaaggg-----
                          Rat  aaaacagggg-----
              Star-nosed mole  ===============
               Golden hamster  ===============
                     Hedgehog  ===============
                        Mouse  ===============
                  Zebra mbuna  ===============
          Pundamilia nyererei  ===============
        Burton's mouthbreeder  ===============
          Princess of Burundi  ---------------
                 Nile tilapia  ===============
             Peregrine falcon  ===============
                 Saker falcon  ===============
     Mexican tetra (cavefish)  ---------------
                  Spotted gar  ---------------
                   Coelacanth  ===============
                    Zebrafish  ---------------
                       Parrot  ---------------
                   Budgerigar  ---------------
                  Rock pigeon  ---------------
           Southern platyfish  ---------------
                       Medaka  ---------------
                 Mallard duck  ===============
                      Lamprey  ---------------
                    Tetraodon  ---------------
     Chinese softshell turtle  ---------------
       Yellowbelly pufferfish  ---------------
                         Fugu  ---------------
                      Chicken  ===============
          Medium ground finch  ===============
                       Turkey  ===============
                X. tropicalis  ===============
               Painted turtle  ---------------
                  Zebra finch  ===============
                 Atlantic cod  ---------------
          Collared flycatcher  ===============
           American alligator  ---------------
           Tibetan ground jay  ===============
                Scarlet macaw  ---------------
                       Lizard  ---------------
       White-throated sparrow  ===============
                  Stickleback  ---------------
                   Guinea pig  ===============
             Brush-tailed rat  ===============
               Naked mole-rat  ===============
                   Chinchilla  ===============
                     Squirrel  ---------------
          Cape elephant shrew  ===============
              Chinese hamster  ===============
                        Panda  ---------------
                Domestic goat  ===============
                        Sheep  ===============
                      Wallaby  ---------------
              Tasmanian devil  ===============
                     Platypus  ---------------
              Green seaturtle  ===============
                          Cow  ===============
             Tibetan antelope  ===============
                     Microbat  ---------------
         David's myotis (bat)  ---------------
                Big brown bat  ---------------
             Black flying-fox  ===============
                      Megabat  ---------------
                          Pig  ===============
           Chinese tree shrew  ===============
                       Rabbit  ===============
                      Opossum  ===============
               Pacific walrus  ---------------
                         Pika  ===============
                      Ferret   ---------------
               Bactrian camel  ===============
                       Alpaca  ===============
                          Dog  ===============
       Lesser Egyptian jerboa  ===============
                       Tenrec  ===============
                    Armadillo  ===============
                          Cat  ---------------
                     Aardvark  ===============
                     Elephant  ===============
                        Horse  ---------------
                 Weddell seal  ---------------
             White rhinoceros  ---------------
                      Manatee  ===============
                 Killer whale  ===============
                      Dolphin  ===============
             Cape golden mole  ===============
                     Bushbaby  ===============

Alignment block 21 of 131 in window, 227660329 - 227660345, 17 bps 
B D                     Human  aaaagtgca-acatctga
B D                     Chimp  aaaagtgca-atgtctga
B D                   Gorilla  aaaagtgca-acatctga
B D                 Orangutan  aaaagtgca-acatctga
B D                    Gibbon  aaaagtgca-acatctga
B D                    Rhesus  aaaagtgca-acatctg-
B D       Crab-eating macaque  aaaagtgca-acatctg-
B D                    Baboon  aaaagtgca-acatctg-
B D              Green monkey  aaaaatgca-acatctg-
B D                  Marmoset  gaaagtgca-acatctaa
B D           Squirrel monkey  gaaagtgca-acatctga
B D                  Squirrel  aaaagtata-atacctca
                 Prairie vole  -gagacaca-aaatctga
B D                       Rat  -----cacagaaatctgc
             Star-nosed mole  ==================
              Golden hamster  ==================
B D                  Hedgehog  ==================
B D                     Mouse  ==================
                 Zebra mbuna  ==================
         Pundamilia nyererei  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ------------------
B D              Nile tilapia  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
    Mexican tetra (cavefish)  ------------------
                 Spotted gar  ------------------
B D                Coelacanth  ==================
B D                 Zebrafish  ------------------
  D                    Parrot  ------------------
B D                Budgerigar  ------------------
  D               Rock pigeon  ------------------
          Southern platyfish  ------------------
B D                    Medaka  ------------------
  D              Mallard duck  ==================
B D                   Lamprey  ------------------
B D                 Tetraodon  ------------------
  D  Chinese softshell turtle  ------------------
      Yellowbelly pufferfish  ------------------
B D                      Fugu  ------------------
B D                   Chicken  ==================
B D       Medium ground finch  ==================
B D                    Turkey  ==================
B D             X. tropicalis  ==================
  D            Painted turtle  ------------------
B D               Zebra finch  ==================
B D              Atlantic cod  ------------------
  D       Collared flycatcher  ==================
B D        American alligator  ------------------
          Tibetan ground jay  ==================
  D             Scarlet macaw  ------------------
B D                    Lizard  ------------------
  D    White-throated sparrow  ==================
B D               Stickleback  ------------------
B D                Guinea pig  ==================
            Brush-tailed rat  ==================
B D            Naked mole-rat  ==================
                  Chinchilla  ==================
         Cape elephant shrew  ==================
B D           Chinese hamster  ==================
B D                     Panda  ------------------
               Domestic goat  ==================
B D                     Sheep  ==================
B D                   Wallaby  ------------------
B D           Tasmanian devil  ==================
B D                  Platypus  ------------------
  D           Green seaturtle  ==================
B D                       Cow  ==================
            Tibetan antelope  ==================
B D                  Microbat  ------------------
        David's myotis (bat)  ------------------
               Big brown bat  ------------------
            Black flying-fox  ==================
B D                   Megabat  ------------------
B D                       Pig  ==================
          Chinese tree shrew  ==================
B D                    Rabbit  ==================
B D                   Opossum  ==================
              Pacific walrus  ------------------
B D                      Pika  ==================
B D                   Ferret   ------------------
              Bactrian camel  ==================
B D                    Alpaca  ==================
B D                       Dog  ==================
      Lesser Egyptian jerboa  ==================
B D                    Tenrec  ==================
B D                 Armadillo  ==================
B D                       Cat  ------------------
                    Aardvark  ==================
B D                  Elephant  ==================
B D                     Horse  ------------------
                Weddell seal  ------------------
B D          White rhinoceros  ------------------
B D                   Manatee  ==================
                Killer whale  ==================
B D                   Dolphin  ==================
            Cape golden mole  ==================
B D                  Bushbaby  ==================

Alignment block 22 of 131 in window, 227660346 - 227660374, 29 bps 
B D                     Human  cactttctagtaattgtttaaatataatg
B D                     Chimp  cac-ttctagtaattgtttaaatgtaatg
B D                   Gorilla  cactttctagtaattgtttaaatgtaatg
B D                 Orangutan  cactttttagtaattgtttaaatgtaatg
B D                    Gibbon  cactttctagtaattgtttaaatgtaatg
B D                    Rhesus  -actttctagtaattgtttaaatgtaatg
B D       Crab-eating macaque  -actttctagtaattgtttaaatgtaatg
B D                    Baboon  -actttctagtaattgtttaaatgtaatg
B D              Green monkey  -actttctagtaattgtttaaatgtaatg
B D                  Marmoset  tactttcta-tagttgtttaaatgtaatg
B D           Squirrel monkey  tactttcta-tagttgtttaaatgtaatg
B D                  Squirrel  tcctttctaggaattgtctaaatttaatg
                 Prairie vole  taccatctagaaattgttcaaatttaatg
B D                       Rat  tatcatctagaagttgtttaaatttaatg
B D                       Cat  cactttccagtaactgtttaaatttaatc
B D                   Ferret   cactacctagtaattgtttaagtttaatg
B D                     Panda  cactttccagtaattgtttaaatgtaatg
               Pacific walrus  cactttctggtaattgtttaaatttaatg
                 Weddell seal  cactttctggtaattgtttaaatttaatg
B D                   Megabat  cactttccagtaattgtttaaat-taatg
             Star-nosed mole  =============================
              Golden hamster  =============================
B D                  Hedgehog  =============================
B D                     Mouse  =============================
                 Zebra mbuna  =============================
         Pundamilia nyererei  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  -----------------------------
B D              Nile tilapia  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
    Mexican tetra (cavefish)  -----------------------------
                 Spotted gar  -----------------------------
B D                Coelacanth  =============================
B D                 Zebrafish  -----------------------------
  D                    Parrot  -----------------------------
B D                Budgerigar  -----------------------------
  D               Rock pigeon  -----------------------------
          Southern platyfish  -----------------------------
B D                    Medaka  -----------------------------
  D              Mallard duck  =============================
B D                   Lamprey  -----------------------------
B D                 Tetraodon  -----------------------------
  D  Chinese softshell turtle  -----------------------------
      Yellowbelly pufferfish  -----------------------------
B D                      Fugu  -----------------------------
B D                   Chicken  =============================
B D       Medium ground finch  =============================
B D                    Turkey  =============================
B D             X. tropicalis  =============================
  D            Painted turtle  -----------------------------
B D               Zebra finch  =============================
B D              Atlantic cod  -----------------------------
  D       Collared flycatcher  =============================
B D        American alligator  -----------------------------
          Tibetan ground jay  =============================
  D             Scarlet macaw  -----------------------------
B D                    Lizard  -----------------------------
  D    White-throated sparrow  =============================
B D               Stickleback  -----------------------------
B D                Guinea pig  =============================
            Brush-tailed rat  =============================
B D            Naked mole-rat  =============================
                  Chinchilla  =============================
         Cape elephant shrew  =============================
B D           Chinese hamster  =============================
               Domestic goat  =============================
B D                     Sheep  =============================
B D                   Wallaby  -----------------------------
B D           Tasmanian devil  =============================
B D                  Platypus  -----------------------------
  D           Green seaturtle  =============================
B D                       Cow  =============================
            Tibetan antelope  =============================
B D                  Microbat  -----------------------------
        David's myotis (bat)  -----------------------------
               Big brown bat  -----------------------------
            Black flying-fox  =============================
B D                       Pig  =============================
          Chinese tree shrew  =============================
B D                    Rabbit  =============================
B D                   Opossum  =============================
B D                      Pika  =============================
              Bactrian camel  =============================
B D                    Alpaca  =============================
B D                       Dog  =============================
      Lesser Egyptian jerboa  =============================
B D                    Tenrec  =============================
B D                 Armadillo  =============================
                    Aardvark  =============================
B D                  Elephant  =============================
B D                     Horse  -----------------------------
B D          White rhinoceros  -----------------------------
B D                   Manatee  =============================
                Killer whale  =============================
B D                   Dolphin  =============================
            Cape golden mole  =============================
B D                  Bushbaby  =============================

Alignment block 23 of 131 in window, 227660375 - 227660375, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Squirrel  a
B D                       Cat  a
B D                   Ferret   g
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
B D                       Rat  -
B D                     Mouse  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
                Prairie vole  -
         Cape elephant shrew  =
B D           Chinese hamster  =
B D                     Panda  -
               Domestic goat  =
B D                     Sheep  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
            Black flying-fox  =
B D                   Megabat  -
B D                       Pig  =
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
              Pacific walrus  -
B D                      Pika  =
              Bactrian camel  =
B D                    Alpaca  =
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                 Armadillo  =
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
                Weddell seal  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  =

Alignment block 24 of 131 in window, 227660376 - 227660376, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  c
B D                   Ferret   t
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
B D                       Rat  -
B D                     Mouse  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  -
B D              Nile tilapia  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  -
                 Spotted gar  -
B D                Coelacanth  =
B D                 Zebrafish  -
  D                    Parrot  -
B D                Budgerigar  -
  D               Rock pigeon  -
          Southern platyfish  -
B D                    Medaka  -
  D              Mallard duck  =
B D                   Lamprey  -
B D                 Tetraodon  -
  D  Chinese softshell turtle  -
      Yellowbelly pufferfish  -
B D                      Fugu  -
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D             X. tropicalis  =
  D            Painted turtle  -
B D               Zebra finch  =
B D              Atlantic cod  -
  D       Collared flycatcher  =
B D        American alligator  -
          Tibetan ground jay  =
  D             Scarlet macaw  -
B D                    Lizard  -
  D    White-throated sparrow  =
B D               Stickleback  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
                Prairie vole  -
         Cape elephant shrew  =
B D           Chinese hamster  =
B D                     Panda  -
               Domestic goat  =
B D                     Sheep  =
B D                   Wallaby  -
B D           Tasmanian devil  =
B D                  Platypus  -
  D           Green seaturtle  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
            Black flying-fox  =
B D                   Megabat  -
B D                       Pig  =
          Chinese tree shrew  =
B D                    Rabbit  =
B D                   Opossum  =
              Pacific walrus  -
B D                      Pika  =
              Bactrian camel  =
B D                    Alpaca  =
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                 Armadillo  =
B D                       Cat  -
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
                Weddell seal  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  =
B D                   Dolphin  =
            Cape golden mole  =
B D                  Bushbaby  =

Alignment block 25 of 131 in window, 227660377 - 227660434, 58 bps 
B D                     Human  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D                     Chimp  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D                   Gorilla  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D                 Orangutan  attgtatactctggtttcttttcaaattgtgtacatcttttgcctttcaaatgtaatg
B D                    Gibbon  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D                    Rhesus  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D       Crab-eating macaque  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D                    Baboon  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D              Green monkey  attgtatactctggtttctcttcaaattgtgtacatcttttgccttttaaatgtaatg
B D                  Marmoset  attgtatactctggtttctcttcagattgtgtaaatcttttgccttttaaatgtaatg
B D           Squirrel monkey  attgtatactccgatttctcttcagattgtgtaaatcttttgccttttaaatgtaatg
B D                   Ferret   attttat-------------------ttgtatacatc--ctgct------atgttaca
             Star-nosed mole  ==========================================================
              Golden hamster  ==========================================================
B D                  Hedgehog  ==========================================================
B D                       Rat  ----------------------------------------------------------
B D                     Mouse  ==========================================================
                 Zebra mbuna  ==========================================================
         Pundamilia nyererei  ==========================================================
       Burton's mouthbreeder  ==========================================================
         Princess of Burundi  ----------------------------------------------------------
B D              Nile tilapia  ==========================================================
  D          Peregrine falcon  ==========================================================
  D              Saker falcon  ==========================================================
    Mexican tetra (cavefish)  ----------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------
B D                Coelacanth  ==========================================================
B D                 Zebrafish  ----------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------
          Southern platyfish  ----------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------
  D              Mallard duck  ==========================================================
B D                   Lamprey  ----------------------------------------------------------
B D                 Tetraodon  ----------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------
      Yellowbelly pufferfish  ----------------------------------------------------------
B D                      Fugu  ----------------------------------------------------------
B D                   Chicken  ==========================================================
B D       Medium ground finch  ==========================================================
B D                    Turkey  ==========================================================
B D             X. tropicalis  ==========================================================
  D            Painted turtle  ----------------------------------------------------------
B D               Zebra finch  ==========================================================
B D              Atlantic cod  ----------------------------------------------------------
  D       Collared flycatcher  ==========================================================
B D        American alligator  ----------------------------------------------------------
          Tibetan ground jay  ==========================================================
  D             Scarlet macaw  ----------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------
  D    White-throated sparrow  ==========================================================
B D               Stickleback  ----------------------------------------------------------
B D                Guinea pig  ==========================================================
            Brush-tailed rat  ==========================================================
B D            Naked mole-rat  ==========================================================
                  Chinchilla  ==========================================================
B D                  Squirrel  ----------------------------------------------------------
                Prairie vole  ----------------------------------------------------------
         Cape elephant shrew  ==========================================================
B D           Chinese hamster  ==========================================================
B D                     Panda  ----------------------------------------------------------
               Domestic goat  ==========================================================
B D                     Sheep  ==========================================================
B D                   Wallaby  ----------------------------------------------------------
B D           Tasmanian devil  ==========================================================
B D                  Platypus  ----------------------------------------------------------
  D           Green seaturtle  ==========================================================
B D                       Cow  ==========================================================
            Tibetan antelope  ==========================================================
B D                  Microbat  ----------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------
               Big brown bat  ----------------------------------------------------------
            Black flying-fox  ==========================================================
B D                   Megabat  ----------------------------------------------------------
B D                       Pig  ==========================================================
          Chinese tree shrew  ==========================================================
B D                    Rabbit  ==========================================================
B D                   Opossum  ==========================================================
              Pacific walrus  ----------------------------------------------------------
B D                      Pika  ==========================================================
              Bactrian camel  ==========================================================
B D                    Alpaca  ==========================================================
B D                       Dog  ==========================================================
      Lesser Egyptian jerboa  ==========================================================
B D                    Tenrec  ==========================================================
B D                 Armadillo  ==========================================================
B D                       Cat  ----------------------------------------------------------
                    Aardvark  ==========================================================