Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1468 in window, 67372520 - 67372532, 13 bps 
B D                     Human  tcttcctctttta
B D                     Chimp  tcttcctctttta
B D                   Gorilla  tcttcctctttta
B D                 Orangutan  tcttcctcattta
B D                    Gibbon  tcttcctcattta
B D                    Rhesus  tcttcctcattta
B D       Crab-eating macaque  tcttcctcattta
B D                    Baboon  tcttcctcattta
B D              Green monkey  tcttcctcattta
B D                  Marmoset  tcttcctcattca
B D           Squirrel monkey  tcttcctcattca
B D                  Bushbaby  tctttcaggcgta
           Chinese tree shrew  tcttcctcattta
B D                  Squirrel  acttccttgttta
       Lesser Egyptian jerboa  acttcctgtgcta
                 Prairie vole  tcttcatttgtta
B D           Chinese hamster  tcttcctttgtta
               Golden hamster  tcttcattgctta
B D                     Mouse  ctttcatttctta
B D                       Rat  ccttcatttctta
B D            Naked mole-rat  tcttcctcactta
B D                Guinea pig  tcttcatcactta
                   Chinchilla  tcttcatcagcta
             Brush-tailed rat  tcttcctcactta
B D                    Rabbit  tgttcctcctgta
B D                      Pika  tcttcctcctgca
B D                    Alpaca  acttcctccttta
               Bactrian camel  gcttcctcattta
B D                   Dolphin  tcttccttgttta
                 Killer whale  tcttccttgttta
             Tibetan antelope  atttcctgtctta
B D                       Cow  atttcctgtctta
B D                     Sheep  atttcctgtctta
                Domestic goat  atttcctgtctta
B D                     Horse  tcttcctcactta
B D          White rhinoceros  tcttcctcactca
B D                       Cat  ttttcttcattta
B D                       Dog  tcttcctcattta
B D                   Ferret   tattcctcttgta
B D                     Panda  tcttcctcatgta
               Pacific walrus  tcttcctcatcta
                 Weddell seal  tcttcctcatcta
             Black flying-fox  ttttcctcatgtt
B D                   Megabat  ttttcctcatgtt
                Big brown bat  acttccacgtttt
         David's myotis (bat)  acttccacgtgtt
B D                  Microbat  acttccacgtttt
B D                  Hedgehog  acttcctctgcta
B D                     Shrew  tctacatcctgta
              Star-nosed mole  tcttcctccttta
B D                  Elephant  tcttcctcgctta
          Cape elephant shrew  acttcttccttta
B D                   Manatee  tcttcctcattta
             Cape golden mole  tattcctcattta
B D                    Tenrec  tcttcctccttca
                     Aardvark  tgttccttgttta
B D                 Armadillo  tcttcctctttta
B D                   Opossum  cctattttatttt
B D                   Wallaby  cctactctacttt
B D                  Platypus  cctacagcgattt
  D               Rock pigeon  cctctgtccagct
  D              Saker falcon  cctacgtccattt
  D          Peregrine falcon  cctacgtccattt
B D               Zebra finch  -------------
B D                Budgerigar  cctacatccatct
  D                    Parrot  cctacatccatct
  D             Scarlet macaw  cctacatccatct
  D              Mallard duck  cctacgtccgttt
B D                   Chicken  cctacgtccgact
B D                    Turkey  cctacgtccgctt
B D        American alligator  cctacatccattt
  D           Green seaturtle  cctacatccattt
  D            Painted turtle  cctacatccattt
  D  Chinese softshell turtle  cctacatctatta
  D    Spiny softshell turtle  cctacatctatta
B D                    Lizard  cctacatccagtt
B D             X. tropicalis  cttaccttactta
B D                Coelacanth  cttata-------
B D              Nile tilapia  cctacttgtgcca
          Princess of Burundi  cctacttgtgcca
        Burton's mouthbreeder  cctacttgtgcca
                  Zebra mbuna  cctacttgtgcca
          Pundamilia nyererei  cctacttgtgcca
B D                    Medaka  ctcacctgtgcaa
           Southern platyfish  cttacctgtgcta
B D               Stickleback  ccttcctgcgcca
B D                 Zebrafish  cctacctgatccg
     Mexican tetra (cavefish)  cctacctgcgtca
                  Spotted gar  cctacctgcgcta
B D              Atlantic cod  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D                 Tetraodon  =============
  D       Collared flycatcher  =============
          Tibetan ground jay  =============
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
B D           Tasmanian devil  =============

Inserts between block 1 and 2 in window
B D              Zebra finch 4bp
B D               Coelacanth 7bp

Alignment block 2 of 1468 in window, 67372533 - 67372536, 4 bps 
B D                     Human  tcgc
B D                     Chimp  tcgc
B D                   Gorilla  tcgc
B D                 Orangutan  tcgc
B D                    Gibbon  tcgc
B D                    Rhesus  tcgc
B D       Crab-eating macaque  tcgc
B D                    Baboon  tcgc
B D              Green monkey  tcgc
B D                  Marmoset  tcgc
B D           Squirrel monkey  tcgg
B D                  Bushbaby  ccgc
           Chinese tree shrew  tcgc
B D                  Squirrel  ccgt
       Lesser Egyptian jerboa  ccgc
                 Prairie vole  tcgc
B D           Chinese hamster  tcgc
               Golden hamster  tcgc
B D                     Mouse  tcgc
B D                       Rat  tcgc
B D            Naked mole-rat  ccgc
B D                Guinea pig  ccgc
                   Chinchilla  ccgc
             Brush-tailed rat  ccgc
B D                    Rabbit  ccgc
B D                      Pika  ccgt
B D                    Alpaca  ccgg
               Bactrian camel  ccgg
B D                   Dolphin  tcac
                 Killer whale  tcac
             Tibetan antelope  tcgc
B D                       Cow  tcgc
B D                     Sheep  tcgc
                Domestic goat  tcgc
B D                     Horse  tcgc
B D          White rhinoceros  tcgc
B D                       Cat  tcgc
B D                       Dog  tcgc
B D                   Ferret   tcgc
B D                     Panda  tcgc
               Pacific walrus  tcgc
                 Weddell seal  tcgc
             Black flying-fox  tcgc
B D                   Megabat  tcgc
                Big brown bat  tcgc
         David's myotis (bat)  tcgc
B D                  Microbat  ccgc
B D                  Hedgehog  ccgg
B D                     Shrew  ccgc
              Star-nosed mole  ccgc
B D                  Elephant  ccgg
          Cape elephant shrew  ccgt
B D                   Manatee  ccga
             Cape golden mole  ccga
B D                    Tenrec  ccga
                     Aardvark  ccga
B D                 Armadillo  tcgc
B D                   Opossum  ccgg
B D                   Wallaby  tcgg
B D                  Platypus  caaa
  D               Rock pigeon  -c--
  D              Saker falcon  -c--
  D          Peregrine falcon  -c--
B D                Budgerigar  -c--
  D                    Parrot  -c--
  D             Scarlet macaw  -c--
  D              Mallard duck  -c--
B D                   Chicken  -c--
B D                    Turkey  -c--
B D        American alligator  -c--
  D           Green seaturtle  -c--
  D            Painted turtle  -c--
  D  Chinese softshell turtle  -c--
  D    Spiny softshell turtle  -c--
B D                    Lizard  cc--
B D             X. tropicalis  ccgt
B D                Coelacanth  ---c
B D              Nile tilapia  ctgt
          Princess of Burundi  ctgt
        Burton's mouthbreeder  ctgt
                  Zebra mbuna  ctgt
          Pundamilia nyererei  ctgt
B D                    Medaka  ctgc
           Southern platyfish  ccac
B D               Stickleback  ctgc
B D                 Zebrafish  gctt
     Mexican tetra (cavefish)  acag
                  Spotted gar  ccgg
B D              Atlantic cod  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
  D       Collared flycatcher  ====
          Tibetan ground jay  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====

Inserts between block 2 and 3 in window
  D              Rock pigeon 3bp
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
  D             Mallard duck 3bp
B D                  Chicken 3bp
B D                   Turkey 3bp
B D       American alligator 3bp
  D          Green seaturtle 3bp
  D           Painted turtle 3bp
  D Chinese softshell turtle 3bp
  D   Spiny softshell turtle 3bp
B D                   Lizard 2bp
B D               Coelacanth 3bp

Alignment block 3 of 1468 in window, 67372537 - 67372544, 8 bps 
B D                     Human  c-agcagaa
B D                     Chimp  c-agcagaa
B D                   Gorilla  c-ggcagaa
B D                 Orangutan  c-agcagaa
B D                    Gibbon  c-agcagaa
B D                    Rhesus  c-agcagaa
B D       Crab-eating macaque  c-agcagaa
B D                    Baboon  c-agcagaa
B D              Green monkey  c-agcagaa
B D                  Marmoset  c-agcagaa
B D           Squirrel monkey  c-ggcagaa
B D                  Bushbaby  c-agcagaa
           Chinese tree shrew  c-agaagaa
B D                  Squirrel  c-agcagaa
       Lesser Egyptian jerboa  c-agcagaa
                 Prairie vole  c-agaagaa
B D           Chinese hamster  c-agaagaa
               Golden hamster  c-agaagaa
B D                     Mouse  c-agaagaa
B D                       Rat  c-agaagaa
B D            Naked mole-rat  c-agcagaa
B D                Guinea pig  c-agcagaa
                   Chinchilla  c-agcggaa
             Brush-tailed rat  c-agcagaa
B D                    Rabbit  g-cgcagaa
B D                      Pika  g-cgcagaa
B D                    Alpaca  c-ggcagaa
               Bactrian camel  c-ggcagaa
B D                   Dolphin  c-ggcagaa
                 Killer whale  c-ggcagaa
             Tibetan antelope  c-ggcagaa
B D                       Cow  c-ggcagaa
B D                     Sheep  c-ggcagaa
                Domestic goat  c-ggcagaa
B D                     Horse  c-agcagaa
B D          White rhinoceros  c-agcagaa
B D                       Cat  c-agcagaa
B D                       Dog  c-agcagaa
B D                   Ferret   c-agcagaa
B D                     Panda  c-agcagaa
               Pacific walrus  c-agcagaa
                 Weddell seal  c-agcagaa
             Black flying-fox  c-agcacaa
B D                   Megabat  c-agcacaa
                Big brown bat  c-agcagaa
         David's myotis (bat)  c-agcagaa
B D                  Microbat  c-agcagaa
B D                  Hedgehog  c-agcagaa
B D                     Shrew  c-agcagaa
              Star-nosed mole  c-agcagaa
B D                  Elephant  a-agcagaa
          Cape elephant shrew  a-agaggaa
B D                   Manatee  a-agcagaa
             Cape golden mole  a-agcagaa
B D                    Tenrec  a-agcagaa
                     Aardvark  a-aacagaa
B D                 Armadillo  c-ggcagaa
B D                   Opossum  c-gacagaa
B D                   Wallaby  a-ggcagaa
B D                  Platypus  c-ggaagaa
  D               Rock pigeon  c-agcagca
  D              Saker falcon  c-agcagca
  D          Peregrine falcon  c-agcagca
  D       Collared flycatcher  c-agcagca
B D       Medium ground finch  c-agcagca
B D               Zebra finch  c-agcagca
           Tibetan ground jay  c-agcagca
B D                Budgerigar  c-agcagca
  D                    Parrot  c-agcagca
  D             Scarlet macaw  c-agcagca
  D              Mallard duck  c-agcagca
B D                   Chicken  c-agcagca
B D                    Turkey  c-agcagca
B D        American alligator  c-agcagca
  D           Green seaturtle  c-agcagca
  D            Painted turtle  c-agcagca
  D  Chinese softshell turtle  c-agcagca
  D    Spiny softshell turtle  c-agcagca
B D                    Lizard  c-agcacca
B D             X. tropicalis  c-ggcaaaa
B D                Coelacanth  c-agcggaa
B D              Nile tilapia  c-gccgcaa
          Princess of Burundi  c-gccgcaa
        Burton's mouthbreeder  c-gccgcaa
                  Zebra mbuna  c-gccgcaa
          Pundamilia nyererei  c-gccgcaa
B D                    Medaka  aggtggcaa
           Southern platyfish  c-gccgcaa
B D               Stickleback  c-ggcgcag
B D                 Zebrafish  a-ggtccaa
     Mexican tetra (cavefish)  a-ggcgcaa
                  Spotted gar  c-ggcaaaa
B D              Atlantic cod  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                 Tetraodon  =========
  D    White-throated sparrow  =========
B D           Tasmanian devil  =========

Alignment block 4 of 1468 in window, 67372545 - 67372619, 75 bps 
B D                     Human  gtgggcatcaggtgtgattgccattgcttggctgttatattgccataagactcgactaaagaagatacta
B D                     Chimp  gtgggcatcaggtgtgattgccattgcttggctgttatattgccataagactcgactaaagaagatacta
B D                   Gorilla  gtgggcatcaggtgtgattgccattgcttggctgttatattgccataagattcgactaaagaagatacta
B D                 Orangutan  gtgggcatcaggtgtgattgccattgcctggctgttacattgccataagactcgactaaagaagatacta
B D                    Gibbon  gtgggcatcaggtgtgattgctattgcttggctgtcacattgccataagactcgactaaagaagatacta
B D                    Rhesus  gtgggcatcaggtgtgattgccattgcttggctgttacattgccataagactcgactgaagaagatacta
B D       Crab-eating macaque  gtgggcatcaggtgtgattgccattgcttggctgttacattgccataagactcgactgaagaagatacta
B D                    Baboon  gtgggcatcaggtgtgattgccattgcttggctattacattgccataagactcgactaaagaagatacta
B D              Green monkey  gtgggcatcaggtgtgattgccattgcttggctgttacattgccataagactcgactaaagaagatacta
B D                  Marmoset  gtgggcatcaggtgtgattgccattgcttggctgttacattgccataagactcgactaaagaagatacta
B D           Squirrel monkey  gtgggcatcaggtgtgattgccattgcttggctgttacattgccataagactcgactaaagaagatacta
B D                  Bushbaby  gtgggcgtcaggtgtgatttccatcgcttggcttttatattgccataagattcgagtaaggaagatccta
           Chinese tree shrew  gtgggcatcaggcgtgatctccatagcttggcttttacgttgccacaaggcccggctgaagaggatcctg
B D                  Squirrel  gtgggcgtcgggtgtgatcgcccttgcttggcttttacgttgccataagacccgagtgaagaagatcctg
       Lesser Egyptian jerboa  gtgggcatcgggcgtgattgccctggcgtggctcttacactgccacagggcccgggtgaagaggatcctg
                 Prairie vole  gtgggcctcaggtgtgattgcccttgcgtggcttttacattgccacaagacaagactaaagaagatacta
B D           Chinese hamster  gtgggcctcaggtgtgatcgcccttgcatggcttttatattgccacaggataaggataaagaagatactg
               Golden hamster  gtgggcctcaggtgtgatcgcccttgcgtggcttttatattgccacaagataaggataaagaagatactg
B D                     Mouse  atgggcctcaggtgtgatcgccctggcgtggcttttacattgccacaggacaagactaaagaggatagtg
B D                       Rat  gtgggcctcgggagtgatcgccctggcatggcttctacattgccacaaaacaagactaaagaggatagtg
B D            Naked mole-rat  gtgggcattgggtgtaattgccatcgcttggcttttacactgccacaagactcgactgaagaagaccctg
B D                Guinea pig  gtgggcatcgggcgtgattgccatcgcgtggcttttgcactgccacaaggctcgactgaagcagaccttg
                   Chinchilla  gtgggcgtcgggcgtgattgccattacttggcttttgcattgccataagactcgactgaagaagatcttg
             Brush-tailed rat  gtgggcgtcgggcgtgattgccatcacctggctgttgcattgccacaagaggcggctgaagaaggtcctg
B D                    Rabbit  gtgggcgtcaggtgtcattgccatcgcctggctcttacactgccataagactcggctgaaggccatcctg
B D                      Pika  gtgggcttcgggcgtgatcgccatcgcctggctgctgcactgccacaagacgcggctgaaggccatcctg
B D                    Alpaca  gtgggcttcaggagtgatcgccatcgcctggctcttacactgccacaaggtccgactgaggaagctcctg
               Bactrian camel  gtgggcgtcaggagtgatcgccatcgcctggctcttacactgccacaaggtccgactgaggaagctcctg
B D                   Dolphin  gtgggcatcaggtgtgatcaccgttgcgtggctcttacatcgccataagacccggctgaggaagctcctg
                 Killer whale  gtgggcatcaggtgtgatcaccgttgcatggctcttacatcgccataagacccggctgaggaagctcctg
             Tibetan antelope  gtgggcatcaggtgtcatcgccatcgcttggctcttacattgccataagacccggctcaggaagcttctg
B D                       Cow  gtgggcatcaggtgtcattgccattgcgtggctcttacattgccataagacccggctcaggaagcttcta
B D                     Sheep  gtgggcatcaggtgtcatcgccatcgcgtggatcttacattgccataagacccggctcaggaagcttctg
                Domestic goat  gtgggcatcaggtgtcatcgccatcgcatggctcttacattgccataagacccggctcaggaagcttctg
B D                     Horse  gtgggcgtcaggggtgatcgccattgcctggctcctacactgccataagtcccgagtgaagaagatcctg
B D          White rhinoceros  gtgggcttcaggggtgattgccatcgcatggctcctacattgccataagacccgactgaagaggatcctg
B D                       Cat  gtgggcttcaggtgtgattgccatcgcgtggctcttacattgccataagacccgagtgaagaagatcctg
B D                       Dog  gtgggcatcaggtgtgattgccattgcatggctcttacattgccacaagacccgagtgaagaagatcctg
B D                   Ferret   gtgggcatcaggtgtgatttccattgcgtggctcttacattgccacaagacccgaatgaagaagatcctg
B D                     Panda  gtgggcttcaggtgtgatttccattgcatggctcttacattgccataagacccgagtgaagaagatcctg
               Pacific walrus  gtgggcatcgggtgtgatttccattgcgtggctcttacattgccataagacccgagtgaagaagatcctg
                 Weddell seal  gtgggcatcaggtgtgatttccattgcgtggctcttacattgccataagacccgagtgaagaagatcctg
             Black flying-fox  gtgggcgtcaggtgtgatcaccattgcatggctcttacattgccataaggcccgactgaagaagatcctg
B D                   Megabat  gtgggcgtcaggtgtgatcaccattgcatggctcttacattgccataaggcccgactgaagaagatcctg
                Big brown bat  gtgggcatcaggtgtgatcgccattgcgtggctcttacattgccataagacgcgactcacgaagatcctg
         David's myotis (bat)  gtgggcgtcgggtgtgattgccatcgcgtggctcttgcattgccataagacacgactgatgaagatcctg
B D                  Microbat  gtgggcgtcgggcgtgattgccatcgcgtggctcctgcactgccataagacacgactgaggaagatcctg
B D                  Hedgehog  gtgggcgtcgggcgtgatcgccatcgcctggctgctgcactgccacaagacccgcctgaggagggtcctc
B D                     Shrew  gtgggcatcgggcgtgattgctatcaagtggcttttacattgccacaagtcccgagtcagaaagctgcag
              Star-nosed mole  atgggcgtccggtgtgattgccatttcgtggctcttacattgccataagacgcgagtaaagaagatcctg
B D                  Elephant  gtgggcatcaggtgtgattgccattgcttggcttttacactgccataagactcgactgaggaagatcctg
          Cape elephant shrew  gtgggcatcaggtgtgattgccattgcttggcttttacgttgccacaagactcgactgagaaacatcatg
B D                   Manatee  gtgggcatcaggtgtgattgccattgcttggcttttacattgccataagactcgactgaggaagatcctg
             Cape golden mole  gtgggcatcaggggtgattgccattgcttggcttttgcattgccataagtctcgactgaggaagatcatg
B D                    Tenrec  atgggcatcgggcgtgatcgccattgcctggctcttatactgccacagggtgcggctgaggaagatcctg
                     Aardvark  gtgggcatcaggtgtgattgccattgcttggcttttacattgccataagactcgactgaggaagatcctg
B D                 Armadillo  gtgggcatcaggtgtgattgccattgcttggcttttacattgccataagactcgactgaaaaagatcctg
B D                   Opossum  gtgggctgcaggtgtgattgccatcaactggcttttgcacggtcacagggcccgattgaaaaagatcctg
B D                   Wallaby  gtgggctgcaggcgtgattgccctcaactggcttttggtcggtcacaaggctcgaacgaaaaggatcctg
B D                  Platypus  gtgggcctcgggtgtgatcgccgttacttggctcctgtacactcaaaagatacgattgaagaaggccctg
  D               Rock pigeon  gcgggcagcaggtgtgatcgccatttcttggctcttgcataatcgcatggcacatgtgaaaaaagccctg
  D              Saker falcon  gtgggcatcaggtgtgatcgcggtttcttggctcttgcgtaatcacatggcacgtgtgaaaaagaccctg
  D          Peregrine falcon  gtgggcatcaggtgtgatcgcggtttcttggctcttgcgtaatcacatggcacgtgtgaaaaagaccctg
  D       Collared flycatcher  cagggcagcagctgtgat---------ctgggactcct---------------ggctgagcagcaccctg
B D       Medium ground finch  gtgggcagcaggtgtgatcagctcttcctggcgttcttggagtcacctggcacggctgaggaatgccctg
B D               Zebra finch  gcgggcagcaggtgtgatcagcgctgcctggcgctcctggagtcacctggcacggctgaggagcgccctg
           Tibetan ground jay  gcgggcagcaggtgtgatcagcgcttcctggcgctcctggaatcacctggcacgggtgaggaacgccctg
B D                Budgerigar  gtgggcatcaggtgtgatcagctcttcctggcgctcgtgtaatcacatggcacgtgtgaaaaagagcctg
  D                    Parrot  gtgggcatcaggtgtgatcggctcttcctggcgctcatgtaatcacatggcacgtgtgaaaaagagcctg
  D             Scarlet macaw  gtgggcatcaggtgtgatcggctcttcctggcgctcgtgtaatcacatggcacgtgtgaaaaagagcctg
  D              Mallard duck  gtgggcatcaggtgtgattgccatttcttggctcttgcataatcacatggcacgtgtgaaaaagaccctg
B D                   Chicken  gtgggcatcaggtgtgattgccatttcttggctcctgcgtagtcacatggcacgtgtgaaaaagagcctg
B D                    Turkey  gtgggcatcaggtgtgattgccatttcttggctcctgcacaatcacatggcacgtgtgaaaaagaccctg
B D        American alligator  gcaggcatcaggtgtgattgccatttcttggctcttgcatactcgcatggcacgtgtaaaaaagaccctg
  D           Green seaturtle  gtgggcatcaggtgtgattgccatttcttggctcttgcatagtcacatggcacgtgtaaaaaaggccctg
  D            Painted turtle  gtgggcatcaggtgtgattgccatttcttggctcctgcatagtcacatggcacgtgtaaaaaagaccctg
  D  Chinese softshell turtle  gtgggcatcaggtgtgattgccatttcttggctcctgcataatcacatggcacgtgtaaaaaagaccctg
  D    Spiny softshell turtle  gtgggcatcaggtgtgattgccatttcttggctcctgcataatcacatggcacgtgtaaaaaagaccctg
B D                    Lizard  gtgggccacgggggtgattgccatcccgtggcttatccacatccacatgcgccgcgtcaggaagatcctg
B D             X. tropicalis  gtgggctgctggggtcattgctataacttggctactacatgtgcagaggtcccgtgtaaagaagctcctg
B D                Coelacanth  gtgggcatcaggtgtgatagccatttcttggctcttgcatgttcagaagacacgagtgaaaaaggccctg
B D              Nile tilapia  gtgggcggcgggcaccattgccatctcatggttgatgcacgctcagctgtgccgtgtcaggaaggccctg
          Princess of Burundi  gtgggcggcgggcaccattgccatctcatggttgatgcacgctcagctgtgccgtgtcaggaaggccctg
        Burton's mouthbreeder  gtgggcggcgggcaccattgccatctcatggttgatgcacgctcagctgtgccgtgtcaggaaggccctg
                  Zebra mbuna  gtgggcggcgggcaccattgccatctcatggttgatgcacgctcagctgtgccgtgtcaggaaggccctg
          Pundamilia nyererei  gtgggcggcgggcaccattgccatctcatggttgatgcacgctcagctgtgccgtgtcaggaaggccctg
B D                    Medaka  atgggcagctgggattattgccatgtcatggttattgtacattcagatgcaacgtgtcaggaagggccta
           Southern platyfish  gaaggcagcggaggttatctcgttgtcatggctgttgcactatcaaaggtgccaagtgaagaaagccctt
B D               Stickleback  gtgggcggcagacaccataactgtctcatggctgatgctcactcagaagcgccacgtgaggaaggcccta
B D              Atlantic cod  gtgggccgggggcgtcctggccctcgccctgtggaggcgcctgcagatgcggcgggtcagggagctcctg
B D                 Zebrafish  atgggcggcagaaattattgccatgtctctgctgaaacgtgccaaactgtgccatttgaagaagagtctg
     Mexican tetra (cavefish)  atgggcggctgaaaccatcgctatctcctggctgctgcacgcccaggtgggacgtgtgaggaaaagcctg
                  Spotted gar  gtgggcggccggtgtcatcgcaatctcctggctactgcatgctcagatggcacgcacaagaaaggccctg
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  aagga
                        Chimp  aagga
                      Gorilla  aagga
                    Orangutan  aagga
                       Gibbon  aagga
                       Rhesus  aagga
          Crab-eating macaque  aagga
                       Baboon  aagga
                 Green monkey  aagga
                     Marmoset  aagga
              Squirrel monkey  aagga
                     Bushbaby  cggga
           Chinese tree shrew  aaaga
                     Squirrel  aagga
       Lesser Egyptian jerboa  cagga
                 Prairie vole  aagga
              Chinese hamster  aagga
               Golden hamster  aagga
                        Mouse  aagga
                          Rat  gagga
               Naked mole-rat  aagga
                   Guinea pig  aagga
                   Chinchilla  aagga
             Brush-tailed rat  aagga
                       Rabbit  aagga
                         Pika  aggga
                       Alpaca  aagga
               Bactrian camel  aagga
                      Dolphin  aagga
                 Killer whale  aagga
             Tibetan antelope  aaaga
                          Cow  aagga
                        Sheep  aagga
                Domestic goat  aagga
                        Horse  aagga
             White rhinoceros  aagga
                          Cat  cagga
                          Dog  aagga
                      Ferret   aagga
                        Panda  aagga
               Pacific walrus  aagga
                 Weddell seal  aagga
             Black flying-fox  gagga
                      Megabat  gagga
                Big brown bat  aagga
         David's myotis (bat)  aagga
                     Microbat  aagga
                     Hedgehog  atggc
                        Shrew  aagga
              Star-nosed mole  atgga
                     Elephant  atgga
          Cape elephant shrew  agaga
                      Manatee  aagga
             Cape golden mole  aagga
                       Tenrec  aagga
                     Aardvark  cagga
                    Armadillo  aagga
                      Opossum  aagga
                      Wallaby  aagga
                     Platypus  aagga
                  Rock pigeon  aagga
                 Saker falcon  aagga
             Peregrine falcon  aagga
          Collared flycatcher  gggga
          Medium ground finch  aggga
                  Zebra finch  ggggc
           Tibetan ground jay  aggga
                   Budgerigar  aagga
                       Parrot  aagga
                Scarlet macaw  aagga
                 Mallard duck  aagga
                      Chicken  aagga
                       Turkey  aagga
           American alligator  aagga
              Green seaturtle  aagga
               Painted turtle  aagga
     Chinese softshell turtle  aagga
       Spiny softshell turtle  aagga
                       Lizard  aagga
                X. tropicalis  cagga
                   Coelacanth  aagga
                 Nile tilapia  caggc
          Princess of Burundi  caggc
        Burton's mouthbreeder  caggc
                  Zebra mbuna  caggc
          Pundamilia nyererei  caggc
                       Medaka  caggc
           Southern platyfish  cagga
                  Stickleback  caggc
                 Atlantic cod  caggc
                    Zebrafish  caggc
     Mexican tetra (cavefish)  caggc
                  Spotted gar  caggc
       Yellowbelly pufferfish  =====
                         Fugu  =====
                    Tetraodon  =====
       White-throated sparrow  =====
              Tasmanian devil  =====

Alignment block 5 of 1468 in window, 67372620 - 67372665, 46 bps 
B D                     Human  atcacgtcagagacacctggagaattttcgcattcgagccaaggtg
B D                     Chimp  atcacgtcagagacacctggagaattttcgcattcgagccaaggtg
B D                   Gorilla  atcacgtcagagacacctggagaattttcgcattcgagccaaggtg
B D                 Orangutan  atcacgtcagagacacctggagaatttccgcattcgagccaaggtg
B D                    Gibbon  atcacgtcagagacacctggagaatttccgcattcgagccaaggtg
B D                    Rhesus  atcacgtcagagacacctggagaatttccgcattcgagccaaggtg
B D       Crab-eating macaque  atcacgtcagagacacctggagaatttccgcattcgagccaaggtg
B D                    Baboon  atcacgtcagagacacctggagaatttccgcattcgagccaaggtg
B D              Green monkey  atcacgtcagagacacctggagaatttccgcattcgagccaaggtg
B D                  Marmoset  atcacgtcagagacacctggagaatttccgcattcgagccaaggtt
B D           Squirrel monkey  atcacgtcagagacacctggagaatttccgcattcgagccaaggtt
B D                  Bushbaby  atcacggcagagacacctggagaatttccgcattcgagccaaggtg
           Chinese tree shrew  atcccgtcagagacacctggagaatttccgccttcgagccaaggtg
B D                  Squirrel  atcgcggcagagacacctggagaatttccgaatgcgagccaaggtg
       Lesser Egyptian jerboa  agccaggcagagacacctgcaaaatttccgcatccgagccaaggtg
                 Prairie vole  atctcgtcagagacacctggagaatttccgcattcgagccaaggtg
B D           Chinese hamster  atctcgtcagagacacctggagaatttccgcattcgagccaaggtg
               Golden hamster  atctcgtcagagacacctggagaatttccgcattcgagccaaggtg
B D                     Mouse  atcccgacagagacacctggagaacttccgcattcgagcccaggta
B D                       Rat  atctcgacagagacacctggataacttccgaattcgagccaaggta
B D            Naked mole-rat  atcacgtcagagacacctggagaatttccgcatccgagccaaggtg
B D                Guinea pig  atcgcgtcagagacacctggagaatttccgcatccgagccaaggtg
                   Chinchilla  atcgcgtcagagacacctggaaaatttccgcatccgagccaaggtg
             Brush-tailed rat  atcgcggcagagacacctggagaatttccgcatccgagccaaggtg
B D                    Rabbit  gtcgcggcagagacacctggagaacttccgcatccgagccaaggtg
B D                      Pika  gtcccgacagaggcacctggagaatttccgcatccgagccaagg--
B D                    Alpaca  gtcacgtgaaagacacctggagaatttccgcattcgagccaaggta
               Bactrian camel  gtcacgtgaaagacacctggagaatttccgcattcgagccaaggta
B D                   Dolphin  atcacgtgaaagacacctggagaatttccgcgttcgagccaaggta
                 Killer whale  atcacgtgaaagacacctggagaatttccgcgttcgagccaaggta
             Tibetan antelope  atcacgtgaaagacacctggagaatttccgcatccgagccaaggta
B D                       Cow  atcacgtgagagacacctggagaatttccgcatccgagccaaggta
B D                     Sheep  atcacgtgaaagacacctggagaatttccgcatccgagccaaggta
                Domestic goat  atcacgtgaaagacacctggagaatttccgcatccgagccaaggta
B D                     Horse  gtctcgggaaagacacctggagaatttccgcatccgagccaaggta
B D          White rhinoceros  atcacgtgacagacacctggagaatttccgcatccgagccaaggta
B D                       Cat  atcacgtgaaagacacctggagaatttccgtattcgagccaaggta
B D                       Dog  atcacgtgagagacacctggagaatttccgtattcgagccaaggta
B D                   Ferret   atcacgtgagagacacctggagaatttccgtattcgagccaaggta
B D                     Panda  atcacgcgagagacacctggagaatttccgtattcgagccaaggta
               Pacific walrus  atcacgtgagagacacctggagaatttccgtatccgagccaaggta
                 Weddell seal  atcacgtgagagacacctggagaatttccgtatccgagccaaggta
             Black flying-fox  atcacgtgaaagacacctgcagaatttccgcatccgagccaaggta
B D                   Megabat  atcacgtgaaagacacctgcagaatttccgcatccgagccaaggta
                Big brown bat  gtcacgtgaaagacacctgcagaatttccgcattcgagccaaggta
         David's myotis (bat)  gtcacgtgagagacacctgcagaatttccgcattcgagccaaggta
B D                  Microbat  gtcacgtgagaggcacctgcagaatttccgcattcgagccaaggta
B D                  Hedgehog  ctcccggcagagacacctgcagaacttccgcatccgagccaaggta
B D                     Shrew  gaaccagcaaagacatctgagtaatttccacattcgtgccaaggta
              Star-nosed mole  aacacgtcagagacacctggagaatttccacattcgagccaaggta
B D                  Elephant  atcacgtcaaagacacctggagaatttccgcattcgagccaaggtg
          Cape elephant shrew  atcccatcaaagacacctggagaatttccacattcgagccaag--g
B D                   Manatee  atcacgtcaaagacacctggagaatttccacattcgagccaaggtg
             Cape golden mole  atcacgtcaaagacacctggagaatttccgcatccgagccaaggtg
B D                    Tenrec  gtcgcgactcagacacctggagaatttccgcgttcgagccaaggtg
                     Aardvark  atcacgtcaaagacacctgcagaatttccatgtgagagccaaggtg
B D                 Armadillo  gtcacgtcaaagacacctggagaatttccgcattcgagccaaggta
B D                   Opossum  gaaacgtttaaaacaactggagaatttccacattcgagccaaggtg
B D                   Wallaby  aagatgtgcaaaacacctggagaatttccgccttcgagcccaggtg
B D                  Platypus  atcacgtcaaagacacctggagaattttcacgctcgagccaaggtg
  D               Rock pigeon  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
  D              Saker falcon  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
  D          Peregrine falcon  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
  D       Collared flycatcher  ggctcagcacagacacctgcagaatttctacagcagggccaaggtg
  D    White-throated sparrow  agcacggcgcagacacctggagagtttctgcagcagggccaaggtg
B D       Medium ground finch  agcacgccacagacacctggagaatttctgcagcagggccaaggtg
B D               Zebra finch  agcacgccgcagccacctggagaatttccacagcagggccgaggtg
           Tibetan ground jay  agcacgccacagacacctggagaatttctacagcagggccaaggtg
B D                Budgerigar  atcacgtcagagacacctggagagctttcacatcagggccaaggtg
  D                    Parrot  atcgcgtcagagacacctggagagctttcacatcagggccaaggtg
  D             Scarlet macaw  atcacgtcagagacacctggagagctttcacatcagggccaaggtg
  D              Mallard duck  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
B D                   Chicken  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
B D                    Turkey  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
B D        American alligator  atcacgtcggagacacctggagaatttttacatcagggccaaggtg
  D           Green seaturtle  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
  D            Painted turtle  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
  D  Chinese softshell turtle  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
  D    Spiny softshell turtle  atcacgtcagagacacctggagaatttttacatcagggccaaggtg
B D                    Lizard  agcgcggcagaggcacctggagaacttccacctccgggccaaggtg
B D             X. tropicalis  atccagggcacagcagctacagaacttccattcaagagctaaggtg
B D                Coelacanth  atctcgtaagagacacctggagaattttcgcagtagggccaaggtg
B D              Nile tilapia  tcggcgttttagtcagctggaaaacagtcgcagcagagcacaggtg
          Princess of Burundi  tcggcgttttagtcagctggaaaacagtcgcagcagagcacaggtg
        Burton's mouthbreeder  tcggcgttttagtcagctggaaaacagccgcagccgagcacaggtg
                  Zebra mbuna  tcggcgttttagtcagctggaaaacagccgcagccgagcacaggtg
          Pundamilia nyererei  tcggcgttttagtcagctggaaaacagccgcagccgagcacaggtg
B D                    Medaka  caactgttttcgctagctggagaataattgcagcacagcccaggtg
           Southern platyfish  gaagcgtttcagacagctggaaaattatcgcaacagagcagaggtg
B D               Stickleback  ccgtcgttccagacaactggagaatttccacggcagagccaaggtg
B D              Atlantic cod  ccggcgccgcagacagctggagaaccaccggcagagagcccaggta
B D                 Zebrafish  ctcacgtcttcggcagctggaaaacttccacagcagggcagaggtg
     Mexican tetra (cavefish)  gactcgccttcgccaactggagaattaccgcagcagggccgaggtg
                  Spotted gar  atctcggcagagacacctggagaatttccgcagcagggctgaggtg
      Yellowbelly pufferfish  ==============================================
B D                      Fugu  ==============================================
B D                 Tetraodon  ==============================================
B D           Tasmanian devil  ==============================================

Inserts between block 5 and 6 in window
B D            X. tropicalis 1702bp
B D             Nile tilapia 3bp
         Princess of Burundi 1511bp
       Burton's mouthbreeder 1507bp
                 Zebra mbuna 1499bp
         Pundamilia nyererei 1427bp
B D                   Medaka 996bp
          Southern platyfish 676bp
B D              Stickleback 854bp
B D             Atlantic cod 800bp
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 1248bp

Alignment block 6 of 1468 in window, 67372666 - 67372666, 1 bps 
B D                     Human  -c
B D                     Chimp  -c
B D                   Gorilla  -c
B D                 Orangutan  -c
B D                    Gibbon  -c
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                  Bushbaby  -c
           Chinese tree shrew  -c
B D                  Squirrel  -c
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -c
               Golden hamster  -c
B D                     Mouse  -t
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                    Rabbit  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -c
B D                       Cow  -c
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -c
B D                       Dog  -c
B D                   Ferret   -c
B D                     Panda  -c
               Pacific walrus  -c
                 Weddell seal  -c
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -c
         David's myotis (bat)  -c
B D                  Microbat  -c
B D                  Hedgehog  -c
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  -t
          Cape elephant shrew  -t
B D                   Manatee  -c
             Cape golden mole  -c
B D                    Tenrec  -c
                     Aardvark  -c
B D                 Armadillo  -t
B D                   Opossum  -c
B D                   Wallaby  -c
B D                  Platypus  -t
  D               Rock pigeon  -t
  D              Saker falcon  -t
  D          Peregrine falcon  -t
  D       Collared flycatcher  -t
  D    White-throated sparrow  -a
B D       Medium ground finch  -t
B D               Zebra finch  -t
           Tibetan ground jay  -t
B D                Budgerigar  -t
  D                    Parrot  -t
  D             Scarlet macaw  -t
  D              Mallard duck  -t
B D                   Chicken  -t
B D                    Turkey  -t
B D        American alligator  -t
  D           Green seaturtle  -t
  D            Painted turtle  -t
  D  Chinese softshell turtle  -t
  D    Spiny softshell turtle  -t
B D                    Lizard  -c
B D                Coelacanth  -t
                  Spotted gar  a-
B D                      Pika  --
B D              Atlantic cod  ==
          Southern platyfish  ==
                 Zebra mbuna  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D             X. tropicalis  ==
B D                 Zebrafish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
B D           Tasmanian devil  ==

Alignment block 7 of 1468 in window, 67372667 - 67372667, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  g
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  c
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  g
B D                    Alpaca  g
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  a
B D                   Wallaby  a
B D                  Platypus  g
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  g
B D                    Lizard  g
B D                Coelacanth  g
B D                 Zebrafish  a
                  Spotted gar  g
B D                      Pika  -
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D             X. tropicalis  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D                 Tetraodon  =
B D               Stickleback  =
B D           Tasmanian devil  =

Inserts between block 7 and 8 in window
B D                Zebrafish 2072bp

Alignment block 8 of 1468 in window, 67372668 - 67372703, 36 bps 
B D                     Human  c---aaggctgccagctgttaaggcag----acctctttttct
B D                     Chimp  c---aaggctgccagctgttaaggcag----acctctttttct
B D                   Gorilla  c---aaggctgccagctgttaaggcag----acctctttttct
B D                 Orangutan  c---aaggctgccagctgttaaggcag----acctctttttct
B D                    Gibbon  c---aaggctgccagctgttaaggcag----acctctttttct
B D                    Rhesus  c---aaggctgccagctgttaaggcag----acctctttttct
B D       Crab-eating macaque  c---aaggctgccagctgttaaggcag----acctctttttct
B D                    Baboon  c---aaggctgccagctgttatggcag----acctctttttct
B D              Green monkey  c---aaggctgccagctgttaaggcag----acctcttttact
B D                  Marmoset  c---atggctgccagctgttaaggcag----acctctttttct
B D           Squirrel monkey  c---aaggctgccagctgttaaggcag----aactcttcttct
B D                  Bushbaby  c---aaggctgccagctgttaaggcag----acctccttttct
           Chinese tree shrew  c---gcgactgccacctgctacggcag----gcctctttttct
B D                  Squirrel  c---gaggctgccagctgctcaggcag----acctctttttct
       Lesser Egyptian jerboa  cagtcctgctgccagcagcc-aggcag----acctcggtctct
                 Prairie vole  c---caggctgccagctgttaaagcag----acctctttttct
B D           Chinese hamster  c---taggctgccagctgttaaagaag----acctctttttct
               Golden hamster  c---caggctgccagctgctaaagcag----acctctctttct
B D                     Mouse  c---caggctgccagctgttaaggcaa----gcctctttttct
B D                       Rat  ----caggctgccagccgttaaggcaagcctgcctctctttct
B D            Naked mole-rat  c---aaggctcccagctgttaagacag----acctctttttct
B D                Guinea pig  g---a-gtctgccagctgttgagacag----acctctttttct
                   Chinchilla  c---acggccaccagctgttgagacag----acttctttttct
             Brush-tailed rat  c---g-ggctgccagcggggacgccag----gcccctctttcg
B D                    Rabbit  c---ggggctgccagctgtcgcgtcag----ccctcttcttct
B D                      Pika  ---------tgccagctgtcgaggcag----ccctgctttgct
B D                    Alpaca  c---aaggctgccagctgttagggcag----gcctctttttct
               Bactrian camel  c---aaggctgccagctgttagggcag----acctctttttct
B D                   Dolphin  c---aaggctgccagctgttaaggcag----acctctttttct
                 Killer whale  c---aaggctgccagctgttaaggcag----acctctttttct
             Tibetan antelope  c---aaggctgccagctgttaaggcag----acctctttttct
B D                       Cow  c---aaggctgccagctgttaaggcag----acctctttttct
B D                     Sheep  c---aaggctgccagctgttaaggcag----acctctttttct
                Domestic goat  c---aaggctgccagctgttaaggcag----acctctttttct
B D                     Horse  c---aaggctgccagctgttaaggcag----acctctttttct
B D          White rhinoceros  c----aggctgccagctgttaaggcag----acctctttttct
B D                       Cat  c---aaggctgccagctgttaaggcag----acctctttttct
B D                       Dog  c---aaggctgccagctgttaaggcag----acctctttttct
B D                   Ferret   c---aaggctgccagctgttaaggcag----acctctttttct
B D                     Panda  c---aaggctgccagctgttaaggcag----acctctttttct
               Pacific walrus  c---aaggctgccagctgttaaggcag----acctctttttct
                 Weddell seal  c---aaggctaccagctgttaaggcag----acctctttttct
             Black flying-fox  c---aacgctgccagctgttaaagcag----acctctttttct
B D                   Megabat  c---aacgctgccagctgttaaagcag----acctctttttct
                Big brown bat  c---aaggctgccagctgctaaggcag----a-ctctttttct
         David's myotis (bat)  c---aaggccgccagctgttaaggcag----a-ctctttttct
B D                  Microbat  c---aaggctgccagctgttagggcag----a-ctctttttct
B D                  Hedgehog  c-----ggccgccagccgct-gggcag----accc---tccct
B D                     Shrew  c---agggctgccggctgttccagcag----gcccccttttct
              Star-nosed mole  c---aaggctgccagctgttaaggcag----acctctttttct
B D                  Elephant  c---aaggctggcagctgttaagacag----acctctttttct
          Cape elephant shrew  c---atgactgccagctgtgaatgcag----acctctccttct
B D                   Manatee  c---aaggctgccagctgttaaggcag----acctctttttct
             Cape golden mole  c---aaggctgccagctgttaaggcag----acctctttttcc
B D                    Tenrec  g---gcggctgccagctgctcgggcaa----ccctctctctc-
                     Aardvark  t---gaggcgagcagctgttaaggcag----acctctttttct
B D                 Armadillo  c---aaggttgccagctgttaaggcaa----acctctttttgt
B D                   Opossum  c---gaggctgccagctgttatggcag----acttccttttct
B D                   Wallaby  c---aaggctgccagctgttatggcag----acttccttttct
B D                  Platypus  c---ggggctgccagctgttaaggcag----acctccttctct
  D               Rock pigeon  c---agtgctaccagctgttacggcag----cacttcttttct
  D              Saker falcon  c---agtgctaccagctgttacggcag----cacttcttttct
  D          Peregrine falcon  c---agtgctaccagctgttacggcag----cacttcttttct
  D       Collared flycatcher  t---gctgctggcagctgct------------gctgcttctcc
  D    White-throated sparrow  t---gctgctggcagccggtgctgcag----cgctgcctctgc
B D       Medium ground finch  t---gctgctagcagctggtactgcag----cgctgcttctcc
B D               Zebra finch  t---gctgctggcagctgctgctgcgg----cgctgcttctcc
           Tibetan ground jay  t---ggtgctaccagctgttactgcag----cgctgcttttct
B D                Budgerigar  c---agtgctaccagctgttacggcag----cgctgcttctct
  D                    Parrot  c---agtgctaccagctgttacagcag----cgctgcttctct
  D             Scarlet macaw  c---agtgctaccagctgttacagcag----cgctgcttctct
  D              Mallard duck  c---agtgctaccagctgttacggcag----catttcttttct
B D                   Chicken  c---ggtgctaccagctgttacggcag----ctctgcttttct
B D                    Turkey  c---agtgctaccagctgttacggcag----ctcttcttttct
B D        American alligator  c---ggtgctgccagctgttacggcag----cacttcttttct
  D           Green seaturtle  c---agtgctgccagctgctacggcag----cacttctgtcct
  D            Painted turtle  c---agtgctgccagctgctactgcag----cacttcctttct
  D  Chinese softshell turtle  c---tgtgctgccagctgctacagcag----cacttcttttct
  D    Spiny softshell turtle  c---tgtgctgccagctgctacagcag----cacttcttttct
B D                    Lizard  c---cacggggcctgcggttctggcag----cgctcctcccct
B D                Coelacanth  t---ggtgctgccagctgttaaaacag----cacttctttcc-
B D              Nile tilapia  c---tactttctc-gcttc-----cat----ctctcttttacc
                  Spotted gar  c---tgagccggcagctgt-----cat----ctctctttctcc
B D              Atlantic cod  ===========================================
          Southern platyfish  ===========================================
                 Zebra mbuna  ===========================================
         Pundamilia nyererei  ===========================================
       Burton's mouthbreeder  ===========================================
         Princess of Burundi  ===========================================
B D             X. tropicalis  ===========================================
B D                 Zebrafish  ===========================================
      Yellowbelly pufferfish  ===========================================
B D                      Fugu  ===========================================
B D                    Medaka  ===========================================
    Mexican tetra (cavefish)  ===========================================
B D                 Tetraodon  ===========================================
B D               Stickleback  ===========================================
B D           Tasmanian devil  ===========================================

Inserts between block 8 and 9 in window
B D                   Lizard 1695bp

Alignment block 9 of 1468 in window, 67372704 - 67372767, 64 bps 
B D                     Human  aaacatt-tcgtgcttgagcggttgtaataa-gttgtctc---t--atcttccct---------------
B D                     Chimp  aaacatt-tcgtgcttgagcggttgtaataa-gttgtctc---tttatcttccct---------------
B D                   Gorilla  aaacatt-tcgtgcttgagcggttgtaataa-gttgtctc---tttatcatccct---------------
B D                 Orangutan  aaacatt-tcgtgcttgagcggttgcaataa-gttgtctc---tttatcttccct---------------
B D                    Gibbon  aaacatt-tcgtgcttgagcggttgcaataa-gttgtctc---tttatcttccct---------------
B D                    Rhesus  aaacatt-tcgtgcttgagcggttgcaataa-gttgtctc---tttatcttccct---------------
B D       Crab-eating macaque  aaacatt-tcgtgcttgagcggttgcaataa-gttgtctc---tttatcttccct---------------
B D                    Baboon  aaacatt-tcatgcttgagcggttgcaataa-gttgtctc---tttatcttccct---------------
B D              Green monkey  aaacatt-tcgtgcttgagcggttgcaataa-gttgtctc---tttatcttccct---------------
B D                  Marmoset  aaacatt-tcgtgcttgagtgattgcaataa-gttgtctc---tttatcttccct---------------
B D           Squirrel monkey  aaacatt-tcatgcttgagtgattgcaataa-gttgtctc---tttatcttccct---------------
B D                  Bushbaby  aaacatt-tcttgcttgagcgatcgccataa-gttgtctc---ttcatcttcccc---------------
           Chinese tree shrew  gaaggtg-tcttgctcgagcggttacgatac-gctgtctc---tttatcctcccg---------------
B D                  Squirrel  aaacagt-tcctgcttgaacgactgcaataa-gttgtctc---tttctctttcct---------------
       Lesser Egyptian jerboa  --gcacg-cgctgcttggacgaccctgataa-tctgcctc---gttctctttcct---------------
                 Prairie vole  aaacatt-tcctgcttgaacaactgcagtaa-cttgtctc---tttatctcccc----------------
B D           Chinese hamster  aaacatt-tcttgcttgaacaactgcaataa-cttgtctct--tttatcttccc----------------
               Golden hamster  aaacatt-tcttgcttcaacaattgcaacac-cttgtctc---tttatcttccc----------------
B D                     Mouse  aaatatt-tcctgcttgaacaagtgcagtaa-cttgtctc---tttatctttcc----------------
B D                       Rat  caatagt-tccttgatgaacaagtgcagtaa-cctgtctc---tttacctttcc----------------
B D            Naked mole-rat  aaacatt-tcttgcttgaacgactgcaataa-gttgtctc---tttatct--------------------
B D                Guinea pig  aaacatt-tcttgcttgaataactgc-ataa-gttgtctc---tttatct--------------------
                   Chinchilla  aaacagt-tcttgcttgaacgactacaataa-gttgtttc---tttatct--------------------
             Brush-tailed rat  aaacact-tcttgcttgaacgactgcaatac-gtggtttc---tttatct--------------------
B D                    Rabbit  aaacatt-tcctgcttgagcgactgccatac-gttgtctc----ttatcttctctctctctccctctccc
B D                      Pika  aaacatt-tcttgcttgagcgagcgccatat-tttgtctc---tttatcttctctctctcacc--aacca
B D                    Alpaca  aaacatt-tcctgcttgagcgattgcaataa-gttgtctc---tctatctcccct---------------
               Bactrian camel  aaacatt-tcctgcttgagcgattgcagtaa-gttgtctc---tttatctcccct---------------
B D                   Dolphin  aaacatt-tcttgcttgaacgattgcagtaa-gttgtctc---tttttctttcct---------------
                 Killer whale  aaacatt-tcttgcttgaacgattgcagtaa-gttgtctc---tttttctttcct---------------
             Tibetan antelope  aaacatt-tctcgcttgaacgattgcagtaa-gttgtctc---tttatcctcctt---------------
B D                       Cow  aaacatt-tctcgcttgaacgattgcagtaa-gttgtctc---tttatcttcctt---------------
B D                     Sheep  aaacatt-tctcgcttgaacgattgcagtaa-gttgtctc---tttatctccctt---------------
                Domestic goat  aaacatt-tctcacttgaacgattgcagtaa-gttgtctc---tttatctccctt---------------
B D                     Horse  aaacatt-tcctgcttgagcgatcgcaataa-gttgtctc---tttatcttccct---------------
B D          White rhinoceros  aaacatt-tcttgcttgagcgattgcaataa-gttgtccc---tttatcttccct---------------
B D                       Cat  aaacatt-tcttgcttgagcgattgcagtaa-gttgtctc---ttcatcttccct---------------
B D                       Dog  aaacatt-tcttgcttgagcgattgcagtaa-gttgtctc---tttatcttccct---------------
B D                   Ferret   aaacatt-tcttgcttgagcgaatgcaataa-gttgtctc---tttatcttccct---------------
B D                     Panda  aaacatt-tcttgcttcagcgattacagtaa-gttgtctc---tttatcttccct---------------
               Pacific walrus  agacatt-tcttgcttgagcgattgcaataa-gttgtctc---tttatcttccct---------------
                 Weddell seal  agacatt-tcttgcttgagtgattgcaataa-gttgtctc---tttatcttccct---------------
             Black flying-fox  aaacatt-tcttgcttgaacgattgcaataa-gttgtctc---tctatcttccct---------------
B D                   Megabat  aaacatt-tcttgcttgaacgattgcaataa-gttgtctc---tctatcttcccc---------------
                Big brown bat  aaacatt-tcttgcttgaatgattgcaataa-gttgtctc---tttatttttcct---------------
         David's myotis (bat)  aaacatt-tcttgcttgaacgattgccataa-gttgtctc---tttatctgtcct---------------
B D                  Microbat  aaacatt-tcttgcttgaacgattgccataa-gttgtctc---tttatctgtcct---------------
B D                  Hedgehog  gagcacc-ctccgctaggtagctggcagg-------gctg---tctgtctcccc----------------
B D                     Shrew  aaacatg-acttgttccagcgatcttgagac-cctggctc---ttttgctccccg---------------
              Star-nosed mole  aaacatt-ctttgcttgagcaattgcagtac-attcccta---ttttccttctc----------------
B D                  Elephant  aaacatt-tcttgcttgagtgattgcaataa-gttggctc---tttatcttccct---------------
          Cape elephant shrew  aagcatt-ccttgcttgagcagttaaaataa-gctggctt---cttatgtcccct---------------
B D                   Manatee  aaacatt-tcttgcttgagcggttgcaataa-gttggctc---tttatcttccct---------------
             Cape golden mole  aaacatt-tcttgcttgagcgattacaataa-gttggctc---tttatcttccct---------------
B D                    Tenrec  -agcatt-ccttgctccagcgattgcaataa-gctgggtc---tttatct--------------------
                     Aardvark  aaacatt-ccttgcttgagcgattgcaataa-gttggctc---tttatcttccct---------------
B D                 Armadillo  aaacaat-ttttgcttgagcaattgcaataa-gttgtctc---tttatcttccct---------------
B D                   Opossum  aaacatc-tcttgcttgagcgattgcaataagtgtgtctg---tttctcttccct---------------
B D                   Wallaby  aaacatc-tcttgcttaagcgattgcaataa--------g---tttctcttcctt---------------
B D                  Platypus  aaacacc-tcttgcttgagcgactgccataa-actgtctc---tttcctttcccc---------------
  D               Rock pigeon  aaacatc-tcttgcttcagtgattgcaataa-gctgtttccattttttttcccct---------------
  D              Saker falcon  aaacatc-tcttgcttcagtgattgcaataa-gctgtttcca-ttttttccccct---------------
  D          Peregrine falcon  aaacatc-tcttgcttcagtgattgcaataa-gctgtttcca-ttttttccccct---------------
  D       Collared flycatcher  aaacatc-tc-tgcttcactgcctgcaagaa-gctgttgcca-tttcccccccct---------------
  D    White-throated sparrow  aaacatc------------------------------------cctgctccccct---------------
B D       Medium ground finch  aaacatc-tc-----------------------ctgctcccatccttctccccct---------------
B D               Zebra finch  aaacatt-cc-tgcttcagcgctcccgagga-gctgctcccattcttctccccct---------------
           Tibetan ground jay  aaacatc-tcctgcttcagtgcttgcgagaa-gctgttcccatttttttccccct---------------
B D                Budgerigar  aaacatc-tcttgcttcagtgactgcaataa-gttgttccca-tttttcccccct---------------
  D                    Parrot  aaacatc-tcttgcttcagtgattgcaataa-gctgttcccatttttttccccct---------------
  D             Scarlet macaw  aaacatc-tcttgcttcagtgattgcaataa-gctgttcccatttttttccccct---------------
  D              Mallard duck  aaacatc-tcttgcttcagtgattgcaataa-gctgtttcca-tttttttcccct---------------
B D                   Chicken  aaacatc-ccttgcttcagtgatcgcaataa-gctgtttcca---tttttcccct---------------
B D                    Turkey  aaacatc-tcttgcttcagtgatcgcaataa-gctgtttcca-tttttttcccct---------------
B D        American alligator  aaacatc-tcttgcttgactgattgcaataa-gctgtttcca--tttttttccct---------------
  D           Green seaturtle  aaacatc-tcttgcttgagtaatcgcaataa-gctgtttcca--tttttttccct---------------
  D            Painted turtle  aaacatc-tcttgcttgagtaatcgcaataa-gctgtttcca--tttttttccct---------------
  D  Chinese softshell turtle  aaacatc-tcttgcttgagtaatcacaataa-gctgtttcca--tttttttccct---------------
  D    Spiny softshell turtle  aaacatc-tcttgcttgagtaatcacaataa-gctgtttcct--tttttttccct---------------
B D                Coelacanth  aaacatc-acctgcttgagtgcttctataaa-gctgtttc---caattcccccca---------------
B D              Nile tilapia  taataatgctctggt---------------a-cctgtttt---tttgacttttct---------------
                  Spotted gar  -----at-ctctg---------------------tgtctc---tct---ttttcc---------------
B D                    Lizard  ======================================================================
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
B D                 Zebrafish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  --ttc--tctttccaactac
                        Chimp  --ttc--tctttccaactac
                      Gorilla  --ttc--tctttccaactac
                    Orangutan  --ttc--tctttacaactac
                       Gibbon  --ttc--tttttccaactac
                       Rhesus  --ttc--tgtttccaactac
          Crab-eating macaque  --ttc--tgtttccaactac
                       Baboon  --ttc--tgtttccaactac
                 Green monkey  --ttc--tgtttccaactac
                     Marmoset  --ttc--tctctccaactac
              Squirrel monkey  --ttc--tctctccaactac
                     Bushbaby  --ttc--tctctctgactac
           Chinese tree shrew  --ttc--tctctctgactac
                     Squirrel  --ttc--cttctccaactcc
       Lesser Egyptian jerboa  --ttc--cctctcc------
                 Prairie vole  --ttc--cctctccagtcac
              Chinese hamster  --ttc--cctctccagccac
               Golden hamster  --ttc--cttctccagccac
                        Mouse  --ttc--cctctccagcctc
                          Rat  --ttc--tctctctggcc-a
               Naked mole-rat  --ttc--cctctccacccac
                   Guinea pig  --ttc--cctctccgcctcc
                   Chinchilla  --ttc--cctttcccacttc
             Brush-tailed rat  --ttc--cctctccaaccac
                       Rabbit  ccctc--cctcccccgccgc
                         Pika  ccctc--cttctccacctat
                       Alpaca  --ttc--tctccccagctcc
               Bactrian camel  --ttc--tctccccagctcc
                      Dolphin  --ctc--tctctccaactcc
                 Killer whale  --ctc--tctctccaactcc
             Tibetan antelope  --ctc--tctctccaactcc
                          Cow  --ctc--tctctccaactcc
                        Sheep  --ttc--tctctccaactcc
                Domestic goat  --ctc--tctctccaactcc
                        Horse  --tcc--tctctccagctac
             White rhinoceros  --tcc--tctctctggctac
                          Cat  --ttc--tctctccaactac
                          Dog  --ttc--tctctcca-ctac
                      Ferret   --ttc--tctctccagctac
                        Panda  --t------tcaccaactac
               Pacific walrus  --ttc--tctctccaactac
                 Weddell seal  --ttc--tctctccaactac
             Black flying-fox  --tcc--tctctccaacagc
                      Megabat  --tcc--tctctccaacagc
                Big brown bat  --ttc--tctctccaactac
         David's myotis (bat)  --ttc--tctctccaacgac
                     Microbat  --ttc--tctctccaacgac
                     Hedgehog  -----------accgcaccc
                        Shrew  --ttt--tctttccagcttc
              Star-nosed mole  -------tctctctaatcac
                     Elephant  --ttc--tccctccagctcc
          Cape elephant shrew  --ttc--tctctccgac---
                      Manatee  --tt------ctccagctac
             Cape golden mole  --ttc--tctctccaactac
                       Tenrec  -----------tccaactac
                     Aardvark  --ttc--tctctccaaccag
                    Armadillo  --tcc--tctctccaactac
                      Opossum  --ctg--tctttc-------
                      Wallaby  --tca--ccttcc-------
                     Platypus  --gcc--tc-----------
                  Rock pigeon  --tt----------------
                 Saker falcon  --tt----------------
             Peregrine falcon  --tt----------------
          Collared flycatcher  --------------------
       White-throated sparrow  --gt----------------
          Medium ground finch  --tt----------------
                  Zebra finch  --tt----------------
           Tibetan ground jay  --tt----------------
                   Budgerigar  --tt----------------
                       Parrot  --tt----------------
                Scarlet macaw  --tt----------------
                 Mallard duck  --tt----------------
                      Chicken  --tt----------------
                       Turkey  --tt----------------
           American alligator  --tt----------------
              Green seaturtle  --tt----------------
               Painted turtle  --tt----------------
     Chinese softshell turtle  --tt----------------
       Spiny softshell turtle  --tt----------------
                   Coelacanth  --ccc--cctatct------
                 Nile tilapia  --ctcaatttctccaaatcc
                  Spotted gar  --ctc--tctttcctcttcc
                       Lizard  ====================
                 Atlantic cod  ====================
           Southern platyfish  ====================
                  Zebra mbuna  ====================
          Pundamilia nyererei  ====================
        Burton's mouthbreeder  ====================
          Princess of Burundi  ====================
                X. tropicalis  ====================
                    Zebrafish  ====================
       Yellowbelly pufferfish  ====================
                         Fugu  ====================
                       Medaka  ====================
     Mexican tetra (cavefish)  ====================
                    Tetraodon  ====================
                  Stickleback  ====================
              Tasmanian devil  ====================

Inserts between block 9 and 10 in window
B D                   Rabbit 6bp
B D                     Pika 4bp
B D             Nile tilapia 1394bp

Alignment block 10 of 1468 in window, 67372768 - 67372810, 43 bps 
B D                     Human  ------tctccttgc--ctcaga----------ctcccacgcctttcac-tcccct----caatgt
B D                     Chimp  ------cctcctcgc--ctcaga----------ctcccacgcttttcac-tcccct----caatgt
B D                   Gorilla  ------cctcctcgc--ctcaga----------ctcccacgcctttcac-tcccct----caatgt
B D                 Orangutan  ------cctccttgc--gtcaga----------ctcccacgcctttcac-tcccct----caatgt
B D                    Gibbon  ------cctccttgc--ctcaga----------ctcccttgcctttcac-tcccct----caatgt
B D                    Rhesus  ------cctcctcgc--ctcaga----------ctccctcgcctttctc-tcccct----caatgt
B D       Crab-eating macaque  ------cctcctcgc--ctcaga----------ctccctcgcctttctc-tcccct----caatgt
B D                    Baboon  ------cctcctcgc--ctcaga----------ctccctcgcctttctc-tcccct----caatgt
B D              Green monkey  ------cctcctcgc--ctcaga----------ctccctcgcctttctc-tcccct----caatgt
B D                  Marmoset  ------cctcccc-c--ttcaga----------ctctcttccctttcac-tcccct----caacgt
B D           Squirrel monkey  ------cctcccc-c--ctcaga----------ctctcttgcctttcac-tcccct----caacgt
B D                  Bushbaby  ------cctctc--c--ctcagc----------ctctcatactttttactttctct----caatga
           Chinese tree shrew  ------cctcc---c--ctcagc----------ctccctcgcctttcac-tcccct----cactgt
B D                  Squirrel  ------cctccc--c--ctcagc----------ctccctggtctttttc-tttcct----ctacgc
       Lesser Egyptian jerboa  ------------------tcagc----------ttcctgcacct-------------------ttt
                 Prairie vole  ------ccgccc--a--cccagc----------atccttcatctaaaag-tctcct----cggtat
B D           Chinese hamster  ------cctccc--a--gccagt----------atcctgtacctataag-tctccg----caatat
               Golden hamster  ------cccccc--a--gccagc----------atcctgtacctataag-tctctg----caatat
B D                     Mouse  ------cctccc--c--ctcagc----------attctgcatctataat-tctcct----caggat
B D                       Rat  ------ccttcc--t--ctcagc----------atcctgcacctataac-tgtcct----cagtat
B D            Naked mole-rat  ------cctctc--c--ctcagc----------ctcccttgccttttac-ttctct----cagggt
B D                Guinea pig  ------cctcc------ctcagc----------ctcccttgcctttgac-ttctcc----cagagt
                   Chinchilla  ------ccttcc--ccgctcagc----------ctc-cttgctttttac-ttctct----cagggt
             Brush-tailed rat  ------cctctc--c--ctccgc----------ctcgcttgcctttgac-ttctct----cagggc
B D                    Rabbit  ------cctccc--c--ctccgc----------ctccctcgcgttagac-tcccct----ccacac
B D                      Pika  ------ctttcc--a--ctcc-c----------ctccatc------aac-tctaca----tcatat
B D                    Alpaca  ------cc-ccc--c--ccccgc----------ctcctttg-cctccac-gcccct----cagtgt
               Bactrian camel  ------cctccc--c--ctccgc----------ctcctttg-cctccac-gcccct----cagtgt
B D                   Dolphin  ------cctccc--c--accagc----------ctccctca-cctccac-tccctt----taatgt
                 Killer whale  ------cctccc--c--accagc----------ctccctca-cctctac-tccctt----taatgt
             Tibetan antelope  ------ctaccc------------------------------cctccac-tccctt----taatgt
B D                       Cow  ------ctaccc------------------------------cctccac-tccctt----taatgt
B D                     Sheep  ------ctaccc------------------------------cctccac-tccctt----taatgt
                Domestic goat  ------ctaccc------------------------------cctccat-tccctt----taatgt
B D                     Horse  ------cctccc--c--ctcagc----------c----------tccac-tcatct----caacac
B D          White rhinoceros  ------cctccc--c--gtcagc----------ctccctcgccttccac-tcccat----caatgt
B D                       Cat  ------cctccc--c--ctcagc-ctc-----tctctctcgccttccgc-tcctcc----ccgtgt
B D                       Dog  ------cctcct--a--gccagc----------ctctcttgccttccac-tcttct----ccgtgt
B D                   Ferret   ------cctcct--c--gtcaac----------ctctctcgtcttccac-tcttct----ccacgt
B D                     Panda  ------cctcct--c--atcaac----------ctctctcgccttccac-tcttct----ccgtat
               Pacific walrus  ------cctcct--c--atcaac----------ctcactcgccttctgc-tctt-------cgtgt
                 Weddell seal  ------cctcct--c--gtcaac----------ctcgctcgccttccgc-tctt-------cgtgt
             Black flying-fox  ------cctccc--c--ttcaat----------ctccctcacttaccac-tctcct----caatgt
B D                   Megabat  ------cctccc--c--ttcaat----------ctccctcacttaccac-tctcct----caatgt
                Big brown bat  ------cctccccgc--ctcagc----------ctccctcaccttccac-tctcct----ccatgt
         David's myotis (bat)  ------cctccc--c--ctccgc----------ctccctcaccttccac-tctcct----ccatgt
B D                  Microbat  ------cctccc--g--ctctgc----------ctccctcaccttccac-tctcct----ccgtgt
B D                  Hedgehog  ------ctcccc--t--cgcggc----------cccccgggcctccctc-tcctct----cagtgt
B D                     Shrew  ------cctctc--t--ctgggc----------ctgcctccccttcccc-tcccct----ctaagt
              Star-nosed mole  ------cctctt--t--cttcac---------tctcccttgccttccac-tcccct----cagtgt
B D                  Elephant  ------cttccc--c--ctcagc----------caccttcgcctttcac-tcccct----------
          Cape elephant shrew  --------cacc--c--ctcagc----------tttccttgccttcctt-ttccct----------
B D                   Manatee  ------cctccc--c--ttcagc----------ctcctttgcctttcac-tcccct----------
             Cape golden mole  ------cctcag--c--ctcagc----------ctcccttgcctttcac-tcccct----------
B D                    Tenrec  --------------c--ctcagc----------ctccctcgcctcccac-tcccct----------
                     Aardvark  ------tctcct--c--ctcacc----------ctcccttgcctttcac-tcccct----------
B D                 Armadillo  ------cctccc--t--ctcagc----------ctctcttgccttt-gg-tctcct----------
B D                   Opossum  ------tcttcc--c--cttatt----------tt-------------------------------
B D                   Wallaby  ------tcttcc--c--cttatt----------tt-------------------------------
                  Spotted gar  tgacatcccccg--c--ttcagcgctcgcacagctcccgtccccgccac-ccccttcctgcgatct
B D                    Lizard  ==================================================================
B D              Atlantic cod  ==================================================================
          Southern platyfish  ==================================================================
                 Zebra mbuna  ==================================================================
B D              Nile tilapia  ==================================================================
         Pundamilia nyererei  ==================================================================
       Burton's mouthbreeder  ==================================================================
         Princess of Burundi  ==================================================================
B D             X. tropicalis  ==================================================================
B D                 Zebrafish  ==================================================================
B D                Coelacanth  ------------------------------------------------------------------
  D               Rock pigeon  ------------------------------------------------------------------
B D        American alligator  ------------------------------------------------------------------
      Yellowbelly pufferfish  ==================================================================
B D                      Fugu  ==================================================================
  D             Scarlet macaw  ------------------------------------------------------------------
B D                    Medaka  ==================================================================
    Mexican tetra (cavefish)  ==================================================================
  D              Mallard duck  ------------------------------------------------------------------
B D                 Tetraodon  ==================================================================
B D               Stickleback  ==================================================================
  D       Collared flycatcher  ------------------------------------------------------------------
B D                    Turkey  ------------------------------------------------------------------
B D                   Chicken  ------------------------------------------------------------------
  D    Spiny softshell turtle  ------------------------------------------------------------------
  D  Chinese softshell turtle  ------------------------------------------------------------------
          Tibetan ground jay  ------------------------------------------------------------------
B D                Budgerigar  ------------------------------------------------------------------
  D          Peregrine falcon  ------------------------------------------------------------------
  D              Saker falcon  ------------------------------------------------------------------
  D                    Parrot  ------------------------------------------------------------------
B D       Medium ground finch  ------------------------------------------------------------------
  D    White-throated sparrow  ------------------------------------------------------------------
B D               Zebra finch  ------------------------------------------------------------------
B D           Tasmanian devil  ==================================================================
  D            Painted turtle  ------------------------------------------------------------------
  D           Green seaturtle  ------------------------------------------------------------------
B D                  Platypus  ------------------------------------------------------------------

Inserts between block 10 and 11 in window
B D                 Hedgehog 652bp

Alignment block 11 of 1468 in window, 67372811 - 67372829, 19 bps 
B D                     Human  -------atgatgcacaaaccc---cac-a
B D                     Chimp  -------atgatgcacaaaccc---cac-a
B D                   Gorilla  -------atgatgcacaaaccc---cac-a
B D                 Orangutan  -------atgatgcacaaaccc---cac-a
B D                    Gibbon  -------atgatgcacaaaccc---cac-a
B D                    Rhesus  -------atgatgcacaaaccc---cac-a
B D       Crab-eating macaque  -------atgatgcacaaaccc---cac-a
B D                    Baboon  -------atgatgcacaaaccc---cac-a
B D              Green monkey  -------atgatgcacaaaccc---cac-a
B D                  Marmoset  -------atgatgcgcaaaacc---tac-g
B D           Squirrel monkey  -------atgatgcacaaaacc---tac--
B D                  Bushbaby  -------acaatgcactaaccc---cat-g
           Chinese tree shrew  -------g----------------------
B D                  Squirrel  -------aggatgcacaagccc---cac-a
       Lesser Egyptian jerboa  -------acgtcacacccactc-----t-a
                 Prairie vole  -------aagatgcacaaactc--------
B D           Chinese hamster  -------aagatgtacaaactc---tgt-g
               Golden hamster  -------aagatgcacaaactt-----t-g
B D                     Mouse  -------atgatacaca-------------
B D                       Rat  -------aagattcaca--ctc-----t-g
B D            Naked mole-rat  -------atgatgcacaaacct---cac-a
B D                Guinea pig  -------aggatgcaccagcct---ccc-a
                   Chinchilla  -------aggatgcacaaacct---cac-g
             Brush-tailed rat  -------gtgacgcacaaacct---ccc-a
B D                    Rabbit  -------g-gatgcacagaccc--ctac-a
B D                      Pika  -------a-tata---atatat--ataa-t
B D                    Alpaca  -------gcaacgcacgggccc---tac-a
               Bactrian camel  -------acaacgcacggaccc---tac-a
B D                   Dolphin  -------acaaagcacaaaccc---tac-g
                 Killer whale  -------acaaagcacaaaccc---tac-g
             Tibetan antelope  -------gcaatgcacaaaccc---tac-a
B D                       Cow  -------acaatgcacaaaccc---tac-a
B D                     Sheep  -------gcaatgcacaaaccc---tac-a
                Domestic goat  -------gcaatgcacaaaccc---tac-a
B D                     Horse  -------atgatgcgcaaaccc---tac-a
B D          White rhinoceros  -------atgatgtgcaaaccc---tac-a
B D                       Cat  -------atgatgcacaaaccc---tac-g
B D                       Dog  -------atgatgcacaaaccctaatac-a
B D                   Ferret   -------aggatgcataagccc---tac-a
B D                     Panda  -------atgatgcacaaaccc---tac-a
               Pacific walrus  -------atgatgcacaaaccc---tac-a
                 Weddell seal  -------atgatgcacaaaccc---tac-a
             Black flying-fox  -------acaatacacaaaccc---tac-a
B D                   Megabat  -------acaatacacaaaccc---tac-a
                Big brown bat  -------gtgatgcacaaaccc---tac-g
         David's myotis (bat)  -------gcgacgcacaaaccc---tac-g
B D                  Microbat  -------gtgatgcacaaaccc---tgc-g
B D                     Shrew  -------tgcgtgcccacaacc---tgc-a
              Star-nosed mole  -------aggaagttcaaaccc---tcc-a
B D                  Elephant  ---------------ccaatca---gac-a
          Cape elephant shrew  ---------------ccaatca---gac-t
B D                   Manatee  ---------------ccaatca---tac-a
             Cape golden mole  ---------------ccaatcc---cat-a
B D                    Tenrec  ---------------ccaatgg---tat-a
                     Aardvark  ---------------ccactca---tac-a
B D                 Armadillo  ---------------ccaatca---tac-a
B D                   Opossum  -----------------aacca---tcc-a
B D                   Wallaby  -----------------aacca---tcc-a
B D                  Platypus  -------------cattaacca---tgc-c
  D               Rock pigeon  -----------------aacca---tac-a
  D              Saker falcon  -----------------aaccg---ttc-a
  D          Peregrine falcon  -----------------aaccg---ttc-a
  D       Collared flycatcher  --------------------cc---tcctc
  D    White-throated sparrow  -----------------aagca---tcctc
B D       Medium ground finch  -----------------aagca---tcc-c
B D               Zebra finch  -----------------aa-----------
           Tibetan ground jay  -----------------aacca---tcc-a
B D                Budgerigar  -----------------aacca---tac-c
  D                    Parrot  -----------------aacca---tac-a
  D             Scarlet macaw  -----------------aacca---tat-a
  D              Mallard duck  -----------------aacca---tac-a
B D                   Chicken  -----------------aacca---tac-a
B D                    Turkey  -----------------aacca---tac-a
B D        American alligator  -----------------aacca---tac-a
  D           Green seaturtle  -----------------aactg---tac-a
  D            Painted turtle  -----------------aacca---tac-a
  D  Chinese softshell turtle  -----------------aacca---tac-a
  D    Spiny softshell turtle  -----------------aacca---tac-a
B D                Coelacanth  ------------------------gtac-a
                  Spotted gar  ctctcccattaaaaaaaga-----------
B D                  Hedgehog  ==============================
B D                    Lizard  ==============================
B D              Atlantic cod  ==============================
          Southern platyfish  ==============================
                 Zebra mbuna  ==============================
B D              Nile tilapia  ==============================
         Pundamilia nyererei  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D             X. tropicalis  ==============================
B D                 Zebrafish  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                    Medaka  ==============================
    Mexican tetra (cavefish)  ==============================
B D                 Tetraodon  ==============================
B D               Stickleback  ==============================
B D           Tasmanian devil  ==============================

Alignment block 12 of 1468 in window, 67372830 - 67372927, 98 bps 
B D                     Human  tttgtttgt-----gcatcatagtttagccctaatcaagaatct-g--g---c----tttc-gtgcctgc
B D                     Chimp  tttgtttgt-----gcatcatagtttagccctaatcaagaatct-g--g---c----tttc-gtgcctgc
B D                   Gorilla  tttgtttgt-----gcatcatagtttagccctaatcaagaatct-g--g---c----tttc-atgcctgc
B D                 Orangutan  ----tttgt-----gcatcatagtttagccctaatcaagaatct-g--g---c----tttc-gtgcctgc
B D                    Gibbon  tttgtttgt-----gcatcatagtttagccctaatcaagaatct-g--g---c----tttc-gtggctgc
B D                    Rhesus  tttgtttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttc-gtgcctgc
B D       Crab-eating macaque  tttgtttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttc-gtgcctgc
B D                    Baboon  attgtttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttc-gtgcctgc
B D              Green monkey  tttgtttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttc-gtgcctgc
B D                  Marmoset  tttgtttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tatc-gtgcctgc
B D           Squirrel monkey  ---atttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttt-gtgcctgc
B D                  Bushbaby  tttgttcgt-----gtatcatattttagacctaaccaggaattt-g--g---c----tttt-gcgtctgc
           Chinese tree shrew  ------tgt-----gcatcgtattttagccctaatcaggaatct-g--g---c----tttt-gtacctgc
B D                  Squirrel  tttgttcct-----gcagcatattttagccctaatcggcaatct-g--g---c----tttt-gtgcctgc
       Lesser Egyptian jerboa  cat-tttgt-----gcttgctagtttaaccctagtctgcaatct-g--a---c----tcaa-a--cctca
                 Prairie vole  --tgtttgt-----gcagcatattttagacttaactcagagtct-g--g---c----ttat-atgcctgc
B D           Chinese hamster  tttgctttt-----gcaacatattttagtcttaacccagaatct-g--g---c----ttat-atgcctgc
               Golden hamster  tttgtttgt-----gcagcatattttagtcttaacccagagtct-a--a---c----ttac-atgcctgc
B D                     Mouse  --------------------------------aactcagagcct-g--g---c----ctgc-atgcctgc
B D                       Rat  tttgtttgg-----acagcatattttagcctcaacccagagcct-g--g---c----cttt-atgcatgc
B D            Naked mole-rat  tttgtttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttt-gtgcctgt
B D                Guinea pig  tttgtttgt--------acatattttag-cctaatctggatccc-g--a---c----tttt-gtgtctgc
                   Chinchilla  tttatttgt-----ccgtcagattttagccctgatctggaacct-g--g---c----tttt-gtggctga
             Brush-tailed rat  ttggtttgt-------agccaactttagtccgagtctggaatct-g--g---c----tttg-gaagctga
B D                    Rabbit  ttggttttt-----gcatcatatttgagccctaaccgggaacct-g--g---c----cgttagcccttgc
B D                      Pika  atatttttt-----gcatcatattttagctttccttgggaatct-g--g---a----ttct-gcccctgc
B D                    Alpaca  tttgtcctt-----acatcatattttagccctaatcaggaatct-g--g---c----tttt-gcgcctgc
               Bactrian camel  tttgtccct-----acgtcgtattttagccctaatcaggaatct-g--g---c----tttt-gtgcctgc
B D                   Dolphin  cttgtctct-----acatcatattttagccctaatcaggaatct-g--g---c----tttt-gtgcctgc
                 Killer whale  cttgtctct-----acatcatattttagccctaatcaggaatct-g--g---c----tttt-gtgcctgc
             Tibetan antelope  tttgtctct-----acatcatattttagccctaataaggaatca-g--g---c----tttt-gtgcctgc
B D                       Cow  tttgtctct-----acatcatattttagccctaataaggaatca-g--g---a----tttt-gtgcctgc
B D                     Sheep  tttgtctct-----acatcatattttagccctaataaggaatca-g--g---c----tttt-gtgcctgc
                Domestic goat  tttgtctct-----acatcatattttagccctaataaggaatca-g--g---c----tttt-gtgcctgc
B D                     Horse  cttttttat-----atgtcatattttagccctaatcagcaatcc-a--g---c----tttt-gcgcccac
B D          White rhinoceros  tttttttct-----atatcatattttagtcctaatcaggaatct-g--g---c----tttt-gcttctgc
B D                       Cat  tgtgtttgt-----acatcatattttagccctaaccaggaatct-g--g---c----tttt-gcacctgt
B D                       Dog  tgtgtttgt-----acatcatattttagccctaatcaggaatct-g--g---c----tttt-gcacctgt
B D                   Ferret   tgtgtttgt-----acatcatattttagccctaatcaggaatct-g--g---c----tttt-gcacctgc
B D                     Panda  tgtgtttgt-----acatcatattttagccctaatcaggaatct-g--g---c----attt-gcacctgt
               Pacific walrus  tgtgtttgt-----acatcatattttagccctaatcaggaatct-g--g---c----tttt-gcacctgt
                 Weddell seal  tgtgtttgt-----acatcatattttagccctgatcaggaatct-g--g---c----tttt-gcacctgt
             Black flying-fox  tttgtttgtattggacatcatattttagccctgatcaggaat------------------------ctgc
B D                   Megabat  tttgtttgtattgtacatcatattttagccctgatcaggaat------------------------ctgc
                Big brown bat  tttgtttgtgccgtacatcatattttagtcctaaccaggaat------------------------ctgc
         David's myotis (bat)  tttgtttgtaccatgcatcatattttagtcctcaccaggaat------------------------ctgc
B D                  Microbat  tttgtgtgtaccatacatcatatttcagtcctcaccaggaat------------------------ctgc
B D                     Shrew  cttgtttgc-----atactatctttgaaccctcatcagcaaggc-g--a---c----cttt-gtggctg-
              Star-nosed mole  tttgtctgt-----acgtcattttttacccctaacagggaaact-g--g---c----tttt-gcacctgc
B D                  Elephant  tttgcttgt-----gcatcatattttagccataatcaggaatgc-g--g---c----tttt-tcagctgc
          Cape elephant shrew  tctacttgt-----gcatcatatgtaagccctaatcagaaacct-g--g---c-----tct-tcagcagc
B D                   Manatee  tttgcttgt-----gcatcatattttagccctaatcaggaatct-g--g---c----tttt-tcggctgc
             Cape golden mole  tttgcttgt-----gcatcatattttaactctaatcagga--tt-t--g---gactttttt-tcggttcc
B D                    Tenrec  ttcgcttgt-----gcatcatattttaaccctcatcgggaatct-g--g---gtttttttt-tcagctgc
                     Aardvark  tttgcttgt-----gcatcatattttagccctaatcaggaatct-g--a---g----gttt-tcagctgc
B D                 Armadillo  tttatttgt-----gcatcattttttagccctaatcaggagtct-g--c---c-----ttt-acggctgc
B D                   Opossum  tttgttcaa-----gcatcatattttagtccccatcagcaatct-a--g---c----tttt-gcaactac
B D                   Wallaby  tttgttcaa-----gcatcatattttagtcctcatcagcaatct-aatg---c----tttt-gcagctac
B D                  Platypus  cttatccaa-----gcttcgtatctcagccccgatcaagaccct-c--g---c----cctt-gtggctgc
  D               Rock pigeon  cttgtccga-----gtatcatatttcatccttcatcagagattc-a--g---c----cttt-gtggctgc
  D              Saker falcon  cttgtccaa-----gtatcatatttcatctttcatcagcaattc-a--g---c----cttt-gtggctgc
  D          Peregrine falcon  cttgtccaa-----gtatcatatttcatctttcatcagcaattc-a--g---c----cttt-gtggctgc
  D       Collared flycatcher  tttttccca-----ggatcatatttcatccttcatcagcaattcaa--g---c----cttt-gtggctgc
  D    White-throated sparrow  cccgtgcaa-----ggatcatatttcatccttcatcagcaattc-a--g---c----cttt-gtggctgc
B D       Medium ground finch  cctgtccaa-----ggatcatatttcatccttcatcagcaattc-a--g---c----cttt-gtggctgc
B D               Zebra finch  cttgtccaa-----ggatcatatttcatccttcatcagcaattc-a--g---c----cttt-gtggctgc
           Tibetan ground jay  cttgtccga-----ggatcatatttcatccttcatcagcaattc-a--g---c----ctct-gtggctgc
B D                Budgerigar  ctcgtccaa-----gtatcatatttcatccttcatcagcaattc-a--g---c----ctct-gtggctgc
  D                    Parrot  ctcgtccga-----gtatcatatttcatccttcatcagcaattc-a--g---c----cttt-gtggctgc
  D             Scarlet macaw  ctcgtccga-----gtatcatatttcatccttcatcagcaattc-a--g---c----cttt-gtggctgc
  D              Mallard duck  cttgtccga-----gtatcatatttcatccttcatcagcgattc-a--g---c----cttt-gtggctgc
B D                   Chicken  cttgtccga-----gtatcatatttcatccttcatcagcgatcc-a--g---c----cttt-gtggctgt
B D                    Turkey  cttgtccga-----gtctcatatttcatccttcatcagcgattc-a--g---c----cttt-gtggctgt
B D        American alligator  cttgtccga-----gcatcatatttcatccttcatcagtgattc-a--g---c----cttt-gtggctgc
  D           Green seaturtle  tttgtccga-----gcatcatatttcatccttcatcagtgattc-a--g---c----cttt-gtggctgc
  D            Painted turtle  ttggtccga-----gcatcatatttcatccttcatcagtgattc-a--g---c----cttt-gtggctgc
  D  Chinese softshell turtle  cttgtccga-----gcatcatatttcatccttcatcagggattc-a--g---c----cttt-gtggctgc
  D    Spiny softshell turtle  cttgtccga-----gcatcatatttcatccttcatcagggattc-a--g---c----cttt-gtggctgc
B D                Coelacanth  cttgtccgt-----gcttcatatttcatccctcatcagagattc-a--g---c----tgtt-gtggctgc
B D                 Zebrafish  tttgttttt------------------------------gatac-a--a--------aact-gaaaaaaa
                  Spotted gar  ttcctttgt-----------------cgccttg--cagggattc-a--gggtc----acca-gcgacaaa
B D                  Hedgehog  ======================================================================
B D                    Lizard  ======================================================================
B D              Atlantic cod  ======================================================================
          Southern platyfish  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Nile tilapia  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------a--
                        Chimp  -a-aaatctgttgcaa--tt-ttt-------------ctgta--g----------------------a--
                      Gorilla  -a-aaatctgttgcaa--tt-ttt-------------ctata--g-------------------------
                    Orangutan  -a-aaatctgttgcaa--tt-ttt-------------ctata--g-------------------------
                       Gibbon  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------a--
                       Rhesus  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------g--
          Crab-eating macaque  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------g-a
                       Baboon  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------g-a
                 Green monkey  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------gaa
                     Marmoset  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------a--
              Squirrel monkey  -a-aaatctgttgcaa--tt-ttt-------------ctata--g-------------------------
                     Bushbaby  -a-aaatctgttgcag--tt-att-------------ctata--g----------------------g--
           Chinese tree shrew  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------a--
                     Squirrel  aa-aaatcggctgcaa--tt-ttt-------------ctata--g----------------------a--
       Lesser Egyptian jerboa  -g-aaatctgttgtca--tt-ttt-------------ccata--c----------------------a--
                 Prairie vole  -a-aaatctgctgcaa--tt-ttt-------------ctata--a----------------------a--
              Chinese hamster  -a-aaatctgttgcaa--tt-ttt-------------ctata--a----------------------a--
               Golden hamster  -a-aaatcagttacaa--tt-ttt-------------ctata--a----------------------a--
                        Mouse  -a-aaatctgttataa--tt-ttt-------------ctata--a----------------------a--
                          Rat  -a-aaatctgttacac--tt-ttt-------------ctata--c----------------------a--
               Naked mole-rat  -a-aaatctgttg-aa--tt-ttt-------------ctata--g----------------------a--
                   Guinea pig  -a-aaatctgttg-aa--gt-ttt-------------ctata--g----------------------a--
                   Chinchilla  -a-aaatcggctg-aa--tt-ttt-------------ctatg--g----------------------a--
             Brush-tailed rat  -a-aaatctgtcg-aa--tt-ttt-------------ctata--g----------------------a--
                       Rabbit  aa-aaatctgttgcaa--tt-ttt-------------cgaca--g------------------gaa-g--
                         Pika  ta-aaatctgttgcag--tt-ttt-------------ccata--g------------------cgt-a--
                       Alpaca  -a-aaatctgttgcaa--tt-ttt-------------ctatg--g--------------------gaa--
               Bactrian camel  -a-aaatctgtcgcaa--tt-ttt-------------ctatg--g--------------------g-a--
                      Dolphin  -a-aaatctgttgcaa--tt-ttt-------------ctata--g-------------------------
                 Killer whale  -a-aaatctgttgcaa--tt-ttt-------------ctata--g-------------------------
             Tibetan antelope  -a-aaatctgttgcaa--tt-ttt-------------ctgta--g----------------------a--
                          Cow  -a-aagtctgttgcaa--tt-ttt-------------ctgta--g--------------------a-a--
                        Sheep  -a-aaatctgttgcaa--tt-ttt-------------ctgta--g----------------------a--
                Domestic goat  -a-aaatctgttgcaa--tt-ttt-------------ctgta--g----------------------a--
                        Horse  -a-aaatctgctgcaa--tt-ttt-------------ctata--g--------------------a-a--
             White rhinoceros  -a-aaatctgttgcag--tt-ttt-------------ctata--g----------------------g--
                          Cat  -a-aaatctattgcaa-ttt-ttt-------------ctata--g----------------------a--
                          Dog  -g-aaatctattgcaa-ttt-ttt-------------ctata--g----------------------a--
                      Ferret   -a-aaatctattgcaa-ttt-ttt-------------ctata--g--------------------a-a--
                        Panda  -a-aaatctattgcaa-ttt-ttt-------------ctata--g----------------------a--
               Pacific walrus  -a-aaatctattgcaatttt-ttt-------------ctata--g--------------------a-a--
                 Weddell seal  -a-aaatctattgcaatttt-ttt-------------ctata--gaaaaaaaatttttttctagaa-a--
             Black flying-fox  -a-a-atctgttgcat--tt-ttttt----------cctcta--g----------------------a--
                      Megabat  -a-a-atctgttgcat--tt-ttttt----------cctcta--g----------------------a--
                Big brown bat  -a-aaatctgttgcaa--tt-ttt-------------ctata--g----------------------g--
         David's myotis (bat)  -a-agatctgctgcaa--tt-ttt-------------ctata--g----------------------g--
                     Microbat  -a-agatctgctgcaa--tt-ttt-------------ctata--g----------------------g--
                        Shrew  -a-aattctgtcgcaa--tt-ttt--------------tatg--g----------------------g--
              Star-nosed mole  -a-aaatctgttgcaa--tt-ttt-------------ctatg--g----------------------a--
                     Elephant  -a-aaatctcttgcga--tt-ttt-------------ctgta--g----------------------g--
          Cape elephant shrew  -a-aaatctgttgcaa--tt-ttt-------------ccgaaagg----------------------a--
                      Manatee  -a-aaatctgttgcaa--ctattt-------------ctata--g----------------------a--
             Cape golden mole  -a-aaatctgttgcaa--tt-ttt-------------ctaca--g----------------aaaaa-a--
                       Tenrec  -a-caatctgttgcaa--tt-ttt-------------ctata--g--------caggaggaaaaag-a--
                     Aardvark  -a-aaagctgttgcca--tt-ttt-------------ctata--g---------------aaaaaa-a--
                    Armadillo  -a-aaatctgttgcaa--at-ttt-------------ctata--g-------------------------
                      Opossum  -a-aaatctgctgcaa--tt-ttt-------------ctata--g----------------------a--
                      Wallaby  -a-aaatctgttgcaa--ct-ttt-------------ctaca--g----------------------a--
                     Platypus  -c-aaagcggtagcaa--tt-ttt-------------ctata--g----------------------g--
                  Rock pigeon  -a-aaatctgttgcag--tg-ttt-------------ctact--g--------------------a-a--
                 Saker falcon  -a-aaatctgttgcag--tg-ttt-------------ctatg--g----------------------a--
             Peregrine falcon  -a-aaatctgttgcag--tg-ttt-------------ctatg--g----------------------a--
          Collared flycatcher  -a-aaatctgtcgcag--tg-ttc-------------ctggt--g----------------------a--
       White-throated sparrow  -a-aaatctgtcgcag--tg-ttt-------------ctggt--g----------------------a--
          Medium ground finch  -a-aaatctgtcgcag--tg-ttt-------------ctggt--g----------------------a--
                  Zebra finch  -a-aaatctgtcgcag--tg-ttg-------------ctggt--g----------------------a--
           Tibetan ground jay  -a-aaatctgtcgcag--tg-ctt-------------ctggt--g----------------------a--
                   Budgerigar  -acaaatctgttgcag--tg-ttt-------------ctcct--g----------------------a--
                       Parrot  -aaaaatctgttgcag--tg-ttt-------------ctcct--g----------------------a--
                Scarlet macaw  -aaaaatctgttgcag--tg-ttt-------------ctcct--g----------------------a--
                 Mallard duck  -a-aaatctgttgcag--tg-ttt-------------ctatt--g----------------------a--
                      Chicken  -a-aaatctgttgcag--tg-ttt-------------ctatt--g----------------------g--
                       Turkey  -a-aaatctgttgcag--tg-ttt-------------ctatt--g----------------------g--
           American alligator  -a-aaatctgttgtaa--tt-ttt-------------ctatg--g----------------------a--
              Green seaturtle  -a-gaatctgttgcaa--tt-ttt-------------ctatg--g----------------------a--
               Painted turtle  -a-gaatctgttgcaa--tt-ttt-------------ctatg--g----------------------a--
     Chinese softshell turtle  -a-gaatctgttgcaa--tt-ttt-------------ctatg--g----------------------a--
       Spiny softshell turtle  -a-gaatctgttgcaa--tt-ttt-------------ctatg--g----------------------a--
                   Coelacanth  -a-aaagctgtcacac--tt-att-------------ttctg--t----------------------a--
                    Zebrafish  -a-aaattagtctgga--ct-ttccttacttctcaatctttt--g----------------------a--
                  Spotted gar  -a-caaata------------------------------ttg--g----------------------g--
                     Hedgehog  ======================================================================
                       Lizard  ======================================================================
                 Atlantic cod  ======================================================================
           Southern platyfish  ======================================================================
                  Zebra mbuna  ======================================================================
                 Nile tilapia  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                X. tropicalis  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  aaaaa------a-aaaagtcccttc
                        Chimp  aaaaa------a-aaaagtcccttc
                      Gorilla  aaaaa------a-aaaagtaccttc
                    Orangutan  -aaaa------a-aaaagtcccttc
                       Gibbon  aaaaa------a-aaaagtcccttc
                       Rhesus  aaaaa------a-aaaagtcccttc
          Crab-eating macaque  aaaaa------a-aaaagtcccttc
                       Baboon  aaaaa------a-aaaagtcccttt
                 Green monkey  aaaaa------a-aaaagtcccttc
                     Marmoset  --aaa------a-aaaagtcccttc
              Squirrel monkey  --aaa------a-aaaagtcccttc
                     Bushbaby  ---aa------a-aaagaccccttt
           Chinese tree shrew  ----a------a-agaagtcccctt
                     Squirrel  ----c------g-taaagtcccttc
       Lesser Egyptian jerboa  ----a------g-aaaagtcccttc
                 Prairie vole  ----a------g-aaaattcttttt
              Chinese hamster  -------------aaaatgctcttt
               Golden hamster  ----a------g-aaaatgcttctt
                        Mouse  ----a------g-aaaatggtcctt
                          Rat  ----a------g-aaaatgctcctt
               Naked mole-rat  ----a------g-aaaagtgccttc
                   Guinea pig  ----g------g-aaaagtgccttc
                   Chinchilla  ----a------g-aaaagtgccttc
             Brush-tailed rat  ----a------g-aaaagtgccttc
                       Rabbit  ----g------a-aaacgttccttc
                         Pika  ----g------a-aaaagtcccttc
                       Alpaca  ----a------a-aaaagtcccttc
               Bactrian camel  ----a------a-aaaagtcccttc
                      Dolphin  ----a------a-aaaagtcccttc
                 Killer whale  ----a------a-aaaagtcccttc
             Tibetan antelope  ----a------a-aaaagtcccttc
                          Cow  ----a------a-aaaagtcccttc
                        Sheep  ----a------a-aaaagtcccttc
                Domestic goat  ----a------a-aaaagtcccttc
                        Horse  ----a------a-aaaagtcccttc
             White rhinoceros  ----a------a-aaaagtcccttc
                          Cat  ----a------a-aaaagtcccttc
                          Dog  ----a------a-agaagtaccttc
                      Ferret   ----a------a-aaaagttccttc
                        Panda  ----a------a-aaaagtctcttc
               Pacific walrus  ----a------a-aaaaatcccttc
                 Weddell seal  ----a------a-aaaagtcccttc
             Black flying-fox  ----a------a-aaatatcccttc
                      Megabat  ----a------a-aaatatcccttc
                Big brown bat  ----a------a-aaatgtgccttc
         David's myotis (bat)  ----a------a-aaatgtcccttc
                     Microbat  ---aa------a-aaatgtcccttc
                        Shrew  ----atagggga-gcgaatcccttc
              Star-nosed mole  ----a------a-aaaagtcccttc
                     Elephant  ----a------a-aaaagtcccttc
          Cape elephant shrew  ----a------a-aaaagttccttt
                      Manatee  ----a------a-aaaagtcccttc
             Cape golden mole  ----a------a-gaaagctccttc
                       Tenrec  ----a------a-aaaagtcccttc
                     Aardvark  ----a------a-aaaaatcccttc
                    Armadillo  ----a------a-aaaagtcccttc
                      Opossum  ----a---------aaagtctgttc
                      Wallaby  ----a---------aaagtctgttc
                     Platypus  ----a---------aaagtcccttc
                  Rock pigeon  ----a---------aaagtcacttc
                 Saker falcon  ----a---------aatgtcccttc
             Peregrine falcon  ----a---------aatgtcccttc
          Collared flycatcher  ----a---------aatgtcccttt
       White-throated sparrow  ----a---------aatgtcccttc
          Medium ground finch  ----a---------aatgtcccttc
                  Zebra finch  ----a---------aatgtcccttc
           Tibetan ground jay  ----a---------aatgtcccttc
                   Budgerigar  ----a---------aacgtcccttt
                       Parrot  ----a---------aacgtcccttt
                Scarlet macaw  ----a---------aacgtcccttt
                 Mallard duck  ----a---------aatgtcccttc
                      Chicken  ----a---------aatgtcccttc
                       Turkey  ----a---------aatgtcccttc
           American alligator  ----g---------aatgtcccttc
              Green seaturtle  ----a---------aatgtcccttc
               Painted turtle  ----a---------aatgtcccttc
     Chinese softshell turtle  ----a---------aatgtcccttc
       Spiny softshell turtle  ----a---------aatgtcccttc
                   Coelacanth  ----a------agaaaagcccaaat
                    Zebrafish  ----a------t-ggcagttcctaa
                  Spotted gar  ----a------a-gaaggagcctcg
                     Hedgehog  =========================
                       Lizard  =========================
                 Atlantic cod  =========================
           Southern platyfish  =========================
                  Zebra mbuna  =========================
                 Nile tilapia  =========================
          Pundamilia nyererei  =========================
        Burton's mouthbreeder  =========================
          Princess of Burundi  =========================
                X. tropicalis  =========================
       Yellowbelly pufferfish  =========================
                         Fugu  =========================
                       Medaka  =========================
     Mexican tetra (cavefish)  =========================
                    Tetraodon  =========================
                  Stickleback  =========================
              Tasmanian devil  =========================

Inserts between block 12 and 13 in window
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
B D                Zebrafish 18bp
                 Spotted gar 2bp

Alignment block 13 of 1468 in window, 67372928 - 67372936, 9 bps 
B D                     Human  acttt---gact-----
B D                     Chimp  acttt---gact-----
B D                   Gorilla  acttt---gact-----
B D                 Orangutan  atttt---gact-----
B D                    Gibbon  acttt---gact-----
B D                    Rhesus  acttt---gact-----
B D       Crab-eating macaque  acttt---gact-----
B D                    Baboon  acttt---gact-----
B D              Green monkey  acttt---gact-----
B D                  Marmoset  acttt---ggct-----
B D           Squirrel monkey  acttt---gaat-----
B D                  Bushbaby  actca---gact-----
           Chinese tree shrew  gcttt---gact-----
B D                  Squirrel  atttg---ggct-----
       Lesser Egyptian jerboa  atttt---gaca-----
                 Prairie vole  gtttt---gact-----
B D           Chinese hamster  gtttt---gact-----
               Golden hamster  gtttt---gact-----
B D                     Mouse  gtttt---gact-----
B D                       Rat  gtttt---cact-----
B D            Naked mole-rat  atgtg---gact-----
B D                Guinea pig  atttc---gact-----
                   Chinchilla  atttt---gact-----
             Brush-tailed rat  atttt---gact-----
B D                    Rabbit  acttt---gacg-----
B D                      Pika  actttcactact-----
B D                    Alpaca  acttt---gtct-----
               Bactrian camel  acttt---gact-----
B D                   Dolphin  gcttt---gact-----
                 Killer whale  gcttt---gact-----
             Tibetan antelope  acttt---gact-----
B D                       Cow  acttt---gact-----
B D                     Sheep  acttt---gact-----
                Domestic goat  acttt---gact-----
B D                     Horse  acttt---gact-----
B D          White rhinoceros  acgtt---gact-----
B D                       Cat  acttt---gact-----
B D                       Dog  acttt---gagt-----
B D                   Ferret   acttt---gact-----
B D                     Panda  acttt---gact-----
               Pacific walrus  acttt---gact-----
                 Weddell seal  acttt---gact-----
             Black flying-fox  acttt---gact-----
B D                   Megabat  acttt---gact-----
                Big brown bat  acttt---gact-----
         David's myotis (bat)  acttt---gact-----
B D                  Microbat  acttt---gact-----
B D                     Shrew  ctgtg---gatg-----
              Star-nosed mole  acttt---gact-----
B D                  Elephant  acgtt---gacg-----
          Cape elephant shrew  ctttt---gact-----
B D                   Manatee  atgtt---gaga-----
             Cape golden mole  acttt---gact-----
B D                    Tenrec  cgtgt---gact-----
                     Aardvark  acttt---gact-----
B D                 Armadillo  acttt---gact-----
B D                   Opossum  acttt---gacc-----
B D                   Wallaby  acttt---gtcc-----
B D                  Platypus  acttt---gact-----
  D               Rock pigeon  acttt---gact-----
  D              Saker falcon  ccttt---gagt-----
  D          Peregrine falcon  acttt---gagt-----
  D       Collared flycatcher  tcttt---ggct-----
  D    White-throated sparrow  tcttt---ggct-----
B D       Medium ground finch  ttttt---ggct-----
B D               Zebra finch  tcttt---ggct-----
           Tibetan ground jay  tcttt---ggct-----
B D                Budgerigar  ctttt---gact-----
  D                    Parrot  ctttt---gact-----
  D             Scarlet macaw  ctttt---gact-----
  D              Mallard duck  acttt---gact-----
B D                   Chicken  gcttt---gact-----
B D                    Turkey  gcttt---gact-----
B D        American alligator  atgtt---gact-----
  D           Green seaturtle  acttt---gact-----
  D            Painted turtle  acttt---gact-----
  D  Chinese softshell turtle  actat---gact-----
  D    Spiny softshell turtle  actat---gact-----
B D                Coelacanth  acttt---ctct-----
           Southern platyfish  --------atctttatt
B D                 Zebrafish  ----------------t
                  Spotted gar  --------atctttt--
B D                  Hedgehog  =================
B D                    Lizard  =================
B D              Atlantic cod  =================
                 Zebra mbuna  =================
B D              Nile tilapia  =================
         Pundamilia nyererei  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D             X. tropicalis  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D                    Medaka  =================
    Mexican tetra (cavefish)  =================
B D                 Tetraodon  =================
B D               Stickleback  =================
B D           Tasmanian devil  =================

Inserts between block 13 and 14 in window
          Southern platyfish 3bp

Alignment block 14 of 1468 in window, 67372937 - 67372947, 11 bps 
B D                     Human  atgg-tagt-------tct
B D                     Chimp  atgg-tagt-------tct
B D                   Gorilla  atgg-tagt-------tct
B D                 Orangutan  atgg-tagt-------tct
B D                    Gibbon  atgg-tagt-------tct
B D                    Rhesus  gtgg-tagt-------tct
B D       Crab-eating macaque  gtgg-tagt-------tct
B D                    Baboon  gtgg-tagt-------tct
B D              Green monkey  gtgg-tagt-------tct
B D                  Marmoset  gtgg-tagt-------tct
B D           Squirrel monkey  atgg-tagt-------tct
B D                  Bushbaby  gtgg-tggt-------tct
           Chinese tree shrew  atgg-tagt-------tct
B D                  Squirrel  acgg-tagt-------tct
       Lesser Egyptian jerboa  atgg-cagt-------tgt
                 Prairie vole  atgg-tagt-------ggt
B D           Chinese hamster  atgg-tagt-------tgt
               Golden hamster  atgg-tagt-------tgt
B D                     Mouse  atgg-tagt-------tgt
B D                       Rat  atgg-tagt-------tgt
B D            Naked mole-rat  atgg-tagt-------tct
B D                Guinea pig  atgg-tagt-------tct
                   Chinchilla  atgg-tagt-------tct
             Brush-tailed rat  atgg--agt-------tct
B D                    Rabbit  gcag-tggc-------tct
B D                      Pika  acag-tagc-------tct
B D                    Alpaca  atgg-tagt-------tct
               Bactrian camel  atgg-tagt-------tct
B D                   Dolphin  atgg-tcgt-------tct
                 Killer whale  acgg-tcgt-------tct
             Tibetan antelope  atgg-tagt-------tct
B D                       Cow  atgg-tagt-------tct
B D                     Sheep  atgg-tagt-------tct
                Domestic goat  atgg-tagt-------tct
B D                     Horse  atgg-tagt-------tcc
B D          White rhinoceros  atgg-tagt-------cct
B D                       Cat  atgg-tagt-------tct
B D                       Dog  atgg-tagt-------tct
B D                   Ferret   acag-ccgt-------tct
B D                     Panda  atgg-tctt-------tct
               Pacific walrus  attg-tcat-------tct
                 Weddell seal  attg-tcgt-------tct
             Black flying-fox  atgg-tagt-------tct
B D                   Megabat  atgg-tagt-------tct
                Big brown bat  atgg-tagt-------ttt
         David's myotis (bat)  atgg-tagt-------tct
B D                  Microbat  ctgg-tagt-------tct
B D                     Shrew  ctgg-cagt-------tct
              Star-nosed mole  acgg-tggt-------tct
B D                  Elephant  atgg-tagt-------tct
          Cape elephant shrew  ctgg-tagt-------tct
B D                   Manatee  atgg-tagt-------tct
             Cape golden mole  atgg-tact-------tct
B D                    Tenrec  atgg-cgct-------tct
                     Aardvark  atgg-tagt-------tct
B D                 Armadillo  aggg-tagc-------tct
B D                   Opossum  agggatagg-------tct
B D                   Wallaby  agggatagg-------tct
B D                  Platypus  ttgg-tggt-------ccc
  D               Rock pigeon  tcag-tagt-------tct
  D              Saker falcon  tcag-tagt-------tct
  D          Peregrine falcon  tcag-tagt-------tct
  D       Collared flycatcher  tcag-tggt-------tct
  D    White-throated sparrow  tcag-tggt-------tct
B D       Medium ground finch  tcag-tggt-------tct
B D               Zebra finch  tcag-cagt-------tct
           Tibetan ground jay  tcag-tggt-------tct
B D                Budgerigar  tcag-tagc-------tct
  D                    Parrot  tcag-tagt-------tct
  D             Scarlet macaw  tcag-tagt-------tct
  D              Mallard duck  tcag-tagt-------tct
B D                   Chicken  tgag-cggc-------tct
B D                    Turkey  tcag-tggt-------tct
B D        American alligator  ttgg-tagt-------tct
  D           Green seaturtle  ttgg-tagt-------tct
  D            Painted turtle  ttgg-tagt---------t
  D  Chinese softshell turtle  ttgg-tagt-------tct
  D    Spiny softshell turtle  ttgg-tagt-------tct
B D                Coelacanth  ttta-tagc-------tgt
          Pundamilia nyererei  acag-tgtt-------tct
           Southern platyfish  ataa-atttctcagagtcc
B D                 Zebrafish  acag-aagt-------tcc
                  Spotted gar  ------------ttgatct
B D                  Hedgehog  ===================
B D                    Lizard  ===================
B D              Atlantic cod  ===================
                 Zebra mbuna  ===================
B D              Nile tilapia  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D             X. tropicalis  ===================
      Yellowbelly pufferfish  ===================
B D                      Fugu  ===================
B D                    Medaka  ===================
    Mexican tetra (cavefish)  ===================
B D                 Tetraodon  ===================
B D               Stickleback  ===================
B D           Tasmanian devil  ===================

Inserts between block 14 and 15 in window
         Pundamilia nyererei 1bp
          Southern platyfish 1bp
B D                Zebrafish 1bp
                 Spotted gar 4bp

Alignment block 15 of 1468 in window, 67372948 - 67372974, 27 bps 
B D                     Human  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                     Chimp  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                   Gorilla  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                 Orangutan  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                    Gibbon  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                    Rhesus  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D       Crab-eating macaque  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                    Baboon  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D              Green monkey  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                  Marmoset  gtcag--------------aaaatcaatgtttt-aa---ctacat
B D           Squirrel monkey  gtcag--------------aaaatcaatgtttt-aa---ctacat
B D                  Bushbaby  gtcag--------------aaaatcaatgtttt-ca---ctgctt
           Chinese tree shrew  gtcag--------------aaaatcgatgtttt-aa---ctgcat
B D                  Squirrel  gtcag--------------aaaatcgatgtttt-aa---ctgcat
       Lesser Egyptian jerboa  gtcagaaaaaaaa------aaaataaatctttt-aa---gtgcat
                 Prairie vole  gttgg--------------aaagtcaatgtttt-ag---ctgcac
B D           Chinese hamster  gttag--------------aaagccaatgtttt-aa---ctgcac
               Golden hamster  gttag--------------aaagtcagtgtttt-aa---ctgcac
B D                     Mouse  gttgg--------------gaagtcactgttct-aa---ctgcat
B D                       Rat  gttgg--------------gaagtcagtgttct-aa---c-----
B D            Naked mole-rat  gtcag--------------aaaatcaatgtttt-aa---atgcat
B D                Guinea pig  gtcag--------------aaaatcaatgttct-aa---tggcat
                   Chinchilla  gtcag--------------aaaatcaatgtttt-aa---ctgcat
             Brush-tailed rat  gtcag-------a------aaaatcaatgtttt-aa---gtgcat
B D                    Rabbit  gtcag--------------aaaatcaatgtttt-cg---ctgcgt
B D                      Pika  gtcag-------a------aaaatcaatatgtt-ca---ctgtgt
B D                    Alpaca  gtcag--------------aaaatcaatgtttt-aa---ctgcat
               Bactrian camel  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                   Dolphin  gtcag-------a------aaaatcaatgtttt-aa---ctgcat
                 Killer whale  gtcag--------------aaaatcaatgtttt-aa---ctgcat
             Tibetan antelope  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                       Cow  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                     Sheep  gtcag--------------aaaatcaatgtttt-aa---ctgcat
                Domestic goat  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                     Horse  gtcag--------------aaaatcaatgtttt-aa---ctgctt
B D          White rhinoceros  gtcag--------------aaaatcaatgtttt-aa---ccgctt
B D                       Cat  gtcag--------------aaaatcaatgtttt-aa---ctgcac
B D                       Dog  gtcag--------------aaaatcaatgtttt-at---ctgcac
B D                   Ferret   gtcgg--------------aaaatcaatgtttt-aa---ccgcac
B D                     Panda  gtcag--------------aaaatcaatgtttt-aa---ctgcac
               Pacific walrus  gtcag--------------aaaatcaatgtttt-aa---ctgcac
                 Weddell seal  gtcag--------------aagatcaatgtttt-aa---ctgcac
             Black flying-fox  gtcag--------------aaaatcaatgttta-ga---ctgcat
B D                   Megabat  gtcag--------------aaaatcaatgttta-ga---ctgcat
                Big brown bat  gtcag--------------aaaatcaatggtgt-aa---ctgcat
         David's myotis (bat)  gtcag--------------gaaatcaatggtgt-aa---ctgcat
B D                  Microbat  gtcag--------------gaaatcaatggtgt-aa---ctgcat
B D                     Shrew  gtcag--------------aaaatcaatgtttt-aa---ctgcat
              Star-nosed mole  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                  Elephant  gtcag--------------aaaatcaatgtttt-aa---ctgcgt
          Cape elephant shrew  gtcag--------------aaaatcaatatttt-aa---ctgcat
B D                   Manatee  gtcag--------------aaaatcaatgtttt-aa---ccgcat
             Cape golden mole  gtcag--------------aaaatcaatgcttt-aa---ctgcat
B D                    Tenrec  gtcag--------------aaaatcaaggttttgaa---cggcac
                     Aardvark  gtcag--------------aaaatcgatgtatt-aa---ctgcat
B D                 Armadillo  gtcag--------------aaaatcaatgtttt-ta---ctgcgt
B D                   Opossum  gtcag--------------aaaatcaatgtttttaa---ctgcat
B D                   Wallaby  gtcag--------------aaaatcaatgtttttaa---ctgcat
B D                  Platypus  gacag--------------aaaatcaatgtttt-aa---ctgcat
  D               Rock pigeon  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D              Saker falcon  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D          Peregrine falcon  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D       Collared flycatcher  ggcag--------------aaaatcaatgtttt-aa---ctgcat
  D    White-throated sparrow  gtcag--------------aaaatcaatgtttt-aa---ctgcgt
B D       Medium ground finch  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D               Zebra finch  gtcag--------------aaaatcaatgtttt-aa---ctgcat
           Tibetan ground jay  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                Budgerigar  gtcag--------------aaaatcaatgtttt-aa---ctgcgt
  D                    Parrot  gtcag--------------aaaatcaatgtttt-aa---ctgcgt
  D             Scarlet macaw  gtcag--------------aaaatcaatgtttt-aa---ctgcgt
  D              Mallard duck  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                   Chicken  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                    Turkey  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D        American alligator  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D           Green seaturtle  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D            Painted turtle  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D  Chinese softshell turtle  gtcag--------------aaaatcaatgtttt-aa---ctgcat
  D    Spiny softshell turtle  gtcag--------------aaaatcaatgtttt-aa---ctgcat
B D                Coelacanth  accag--------------aaatccagtgtttt-ag---ctccac
          Pundamilia nyererei  ---------ttta------aaaaagactgctgt-ga---cag---
           Southern platyfish  ---------ttta------aattgactttcttt-gattcctt---
B D               Stickleback  ---------tttactacatgagatagtttcccc-aa---aac---
B D                 Zebrafish  ---------ctcac-----aagagatttgttct-ga---ctt---
                  Spotted gar  ----------------gtcagaaaatcagtttc-ga---tct---
B D                  Hedgehog  =============================================
B D                    Lizard  =============================================
B D              Atlantic cod  =============================================
                 Zebra mbuna  =============================================
B D              Nile tilapia  =============================================
       Burton's mouthbreeder  =============================================
         Princess of Burundi  =============================================
B D             X. tropicalis  =============================================
      Yellowbelly pufferfish  =============================================
B D                      Fugu  =============================================
B D                    Medaka  =============================================
    Mexican tetra (cavefish)  =============================================
B D                 Tetraodon  =============================================
B D           Tasmanian devil  =============================================

Alignment block 16 of 1468 in window, 67372975 - 67372994, 20 bps 
B D                     Human  tact-ttttct-cc----c--tatatat--
B D                     Chimp  tact-ttttct-cc----c--tatatat--
B D                   Gorilla  tact-ttttct-cc----c--tatatat--
B D                 Orangutan  tact-ttttct-cc----c--tatatat--
B D                    Gibbon  tact-ttttct-cc----c--tatatat--
B D                    Rhesus  tact-ttttct-cc----c--tatatat--
B D       Crab-eating macaque  tact-ttttct-cc----c--tatatat--
B D                    Baboon  tact-ttttct-cc----c--tatatat--
B D              Green monkey  tact-ttttct-cc----c--tatatat--
B D                  Marmoset  tacc-ttttct-cc----c--tatatat--
B D           Squirrel monkey  tacc-ttttct-cc----c--tatatat--
B D                  Bushbaby  tacc-ttttct-cc----c--tatatat--
           Chinese tree shrew  tacc-ttttctccc----c--tatatat--
B D                  Squirrel  tacc-ttttcc-cc---------cctat--
       Lesser Egyptian jerboa  tacc-ttttct-cc----c--gatatat--
                 Prairie vole  tacc-ttttct-ct----a--tatctat--
B D           Chinese hamster  tacc-ttttct-cc----a--tatatat--
               Golden hamster  tacc-ttttcc-cc----a--tatatat--
B D                     Mouse  tacc-ttttct-at----a--cacacac--
B D                       Rat  tacc-ttttct-ac----a--tacacac--
B D            Naked mole-rat  tacc-ttttct-tc----c--tatatat--
B D                Guinea pig  tact-ttttct-cc----c--tatatat--
                   Chinchilla  tacc-ttttct-cc----c--tatatat--
             Brush-tailed rat  tacc-ttttct-cc----c--tatatat--
B D                    Rabbit  tacc-ttttct-cc----c--tatatat--
B D                      Pika  tacc-ttctcc-cc----c--tatctat--
B D                    Alpaca  tacc-ttttct-cc----c--tatatat--
               Bactrian camel  tacc-ttttct-cc----c--tatatat--
B D                   Dolphin  tact-ttttct-cc----c--tatatat--
                 Killer whale  tact-ttttct-cc----c--tatatat--
             Tibetan antelope  tacc-ttttct-cc----c--tatatat--
B D                       Cow  tacc-ttttct-cc----c--tatatat--
B D                     Sheep  tacc-ttttct-cc----c--tatatat--
                Domestic goat  tacc-ttttct-cc----c--tatatat--
B D                     Horse  tacc-atttct-cc----c--tatatat--
B D          White rhinoceros  tacc-ttttct-cc----c--tatatat--
B D                       Cat  tacc-ttttct-cc----c--tatatat--
B D                       Dog  tacc-ttttct-cc----t--tatatat--
B D                   Ferret   tacc-ttttct-cc----c--tatatat--
B D                     Panda  tacc--tttct-cc----c--tatatat--
               Pacific walrus  tacc-ttttct-cc----c--tatatat--
                 Weddell seal  tacc-ttttct-cc----c--tatatat--
             Black flying-fox  tacc-ttttct-cc----c--tatatat--
B D                   Megabat  tacc-ttttct-cc----c--tatatat--
                Big brown bat  tacc-ttttct-tc----c--tgaatat--
         David's myotis (bat)  tacc-ttttct-cc----c--tgtatat--
B D                  Microbat  tacc-ttttct-cc----c--tgtatat--
B D                     Shrew  tacc-ttttct-cc----c--tatatat--
              Star-nosed mole  tacc-ttttct-cc----t--tatgtat--
B D                  Elephant  tacc-ttttct-cc----c--tatatgt--
          Cape elephant shrew  tacg-ttttct-ct----ctatatatat--
B D                   Manatee  tacc-ttttct-cc----c--tatatat--
             Cape golden mole  tacc-ttttct-cc----c--tatatat--
B D                    Tenrec  tacc-ttttct-ccccatc--tatatat--
                     Aardvark  tacc-ttttct-cc----c--tatatat--
B D                 Armadillo  tacc-ttttct-ca----c--tatatat--
B D                   Opossum  tacc-ttttct-cc----c--tatatat--
B D                   Wallaby  tacc-ttttct-ct----c--tatacat--
B D                  Platypus  tacctttttct-cc----c--tatatat--
  D               Rock pigeon  tacc-ttagtt-ct----c--tatatat--
  D              Saker falcon  tacc-ttagtt-cc----t--tatatat--
  D          Peregrine falcon  tacc-ttagtt-cc----t--tatatat--
  D       Collared flycatcher  tacc-ttagtt-cc----ttatatatat--
  D    White-throated sparrow  tacc-ttagtt-cc----t--tatatat--
B D       Medium ground finch  tacc-ttagtt-cc----t--tatatat--
B D               Zebra finch  tacc-ttagtt-cc----t--tatatat--
           Tibetan ground jay  tacc-ttagtt-cc----t--tatatat--
B D                Budgerigar  tacc-tcggtt-cc----ctatatatat--
  D                    Parrot  tacc-tcggtt-cc----ttatatatat--
  D             Scarlet macaw  tacc-tcggtt-cc----ttatatatat--
  D              Mallard duck  tacc-ttagtt-cc----c--tatatat--
B D                   Chicken  tacc-ttagct-cc----c--tatatat--
B D                    Turkey  tacc-ttagct-cc----c--tatatat--
B D        American alligator  tacc-ttagct-cc----c--tatatat--
  D           Green seaturtle  tacc-gtagct-cc----c--aatatat--
  D            Painted turtle  taac-gtagct-cc----c--tatatat--
  D  Chinese softshell turtle  tact-gtagct-cc----c--tatatat--
  D    Spiny softshell turtle  tact-gtagct-cc----c--tatatat--
B D             X. tropicalis  tcca-tgttgt-ct----a--tgtttat--
B D                Coelacanth  tgtc-ttatct-cc----c--tatatat--
          Pundamilia nyererei  --tt-caattg-tt----c--tacatacgt
           Southern platyfish  --tt-ctcttt-tt----t--tgcat----
B D               Stickleback  --tc-ataatg-tt----c--tgcacat--
B D                 Zebrafish  --gc-ttaaac-ac----t--tgaccactg
                  Spotted gar  --ct-gtcttc-cg----a--tgtgtctga
B D                  Hedgehog  ==============================
B D                    Lizard  ==============================
B D              Atlantic cod  ==============================
                 Zebra mbuna  ==============================
B D              Nile tilapia  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                    Medaka  ==============================
    Mexican tetra (cavefish)  ==============================
B D                 Tetraodon  ==============================
B D           Tasmanian devil  ==============================

Inserts between block 16 and 17 in window
B D                 Squirrel 4bp
                Prairie vole 11bp
B D          Chinese hamster 17bp
              Golden hamster 11bp
B D                    Mouse 63bp
B D                      Rat 83bp

Alignment block 17 of 1468 in window, 67372995 - 67373005, 11 bps 
B D                     Human  accttct-ggca----------
B D                     Chimp  accttct-ggca----------
B D                   Gorilla  accttct-ggca----------
B D                 Orangutan  agcttct-ggca----------
B D                    Gibbon  accttct-ggca----------
B D                    Rhesus  accttct-ggca----------
B D       Crab-eating macaque  accttct-ggca----------
B D                    Baboon  accttct-ggca----------
B D              Green monkey  accttct-ggca----------
B D                  Marmoset  accttct-ggca----------
B D           Squirrel monkey  accttct-ggca----------
B D                  Bushbaby  accttct-ggca----------
           Chinese tree shrew  accttct-ggca----------
B D                  Squirrel  accttct-ggca----------
       Lesser Egyptian jerboa  accttct-ggca----------
                 Prairie vole  accttct-gaca----------
B D           Chinese hamster  accttct-gaca----------
               Golden hamster  accttct-gaca----------
B D                     Mouse  accttct-gaca----------
B D                       Rat  accttct-gaca----------
B D            Naked mole-rat  accttct-ggca----------
B D                Guinea pig  acctcct-ggca----------
                   Chinchilla  acctcct-ggca----------
             Brush-tailed rat  accttct-ggca----------
B D                    Rabbit  accttct-ggca----------
B D                      Pika  accttct-ggca----------
B D                    Alpaca  accttct-ggca----------
               Bactrian camel  accttct-ggca----------
B D                   Dolphin  accttct-ggcg----------
                 Killer whale  accttct-ggtg----------
             Tibetan antelope  acctcctgggca----------
B D                       Cow  acctcctgggca----------
B D                     Sheep  acctcctgggca----------
                Domestic goat  acctcctgggca----------
B D                     Horse  accttct-ggca----------
B D          White rhinoceros  accttct-ggca----------
B D                       Cat  accttct-ggca----------
B D                       Dog  accttct-ggca----------
B D                   Ferret   accttct-ggca----------
B D                     Panda  accttct-ggca----------
               Pacific walrus  accttct-ggca----------
                 Weddell seal  accttct-ggca----------
             Black flying-fox  accttct-ggca----------
B D                   Megabat  accttct-ggca----------
                Big brown bat  accttct-ggca----------
         David's myotis (bat)  accttct-ggca----------
B D                  Microbat  accttct-ggca----------
B D                  Hedgehog  acctcca-ggcg----------
B D                     Shrew  accttct-ggca----------
              Star-nosed mole  accttct-ggca----------
B D                  Elephant  accttct-ggca----------
          Cape elephant shrew  accttct-ggca----------
B D                   Manatee  accttct-ggca----------
             Cape golden mole  accttct-ggca----------
B D                    Tenrec  accttct-ggca----------
                     Aardvark  accttct-ggca----------
B D                 Armadillo  accttct-ggca----------
B D                   Opossum  accttct-ggca----------
B D                   Wallaby  accttct-ggca----------
B D                  Platypus  accttct-ggca----------
  D               Rock pigeon  accttgt-ggca----------
  D              Saker falcon  accttgt-ggca----------
  D          Peregrine falcon  accttgt-ggca----------
  D       Collared flycatcher  accttgt-ggca----------
  D    White-throated sparrow  accttgt-ggca----------
B D       Medium ground finch  accttgt-ggca----------
B D               Zebra finch  accttgt-ggca----------
           Tibetan ground jay  accttgt-ggca----------
B D                Budgerigar  accttgt-ggca----------
  D                    Parrot  accttgt-ggca----------
  D             Scarlet macaw  accttgt-ggca----------
  D              Mallard duck  accttgt-ggca----------
B D                   Chicken  accttgt-ggca----------
B D                    Turkey  accttgt-ggca----------
B D        American alligator  accttgt-ggca----------
  D           Green seaturtle  accttgt-ggca----------
  D            Painted turtle  accttgt-ggca----------
  D  Chinese softshell turtle  accttgt-ggca----------
  D    Spiny softshell turtle  accttgt-ggca----------
B D             X. tropicalis  -----gt-agaa----------
B D                Coelacanth  accttct-ggca----------
          Pundamilia nyererei  -----------aatat-----t
B D                 Zebrafish  -----------acg--------
                  Spotted gar  -----------agcagagaaat
B D                    Lizard  ======================
B D              Atlantic cod  ======================
          Southern platyfish  ----------------------
                 Zebra mbuna  ======================
B D              Nile tilapia  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D                    Medaka  ======================
    Mexican tetra (cavefish)  ======================
B D                 Tetraodon  ======================
B D               Stickleback  ----------------------
B D           Tasmanian devil  ======================

Inserts between block 17 and 18 in window
B D            X. tropicalis 5bp
B D               Coelacanth 1bp

Alignment block 18 of 1468 in window, 67373006 - 67373030, 25 bps 
B D                     Human  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D                     Chimp  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D                   Gorilla  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D                 Orangutan  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D                    Gibbon  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D                    Rhesus  cttta---atttgctc---ag----------------------------------a----aaaaaaa--g
B D       Crab-eating macaque  cttta---atttgctc---ag----------------------------------a----aaaaaaa--g
B D                    Baboon  cttta---atttgctc---ag----------------------------------a----aaaaaaa--g
B D              Green monkey  cttta---atttgctc---ag----------------------------------a----aaaaaaa--g
B D                  Marmoset  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D           Squirrel monkey  cttta---atttgctc---ag----------------------------------a----aaaaaaa--a
B D                  Bushbaby  ctata---atttgcta---ag----------------------------------a----aaaaaaa---
           Chinese tree shrew  gttta---atttgcta---gg----------------------------------a----aaaaaaa--a
B D                  Squirrel  cttta---atttgcta---gg----------------------------------g----gaaaaaa--a
       Lesser Egyptian jerboa  cttta---atttgcta---ag----------------------------------a----aaaaaaa--a
                 Prairie vole  tttta---atttgcta---g------------------------------------------aaaaa--a
B D           Chinese hamster  tttta---atttgcta---g-----------------------------------------aaaaaa--a
               Golden hamster  tttta---atttgcta---g-----------------------------------------aaaaaa--a
B D                     Mouse  cttta---atttggta---gg----------------------------------------aaaaaa--c
B D                       Rat  cttta---atttggta---gg----------------------------------------aaaaaa--c
B D            Naked mole-rat  cttta---atttgcta---ga------------------------------------------aaaa--a
B D                Guinea pig  cttta---atttgcca---gg----------------------------------------aaaaaa--a
                   Chinchilla  cttta---atttgcta---gg----------------------------------a-----aaaaaa--a
             Brush-tailed rat  cttta---atttgcta---ga----------------------------------a-----aaaaaa--a
B D                    Rabbit  cttta---atttgcta---gg----------------------------------a----aaaaaaa--a
B D                      Pika  ctttc---atttgcta---ag----------------gggatggggaaaaaaaaaa----gaaaaga--a
B D                    Alpaca  cttta---attcccca---gg--------------------------------aaa----aaaaaaa--a
               Bactrian camel  cttta---attcgcca---gg----------------------------------a----aaaaaaa--a
B D                   Dolphin  cttta---atttgcta---gg----------------------------------a----aaaaaaa--a
                 Killer whale  cttta---atttgcta---gg----------------------------------a----aaaaaaa--a
             Tibetan antelope  cttta---atttgcta---gg--------------------------------g-g----aaaaaaa--a
B D                       Cow  cttta---atttgcta---gg--------------------------------gaa----aaaaaaa--a
B D                     Sheep  cttta---atttgcta---gg--------------------------------g-g----aaaaaaa--a
                Domestic goat  cttta---atttgcta---gg--------------------------------g-g----aaaaaaa--a
B D                     Horse  cttta---atttgcta---gg--------------------------------g-g----aaaaaaa--a
B D          White rhinoceros  cttta---atttgcta---gg-------------------------------aa-a----aaaaaaa--a
B D                       Cat  cttta---atttgcta---gg---------------------------------------aaaaaaa--a
B D                       Dog  cttta---atttgcta---ag---------------------------------------aaaaaaa--a
B D                   Ferret   cttta---atttgctt---gg---------------------------------------aaaaaaa--a
B D                     Panda  cttta---atttgcta---gg---------------------------------------aaaaaaa--a
               Pacific walrus  cttta---atttgcta---gg---------------------------------------aaaaaaa--a
                 Weddell seal  cttta---atttgcta---gg---------------------------------------aaaaaaa--a
             Black flying-fox  cttca---atttgcta---gg----------------------------------------aaaaaa--a
B D                   Megabat  cttca---atttgctg---gg----------------------------------------aaaaaa--a
                Big brown bat  cttta---atttgcta---gg----------------------------------------ggaaaa--a
         David's myotis (bat)  cttta---atttgcta---gg----------------------------------------ggaaaa--a
B D                  Microbat  cttta---atttgcga---gg----------------------------------------ggaaaa--a
B D                  Hedgehog  ccatg---atttgttt---gg---------------------------------gg----gcgggaa--g
B D                     Shrew  cttta---atttgcta---gg-------------------------------caaa----aaaaaaa--a
              Star-nosed mole  cttta---atttgcta---gg----------------------------------a----aaaaaaa--a
B D                  Elephant  cttta---atttgcta---gg----------------------------------a----aaaaaaa--a
          Cape elephant shrew  cttta---atttgcta---ag---------------------------------------aaaaaaa--a
B D                   Manatee  cttca---atttgcaa---gg---------------------------------------aaaaaaa--a
             Cape golden mole  cttta---atttgcta---gg----------------------------------g---aaaaaaaa--a
B D                    Tenrec  ctttc---actgtcag---gg----------------------------------g-------gaga--a
                     Aardvark  cttta---atttgcta---gg----------------------------------a--aaaaaaaaa--a
B D                 Armadillo  cttta---atttgcta---gg---------------------------------------aaaaaaa--a
B D                   Opossum  cttta---atttgcta---gg----------------------------------g----aaaaaaa--a
B D                   Wallaby  cttta---atttgcta---gg----------------------------------a----aaaaaaa--a
B D                  Platypus  cttta---atttgcta---gg----------------------------------agaaaaaaaaaa--a
  D               Rock pigeon  -ctca---atttgct----gg-------------------------------gcaa----aaaaaaa--a
  D              Saker falcon  -ctta---atttgca----ga---------------------------------------aaaaaaa--a
  D          Peregrine falcon  -ctta---atttgca----ga---------------------------------------aaaaaaa--a
  D       Collared flycatcher  -ctta---atttgct----gc-----------------------aaaaaaaaaaaa----aaaaaaa--a
  D    White-throated sparrow  -ctta---atttgct----gc------------------------------aaaaa----aaaaaaa--a
B D       Medium ground finch  -ctta---atttgct----gc--------------------------------aaa----aaaaaaa--a
B D               Zebra finch  -ctta---atttgct----gc-------------------------------aaaa----aaaaaaa--a
           Tibetan ground jay  -ctta---atttgct----gc-------------------------aaaaaaaaaa----taaaaaa--a
B D                Budgerigar  -ctta---atttgct----gg---------------------------------------ggaaaaa--a
  D                    Parrot  -ctta---atttgctg---gg---------------------------------------gaaaaaa--g
  D             Scarlet macaw  -ctta---atttgct----gg---------------------------------------gaaaaaa--g
  D              Mallard duck  -ctta---atttgct----ga----------------------------------------aaaaaa--a
B D                   Chicken  -ctta---atttgct----ga----------------------------------------caaaaa--a
B D                    Turkey  -ctta---atttgct----ga-----------------------------------------aaaaa--a
B D        American alligator  -ctta---atttgct----gg----------------------------------------aaaaaa--a
  D           Green seaturtle  -gtaa---attggct----gg----------------------------------------aaaaaa--a
  D            Painted turtle  -gtaa---attggct----gg----------------------------------------aaaaaa--a
  D  Chinese softshell turtle  -gtaa---attggct----gg----------------------------------------aaaaaa--a
  D    Spiny softshell turtle  -gtaa---attggct----gg----------------------------------------aaaaaa--a
B D                    Lizard  cttag---atttgtg----gc----------------------------------a----ggcaaag--a
B D             X. tropicalis  cttcacctcttcttca---gg----------------------------------g----agactga--a
B D                Coelacanth  ttctc---atttgtta---ag----------------------------------a----aaaaaaacta
          Pundamilia nyererei  ctgta---atccttttcttgt----------------------------------a--------------
           Southern platyfish  -tgaa---atttgctc------------------------------------------------------
B D               Stickleback  -tttt---acccattcagcat----------------------------------a--------------
B D                 Zebrafish  -tata---agtttctatttgt----------------------------cagacca--------------
                  Spotted gar  atata---gacttacctttgtggcagttttcattcggtaaaaagaaaaacaataca--------------
B D              Atlantic cod  ======================================================================
                 Zebra mbuna  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Tetraodon  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  a
                        Chimp  a
                      Gorilla  a
                    Orangutan  a
                       Gibbon  a
                       Rhesus  a
          Crab-eating macaque  a
                       Baboon  a
                 Green monkey  a
                     Marmoset  a
              Squirrel monkey  a
                     Bushbaby  a
           Chinese tree shrew  a
                     Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
              Chinese hamster  a
               Golden hamster  a
                        Mouse  a
                          Rat  a
               Naked mole-rat  a
                   Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
                       Rabbit  a
                         Pika  a
                       Alpaca  a
               Bactrian camel  a
                      Dolphin  a
                 Killer whale  a
             Tibetan antelope  g
                          Cow  a
                        Sheep  a
                Domestic goat  a
                        Horse  a
             White rhinoceros  a
                          Cat  a
                          Dog  a
                      Ferret   t
                        Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
                      Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
                     Microbat  a
                     Hedgehog  c
                        Shrew  a
              Star-nosed mole  a
                     Elephant  a
          Cape elephant shrew  a
                      Manatee  a
             Cape golden mole  a
                       Tenrec  a
                     Aardvark  a
                    Armadillo  a
                      Opossum  a
                      Wallaby  a
                     Platypus  t
                  Rock pigeon  t
                 Saker falcon  t
             Peregrine falcon  t
          Collared flycatcher  t
       White-throated sparrow  t
          Medium ground finch  t
                  Zebra finch  t
           Tibetan ground jay  t
                   Budgerigar  g
                       Parrot  g
                Scarlet macaw  g
                 Mallard duck  t
                      Chicken  t
                       Turkey  t
           American alligator  t
              Green seaturtle  t
               Painted turtle  t
     Chinese softshell turtle  t
       Spiny softshell turtle  t
                       Lizard  g
                X. tropicalis  c
                   Coelacanth  t
          Pundamilia nyererei  -
           Southern platyfish  -
                  Stickleback  -
                    Zebrafish  -
                  Spotted gar  -
                 Atlantic cod  =
                  Zebra mbuna  =
                 Nile tilapia  =
        Burton's mouthbreeder  =
          Princess of Burundi  =
       Yellowbelly pufferfish  =
                         Fugu  =
                       Medaka  =
     Mexican tetra (cavefish)  =
                    Tetraodon  =
              Tasmanian devil  =

Inserts between block 18 and 19 in window
B D                    Chimp 2bp
          Chinese tree shrew 3bp
B D                      Cat 4bp
              Pacific walrus 1bp
         Pundamilia nyererei 14bp
B D              Stickleback 2bp
B D                Zebrafish 6bp
                 Spotted gar 1bp

Alignment block 19 of 1468 in window, 67373031 - 67373031, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  a
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D                   Wallaby  t
B D                  Platypus  c
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D                    Lizard  c
B D             X. tropicalis  a
B D                Coelacanth  c
          Princess of Burundi  t
        Burton's mouthbreeder  t
                  Zebra mbuna  t
           Southern platyfish  c
B D                 Zebrafish  t
                  Spotted gar  c
B D                   Ferret   -
B D              Atlantic cod  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D                 Tetraodon  =
B D               Stickleback  =
B D           Tasmanian devil  =

Inserts between block 19 and 20 in window
         Princess of Burundi 5bp
       Burton's mouthbreeder 5bp
                 Zebra mbuna 5bp
B D                Zebrafish 2bp

Alignment block 20 of 1468 in window, 67373032 - 67373047, 16 bps 
B D                     Human  c-------ctctc----ttgtc-----------------tacat
B D                     Chimp  c-------ctctc----ttgtc-----------------tacat
B D                   Gorilla  c-------ctctc----ttgtc-----------------tacat
B D                 Orangutan  c-------ctctc----ttgtc-----------------tacat
B D                    Gibbon  c-------ctctc----ttgtc-----------------tacat
B D                    Rhesus  c-------ctctc----ttgtc-----------------tacat
B D       Crab-eating macaque  c-------ctctc----ttgtc-----------------tacat
B D                    Baboon  c-------ctctc----ttgtc-----------------tacat
B D              Green monkey  c-------ctctc----ttgtc-----------------tacat
B D                  Marmoset  a-------ttctc----tcgtc-----------------tgcat
B D           Squirrel monkey  aaaaaattctgtc----ttgtc-----------------tacat
B D                  Bushbaby  c-------ctctc----ttgtc-----------------tacat
           Chinese tree shrew  c-------ctctc----ttgtc-----------------tacat
B D                  Squirrel  c-------ctctc----ttgtc-----------------tacat
       Lesser Egyptian jerboa  c-------ctctc----ttgtc-----------------tacat
                 Prairie vole  c-------ctcac----ttgtc-----------------tacat
B D           Chinese hamster  c-------ctcac----ttgtc-----------------tacat
               Golden hamster  c-------ctcac----ttgtc-----------------tacat
B D                     Mouse  c-------ctcac----ttgtc-----------------tatgt
B D                       Rat  c-------ctcac----ttgtc-----------------tacgt
B D            Naked mole-rat  c-------ctctc----ttgtc-----------------tacat
B D                Guinea pig  c-------ctctc----ttgcc----------------ttacat
                   Chinchilla  c-------ctctg----ttgtc-----------------tacaa
             Brush-tailed rat  c-------ctctc----ttgtc-----------------tacat
B D                    Rabbit  c-------ctctc----ttgtc-----------------tccgt
B D                      Pika  c-------ctctt----ttgtc-----------------tccat
B D                    Alpaca  c-------ctctc----ttgtc-----------------tacat
               Bactrian camel  c-------ctctc----ttgtc-----------------tacat
B D                   Dolphin  c-------ctctc----ttgtc-----------------tactt
                 Killer whale  c-------ctctc----ttgtc-----------------tacgt
             Tibetan antelope  c-------ctctc----ttgtc-----------------tacat
B D                       Cow  c-------ctctc----ttgtc-----------------tacat
B D                     Sheep  c-------ctctc----ttgtc-----------------tccat
                Domestic goat  c-------ctctc----ttgtc-----------------tccat
B D                     Horse  c-------ctctc----ttgtc-----------------tacat
B D          White rhinoceros  c-------ctctc----ttgtc-----------------tacat
B D                       Cat  c-------ctctc----ttgtc-----------------tacat
B D                       Dog  c-------ctctc----ttgtc-----------------tacat
B D                   Ferret   ---------cctc----ttgtc-----------------tacat
B D                     Panda  c-------ctctc----ttgtc-----------------tacat
               Pacific walrus  c-------ctctc----tcgtc-----------------tacat
                 Weddell seal  c-------ctctc----tcgtc-----------------tacat
             Black flying-fox  c-------ctgtc----ttgtc-----------------tacat
B D                   Megabat  c-------ctgtc----ttgtc-----------------tacat
                Big brown bat  c-------ctgtc----ttgtc-----------------tacat
         David's myotis (bat)  c-------ctgtc----ttgtc-----------------tacat
B D                  Microbat  c-------ctgtc----ttgtc-----------------tacat
B D                  Hedgehog  c-------ctctccctgtcgtc-----------------tccat
B D                     Shrew  c-------ctgtc----ttgtc-----------------tacat
              Star-nosed mole  c-------ctctc----ttgtc-----------------tacat
B D                  Elephant  c-------ctctc----ttgtc-----------------tgcat
          Cape elephant shrew  c-------ctctc----ttgtc-----------------tgcat
B D                   Manatee  c-------ctctc----ttgtc-----------------tacat
             Cape golden mole  c-------ctctc----ttgtc-----------------tacat
B D                    Tenrec  c-------ctctc----ttgtc-----------------tgcat
                     Aardvark  c-------ctctc----ttgtc-----------------tacat
B D                 Armadillo  c-------ctctc----ttgtc-----------------tacat
B D                   Opossum  c------cctctc----ttgtc-----------------tacat
B D                   Wallaby  c------cctctc----ttgtc-----------------tacaa
B D                  Platypus  c-------ctctc----ttgtc-----------------tacat
  D               Rock pigeon  c-------ctctc----ttgtc-----------------tacat
  D              Saker falcon  c-------ctctc----ttgtc-----------------tacat
  D          Peregrine falcon  c-------ctctc----ttgtc-----------------tacat
  D       Collared flycatcher  c-------ctctc----ttgtc-----------------tacat
  D    White-throated sparrow  c-------ctctc----ttgtc-----------------tacat
B D       Medium ground finch  c-------ctctc----ttgtc-----------------tacat
B D               Zebra finch  c-------ctctc----ttgtc-----------------tacat
           Tibetan ground jay  c-------ctctc----ttgtc-----------------tacat
B D                Budgerigar  c-------ctctc----tcgtc-----------------tccat
  D                    Parrot  c-------ctctc----tcgtc-----------------tccat
  D             Scarlet macaw  c-------ctctc----tcttc-----------------tccat
  D              Mallard duck  c-------ctctc----ttgtc-----------------tacat
B D                   Chicken  c-------ctctc----ttgtc-----------------tacat
B D                    Turkey  c-------ctctc----tcgtc-----------------tacat
B D        American alligator  c-------ctccc----ttgtc-----------------tacat
  D           Green seaturtle  c-------ctctc----ttgtc-----------------tactt
  D            Painted turtle  c-------ctctc----ttgtc-----------------tacat
  D  Chinese softshell turtle  c-------ctctc----ttgtc-----------------tacat
  D    Spiny softshell turtle  c-------ctctc----ttgtc-----------------tacat
B D                    Lizard  g-------ctcac----ttgcc-----------------tctct
B D             X. tropicalis  c-------ctctc-------tc----------------------
B D                Coelacanth  c-------ctttc----ttgtc-----------------tgtaa
B D              Nile tilapia  c-------ttttc----ttgta----------------------
          Princess of Burundi  c-------ttttc----ttgta----------------------
        Burton's mouthbreeder  c-------ttttc----ttgta----------------------
                  Zebra mbuna  c-------ttttc----ttgta----------------------
           Southern platyfish  t-------tttgc----gtgtagacgtc----------------
B D               Stickleback  ---------tgtc----gtgtc------tgt-------------
B D                 Zebrafish  t-------ctgtg----ctgtc---------at-----------
                  Spotted gar  t-------tcccc----ttgtc-----------tgtgc------
B D              Atlantic cod  ============================================
         Pundamilia nyererei  ============================================
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D                    Medaka  ============================================
    Mexican tetra (cavefish)  ============================================
B D                 Tetraodon  ============================================
B D           Tasmanian devil  ============================================

Alignment block 21 of 1468 in window, 67373048 - 67373048, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  g
B D                      Pika  g
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D                   Wallaby  t
B D                  Platypus  t
  D               Rock pigeon  t
  D              Saker falcon  t
  D          Peregrine falcon  t
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
B D               Zebra finch  t
           Tibetan ground jay  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                    Lizard  g
B D                Coelacanth  a
     Mexican tetra (cavefish)  t
                  Spotted gar  c
B D              Atlantic cod  =
          Southern platyfish  -
                 Zebra mbuna  -
B D              Nile tilapia  -
         Pundamilia nyererei  =
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D             X. tropicalis  -
B D                 Zebrafish  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Medaka  =
B D                 Tetraodon  =
B D               Stickleback  -
B D           Tasmanian devil  =

Alignment block 22 of 1468 in window, 67373049 - 67373049, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  t
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D                   Wallaby  g
B D                  Platypus  g
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  g
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  g
B D                    Lizard  g
B D                Coelacanth  g
B D                      Fugu  g
       Yellowbelly pufferfish  g
B D              Nile tilapia  g
          Princess of Burundi  g
        Burton's mouthbreeder  g
                  Zebra mbuna  g
           Southern platyfish  a
B D               Stickleback  g
     Mexican tetra (cavefish)  g
B D              Atlantic cod  =
         Pundamilia nyererei  =
                 Spotted gar  -
B D             X. tropicalis  -
B D                 Zebrafish  -
B D                    Medaka  =
B D                 Tetraodon  =
B D           Tasmanian devil  =
B D          White rhinoceros  -

Inserts between block 22 and 23 in window
B D             Nile tilapia 13bp
         Princess of Burundi 13bp
       Burton's mouthbreeder 13bp
                 Zebra mbuna 13bp
          Southern platyfish 8bp

Alignment block 23 of 1468 in window, 67373050 - 67373072, 23 bps 
B D                     Human  ctgtcaccacttt-gtcag-aaagt
B D                     Chimp  ctgtcaccacttt-gtcag-aaagt
B D                   Gorilla  ctgtcaccacttt-gtcag-aaagt
B D                 Orangutan  ctgtcaccacttt-gtcag-aaagt
B D                    Gibbon  ctgtcaccacttt-gtcag-aaagt
B D                    Rhesus  ctgtcaccacttt-gtcag-aaagt
B D       Crab-eating macaque  ctgtcaccacttt-gtcag-aaagt
B D                    Baboon  ctgtcaccacttt-gtcag-aaagt
B D              Green monkey  ctgtcaccacttt-gtcag-aaagt
B D                  Marmoset  ctgtcaccacttt-gtcag-aaagt
B D           Squirrel monkey  ctgtcaccacttt-gtcag-aaagt
B D                  Bushbaby  ctgtcaccacttt-gtcag-aaagt
           Chinese tree shrew  ctgtcaccacttt-gtcag-aaagt
B D                  Squirrel  ctgtcaccacttt-gtcag-aaagt
       Lesser Egyptian jerboa  ccatcaccacttt-gtcag-aaagt
                 Prairie vole  ctgtcaccacttt-gtcag-aaagt
B D           Chinese hamster  ctgtcaccacttt-gtcag-aaagt
               Golden hamster  ctgtcaccacttt-gtcag-aaagt
B D                     Mouse  ctgtcaccacttt-gtcag-aaagt
B D                       Rat  ctgtcaccacttt-gtcag-aaagt
B D            Naked mole-rat  ctgtcaccacttt-gtcag-aaagt
B D                Guinea pig  ctgtcaccacttt-gtcag-aaagt
                   Chinchilla  ctgtcaccacttt-gtcag-aaagt
             Brush-tailed rat  ctgtcaccacttt-gtcag-aaagt
B D                    Rabbit  ctgtcaccacttt-gtcag-aaagt
B D                      Pika  ctgtcaccacttt-gtcag-aaagt
B D                    Alpaca  ctgtcaccacttt-gtcag-aaagt
               Bactrian camel  ctgtcaccacttt-gtcag-aaagt
B D                   Dolphin  ctgtcaccacttt-gtcag-aaagt
                 Killer whale  ctgtcaccacttt-gtcag-aaagt
             Tibetan antelope  ctgtcaccacttt-gtcag-aaagt
B D                       Cow  ctgtcaccacttt-gtcag-aaagt
B D                     Sheep  ctgtcaccacttt-gtcag-aaagt
                Domestic goat  ctgtcaccacttt-gtcag-aaagt
B D                     Horse  ctgtcaccacttt-gtcag-aaagt
B D          White rhinoceros  ttgtcaccacttt-gtcag-aaagt
B D                       Cat  ctgtcaccacttt-gtcag-aaagt
B D                       Dog  ctgtcaccacttt-gtcag-aaagt
B D                   Ferret   ctgtcaccacttt-gtcag-aaagt
B D                     Panda  ctgtcaccacttt-gtcag-aaagt
               Pacific walrus  ctgtcaccacttt-gtcag-aaagt
                 Weddell seal  ctgtcaccacttt-gtcag-aaagt
             Black flying-fox  ctgtcaccacttt-gtcag-aaagt
B D                   Megabat  ctgtcaccacttt-gtcag-aaagt
                Big brown bat  ctgtcaccacttt-gtcag-aaagt
         David's myotis (bat)  ctgtcaccacttt-gtcag-aaagt
B D                  Microbat  ctgtcaccacttt-gtcag-aaagt
B D                  Hedgehog  ctgtcaccactct-gtcag-aaagt
B D                     Shrew  ctgtcaccacttt-gtcag-aaagt
              Star-nosed mole  ctgtcaccacttt-gtcag-aaagt
B D                  Elephant  ctgtcaccacttt-gtcag-aaagt
          Cape elephant shrew  ctgtcaccacttt-gtcag-aaagt
B D                   Manatee  ctgtcaccacttt-gtcag-aaagt
             Cape golden mole  ctgtcaccacttt-gtcag-aaagt
B D                    Tenrec  ctgtcaccacttt-gtcag-aaagt
                     Aardvark  ctgtcaccacttt-gtcag-aaagt
B D                 Armadillo  ctgtcaccacttt-gtcag-aaagt
B D                   Opossum  ctgtcaccacttt-gtcag-aaagt
B D                   Wallaby  ctgtcaccacttt-gtcag-aaagt
B D                  Platypus  ctgtcaccacttt-gtcag-aaagt
  D               Rock pigeon  ctgtcaccacttt-gtcag-aaagt
  D              Saker falcon  ctgtcaccacttt-gtcag-aaagt
  D          Peregrine falcon  ctgtcaccacttt-gtcag-aaagt
  D       Collared flycatcher  ctgtcaccacttt-gtcag-aaagt
  D    White-throated sparrow  ctgtcaccacttt-gtcag-aaagt
B D       Medium ground finch  ctgtcaccacttt-gtcag-aaagt
B D               Zebra finch  ctgtcaccacttt-gtcag-aaagt
           Tibetan ground jay  ctgtcaccacttt-gtcag-aaagt
B D                Budgerigar  ctgtcaccacttt-gtcag-aaagt
  D                    Parrot  ctgtcaccacttt-gtcag-aaagt
  D             Scarlet macaw  ctgtcaccacttt-gtcag-aaagt
  D              Mallard duck  ctgtcactacttt-gtcag-aaagt
B D                   Chicken  ctgtcaccacttt-gtcag-aaagt
B D                    Turkey  ctgtcaccacttt-gtcag-aaagt
B D        American alligator  ctgtcaccacttt-gtcag-aaagt
  D           Green seaturtle  ctgtcaccacttt-gtcag-aaagt
  D            Painted turtle  ctgtcaccacttt-gtcag-aaagt
  D  Chinese softshell turtle  ctgtcaccacttt-gtcag-aaagt
  D    Spiny softshell turtle  ctgtcaccacttt-gtcag-aaagt
B D                    Lizard  cagtcactacttt-gtcag-aaagt
B D             X. tropicalis  ctgtcattgctcc-atcag-gaagt
B D                Coelacanth  ctgtcactacttt-gtcag-aaagt
B D                 Tetraodon  ctgtca----cctgggtgg-aaagt
B D                      Fugu  ctgtca----tctgggttg-aacat
       Yellowbelly pufferfish  ctgtca----tctgggttg-aacat
B D              Nile tilapia  gtgtca----tct-ggctg-aacat
          Princess of Burundi  gtgtca----tct-ggctg-aacat
        Burton's mouthbreeder  gtgtca----tct-ggctg-aacat
                  Zebra mbuna  gtgtca----tct-ggctg-aacat
          Pundamilia nyererei  gtgtca----tct-ggctg-aacat
           Southern platyfish  ctgtca----tctggcctg-aacat
B D               Stickleback  ctgtca----tctgggttg-aacat
B D                 Zebrafish  -----------tc---ctgtaacat
     Mexican tetra (cavefish)  ctgtca----tcc---ctgtaacat
                  Spotted gar  ctgtca----tct-tttggtaacgt
B D              Atlantic cod  =========================
B D                    Medaka  =========================
B D           Tasmanian devil  =========================

Inserts between block 23 and 24 in window
B D              Stickleback 1bp

Alignment block 24 of 1468 in window, 67373073 - 67373331, 259 bps 
B D                     Human  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                     Chimp  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Gorilla  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                 Orangutan  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Gibbon  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Rhesus  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D       Crab-eating macaque  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Baboon  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D              Green monkey  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Marmoset  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D           Squirrel monkey  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Bushbaby  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
           Chinese tree shrew  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Squirrel  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
       Lesser Egyptian jerboa  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                 Prairie vole  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D           Chinese hamster  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
               Golden hamster  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                     Mouse  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                       Rat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D            Naked mole-rat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                Guinea pig  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                   Chinchilla  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
             Brush-tailed rat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Rabbit  atttaagttttcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                      Pika  atttaagttttcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Alpaca  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
               Bactrian camel  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Dolphin  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                 Killer whale  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
             Tibetan antelope  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                       Cow  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                     Sheep  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                Domestic goat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                     Horse  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D          White rhinoceros  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                       Cat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                       Dog  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Ferret   atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                     Panda  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
               Pacific walrus  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                 Weddell seal  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
             Black flying-fox  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Megabat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                Big brown bat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
         David's myotis (bat)  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Microbat  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Hedgehog  atttaagtttgcagacaggc-tttaattagtgctcacgatttcatc------------------tatgtt
B D                     Shrew  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
              Star-nosed mole  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Elephant  atttaagtttgcagacaggcttttaattagtgctcacaatttcatt------------------tatgtt
          Cape elephant shrew  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Manatee  atttaaatttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
             Cape golden mole  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Tenrec  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
                     Aardvark  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                 Armadillo  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Opossum  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                   Wallaby  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                  Platypus  atttaagtttgcagacagccttttaattagtgctcacaatttcatt------------------tatgtt
  D               Rock pigeon  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
  D              Saker falcon  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
  D          Peregrine falcon  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
  D       Collared flycatcher  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
  D    White-throated sparrow  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
B D       Medium ground finch  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
B D               Zebra finch  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
           Tibetan ground jay  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
B D                Budgerigar  atttaagtttgcagccaggctcttaattagtgctcacaatttcatt------------------tatgtt
  D                    Parrot  atttaagtttgcagccaggctcttaattagtgctcacaatttcatt------------------tatgtt
  D             Scarlet macaw  atttaagtttgcagccaggctcttaattagtgctcacaatttcatt------------------tatgtt
  D              Mallard duck  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
B D                   Chicken  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
B D                    Turkey  atttaagtttgcagacagcctcttaattagtgctcacaatttcatt------------------tatgtt
B D        American alligator  atttaagtttggagacagccttttaattagtgctcacaatttcatt------------------tatgtt
  D           Green seaturtle  atttaagtttgtagacagccttttaattagtgctcacaatttcatt------------------tatgtt
  D            Painted turtle  atttaagtttgtagacagccttttaattagtgctcacaatttcatt------------------tatgtt
  D  Chinese softshell turtle  atttaagtttgtagacagccttttaattagtgctcacaatttcatt------------------tatgtt
  D    Spiny softshell turtle  atttaagtttgtagacagccttttaattagtgctcacaatttcatt------------------tatgtt
B D                    Lizard  acttaagtttgcagacaggcttttaattagtgctcaccatttcatt------------------tatgtt
B D             X. tropicalis  atttaac-------acggccttttaattagtgcgcaccatttaatt------------------tatatt
B D                Coelacanth  atttaagtttgcagacaggcttttaattagtgctcacaattttgtt------------------tatgtt
B D                 Tetraodon  ctttagaggtgcagacacagtattaatttgtatctacaagttaatttagttgtaacatcatgtgcatgtg
B D                      Fugu  ctttagaggtgttgacacaatattaattagtacctacaagttcatttagttttaacatcac-tgcgtgtc
       Yellowbelly pufferfish  ctttagaggtgttgacacaatattaattagtacctacaagttcatttagttttaacatcac-tgcgtgtc
B D              Nile tilapia  cttctagagtgctgacataatattaattagtgcctacaacttcatttagttttaccattac-tgtgtgtg
          Princess of Burundi  cttctagagcgctgacataatattaattagtgcctacaacttcatttagttttaccattac---tgtgtg
        Burton's mouthbreeder  cttctagagcgctgacataatattaattagtgcctacaacttcatttagttttaccattac---tgtgtg
                  Zebra mbuna  cttctagagcgctgacataatattaattagtgcctaaaacctcatttagttttaccattac---tgtgtg
          Pundamilia nyererei  cttctagagcgctgacataatattaattagtgcctacaacttcatttagttttaccattac---tgtgtg
B D                    Medaka  attt---aggtttaacatcatagt-------------------------------------------gca
           Southern platyfish  cttttaaagctctgacataatattaattagtgcctacaagttcatttagatcgaacattgt---tgtgtg
B D               Stickleback  tttttagactgctgacaaaatactaattagtaccgacaagttcatttagttttaacatctc---tgtgcg
B D                 Zebrafish  ctttatgaatttcgcatgtctcttaattagtgcccacatgttcatttatcctcaccgccac---tcaccg
     Mexican tetra (cavefish)  cttcatgaatgtagcatgtcttttaattagcccccacacgttcatttgttcgtagcgtcag---tcagtt
                  Spotted gar  ctttataaacgcagacagccttgtaattagtgctcacaacttcggttctgtttgccttcac---tctgtt
B D              Atlantic cod  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  tg-------------------------ctt------tc--------------------------tc---t
                        Chimp  tg-------------------------ctt------tc--------------------------tc---t
                      Gorilla  tg-------------------------ctt------tc--------------------------tc---t
                    Orangutan  tg-------------------------ctt------tc--------------------------tc---t
                       Gibbon  tg-------------------------ctt------tc--------------------------tc---t
                       Rhesus  tg-------------------------ctt------tc--------------------------tc---t
          Crab-eating macaque  tg-------------------------ctt------tc--------------------------tc---t
                       Baboon  tg-------------------------ctt------tc--------------------------tc---t
                 Green monkey  tg-------------------------ctt------tc--------------------------tc---t
                     Marmoset  tg-------------------------ctt------tc--------------------------tc---t
              Squirrel monkey  tg-------------------------ctt------tc--------------------------tc---t
                     Bushbaby  tg-------------------------ctt------tc--------------------------tc---t
           Chinese tree shrew  tg-------------------------ctt------tc--------------------------tc---t
                     Squirrel  tg-------------------------ctt------tc--------------------------tc---t
       Lesser Egyptian jerboa  tg-------------------------ctt------tc--------------------------tc--tt
                 Prairie vole  tg-------------------------ctt------tc--------------------------t----t
              Chinese hamster  tg-------------------------ctt------tc--------------------------tc---t
               Golden hamster  tg-------------------------ctt------tc--------------------------tc---t
                        Mouse  tg-------------------------ctt------tc--------------------------tc---t
                          Rat  tg-------------------------ctt------tc--------------------------tc---t
               Naked mole-rat  tg-------------------------ctt------tc--------------------------tc---t
                   Guinea pig  tg-------------------------ctt----------------------------------tc---t
                   Chinchilla  tg-------------------------ctt------tc--------------------------tc---t
             Brush-tailed rat  tg-------------------------ctt------tc--------------------------tc---t
                       Rabbit  tg-------------------------ctt----tctc--------------------------tt--tt
                         Pika  tg-------------------------ctt------tc--------------------------tt--tt
                       Alpaca  tg-------------------------ctt------tc--------------------------tc---t
               Bactrian camel  tg-------------------------ctt------tc--------------------------tc---t
                      Dolphin  tg-------------------------ctt------tc--------------------------tc---t
                 Killer whale  tg-------------------------ctt------tc--------------------------tc---t
             Tibetan antelope  tg-------------------------ctt------tc--------------------------tc---t
                          Cow  tg-------------------------ctt------tc--------------------------tc---t
                        Sheep  tg-------------------------ctt------tc--------------------------tc---t
                Domestic goat  tg-------------------------ctt------tc--------------------------tc---t
                        Horse  tg-------------------------ctt------tc--------------------------tc---t
             White rhinoceros  tg-------------------------ctt------tc--------------------------tc--tt
                          Cat  tg-------------------------ctt------tc--------------------------tc---t
                          Dog  tg-------------------------ctt------tc--------------------------tc---t
                      Ferret   tg-------------------------ctt------tc--------------------------tc---t
                        Panda  tg-------------------------ctt------tc--------------------------tc---t
               Pacific walrus  tg-------------------------ctt------tc--------------------------tc---t
                 Weddell seal  tg-------------------------ctt------tc--------------------------tc---t
             Black flying-fox  tg-------------------------ctt------tc--------------------------tc---t
                      Megabat  tg-------------------------ctt------tc--------------------------tc---t
                Big brown bat  tg-------------------------ctt------tc--------------------------tc---t
         David's myotis (bat)  tg-------------------------ctt------tc--------------------------tc-tct
                     Microbat  tg-------------------------ctt------tc--------------------------tctttt
                     Hedgehog  tg-------------------------cct------cc--------------------------tc---t
                        Shrew  tg-------------------------ctt------tc--------------------------tc---t
              Star-nosed mole  tg-------------------------ctt------tc--------------------------tc---t
                     Elephant  tg-------------------------ctt------tc--------------------------tc---t
          Cape elephant shrew  tg-------------------------ctt------tc--------------------------tc---t
                      Manatee  tg-------------------------ctt------tc--------------------------tc---t
             Cape golden mole  tg-------------------------ctt------tc--------------------------tc---t
                       Tenrec  tg-------------------------ctt------tc--------------------------tc---t
                     Aardvark  tg-------------------------ctt------tc--------------------------tc---t
                    Armadillo  tg-------------------------ctt------tc--------------------------tc---t
                      Opossum  tg-------------------------ctt------tc--------------------------tctttt
                      Wallaby  tg-------------------------ctt------tc--------------------------tctttt
                     Platypus  tg-------------------------ctt------tc--------------------------tc---t
                  Rock pigeon  tg-------------------------ctt------tc--------------------------tt---t
                 Saker falcon  tg-------------------------ctt------tc-------------------------ttt---t
             Peregrine falcon  tg-------------------------ctt------tc-------------------------ttt---t
          Collared flycatcher  tg-------------------------ctt------tc------------------------tttt---t
       White-throated sparrow  tg-------------------------ctt------tc--------------------------tt---t
          Medium ground finch  tg-------------------------ctt------tc--------------------------tt---t
                  Zebra finch  tg-------------------------ctt------tc--------------------------tt---t
           Tibetan ground jay  tg-------------------------ctt------tc--------------------------tt---t
                   Budgerigar  tg-------------------------ctt------gc---------------------------t---t
                       Parrot  tg-------------------------ctt------gc---------------------------t---t
                Scarlet macaw  tg-------------------------ctt------gc---------------------------t---t
                 Mallard duck  tg-------------------------ctt------tc--------------------------tt---t
                      Chicken  tg-------------------------ctt------tct-----------------------tttt---t
                       Turkey  tg-------------------------ctt------tc-------------------------ttt---t
           American alligator  tg-------------------------ctt------tc------------------------ccct---t
              Green seaturtle  tg-------------------------ctt------tc--------------------------tt---t
               Painted turtle  tg-------------------------ctt------tc-------------------------ttt---t
     Chinese softshell turtle  tg-------------------------ctt------tc---------------------------t---t
       Spiny softshell turtle  tg-------------------------ctt------tc---------------------------t---t
                       Lizard  tg-------------------------ctt------tcttctctctcccccttctctcctccttct---t
                X. tropicalis  tg-------------------------cat------tacctcccgcccgcccccaccacacacttt---c
                   Coelacanth  tg-------------------------cttttactttc--------------------------tt---t
                    Tetraodon  tg------tatacatgcacttaatgtatgt------tc--------------------------tc---a
                         Fugu  tg------tatacatgcacataatgtatgt------tc--------------------------tc---a
       Yellowbelly pufferfish  tg------tatacatgcacataatgtatgt------tc--------------------------tc---a
                 Nile tilapia  tg------tatacatgcactaaatgtatgt------tc--------------------------tc---a
          Princess of Burundi  tg------tatacatgcactaaatgtatgt------tc--------------------------tc---a
        Burton's mouthbreeder  tg------tatacatgcactaaatgtatgt------tc--------------------------tc---a
                  Zebra mbuna  tg------tatacatgcactaaatgtatgt------tc--------------------------tc---a
          Pundamilia nyererei  tg------tatacatgcactaaatgtatgt------tc--------------------------tc---a
                       Medaka  tg------tatacatgcactgaatgtatgt------tc--------------------------tt---a
           Southern platyfish  tg------tatacatgcacttaaaacatgt------tc--------------------------tc---a
                  Stickleback  tg------tatacatgcactaaatgtatgt------cc--------------------------tc---a
                    Zebrafish  tgaga---cgagacacaagcttgtgtatgt------tt--------------------------cc---a
     Mexican tetra (cavefish)  taaaagagcggacaaggagcttgtgtacgt------tt--------------------------cc---a
                  Spotted gar  tt---------------------------t------tt--------------------------tt---g
                 Atlantic cod  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                        Chimp  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Gorilla  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                    Orangutan  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                       Gibbon  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                       Rhesus  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
          Crab-eating macaque  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                       Baboon  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                 Green monkey  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Marmoset  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
              Squirrel monkey  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Bushbaby  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
           Chinese tree shrew  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Squirrel  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
       Lesser Egyptian jerboa  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                 Prairie vole  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
              Chinese hamster  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
               Golden hamster  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                        Mouse  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                          Rat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
               Naked mole-rat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                   Guinea pig  -t---ttttt---tattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                   Chinchilla  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
             Brush-tailed rat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                       Rabbit  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                         Pika  -t---ttttt---cattcatattctgttaattaagtaagctgt--ct-ctaatcttcccctgccag-tag
                       Alpaca  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
               Bactrian camel  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Dolphin  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                 Killer whale  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
             Tibetan antelope  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                          Cow  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                        Sheep  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                Domestic goat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                        Horse  -t---ttttt---cattcatattctgttaattaagtgagccgc--ct-ctaatcttccgctgccag-tag
             White rhinoceros  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccgg-ttg
                          Cat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                          Dog  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Ferret   -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                        Panda  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
               Pacific walrus  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                 Weddell seal  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
             Black flying-fox  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Megabat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                Big brown bat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
         David's myotis (bat)  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Microbat  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Hedgehog  ct---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatctt-ccctgccag-tgg
                        Shrew  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-ttg
              Star-nosed mole  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Elephant  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
          Cape elephant shrew  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Manatee  -t---ttttt---cattcatattctgttaattaagtgagctgc--gt-ctaatcttcccctgccag-tag
             Cape golden mole  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                       Tenrec  -t---ttttt---cattcatattctcttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Aardvark  -t---ttttt---cattcatattctgttaattaagtgagctgc--ctcctaatcttcccctgccag-tag
                    Armadillo  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Opossum  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                      Wallaby  -t---ttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                     Platypus  -tttcttttt---cattcatattctgttaattaagtgagctgc--ct-ctaatcttcccctgccag-tag
                  Rock pigeon  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                 Saker falcon  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
             Peregrine falcon  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
          Collared flycatcher  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
       White-throated sparrow  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
          Medium ground finch  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                  Zebra finch  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
           Tibetan ground jay  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                   Budgerigar  -t---ttttc---c-ttcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                       Parrot  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                Scarlet macaw  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                 Mallard duck  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                      Chicken  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                       Turkey  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
           American alligator  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
              Green seaturtle  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
               Painted turtle  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
     Chinese softshell turtle  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
       Spiny softshell turtle  -t---ttttt---cattcatattctgttaattaagtgagcagc--ct-ctaatcttcccctgccag-tag
                       Lizard  -t---ttttt---cattcatattctgttaattaagtgatcagc--ct-ctaatcttcccctgccag-tag
                X. tropicalis  -t---gtgtt---aattcatattcttttaattaaagcaaatacggcc-ttaatctcccctcaccag-tcg
                   Coelacanth  -t---ttttt---cattcatattctgttaattaagcaagcagg--tt-ctaatcttcccctgccag-tgg
                    Tetraodon  -g---tctttaaacattcacaccctgttaattaagg------c--cg-ctaatcttcctgtggcac-cgg
                         Fugu  -c---cctttaaacattcataccctgttaattaaag------c--cg-ctaatcttccactggcac-cgg
       Yellowbelly pufferfish  -c---cctttaaacattcataccctgttaattaaag------c--cg-ctaatcttccactggcac-cgg
                 Nile tilapia  -c---tcttaaagcattcataccctggtaattaagc------c--tg-ctaatcttcccctggcag-tag
          Princess of Burundi  -c---tcttaaagcattcataccctggtaattaagc------c--tg-ctaatcttcccctggcag-tag
        Burton's mouthbreeder  -c---tcttaaagcattcataccctggtaattaagc------c--tg-ctaatcttcccctggcag-tag
                  Zebra mbuna  -c---tcttaaagcattcataccctggtaattaagc------c--tg-ctaatcttcccctggcag-tag
          Pundamilia nyererei  -c---tcttaaagcattcataccctggtaattaagc------c--tg-ctaatcttcccctggcag-tag
                       Medaka  -t---cttttaaacattcataccctgttaattaagc------c--cg-ctaatgctcccctggcaa-gag
           Southern platyfish  -c---tctttaaacattcataccctgttaattaagc------c--tg-ctaatcttcccctggcag-tag
                  Stickleback  -c---tcttaaaacattcataccctgttaattaagc------c--ag-ctaatctccccctggcag-tag
                    Zebrafish  -c---cctttaaacactcacatccttttaattaagc------c--t---taatcttcccctggcagaaag
     Mexican tetra (cavefish)  -c---cctttaagcagtcacactatgttaattaagc------c--t---taatctacccctggcagaaag
                  Spotted gar  -t---gctttaaacattcatattctgttaattaaac------c--cc-ctaatcttcccctgccag-tag
                 Atlantic cod  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                        Chimp  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Gorilla  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                    Orangutan  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Gibbon  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Rhesus  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
          Crab-eating macaque  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Baboon  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                 Green monkey  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Marmoset  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
              Squirrel monkey  catcctgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Bushbaby  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
           Chinese tree shrew  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Squirrel  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
       Lesser Egyptian jerboa  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                 Prairie vole  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
              Chinese hamster  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
               Golden hamster  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                        Mouse  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                          Rat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
               Naked mole-rat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                   Guinea pig  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aactat
                   Chinchilla  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
             Brush-tailed rat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Rabbit  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                         Pika  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Alpaca  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
               Bactrian camel  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Dolphin  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                 Killer whale  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
             Tibetan antelope  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                          Cow  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                        Sheep  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                Domestic goat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                        Horse  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
             White rhinoceros  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                          Cat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                          Dog  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Ferret   catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                        Panda  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
               Pacific walrus  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                 Weddell seal  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
             Black flying-fox  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Megabat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                Big brown bat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
         David's myotis (bat)  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Microbat  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Hedgehog  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                        Shrew  catcctgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
              Star-nosed mole  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Elephant  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
          Cape elephant shrew  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Manatee  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
             Cape golden mole  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Tenrec  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Aardvark  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                    Armadillo  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Opossum  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Wallaby  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                     Platypus  catcgtgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                  Rock pigeon  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                 Saker falcon  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
             Peregrine falcon  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
          Collared flycatcher  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
       White-throated sparrow  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
          Medium ground finch  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                  Zebra finch  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
           Tibetan ground jay  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                   Budgerigar  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Parrot  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                Scarlet macaw  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                 Mallard duck  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                      Chicken  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Turkey  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
           American alligator  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
              Green seaturtle  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
               Painted turtle  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
     Chinese softshell turtle  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
       Spiny softshell turtle  cttcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                       Lizard  cttcatgtagccatctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                X. tropicalis  catcatgcagcctcctaattaaattaatt-g-ggggggggggaggtgaggagatgtt--t-ttaaagcat
                   Coelacanth  catcatgtagccacctaattaaattaatt-g-gg--------------gaagatgtt--t-t--aagtat
                    Tetraodon  catcatgtaccctcctgattgaattaatt-gcag--------------gaagatgttact-g--aagtaa
                         Fugu  catcatgtaccctcctgattgaattaatt-gcaa--------------gaagatgttact-a--aagtaa
       Yellowbelly pufferfish  catcatgtaccctcctgattgaattaatt-gcaa--------------gaagatgttact-a--aagtaa
                 Nile tilapia  catcatgtaccttgctgattgaattaatt-gtga--------------gaagatgttcct-a--aagtaa
          Princess of Burundi  catcatgtaccttgctgattgaattaatt-gtga--------------gaagatgttcct-a--aagtaa
        Burton's mouthbreeder  catcatgtaccttgctgattgaattaatt-gtga--------------gaagatgttcct-a--aagtaa
                  Zebra mbuna  catcatgtaccttgctgattgaattaatt-gtga--------------gaagatgttcct-a--aagtaa
          Pundamilia nyererei  catcatgtaccttgctgattgaattaatt-gtga--------------gaagatgttcct-a--aagtaa
                       Medaka  catcttgtaccttgctgattgaattaatt-gtaa--------------gaagatgtttct-a--aagtaa
           Southern platyfish  catcatgtaccttgctgattgaattaatt-gtga--------------gacgatgtttccga--aagtaa
                  Stickleback  catcatgtaccttgctgattgaattaatt-gtgg--------------gaagataatgct-a--aagtaa
                    Zebrafish  cttcatgtagcctgctaattgaattaata-gagg--------------aaagatgtttct----aagcat
     Mexican tetra (cavefish)  catcatgtagcttgttaattgaattaata-tagg--------------gaagatgttttg----atgtat
                  Spotted gar  catcatgtagccggctaattgaattaattggggg--------------gaagatgtttct----aagtat
                 Atlantic cod  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                        Chimp  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                      Gorilla  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                    Orangutan  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Gibbon  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Rhesus  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
          Crab-eating macaque  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Baboon  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                 Green monkey  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Marmoset  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
              Squirrel monkey  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Bushbaby  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
           Chinese tree shrew  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Squirrel  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
       Lesser Egyptian jerboa  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                 Prairie vole  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
              Chinese hamster  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
               Golden hamster  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                        Mouse  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                          Rat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
               Naked mole-rat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                   Guinea pig  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                   Chinchilla  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
             Brush-tailed rat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Rabbit  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                         Pika  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Alpaca  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
               Bactrian camel  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                      Dolphin  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                 Killer whale  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
             Tibetan antelope  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                          Cow  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                        Sheep  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                Domestic goat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                        Horse  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
             White rhinoceros  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                          Cat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                          Dog  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                      Ferret   gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                        Panda  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
               Pacific walrus  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                 Weddell seal  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
             Black flying-fox  gtaatta----aatcaattaatataa---tttatgcctggcgtaact------g--taca---gt-g---
                      Megabat  gtaatta----aatcaattaatataa---tttatgcctggcgtaact------g--taca---gt-g---
                Big brown bat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
         David's myotis (bat)  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Microbat  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Hedgehog  gtaatta----aatcaattaatataa---ttgatgcccggcttcact------g--taca---gt-ggga
                        Shrew  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
              Star-nosed mole  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Elephant  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
          Cape elephant shrew  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                      Manatee  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
             Cape golden mole  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Tenrec  gtaatta----aatcaattaatataa---tttatgcctggcttaacc------g--taca---gt-g---
                     Aardvark  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                    Armadillo  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-t---
                      Opossum  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                      Wallaby  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                     Platypus  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                  Rock pigeon  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                 Saker falcon  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
             Peregrine falcon  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
          Collared flycatcher  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
       White-throated sparrow  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
          Medium ground finch  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                  Zebra finch  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
           Tibetan ground jay  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                   Budgerigar  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Parrot  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                Scarlet macaw  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                 Mallard duck  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                      Chicken  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Turkey  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
           American alligator  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
              Green seaturtle  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
               Painted turtle  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
     Chinese softshell turtle  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
       Spiny softshell turtle  gtaatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                       Lizard  gtgatta----aatcaattaatataa---tttatgcctggcttaact------g--taca---gt-g---
                X. tropicalis  ataatta----aatcaattaatataa---tttaagcttggattaacc------g--tacg---gcag---
                   Coelacanth  gtaatta----aattaattaatataa---tttatgcctggcgtgact------a--tata---gt-g---
                    Tetraodon  acgctta----atttaattaaggtggtattttatgcttggtttgcttctgatag--ccca---ga-g---
                         Fugu  acgctta----atttaattaaggtggtattttatgcttggtttgcttctgatag--ccca---ga-g---
       Yellowbelly pufferfish  acgctta----atttaattaaggtggtattttatgcttggtttgcttctgatag--ccca---ga-g---
                 Nile tilapia  acgctta----atttaattatggtggtattttatgcttggtttgcttctgtgag--ccca---ga-g---
          Princess of Burundi  acgctta----atttaattacggtggtattttatgcttggtttgcttctgtgag--ccca---ga-g---
        Burton's mouthbreeder  acgctta----atttaattacggtggtattttatgcttggtttgcttctgtgag--ccca---ga-g---
                  Zebra mbuna  acgctta----atttaattacggtggtattttatgcttggtttgcttctgtgag--ccca---ga-g---
          Pundamilia nyererei  acgctta----atttaattacggtggtattttatgcttggtttgcttctgtgag--ccca---ga-g---
                       Medaka  gagctta----atttaattatggtggtattttatgcttggtttgcttctgcatg--cctaga-ga-g---
           Southern platyfish  acgctta----atttaattatgatggtattttatgcttggtttgcttctgtgag--cc-----aa-g---
                  Stickleback  acgctta----atttaattacggtgatattttatgcttggtttggttctgttag--ccca---ga-g---
                    Zebrafish  gcacttagctgatttaattaatgtga---tttatgcttggtttgtctcaatgaga-cccagg-ga-g---
     Mexican tetra (cavefish)  gcacttagctgatttaatgaatgtga---ttcatgcctgggttgtcaccacaaaagcccaga-ga-g---
                  Spotted gar  gtaatta----atttaattaatataa---tttatgcttggcttgtttctgttaa--agcaagtaa-a---
                 Atlantic cod  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -g---aaaaa----------------------------------cagctga------a------------
                        Chimp  -g---aaaaa----------------------------------cagctga------a------------
                      Gorilla  -g---aaaaa----------------------------------cagctga------a------------
                    Orangutan  -g---aaaaa----------------------------------cagctga------a------------
                       Gibbon  -g---aaaaa----------------------------------cagctga------a------------
                       Rhesus  -g---aaaaa----------------------------------cagctga------a------------
          Crab-eating macaque  -g---aaaaa----------------------------------cagctga------a------------
                       Baboon  -g---aaaaa----------------------------------cagctga------a------------
                 Green monkey  -g---aaaaa----------------------------------cagctga------a------------
                     Marmoset  -g---aaaaa----------------------------------cagctga------a------------
              Squirrel monkey  -g---aaaaa----------------------------------cagctga------a------------
                     Bushbaby  -g---aaaaa----------------------------------cagctga------a------------
           Chinese tree shrew  -g---aaaaa----------------------------------cagctga------a------------
                     Squirrel  -g---aaaaa----------------------------------cagctga------a------------
       Lesser Egyptian jerboa  -g---aaaaa----------------------------------cagctga------a------------
                 Prairie vole  -g----aaac----------------------------------cagctga------a------------
              Chinese hamster  -g---aaaaa----------------------------------cagctga------a------------
               Golden hamster  -g---aaaaa----------------------------------cagctga------a------------
                        Mouse  -g---aaaaa----------------------------------cagctga------a------------
                          Rat  -g---aaaaa----------------------------------cagctga------a------------
               Naked mole-rat  -g---aaaaa----------------------------------cagctga------a------------
                   Guinea pig  -g---aaaaa----------------------------------cagctga------a------------
                   Chinchilla  -g---aaaaa----------------------------------cagctga------a------------
             Brush-tailed rat  -g---aaaaa----------------------------------cagctga------a------------
                       Rabbit  -g---aaaaa----------------------------------cagctga------a------------
                         Pika  -ggaaaaaaa----------------------------------cagctga------a------------
                       Alpaca  -g---aaaaa----------------------------------cagctga------a------------
               Bactrian camel  -g---aaaaa----------------------------------cagctga------a------------
                      Dolphin  -c---aaaaa----------------------------------cagctga------a------------
                 Killer whale  -g---aaaaa----------------------------------cagctga------a------------
             Tibetan antelope  -g---aaaaa----------------------------------cagctga------a------------
                          Cow  -g---aaaaa----------------------------------cagctga------a------------
                        Sheep  -g---aaaaa----------------------------------cagctga------a------------
                Domestic goat  -g---aaaaa----------------------------------cagctga------a------------
                        Horse  -g---aaaaa----------------------------------cagctga------a------------
             White rhinoceros  -g---aaaag----------------------------------cagctga------a------------
                          Cat  -g---aaaaa----------------------------------cagctga------a------------
                          Dog  -g---aaaaa----------------------------------cagctga------a------------
                      Ferret   -g---aaaaa----------------------------------cagctga------a------------
                        Panda  -g---aaaaa----------------------------------cagctga------a------------
               Pacific walrus  -g---aaaaa----------------------------------cagctga------a------------
                 Weddell seal  -g---aaaaa----------------------------------cagctga------a------------
             Black flying-fox  -g---aaaaa----------------------------------cagctga------a------------
                      Megabat  -g---aaaaa----------------------------------cagctga------a------------
                Big brown bat  -g---aaaca----------------------------------cagctga------a------------
         David's myotis (bat)  -g---aaaca----------------------------------cagctga------a------------
                     Microbat  -g---aaaca----------------------------------cagctga------a------------
                     Hedgehog  ag---aaagg----------------------------------cagctcc------g------------
                        Shrew  -g---aaaaa----------------------------------cagctga------a------------
              Star-nosed mole  -g---aaaaa----------------------------------cagctga------a------------
                     Elephant  -g---aaaac----------------------------------cagctga------a------------
          Cape elephant shrew  -g---aaaaa----------------------------------cagctga------a------------
                      Manatee  -g---aaaaa----------------------------------cagctga------a------------
             Cape golden mole  -g---aaaaa----------------------------------cagctga------a------------
                       Tenrec  -g-gaaaaaa----------------------------------cagctga------a------------
                     Aardvark  -g---aaaaa----------------------------------cagctga------a------------
                    Armadillo  -g---aaaaa----------------------------------cagctga------a------------
                      Opossum  -g-aaaaaaa----------------------------------cagctga------a------------
                      Wallaby  -g--aaaaaa----------------------------------cagctga------a------------
                     Platypus  -g---aaaaa----------------------------------cagctga------a------------
                  Rock pigeon  -g---aaaaa----------------------------------cagctga------a------------
                 Saker falcon  -g---aaaaa----------------------------------cagctga------a------------
             Peregrine falcon  -g---aaaaa----------------------------------cagctga------a------------
          Collared flycatcher  -g---aaaaa----------------------------------cagctga------a------------
       White-throated sparrow  -g---aaaaa----------------------------------cagctga------a------------
          Medium ground finch  -g---aaaaa----------------------------------cagctga------a------------
                  Zebra finch  -g---aaaaa----------------------------------cagctga------a------------
           Tibetan ground jay  -g---aaaaa----------------------------------cagctga------a------------
                   Budgerigar  -g---aaaaa---------------------------------ccagctga------a------------
                       Parrot  -g---aaaaa---------------------------------ccagctga------a------------
                Scarlet macaw  -g---aaaag---------------------------------ccagctga------a------------
                 Mallard duck  -g---aaaaa----------------------------------cagctga------a------------
                      Chicken  -g---aaaaa----------------------------------cagctga------a------------
                       Turkey  -g---aagaa----------------------------------cagctga------a------------
           American alligator  -g---aaaaa----------------------------------cagctga------a------------
              Green seaturtle  -g---aaaaa----------------------------------cagctga------a------------
               Painted turtle  -g---aaaaa----------------------------------cagctga------a------------
     Chinese softshell turtle  -g---aaaaa----------------------------------cagctga------a------------
       Spiny softshell turtle  -g---aaaaa----------------------------------cagctga------a------------
                       Lizard  -g---gagaagggagcattgggtggtggtggtggtggtggtggtgggacga------a------------
                X. tropicalis  -g---atgaa----------------------------------ggaagga------a------------
                   Coelacanth  -g---agaag----------------------------------cagctga------a------------
                    Tetraodon  -a---gatat----------------------------------tgtcttg----------------atg
                         Fugu  -a---gatat----------------------------------agccttg----------------atg
       Yellowbelly pufferfish  -a---gatat----------------------------------agccttg----------------atg
                 Nile tilapia  -a---gagat----------------------------------tggcttgatgtg--------------
          Princess of Burundi  -a---gagat----------------------------------tggcttg----at----------gtg
        Burton's mouthbreeder  -a---gagat----------------------------------tggcttg------a--------tgtg
                  Zebra mbuna  -a---gagat----------------------------------tggcttg------a--------tgtg
          Pundamilia nyererei  -a---gagat----------------------------------tggcttg------a--------tgtg
                       Medaka  -a---gagat----------------------------------aggcttg------g--------tttg
           Southern platyfish  -a---gagat----------------------------------tggtttg------g--------tgtg
                  Stickleback  -a---gagat----------------------------------tggcttg------a--------tgtg
                    Zebrafish  -a---aagac----------------------------------gagcatc----------------att
     Mexican tetra (cavefish)  -a---aagat----------------------------------gggtgta----------------att
                  Spotted gar  -a---aagac----------------------------------aagcttg------actcccctttttt
                 Atlantic cod  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                        Chimp  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Gorilla  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                    Orangutan  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                       Gibbon  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                       Rhesus  -gtttga----------------cta--gatga------------atccact-----------aca-gct
          Crab-eating macaque  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                       Baboon  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                 Green monkey  -gtttga----------------cta--gatga------------atccact-----------acc-gct
                     Marmoset  -gtttga----------------cta--gatga------------atccact-----------aca-gct
              Squirrel monkey  -gtttgg----------------cta--gatga------------atccact-----------aca-gct
                     Bushbaby  -gtttga----------------cta--gatga------------atccact-----------aca-gct
           Chinese tree shrew  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                     Squirrel  -gtttga----------------cta--gatga------------atccact-----------aca-gct
       Lesser Egyptian jerboa  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                 Prairie vole  -gtttga----------------cta--gatga------------atccact-----------aca-gct
              Chinese hamster  -gtttga----------------cta--gatga------------atccact-----------aca-gct
               Golden hamster  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                        Mouse  -gtttga----------------cta--gatgc------------atccact-----------aca-gcg
                          Rat  -gtttga----------------cta--gatga------------atccact-----------gca-gct
               Naked mole-rat  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                   Guinea pig  -gtttga----------------cta--gatga------------atctact-----------aca-gct
                   Chinchilla  -gtttga----------------cta--gatga------------atccact-----------aca-gct
             Brush-tailed rat  -gtttga----------------cta--gatga------------atccact-----------gca-gct
                       Rabbit  -gttcga----------------ctc--gatgg------------atccact-----------gca-gcg
                         Pika  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                       Alpaca  -gtttga----------------cta--gatga------------atccact-----------aca-gct
               Bactrian camel  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Dolphin  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                 Killer whale  -gtttga----------------cta--gatga------------atccact-----------aca-gct
             Tibetan antelope  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                          Cow  -gtttga----------------cta--gatga------------atccact-----------ata-gct
                        Sheep  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                Domestic goat  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                        Horse  -gttcga----------------cta--gatga------------agccact-----------gca-gct
             White rhinoceros  -gtttga----------------cta--gagga------------atccact-----------aca-gct
                          Cat  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                          Dog  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Ferret   -gtttga----------------cta--gatga------------atccact-----------aca-gct
                        Panda  -gtttga----------------cta--gatga------------atccact-----------acg-gct
               Pacific walrus  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                 Weddell seal  -gtttga----------------cta--gatga------------atccact-----------aca-gct
             Black flying-fox  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Megabat  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                Big brown bat  -gtttga----------------cta--gatga------------atccact-----------aca-gct
         David's myotis (bat)  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                     Microbat  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                     Hedgehog  -gtctgc----------------cta--ggcga------------agccgcc------------cc-gct
                        Shrew  -gtttga----------------cta--gatga------------atccact-----------aca-gct
              Star-nosed mole  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                     Elephant  -gtttga----------------cta--gatga------------atccatt-----------gca-gct
          Cape elephant shrew  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Manatee  -gtttga----------------cta--gatga------------atccagt-----------aca-gct
             Cape golden mole  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                       Tenrec  -gtttgt----------------cta--gatga------------atccact-----------gca-gct
                     Aardvark  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                    Armadillo  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Opossum  -gtttga----------------gta--gatga------------atccact-----------aca-gct
                      Wallaby  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                     Platypus  -gtttga----------------cta--gatga------------atccact-----------gca-gct
                  Rock pigeon  -gtttga----------------cta--gatga------------atccact-----------aca-act
                 Saker falcon  -gtttga----------------cta--gatga------------atccact-----------aca-gct
             Peregrine falcon  -gtttga----------------cta--gatga------------atccact-----------aca-gct
          Collared flycatcher  -gtttga----------------cta--gatga------------atccact-----------aca-gct
       White-throated sparrow  -gtttga----------------cta--gatga------------atccact-----------aca-gct
          Medium ground finch  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                  Zebra finch  -gtttga----------------cta--gatga------------atccact-----------aca-gct
           Tibetan ground jay  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                   Budgerigar  -gtttgg----------------cta--gatga------------atccact-----------cca-gct
                       Parrot  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                Scarlet macaw  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                 Mallard duck  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                      Chicken  -gtttga----------------cta--gatga------------atccact-----------aca-gct
                       Turkey  -gtttga----------------cta--gatga------------atccact-----------aca-gct
           American alligator  -gtttga----------------ctc--gatga------------atccact-----------aca-gct
              Green seaturtle  -gtttga----------------cta--gatga------------atccact-----------aca-gct
               Painted turtle  -gtttga----------------cta--gatga------------atccact-----------aca-gct
     Chinese softshell turtle  -gtttga----------------cta--gatga------------atccact-----------ata-gct
       Spiny softshell turtle  -gtttga----------------cta--gatga------------atccact-----------ata-gct
                       Lizard  -gtttgc----------------ctg--g--gc------------ctcctcc-----------tcc-tcc
                X. tropicalis  -gcttaagacccccctcgccctctcc--gataa------------gtgtgtt-----------cca-gac
                   Coelacanth  -gtttga----------------ctt--gatga------------atccatt-----------aca-gct
                    Tetraodon  -tgttag----------------cca--tgggg------------tgatgtt-----------atg-att
                         Fugu  -tgctag----------------cca--ggcgg------------tgatgtg-----------atg-att
       Yellowbelly pufferfish  -tgctag----------------cca--ggcgg------------tgatgtg-----------atg-att
                 Nile tilapia  -ttttag----------------cta--tgcag------------tgatgtg-----------atg-att
          Princess of Burundi  -ttttag----------------cta--tgcag------------tgatatg-----------atg-att
        Burton's mouthbreeder  -ttttag----------------cta--tgcaa------------tgatatg-----------atg-att
                  Zebra mbuna  -ttttag----------------cta--tgcaa------------tgatatg-----------atg-att
          Pundamilia nyererei  -ttttag----------------cta--tgcaa------------tgatatg-----------atg-att
                       Medaka  tttttat----------------ctg--tgctg------------cgttgtgatgatttgtgcatgcaag
           Southern platyfish  -ttttat----------------cca--tgcgg------------cgatgag-----------atg-att
                  Stickleback  -ttttat----------------cca--tgtaa------------tg----------------atg-att
                    Zebrafish  -tcctcc----------------ctt--tgctgccatcggtgggccgacaac-----------atg-ata
     Mexican tetra (cavefish)  -tgctgc----------------cttcatgttgccagtgtgcggctggtgag-----------gcg----
                  Spotted gar  -tttttg----------------cct--tccaagcct--------tgacttg-----------atg-aat
                 Atlantic cod  ======================================================================
              Tasmanian devil  ======================================================================

Inserts between block 24 and 25 in window
B D                Tetraodon 15bp
B D                     Fugu 15bp
      Yellowbelly pufferfish 15bp
B D             Nile tilapia 37bp
         Princess of Burundi 35bp
       Burton's mouthbreeder 37bp
                 Zebra mbuna 37bp
         Pundamilia nyererei 37bp
B D                   Medaka 31bp
          Southern platyfish 39bp
B D              Stickleback 48bp
B D                Zebrafish 27bp
    Mexican tetra (cavefish) 14bp
                 Spotted gar 10bp

Alignment block 25 of 1468 in window, 67373332 - 67373452, 121 bps 
B D                     Human  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                     Chimp  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Gorilla  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                 Orangutan  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                    Gibbon  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                    Rhesus  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D       Crab-eating macaque  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                    Baboon  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D              Green monkey  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                  Marmoset  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D           Squirrel monkey  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                  Bushbaby  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
           Chinese tree shrew  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ca
B D                  Squirrel  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
       Lesser Egyptian jerboa  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
                 Prairie vole  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------gc-tttt---ca
B D           Chinese hamster  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------gc-tttt---ca
               Golden hamster  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------gc-tttt---ca
B D                     Mouse  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------gc-tttt---ca
B D                       Rat  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------gc--ttt---ca
B D            Naked mole-rat  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                Guinea pig  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
                   Chinchilla  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
             Brush-tailed rat  t---cc-------------tgtcactgatcaa--------tg-ctcctctt-------ga-tttt---ca
B D                    Rabbit  t---cc-------------tgtcactgatcaa--------tg-ctcctctt-------ga-tttt---ca
B D                      Pika  c---cc-------------tgtcactgatcaa--------tg-ctcctctt-------ga-tttt---ca
B D                    Alpaca  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
               Bactrian camel  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Dolphin  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
                 Killer whale  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
             Tibetan antelope  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                       Cow  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                     Sheep  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
                Domestic goat  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                     Horse  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D          White rhinoceros  t---tc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                       Cat  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                       Dog  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Ferret   t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                     Panda  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
               Pacific walrus  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
                 Weddell seal  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
             Black flying-fox  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Megabat  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
                Big brown bat  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
         David's myotis (bat)  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                  Microbat  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                  Hedgehog  t---cc-------------tgcctctgatcag--------tg-ctcctctt-------g---ttt---ca
B D                     Shrew  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
              Star-nosed mole  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                  Elephant  t---cc-------------tgtcactgatcta--------tg-ctcttctt-------ga-tttt---ta
          Cape elephant shrew  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Manatee  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
             Cape golden mole  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                    Tenrec  t---cc-------------tgtcactgatcca--------tg-ctcttctc-------ga-tttt---ca
                     Aardvark  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                 Armadillo  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Opossum  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Wallaby  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                  Platypus  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D               Rock pigeon  c---cc-------------tgtcactgatcaa--------tg-ctctcctt-------ga-tttt---ta
  D              Saker falcon  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D          Peregrine falcon  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D       Collared flycatcher  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D    White-throated sparrow  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D       Medium ground finch  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D               Zebra finch  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
           Tibetan ground jay  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                Budgerigar  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D                    Parrot  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D             Scarlet macaw  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D              Mallard duck  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                   Chicken  c---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                    Turkey  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D        American alligator  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D           Green seaturtle  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D            Painted turtle  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D  Chinese softshell turtle  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
  D    Spiny softshell turtle  t---cc-------------tgtcactgatcaa--------tg-ctcttctt-------ga-tttt---ta
B D                    Lizard  t---ccttgtttcctcccttgtcactgatcaa--------tgccttctctc-------gc-tttc---ca
B D             X. tropicalis  tgcctc-------------tctcactcattgc--------tc-ttcctctt-------gattttt---ta
B D                Coelacanth  ----cc-------------tgtcactgatcaa--------tg-ctttcctt-------ga-tttt---ta
B D                 Tetraodon  c---cc-------------ccgtgctgatcgc--------tc-cttttctc-------ca-tcct---ca
B D                      Fugu  ----cc-------------ccgtgctgatcgc--------tc-cttttctc-------ca-tccc---ca
       Yellowbelly pufferfish  ----cc-------------ccgtgctgatcgc--------tc-cttttctc-------ca-tccc---ca
B D              Nile tilapia  t---cc-------------catctctgatcgc--------tc-cttttttc-------cg-tccc---ca
          Princess of Burundi  t---cc-------------catctctgatcgc--------tc-cttttttc-------cg-tccc---ca
        Burton's mouthbreeder  t---cc-------------catctctgatcgc--------tc-cttttttc-------cg-tccc---ca
                  Zebra mbuna  t---cc-------------catctctgatcgc--------tc-cttttttc-------cg-tccc---ca
          Pundamilia nyererei  t---cc-------------catctctgatcgc--------tc-cttttttc-------cg-tccc---ca
B D                    Medaka  c---tt-------------tctctctgatcac--------tc-cttttttt-------tg-tcac---ca
           Southern platyfish  c---ct-------------cctccatgatcgc--------tt-cttttctc-------tg-tccc---ca
B D               Stickleback  ----gc-------------gctttctgatcac--------tc-cttttctc-------ca-tccc---ca
B D              Atlantic cod  t---ac-------------tctcccctctctc--------tc-ctcttctt-------ta-tttg---ca
B D                 Zebrafish  a---cc-------------catcacttttactctcttttatt-ctctgctgtgtg---tg-tttc--aca
     Mexican tetra (cavefish)  c---ct-------------tgtcactgttaac--------ta-ttctgctgtgtgttctg-ttctgggca
                  Spotted gar  t---cc-------------tgtcactgatcaa--------tg-tttgtctt-------ga-tttc---ta
B D           Tasmanian devil  ======================================================================

                        Human  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                        Chimp  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Gorilla  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                    Orangutan  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Gibbon  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Rhesus  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
          Crab-eating macaque  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Baboon  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                 Green monkey  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                     Marmoset  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
              Squirrel monkey  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccgtcattaggt
                     Bushbaby  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
           Chinese tree shrew  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                     Squirrel  gcatctggcagccaactggaatcgcatcaggacctccaggaggacgattatccatatcccatcattaggt
       Lesser Egyptian jerboa  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                 Prairie vole  gcatctggcagccaactggagtcgcatcaggacctccaggaggactattatccatatcccatcattaggt
              Chinese hamster  gcatctggcagccaactggagtcgcatcaggacctccaggaggactattatccatatcccatcattaggt
               Golden hamster  gcatctggcagccaactggagtcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                        Mouse  gcatctggcagccaactggagtcgcatcaggacctccaggaggactattatccatataccatcattaggt
                          Rat  gcatctggcagccaactggagtcgcatcaggacctccaggaggactattatccatataccatcattaggt
               Naked mole-rat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                   Guinea pig  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                   Chinchilla  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
             Brush-tailed rat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Rabbit  gcatctggcagccaactggaatcgcatcaagacctcgaggaggactattatccatatcccgtcattaggt
                         Pika  gcatctggcaaccaactggaatcgcatcaggacctccaagaggaccattatccatatcccatcattaggt
                       Alpaca  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
               Bactrian camel  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Dolphin  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                 Killer whale  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
             Tibetan antelope  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                          Cow  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                        Sheep  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                Domestic goat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                        Horse  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
             White rhinoceros  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccgtcattaggt
                          Cat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                          Dog  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Ferret   gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                        Panda  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
               Pacific walrus  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                 Weddell seal  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
             Black flying-fox  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Megabat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                Big brown bat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
         David's myotis (bat)  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                     Microbat  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                     Hedgehog  gcatctggcagccaactggaatcgtatcaggacctccaggaggactgtcatccatgtcccgtcattaggt
                        Shrew  gcatctggcagccaactggaatcgcatccggacctccaggagaaccattatccatatcccatcattaggt
              Star-nosed mole  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                     Elephant  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
          Cape elephant shrew  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Manatee  gcatctggcagccaactggaatcgcatcaggacttccaggaggactattatccatatcccatcattaggt
             Cape golden mole  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Tenrec  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatgtcccgtcattaggt
                     Aardvark  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                    Armadillo  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Opossum  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Wallaby  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                     Platypus  gcatctggcagccaactggaatcgcatgaggacttccaggaggactattatccatatcccgtcattaggt
                  Rock pigeon  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                 Saker falcon  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
             Peregrine falcon  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
          Collared flycatcher  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
       White-throated sparrow  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
          Medium ground finch  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                  Zebra finch  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
           Tibetan ground jay  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                   Budgerigar  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Parrot  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                Scarlet macaw  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                 Mallard duck  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                      Chicken  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Turkey  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
           American alligator  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
              Green seaturtle  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
               Painted turtle  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
     Chinese softshell turtle  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
       Spiny softshell turtle  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatatcccatcattaggt
                       Lizard  gcatctggccgccaactggagtcgcatcaggacctcgaggaggaccattatccacgtcccatcattaggt
                X. tropicalis  gcatctggcatccaactggaatcacatcaggacgtgcaggaggagcattatccatatcccatcattaggt
                   Coelacanth  gcatctggcagccaactggaatcgcatcaggacctccaggaggactattatccatgtcccatcattaggt
                    Tetraodon  gcatctggcagccaactggaaacatatccagtcgtcctagaggaccattatcccca-cccttcattaggt
                         Fugu  gcatctggcagccaactggaaacacatccagtcctcctagaggaccattatccacatcccttcattaggt
       Yellowbelly pufferfish  gcatctggcagccaactggaaacacatccagtcctcctagaggaccattatccacatcccttcattaggt
                 Nile tilapia  gcatctggcagccaactggaaacgcatccagtccttcaagaggaccattatccacatcccttcattaggt
          Princess of Burundi  gcatctggcagccaactggaaacgcatccagtccttcaagaggaccattatccacatcccttcattaggt
        Burton's mouthbreeder  gcatctggcagccaactggaaacgcatccagtccttcaagaggaccattatccacatcccttcattaggt
                  Zebra mbuna  gcatctggcagccaactggaaacgcatccagtccttcaagaggaccattatccacatcccttcattaggt
          Pundamilia nyererei  gcatctggcagccaactggaaacgcatccagtccttcaagaggaccattatccacatcccttcattaggt
                       Medaka  gcatctggcagccaactggaaacacattcagtcgtccaagaggaccattatccacatcccttcattaggt
           Southern platyfish  gcatctggcagcaaactggaaacacatccggtcgtccaagaggaccattatccacatcccttcattaggt
                  Stickleback  gcatctggcagccaactggaaacgcatccagtcctccaagaggaccattatccacatcccttcattaggt
                 Atlantic cod  gcatctggcagccaactggaaacacatccactcctccacgaggaccattatccacattccatcattaggt
                    Zebrafish  gagtctggcaaccaactggaaacacatcacctccgccaaaaggactatcatccatgtcccatcactgggt
     Mexican tetra (cavefish)  gtatctggcagacaactggaaacacctcagcacctccaggaggaccattatccatgtaccatcattaggt
                  Spotted gar  gcatctggcagccaactggaaacacatcaggtcttccaggaggagtattatccacatcccgtcattaggt
              Tasmanian devil  ======================================================================

                        Human  a------taacacttt-t-gcctg----------------------------c
                        Chimp  a------taacacttt-t-gcctg----------------------------c
                      Gorilla  a------taacacttt-t-gcctg----------------------------c
                    Orangutan  a------taacacttt-t-gcctg----------------------------c
                       Gibbon  a------taacacttt-t-gcctg----------------------------c
                       Rhesus  a------taacacttt-t-gcctg----------------------------c
          Crab-eating macaque  a------taacacttt-t-gcctg----------------------------c
                       Baboon  a------taacacttt-t-gcctg----------------------------c
                 Green monkey  a------taacacttt-t-gcctg----------------------------c
                     Marmoset  a------taacacttt-t-gcctg----------------------------c
              Squirrel monkey  a------taacacttt-t-gcctg----------------------------c
                     Bushbaby  a------taacacttt-t-gcctg----------------------------c
           Chinese tree shrew  a------taacacttt-t-gcctg----------------------------c
                     Squirrel  a------taacacttt-t-gcctg----------------------------c
       Lesser Egyptian jerboa  a------taacacttt-t-gcctg----------------------------c
                 Prairie vole  a------taacacttt-t-gcctg----------------------------c
              Chinese hamster  a------taacacttt-t-gcctg----------------------------c
               Golden hamster  a------taacacttt-t-gcctg----------------------------c
                        Mouse  a------taacacttt-t-gcctg----------------------------c
                          Rat  a------taacacttt-t-gcctg----------------------------c
               Naked mole-rat  a------taacacttt-t-gcctg----------------------------c
                   Guinea pig  a------taacacttt-t-gcctg----------------------------c
                   Chinchilla  a------taacacttt-t-gcctg----------------------------c
             Brush-tailed rat  a------taacacttt-t-gcctg----------------------------c
                       Rabbit  a------caacacttc-t-gcctg----------------------------c
                         Pika  a------taacacttt-t-gcctg----------------------------c
                       Alpaca  a------taacacttt-t-gcctg----------------------------c
               Bactrian camel  a------taacacttt-t-gcctg----------------------------c
                      Dolphin  a------taacacttt-t-gcctg----------------------------c
                 Killer whale  a------taacacttt-t-gcctg----------------------------c
             Tibetan antelope  a------taacacttt-t-gcctg----------------------------c
                          Cow  a------taacacttt-t-gcctg----------------------------c
                        Sheep  a------taacacttt-t-gcctg----------------------------c
                Domestic goat  a------taacacttt-t-gcctg----------------------------c
                        Horse  a------taacacttt-t-gcctg----------------------------c
             White rhinoceros  a------taacacttt-t-gcctg----------------------------c
                          Cat  a------taacacttt-t-gcctg----------------------------c
                          Dog  a------taacacttt-t-gcctg----------------------------c
                      Ferret   a------taacacttt-t-gcctg----------------------------c
                        Panda  a------taacacttt-t-gcctg----------------------------c
               Pacific walrus  a------taacacttt-t-gcctg----------------------------c
                 Weddell seal  a------taacacttt-t-gcctg----------------------------c
             Black flying-fox  a------taacacttt-t-gcctg----------------------------c
                      Megabat  a------taacacttt-t-gcctg----------------------------c
                Big brown bat  a------taacacttt-t-gcctg----------------------------c
         David's myotis (bat)  a------taacacttt-t-gcctg----------------------------c
                     Microbat  a------taacacttt-t-gcctg----------------------------c
                     Hedgehog  a------gagcgcttt-t-gcctg----------------------------c
                        Shrew  a------taacacttt-t-gcctg----------------------------c
              Star-nosed mole  a------taacacttt-t-gcctg----------------------------c
                     Elephant  a------taacacttt-t-gcctg----------------------------c
          Cape elephant shrew  a------taacacttt-t-gcctg----------------------------c
                      Manatee  a------taacacttt-t-gcctg----------------------------c
             Cape golden mole  a------taacacttt-t-gcctg----------------------------c
                       Tenrec  a------taacacttt-t-gcctg----------------------------c
                     Aardvark  a------taacacttt-t-gcctg----------------------------c
                    Armadillo  a------taacacttt-t-gcctg----------------------------c
                      Opossum  a------taacacttt-t-gcctg----------------------------c
                      Wallaby  a------taacacttt-t-gcctg----------------------------c
                     Platypus  a------taacacttt-t-gcctg----------------------------c
                  Rock pigeon  a------taacacttt-t-gcctg----------------------------c
                 Saker falcon  a------taacacttt-t-gcctg----------------------------c
             Peregrine falcon  a------taacacttt-t-gcctg----------------------------c
          Collared flycatcher  a------taacacttt-t-gcctg----------------------------c
       White-throated sparrow  a------taacacttt-t-gcctg----------------------------c
          Medium ground finch  a------taacacttt-t-gcctg----------------------------c
                  Zebra finch  a------taacacttt-t-gcctg----------------------------c
           Tibetan ground jay  a------taacacttt-t-gcctg----------------------------c
                   Budgerigar  a------taacacttt-t-gcctg----------------------------c
                       Parrot  a------taacacttt-t-gcctg----------------------------c
                Scarlet macaw  a------taacacttt-t-gcctg----------------------------c
                 Mallard duck  a------taacacttt-t-gcctg----------------------------c
                      Chicken  a------taacacttt-t-gcctg----------------------------c
                       Turkey  a------taacacttt-t-gcctg----------------------------c
           American alligator  a------taacacttt-t-gcctg----------------------------c
              Green seaturtle  a------taacacttt-t-gcctg----------------------------c
               Painted turtle  a------taacacttt-t-gcctg----------------------------c
     Chinese softshell turtle  a------taacacttt-t-gcctg----------------------------c
       Spiny softshell turtle  a------taacacttt-t-gcctg----------------------------c
                       Lizard  acggcggtggcgctttgt-gcctgtgcatgcgcatgtgtgtgtgcgcggatat
                X. tropicalis  a------aagagctct-tagcctc----------------------------c
                   Coelacanth  a------tatcacttt-t-gcctg----------------------------g
                    Tetraodon  a------gctttctg--t-gtctg----------------------------g
                         Fugu  a------gctttctc--t-gtctg----------------------------a
       Yellowbelly pufferfish  a------gctttctc--t-gtctg----------------------------a
                 Nile tilapia  a------gctttctt--t-gcctg----------------------------c
          Princess of Burundi  a------gctttctt--t-gcctg----------------------------c
        Burton's mouthbreeder  a------gctttctt--t-gcctg----------------------------c
                  Zebra mbuna  a------gctttctt--t-gcctg----------------------------c
          Pundamilia nyererei  a------gctttctt--t-gcctg----------------------------c
                       Medaka  a------gctttcgt--t-gactg----------------------------c
           Southern platyfish  g------gcatttgt--c-gcccg----------------------------c
                  Stickleback  g------gctttctg--t-gcctg----------------------------c
                 Atlantic cod  a------cctctctctgt-gtcgg----------------------------c
                    Zebrafish  a------attcatttc-a-atctg----------------------------c
     Mexican tetra (cavefish)  acact--agtcact---a-gtc-------------------------------
                  Spotted gar  a------cctctctc--t-----------------------------------
              Tasmanian devil  =====================================================

Inserts between block 25 and 26 in window
B D                Tetraodon 34bp
B D                     Fugu 42bp
      Yellowbelly pufferfish 42bp
B D             Nile tilapia 24bp
         Princess of Burundi 24bp
       Burton's mouthbreeder 20bp
                 Zebra mbuna 20bp
         Pundamilia nyererei 20bp
B D                   Medaka 27bp
          Southern platyfish 26bp
B D              Stickleback 22bp
B D             Atlantic cod 62bp
B D                Zebrafish 123bp

Alignment block 26 of 1468 in window, 67373453 - 67373509, 57 bps 
B D                     Human  a----------------aatctatcagca-------------------acct------------------
B D                     Chimp  a----------------aatctatcagca-------------------acct------------------
B D                   Gorilla  a----------------aatctatcagca-------------------acct------------------
B D                 Orangutan  a----------------aatctatcagca-------------------acct------------------
B D                    Gibbon  a----------------aatctatcagca-------------------acct------------------
B D                    Rhesus  a----------------aatctatcagca-------------------acct------------------
B D       Crab-eating macaque  a----------------aatctatcagca-------------------acct------------------
B D                    Baboon  a----------------aatctatcagca-------------------acct------------------
B D              Green monkey  a----------------aatctatcagca-------------------acct------------------
B D                  Marmoset  a----------------aatctatcagca-------------------acct------------------
B D           Squirrel monkey  a----------------aatctatcagca-------------------acct------------------
B D                  Bushbaby  a----------------aatctatcagca-------------------acct------------------
           Chinese tree shrew  a----------------aatctatcagca-------------------acct------------------
B D                  Squirrel  a----------------aatctatcagca-------------------acct------------------
       Lesser Egyptian jerboa  a----------------aatctatcagca-------------------acct------------------
                 Prairie vole  a----------------aatctatcagca-------------------acct------------------
B D           Chinese hamster  a----------------aatctatcagca-------------------acct------------------
               Golden hamster  a----------------aatctatcagca-------------------acct------------------
B D                     Mouse  a----------------aatctatcagca-------------------acct------------------
B D                       Rat  a----------------aatctatcagca-------------------acct------------------
B D            Naked mole-rat  a----------------aatctatcagca-------------------acct------------------
B D                Guinea pig  a----------------aatctatcagca-------------------acct------------------
                   Chinchilla  a----------------aatctatcagca-------------------acct------------------
             Brush-tailed rat  a----------------aatctatcagca-------------------acct------------------
B D                    Rabbit  a----------------aatccatcagca-------------------acct------------------
B D                      Pika  a----------------aatctaacagca-------------------acct------------------
B D                    Alpaca  a----------------aatctatcagca-------------------acct------------------
               Bactrian camel  a----------------aatctatcagca-------------------acct------------------
B D                   Dolphin  a----------------aatctttcagta-------------------acct------------------
                 Killer whale  a----------------aatctttcagca-------------------acct------------------
             Tibetan antelope  a----------------aatctatcagca-------------------acct------------------
B D                       Cow  a----------------aatctatcagca-------------------acct------------------
B D                     Sheep  a----------------aatctatcagca-------------------acct------------------
                Domestic goat  a----------------aatctatcagca-------------------acct------------------
B D                     Horse  a----------------aatctatcagca-------------------acct------------------
B D          White rhinoceros  a----------------aatctatcagca-------------------acct------------------
B D                       Cat  a----------------aatctatcagca-------------------acct------------------
B D                       Dog  a----------------aatctatcagca-------------------acct------------------
B