Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 389 in window, 28931939 - 28931947, 9 bps 
B D                   Human  a--ggcccct----------g
B D                   Chimp  a--ggcccct----------g
B D                 Gorilla  a--ggcccct----------g
B D               Orangutan  a--ggcccct----------g
B D                  Gibbon  a--ggcccct----------g
B D                  Rhesus  a--ggcccct----------g
B D     Crab-eating macaque  a--ggcccct----------g
B D                  Baboon  a--ggcccct----------a
B D            Green monkey  a--ggcccct----------g
B D                Marmoset  a--ggcccct----------g
B D         Squirrel monkey  a--ggcccct----------g
B D                Bushbaby  a--ggcccccgcctgctccag
         Chinese tree shrew  a--ggccccc----------g
     Lesser Egyptian jerboa  a--g-----------------
               Prairie vole  a--gcctccg----------g
B D         Chinese hamster  g--gcctcct----------g
B D                   Mouse  a--ggctcct----------g
B D                     Rat  a--ggctcct----------g
B D          Naked mole-rat  a---gcccca----------g
B D              Guinea pig  a--ggcccca----------g
                 Chinchilla  g--ggcccca----------g
           Brush-tailed rat  g--ggcccca----------g
B D                  Rabbit  a--ggcccct----------g
B D                    Pika  a--agcccca----------g
B D                     Pig  a--ggtcccc----------g
B D                  Alpaca  a--ggttccc----------g
             Bactrian camel  a--ggttccc----------g
B D                 Dolphin  a--ggtcccc----------g
               Killer whale  a--ggtcccc----------g
           Tibetan antelope  g--ggtcccc----------g
B D                   Sheep  c--ggtcccc----------g
              Domestic goat  g--ggtcccc----------g
B D                   Horse  a--ggccccc----------a
B D        White rhinoceros  a--ggcccca----------g
B D                     Cat  a--ggccccc----------a
B D                     Dog  a--ggccccc----------g
B D                 Ferret   a--ggccccc----------g
             Pacific walrus  a--ggccccc----------g
               Weddell seal  a--ggccccc----------g
           Black flying-fox  a--agtccct----------g
B D                 Megabat  a--agtccct----------g
              Big brown bat  a--gcccccc----------a
       David's myotis (bat)  a--gcccccc----------a
B D                Hedgehog  c--ggccccc----------g
B D                   Shrew  c--ggccccc----------g
            Star-nosed mole  ------cccc----------a
B D                Elephant  a--ggcccct----------g
        Cape elephant shrew  a--ggtcccc----------g
B D                 Manatee  a--ggcccca----------g
           Cape golden mole  a--ggccctt----------g
B D                  Tenrec  a--ggccccc----------g
                   Aardvark  a---gccccc----------g
B D               Armadillo  c--agccccc----------g
B D                 Opossum  accagcccct----------g
B D         Tasmanian devil  accagcccct----------g
B D                 Wallaby  accagccctt----------g
B D                Platypus  a--gca---------------
B D                Microbat  =====================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNN
B D                Squirrel  NNNNNNNNNNNNNNNNNNNNN
B D                     Cow  =====================
B D                   Panda  =====================
B D             Zebra finch  =====================
  D          Painted turtle  =====================
B D      American alligator  =====================
B D                  Lizard  =====================

Alignment block 2 of 389 in window, 28931948 - 28932003, 56 bps 
B D                   Human  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccggaga
B D                   Chimp  cctg-ccccagcatcccctgc----c----------------------g--aagctgggtgccccggaga
B D                 Gorilla  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccggaga
B D               Orangutan  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccggaga
B D                  Gibbon  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccggaga
B D                  Rhesus  ccta-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccgggga
B D     Crab-eating macaque  ccta-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccgggga
B D                  Baboon  ccta-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccgggga
B D            Green monkey  ccta-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccgagga
B D                Marmoset  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccgggga
B D         Squirrel monkey  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccgggga
B D                Bushbaby  cctg-ccccagcatcccctgcg---c----------------------g--aagctgggtgccccaggga
         Chinese tree shrew  cctg-ccccagcatcccctgcg---c-------------gcc----gag--aagc----tgccccgggga
     Lesser Egyptian jerboa  ---g-ccccagcatcctctgcg---c-------------gggccggcagctgaactgggtgttccaggga
               Prairie vole  cttg-ccccagcatcctctgcg---c-------------agccacacag--aagcggagtgccccgggga
B D         Chinese hamster  cttg-ccccagcatcctctgcg---c-------------ggccacacag--aaactgagtgccccgggga
B D                   Mouse  ctcg-ccccagcatcctctgcg---c-------------agccacgcag--aagccgggtgccccaggga
B D                     Rat  cttg-ccccagcatcctctgcg---c-------------agccgcgcag--aagccgggtgccccaggga
B D          Naked mole-rat  cctg-acccagcatcccctgcg---c-------------ggc------a--aagc-gggtggcctgagga
B D              Guinea pig  cctg-ccccagcatcctctgcg---c-------------ggc------a--aagctgggtggcccaggga
                 Chinchilla  cctg-ccccagcatcccctgcg---c-------------ggc------a--aagctgggtggcct-ggga
           Brush-tailed rat  -ctg-ccccggcatcccctgcg---c-------------ggc------a--aagctgggtggcccgggga
B D                  Rabbit  cctg-ccccagcatcccctgcg---c-------------ggg------g--aagctgggcggcccgggga
B D                    Pika  ccta-ccccagcatcccctgcg---c-------------gct------g--aagctgggtgccccgggga
B D                     Pig  cctg-ccccagcatcccctgcg---c-------------ggc------g--gagctgggtgccacgggga
B D                  Alpaca  ccta-ccccagcatcccccgcg---c--------------gc------g--aggctgggcgccccaggga
             Bactrian camel  ccta-ccccagcatcccccgcg---c--------------gt------g--aggctgggcgccccaggga
B D                 Dolphin  cctg-ccccagcatcccccgcg---c-------------ggc------g--aagctgggtgccgggggga
               Killer whale  cctg-ccccagcatcccccgcg---c-------------ggc------g--aagctgggtgccccgggga
           Tibetan antelope  cctg-ccccagcatcccccgcg---c-------------ggc------g--aagccgggcgccccgggga
B D                   Sheep  c-------------cccccgcg---c-------------ggc------g--acgccgggcgccccgggga
              Domestic goat  cctg-ccccagcatcccccgcg---c-------------ggc------g--aagccgggcgccccgggga
B D                   Horse  cctg-ccccagcatcccc--cg---c-------------ggc------g--aagctgggtgccgcgggga
B D        White rhinoceros  cctg-ccccagcatcccc--cg---c-------------ggc------g--aagctgggtgccgcgggga
B D                     Cat  cctgcccccagcatccaccgcg---c-------------ggc------c--aagctgggtgccccgggga
B D                     Dog  cctg-ccccagcatcccctgcg---c-------------ggc------c--aagctgggtgccccgggga
B D                 Ferret   cctg-ccccagcatcccccgcg---c-------------ggc------c--aagctgggtgccccgggga
B D                   Panda  cctg-ccccagcatcccccgcg---c-------------ggc------c--aagctgggtgccccgggga
             Pacific walrus  cctg-ccccagcatcccccgcg---c-------------ggc------c--aagctgggtgccccgggga
               Weddell seal  cctg-ccccagcatcccctgcg---c-------------ggc------c--aagctgggtgccccgggga
           Black flying-fox  cctg-ccccagcatcccctgcg---c-------------ggc------c--aagct-ggtgcctcgggga
B D                 Megabat  cctg-ccccagcatcccctgcg---c-------------ggc------c--aagct-ggtgcctcgggga
              Big brown bat  tttg-ccccagcatcccctgcg---c-------------ggg------g--aagctgggttcctcggaga
       David's myotis (bat)  cttg-ccccagcaacccctgcg---c-------------ggg------g--aagctgggtgcctcggaga
B D                Hedgehog  cctg-ccccagcatcctctgcg---c-------------gga------g--aagctgcgtg-cctgggga
B D                   Shrew  cccg-ccccagcatcccctgcg---c------------cgag------g--agctggggtgtcccgggca
            Star-nosed mole  cctg-ccccagcatcccttgcg---c--------------gt------g--agtctgtgtgccttggagg
B D                Elephant  cct--ccccagcatcccctgcg---c-------------ggg------g--aagctgggtgccccgggga
        Cape elephant shrew  cctg-ccccagcatcccctgcg---c-------------gga------g--aagctgggtgccccgggga
B D                 Manatee  cctg-ccccagcatcccctgcgccac-------------cgg------g--aagctgggtgccccgggga
           Cape golden mole  tctg-ccccagcatcccctgcgccac------cctgcgccgg------g--aagttgggcgccccgggga
B D                  Tenrec  cctg-ccccagcatcctctgcgcggcgggaggggggcg-ggg------g--aaactgggtgcttggggga
                   Aardvark  cctg-ccccagcatcccttgcg---c-------------ggg------c--aagctgggcgccccgggga
B D               Armadillo  cctg-ccccagcagcccctgcg---c-------------cgt------g--aagctgggcttcccgggga
B D                 Opossum  ccgg-tcccagcatccgcctcg---a----------------------c--gacggagacacccagagga
B D         Tasmanian devil  cttg-ccccagcatccacctcg---c----------------------g--gatccggacactcccagga
B D                 Wallaby  cctg-ccccagcatccacctcg---c----------------------c--gatccggatacccagtgga
B D                Platypus  acct-ccccaacgtcccccgcg---c----------------------t--gagccaggagcccggggga
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Cow  ======================================================================
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D      American alligator  ======================================================================
B D                  Lizard  ======================================================================

                      Human  gt------ctgac-------caccatg
                      Chimp  gt------ctgac-------caccatg
                    Gorilla  gt------ctgac-------caccatg
                  Orangutan  gt------ctgac-------caccatg
                     Gibbon  gt------ctgac-------caccatg
                     Rhesus  gt------ctgac-------caccatg
        Crab-eating macaque  gt------ctgac-------caccatg
                     Baboon  gt------ctgac-------caccatg
               Green monkey  gt------ctgac-------caccatg
                   Marmoset  gt------ctgac-------cagcatg
            Squirrel monkey  gt------ctgac-------cagcatg
                   Bushbaby  gt------ctggc-------caccatg
         Chinese tree shrew  gc------ccggc-------cagcatg
     Lesser Egyptian jerboa  gc------ctggc-------caccatg
               Prairie vole  gc------ctggc-------taccatg
            Chinese hamster  gc------ctggc-------taccatg
                      Mouse  gc------ctggc-------taccatg
                        Rat  gc------ctggc-------taccatg
             Naked mole-rat  tc------ctggc-------tgccatg
                 Guinea pig  tc------ctggc-------tgccatg
                 Chinchilla  tc------ctggc-------tgccatg
           Brush-tailed rat  tc------ctggc-------tgccatg
                     Rabbit  gt------ctggc-------caccatg
                       Pika  gc------ctggc-------caccatg
                        Pig  gt------ctggc-------caccatg
                     Alpaca  gt------ctgat-------caccatg
             Bactrian camel  gt------ctgac-------caccatg
                    Dolphin  gt------ctggc-------caccatg
               Killer whale  gt------ctggc-------caccatg
           Tibetan antelope  gt------ctggc-------caccatg
                      Sheep  gt------ctggc-------caccatg
              Domestic goat  gt------ctggc-------caccatg
                      Horse  gt------ctggc-------caccatg
           White rhinoceros  gt------ctggc-------caccatg
                        Cat  gc------ctggc-------cgccatg
                        Dog  gt------ctggc-------cgccatg
                    Ferret   gt------ctggc-------cgccatg
                      Panda  gt------ctggc-------cgccatg
             Pacific walrus  gt------ctggc-------cgccatg
               Weddell seal  gt------ctggc-------cgccatg
           Black flying-fox  gt------ctggc-------caccatg
                    Megabat  gt------ctggc-------caccatg
              Big brown bat  gt------ctggc-------caccatg
       David's myotis (bat)  gt------ctagc-------caccatg
                   Hedgehog  gt------tgggc-------caccatg
                      Shrew  gt------ccgg-----------catg
            Star-nosed mole  gt------ctggc-------caccatg
                   Elephant  gt------ctagc-------caccatg
        Cape elephant shrew  gc------ctggc-------caccatg
                    Manatee  gt------ctggc-------caccatg
           Cape golden mole  gc------ctggc-------caccatg
                     Tenrec  gt------ctggc-------caccatg
                   Aardvark  gt------ctggc-------caccatg
                  Armadillo  gt------ccggc-------caccatg
                    Opossum  gcgagagtccgact------cgccatg
            Tasmanian devil  gttagagcctgact------cgccatg
                    Wallaby  gttatagcccaact------cgccatg
                   Platypus  gc------ctaagttcaaaacgccatg
                   Microbat  ===========================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Cow  ===========================
                Zebra finch  ===========================
             Painted turtle  ===========================
         American alligator  ===========================
                     Lizard  ===========================

Inserts between block 2 and 3 in window
B D                Opossum 6bp
B D        Tasmanian devil 6bp
B D                Wallaby 6bp

Alignment block 3 of 389 in window, 28932004 - 28932103, 100 bps 
B D                   Human  ccacctcctcgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D                 Gorilla  ccacctcctcgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D               Orangutan  ccacctcctcgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D                  Gibbon  ccatctccttgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D                  Rhesus  ccacctccttgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D     Crab-eating macaque  ccacctccttgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D                  Baboon  ccacctccttgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D            Green monkey  ccacctccttgcctcctcttcttcctcctc---------------ttcctcacccccatggaagtcaggc
B D                Marmoset  ccacctgcttgcctcctcttcttcctcctc---------------ttcctcacccccatgggagtcaggc
B D         Squirrel monkey  ccacctccttgcctcctcttcttcctcctc---------------ttcctcacccccatgggagtcaggc
B D                Bushbaby  ctaactcctctcctcttctcgtttctcctc---------------ttccttacccctatgagagtgaggc
         Chinese tree shrew  ccgcctcctctccttctcctcttcctcctc---------------ttcctcagcctggtgggagtcagtc
     Lesser Egyptian jerboa  ccacctcctctct---tcttcctcctcctc---------------ttccttaccctaatgggagtacgac
               Prairie vole  ccatctcctctccccctctccttccttctc---------------ttccttacccttgtaggaagcagga
B D         Chinese hamster  ccatctcctctttctctctccttcctcctc---------------ttccttacccttgtagaaggcacga
B D                   Mouse  ccatctcctctccctgtctccttcctcctc---------------tttcttaccttagtaggaggcaggc
B D                     Rat  ccatctcctctccctgtctccctcctcctc---------------ttccttaccttagtaggaggcaggc
B D          Naked mole-rat  ccacctcctctcctcctctccttcctcctc---------------ttcctcttccccaagggaggcaggc
B D              Guinea pig  ccacctcctctgctcctctccttcctcctc---------------tttcttttccccaagggagtcaggc
                 Chinchilla  ccacctcctctcctcctctccctcctcctc---------------ttccttttccccaagggagtcaggc
           Brush-tailed rat  ccacctcctctcctcctctccgtcctcctc---------------ttcctttttcccaagggagtcaggc
B D                  Rabbit  ccacctcctctcctgctcgccttcctcctc---------------ttcctgaccctggggagagtcaggc
B D                    Pika  ccacctcctctcctcctctccttcgtcctc---------------ttcctcaccccgatgggagtcagac
B D                     Pig  ccacctcct---ctcctcctcttctccctcctcttctccttcttcttccttacccctgtggaagcccggc
B D                  Alpaca  ccatctcctctcctcctcttcctcgcgctc---------------ttccttgtccccgcgggaatcaggg
             Bactrian camel  ccatctcct---ctcctcttcctcgcgctc---------------ttccttgtcccagcgggaatcaggg
B D                 Dolphin  ccacctcct---ctcctcctcttcttcctcc---------acctgttccttacccccatgggagtcaggc
               Killer whale  ccacctcct---ctcctcctcttcttcctcc---------acctgttccttacccccatgggagtcaggc
           Tibetan antelope  ccacctcct---ctcctctccctcctcctc---------------ttccttacccctgtgggagtcagac
B D                   Sheep  ccacctcct---ctcctcttcctcctcctc---------------ttccttgcccctgtgggagtcagac
              Domestic goat  ccacctcct---ctcctcttcctcctcctc---------------ttccttgcccctgtgggagtcagac
B D                   Horse  ccacctcctctcctcctcttcttcctcctc---------------ttccttacccccacgggaggcagat
B D        White rhinoceros  ccacctcctctcctcctcttcttcctcctc---------------ttccttactcccgtgggaggcaagg
B D                     Cat  ccacctcctcttctcctcttcttcctcctc---------------ttcctcacccctgagggagtcaggc
B D                     Dog  ccacctcctctcctcctcttcttcctcctc---------------ttccttacacccgagggagtcaggc
B D                 Ferret   ccacctcctctcctgctcttcttcctcctc---------------ttcctcacccccgagggagtccggc
B D                   Panda  ccacctcctctccttctcttcttcctcctc---------------ttccttacacccgagggagtcaggc
             Pacific walrus  ccacctcctctccttctcttcttcctcctc---------------ttcctcacacccgagggagtcaggc
               Weddell seal  ccacctcctctccttctcttcttcctcctc---------------ttcctcacacccgagggagtcaggc
           Black flying-fox  ccacctcctctccgcctcttcttcctcctc---------------ttccttactcctgtgagagtcaggc
B D                 Megabat  ccacctcctctccgcctcttcttcctcctc---------------ttccttactcctgtgagagtcaggc
              Big brown bat  ccacctcctctcctcctcttcttcctcctc---------------ttccttaccccggtgggagtcaggc
       David's myotis (bat)  ccacctcct---ctcctcttcttcctcctc---------------ttccttactccggtgggagtcaggc
B D                Hedgehog  c---caccgcctctcctcatcttcctcctc---------------ttcctcaccccctgggaagttaggc
B D                   Shrew  gccacgccgcgtctcctctccttcctgctc---------------ttcctcacgcccgtggcggcgagac
            Star-nosed mole  cccactcctctcctgctcttctccctcctc---------------ttccttgcctctgtgggaatcaggc
B D                Elephant  ccgccccttctcctcctctttttcctcctc---------------ttccttgctctggcaggagtcaggc
        Cape elephant shrew  ccacctcctcgccttctatttttcctcctc---------------ttcctcacccctgggcgagtcaggc
B D                 Manatee  ccgccccctctcctcctctttgtcctcctc---------------ttccttattccagtaggagtcaggc
           Cape golden mole  ccacctcctctccttcttttttctctcttt---------------ttccttattccggagggagtcaggc
B D                  Tenrec  ctacctcctctcctttgtgtcttcctc------------------ttcctgatcctggtgggagccagac
                   Aardvark  ccacctcctctccttctctttttcctcttc---------------ttccttaccctggtgggagtcaggc
B D               Armadillo  ccgcctcctctcctcctctccttcctcctc---------------ttcctggcccccgtgggagtcaggc
B D                 Opossum  gcccctttccccctcatcctcctctttctg---------------ttcctcactccacaggttgctgagc
B D         Tasmanian devil  ccccctttcttctacctcctcctctttctc---------------tttctcaccccccaggctgccaagt
B D                 Wallaby  ccccctttcttcctcctccttttctttccc---------------tttctcaccccacagagcgctgagc
B D                Platypus  cggccccct---ctcctcctcctcctcctc---------------ctccttgctccggtgtgtggagggg
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Cow  ======================================================================
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D      American alligator  ======================================================================
B D                  Lizard  ======================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ccgaggaacctctagtggtgaaggtggaaggtatg------------t-cc------aaagggc
                    Gorilla  ctgaggaacctctagtggtgaaggtggaaggtatg------------t-cc------aaagggc
                  Orangutan  ccgaggaacctctagtggtgaaggtggaaggtatg------------t-cc------aaagggc
                     Gibbon  cccaggaacgtctagtggtgaaggtggaaggtatg------------t-cc------aaagggc
                     Rhesus  cccaggaacctctagtggtgaaggtagaaggtatg------------t-cc------aaagggc
        Crab-eating macaque  cccaggaacctctagtggtgaaggtagaaggtatg------------t-cc------aaagggc
                     Baboon  cccaggaacctctagtggtgaaggtggaaggtatg------------t-cc------aaagagc
               Green monkey  cccaggaacctctagtggtgaaggtggaaggtatg------------t-cc------aaagggc
                   Marmoset  cccaggaacctcgactggtgaaggtggaaggtatg------------t-cc------aaagggc
            Squirrel monkey  cccaggaacctcgactggtaaaggtggaaggtatg------------t-cc------aaagagc
                   Bushbaby  cccaggaacagcggttggtgaaggtagaaggtaag------------t-gc------gaagggc
         Chinese tree shrew  cccagaagccactgctggtggagacagaaggtatg------------t-ct------gaaagc-
     Lesser Egyptian jerboa  ctcagaagccactagtagtgaaggtggaaggtaag------------t-ct------gaagggc
               Prairie vole  cccagaagccggtacaggtggagatagaaggtatg--------tctgt-ct------gtgcctc
            Chinese hamster  gccagaagccgctactgctagaggtagaaggtatg--------tccgt-ct------gtatgtc
                      Mouse  cccagaagtccttactggtggaggtagaaggtatgtctatctatctgt-ct------gtacgtc
                        Rat  cccagaattccttactggtggaggtagaaggtatg----tctgtctgt-ct------gtacgtc
             Naked mole-rat  cccagaaacctctgctggtggaggtacaaggtatg------------t-cc------gaagggc
                 Guinea pig  cccagaaaccactgctggtggaggtggaaggtatg------------t-cc------aaagggc
                 Chinchilla  cccagaaaccactgctggtggaggtggaaggtacg------------t-cc------gaagggc
           Brush-tailed rat  cccagaaaccagtgctggtggaggtggaaggtatg------------t-cc------gaagggc
                     Rabbit  cccagaaactactgcaggtggagatggaaggtagg------------tcca------aagaggc
                       Pika  ctctggaaccagtgatggtggaggtggaaggtagg------------t-gg------aagggac
                        Pig  cccaggaaccatacctagtagaggctcaaggtatg------------t-cc------agagggt
                     Alpaca  cccgggaaccacacctagtggaggttaaaggtatg------------t-cc------agagggc
             Bactrian camel  cccgggaaccacacctagtggaggttaaaggtatg------------t-cc------agagggc
                    Dolphin  cccaggaaacacacctactggaggctaaaggtatg------------t-cc------ggagggc
               Killer whale  cccaggaaacacacctactggaggctaaaggtatg------------t-cc------ggagggc
           Tibetan antelope  ccgaggacccacgcctagtggaggctaaaggtatg------------t-cc------ggagggc
                      Sheep  ccgaggatccacgcctagtggaggctaaaggtatg------------t-cc------ggagggc
              Domestic goat  ccgaggatccacgcctagtggaggctaaaggtatg------------t-cc------ggagggc
                      Horse  cccaggaagcactgctggtggagactaaaggtatg------------t-cc------aaagggc
           White rhinoceros  cccaggaaccacagctggtggaggctaaaggtatg------------t-cc------aaagggc
                        Cat  cccagaaaacactgctggtggaggctaaaggtacg------------t-cc------aaagggt
                        Dog  cccaggaaacactgcaggtggaggctaaaggtatg------------t-cc------aaagggt
                    Ferret   cccagaaaacactgctggtgaatgctaaaggtatg------------t-cc------agaaggg
                      Panda  cccagaaaacactgctggtggaggctaaaggtatg------------t-cc------agagggt
             Pacific walrus  cccagaaaacactgctggtggaggctaaaggtatg------------t-cc------agagggt
               Weddell seal  cccacgaaacactgctggtggaggctaaaggtatg------------t-cc------ggagggt
           Black flying-fox  tccagaaaccacagctggtggaggctaaaggtatg------------t-cc------aaggggc
                    Megabat  tccagaaaccacagctggtggaggctaaaggtatg------------t-cc------aaagggc
              Big brown bat  cccagaaatcacagctggtggaggctacaggtatg------------a-cc------gaagggc
       David's myotis (bat)  cccagaaatcacagctgatggaggctaaaggtatg------------a-cc------gaagggc
                   Hedgehog  cccgggagccttggctggttaaggtgacgggtaag------------t-tggaactagaaggac
                      Shrew  cccaggagccacggctggtgcaggttacaggtatg------------a-cc------ggaagag
            Star-nosed mole  ctctggaagcacggctggtgaaggttacaggtatg------------t-gg------gcagggc
                   Elephant  cccagaaacaagtgct------ggttgaaggtatg------------t-ca------taaaggc
        Cape elephant shrew  cccagaaacaattgctgatgaaggttgaaggtatg------------t-cc------aggaggc
                    Manatee  cacggcaacaagtgct------ggttgaaggtacg------------t-ca------t------
           Cape golden mole  cccagaaacaaatggtggtgactgttgaaggtatg------------t-cc------gaaaggc
                     Tenrec  cccagaaacatgtgctgatgacggtagaaggtagg------------t-ct------gaaaggt
                   Aardvark  cccagaaacaagtgctgatgaaggttgaaggtagg------------t-tt------gaaaggc
                  Armadillo  ccgaggaaaaagtgctggtggaggttgaaggtatg------------t-cg------gaagggc
                    Opossum  cccaagacctcctgagagtggaggtggaaggta-------------------------------
            Tasmanian devil  cccaagacccactgagagtggaggctgaaggta-------------------------------
                    Wallaby  cccaagaccccctgaatgtggaggctgaaggta-------------------------------
                   Platypus  cccgggacttgctgcgggtggaggttgaaggtagg------------a-cc------tt-----
                   Microbat  ================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Cow  ================================================================
                Zebra finch  ================================================================
             Painted turtle  ================================================================
         American alligator  ================================================================
                     Lizard  ================================================================
                      Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 4 of 389 in window, 28932104 - 28932129, 26 bps 
B D                   Human  agaaagggaa-gggattgaggctgg-aa
B D                   Chimp  agaaagggaa-gggattgaggctgg-aa
B D                 Gorilla  agaaagggaa-gggattgaggctgg-aa
B D               Orangutan  agaaagggaa-gagattgaggctgg-aa
B D                  Gibbon  agaaagggaa-gggattgaggctgg-aa
B D                  Rhesus  agaaagggaa-gggatggaggctgg-aa
B D     Crab-eating macaque  agaaagggaa-gggatggaggctgg-aa
B D                  Baboon  agaaagggaa-gggatggaggctgg-aa
B D            Green monkey  agaaagggaa-gggatggaggctgg-ta
B D                Marmoset  agaaagggaa--ggcttgtgtctgg-aa
B D         Squirrel monkey  agaaagggaa-gggattgtgtctgg-aa
B D                Bushbaby  agcaagggaa-ggagttagagctgg-aa
         Chinese tree shrew  agagagggaa-ggagtcgcagctgg-aa
     Lesser Egyptian jerboa  agag--gaaa-ggagct-gggctag-aa
               Prairie vole  tgaa-gggaa-ggagctgggcttgg-aa
B D         Chinese hamster  tgaa--ggaa-agacctggggttgg-aa
B D                   Mouse  tggg-gggaa-ggagctagggttga-aa
B D                     Rat  tgac-tggaa-ggagctagggttgg-ga
B D          Naked mole-rat  agagagg----ggagtcgggccc-----
B D              Guinea pig  agggagggaa-ggagttgggcctag-ag
                 Chinchilla  agggagggaa-gaagtcgggcctgg-ag
           Brush-tailed rat  agggcgggaa-ggaatctggcccag-ag
B D                  Rabbit  agagagggag-ggagtcggggttgg-aa
B D                    Pika  ggggggggag-gcagctgggactgg-aa
B D                     Pig  agtgatggat-gga---agggcggg-gg
B D                  Alpaca  agaggtagac-gga---agggctgg-aa
             Bactrian camel  agaggtagac-gga---agggctgg-aa
B D                 Dolphin  agaggtggat-gga---agggctgg-aa
               Killer whale  agaggtggat-gga---agggctgg-aa
           Tibetan antelope  agaggtggac-gga---agtgttgg-aa
B D                   Sheep  agaggtggat-gga---agtgttgg-aa
              Domestic goat  agaggtggat-gga---agtgttgg-aa
B D                   Horse  atggatggaa-ggagtcggggccag-aa
B D        White rhinoceros  agagatggaa-ggagtcggggctgg-aa
B D                     Cat  acagatggaa-ggagttggggctgg-aa
B D                     Dog  acagatggaa-agagttgggggtgg-aa
B D                 Ferret   acagatggaagagagttggggctgg-aa
B D                   Panda  acagatggaa-agagttggggctgg-aa
             Pacific walrus  acagatggaa-agaattggggctggaaa
               Weddell seal  acagatggaa-agagttggggctggaaa
           Black flying-fox  acaagtagaa-ggattcggggctgg-aa
B D                 Megabat  acaagtagaa-ggattcggggctgg-aa
              Big brown bat  acagatgg-a-ggggccagggctgg-ac
       David's myotis (bat)  acggatggaa-ggagccagggccgg-ac
B D                Hedgehog  atgggtgcaa-ggagtcggggctgg-a-
B D                   Shrew  acgaatggaa-ggcactgaggctgg-aa
            Star-nosed mole  acagacagaa-gagattagggctgg-ca
B D                Elephant  acagagggaa-ggagtggggacata-ga
        Cape elephant shrew  actgagggaa-ggcgtgggcacccg-ag
B D                 Manatee  acagagagaa-ggagtggggaccgg-aa
           Cape golden mole  atagagggac-ggggtggggactgg-aa
B D                  Tenrec  acaggg----------tgggcccgg-aa
                   Aardvark  acagagggaa-ggagtggggaccgg-aa
B D               Armadillo  acaggggctg-gaagcaggggctgg-ag
B D                 Opossum  ------ggaa-gatgcccagac----ta
B D         Tasmanian devil  ------ggaa-gaagcagaggtgtg-gg
B D                 Wallaby  ------ggaa-taagcagagatgtg-gg
B D                Platypus  gaaaagagat-caactcgcctcccg-ga
B D                Microbat  ============================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Cow  ============================
B D             Zebra finch  ============================
  D          Painted turtle  ============================
B D      American alligator  ============================
B D                  Lizard  ============================

Alignment block 5 of 389 in window, 28932130 - 28932203, 74 bps 
B D                   Human  a---cttgag-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D                   Chimp  a---cttgag-ct--gtggctggg----------------tgt---------ccttggctgagtaactta
B D                 Gorilla  a---cttgag-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D               Orangutan  a---cttgag-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D                  Gibbon  a---cttgag-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D                  Rhesus  a---cttggg-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D     Crab-eating macaque  a---cttggg-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D                  Baboon  a---cttggg-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D            Green monkey  a---cttggg-tt--gtggctggg----------------tgt---------ccttggctgagtaactta
B D                Marmoset  a---cttggg-tt--gtggctgag----------------tgt---------cctcagctgagtaactta
B D         Squirrel monkey  a---cttggg-tg--gtggctggg----------------ggt---------tctcagctgagtcactta
B D                Bushbaby  a---cctggg-ct--gggactggg----------------tcc---------ccctggccgggtaactta
         Chinese tree shrew  a---cctagg-tt--ctggctggg----------------tgc---------ccttggctgggtcactta
     Lesser Egyptian jerboa  g---cctgggttt----------------------------------------ctgggctgagtaatgtg
               Prairie vole  g---cctggg-tt----------------------------------------ctgggttgagggactgg
B D         Chinese hamster  g---cctggg-tt----------------------------------------ctgggttgagtaactgg
B D                   Mouse  g---tctggg-tt----------------------------------------ctgagttgagtaactgg
B D                     Rat  g---cctggg-tt----------------------------------------cctggttgagtaactgg
B D          Naked mole-rat  -------------------ccggg----------------tga---------cctcagctgagtgactta
B D              Guinea pig  t---tctggg-ttc---cattggg----------------tga---------cttcggctcagtaacttt
                 Chinchilla  g---cctggg-ctc---cgctggg----------------cga---------cctcagctgagtaactga
           Brush-tailed rat  ggctcgtggg-ttc---cactggg----------------tga---------cctcagctgagtaactct
B D                  Rabbit  g---cctggg-ttt-g-ggctggg----------------tgc---------cctccacagcgtggctca
B D                    Pika  g---cctggg-tttcg-ggctggg----------------tgc---------cctccatagggtaacctg
B D                     Pig  a---cctggg-tt--ccggctggg----------------cgc---------cctcggccaagtggctta
B D                  Alpaca  a---cctggg-tt--ccggctggg----------------tgc---------cctcggccaagtaactta
             Bactrian camel  a---cctggg-tt--ccggctggg----------------tgc---------cctcgaccaagtaactta
B D                 Dolphin  a---cctggg-tt--ccggttggg----------------tgc---------ccttggccaagtcactta
               Killer whale  a---cctgcg-tt--ccggttggg----------------tgg---------ccttggccaagtcactta
           Tibetan antelope  a---tctggg-tt--ccggctggg----------------tgc---------ccttggccgagtcactta
B D                     Cow  a---tctggg-tt--ccggctggg----------------tgc---------ccttggctgagtcactta
B D                   Sheep  a---tctggg-tt--ccggctggg----------------tgc---------ccttggctgagtcactta
              Domestic goat  a---tctggg-tt--ccggctggg----------------tgc---------ccttggccgagtcaccta
B D                   Horse  a---cctggg-tc--ctgcctggg----------------tgc---------ccttggccaagtaactta
B D        White rhinoceros  a---cctagg-tt--ccgcctgga----------------tgc---------ccttggccaagtaactta
B D                     Cat  a---cttggg-t---ctgccgggg----------------tgc---------ccttgaccaagtaact-a
B D                     Dog  a---cttggc-t---tccgctggg----------------tgc---------cctcggccaaggaaccca
B D                 Ferret   a---cgcggg-g---ctggctggg----------------tgc---------ccttggcccagtcaccgg
B D                   Panda  a---cttggg-t---ctgcctggg----------------tgc---------ccttggc-------ctta
             Pacific walrus  a---cctggg-t---ctggctggg----------------tgc---------tcttggccaagtcactta
               Weddell seal  a---cctggg-t---ctggctggg----------------tgc---------tcttggccaaatcactta
           Black flying-fox  a---cctggg-tt--ctggctggg----------------cgt---------ctttgcccaagtaactta
B D                 Megabat  a---cctggg-tt--ctggctggg----------------cgt---------ctttgcccaagtaactta
              Big brown bat  a---cctggg-tt--caggctgga----------------tgc---------ccttggccaagtaactta
       David's myotis (bat)  a---cctggg-ct--cgggctgga----------------tgc---------ccttggccaagtaacctg
B D                Hedgehog  -----------c---ttaccc-----------------------------------agccaagtagctca
B D                   Shrew  a---aatggg-c---tcgg-------------------------------------ggccgag-aaactc
            Star-nosed mole  a---cctggg-t---ctggctggg----------------tgc---------ccttggcc----aactta
B D                Elephant  -----------------accctgg----------------tgc---------ccttggccaagtaactta
        Cape elephant shrew  -----------------cccggag----------------tgc---------cgttggccaag-aactcc
B D                 Manatee  -----------------ccccggg----------------tgc---------ccttggccaagttactta
           Cape golden mole  -----------------ccctgag----------------tgc---------cc-tggccaagtgactta
B D                  Tenrec  -----------------ctcaggg----------------gac---------ccgtggccaagccactcg
                   Aardvark  -----------------ccctggg----------------tgc---------ccttggccaagtcactca
B D               Armadillo  -----------------gcccggg----------------ttcggctgggtggcttggccacgtcgctta
B D                 Opossum  ---tctcttg-tc--ccactttgg------------------g---------cctc--------------
B D         Tasmanian devil  ---actcttg-tc--ccagcttgg---ccagtctatggtgtag---------cattgg----aaagtttg
B D                 Wallaby  ---gctctcg-tc--ccagcttggccaccaagctgttgtgtga---------cctt--------agttta
B D                Platypus  ---------------------agg----------------tgg---------ggaagagcgaggggaggg
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D      American alligator  ======================================================================
B D                  Lizard  ======================================================================

                      Human  ccctctc-t-ga---gcctccattttctta-tttgta--aaat
                      Chimp  ccctctc-t-ga---gcctccattttctta-tttgta--aaat
                    Gorilla  ccctctc-t-ga---gcctccattttctta-ttcgta--aaat
                  Orangutan  ccctctc-t-ga---gcctccattttctta-tttgta--aaat
                     Gibbon  ccctctc-t-ga---gcctccattttctta-tttgta--aaat
                     Rhesus  ccctctc-t-ga---gcctccattttctta-tttgtg--aaat
        Crab-eating macaque  ccctctc-t-ga---gcctccattttctta-tttgtg--aaat
                     Baboon  ccctctc-t-ga---gcctccattttctta-tttgtg--aaat
               Green monkey  ccctctc-t-ga---gcctccattttctta-tttgtg--aaat
                   Marmoset  ccctctc-t-ga---gcctccattttctta-tttgta--aatt
            Squirrel monkey  ccctctc-t-ga---gcctccattttcttg-tttgta--gatt
                   Bushbaby  ctctctc-t-ga---gcctccattttcata-tttgta--aaat
         Chinese tree shrew  ccctctc-t-ga---gcctccattttctga-tttgtg--aaat
     Lesser Egyptian jerboa  tcctctc-t-ga---ccctccattttctta-tctgta--aact
               Prairie vole  cctcctc-t-gc---gcctccattttctta-tttgta--aacc
            Chinese hamster  ccttctc-t-ga---g---------------------------
                      Mouse  ccttctt-g-ga---gcctccattttctta-cttgta--aa--
                        Rat  ccttctt-t-ga---gcctccattttctta-cttgta--aact
             Naked mole-rat  ccctctc-t-gg---ccctccattttctta-tttgtg--aa-a
                 Guinea pig  ccctcgc-t-ga---gcctccatt---tta-tttgtg--aa--
                 Chinchilla  ccctctc-t-ga---gcctccatt---tta-tttgtg--aaag
           Brush-tailed rat  ccctctc-t-ga---gcctccatt---tta-tctgtg--aaat
                     Rabbit  ccctctc-t-ga---gcctttctagctt---------------
                       Pika  ccttctg-t-ga---gcttctattacataa-ttcaag------
                        Pig  ccctctc-t-ga---gcctccattttctca-tttgta--acat
                     Alpaca  ccctctc-t-ga---gcctccattttctta-tttgta--aaat
             Bactrian camel  ccctctc-t-ga---gcctccattttctta-tttgta--aaat
                    Dolphin  ccctctc-t-ga---gcctccattttgtta-cttgta--aaat
               Killer whale  ccctctc-t-ga---gcctccattttgtta-cttgta--aaat
           Tibetan antelope  ccctctc-t-gg---gcctccattttgtta-tctgta--aaat
                        Cow  ccctctc-t-ga---gcctccattttgtta-tctgta--aaat
                      Sheep  ccctctc-t-gg---gcctccattttgtta-tctgta--aaat
              Domestic goat  ccctctc-t-gg---gcctccattttgtta-tctgta--aaat
                      Horse  ccctcgc-g-ga---gcctccattttctta-tttgta--aaat
           White rhinoceros  ccctcgc-t-ga---gcctccattttcttg-tttgta--aaat
                        Cat  tcctctc-t-ggatagccttcattttatta-tctgta--aaac
                        Dog  ccctctc-t-gg---gccttcattttgtta-tttgca--aaat
                    Ferret   ccctctc-t-ag---gccttcattttgtga-tctgta--agac
                      Panda  ccctccc-t-gg---gccttcattttgtta-tttgta--aaat
             Pacific walrus  ccctctc-t-gg---gccgtcattttgtta-tttgta--aaat
               Weddell seal  ccctctc-t-gg---gccttcattttgtta-tttgta--aaat
           Black flying-fox  ccctctc-t-gg---gcctccattttctta-attgta--aaat
                    Megabat  ccctctc-t-gg---gcctccattttctta-attgta--aaat
              Big brown bat  ccctctc-t-ga---gcctctatttcctta-attgta--aaat
       David's myotis (bat)  ccctctc-t-ga---gcctccattttcttc-atggga--aaat
                   Hedgehog  ccctgtc-t-ga---gcttccactttcttgtttctcc--aaat
                      Shrew  cccggcc-a-ga---gccgccgtgggcttg-ctcaca--aaat
            Star-nosed mole  ccttctc-t-ga---gccttcattgtcttg-cttgta--aaat
                   Elephant  ctctctc-tggg---gcctccattttccta-ctcata--aatt
        Cape elephant shrew  cctggtc-t--g---gtctcctttttctga-cttgtt--aacc
                    Manatee  ctctctc-t-gg---gcctccattttctaa-cttata--aaaa
           Cape golden mole  ccctttt-t-gg---gcctccattttctaa-cttctt--agat
                     Tenrec  ccctctc-t-gg---gcctccattttctcg-ctggttcaggat
                   Aardvark  ccctctc-t-gg---gcctccattttcttc-cttaga--aaac
                  Armadillo  ccctctc-t-gg---gcctccattttctca-tttgtg--agac
                    Opossum  --------t-gg---gattctgtctcctcc-actgta--aaat
            Tasmanian devil  ccactttct-gg---actttattttcttct-tgtgta--aaat
                    Wallaby  tctctct-t-gg---gcttcattttcttcc-tctgta--aaat
                   Platypus  ccgggaa-g-ga---gact-catggc-----------------
                   Microbat  ===========================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ===========================================
             Painted turtle  ===========================================
         American alligator  ===========================================
                     Lizard  ===========================================

Inserts between block 5 and 6 in window
B D                Opossum 4bp
B D        Tasmanian devil 4bp
B D                Wallaby 397bp

Alignment block 6 of 389 in window, 28932204 - 28932207, 4 bps 
B D                   Human  tcag
B D                   Chimp  tcag
B D                 Gorilla  tcag
B D               Orangutan  tcag
B D                  Gibbon  tcag
B D                  Rhesus  tcag
B D     Crab-eating macaque  tcag
B D                  Baboon  tcag
B D            Green monkey  tcag
B D                Marmoset  tcag
B D         Squirrel monkey  tcag
B D                Bushbaby  tcag
         Chinese tree shrew  ttgg
     Lesser Egyptian jerboa  tctg
               Prairie vole  tctg
B D                   Mouse  -ctg
B D                     Rat  tctg
B D          Naked mole-rat  cctg
B D              Guinea pig  --tg
                 Chinchilla  tctg
           Brush-tailed rat  tctg
B D                     Pig  tcag
B D                  Alpaca  tcag
             Bactrian camel  tcag
B D                 Dolphin  tcag
               Killer whale  tcag
           Tibetan antelope  ccag
B D                     Cow  ccag
B D                   Sheep  ccag
              Domestic goat  ccag
B D                   Horse  tcag
B D        White rhinoceros  tcag
B D                     Cat  tcag
B D                     Dog  tcag
B D                 Ferret   tcgg
B D                   Panda  tcag
             Pacific walrus  tcag
               Weddell seal  tcag
           Black flying-fox  tcag
B D                 Megabat  tcag
              Big brown bat  tcag
       David's myotis (bat)  tcag
B D                Hedgehog  tcgg
B D                   Shrew  ccgg
            Star-nosed mole  tcag
B D                Elephant  tcaa
        Cape elephant shrew  tcag
B D                 Manatee  tcag
           Cape golden mole  tcaa
B D                  Tenrec  tcag
                   Aardvark  tcag
B D               Armadillo  taag
B D                 Opossum  ccgg
B D         Tasmanian devil  ttga
B D                Platypus  cctg
B D                Microbat  ====
            Golden hamster  NNNN
B D                Squirrel  NNNN
B D         Chinese hamster  ----
B D                  Rabbit  ----
B D                    Pika  ----
B D             Zebra finch  ====
  D          Painted turtle  ====
B D      American alligator  ====
B D                  Lizard  ====
B D                 Wallaby  ====

Alignment block 7 of 389 in window, 28932208 - 28932262, 55 bps 
B D                   Human  gaa-agggttggaaggac-tc------tgccgg----ctcctc-cactcccag--ct-------ttt---
B D                   Chimp  gaa-agggttggaaggac-tc------tgccgg----ctcctc-cactcccag--ct-------ttt---
B D                 Gorilla  gaa-agggttggaaggac-tc------tgccgg----ctcctc-cactcccag--ct-------ttt---
B D               Orangutan  gga-ggggttggaaggac-tc------tgccgg----ctcctc-cactcccag--ct-------ttt---
B D                  Gibbon  gga-ggggttggaaggac-tc------tgccgg----ctcctc-cactcccag--ct-------ttt---
B D                  Rhesus  gga-ggggttggaaggac-tc------tgccgg----ctcctc-cactcccag--tt-------ttt---
B D     Crab-eating macaque  gga-ggggttggaaggac-tc------tgccgg----ctcctc-cactcccag--tt-------ttt---
B D                  Baboon  gga-ggggttggaaggac-tc------tgctgg----ctcctc-cactcccag--tt-------ttt---
B D            Green monkey  gga-ggggttggaaggac-tc------tgccgg----ctcctc-cactcccag--tt-------ttt---
B D                Marmoset  gga-gggtttggaaggac-tc------tgctgc----ctcctc-cactcccag--ct-------ttt---
B D         Squirrel monkey  gga-ggggttggaaggac-tc------tgctgg----ctcctc-cactcccag--ct-------ttt---
B D                Bushbaby  g----ggtttggaaggat-tc------taaggg----ctcatc-catgtccag--ct-------tgc---
         Chinese tree shrew  atg-ggagttgggaggac-tg------tgaggg----cctgcc-cacccccag--ct-------tgt---
B D                Squirrel  ggg-agggtgagaaggac-tc------tgaggg----c------------------t-------cgt---
     Lesser Egyptian jerboa  gga-gggggtggaaggct-ct------gcagg--------------------------------------
               Prairie vole  ggg-tgagtcagaagagtccc------tcaggg----ct--------tcccat--at-------ggt---
B D         Chinese hamster  -------------------cc------tcaggg----ct--------tcccat--at-------ggt---
B D                   Mouse  gga-ggagtcagaaagac-cc------ttagag----c---------ttccat--at-------ggt---
B D                     Rat  aga-ggtgtcagaaagac-ct------ttaggg----ct--------ttccat--at-------ggt---
B D          Naked mole-rat  gga-ggatctgagaggac-tc------tgaggg----cccat--gactcccac--ct-------tgt---
B D              Guinea pig  gga-ggatctgagaggac-cc------tgagga----cccat--tactcccac--ct-------cat---
                 Chinchilla  gga-ggatctgggagggc-tc------tgaggg----ctcct--cactcccac--cc-------tgt---
           Brush-tailed rat  gga-gggcctgagaggac-tg------tgcggg----cccat--tacccccag--ct-------gct---
B D                  Rabbit  --g-tgacccagcagg-t-gc------tggggc----ag-------------------------------
B D                    Pika  gga-tgatttggaaggat-gg------agggga----aggtt--tagctattc--ct-------ggt---
B D                     Pig  gga-gggactggaagggc-tc------tgagga----ttcatc-cactcccag--ct-------ggc---
B D                  Alpaca  aga-gggattgaaaggaa-tc------tgagga----ctcatc-cactcccag--at-------ggt---
             Bactrian camel  aga-gggattgaaaggaa-tc------tgagga----ctcatc-cactcccag--at-------ggt---
B D                 Dolphin  ggg-acgactgcaaggac-tc------tgagga----ctcttc-cactcccag--ct-------ggt---
               Killer whale  ggg-acgactgcaaggac-tc------tgagga----ctcttc-cactcccag--ct-------ggt---
           Tibetan antelope  ggg-aggattggaaagac-tc------tgagga----ctcacc-cactccctg--ct-------gtg---
B D                     Cow  ggg-aggattggaaggac-tc------tgagga----ctcatc-cactccctg--ct-------gta---
B D                   Sheep  ggg-aggattggaaagac-tc------tgagga----ctcacc-cactccctg--ct-------gtg---
              Domestic goat  ggg-aggattggaaagac-tc------tgagga----ctcacc-cactccctg--ct-------gtg---
B D                   Horse  gga-ggggttggaaggac-tc------tgaggg----ctcatc-cactcccgg--ct-------ggt---
B D        White rhinoceros  gga-ggctttggaagaac-tc------tgaggg----ctcatc-tgctcccag--ct-------gct---
B D                     Cat  aga-ggggttggaaggac-tc------t--gag----ctcatc-cgcttccag--ct-------tgt---
B D                     Dog  gga-ggagttg---ggac-tc------tgagag----ctcaca-cactcccag--ct-------ggtg--
B D                 Ferret   gga-ggggctgggaggac-tc--------agag----ctcctc-cactcccag--ct-------ggt---
B D                   Panda  gga-gggcttggaaggac-cc------tgagag----ctcatc-cactcccat--ct-------ggt---
             Pacific walrus  gga-ggggttggaaggac-tc------tgagag----ctcatc-cactcccag--ct-------ggt---
               Weddell seal  gga-ggggttggaaggac-tc------tgagag----ctcatc-cactcccag--ct-------ggt---
           Black flying-fox  gga-gaggttggaaggat-tc------tgaggg----ctcatc-cactcccaa--tt-------ggtgga
B D                 Megabat  gga-ggggttggaaggat-tc------tgaggg----ctcatc-cactcccaa--tt-------ggtgga
              Big brown bat  gcc-agggct-gaaggat-gc------tgaagg----ctcat--ggctcccag--tc-------ggtggg
       David's myotis (bat)  gcc-a-ggct-gaaggat-gc------tgaa---------------------------------------
B D                Hedgehog  gga-gagcttggctgggt-tc-------------------------ccgcctg--gt-------agc---
B D                   Shrew  cga-ggggctggaaggac-tcggggtggggggg----cttatc-tgctccccg--ct-------ggt---
            Star-nosed mole  tg--ggagttgaaaggac-tc------tgtgga----ctcgtc-cactcccag--ct-------ggt---
B D                Elephant  gga-ggggttggaaggac-tc------tgaggg----ctcatggcactcccag--ct-------tgt---
        Cape elephant shrew  aga-gggcttggaagga---c------agaggc----ctcacccaatggccag--tt-------tgt---
B D                 Manatee  gggtggggttggaaggac-tc------tgaggg----ctcatcgcactcccag--ct-------tgt---
           Cape golden mole  gaa-cgggttggaaggac-tc------tgaggg----ctcatcatacccttag--ct-------tgt---
B D                  Tenrec  gga---gggtggaagaac-tg------caaggg----ctcatgtcactcccag--ct-------cgt---
                   Aardvark  gga-ggggttggaagggc-tc------tgaggg----ctcatggtacttccag--ct-------tgt---
B D               Armadillo  gga-gggatgggaaggag-ac------tgagga----c-agtcccgctccccgctct-------cgt---
B D                 Opossum  aga-tgggatgagaagat-cc------ccagaagcgtcttccc-aactctaaa--ttcggcgatttc---
B D         Tasmanian devil  aga-tcagttgagatgat-tt------gcaggaggccctttcc-aactctaaa-----------ttc---
B D                Platypus  gga-aagaggagaagttc-tt----cttcaagc----ctcatg-tcttccctt--t--------------
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D      American alligator  ======================================================================
B D                  Lizard  ======================================================================
B D                 Wallaby  ======================================================================

                      Human  ----ggagtcc-tct
                      Chimp  ----ggagtcc-tct
                    Gorilla  ----ggagtcc-tct
                  Orangutan  ----ggagtcc-tct
                     Gibbon  ----ggagtcc-tct
                     Rhesus  ----ggagtcc-tct
        Crab-eating macaque  ----ggagtcc-tct
                     Baboon  ----agagtcc-tct
               Green monkey  ----ggagtcc-tct
                   Marmoset  ----ggagtcc-tct
            Squirrel monkey  ----ggagtcc-tct
                   Bushbaby  ----agggtcc-ctt
         Chinese tree shrew  ----ggggtcc-ttg
                   Squirrel  ----ccactc-----
     Lesser Egyptian jerboa  -------ctc-----
               Prairie vole  ----gaactt-----
            Chinese hamster  ----gaactt-----
                      Mouse  ----ggactt-----
                        Rat  ----gaactt-----
             Naked mole-rat  ----ggggct-----
                 Guinea pig  ----gggccct-ccg
                 Chinchilla  ----gggccct-ccc
           Brush-tailed rat  ----gggtcct-gcc
                     Rabbit  ---------------
                       Pika  ----tctcac-----
                        Pig  ----agggtcg-ctg
                     Alpaca  ----ggggtta-ttg
             Bactrian camel  ----ggggtta-ttg
                    Dolphin  ----ggggtcg-ttg
               Killer whale  ----ggggtcg-ttg
           Tibetan antelope  ----gggattg-ggg
                        Cow  ----gggactg-ggg
                      Sheep  ----gggatta-ggg
              Domestic goat  ----gggatta-ggg
                      Horse  ----ggggtcg-tcg
           White rhinoceros  ----ggggtcg-ttg
                        Cat  ----gggttcg-ctg
                        Dog  ----gggggtg-ctg
                    Ferret   ----ggagtcc-ttg
                      Panda  ----ggggtcg-gtg
             Pacific walrus  ----ggggtcg-ttg
               Weddell seal  ----ggggtcg-ttg
           Black flying-fox  gtccgagatca-ctg
                    Megabat  gtccgagatca-ttg
              Big brown bat  gaatggggtca-ttt
       David's myotis (bat)  -----gggtca-ttg
                   Hedgehog  ----aggggct-tgg
                      Shrew  ----ggggt-c-tcg
            Star-nosed mole  ----ggggtac-tgg
                   Elephant  ----ggggtcccttg
        Cape elephant shrew  ----gaggtcc--tg
                    Manatee  ----gaggtcc-ttg
           Cape golden mole  ----ggggtcc-ttg
                     Tenrec  ----gggtacc-cag
                   Aardvark  ----gggctcc-ttg
                  Armadillo  ----ggggtct----
                    Opossum  ----ggggtct-ctt
            Tasmanian devil  ----ggagtct-tat
                   Platypus  ---------------
                   Microbat  ===============
             Golden hamster  NNNNNNNNNNNNNNN
                Zebra finch  ===============
             Painted turtle  ===============
         American alligator  ===============
                     Lizard  ===============
                    Wallaby  ===============

Inserts between block 7 and 8 in window
B D        Tasmanian devil 351bp

Alignment block 8 of 389 in window, 28932263 - 28932299, 37 bps 
B D                   Human  gct---c-------tata--acctggtg-------tgagga-------gtcg-ggg----ggcttgga
B D                   Chimp  gct---c-------tata--acctggtg-------tgagga-------gtgg-ggg----ggcttgga
B D                 Gorilla  gct---c-------tata--acctggtg-------tgagga-------gtgg-ggg----ggcttgga
B D               Orangutan  gct---c-------tata--acccggtg-------tgagga-------gtgg-ggg----ggcttgga
B D                  Gibbon  gct---c-------tata--acccggtg-------tgaaga-------gtgg-ggg----ggcttgga
B D                  Rhesus  gat---c-------tata--acccggtg-------tgagca-------gtgg-ggg----ggcttgga
B D     Crab-eating macaque  gat---c-------tata--acccggtg-------tgagca-------gtgg-ggg----ggcttgga
B D                  Baboon  gat---c-------tata--acccggtg-------tgagga-------gtgg-ggg----ggcttgga
B D            Green monkey  gat---c-------tata--acctggtg-------tgagga-------gtgg-ggg----ggcttgga
B D                Marmoset  gct---c-------tgta--acccagtg-------tgagga-------gtgacggg----ggctcaga
B D         Squirrel monkey  gct---c-------tgtc--acccagtg-------tgagga-------gtgacggg----ggctcaga
B D                Bushbaby  gtt---t-------tatg--acccagtg-------tgagga-------aagg-tag---------caa
         Chinese tree shrew  ggt---t-------tctg--ctccagtg-------tgagga-------gcgacagg----ggctcaga
B D                Squirrel  ------ccagtccgtggg--gtcctctg--gttt-ttcgga-------ggga-agg----ggactagg
     Lesser Egyptian jerboa  ------c-------cagt--acccc-------------------------------------------
               Prairie vole  ------t-------tggg--atcctatg--gcttataagga-------ggga-agg----ggggctgg
B D         Chinese hamster  ------c-------tggg--gtcctttg--gtttatgagga-------ggga-a-a----ggggctgg
B D                   Mouse  ------c-------tggg--gtcctttg--atttatgagga-------ggga-aga----ggggctgg
B D                     Rat  ------c-------tggg--gtcctttg--atttatgagga-------ggga-aaa----ggggttgg
B D          Naked mole-rat  --------------------ggctgg----cttcttcggga-------ggct-a--------------
B D              Guinea pig  tcct--t-------agag--gtcagatg--tttctgcagga-------ggct-a--------------
                 Chinchilla  tcctgct-------tacg--gtctgttgc-tttctgcagga-------ggct-a--------------
           Brush-tailed rat  tgcttcc-------tgtg--ggttggtccgtttccatagga-------ggct-a--------------
B D                  Rabbit  ------t-------gacg--ggaagggg-------ctggga---------------------------
B D                    Pika  ------c-------agca--gggtgggg-------tgggga-------ggaa-g---------actag
B D                     Pig  ggt---c-------tata--acccaggg-------agcgga-------gtga-agg----gggctggg
B D                  Alpaca  ggt---t-------tata--accctgtg-------caaaga-------gtga-agg----ggcctaga
             Bactrian camel  ggt---t-------tata--accctgtg-------caaaga-------gtga-agg----ggcctaga
B D                 Dolphin  gct---t-------tata--acccagtg-------tgagga-------gtga-agg----gggctagg
               Killer whale  gct---t-------tata--acccagtg-------tgagga-------gtga-agg----gggctagg
           Tibetan antelope  gtt---c-------c-tc--acccagag-------tgagga-------gcga-agg----gggctggg
B D                     Cow  gtt---c-------c-tc--acccagtg-------tgagga-------gtga-agg----gggctggg
B D                   Sheep  gct---c-------c-tc--acccagag-------tgagga-------gtga-agg----gggctggg
              Domestic goat  gct---c-------c-tc--acccagag-------tgagga-------gtga-agg----gggctggg
B D                   Horse  ggt---t-------tgta--acccagtg-------tgagga-------ggga-agc----gggctcgg
B D        White rhinoceros  ggt---t-------tata--acccagtg-------tgagga-------ggga-aga----gggctagg
B D                     Cat  gg----t-------tatc--acccagtg-------cgagga-------atga-agg----gggctaag
B D                     Dog  gg----t-------aata--atccagtg-------tgagga-------atga-agg----gggcgaag
B D                 Ferret   gg----t-------aatg--acctgctg-------tgagga-------atca-aga----gggcgaag
B D                   Panda  gg----g-------aata--acccagtg-------tgaaga-------atga-agt----gggcgaag
             Pacific walrus  gg----t-------aata--acccagtg-------tgagga-------atga-agg----gggcgacg
               Weddell seal  gg----t-------aata--acccagtg-------tgagga-------atga-agg----gggcgaag
           Black flying-fox  ggt---t-------tata--acctagtg-------tgagga-------gtga-agg----gagccaga
B D                 Megabat  ggt---t-------tata--acctagtg-------tgagga-------gtga-agg----gagccaga
              Big brown bat  ggt---t-------tgta--atccagtg-------tgaggc-------gtga-agg----gggctagc
       David's myotis (bat)  ggt---t-------tgtaacacacagcg-------tgaggc-------gtga-a-g----gggctagc
B D                Hedgehog  gct---c-------tgca--acccagtg-------caaggc-------ataa-agg----gggttcgg
B D                   Shrew  ggt---c-------gata--acccggag-------ggaggc-------gggt-gtgacccgggcttgg
            Star-nosed mole  ggt---t-------taga--atccagtg-------tgagga-------gtga-ag-----gggctagg
B D                Elephant  ggt---t-------tagg--acccagtg-------tgaaga-------gaga-agg----gggacatg
        Cape elephant shrew  ggt---t-------tcag--actcagtg-------agaagagatcagggaga-agg----ggggcagg
B D                 Manatee  ggt---t-------tagg--acccagtg-------tggaga-------gaga-agt----ggggcatg
           Cape golden mole  agt---t-------tagg--tcccagta-------tgagga-------gaga-agg----agggcttg
B D                  Tenrec  ag-------------------------a-------gaaggg-------gagc-agg----gggaccct
                   Aardvark  ggt---t-------tagg--agtcagtg-------tgtaga-------gaga-aag----gggggtcg
B D               Armadillo  ggg---t-------gagg--ccccagtg-------caagga-------gtga-agg----gggg----
B D                 Opossum  ggc---c-------tgag--ggttgacg------atgggga-------gagg-agg----aagtaga-
B D                Platypus  --------------------gccc--------------------------------------------
B D                Microbat  ====================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ====================================================================
B D         Tasmanian devil  ====================================================================
  D          Painted turtle  ====================================================================
B D      American alligator  ====================================================================
B D                  Lizard  ====================================================================
B D                 Wallaby  ====================================================================

Inserts between block 8 and 9 in window
B D                Opossum 178bp

Alignment block 9 of 389 in window, 28932300 - 28932300, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  g
     Lesser Egyptian jerboa  a
               Prairie vole  g
B D         Chinese hamster  g
B D                   Mouse  g
B D                     Rat  g
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                    Pika  g
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  a
B D                     Dog  g
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  t
       David's myotis (bat)  t
B D                Hedgehog  g
B D                   Shrew  g
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  g
B D                 Manatee  g
           Cape golden mole  g
B D                  Tenrec  c
                   Aardvark  g
B D                 Opossum  g
B D               Armadillo  -
B D                Microbat  =
            Golden hamster  N
B D                  Rabbit  -
B D                     Pig  -
B D             Zebra finch  =
B D         Tasmanian devil  =
  D          Painted turtle  =
B D      American alligator  =
B D                  Lizard  =
B D                 Wallaby  =
B D                Platypus  -

Alignment block 10 of 389 in window, 28932301 - 28932302, 2 bps 
B D                   Human  gt
B D                   Chimp  gt
B D                 Gorilla  gt
B D               Orangutan  gt
B D                  Gibbon  gt
B D                  Rhesus  gt
B D     Crab-eating macaque  gt
B D                  Baboon  gt
B D            Green monkey  gt
B D                Marmoset  gt
B D         Squirrel monkey  gt
B D                Bushbaby  gg
B D                Squirrel  gc
     Lesser Egyptian jerboa  gc
               Prairie vole  gc
B D         Chinese hamster  gc
B D                   Mouse  gc
B D                     Rat  gc
B D          Naked mole-rat  gc
B D              Guinea pig  tc
                 Chinchilla  gc
           Brush-tailed rat  gc
B D                    Pika  tc
B D                  Alpaca  ac
             Bactrian camel  ac
B D                 Dolphin  gc
               Killer whale  gc
           Tibetan antelope  gt
B D                     Cow  gt
B D                   Sheep  gt
              Domestic goat  gt
B D                   Horse  ac
B D        White rhinoceros  gc
B D                     Cat  gt
B D                     Dog  gt
B D                 Ferret   tt
B D                   Panda  gt
             Pacific walrus  gt
               Weddell seal  gt
           Black flying-fox  gc
B D                 Megabat  gc
              Big brown bat  gc
       David's myotis (bat)  gc
B D                Hedgehog  gc
B D                   Shrew  gc
            Star-nosed mole  gc
B D                Elephant  gg
        Cape elephant shrew  ca
B D                 Manatee  gg
           Cape golden mole  gg
B D                  Tenrec  tc
                   Aardvark  gc
B D               Armadillo  -g
B D                 Opossum  -t
B D         Tasmanian devil  gt
B D                Microbat  ==
            Golden hamster  NN
        Chinese tree shrew  --
B D                  Rabbit  --
B D                     Pig  --
B D             Zebra finch  ==
  D          Painted turtle  ==
B D      American alligator  ==
B D                  Lizard  ==
B D                 Wallaby  ==
B D                Platypus  --

Inserts between block 10 and 11 in window
B D               Marmoset 1bp
B D                Opossum 1bp
B D        Tasmanian devil 1bp

Alignment block 11 of 389 in window, 28932303 - 28932308, 6 bps 
B D                   Human  cccccc-------------
B D                   Chimp  cccccc-------------
B D                 Gorilla  ccctcc-------------
B D               Orangutan  cccccc-------------
B D                  Gibbon  gcccccaa-----------
B D                  Rhesus  cccccc-------------
B D     Crab-eating macaque  cccccc-------------
B D                  Baboon  cccccc-------------
B D            Green monkey  cccccc-------------
B D                Marmoset  ccccca-------------
B D         Squirrel monkey  ccccca-------------
B D                Bushbaby  ctcccc-------------
         Chinese tree shrew  cacccc-------------
B D                Squirrel  t------------------
     Lesser Egyptian jerboa  t------------------
               Prairie vole  t------------------
B D         Chinese hamster  t------------------
B D                   Mouse  t------------------
B D                     Rat  t------------------
B D          Naked mole-rat  c------------------
B D              Guinea pig  c------------------
                 Chinchilla  c------------------
           Brush-tailed rat  g------------------
B D                    Pika  t------------------
B D                     Pig  ---tc--------------
B D                  Alpaca  tcctc--------------
             Bactrian camel  tcctc--------------
B D                 Dolphin  tcctc--------------
               Killer whale  tcctc--------------
           Tibetan antelope  tcctt--------------
B D                     Cow  tcctt--------------
B D                   Sheep  tcctt--------------
              Domestic goat  tcctt--------------
B D                   Horse  tcctc--------------
B D        White rhinoceros  tcctc--------------
B D                     Cat  tcctc--------------
B D                     Dog  tcctc--------------
B D                 Ferret   tcctc--------------
B D                   Panda  tcccc--------------
             Pacific walrus  gcctc--------------
               Weddell seal  tcctc--------------
           Black flying-fox  tcctc--------------
B D                 Megabat  tcctc--------------
              Big brown bat  tccccgcgaccccccctaa
       David's myotis (bat)  tcctc--------------
B D                Hedgehog  cccct--------------
B D                   Shrew  tcctg--------------
            Star-nosed mole  tcctc--------------
B D                Elephant  att-c--------------
        Cape elephant shrew  cttcc--------------
B D                 Manatee  ctt-c--------------
           Cape golden mole  ctt-c--------------
B D                  Tenrec  tct-c--------------
                   Aardvark  ctctc--------------
B D               Armadillo  ttt-c--------------
B D                Microbat  ===================
            Golden hamster  NNNNNNNNNNNNNNNNNNN
B D                  Rabbit  -------------------
B D             Zebra finch  ===================
B D         Tasmanian devil  ===================
  D          Painted turtle  ===================
B D      American alligator  ===================
B D                 Opossum  ===================
B D                  Lizard  ===================
B D                 Wallaby  ===================
B D                Platypus  -------------------

Alignment block 12 of 389 in window, 28932309 - 28932486, 178 bps 
B D                   Human  c-----------------------------------acccatgcccacacct--------c-tctc----
B D                   Chimp  c-------------------------------caccacccatgcccacacct--------c-tctc----
B D                 Gorilla  c-----------------------------------acccatgcccacacct--------c-tctc----
B D               Orangutan  c----------------------------------aacccatgcccacacct--------c-tctc----
B D                  Gibbon  c-----------------------------------ccccatgcccacacct--------c-tctc----
B D                  Rhesus  g-------------------------------------tcatgcccacacct--------c-tctc----
B D     Crab-eating macaque  g-------------------------------------tcatgcccacacct--------c-tctc----
B D                  Baboon  g-------------------------------------tcatgcccacacct--------c-tctc----
B D            Green monkey  g-------------------------------------tcatgcccacacct--------c-tctc----
B D                Marmoset  c-------------------------------------ctatccccacacct--------c-tctc----
B D         Squirrel monkey  c-------------------------------------ccatccccacacct--------c-tctc----
B D                Bushbaby  c-----------------------------------------------atct--------c-tctc----
         Chinese tree shrew  t---------------------------------------------------------------------
B D                Squirrel  c-----------------ctctctctctctctctctctctctctctctctct--------c-tctc----
     Lesser Egyptian jerboa  c-----------------------------------------------------------c-cctc----
               Prairie vole  c-----------------------------------------------------------c-cctc----
B D         Chinese hamster  c-----------------------------------------------------------c-cgtc----
B D                   Mouse  c-----------------------------------------------------------c-cctt----
B D                     Rat  c-----------------------------------------------------------t-cctt----
B D          Naked mole-rat  t--------------------------------------------------c--------c-tctc----
B D              Guinea pig  t--------------------------------------------------t--------t-tctc----
                 Chinchilla  t--------------------------------------------------c--------c-tctc----
           Brush-tailed rat  tgttctctctctctctctctctctctctctctctctctctctctctctctct--------c-tctc----
B D                  Rabbit  ------------------------------------------------ctct--------c-cctc----
B D                    Pika  c----------------------------------tctctctttctctttct--------c-tctc----
B D                     Pig  t---------------------------------------ccccccacct-c--------a-tccc----
B D                  Alpaca  t---------------------------------------ctcctcctgtcc--------g-ttct----
             Bactrian camel  t---------------------------------------ctcctcctgtcc--------g-ttct----
B D                 Dolphin  a---------------------------------------ctccccaccccc--------a-tcct----
               Killer whale  a---------------------------------------ctccccaccccc--------a-tcct----
           Tibetan antelope  t---------------------------------------ctccccgcttcc--------a-ccctgcca
B D                     Cow  t---------------------------------------ctccccgcttcc--------a-ccctgcca
B D                   Sheep  t---------------------------------------ctccccgcttcc--------a-ccctgcca
              Domestic goat  t---------------------------------------ctccccgcttcc--------a-ccctgcca
B D                   Horse  c---------------------------------------tg------------------c-tctc----
B D        White rhinoceros  t---------------------------------------ca------------------c-tctc----
B D                     Cat  t---------------------------------------ctctctctctctctctctctc-tctc----
B D                     Dog  t-----------------------------------------------------------c-cctc----
B D                 Ferret   t---------------------------------------ct---------------tccc-tccc----
B D                   Panda  t-----------------------------------------------------------t-cctc----
             Pacific walrus  t-----------------------------------------------------------c-cctc----
               Weddell seal  t-----------------------------------------------------------c-cctc----
           Black flying-fox  t---------------------------------------ctct----------------c-cttc----
B D                 Megabat  t---------------------------------------ctct----------------c-cttc----
              Big brown bat  c---------------------------------------cccc----------------accccc----
       David's myotis (bat)  t---------------------------------------cccc----------------a-cccc----
B D                Hedgehog  c-----------------------------------------------------------g-cccc----
B D                   Shrew  c-----------------------------------------------------------t-gctc----
            Star-nosed mole  t-----------------------------------------------------------c-gctc----
B D                Elephant  t-----------------------------------------------------------c-tctc----
        Cape elephant shrew  c-----------------------------------------------------------c-tctc----
B D                 Manatee  t-----------------------------------------------------------c-tctc----
           Cape golden mole  t-----------------------------------------------------------c-ttga----
B D                  Tenrec  t-----------------------------------------------------------c-tccc----
                   Aardvark  t-----------------------------------------------------------c-tctc----
B D               Armadillo  t-----------------------------------------------------------c-tctc----
B D                 Opossum  -----------------------------cacatcccctcttcctcacccat--------t-ctcc----
B D         Tasmanian devil  -----------------------------cccatcaccattttctcccctac--------t-gtcc----
B D                 Wallaby  -----------------------------ccctttctcctccactctcctct--------c-tccc----
B D                Platypus  ----------------------------------cccgccccccatctctct--------c-tctc----
B D      American alligator  ----------------------------cagccagggccacaactgaggccg--------t-tccc----
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================

                      Human  ------------------cc----t-ctctctc-------------------------------cacaga
                      Chimp  ------------------cc----t-ctctctc-------------------------------cacaga
                    Gorilla  ------------------cc----t-ctctctc-------------------------------cacaga
                  Orangutan  ------------------cc----t-ctctctc-------------------------------cacaga
                     Gibbon  ------------------cc----t-ctctctc-------------------------------cacaga
                     Rhesus  ------------------cc----t-ctctctc-------------------------------cacaga
        Crab-eating macaque  ------------------cc----t-ctctctc-------------------------------cacaga
                     Baboon  ------------------cc----t-ctctctc-------------------------------cacaga
               Green monkey  ------------------cc----t-ctctctc-------------------------------cacaga
                   Marmoset  ------------------cctgtct-gtctctc-------------------------------cacaga
            Squirrel monkey  ------------------cccg--t-gtctctc-------------------------------cacaga
                   Bushbaby  ------------------tc----t-ctttctc-------------------------------tacaga
         Chinese tree shrew  -------------------c----t-ctctctc-------------------------------cacaga
                   Squirrel  ------------------tc----t-ctctctc-------------------------------cacaga
     Lesser Egyptian jerboa  ------------------tc----t-ctttccc-------------------------------cataga
               Prairie vole  ------------------tt----c-ctctttc-------------------------------cacaga
            Chinese hamster  ------------------tt----c-ctctccc-------------------------------cacaga
                      Mouse  ------------------tt----c-ctctccc-------------------------------cacaga
                        Rat  ------------------tt----c-ctctccc-------------------------------cacaga
             Naked mole-rat  ------------------tc----t-ccc-----------------------------acccttcccaga
                 Guinea pig  ------------------tc----t-ctctgcc-----------------------tgaacctttgcaga
                 Chinchilla  ------------------tc----t-ctccccc-------------------------acccttcacaga
           Brush-tailed rat  ------------------tc----t-ctcccccccccccccggacacccccccccccgacccctcacaga
                     Rabbit  ------------------cc----t-ctctgcc-------------------------------cacaga
                       Pika  ------------------tc----t-ttctctc-------------------------------tttaga
                        Pig  ------------------tc----t-ctctctc-------------------------------cgcaga
                     Alpaca  ------------------tc----t-ctctctc-------------------------------cacaga
             Bactrian camel  ------------------tc----t-ctctctc-------------------------------cacaga
                    Dolphin  ------------------tc----t-ctctctc-------------------------------cacaga
               Killer whale  ------------------tc----t-ctctctc-------------------------------cacaga
           Tibetan antelope  ccccaccctg----tctctc----t-ctctctc-------------------------------cccaga
                        Cow  ccccaccctg--tccctctc----t-ctctctc-------------------------------cacaga
                      Sheep  ccccaccctg------tctc----t-ctctctc-------------------------------cacaga
              Domestic goat  ccccaccctgtctctctctc----t-ctctctc-------------------------------cacaga
                      Horse  ------------------ct----t-ctctctc-------------------------------cacaga
           White rhinoceros  ------cccg--------cc----c-ctctctc-------------------------------cacaga
                        Cat  ------------------tc----t-ctctctc-------------------------------ctcaga
                        Dog  ------------------tt----t-ctttctc-------------------------------ctcaga
                    Ferret   ------------------tc----t-ctctctc-------------------------------ctcaga
                      Panda  ------------------tc----t-ctctttc-------------------------------ctcaga
             Pacific walrus  ------------------tc----t-ctctctc-------------------------------ctcaga
               Weddell seal  ------------------tc----t-ctctctc-------------------------------ctcaga
           Black flying-fox  ------------------tc----t-ctctctc-------------------------------cgcaga
                    Megabat  ------------------tc----t-ctctctc-------------------------------cgcaga
              Big brown bat  ------------------gc----t-ctctctc-------------------------------cgcaga
       David's myotis (bat)  ------------------gc----t-ctctttc-------------------------------cataga
                   Hedgehog  ------------------tc----t---ttctc-------------------------------cacaga
                      Shrew  ------------------tc----c---ttctc-------------------------------cacaga
            Star-nosed mole  ------------------cc----ccatctctc-------------------------------cacaga
                   Elephant  ------------------tt----t-ttgtctc-------------------------------cacaga
        Cape elephant shrew  ------------------tc----t-ttctctc-------------------------------tacaga
                    Manatee  ------------------tc----t-ttctctc-------------------------------cacaga
           Cape golden mole  ------------------tt----t-ctctc---------------------------------cacaga
                     Tenrec  ------------------tc----t-ctctcct-------------------------------cgcaga
                   Aardvark  ------------------tc----t-ttctctc-------------------------------cacaga
                  Armadillo  ------------------cc----t-ctctctc-------------------------------cacaga
                    Opossum  ------------------tc----t-ctctctt-------------------------------cccaga
            Tasmanian devil  ------------------tc----t-ctctctc-------------------------------cacaga
                    Wallaby  ------------------tc----t-ctctctc-------------------------------cacaga
                   Platypus  ------------------ta----t-ctctctc-------------------------------tgtaga
         American alligator  ------------------tc----t-cccgccc-------------------------------cacaga
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================

                      Human  gggagataacgctgtgctgcagtgcct--------------------caaggggacctcaga--------
                      Chimp  gggagataacgctgtgctgcagtgcct--------------------caaggggacctcaga--------
                    Gorilla  gggagataacgctgtgctgcagtgcct--------------------caaggggacctcaga--------
                  Orangutan  gggagataacgctgtgctgcagtgcct--------------------caaggggacctcaga--------
                     Gibbon  gggagataatgctgtgctgcagtgcct--------------------caaggggacctcaga--------
                     Rhesus  gggagataacgctgtgctgcagtgcct--------------------cgaggggacctcaga--------
        Crab-eating macaque  gggagataacgctgtgctgcagtgcct--------------------cgaggggacctcaga--------
                     Baboon  gggagataacgctgtgctgcagtgcct--------------------cggggggacctcaga--------
               Green monkey  gggagataacgctgtgctgcagtgcct--------------------cggggggacctcaga--------
                   Marmoset  gggagatgacgctatgctgttgtgcct--------------------tgaggagacctcaca--------
            Squirrel monkey  gggagatgacgctgtgctgttgtgcct--------------------tgaggagacctcaca--------
                   Bushbaby  gggaagtgatgctgtgctgcagtgcct--------------------taagggtccctcaga--------
         Chinese tree shrew  gggagccaatgccatactgccgtgcct--------------------tgggaatccctctgg--------
                   Squirrel  gggaaaagagatcctgctgccctgcct--------------------ccaggat------ca--------
     Lesser Egyptian jerboa  gggaagcgatgctgtattgtcgtgtct--------------------ccagaactcttcatt--------
               Prairie vole  gggaggcaatcttgtgctaccgtgcct--------------------ctcggaccccccacc--------
            Chinese hamster  gggaagcaatcttgtgctgccatgcct--------------------cccggacccctcacc--------
                      Mouse  gggaggcaatgttgtgctgccatgcct--------------------cccggactcctcacc--------
                        Rat  gggagacaatgttgtgctgtcatgcct--------------------ccgggactcctcacc--------
             Naked mole-rat  gggaggtgatgccgtgctgccgtgcct--------------------tcggggcccctccag--------
                 Guinea pig  aggaggtgatgctgtgttgccgtgcct--------------------ccggggtccctccac--------
                 Chinchilla  gggaggcgatgctgtgctgccgtgcct--------------------ccggggtccctccag--------
           Brush-tailed rat  gggcggcaatgtagtgctgccgtgcct--------------------gcggaatctgtccag--------
                     Rabbit  gggaagtgatgctgtgttgccgtgcct--------------------ccaggaccccccgga--------
                       Pika  gggaagtgacctcatgctgccgtgcct--------------------cttgaacctctcaga--------
                        Pig  gggaggcaatgctgtactaccgtgcct--------------------cgaaggtccctcaga--------
                     Alpaca  gggaggcaatgctgtgctgtcgtgcct--------------------tggaggtcccacaga--------
             Bactrian camel  gggaggcaatgctgtgctgtcgtgcct--------------------tggaggtcccacaga--------
                    Dolphin  gggaggcaatgctgtgctgccgtgcct--------------------tgacggtctctcaga--------
               Killer whale  gggaggcaatgctgtgctgccatgcct--------------------tgacggtctctcaga--------
           Tibetan antelope  gggaggcaacgctgtgctgccatgcct--------------------cgaagcttcctcggc--------
                        Cow  gggaggcgatgctgtgctgccatgcct--------------------cgaaggttcctcggc--------
                      Sheep  gggaggcaacgctgtgctgccatgcct--------------------cgaagcttcctcggc--------
              Domestic goat  gggaggcaatgctgtgctgccatgcct--------------------cgaagcttcctcggc--------
                      Horse  gggagacaatgctgtgctgccgtgctt--------------------cag---tccctcaga--------
           White rhinoceros  gggagacaacgctgtgctgccgtgctt--------------------caa---ttccccaga--------
                        Cat  gggaggcaaagctgagctgccatgcct--------------------caaaggtccctcaga--------
                        Dog  gggaggcaaagctgagctgccatgcct--------------------caaagttccctcaga--------
                    Ferret   gggaggcaaagctgagctaccatgtct--------------------caacagtccctcaga--------
                      Panda  gggaggcaaagctgagctgccatgtct--------------------caaaggtccctcaga--------
             Pacific walrus  gggaggcaaagctgagctgccatgcct--------------------caaaggtccctcaga--------
               Weddell seal  gggaggcaaagttgagctgccatgctt--------------------caaaggtccctcaga--------
           Black flying-fox  gggaagcagtgctgtgctaccatgcct--------------------caagggttcctcaga--------
                    Megabat  gggaagcagtgctgtgctaccatgcct--------------------caagggttcctcaga--------
              Big brown bat  gggaggcagtgctgtgctgccgtgcct--------------------------ttcctccga--------
       David's myotis (bat)  gggaggcagtgctgtgctgccctgcgt--------------------------ttcctcggg--------
                   Hedgehog  gggagaagatgcccatctgccgtgcct--------------------cacagacccccctga--------
                      Shrew  gggagacgatgctgtgctgccgtgcct--------------------tagagaccccctcga--------
            Star-nosed mole  gggagataatgctttgttgcagtgcct--------------------caaagatcccccaga--------
                   Elephant  gggagacgatgccatgctgacgtgtct--------------------caaggaccccttaaactcctcac
        Cape elephant shrew  gggagaagatgctgtgctgagctgcct--------------------caaggagtccttaaa--------
                    Manatee  gggagacgatgccacgctgccgtgttt--------------------aaagaacacctcaga--------
           Cape golden mole  aggagatgacgccatgctgacgtgcct--------------------caaggaaactttaga--------
                     Tenrec  gggagatgatgctgttttgagctgcct--------------------ccaggagccccccga--------
                   Aardvark  gggagatgatgccgtgctgccgtgccc--------------------caaggagtccctggg--------
                  Armadillo  gggaggcgatgcctacctgccgtgcct--------------------caatgactccttgga--------
                    Opossum  gggaaggaatgcggtgctgccctgcct--------------------gaccagccccagcga--------
            Tasmanian devil  ggggaggaatgcggttctgccatgctt--------------------gattggccccaggga--------
                    Wallaby  gggaaggaatgcagtgctgccatgcct--------------------gattggccccaggga--------
                   Platypus  gggggcggatgcagtgttgccctgcct--------------------tattggcccccggga--------
         American alligator  gtcgggcacggccgtgctgccctgccagggccccggggaccgggacacagaggccctgcagc--------
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================

                      Human  -tggcccc------actcagcagctgacctggtctcgggag------tc------------cc---c---
                      Chimp  -tggcccc------actcagcagctgacctggtctcgggag------tc------------cc---c---
                    Gorilla  -tggcccc------actcagcagctgacctggtctcgggag------tc------------cc---c---
                  Orangutan  -tggcccc------actcagcagctgacttggtttcgggag------tc------------cc---c---
                     Gibbon  -tggcccc------actcagcagctgacctggtgtcgggag------tc------------cc---c---
                     Rhesus  -tggcccc------actcagcagctggtctggtgtcgggac------tc------------cc---c---
        Crab-eating macaque  -tggcccc------actcagcagctggtctggtgtcgggac------tc------------cc---c---
                     Baboon  -tggcccc------actcagcagctggtctggtgtcgggac------tc------------cc---c---
               Green monkey  -tggcccc------actcagcagctggtctggtgtcgggac------tc------------cc---c---
                   Marmoset  -agaccct------gctcagcaagtggcctggtggcgggag------tc------------cccatc---
            Squirrel monkey  -tgaccct------gctcagcaactggcctggcggcgggag------tc------------cccgtc---
                   Bushbaby  -ttgtccc------ccagagcagctgacctggtatcggggg------tc------------cc---a---
         Chinese tree shrew  -tgatccc------cctgagcagctgacctggtatcggggg------tc------------tc---t---
                   Squirrel  -tgctccc------tcccagcagctggcctggtctcggggg------aa------------cc---a---
     Lesser Egyptian jerboa  -tgccccc------tctaagaagttggcctggtatcgcgga------aa------------cc---a---
               Prairie vole  -tgtctct------tctgagaagctggcctggtatcgagga------aa------------tc---a---
            Chinese hamster  -taactct------actgagaaactagcctggtatcgaggg------aa------------tc---a---
                      Mouse  -tgtctct------tctgagaagctggcttggtatcgaggt------aa------------cc---a---
                        Rat  -tgtctct------tctgagaagctggcttggtatcgaggt------aa------------cc---a---
             Naked mole-rat  -tgcccgc------tctgagcccctggtctggtctcggggg------aa------------cc---a---
                 Guinea pig  -tgctccc------tctgagcagctggtctggtctcggggc------aa------------cc---a---
                 Chinchilla  -tgccccc------gctgagcagatggtctggtctcggggc------aa------------cc---a---
           Brush-tailed rat  -tgccccccacccacctgagaagatggtctggttccagggc------aa------------cc---a---
                     Rabbit  -tggtccc------cctgagcggctgatctggtctcggg---------------------------a---
                       Pika  -tagttcc------cctgacacactgacctggtatcggg---------------------------a---
                        Pig  -aggcccc------cctgagcagctggcctggtttcggggg------tc------------cc---a---
                     Alpaca  -tggtccc------actgagcaactggcctggtttcagggg------cc------------cc---a---
             Bactrian camel  -tggtccc------actgagcaactggcctggtttcagggg------cc------------cc---a---
                    Dolphin  -tggtccc------cctgagcaactggcctggtttcggggc------tc------------cc---a---
               Killer whale  -tggtccc------cctgagcaactggcctggtttcggggc------tc------------cc---a---
           Tibetan antelope  -tggtccc------cctgaacaactggcctggtttcggggc------tc------------cc---a---
                        Cow  -tggtccc------cctgaacaactggcctggtttcggggc------tc------------cc---a---
                      Sheep  -tggtccc------cctgaacaactggcctggtttcggggc------tc------------cc---aatc
              Domestic goat  -tggtccc------cctgaaaaactggcctggtttcggggc------tc------------cc---aatc
                      Horse  -tggtccc------cctcagaagctggcccagtataaggagacagaagc------------tt---t---
           White rhinoceros  -gggtcac------tcgcagaagctggcctggtttcgggagacggcagc------------tt---t---
                        Cat  -tggtccc------cctgagcagcaggcctggtttcagggg------gc------------tc---a---
                        Dog  -tggtccc------cttgagcagcaggcctggtttcagggg------gc------------tc---a---
                    Ferret   -tggtccc------cctgagcagcagacctggcttcagggg------tc------------ta---a---
                      Panda  -tggtccc------cttgaacagcaggcctggtttcggggg------tc------------tc---a---
             Pacific walrus  -tggtcgt------cctaagcagcaggcctggtttcagggg------tc------------tc---a---
               Weddell seal  -tggtcgt------cctgagcagcaggcctggtttcagagg------tc------------tc---a---
           Black flying-fox  -tggttcc------ccccatcagctggcctggaatcgggag------tgcaagtcggcatcct---t---
                    Megabat  -tggtccc------ccccatcagctggcctggaatcgggag------tgcaagtcggcatcct---t---
              Big brown bat  -tgatccc------cccgatcagctggcctggtatcaggcg------tg------------cc---a---
       David's myotis (bat)  -gggtccc------cctgatcagctggcctggtacgaggcg------tg------------cc---t---
                   Hedgehog  -caatctc------ctggagtcgctggcctggtatcagggg------gc------------cc---a---
                      Shrew  -cggtccc------cctgaggacctggcctggtaccggg---------------------------a---
            Star-nosed mole  -cgatggc------cccaagcagctgaactggtctcggatg------cc------------cc---a---
                   Elephant  ctgagtcc------tctatgcccctggcctggtatcagggg------tc------------ca---a---
        Cape elephant shrew  -tgagacc------gctgagtccctgatctggtcccgggag------tc------------ac---a---
                    Manatee  -tgagtcc------cctgtgctcctggcctggtatcggggg------tc------------cc---a---
           Cape golden mole  -tgagccc------cttgaacccctggcctggtatcgaggg------tc------------cc---a---
                     Tenrec  -gaagcct------tcggagctcctggcctggtctcggagc------tc------------cc---a---
                   Aardvark  -ggagtcc------tctgagcctctgagctggtatcggggc------tc------------cc---a---
                  Armadillo  -tgggccc------cctgagcagctggcctggttccggggg------tc------------cc---a---
                    Opossum  -cagctcc------ttcaagcccatcacctggtccggagga------gg------------gc---a---
            Tasmanian devil  -tggactc------tttgaaccagtcacctggtctggagga------gg------------gc---a---
                    Wallaby  -tggaccc------tttgagccgatcacctggtctggagga------gg------------gc---a---
                   Platypus  -tgacccg------cgtgagcagctgacctggtcctggggg------gg------------ca---a---
         American alligator  -cgccctc------cctg---cgctggcagggcccaggggg------cc------------gc---gagc
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================

                      Human  -gct---taaacccttcttaaaa------------ctcagcctggggctgccaggcctgggaatccacat
                      Chimp  -gct---taaacccttcttaaaa------------ctcagcctgggcctgccaggcctgggaatccacat
                    Gorilla  -gct---taaacccttcttaaaa------------ctcagcctggggctgccaggcctgggaatccacat
                  Orangutan  -gtt---taaacccttcttaaaa------------ctcagcctggggctgccaggcctgggaatccacat
                     Gibbon  -gct---taaacccttcttaaaa------------ctcagcctggggctgccaggcctgggaatccacat
                     Rhesus  -gtt---tgaacccttcttaaat------------ctcagcctggggctgccaggcatgggaatccgcat
        Crab-eating macaque  -gtt---tgaacccttcttaaat------------ctcagcctggggctgccaggcatgggaatccgcat
                     Baboon  -gtt---tgaacccttcttaaat------------ctcagcctggggctgccaggcatgggaatccgcat
               Green monkey  -gtt---tgaacccttcttaaat------------ctcagcctggggttgccaggcatgggaatccgcat
                   Marmoset  -gct---cgaacccttcttaaaa------------ctcaacctggggctgccaggcctgggattccacgt
            Squirrel monkey  -gct---cgaacccttcttaaaa------------ctcagcctggggctgccaggcctgggaatccacgt
                   Bushbaby  -gtc---agcacccttcttagac------------ctcagcctggggttaccagacctgggcatctacat
         Chinese tree shrew  -gtc---aacacctttcttaaac------------ctgagcctggggtcacaagacctgggcatccaggt
                   Squirrel  -gtc---agaacccttcttagag------------ctgagcctgggcttaccagacctggacgtccttgt
     Lesser Egyptian jerboa  -gtc---agcacccttcttggag------------ttgggcatagggtcaccaggcctgggcctacaagt
               Prairie vole  -gtc---tacacccttcttggag------------ctgagcatagggtccccaggcctgggcctgcaggt
            Chinese hamster  -gtc---aacacccttcttggag------------ctgagcctagggtccccaggcctaggcctgcgtgt
                      Mouse  -gtc---aacacccttcctggag------------ctgagccccgggtcccctggcctgggattgcacgt
                        Rat  -gtc---aacacccttcctggag------------ctgagcctcaggtccccggacctgggtctgcacat
             Naked mole-rat  -gtc---ggcgcccttcttagag------------ctgagcctggggctccccggcctgggtgtccagat
                 Guinea pig  -gtc---agcacccttcttagag------------ctgaacctggggctccctgacctgggcatccacac
                 Chinchilla  -gtc---agcacccttcttagag------------ctgagcctgtggctccccagcctaggcatccacat
           Brush-tailed rat  -gtc---ggcacccttcctagag------------ctgagcgtggaggtccctggcctgggcatccacat
                     Rabbit  -ctcccaagggcctttcctggag------------ctgagccccgggtccccaggcctgggcatccatgt
                       Pika  -gtc---aaactcctttttagag------------ctgagcccagggaccccaggccaggccttctatgt
                        Pig  -gtc---cacacccttcttagag------------ctgagcctagggttaccaggcttgggcatccatgt
                     Alpaca  -gtc---aaaacccttcctagag------------ctgagcctagggttaccaggcctgggcgtccatgt
             Bactrian camel  -gtc---aaaacccttcctagag------------ctgagcctagggttaccaggcctgggcgtccatgt
                    Dolphin  -atc---aacacccttcttagag------------ctgagcctagggttaccaggcctgggcatccatgt
               Killer whale  -atc---aacacccttcttagag------------ctgagcctagggttaccaggcctgggcatccatgt
           Tibetan antelope  -atc---aacacccttcttacag------------ttgaccctagggttaccaggcctgggcatccatgt
                        Cow  -aac---aacacccttcttaaat------------ttgagcctagggttaccaggcctgggcatccatgt
                      Sheep  -aac---aacacccttcttagtg------------ttgaccctagggttaccaggcctgggcatccatgt
              Domestic goat  -aac---aacacccttcttaatg------------ttgaccctagggttaccaggcctgggcatccatgt
                      Horse  ----------------cttacag------------ctgagctcaaagttacgagacctgagcattcagaa
           White rhinoceros  ----------------cttagcg------------ctgagcccaaagttacgagacctgagcattcagaa
                        Cat  ----------------gtcagag------------ctggacccaggttcacaaggcctgggcatccagaa
                        Dog  ----------------gtcagag------------ctgggcctctggtcacaaggcctgggcgtccggaa
                    Ferret   ----------------gtcagat------------ctgggccacgggccccaagacgtggtcatccagaa
                      Panda  ----------------gtcagag------------ctgggctacgggtcccaaggcctgggcatccggaa
             Pacific walrus  ----------------ggcagag------------ctgggccacaggtcccaaggcctgggcatccagaa
               Weddell seal  ----------------gtcagag------------ctgggccacaggtcccaaggcctgggcatccagaa
           Black flying-fox  ----------------gttacag------------atgagtgcagggctgccaggcctgggcatccaggt
                    Megabat  ----------------gttacag------------atgagtgcagggctgccaggcctgggcatccaggt
              Big brown bat  ----------------gtcacag------cggaaccagagccgagggctgccaggcctgggcatccaggt
       David's myotis (bat)  ----------------gttacagcggagccggagccggagccgagggctgccaggcctgggcatccaggt
                   Hedgehog  -gtc---agagcccttcttagtg------------ttgagccatcgggtcccaggcctgggcctccagaa
                      Shrew  -gga---caaacccttcctgcag------------ctgaaccgagggtcactgaacgtgggggtggagaa
            Star-nosed mole  -gga---agaatccttgttggca------------ttgaaacaagggttaccaggcctgggcatcgagaa
                   Elephant  -gac---agagcccttcttagag------------ctgaagctggggttaccaggcctgggcatccaggt
        Cape elephant shrew  -gcc---agcgcccttcttagag------------ctgaactttagagcagagaacatgggcatctgggt
                    Manatee  -gcc---agtgccactcttagag------------ctaagcctggggttaccaggcctgggcatccaggt
           Cape golden mole  -gcc---agtgcccttcttagag------------ctgagcctggggctacctggcctgggtgtccaagt
                     Tenrec  -gct---catacccctcttagag------------ctgcgcctgggtgtgcccggcctgggcatccaggt
                   Aardvark  -gcc---agtgccttttttagag------------ctaagcttgggcttaccaggcctgggcatccaggt
                  Armadillo  -gaa---agtccccttcttaagg------------ctgagcacgaggttaccaggcctgggcatccaggt
                    Opossum  -gct---ggcctctttgcagcaa------------ctcaccctgaaaggcccaggcgtgggggcccaggt
            Tasmanian devil  -gct---atcctctttgcaacaa------------ttgaccctgaaaagcccaggtttgggggcccaggt
                    Wallaby  -gct---atcctctttgcagcag------------ttaaccctgaaaagaccagggttgggggtccaggt
                   Platypus  -gag---gatccctttgcgttgg------------ctgaactcaggaggcccaggcctgggggcccgggt
         American alligator  tgct---gcagctcaatgtgacg------------aggggccaggggctgcaggatgtgcggctc-----
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================

                      Human  gaggc
                      Chimp  gaggc
                    Gorilla  gaggc
                  Orangutan  gaggc
                     Gibbon  gaggc
                     Rhesus  ggggc
        Crab-eating macaque  ggggc
                     Baboon  ggggc
               Green monkey  ggggc
                   Marmoset  ggggc
            Squirrel monkey  ggggc
                   Bushbaby  gggga
         Chinese tree shrew  ggggc
                   Squirrel  gggcc
     Lesser Egyptian jerboa  ggggc
               Prairie vole  ggggc
            Chinese hamster  ggggt
                      Mouse  ggggt
                        Rat  cgggc
             Naked mole-rat  gggac
                 Guinea pig  gggac
                 Chinchilla  ggggc
           Brush-tailed rat  gggac
                     Rabbit  ggggc
                       Pika  ggggc
                        Pig  ggggc
                     Alpaca  ggggc
             Bactrian camel  ggggc
                    Dolphin  ggggc
               Killer whale  ggggc
           Tibetan antelope  ggggc
                        Cow  ggggc
                      Sheep  ggggc
              Domestic goat  ggggc
                      Horse  acggc
           White rhinoceros  acagc
                        Cat  ggggc
                        Dog  ggggt
                    Ferret   ggggt
                      Panda  ggggt
             Pacific walrus  ggggt
               Weddell seal  ggggt
           Black flying-fox  ggggc
                    Megabat  ggggc
              Big brown bat  ggggc
       David's myotis (bat)  ggggg
                   Hedgehog  ggggc
                      Shrew  ggggc
            Star-nosed mole  ggggc
                   Elephant  ggggc
        Cape elephant shrew  gggcc
                    Manatee  ggggc
           Cape golden mole  gggcc
                     Tenrec  ggggc
                   Aardvark  ggggc
                  Armadillo  gggat
                    Opossum  gggac
            Tasmanian devil  ggaac
                    Wallaby  ggaac
                   Platypus  cggac
         American alligator  ggggc
                   Microbat  =====
             Golden hamster  NNNNN
                Zebra finch  =====
             Painted turtle  =====
                     Lizard  =====

Inserts between block 12 and 13 in window
B D               Marmoset 543bp

Alignment block 13 of 389 in window, 28932487 - 28932569, 83 bps 
B D                   Human  ccctggccatct---------------------ggcttttcatcttcaacgtctctcaacagatgggggg
B D                   Chimp  ccctggccatct---------------------ggcttttcatcttcaacgtctctcaacagatgggggg
B D                 Gorilla  ccctggccatct---------------------ggcttttcatcttcaacgtctctcaacagatgggggg
B D               Orangutan  ccctggccatct---------------------ggcttttcatcttcaacgtctctcaacagatgggggg
B D                  Gibbon  ccctggccatct---------------------ggcttttcatcttcaacgtctctcaccagatgggagg
B D                  Rhesus  ccctgggcatct---------------------ggcttttaatcttcaacgtctctaaccagacgggggg
B D     Crab-eating macaque  ccctgggcatct---------------------ggcttttaatcttcaacgtctctaaccagacgggggg
B D                  Baboon  ccctgggcatct---------------------ggcttttaatcttcaacgtctctaaccagacgggggg
B D            Green monkey  ccctgggcatct---------------------ggcttttaatcttcaacgtctctaaccagacgggggg
B D         Squirrel monkey  ccaggggcatct---------------------ggcttttcatcttcaatgtctctcaccagatgggggg
B D                Bushbaby  ccctgggcatcc---------------------tgacattcatcttcaacatctctgatcagatgggggg
         Chinese tree shrew  ccctgggcatcc---------------------tgctgctcctcttcaacgtctctgaccagatgggggg
B D                Squirrel  acctgggcatcc---------------------tgc---tcgtcttcaacgtctctcaccagatgggggg
     Lesser Egyptian jerboa  ccctaggcatcc---------------------tgctactcatcttcaacgtctcagaccagatgggtgg
               Prairie vole  ccctaggagtct---------------------tgctagtcattgtcaatgtttcggaccatatgggggg
B D         Chinese hamster  ccctgggaatct---------------------tgctagtcattgtcaatgcctcggaccatatgggggg
B D                   Mouse  ccctgggcatct---------------------tgctagtgattgtcaatgtctcagaccatatgggggg
B D                     Rat  ccctgggcatct---------------------tgctagtgattgtcaatgtctcggaccataggggggg
B D          Naked mole-rat  ctctgggcatcc---------------------tgctgctcatcttcaacgtctctgaccagatgggggg
B D              Guinea pig  ctctgggcatcc---------------------tgctgctcatcttcaatgtctctgacaagatgggggg
                 Chinchilla  ctctgggcatcc---------------------tggtgctcgtcgtcaatgcctctgaccacacgggggg
           Brush-tailed rat  ctctaggcatcc---------------------tgctgtttatcttcaatgtctctgaccagatgggggg
B D                  Rabbit  gtcttggcatct---------------------tgctgctcatcttcaacgtctctaatgagatgggggg
B D                    Pika  ctatgggcatcc---------------------tactcctcctcttcaatgtctccgagcacatgggggg
B D                     Pig  ccctgggcaccctgaaggagccccagggaaccctgctctttatcttcaacgtctccgaccagatgggggg
B D                  Alpaca  ctctgggtaccctgaaggagccccagggaaccctgctgttcatcttcaatgtctccgaccagatgggggg
             Bactrian camel  ctctgggtaccctgaaggagccccagggaaccctgctgttcatcttcaatgtctccgaccagatgggggg
B D                 Dolphin  ccctgggcaccctgaaggagccccagggaaccttgctgttcatcttcaatgtctccgaccagatgggggg
               Killer whale  ccctgggcaccctgaaggagccccagggaaccttgctgttcatcttcaatgtctccgaccagatgggggg
           Tibetan antelope  ctctgggcaccctgaaggagccccaggggaccatgctgttcctcttcaatgtctccaaacatatgggggg
B D                     Cow  ctctgggcaccctgaaggagccccagggaaccctgctgttcctcttcaatgtctccaaacatatgggggg
B D                   Sheep  ctctgggcaccctgaaggagccccagggaaccatgctgttcctcttcaatgtctccaaacatatgggggg
              Domestic goat  ctctgggcaccctgaaggagccccagggaaccatgctgttcctcttcaatgtctccaaacatatgggggg
B D                   Horse  ccttgggcatca---------------------tgctgctcgtcttcaacgtctctaaccagatgggggg
B D        White rhinoceros  ccctgggcatca---------------------tgctgctcatcttgaacgtcactaagcagatgggggg
B D                     Cat  ccctgggcctcc---------------------agctcctcatcttcaacgtctctgaccagatgggggg
B D                     Dog  ctctgggcatcc---------------------agctgttcgtcttcaacgtctctgaccagatgggggg
B D                 Ferret   ccctgggcgtcc---------------------agctgcttgtcttcaacgtctccgaccagatgggggg
B D                   Panda  ccctgggcgtcc---------------------agctgttcgtcttcaacgtctctgaccagatgggggg
             Pacific walrus  cccttggcgtcc---------------------agctgttcgtcttcaacgtctctgaccagatgggggg
               Weddell seal  ccctgggcgtcc---------------------agctgttcgtcttcaacgtctctgaccagatgggggg
           Black flying-fox  ccctgggcatcc---------------------tgctgctcatctccaacatctctgaccagatgggggg
B D                 Megabat  ccctgggcatcc---------------------tgctgctcatctccaacatctctgaccagatgggggg
              Big brown bat  ccctgggcatcc---------------------tgctgctcatctccaacatctctgaccagatgggggg
       David's myotis (bat)  ccctgggcatcc---------------------tgctgctcatctccgacatctctgcccagatgggggg
B D                Hedgehog  cccagggtgtct---------------------ggctgtccctcttcaacatcagcgagcagatgggggg
B D                   Shrew  cccagggcctct---------------------ggatgttcagcaccaatgtctcggcggagatgggggg
            Star-nosed mole  cccagaatgtct---------------------ggctgttcgttctcaacatctctgagcagatgggggg
B D                Elephant  ctctgggcatca---------------------tgctgctcatcttcaacgtctcgtaccagatgggggg
        Cape elephant shrew  gcctgggcatcc---------------------tgatgctcctcttcaacgtctcagatcatatgggggg
B D                 Manatee  cccggggcatcc---------------------tgctgctcatcttcaacatctcggaccagatgggggg
           Cape golden mole  ccctgggcatcc---------------------tgctgctcatcttcaacgtctcggaccagatgggggg
B D                  Tenrec  ccctgggcatcc---------------------tgctgctcatctccaacgtctcggaccagatgggagg
                   Aardvark  ccctgggcatcc---------------------tgctgatcatcttcaacgtctcggaccagatgggggg
B D               Armadillo  ccctgggcatcc---------------------tgctgcttgtcttcaacatctcgaaccagatgggggg
B D                 Opossum  ccgtgaacatct---------------------cccttttcatctccaacatctcagccgagtctggggg
B D         Tasmanian devil  ccttgaaggtct---------------------ccctcttcatctataacatctcagcccagtctggggg
B D                 Wallaby  cctcgaacatct---------------------ccctcttcatctataacatctcagctatgtctggggg
B D                Platypus  ctctgggcatct---------------------ccctgatcatactgaatgtctcagacaacactggagg
B D      American alligator  --ctggggggcc-----------------------ctgtggctgcccaacgtctctgccgcagacgccgg
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================
B D                Marmoset  ======================================================================

                      Human  cttctacctgtgccagccggggcccccctctgag
                      Chimp  cttctacctgtgccagccggggcccccctctgag
                    Gorilla  cttctacctgtgccagccggggcccccctctgag
                  Orangutan  cttctacctgtgccagcaggggcccccctctgag
                     Gibbon  cttctacctgtgccagccagggcccccctctgag
                     Rhesus  cttctacctatgccagccggggctcccctctgag
        Crab-eating macaque  cttctacctatgccagccggggctcccctctgag
                     Baboon  cttctacctatgccagccggggctcccctctgag
               Green monkey  cttctacctatgccagccggggctcccctctgag
            Squirrel monkey  cttctacctgtgccagcgagggcccccctccgag
                   Bushbaby  cttctacctgtgccagacgtggcccccctctgag
         Chinese tree shrew  cttctacctgtgccagtcagggcccccctccaag
                   Squirrel  cttctacttgtgcaggtcggggcccccttccaag
     Lesser Egyptian jerboa  cttctacttgtgccagcagaggactcccttca--
               Prairie vole  cttctacctgtgccagaagaggccctctttcaag
            Chinese hamster  cttctacctgtgtcagaatgggccccctttcaag
                      Mouse  cttctacctgtgccagaagaggccccctttcaag
                        Rat  cttctatctgtgccaaaagaggccctctttcaag
             Naked mole-rat  cttctacctttgccagcgcgggcccccctccaag
                 Guinea pig  cttctacctttgccagccagggcccccctccaag
                 Chinchilla  cttctacctttgccaggcagggcccccctccggg
           Brush-tailed rat  cttctacatttgccagtcaggacccccctccaag
                     Rabbit  cttctacctgtgccagccagcgcccccctcccag
                       Pika  cttctacttctgccag---atgccatctgccc--
                        Pig  cttctacctgtgccagcaaggcccccctcttgac
                     Alpaca  cttctacctgtgccaaccaggccccccttctgag
             Bactrian camel  cttctacctgtgccaacccggccccccttctgag
                    Dolphin  cttctacctgtgccagcgaggccccttttccgat
               Killer whale  cttctacctgtgccagcgaggccccttttctgag
           Tibetan antelope  cttctacctgtgccagccaggcccgccttctgag
                        Cow  cttctacctgtgccagccaggcctgtcttctgag
                      Sheep  cttctacctgtgccagccagacccgccttctgag
              Domestic goat  cttctacctgtgccagccaggccagccttctgag
                      Horse  cttctacctgtgccagccggggcccccttctgag
           White rhinoceros  cttctacctgtgccagccagggcccccttctgcg
                        Cat  cttctacgtatgccagctggggcccccttctgag
                        Dog  cttctacttgtgccagccggggcccccttccgag
                    Ferret   cttctacctgtgccagctggggcccccttccgag
                      Panda  cttctacctgtgccagctggggcccccttccgac
             Pacific walrus  cttctacctgtgccagctagggtctccttccgag
               Weddell seal  cttctacctgtgccagctggggcccccttccgag
           Black flying-fox  cttctacctgtgtcaacagggatccccttccgag
                    Megabat  cttctacctgtgtcaacagggatccccttccgag
              Big brown bat  cttctacctgtgccaacaggggcccccttccgag
       David's myotis (bat)  cttctacctgtgccaacaggggcccccttccgag
                   Hedgehog  cttctacctgtgccacctagggccccagtcctca
                      Shrew  cttccacctgtgctccagggcccccccttcccag
            Star-nosed mole  cttctacctgtgcgagctggggcatccttccaag
                   Elephant  gttctacctatgccagccacggcccccctctgag
        Cape elephant shrew  cttctacctgtgccaggcccagcccccctctgtg
                    Manatee  cttctacctatgccagccagggcccccctccgag
           Cape golden mole  cttctacctctgccagccagggcctccttctgag
                     Tenrec  cttctacctgtgccagccaggccccacttccgag
                   Aardvark  cttctacctgtgccagccaggacccccctctgag
                  Armadillo  cttctacctgtgccggccctggcccccctcccag
                    Opossum  cttctacctctgcgaaagggaaccacccacaagg
            Tasmanian devil  cttctacctctgtgaattgggaccactcacaaag
                    Wallaby  cttctacctctgtgaatggggaccactcacaaag
                   Platypus  tttctacttatgtgagaagaacctagagccagag
         American alligator  catctaccgctgccagcagggctcgaacccaggc
                   Microbat  ==================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ==================================
             Painted turtle  ==================================
                     Lizard  ==================================
                   Marmoset  ==================================

Inserts between block 13 and 14 in window
B D               Platypus 7bp

Alignment block 14 of 389 in window, 28932570 - 28932620, 51 bps 
B D                   Human  aaggcctgg------cagcctg------g---------ctgg-----acagtcaatgtggagggcagcgg
B D                   Chimp  aaggcctgg------cagcctg------g---------ctgg-----acagtcaatgtggagggcagcgg
B D                 Gorilla  aaggcctgg------cagcctg------g---------ctgg-----acagtcaatgtggagggcagcgg
B D               Orangutan  aaggcctgg------cagcctg------g---------ctgg-----acagtcagtgtggagggcagcgg
B D                  Gibbon  aaggcctgg------cagcctg------g---------ctgg-----acagtcaatgtggagggcagcgg
B D                  Rhesus  aaggcctgg------cagcctg------g---------ctgg-----acagtcagtgtggagggcagcgg
B D     Crab-eating macaque  aaggcctgg------cagcctg------g---------ctgg-----acagtcagtgtggagggcagcgg
B D                  Baboon  aaggcctgg------cagcctg------g---------ctgg-----acagtcagtgtggagggcagcgg
B D            Green monkey  aaggcctgg------cagcctg------g---------ctgg-----acagtcagtgtggagggcagcgg
B D         Squirrel monkey  aaggcctgg------cagcctg------g---------ctgg-----acagtcagtgtggagggcagtgg
B D                Bushbaby  aaggctggg------catcctg------g---------ctgg-----acagtcagtgtggaggacagtgg
         Chinese tree shrew  atggcctgg------cagcctg------g---------ctgg-----acggtcagcgtgaagggcagcgg
B D                Squirrel  gacacctgg------cggcctg------g---------ctgg-----acagtgagcgtggagggcagtgg
     Lesser Egyptian jerboa  -gtacctgg------cagtctg------g---------ttgg-----gcagtgaatgtggacaacagtgg
               Prairie vole  gatacctgg------cagcctg------c---------ctgg-----acggtgaacgtggaggatagtgg
B D         Chinese hamster  gatacctgg------cagcctg------c---------gtgg-----acagtgaatgtggaggatagtgg
B D                   Mouse  gacatctgg------cagcctg------c---------ctgg-----acagtgaacgtggaggatagtgg
B D                     Rat  gacacctgg------cagcctg------c---------ctgg-----accgtaaacgtggaggatagtgg
B D          Naked mole-rat  aatgcctgg------cagcccg------g---------ctgg-----acagtgagcgtggagggcagcgg
B D              Guinea pig  aacgcctgg------cagcccg------g---------ctgg-----acagtgagcgtggagggaagcgg
                 Chinchilla  gatgcctgg------cagcccg------g---------ctgg-----actgtgagcgtggagggcagcgg
           Brush-tailed rat  aatgcctca------cagccca------g---------ctgg-----actgtgagcgtggagggcagtgg
B D                  Rabbit  caggcctgg------cagcctg------g---------ttgg-----acggtcagcgtggagggcagcgg
B D                    Pika  ----cctgg------caacctg------g---------ctgg-----acagtcaccgtgaacggcagtgg
B D                     Pig  cagtcctgg------cagcctg------g---------ctgg-----acggtcaacgtgaagggcagcgg
B D                  Alpaca  caggcctgg------cagcctg------g---------ctgg-----acggtcagcgtgaagggcagcgg
             Bactrian camel  caggcctgg------cagcctg------g---------ctgg-----acggtcagcgtgaagggcagcgg
B D                 Dolphin  caagcctgg------cagtctg------g---------ctgg-----acggtcagcgtgaagggcagcgg
               Killer whale  caagcctgg------cagcctg------g---------ctgg-----acggtcagcgtgaagggcagcgg
           Tibetan antelope  cagggctgg------cagcccg------g---------ctgg-----acggtcagcgtgcagggcagcgg
B D                     Cow  cagggctgg------cagcccg------g---------ctgg-----acagtcagcgtgcagggcagcgg
B D                   Sheep  cagggctgg------cagcccg------g---------ctgg-----acggtcagcgtgcagggcagcgg
              Domestic goat  cagggctgg------cagcccg------g---------ctgg-----acggtcagcgtgcagggcagcgg
B D                   Horse  cagggctgg------cagcctg------g---------ctgg-----acagtcagcgtggaaggcagtgg
B D        White rhinoceros  caggcctgg------cagcctg------g---------ctgg-----acagtcagcgtggagggcagtgg
B D                     Cat  caggcctgg------cagtctg------g---------ctgg-----acagtcaccgtggagggcagcgg
B D                     Dog  caggcctgg------cagtccg------g---------ctgg-----acagtcagcgtggaaggcagtgg
B D                 Ferret   caggcctgg------cagtctg------g---------ctgg-----acagtcagcgtggcaggcagtgg
B D                   Panda  caggcctgg------cagtctg------g---------ctgg-----acagtcagcgtggaaggcagtgg
             Pacific walrus  caggcgtgg------cagtctg------g---------ctgg-----acagtcagcgtggaaggcagtgg
               Weddell seal  caggcgtgg------cagtctg------g---------ctgg-----acagtcagcgtggaaggcagtgg
           Black flying-fox  caggcctgg------caggctg------g---------ctgg-----acagtcagtgtgaacggcagcgg
B D                 Megabat  caggcctgg------caggctg------g---------ctgg-----acagtcagtgtgaacggcagcgg
              Big brown bat  caggcctgg------cagcctg------g---------ctgg-----gcagtcagcgtgaacggcagcgg
B D                Hedgehog  cagcttcaaag---tcagtctg------g---------ctgg-----accgtcagcgtgaatggcagtgg
B D                   Shrew  caggcctgg------cagtctg------g---------ctgg-----accgtcagcgtggagggcagcgg
            Star-nosed mole  cagccggcg------cagtctg------g---------ctgg-----gcagtcagcgtggagggcagcgg
B D                Elephant  caggcctgg------cagcctg------g---------ttgg-----acagtcagtgtgaatggcagcgg
        Cape elephant shrew  caggcctgg------cagcccg------g---------ctgg-----acggtcagcgtggaaggcagtgg
B D                 Manatee  caggactgg------cagcctg------g---------ctgg-----acagtcagcgtggagggcagcgg
           Cape golden mole  caggcttgg------cagcctg------g---------ctgg-----acagtcagcgtggagggcagtgg
B D                  Tenrec  caggcctgg------cagcctg------g---------ctgg-----acggtcagcgtggagggcagtgg
                   Aardvark  caggcctgg------cagcctg------g---------ctgg-----acagtcagcgtggagggcagtgg
B D               Armadillo  caggactgg------cagcctg------g---------ctgg-----acggtcagcgtggagggcagcgg
B D                 Opossum  ccagaggcg------aagttgg------g---------ggct-----gccgtcagtgtccagggcagtgg
B D         Tasmanian devil  caagagttg------aagcccg------g---------ggca-----gctatcagtgtcaagggcagtgg
B D                 Wallaby  caagagtcg------aagccgg------g---------ggct-----gctatcagcgtcaatggcagtgg
B D                Platypus  cggagccgg------ggaacagaacgacg---------ctgggggccgcagtcagcgtggagggcagcgg
B D      American alligator  ---------aggaaccagccgg------gcgcaggcctcctg-----ctgctcaacgtcgcagagagcag
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================
B D                Marmoset  ======================================================================

                      Human  tgagggc
                      Chimp  tgagggc
                    Gorilla  tgagggc
                  Orangutan  tgagggc
                     Gibbon  tgagggc
                     Rhesus  tgagggc
        Crab-eating macaque  tgagggc
                     Baboon  tgagggc
               Green monkey  tgagggc
            Squirrel monkey  tgagggc
                   Bushbaby  tgagggc
         Chinese tree shrew  tgagggc
                   Squirrel  tgagggc
     Lesser Egyptian jerboa  tgagggc
               Prairie vole  tgagtgg
            Chinese hamster  taagt-g
                      Mouse  tgagtgc
                        Rat  tgagtgc
             Naked mole-rat  tgagggc
                 Guinea pig  tgagggc
                 Chinchilla  tgagggc
           Brush-tailed rat  tgagggc
                     Rabbit  tgagggc
                       Pika  tgagcac
                        Pig  tgaggtc
                     Alpaca  tgaggtc
             Bactrian camel  tgaggtc
                    Dolphin  tgaggtc
               Killer whale  tgaggtc
           Tibetan antelope  tgaggtc
                        Cow  tgaggtc
                      Sheep  tgaggtc
              Domestic goat  tgaggtc
                      Horse  tgaggtc
           White rhinoceros  tgaggtc
                        Cat  tgaggtc
                        Dog  tgaggtc
                    Ferret   tgaggtc
                      Panda  tgaggtc
             Pacific walrus  tgaggtc
               Weddell seal  tgaggtc
           Black flying-fox  tgaggtc
                    Megabat  tgaggtc
              Big brown bat  tgaggtc
                   Hedgehog  tgaggcc
                      Shrew  tga----
            Star-nosed mole  tgag---
                   Elephant  taagggc
        Cape elephant shrew  tgaggga
                    Manatee  taagggc
           Cape golden mole  tgaggtc
                     Tenrec  tgagggc
                   Aardvark  taagggc
                  Armadillo  tgagggc
                    Opossum  tgagggt
            Tasmanian devil  tgagggg
                    Wallaby  tgagggg
                   Platypus  tgagccg
         American alligator  tgagc--
                   Microbat  =======
             Golden hamster  NNNNNNN
       David's myotis (bat)  NNNNNNN
                Zebra finch  =======
             Painted turtle  =======
                     Lizard  =======
                   Marmoset  =======

Inserts between block 14 and 15 in window
          Black flying-fox 5bp
B D                Megabat 5bp
B D               Hedgehog 8bp
           Star-nosed mole 3bp
B D                Opossum 1bp
B D        Tasmanian devil 1bp
B D                Wallaby 1bp
B D               Platypus 6bp

Alignment block 15 of 389 in window, 28932621 - 28932655, 35 bps 
B D                   Human  cgggctg-------------------------gggca---------g-----------gg---------g
B D                   Chimp  cgggctg-------------------------gggca---------g-----------gg---------g
B D                 Gorilla  cgggctg-------------------------gggca---------g-----------gg---------g
B D               Orangutan  cgggctg-------------------------gggca---------g-----------gg---------g
B D                  Gibbon  cgggctg-------------------------gggca---------g-----------gg---------g
B D                  Rhesus  cgggctg-gccggg-ct--------------agggca---------g-----------gg---------g
B D     Crab-eating macaque  cgggctg-gccggg-ct--------------agggca---------g-----------gg---------g
B D                  Baboon  cgggctg-gccggg-ct--------------agggca---------g-----------gg---------g
B D            Green monkey  cgggctg-gccggg-ct--------------agggca---------g-----------gg---------g
B D         Squirrel monkey  cgggctg-gccggg-ct--------------gggaca---------g-----------gg---------g
B D                Bushbaby  tgggctg-----gg-cg--------------agggcg---------a-----------gg---------g
         Chinese tree shrew  tgggccaggccggg-ct--------------gggagg---------g-----------gg---------g
B D                Squirrel  caggctg-----gg-ct---------------gggca-------gtg-----------gg---------g
     Lesser Egyptian jerboa  ccagcag-----gg-ct---------------ggggc-------aga-----------gg---------g
               Prairie vole  ctggctg-----gg-ct---------------gggta-------gtg-----------gg---------c
B D         Chinese hamster  ctgggac-----gg-ct---------------gggta-------gtg-----------gg---------g
B D                   Mouse  ctggtgg-----gg-ct---------------gggtt-------gtg-----------ga---------g
B D                     Rat  ctgggag-----gg-ct---------------gggct-------gtg-----------gg---------g
B D          Naked mole-rat  cgggccg-----ggcca---------------gggca---------c------------g---------g
B D              Guinea pig  tgggtca-----gg-tg---------------gggca---------t-----------gg---------g
                 Chinchilla  cgggcca-----gg-tg---------------gggcg---------c-----------gg---------g
           Brush-tailed rat  tggaccc-----ag-cg---------------gggcatggtctggtt-----------gg---------g
B D                  Rabbit  tgggccg-----gc-ct---------------ggggtcagggagggg-----------gg----aagttg
B D                    Pika  tgggctg-----gg-ct---------------ggatactggagggag-----------gg---------g
B D                     Pig  cgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                  Alpaca  cgggctg-----gg-gc---------------aggga---------------------gg---------g
             Bactrian camel  cgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                 Dolphin  cgggctg-----gg-gc---------------aggga---------------------gg---------g
               Killer whale  cgggctg-----gg-gc---------------aggga---------------------gg---------g
           Tibetan antelope  cgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                     Cow  cgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                   Sheep  cgggctg-----gg-gc---------------aggga---------------------gg---------g
              Domestic goat  cgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                   Horse  caggctg-----gg-gt---------------aggga---------------------gg---------g
B D        White rhinoceros  cgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                     Cat  tgggcta-----gg-gc---------------aggga---------------------gg---------g
B D                     Dog  tgggctg-----gg-gc---------------aggga---------------------gg---------g
B D                 Ferret   cgggctg-----gg-gc---------------agggt---------------------gg---------g
B D                   Panda  tgggctg-----gg-gc---------------aggga---------------------gg---------g
             Pacific walrus  tgggccg-----gg-gc---------------aggga---------------------gg---------g
               Weddell seal  tgggccg-----gg-gc---------------aggga---------------------gg---------g
           Black flying-fox  ctgggca-----gg-gc---------------aggga---------------------gg---------g
B D                 Megabat  cagggca-----gg-gc---------------aggga---------------------gg---------g
              Big brown bat  tggggtg-----gg-gc---------------aggga---------------------gg---------g
       David's myotis (bat)  ---cggg-----gg-gg---------------agggg---------------------gg---------g
B D                Hedgehog  gggatgg-----ga-gt------------gcagggga---------------------gg---------g
B D                   Shrew  ------------gg-gc---------------ctgga---------------------tg---------g
            Star-nosed mole  cacactg-----gg-gc---------------aggga---------------------gg---------g
B D                Elephant  caagctg-----at-cc-----------gggcggggg---------------------ggtgggggggaa
        Cape elephant shrew  cagggtg-----ga-ccgcatggggactgggagggtg---------------------ggtggggtggtg
B D                 Manatee  caggctg-----gg-ct-----------gggtgaggg---------------------gg---------g
           Cape golden mole  caggc----------cc--------------agcagg---------------------gg---------a
B D                  Tenrec  caggc----------------------------tggg---------------------gg---------g
                   Aardvark  caggctg-----gg-ct-----------gggcagggg---------------------ag----------
B D               Armadillo  tgagcct-----gg-ct----------ggggaggggt---------------------ag---------g
B D                 Opossum  -------------------------------------------cagg-----------gg---------g
B D         Tasmanian devil  -------------------------------------------caggctgggggtcaagg---------g
B D                 Wallaby  -------------------------------------------cagactgg-------gg---------a
B D                Platypus  ----cgg-----gg-tc---------------cagga---------------------tg---------g
B D      American alligator  ----------------------------cgtgggggc---------------------ga---------g
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================
B D                Marmoset  ======================================================================

                      Human  ca--gg---aggaga-------------gaagggagg
                      Chimp  ca--gg---aggaga-------------gaagggagg
                    Gorilla  ca--gg---aggaga-------------gaagggagg
                  Orangutan  ca--gg---aggaga-------------gaagggagg
                     Gibbon  ca--gg---aggaga-------------gaagggagg
                     Rhesus  ca--gg---aggaga-------------gaagggagg
        Crab-eating macaque  ca--gg---aggaga-------------gaagggagg
                     Baboon  ca--gg---aggaga-------------gaagggagg
               Green monkey  ca--gg---aggaga-------------gaagggagg
            Squirrel monkey  ca--gg---aggaga-------------ggagggggg
                   Bushbaby  cactgg---agtggg-------------ggtggatgg
         Chinese tree shrew  tgctgg---atgaga-------------agaggaggg
                   Squirrel  ct--gg---gcagcggggctggccgaggagagggagg
     Lesser Egyptian jerboa  ct--gg---gtggga-----------agagggaggcc
               Prairie vole  gt--tg---cttag---------------agaggggc
            Chinese hamster  gt--tg---gtggga-------------aagagggtc
                      Mouse  ------------gta-------------aagaggagc
                        Rat  gt--gg---gctgta-------------aagagggtt
             Naked mole-rat  ct--gg---gtgaga------------agggggaggc
                 Guinea pig  ct--gg---atgaga------------agagggaggc
                 Chinchilla  ct--gg---gtgaga------------agagggaggc
           Brush-tailed rat  ct--gg---atgaga------------agaagaaggc
                     Rabbit  ct--gg---atggga------------agtggagagc
                       Pika  ct--ga---agg-------------------------
                        Pig  ct--ga---atgaga-------------agggggcac
                     Alpaca  ct--gg---atgaga-------------ggagggagg
             Bactrian camel  ct--gg---atgaga-------------ggagggagg
                    Dolphin  ct--gg---atgaga-------------agagggagg
               Killer whale  ct--gg---atgaga-------------agagggagg
           Tibetan antelope  ct--ga---gtgaga-------------agagggagg
                        Cow  ct--ga---gtgaga-------------agagggagg
                      Sheep  ct--ga---gtgaga-------------agagggagg
              Domestic goat  ct--ga---gtgaga-------------agagggagg
                      Horse  ct--gg---atgaga-------------agagggagg
           White rhinoceros  tt--ag---atgaga-------------agagggagg
                        Cat  gt--gg---atgaga-------------agagggagg
                        Dog  gc--gg---acgaga-------------agagggagg
                    Ferret   gt---g---atgaga-------------agagggagg
                      Panda  gt--gg---acgaga-------------agagggagg
             Pacific walrus  gt--gg---acgaga-------------agag-----
               Weddell seal  gt--gg---acgaga-------------agag-----
           Black flying-fox  ct--gg---atgagg-------------agagggagg
                    Megabat  ct--gg---atgagg-------------agagggagg
              Big brown bat  ct--gg---atgaga-------------agagggcag
       David's myotis (bat)  ct--gg---atgaga-------------ggagggcag
                   Hedgehog  g---gt---ttgaga-------------agtgggg--
                      Shrew  g---gc---ctgg------------------------
            Star-nosed mole  c---gg---ctggga-------------agaggga--
                   Elephant  ct--gg---gagaga-------------caagggagg
        Cape elephant shrew  ct--gg---gccagg-------------aaaggaagg
                    Manatee  ct--gg---gagaga-------------aaagggagg
           Cape golden mole  ct--gg---gagagg-------------aaagggagg
                     Tenrec  ct--gg---gagaga-------------gaagggagg
                   Aardvark  cc--gg---gagaga-------------aaggggagg
                  Armadillo  ct--gg---gagaga-------------agtaggagg
                    Opossum  tc--gt---ggcagt-------------gaggggaac
            Tasmanian devil  tg--ggcatgggggt-------------gaagggaac
                    Wallaby  tg--gg---gggagt-------------gagggggaa
                   Platypus  ct--at---gggggt-------------cggggacgg
         American alligator  ga--gg---gggaga-------------tgggg----
                   Microbat  =====================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  =====================================
             Painted turtle  =====================================
                     Lizard  =====================================
                   Marmoset  =====================================

Inserts between block 15 and 16 in window
B D               Bushbaby 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Hedgehog 206bp
           Star-nosed mole 3bp
B D               Elephant 1bp
       Cape elephant shrew 1bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp
B D              Armadillo 1bp
B D               Platypus 4bp

Alignment block 16 of 389 in window, 28932656 - 28932656, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D         Squirrel monkey  c
B D                Bushbaby  c
         Chinese tree shrew  c
B D                Squirrel  c
     Lesser Egyptian jerboa  t
               Prairie vole  t
B D         Chinese hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  c
B D              Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  c
B D                  Rabbit  c
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
B D                   Panda  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  c
       David's myotis (bat)  c
B D                Hedgehog  g
            Star-nosed mole  a
B D                Elephant  c
        Cape elephant shrew  t
B D                 Manatee  c
           Cape golden mole  t
B D                  Tenrec  t
                   Aardvark  c
B D               Armadillo  c
B D                 Opossum  c
B D         Tasmanian devil  c
B D                 Wallaby  c
B D                   Shrew  -
B D                Microbat  =
            Golden hamster  N
            Pacific walrus  -
B D                    Pika  -
              Weddell seal  -
B D             Zebra finch  =
  D          Painted turtle  =
B D      American alligator  -
B D                  Lizard  =
B D                Platypus  =
B D                Marmoset  =

Inserts between block 16 and 17 in window
B D                Opossum 26bp
B D                Wallaby 443bp

Alignment block 17 of 389 in window, 28932657 - 28932703, 47 bps 
B D                   Human  c-accat------ggacagaaga-g---------------------------------------------
B D                   Chimp  c-accat------ggacagaaga-g---------------------------------------------
B D                 Gorilla  c-accat------ggacagaaga-g---------------------------------------------
B D               Orangutan  c-accgt------ggacagaaga-g---------------------------------------------
B D                  Gibbon  c-accat------ggacagaaga-g---------------------------------------------
B D                  Rhesus  c-accat------ggacagaaga-g---------------------------------------------
B D     Crab-eating macaque  c-accat------ggacagaaga-g---------------------------------------------
B D                  Baboon  c-accat------ggacagaaga-g---------------------------------------------
B D            Green monkey  c-accat------ggacagaaga-g---------------------------------------------
B D         Squirrel monkey  c-accgg------ggatggaaga-g---------------------------------------------
B D                Bushbaby  c-acctg------ggatagagga-g---------------------------------------------
         Chinese tree shrew  cttccac------ggacagagga-g---------------------------------------------
B D                Squirrel  c-tccag------ggatagtgg------------------------------------------------
     Lesser Egyptian jerboa  c-acgat------ggacagagga-a---------------------------------------------
               Prairie vole  c-tccgc------ggacagtgga-a---------------------------------------------
B D         Chinese hamster  c-tccac------ggacagaag------------------------------------------------
B D                   Mouse  c-tccat------ggacagagga-a---------------------------------------------
B D                     Rat  c-tccat------ggacacagga-a---------------------------------------------
B D          Naked mole-rat  c-accac------ggactggggt-g---------------------------------------------
B D              Guinea pig  t-gccac------ggactggggt-a---------------------------------------------
                 Chinchilla  c-accat------ggactggggt-a---------------------------------------------
           Brush-tailed rat  t-gccat------ggac-agggt-g---------------------------------------------
B D                  Rabbit  c-agtgt------agccagcgg------------------------------------------------
B D                    Pika  --------------gccag---------------------------------------------------
B D                     Pig  c-atgtt------ggatggaggg-g---------------------------------------------
B D                  Alpaca  c-actat------gggtggaggg-g---------------------------------------------
             Bactrian camel  c-accat------gggtggaggg-g---------------------------------------------
B D                 Dolphin  c-accgt------agatggagga-g---------------------------------------------
               Killer whale  c-accgt------agatggagga-g---------------------------------------------
           Tibetan antelope  c-accag------agatggagga-g---------------------------------------------
B D                     Cow  c-accag------agatggagga-g---------------------------------------------
B D                   Sheep  c-accag------agatggagga-g---------------------------------------------
              Domestic goat  c-accag------agatggagga-g---------------------------------------------
B D                   Horse  t-cccat------ggatggagga-g---------------------------------------------
B D        White rhinoceros  c-accat------ggatggagga-g---------------------------------------------
B D                     Cat  c---cac------ggatggaggatg---------------------------------------------
B D                     Dog  c-agctc------ggatggagg--c---------------------------------------------
B D                 Ferret   c-gccgt------agatggggg------------------------------------------------
B D                   Panda  c-accac------ggatggagga-c---------------------------------------------
             Pacific walrus  -----------------ggagga-c---------------------------------------------
               Weddell seal  -----------------ggtgga-c---------------------------------------------
           Black flying-fox  c-accac------ggatgaaaga-g---------------------------------------------
B D                 Megabat  c-accac------ggatgaaaga-g---------------------------------------------
              Big brown bat  c-ggcgt------ggaaggagga-----------------------------------------------
       David's myotis (bat)  c-ggcat------ggacggaaga-----------------------------------------------
B D                Hedgehog  t-gctct------ggttaaaaaa-aataataaattaaagacataaatttaaaaatatatatatatgtatt
B D                   Shrew  t-gctgg------gggtggagt------------------------------------------------
            Star-nosed mole  c-actgt------gggtggagga-c---------------------------------------------
B D                Elephant  t-gctat------ggatgccgga-g---------------------------------------------
        Cape elephant shrew  g-actgtggatgcggatgcggga-a---------------------------------------------
B D                 Manatee  t-gctgt------gagtgcagga-a---------------------------------------------
           Cape golden mole  t-gctgt------ggattcggga-g---------------------------------------------
B D                  Tenrec  g-ctctt------gaattcaggg-g---------------------------------------------
                   Aardvark  t-gctgt------ggatgcagga-a---------------------------------------------
B D               Armadillo  c-accct------gaatggagga-g---------------------------------------------
B D                 Opossum  ----------------------------------------------------------------------
B D         Tasmanian devil  ----------------------------------------------------------------------
B D                Platypus  ------------aaaccgggagc-g---------------------------------------------
B D      American alligator  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================
B D                 Wallaby  ======================================================================
B D                Marmoset  ======================================================================

                      Human  --------------------------------g----tcc---gcggc----------------cacaa-
                      Chimp  --------------------------------g----tcc---gcggc----------------cacaa-
                    Gorilla  --------------------------------g----tcc---gcggc----------------cacaa-
                  Orangutan  --------------------------------g----tcc---gcggc----------------cacaa-
                     Gibbon  --------------------------------g----tcc---gcggc----------------cgcag-
                     Rhesus  --------------------------------g----tcc---gcggc----------------cacaa-
        Crab-eating macaque  --------------------------------g----tcc---gcggc----------------cacaa-
                     Baboon  --------------------------------g----tcc---gcggc----------------cacaa-
               Green monkey  --------------------------------g----tct---gcggc----------------cacaa-
            Squirrel monkey  --------------------------------g----tgt--ggcggc----------------cccag-
                   Bushbaby  --------------------------------g----ccg--agtagc----------------tatga-
         Chinese tree shrew  --------------------------------g----tgc--agtggc----------------ca-ag-
                   Squirrel  ------------------------------------gccc---atggc----------------caaag-
     Lesser Egyptian jerboa  --------------------------------g---tcct---gtggt----------------caaga-
               Prairie vole  --------------------------------g---gtct---ttggc----------------caagg-
            Chinese hamster  -----------------------------------------------------------------aagg-
                      Mouse  --------------------------------g---ttct---ttggt-----------------ctgg-
                        Rat  --------------------------------g---ttct---taggt-----------------ctag-
             Naked mole-rat  --------------------------------g-gtttgt---ccagc----------------------
                 Guinea pig  --------------------------------gtgggtgt---ccagc----------------------
                 Chinchilla  --------------------------------g-gggtgt---ccagc----------------------
           Brush-tailed rat  --------------------------------g-gggtgt---ccggc----------------------
                     Rabbit  -----------------------------------------------c----------------cagag-
                       Pika  ----------------------------------------------------------------caagg-
                        Pig  --------------------------------g----tct--agcagc----------------taaag-
                     Alpaca  --------------------------------c----tct--ggcagc----------------taaaa-
             Bactrian camel  --------------------------------c----tct--ggcagc----------------taaaa-
                    Dolphin  --------------------------------g----tcc--agcagc----------------tgaaa-
               Killer whale  --------------------------------g----tcc--agcagc----------------tgaaa-
           Tibetan antelope  --------------------------------g----tcc--agcagc----------------tgaaa-
                        Cow  --------------------------------g----tcc--agcagc----------------tgaaa-
                      Sheep  --------------------------------g----tcc--agcagc----------------tgaaa-
              Domestic goat  --------------------------------g----tcc--agcagc----------------tgaaa-
                      Horse  --------------------------------t----tcc--agcagc----------------taaaa-
           White rhinoceros  --------------------------------t----tcc--agcagc----------------taaaa-
                        Cat  --------------------------------g----tcc--ggcagt----------------gaaga-
                        Dog  --------------------------------c----ttc--agcagc----------------taaaa-
                    Ferret   --------------------------------------cg--ggctgt----------------cgaaac
                      Panda  --------------------------------g----tcc--ggcagc----------------taaaa-
             Pacific walrus  --------------------------------a----tct--ggccgc----------------taaaa-
               Weddell seal  --------------------------------a----tcc--ggccgc----------------taaaa-
           Black flying-fox  --------------------------------g----tct--ggccaa----------------taaaa-
                    Megabat  --------------------------------g----tct--ggccaa----------------taaaa-
              Big brown bat  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
                   Hedgehog  tattcatctcttaatgagtgaatttacagaggg----acc--agcgccctgctcagttctggtttatgg-
                      Shrew  --------------------------------------cc--agcagc----------------tacta-
            Star-nosed mole  --------------------------------g----acc--actggg----------------taaaa-
                   Elephant  --------------------------------g----tcc--atgagc----------------caaaa-
        Cape elephant shrew  --------------------------------g----tcc--aggggc----------------cacag-
                    Manatee  --------------------------------g----tcc--acaggc----------------caaaa-
           Cape golden mole  --------------------------------a----tct--aggggc----------------caaaa-
                     Tenrec  --------------------------------c----tcc--ggtgac----------------caaaa-
                   Aardvark  --------------------------------g----tcc--aagagc----------------caaaa-
                  Armadillo  --------------------------------g----tct--a-gggc----------------caaaa-
                    Opossum  ---------------------------------------------------------------------g
            Tasmanian devil  ----------------------------------------------------------------------
                   Platypus  --------------------------------g----ttctcagcacc----------------caga--
         American alligator  ----------------------------------------------------------------------
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================
                    Wallaby  ======================================================================
                   Marmoset  ======================================================================

                      Human  -----tggagctg---------------------------ga-g--agagg----
                      Chimp  -----tggagctg---------------------------ga-g--ag--g----
                    Gorilla  -----tggagctg---------------------------ga-g--agagg----
                  Orangutan  -----tagagctg---------------------------ga-g--ag--g----
                     Gibbon  -----tggagctg---------------------------ga-g--agagg----
                     Rhesus  -----tggagctg---------------------------ga-g--agagg----
        Crab-eating macaque  -----tggagctg---------------------------ga-g--agagg----
                     Baboon  -----tggagctg---------------------------ga-g--agagg----
               Green monkey  -----tggagctg---------------------------ga-g--agagg----
            Squirrel monkey  -----aggagctg---------------------------ga-g--agagg----
                   Bushbaby  -----agctgctg---------------------------ga-t------g----
         Chinese tree shrew  -----tggggctg---------------------------ca-c--gga-g----
                   Squirrel  -----tggagttg---------------------------ga-g--gag------
     Lesser Egyptian jerboa  -----tgggcctt---------------------------aa-g--ggg------
               Prairie vole  -----tggggcaa---------------------------ca-g--cca------
            Chinese hamster  -----tggggcta---------------------------ca-a--tga------
                      Mouse  -----cagggctg---------------------------ca-g--cgg------
                        Rat  -----tgacgcta---------------------------ca-g--cgg------
             Naked mole-rat  --------agcca---------------------------ga-g--aag------
                 Guinea pig  --------agcta---------------------------ga-g--agg------
                 Chinchilla  --------agcca---------------------------ga-g--agg------
           Brush-tailed rat  --------agcca---------------------------ga-g--agg------
                     Rabbit  -----cggagctg---------------------------ga-gggagg------
                       Pika  -----aggagctg---------------------------gt-attagg------
                        Pig  -----gggatcct---------------------------ga-g--ggagg----
                     Alpaca  -----tggatctg---------------------------ga-g--ggagg----
             Bactrian camel  -----tggatctg---------------------------ga-g--ggagg----
                    Dolphin  -----tggatctg---------------------------ga-g--ggagg----
               Killer whale  -----tggatctg---------------------------ga-g--ggagg----
           Tibetan antelope  -----tgaatccg---------------------------ga-g--ggagg----
                        Cow  -----tgaatccg---------------------------ga-g--ggagg----
                      Sheep  -----tgaatccg---------------------------ga-g--ggagg----
              Domestic goat  -----tgaatccg---------------------------ga-g--ggagg----
                      Horse  -----tggatctg---------------------------ga-g--ggagg----
           White rhinoceros  -----tggatcta---------------------------ga-g--ggagg----
                        Cat  -----cagatttg---------------------------ca-g--ggagg----
                        Dog  -----cagatttg---------------------------gg-a--ggagg----
                    Ferret   -----cggctttg---------------------------ta-g--ggtg-----
                      Panda  -----cggatttg---------------------------ga-g--ggagg----
             Pacific walrus  -----cggatttg---------------------------ga-g--ggagg----
               Weddell seal  -----cagatttg---------------------------ga-g--ggagg----
           Black flying-fox  -----tggatctg---------------------------ga-g--ggagg----
                    Megabat  -----tggatctg---------------------------ga-g--ggagg----
              Big brown bat  ------gggtctg---------------------------gagg--ggtgg----
       David's myotis (bat)  ------gggtccg---------------------------ga-g--ggtgg----
                   Hedgehog  -----tggtgctg---------------------------g--g--gattg----
                      Shrew  -----agggcctg---------------------------g--g--ggagg----
            Star-nosed mole  -----gggagccg---------------------------g--a--gaggg----
                   Elephant  -----ctgagttg---------------------------ga-t--ggagg----
        Cape elephant shrew  -----ctgagccg---------------------------ga-g--ggagg----
                    Manatee  -----ctgagttg---------------------------ga-g--ggagg----
           Cape golden mole  -----ttgaactg---------------------------ga-g--ggagg----
                     Tenrec  -----gtgaggtg------------------------------------------
                   Aardvark  -----c--agctg---------------------------ga-g--ggagg----
                  Armadillo  -----ctgagctg---------------------------ga-g--ggagg----
                    Opossum  gtcaggggagccaggggcttaggccctttccccttctgctga-g--aaaca----
            Tasmanian devil  -----tgaaactctgggctcag------------------ta-g--agagg----
                   Platypus  -------------------------------------------------------
         American alligator  ----caggggctg---------------------------gg-g--agggccgcg
                   Microbat  =======================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  =======================================================
             Painted turtle  =======================================================
                     Lizard  =======================================================
                    Wallaby  =======================================================
                   Marmoset  =======================================================

Inserts between block 17 and 18 in window
B D               Squirrel 32bp
    Lesser Egyptian jerboa 4bp
              Prairie vole 4bp
B D        Chinese hamster 4bp
B D                  Mouse 1bp
B D                    Rat 1bp

Alignment block 18 of 389 in window, 28932704 - 28932713, 10 bps 
B D                   Human  ggc-tgg---------------------------a-ggg
B D                   Chimp  ggc-tgg---------------------------a-ggg
B D                 Gorilla  ggc-tgg---------------------------a-ggg
B D               Orangutan  ggc-tgg---------------------------a-ggg
B D                  Gibbon  ggc-tgg---------------------------a-ggg
B D                  Rhesus  ggc-tgg---------------------------a-ggg
B D     Crab-eating macaque  ggc-tgg---------------------------a-ggg
B D                  Baboon  ggc-tgg---------------------------a-ggg
B D            Green monkey  ggc-tgg---------------------------a-ggg
B D         Squirrel monkey  gac-tgg---------------------------a-ggg
B D                Bushbaby  ggc-tag---------------------------a-ggg
         Chinese tree shrew  ggc-tgg---------------------------a-ggg
B D          Naked mole-rat  gct---g---------------------------g-agg
B D              Guinea pig  gcc-tag---------------------------a-ggg
                 Chinchilla  ggc-tgg---------------------------c-ggg
           Brush-tailed rat  ggc-cag---------------------------a-ggg
B D                     Pig  ggc-tgg---------------------------a-ggg
B D                  Alpaca  gcc-tgg---------------------------a-ggg
             Bactrian camel  gcc-tgg---------------------------a-ggg
B D                 Dolphin  ggc-tgg---------------------------a-ggg
               Killer whale  ggc-tgg---------------------------a-ggg
           Tibetan antelope  ggc-cgg---------------------------a-ggg
B D                     Cow  ggc-cgg---------------------------a-ggg
B D                   Sheep  ggc-cag---------------------------a-ggg
              Domestic goat  ggc-cgg---------------------------a-ggg
B D                   Horse  ggc-tag---------------------------a-ggg
B D        White rhinoceros  ggc-tgg---------------------------a-ggg
B D                     Cat  ggt-cgg---------------------------a-ggg
B D                     Dog  ggc-tgg---------------------------a-ggg
B D                 Ferret   ----tgg---------------------------a-agg
B D                   Panda  ggc-tgg---------------------------c-ggg
             Pacific walrus  ggc-tca---------------------------a-ggg
               Weddell seal  ggc-tcg---------------------------g-ggg
           Black flying-fox  ggc-tgg---------------------------a-ggg
B D                 Megabat  ggc-tgg---------------------------agggg
              Big brown bat  ggc-tgg---------------------------a-agg
       David's myotis (bat)  ggc-tgg---------------------------a-agg
B D                Hedgehog  aac-ctggggcctcagcgggagctcctagctcatg-gtg
B D                   Shrew  ggc-cag-------------------------------g
            Star-nosed mole  ggc-tgg---------------------------a-atg
B D                Elephant  -gc-tgg---------------------------g-gga
        Cape elephant shrew  -gc-tgg---------------------------g-cgg
B D                 Manatee  -gc-tgg---------------------------g----
           Cape golden mole  -ggttga---------------------------g-ggg
B D                  Tenrec  ----tgt---------------------------g-ggg
                   Aardvark  -cc-tgg---------------------------g-ggt
B D               Armadillo  -ggctgg---------------------------g-ggg
B D                 Opossum  gta-tgg---------------------------t-ggc
B D         Tasmanian devil  gaa-ggg---------------------------g-gga
B D                Platypus  ggg-tgg---------------------------a-tgg
B D      American alligator  ----tgg---------------------------a-ggg
B D                Microbat  =======================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Prairie vole  =======================================
B D                Squirrel  =======================================
B D                     Rat  =======================================
B D                   Mouse  =======================================
    Lesser Egyptian jerboa  =======================================
B D         Chinese hamster  =======================================
B D                  Rabbit  ---------------------------------------
B D                    Pika  ---------------------------------------
B D             Zebra finch  =======================================
  D          Painted turtle  =======================================
B D                  Lizard  =======================================
B D                 Wallaby  =======================================
B D                Marmoset  =======================================

Inserts between block 18 and 19 in window
          Cape golden mole 7bp
B D              Armadillo 1bp
B D        Tasmanian devil 421bp

Alignment block 19 of 389 in window, 28932714 - 28932721, 8 bps 
B D                   Human  attgaggg
B D                   Chimp  attgaggg
B D                 Gorilla  attgaggg
B D               Orangutan  attgaggg
B D                  Gibbon  attgaggg
B D                  Rhesus  attgaggg
B D     Crab-eating macaque  attgaggg
B D                  Baboon  attgaggg
B D            Green monkey  agtgaggg
B D         Squirrel monkey  gctgaggg
B D                Bushbaby  gctgcagg
         Chinese tree shrew  gctggggg
B D          Naked mole-rat  -ccaaggg
B D              Guinea pig  -ccaaggg
                 Chinchilla  -acgaggg
           Brush-tailed rat  -ccaaggg
B D                     Pig  tcggaggg
B D                  Alpaca  tcggaggg
             Bactrian camel  tcggaggg
B D                 Dolphin  tccgaggg
               Killer whale  tccgaggg
           Tibetan antelope  gccaagag
B D                     Cow  gccaagag
B D                   Sheep  gccgagag
              Domestic goat  gccgagag
B D                   Horse  cctgaggg
B D        White rhinoceros  tctgaggg
B D                     Cat  tctgcggg
B D                     Dog  gctgagga
B D                 Ferret   gccgaggg
B D                   Panda  gctgaggg
             Pacific walrus  gctgaggg
               Weddell seal  gctgaggg
           Black flying-fox  gctgagga
B D                 Megabat  gctgagga
              Big brown bat  cct-aggg
       David's myotis (bat)  cctgagga
B D                Hedgehog  gtagaggg
B D                   Shrew  gctgagag
            Star-nosed mole  gctgggga
B D                Elephant  tctgacag
        Cape elephant shrew  tctgac--
B D                 Manatee  ---gacgg
           Cape golden mole  tataacag
                   Aardvark  tctgat--
B D               Armadillo  cttggggg
B D                 Opossum  atggaag-
B D                Platypus  aatgaggg
B D      American alligator  gtccatg-
B D                Microbat  ========
B D                  Tenrec  --------
            Golden hamster  NNNNNNNN
              Prairie vole  ========
B D                Squirrel  ========
B D                     Rat  ========
B D                   Mouse  ========
    Lesser Egyptian jerboa  ========
B D         Chinese hamster  ========
B D                  Rabbit  --------
B D                    Pika  --------
B D             Zebra finch  ========
B D         Tasmanian devil  ========
  D          Painted turtle  ========
B D                  Lizard  ========
B D                 Wallaby  ========
B D                Marmoset  ========

Inserts between block 19 and 20 in window
B D        Squirrel monkey 1bp
B D                  Shrew 172bp
B D               Platypus 16bp

Alignment block 20 of 389 in window, 28932722 - 28932746, 25 bps 
B D                   Human  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D                   Chimp  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D                 Gorilla  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D               Orangutan  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcgga
B D                  Gibbon  ----------caaaact----c---g-----gag-ctaggt--------g--ggcaga
B D                  Rhesus  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D     Crab-eating macaque  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D                  Baboon  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D            Green monkey  ----------cgaaact----c---g-----gag-ctaggt--------g--ggcaga
B D         Squirrel monkey  ----------cgaaact----c----------ag-ctaggt--------g--ggc-ga
B D                Bushbaby  --------------acc----cacag-----aag-ctaattata--gcag--gttaca
         Chinese tree shrew  ----------ggcggct--------g-----gtt-tcaggc--------g--ggcggg
     Lesser Egyptian jerboa  -----------aggaaa----a---a-----aaa-ttagtt------cta--ggca--
               Prairie vole  -----------ggagga----a---g-----ggg-----tt------cta--ggca--
B D         Chinese hamster  -----------gaagga----a---g-----ggg-ttattt------cta--ggca--
B D                   Mouse  ------------gaaga----a---g-----gaa-ttagtt------cta--ggca--
B D                     Rat  -------------agga----a---g-----gag-ttagtt------cta--ggca--
B D          Naked mole-rat  ----------gcaagcc----a---g-----gag-ctagtt------tgg--ggga--
B D              Guinea pig  ----------acaagaa----a---g-----gaa-ctggtc------tgg--ggga--
                 Chinchilla  ----------acaagaa----a---g-----gagccagttt------cgg--ggga--
           Brush-tailed rat  ----------acaagaa----a---g-----gag------------------------
B D                  Rabbit  -------------gctg----a---g-----gag-tcgc-------------------
B D                    Pika  ---------------------------------g-ttgc-------------------
B D                     Pig  ----------acaagct----g---g-----gag-ccaatt------tta--ggtggc
B D                  Alpaca  ----------acaaact----g---g-----gag-ccagtt------tta--ggtggc
             Bactrian camel  ----------acaaact----g---g-----gag-ccagtt------tta--cgtggc
B D                 Dolphin  ----------acaagct----g---g-----gag-ccagtt------tta--ggtggc
               Killer whale  ----------acaagct----g---g-----gag-ccagtt------tta--ggtggc
           Tibetan antelope  ----------acaagct----g---g-----gag-ctagtc------tta--ggtggc
B D                     Cow  ----------acacgct----g---g-----gag-ctagtt------tta--ggtggc
B D                   Sheep  ----------acaagct----g---g-----gag-ctagtt------tta--ggtggc
              Domestic goat  ----------acaagct----g---g-----gag-ctagtt------tta--ggtggc
B D                   Horse  ----------acaagca----g---a-----gag-ccagtt------tta--ggtggc
B D        White rhinoceros  ----------acaagca----g---a-----gag-ccagtt------tta--ggtggc
B D                     Cat  ----------acaggca----c---g-----cag-ctagtt------tta--ggtggc
B D                     Dog  ----------tcgagcatgcct---g-----ccg-ctggtt------cca--ggtggc
B D                 Ferret   ----------acaggca----c---g-----cag-ct-gtt------cga--ggtggc
B D                   Panda  ----------acaa---------------------------------------ggggc
             Pacific walrus  ----------acaagca----c---g-----cag-ctagtt------cta--ggtggc
               Weddell seal  ----------acaagca----c---g-----cag-ctagtt------cta--ggtggc
           Black flying-fox  ----------gc-agca----g---g-----gag-ccaggg-----agca--gggagc
B D                 Megabat  ----------gc-aaca----g---a-----gag-ccaggg-----agca--gggagc
              Big brown bat  ----------tcaagca----g---g-----aag-ccagtt------gta--ggt-gc
       David's myotis (bat)  ----------cccagca----g---g-----aag-ccagtt------gta--agtggc
B D                Hedgehog  ------------------ctgg---g-----ctg-agggcc------cagcagggagc
            Star-nosed mole  ---------------------------------g-caagtt------tag--gtgggt
B D                Elephant  ----------ataagcg----g---g-----gag-ccagttctaga------------
        Cape elephant shrew  ------------aagca----g---g-----ga-------------------------
B D                 Manatee  ----------acaagca----g---g-----gag-ccagttctaga------------
           Cape golden mole  ----------agaagca----g---g-----gag-cc---------------------
                   Aardvark  -------------gaca----g---g-----gag-ccagtcctaga------------
B D               Armadillo  ----------acaagca----g---gtgggaggg-ccacctgt---------------
B D                 Opossum  -----------gaacct----t---g-----gaa-atgggt------gaa--aaga--
B D                Platypus  ----------tggagcc----g---g-----gag-gaaagg-----------------
B D      American alligator  ctgagtgcaggggaagg----t---g-----ggg-tcagt------------------
B D                   Shrew  ==========================================================
B D                Microbat  ==========================================================
B D                  Tenrec  ----------------------------------------------------------
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Squirrel  ==========================================================
B D             Zebra finch  ==========================================================
B D         Tasmanian devil  ==========================================================
  D          Painted turtle  ==========================================================
B D                  Lizard  ==========================================================
B D                 Wallaby  ==========================================================
B D                Marmoset  ==========================================================

Inserts between block 20 and 21 in window
    Lesser Egyptian jerboa 5bp
              Prairie vole 5bp
B D        Chinese hamster 5bp
B D                  Mouse 5bp
B D                    Rat 5bp
B D         Naked mole-rat 5bp
B D             Guinea pig 5bp
                Chinchilla 5bp
B D                    Pig 9bp
B D                 Alpaca 9bp
            Bactrian camel 9bp
B D                Dolphin 9bp
              Killer whale 9bp
          Tibetan antelope 9bp
B D                    Cow 8bp
B D                  Sheep 9bp
             Domestic goat 9bp
B D                  Horse 9bp
B D       White rhinoceros 9bp
B D                    Cat 9bp
B D                    Dog 9bp
B D                Ferret  9bp
B D                  Panda 9bp
            Pacific walrus 9bp
              Weddell seal 9bp
          Black flying-fox 9bp
B D                Megabat 9bp
             Big brown bat 9bp
      David's myotis (bat) 9bp
B D               Hedgehog 9bp
           Star-nosed mole 9bp
B D                Opossum 9bp

Alignment block 21 of 389 in window, 28932747 - 28932755, 9 bps 
B D                   Human  ctcctgggg--
B D                   Chimp  ctcctgggg--
B D                 Gorilla  ctcctgggg--
B D               Orangutan  ctcctgggg--
B D                  Gibbon  ctcctgggg--
B D                  Rhesus  ctcctgggg--
B D     Crab-eating macaque  ctcctgggg--
B D                  Baboon  ctcctgggg--
B D            Green monkey  ctcctgggg--
B D         Squirrel monkey  caccggcgg--
B D                Bushbaby  ctcctgcag--
         Chinese tree shrew  c----------
B D                Squirrel  --cccctgg--
     Lesser Egyptian jerboa  cttctgtga--
               Prairie vole  ttcctatgg--
B D         Chinese hamster  ttcctatgg--
B D                   Mouse  ttcctatgg--
B D                     Rat  ttcctacgg--
B D          Naked mole-rat  ctcctgcaa--
B D              Guinea pig  cgcctgtga--
                 Chinchilla  ggcctgcag--
           Brush-tailed rat  ---ctgcaa--
B D                  Rabbit  ctcctgtgg--
B D                    Pika  cttccgggg--
B D                     Pig  cccccgtgg--
B D                  Alpaca  ctactgcgg--
             Bactrian camel  ctactgtgg--
B D                 Dolphin  ctgctgtgg--
               Killer whale  ctgctgtgg--
           Tibetan antelope  cccctgtgg--
B D                     Cow  cccctgcgg--
B D                   Sheep  cccctgtgg--
              Domestic goat  cccctgtgg--
B D                   Horse  ctcctgtgg--
B D        White rhinoceros  ---cggcgg--
B D                     Cat  ctcctgtgg--
B D                     Dog  ctcctgtgg--
B D                 Ferret   ctcctgtgg--
B D                   Panda  cccccatcg--
             Pacific walrus  ctccgatgg--
               Weddell seal  ctccggtgg--
           Black flying-fox  ttcctgtgg--
B D                 Megabat  ttcctgtgg--
              Big brown bat  tgcctaccg--
       David's myotis (bat)  tgcctccag--
B D                Hedgehog  ctccc-tgg--
            Star-nosed mole  ttcc-------
B D                Elephant  tgggtggga--
        Cape elephant shrew  -------ga--
B D                 Manatee  tgggtggga--
                   Aardvark  tgcggggga--
B D               Armadillo  -------gg--
B D                 Opossum  ccattctga--
B D                Platypus  gtgatgggg--
B D      American alligator  --gctgtgggg
B D                   Shrew  ===========
B D                Microbat  ===========
B D                  Tenrec  -----------
            Golden hamster  NNNNNNNNNNN
          Cape golden mole  -----------
B D             Zebra finch  ===========
B D         Tasmanian devil  ===========
  D          Painted turtle  ===========
B D                  Lizard  ===========
B D                 Wallaby  ===========
B D                Marmoset  ===========

Inserts between block 21 and 22 in window
B D               Squirrel 15bp
B D               Platypus 340bp

Alignment block 22 of 389 in window, 28932756 - 28932782, 27 bps 
B D                   Human  ctt-cgtggcttcagt----a--tgag-----ctgct----tc
B D                   Chimp  ttt-cgtggcttcagt----a--tgag-----ctgct----tc
B D                 Gorilla  ctt-cgtggcttcagt----a--tgag-----ctgct----tc
B D               Orangutan  ctt-cgtggcttcagt----a--tgag-----ctgct----tc
B D                  Gibbon  ctt-tgtggcttcagc----a--tgag-----ctgct----tc
B D                  Rhesus  ctt-cgtggcttcagc----a--tgag-----ctgct----tc
B D     Crab-eating macaque  ctt-cgtggcttcagc----a--tgag-----ctgct----tc
B D                  Baboon  ctt-cgtggcttcagc----a--tgag-----ctgct----tc
B D            Green monkey  ctt-cgtggcttcagc----a--tgag-----ctgct----tc
B D         Squirrel monkey  ctc-tgtggcctcagc----a--tgag-----ctgct----tc
B D                Bushbaby  ctt-cctgacttcaac----ac-tgag-----ctgct----cc
         Chinese tree shrew  --c-tgtggcctcaac----gc-tgag-----cagct----ct
B D                Squirrel  ttt-ggtcgct--gtt----t--c-------------------
     Lesser Egyptian jerboa  ctt-ggtgact--gct----c--tcaa-----ctgctcc----
               Prairie vole  cgt-gataact--gct----c--tgag-----ctatc------
B D         Chinese hamster  att-ggtaatt--gct----t--tgag-----ctatc------
B D                   Mouse  ttt-ggtaact--gct----c--tgag-----ctact------
B D                     Rat  ctt-cgtagct--gct----c--tgag-----ctact------
B D          Naked mole-rat  ctt-ttcgactcaaca----c--t-gg-----ctgc---cc--
B D              Guinea pig  ttt-tgtgacttaaca----c--aagg-----ccgcc--tc--
                 Chinchilla  ctt-tgcgacacaaca----c--tggg-----ctgcg--cc--
           Brush-tailed rat  ctt-tgtgacttaatg----c--tggg-----ccacc--cc--
B D                  Rabbit  ttc-tgagacc--acc----c--ctgaggg--cctc-------
B D                    Pika  tcc-tgtggct--tca----c--caaaggagccctg-------
B D                     Pig  ctt-cctgacgtcagt----gc-tggg-----ctgct------
B D                  Alpaca  ctt-catgacgtcaac----cc-tgag-----ctgct------
             Bactrian camel  ctt-catgacgtcaac----cc-tgag-----ctgct------
B D                 Dolphin  ctt-catgacgtcagc----ac-tgcg-----c-gct------
               Killer whale  ctt-cgtgacgtcagc----ac-tgcg-----c-gct------
           Tibetan antelope  ctt-tatgacgtcagc----gt-cctg-----tggct------
B D                     Cow  ctt-tatgacgtcagc----gc-cgtg-----tggct------
B D                   Sheep  ctt-tatgacgtcagc----gc-cgtg-----tggct------
              Domestic goat  ctt-tatgacgtcagc----gc-cgtg-----tggct------
B D                   Horse  ctt-tgtgacttcaac----ac-tgag-----atgct------
B D        White rhinoceros  ctt-tgtgacttcaac----ac-tgag-----atgct------
B D                     Cat  ctt-cgtgacttccac----cc-tgag-----ctgtt------
B D                     Dog  ctt-tgtgacttcaac----ac-tgag-----ctgtt------
B D                 Ferret   ctt-catgacttcagc----cc-tgag-----ctgct------
B D                   Panda  ctt-c-tgacttcaac----gc-tgag-----ctctt------
             Pacific walrus  ctt-cacgacttcagc----ac-tgag-----ttatt------
               Weddell seal  ctt-catgacttcagc----acttgag-----ctat-------
           Black flying-fox  ctt-tgtgacttcaac----ac-cgaa-----ttgct------
B D                 Megabat  ctt-tgtgacttcaac----ac-cgaa-----ttgct------
              Big brown bat  ctt-tg-gacttcaac----ac-tgaa-----ctgct------
       David's myotis (bat)  ctt-tgtgacttcaac----ac-tgaa-----ctgct------
B D                Hedgehog  gct-tgtgagctcagc----ac-tgag-----tttct------
            Star-nosed mole  ----tgtggcttcatcttctac-ccca-----tttct------
B D                Elephant  ctcgagtggcttcagc----tc-tgag-----ctgct------
        Cape elephant shrew  ctc-agaggcttccat----at-cgaa-----ctg--------
B D                 Manatee  ctcaggtgacttcaac----cc-tgaa-----ctgct------
           Cape golden mole  -------------------------ag-----ctgta------
B D                  Tenrec  -------------------------ag-----ctcca------
                   Aardvark  ctcgggtggcttccat----gc-tgag-----tggaa------
B D               Armadillo  cttcagtggtttcaac----ac-ggag-----ccgct------
B D                 Opossum  ttc-tgctacgtc------------------------------
B D      American alligator  ctc-ccc------------------------------------
B D                   Shrew  ===========================================
B D                Microbat  ===========================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ===========================================
B D         Tasmanian devil  ===========================================
  D          Painted turtle  ===========================================
B D                  Lizard  ===========================================
B D                 Wallaby  ===========================================
B D                Platypus  ===========================================
B D                Marmoset  ===========================================

Inserts between block 22 and 23 in window
B D               Squirrel 4bp
    Lesser Egyptian jerboa 515bp
B D                    Pig 5bp
B D                 Alpaca 9bp
            Bactrian camel 9bp
B D                Dolphin 13bp
              Killer whale 13bp
          Tibetan antelope 9bp
B D                    Cow 9bp
B D                  Sheep 9bp
             Domestic goat 9bp
B D                  Horse 19bp
B D       White rhinoceros 19bp
B D                    Cat 13bp
B D                    Dog 9bp
B D                Ferret  9bp
B D                  Panda 9bp
            Pacific walrus 9bp
              Weddell seal 6bp
          Black flying-fox 13bp
B D                Megabat 13bp
             Big brown bat 9bp
      David's myotis (bat) 11bp
B D               Hedgehog 15bp
           Star-nosed mole 28bp
B D               Elephant 14bp
B D                Manatee 15bp
          Cape golden mole 19bp
B D                 Tenrec 14bp
                  Aardvark 19bp
B D              Armadillo 19bp

Alignment block 23 of 389 in window, 28932783 - 28932827, 45 bps 
B D                   Human  ctgtccc--tctacctctcact-----------------gtct--------------------------t
B D                   Chimp  ctgtccc--tctacctctcact-----------------gtct--------------------------t
B D                 Gorilla  ctgtccc--tctacctctcact-----------------gtc----------------------------
B D               Orangutan  ccgtccc--tctacttctcact-----------------gtct--------------------------t
B D                  Gibbon  ctgtccc--tctacctctcact-----------------gtct--------------------------t
B D                  Rhesus  ctgtccc--tccacctctcact-----------------gccttctctc----------------tctgt
B D     Crab-eating macaque  ctgtccc--tccacctctcact-----------------gccttctctc----------------tctgt
B D                  Baboon  ctgtccc--tccacctctcact-----------------gccttctctc----------------tctgt
B D            Green monkey  ctgtccc--tccacctctcact-----------------gccttctctc----------------tctgt
B D         Squirrel monkey  ctgtccc--tccgcggctcact-----------------gtcttctctc----------------tc--t
B D                Bushbaby  atgtctc--tcggcctatctct------------------------------------------------
         Chinese tree shrew  gtatgtc--tctgtctcatgct-----------------cttctccctctgttcaagtcactgtttctgt
B D                Squirrel  ccacctg--ccccaccccg-cc-----------------cgccattctt--------------------c
     Lesser Egyptian jerboa  ccatccc--tccagccc------------------------ttattata--------------------c
               Prairie vole  ccacacc--tctgactcgc-aa-----------------ttctgtcagc--------------------c
B D         Chinese hamster  ccacatc--tctgtctcag-tc-----------------ttctgtcagg--------------------c
B D                   Mouse  ccgtatc--tctgtctcgc-tt-----------------gtctgttagt--------------------c
B D                     Rat  ctg--tc--tctgtctcac-tc-----------------atctgttagt--------------------c
B D          Naked mole-rat  --------------------gg-----------------gtctgtcctc--------------------a
B D              Guinea pig  --------------------ag-----------------gtctgccctc--------------------c
                 Chinchilla  --------------------ag-----------------gtctgtc--c--------------------c
           Brush-tailed rat  --------------------ag-----------------gtctgtcctc--------------------c
B D                  Rabbit  --------------------ct-----------------gtctctctcc--------------------c
B D                    Pika  --------------------tg-----------------ggctctctct--------------------c
B D                     Pig  tcactct--ttcctctctgcgt-----------------ggacgtt-tc--------------------t
B D                  Alpaca  ccactct--tt-ctctctgagt-----------------caccgtt-----------------------t
             Bactrian camel  tcactct--tt-ctctctgagt-----------------caccgtt-----------------------t
B D                 Dolphin  tcactct--tt--tctctgagt-----------------cgctgtt-tc--------------------t
               Killer whale  tcactct--tt--tctctgagt-----------------cgctgtt-tc--------------------t
           Tibetan antelope  tctctct--tt--tctctgagt-----------------cgctctt-tc--------------------t
B D                     Cow  tcactct--tt--tctctgagt-----------------cgctctt-tc--------------------t
B D                   Sheep  tcactct--tt--tctctgagt-----------------cgctctt-tc--------------------t
              Domestic goat  tcactct--tt--tctctgagt-----------------cgctctt-tc--------------------t
B D                   Horse  actctctggtctctgtctgagt-----------------tactgtt-tc--------------------t
B D        White rhinoceros  actctct--tctctctctgagt-----------------tcccgtt-tc--------------------t
B D                     Cat  actcttg--tctgtctctgagt-----------------t-ccgtt-tc--------------------t
B D                     Dog  actctct--cctctctctgagt-----------------tgtcgtt-ct--------------------t
B D                 Ferret   a---------------------------------------------------------------------
B D                   Panda  actctct--tttctctctgagt-----------------tgtcgtt-tc--------------------t
             Pacific walrus  actctct--tctctctctgagt-----------------tgtcatt-tc--------------------t
               Weddell seal  actctct--tctctctctgagt-----------------tgtcatt-tc--------------------t
           Black flying-fox  agccttg--tctctctctgaga-----------------c------------------------------
B D                 Megabat  agccttg--tttctctctgaga-----------------c------------------------------
              Big brown bat  tgtccca--tttctctcggaga-----------------cgctgct-tc--------------------t
       David's myotis (bat)  tgtctca--tttctctctgaga-----------------tgctgct-cc--------------------t
B D                Hedgehog  tctctct--ct-gggtctgaaa-----------------ctct----tc--------------------t
            Star-nosed mole  tctccct--cc--ttcctgact-----------------ctctccc-tc--------------------t
B D                Elephant  tctcact--cttttctctccctc-------tctctgaatctccgtt-tc--------------------t
        Cape elephant shrew  ---------------------------------------------------------------------t
B D                 Manatee  tctcact--ctcttctcttcctcttctcggtctccatttctctgtc-tc--------------------t
           Cape golden mole  ttttctc--ttttactcttagt-----------------ctctgtt-tc--------------------t
B D                  Tenrec  tctccac--tgactctctgggtttgggggggcccc----ctctgcc-tc--------------------t
                   Aardvark  tcactgt--ctcctctctgagt---------ctctgtttctctgtt-tc--------------------t
B D               Armadillo  tctctgt--tt----------------------------gtctggc-cc--------------------t
B D                 Opossum  ctcctcg--tgtgatcctaagc-------------------cagtc-ac--------------------a
B D      American alligator  ----------------------------------------------------------------------
B D                   Shrew  ======================================================================
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
B D         Tasmanian devil  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================
B D                 Wallaby  ======================================================================
B D                Platypus  ======================================================================
B D                Marmoset  ======================================================================

                      Human  c----------t-----ctc----tct--ctgc--------------------------gggt-cttt--
                      Chimp  c----------t-----ctc----tct--ctgc--------------------------gggt-cttt--
                    Gorilla  c----------t-----ctc----tct--ctgc--------------------------gggt-cttt--
                  Orangutan  c----------t-----ctc----tgt--ctgt--------------------------gggt-cttt--
                     Gibbon  c----------t-----ctc----tct--ctgc--------------------------gggtaaaaa--
                     Rhesus  c----------t-----ctc----tct--ctct--------------------------gagt-cttt--
        Crab-eating macaque  c----------t-----ctc----tct--ctct--------------------------gagt-cttt--
                     Baboon  c----------t-----ctc----tct--ctct--------------------------gagt-cttt--
               Green monkey  c----------t-----ctc----tct--ctct--------------------------gagt-cttt--
            Squirrel monkey  g----------t-----ctc----tct--ctcc--------------------------gggt-ctgt--
                   Bushbaby  ------------------------tct--ctct--------------------------gggt-ccac--
         Chinese tree shrew  c----------t-----ctc----tct--ctct--------------------------gggt-cttc--
                   Squirrel  a----------t-----ctc----tgt--ctcc--------------------------atct-ctct--
     Lesser Egyptian jerboa  t----------t-----ttt----tcc--ccct--------------------------gcat-cttt--
               Prairie vole  a----------taagtgctt----tct--ctct--------------------------gtat-ct----
            Chinese hamster  a----------tagttactt----tct--ctct--------------------------gtgt-ctcc--
                      Mouse  a----------tagttgctt----tct--ccct--------------------------gtat-ctct--
                        Rat  a----------tagtggctt----tct--ccct--------------------------gtat-ctct--
             Naked mole-rat  t----------t-----ccc----tct--gcct-------------------------------------
                 Guinea pig  t----------t-----cct----cct--tcccccttgccg------------------cttt-ctta--
                 Chinchilla  t----------g-----tcc----ctg----cc-----------------------------t-ctgg--
           Brush-tailed rat  t----------c-----ccc----ctg--cccc-----------------------------t-ctct--
                     Rabbit  a----------c-----cct----ccc--ctctctctgcgagtcactgtttctctgtgtctct-attc--
                       Pika  t----------c-----cc---------------------------------------------------
                        Pig  c----------t-----gtc----tct--ctct--------------------------cggg-gttt--
                     Alpaca  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
             Bactrian camel  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
                    Dolphin  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
               Killer whale  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
           Tibetan antelope  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
                        Cow  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
                      Sheep  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
              Domestic goat  c----------t-----gtc----tct--ctct--------------------------gggt-cttt--
                      Horse  t----------t-----gtc----tct--ctct--------------------------gggt-cttt--
           White rhinoceros  c----------t-----gtc----tct--ctct--------------------------gggt-cttc--
                        Cat  ctctc------t-----ggc----tct--ctct--------------------------gggt-cttt--
                        Dog  a----------t-----ctc----tct--ctct--------------------------gggt-cttt--
                    Ferret   -------------------------ct--ctct--------------------------gggt-cttc--
                      Panda  ctctc------t-----gtc----tct--ctct--------------------------ggat-cttt--
             Pacific walrus  ctc--------t-----ctc----tct--ctct--------------------------gggt-cttt--
               Weddell seal  ctctctctctgt-----ctc----tct--ctct--------------------------gggt-cttt--
           Black flying-fox  -------------------------------------------------------------------t--
                    Megabat  -------------------------------------------------------------------t--
              Big brown bat  c----------t-----gcc----tcc--ctct--------------------------ggat-cttt--
       David's myotis (bat)  c----------t-----gtc----tct--ctct--------------------------ggat-cttt--
                   Hedgehog  t----------t-----gtc----tct--gc---------------------------------------
            Star-nosed mole  t----------t-----gtc----tct--ac---------------------------------------
                   Elephant  c----------t-----cttcac-tacctctct--------------------------gggt-tttt--
        Cape elephant shrew  c----------t-----ctccac-taa--ctct--------------------------ggga-ctt---
                    Manatee  c----------t-----cttcac-tct--ctct--------------------------gggt-tttt--
           Cape golden mole  c----------t-----ttcctg-act--ctct--------------------------gggg-tttt--
                     Tenrec  g----------t-----ctcttgccct--ctcc--------------------------tgga-tgtt--
                   Aardvark  c----------a-----cttcgc-tgagtctct--------------------------gggt-tttt--
                  Armadillo  c----------t-----ctt---------cttt--------------------------gggt-ggct--
                    Opossum  t----------t-----ttc----cct--attt--------------------------gggc-ctcc--
         American alligator  -------------------c----tga--cccc--------------------------gtgc-cctccc
                      Shrew  ======================================================================
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
            Tasmanian devil  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================
                    Wallaby  ======================================================================
                   Platypus  ======================================================================
                   Marmoset  ======================================================================

                      Human  --------
                      Chimp  --------
                    Gorilla  --------
                  Orangutan  --------
                     Gibbon  --------
                     Rhesus  --------
        Crab-eating macaque  --------
                     Baboon  --------
               Green monkey  --------
            Squirrel monkey  --------
                   Bushbaby  --------
         Chinese tree shrew  --------
                   Squirrel  --------
     Lesser Egyptian jerboa  --------
               Prairie vole  --------
            Chinese hamster  --------
                      Mouse  --------
                        Rat  --------
             Naked mole-rat  --------
                 Guinea pig  --------
                 Chinchilla  --------
           Brush-tailed rat  --------
                     Rabbit  --------
                       Pika  --------
                        Pig  --------
                     Alpaca  --------
             Bactrian camel  --------
                    Dolphin  --------
               Killer whale  --------
           Tibetan antelope  --------
                        Cow  --------
                      Sheep  --------
              Domestic goat  --------
                      Horse  --------
           White rhinoceros  --------
                        Cat  --------
                        Dog  --------
                    Ferret   --------
                      Panda  --------
             Pacific walrus  --------
               Weddell seal  --------
           Black flying-fox  --------
                    Megabat  --------
              Big brown bat  --------
       David's myotis (bat)  --------
                   Hedgehog  --------
            Star-nosed mole  --------
                   Elephant  --------
        Cape elephant shrew  --------
                    Manatee  --------
           Cape golden mole  --------
                     Tenrec  --------
                   Aardvark  --------
                  Armadillo  --------
                    Opossum  --------
         American alligator  ccagagga
                      Shrew  ========
                   Microbat  ========
             Golden hamster  NNNNNNNN
                Zebra finch  ========
            Tasmanian devil  ========
             Painted turtle  ========
                     Lizard  ========
                    Wallaby  ========
                   Platypus  ========
                   Marmoset  ========

Inserts between block 23 and 24 in window
B D                    Pig 5bp
B D               Hedgehog 5bp
B D                Opossum 2bp

Alignment block 24 of 389 in window, 28932828 - 28932835, 8 bps 
B D                   Human  gt-----ctctat
B D                   Chimp  gt-----ctctat
B D                 Gorilla  gt-----ctctat
B D               Orangutan  gt-----gtctat
B D                  Gibbon  gt-----ctctat
B D                  Rhesus  gt-----ctctat
B D     Crab-eating macaque  gt-----ctctat
B D                  Baboon  gt-----ctctat
B D            Green monkey  gt-----ctctat
B D         Squirrel monkey  gt-----ctctgt
B D                Bushbaby  gtagatgctct-t
         Chinese tree shrew  gt-----ctccat
B D                Squirrel  ga-----gtcttt
     Lesser Egyptian jerboa  gt-----gtccac
               Prairie vole  ga-----ctctgc
B D         Chinese hamster  gg-----ttctgc
B D                   Mouse  gg-----ctctgc
B D                     Rat  gg-----ctctgc
B D              Guinea pig  gt-----ctctgc
                 Chinchilla  gt-----ctctgc
           Brush-tailed rat  gt-----ctgtgc
B D                  Rabbit  at-----ctctgc
B D                    Pika  ------------c
B D                  Alpaca  gt-----c-----
             Bactrian camel  gt-----c-----
B D                 Dolphin  gc-----c-----
               Killer whale  gc-----c-----
           Tibetan antelope  gc-----g-----
B D                     Cow  gc-----a-----
B D                   Sheep  gc-----g-----
              Domestic goat  gc-----a-----
B D                   Horse  tt-----cttcgc
B D        White rhinoceros  gt-----ctccat
B D                     Cat  gt-----c-----
B D                     Dog  gt-----ctccat
B D                 Ferret   gt-----c----t
B D                   Panda  gt-----c----t
             Pacific walrus  gt-----c----t
               Weddell seal  gt-----c----t
           Black flying-fox  gt-----ttctat
B D                 Megabat  gt-----ttctat
              Big brown bat  gt-----ttctgt
       David's myotis (bat)  gt-----ttctat
B D                Elephant  gt-----ctcggt
        Cape elephant shrew  -t-----ctctat
B D                 Manatee  gt-----ctctgt
           Cape golden mole  gt-----ctttgt
B D                  Tenrec  aa-----ctac--
                   Aardvark  gt-----ctctct
B D               Armadillo  gt-----ctctct
B D                 Opossum  tt-----cttca-
B D                 Wallaby  ct-----cccag-
B D      American alligator  --------gctgt
           Star-nosed mole  -------------
B D                Hedgehog  =============
B D                   Shrew  =============
B D                Microbat  =============
            Golden hamster  NNNNNNNNNNNNN
B D          Naked mole-rat  -------------
B D                     Pig  =============
B D             Zebra finch  =============
B D         Tasmanian devil  =============
  D          Painted turtle  =============
B D                  Lizard  =============
B D                Platypus  =============
B D                Marmoset  =============

Inserts between block 24 and 25 in window
B D                 Alpaca 5bp
            Bactrian camel 5bp
B D                Dolphin 5bp
              Killer whale 5bp
          Tibetan antelope 5bp
B D                    Cow 5bp
B D                  Sheep 5bp
             Domestic goat 5bp
B D                  Horse 10bp
B D       White rhinoceros 10bp
B D                    Dog 10bp
B D                Ferret  10bp
B D                  Panda 10bp
            Pacific walrus 5bp
              Weddell seal 10bp
          Black flying-fox 10bp
B D                Megabat 10bp
             Big brown bat 10bp
      David's myotis (bat) 10bp
B D               Elephant 6bp
       Cape elephant shrew 6bp
B D                Manatee 9bp
          Cape golden mole 8bp
B D                 Tenrec 1bp
                  Aardvark 10bp
B D              Armadillo 8bp

Alignment block 25 of 389 in window, 28932836 - 28932837, 2 bps 
B D                   Human  tt
B D                   Chimp  tt
B D                 Gorilla  tt
B D               Orangutan  tt
B D                  Gibbon  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D                  Baboon  tt
B D            Green monkey  tt
B D         Squirrel monkey  tt
B D                Bushbaby  ct
         Chinese tree shrew  tt
B D                Squirrel  ac
     Lesser Egyptian jerboa  tt
               Prairie vole  ct
B D         Chinese hamster  ct
B D                   Mouse  tc
B D                     Rat  tt
B D              Guinea pig  tt
                 Chinchilla  tt
           Brush-tailed rat  tt
B D                  Rabbit  cg
B D                    Pika  tg
B D                     Pig  ct
B D                  Alpaca  ct
             Bactrian camel  ct
B D                 Dolphin  ct
               Killer whale  ct
           Tibetan antelope  ct
B D                     Cow  ct
B D                   Sheep  ct
              Domestic goat  ct
B D                   Horse  ct
B D        White rhinoceros  ct
B D                     Dog  tt
B D                 Ferret   tt
B D                   Panda  tt
               Weddell seal  tt
           Black flying-fox  ct
B D                 Megabat  ct
              Big brown bat  cc
       David's myotis (bat)  ct
B D                Hedgehog  gt
B D                   Shrew  ct
            Star-nosed mole  ct
B D                Elephant  ct
        Cape elephant shrew  ct
B D                 Manatee  ct
           Cape golden mole  at
B D                  Tenrec  at
                   Aardvark  ct
B D               Armadillo  ct
B D                 Opossum  -t
B D                 Wallaby  -t
B D      American alligator  tt
B D                Microbat  ==
            Golden hamster  NN
B D          Naked mole-rat  --
            Pacific walrus  ==
B D                     Cat  --
B D             Zebra finch  ==
B D         Tasmanian devil  ==
  D          Painted turtle  ==
B D                  Lizard  ==
B D                Platypus  ==
B D                Marmoset  ==

Inserts between block 25 and 26 in window
B D                Opossum 2bp
B D                Wallaby 1bp

Alignment block 26 of 389 in window, 28932838 - 28932839, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Gibbon  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D         Squirrel monkey  at
B D                Bushbaby  gc
         Chinese tree shrew  gt
B D                Squirrel  tt
     Lesser Egyptian jerboa  at
               Prairie vole  tt
B D         Chinese hamster  tt
B D                   Mouse  tt
B D                     Rat  tt
B D              Guinea pig  tc
                 Chinchilla  tc
           Brush-tailed rat  tc
B D                  Rabbit  tc
B D                    Pika  tc
B D                     Pig  ct
B D                  Alpaca  tt
             Bactrian camel  tt
B D                 Dolphin  tt
               Killer whale  tt
           Tibetan antelope  tt
B D                     Cow  tt
B D                   Sheep  tt
              Domestic goat  tt
B D                   Horse  tt
B D        White rhinoceros  tt
B D                     Dog  tt
B D                 Ferret   tt
B D                   Panda  tt
             Pacific walrus  -t
               Weddell seal  tt
           Black flying-fox  tt
B D                 Megabat  tt
              Big brown bat  tt
       David's myotis (bat)  tt
B D                Hedgehog  ct
B D                   Shrew  ct
            Star-nosed mole  tt
B D                Elephant  gc
        Cape elephant shrew  ct
B D                 Manatee  tt
           Cape golden mole  ct
B D                  Tenrec  ct
                   Aardvark  tt
B D               Armadillo  tc
B D                 Opossum  at
B D         Tasmanian devil  at
B D      American alligator  at
B D                Microbat  ==
            Golden hamster  NN
B D          Naked mole-rat  --
B D                     Cat  --
B D             Zebra finch  ==
  D          Painted turtle  ==
B D                  Lizard  ==
B D                 Wallaby  ==
B D                Platypus  ==
B D                Marmoset  ==

Inserts between block 26 and 27 in window
B D                Opossum 214bp
B D     American alligator 95bp

Alignment block 27 of 389 in window, 28932840 - 28932843, 4 bps 
B D                   Human  --ctc-t
B D                   Chimp  --ctc-t
B D                 Gorilla  --ctc-t
B D               Orangutan  --gtc-t
B D                  Gibbon  --ctc-t
B D                  Rhesus  --ctc-t
B D     Crab-eating macaque  --ctc-t
B D                  Baboon  --ctc-t
B D            Green monkey  --ctc-t
B D         Squirrel monkey  --ctc-t
B D                Bushbaby  --ctc-t
         Chinese tree shrew  --ctc-t
B D                Squirrel  --ctg-g
     Lesser Egyptian jerboa  --ctc-t
               Prairie vole  --ctg-g
B D         Chinese hamster  --ccg-g
B D                   Mouse  --ccc-a
B D                     Rat  --tgg-g
B D              Guinea pig  --ct---
                 Chinchilla  --ct--g
           Brush-tailed rat  --ct--g
B D                  Rabbit  --ccc-g
B D                    Pika  --ccc-t
B D                     Pig  --att-t
B D                  Alpaca  --ctg-g
             Bactrian camel  --ctg-g
B D                 Dolphin  --ctg-g
               Killer whale  --ctg-g
           Tibetan antelope  --ctg-g
B D                     Cow  --ctg-g
B D                   Sheep  --ctg-g
              Domestic goat  --ctg-g
B D                   Horse  --ctg-g
B D        White rhinoceros  --ctg-g
B D                     Dog  --ctg-g
B D                 Ferret   --atg-c
B D                   Panda  --ctg-g
             Pacific walrus  --ctg-g
               Weddell seal  --ctg-g
           Black flying-fox  --ctgag
B D                 Megabat  --ctgag
              Big brown bat  --ctg-g
       David's myotis (bat)  --ctg-g
B D                Hedgehog  --ctg-g
B D                   Shrew  --ctg-c
            Star-nosed mole  --ttg-g
B D                Elephant  --ctt--
        Cape elephant shrew  --ctg--
B D                 Manatee  --ctg--
           Cape golden mole  --ctg--
B D                  Tenrec  --atc--
                   Aardvark  --ctg--
B D               Armadillo  --cgg--
B D         Tasmanian devil  agct---
B D                Microbat  =======
            Golden hamster  NNNNNNN
B D          Naked mole-rat  -------
B D                     Cat  -------
B D             Zebra finch  =======
  D          Painted turtle  =======
B D      American alligator  =======
B D                 Opossum  =======
B D                  Lizard  =======
B D                 Wallaby  =======
B D                Platypus  =======
B D                Marmoset  =======

Inserts between block 27 and 28 in window
B D               Elephant 12bp
       Cape elephant shrew 12bp
B D                Manatee 12bp
          Cape golden mole 36bp
B D                 Tenrec 110bp
                  Aardvark 19bp
B D              Armadillo 11bp

Alignment block 28 of 389 in window, 28932844 - 28932852, 9 bps 
B D                   Human  g--tctt---tgag
B D                   Chimp  g--tctt---tgag
B D                 Gorilla  g--tctt---tgag
B D               Orangutan  g--tctt---tgag
B D                  Gibbon  a--tctt---tgag
B D                  Rhesus  g--cctt---tgag
B D     Crab-eating macaque  g--cctt---tgag
B D                  Baboon  g--cctt---tgag
B D            Green monkey  g--cctt---tgag
B D         Squirrel monkey  g--cctt---taag
B D                Bushbaby  g--cctt-tctggg
         Chinese tree shrew  a--cctt-cctggg
B D                Squirrel  g--tctg---tatc
     Lesser Egyptian jerboa  gctcttc---tgcg
               Prairie vole  g--tctc---tgta
B D         Chinese hamster  g--tctc---tgta
B D                   Mouse  g--cctt---tgta
B D                     Rat  g--cctc---tgta
B D          Naked mole-rat  ----ctc---tgga
B D              Guinea pig  g--tctc---tgta
                 Chinchilla  g--tctc---agtg
           Brush-tailed rat  g--gctc---tgtc
B D                  Rabbit  a-gtccc---tctg
B D                    Pika  a--cctc---ttgg
B D                     Pig  g--tctc---tgcc
B D                  Alpaca  g--tctc---tgta
             Bactrian camel  g--tctc---tgta
B D                 Dolphin  g--tctc---cgta
               Killer whale  g--tctc---cgta
           Tibetan antelope  g--tctc---cgta
B D                     Cow  g--tctt---tgta
B D                   Sheep  g--tctc---cgtc
              Domestic goat  g--tctc---cgta
B D                   Horse  g--tctc---tgta
B D        White rhinoceros  g--tgcc---tgta
B D                     Cat  ---cctc---tctg
B D                     Dog  g--tctc---tgta
B D                 Ferret   g--tctc---tgta
B D                   Panda  g--tctc---tgta
             Pacific walrus  g--tctc---tgta
               Weddell seal  g--tctc---tgta
           Black flying-fox  g--tctc---tgta
B D                 Megabat  g--tctc---tgta
              Big brown bat  g--tctc----ggg
       David's myotis (bat)  g--tctc---tggg
B D                Hedgehog  g--tctcagtagtg
B D                   Shrew  c--ttcc---tggg
            Star-nosed mole  g--tctt---gggg
B D                 Opossum  g--tctc---tgag
B D         Tasmanian devil  g--tccc---tggg
B D                 Wallaby  ---atct---ttga
B D               Armadillo  ==============
B D                Microbat  ==============
B D                  Tenrec  ==============
            Golden hamster  NNNNNNNNNNNNNN
       Cape elephant shrew  ==============
          Cape golden mole  ==============
B D                Elephant  ==============
                  Aardvark  ==============
B D             Zebra finch  ==============
  D          Painted turtle  ==============
B D      American alligator  ==============
B D                  Lizard  ==============
B D                Platypus  ==============
B D                 Manatee  ==============
B D                Marmoset  ==============

Alignment block 29 of 389 in window, 28932853 - 28932853, 1 bps 
B D                   Human  ------t
B D                   Chimp  ------t
B D                 Gorilla  ------t
B D               Orangutan  ------t
B D                  Gibbon  ------t
B D                  Rhesus  ------t
B D     Crab-eating macaque  ------t
B D                  Baboon  ------t
B D            Green monkey  ------t
B D         Squirrel monkey  ------t
B D                Bushbaby  ------t
         Chinese tree shrew  ------t
B D                Squirrel  ------t
     Lesser Egyptian jerboa  ------t
               Prairie vole  ------t
B D         Chinese hamster  ------t
B D                   Mouse  ------t
B D                     Rat  ------t
B D          Naked mole-rat  ------t
B D              Guinea pig  ------t
                 Chinchilla  ------t
           Brush-tailed rat  ------t
B D                  Rabbit  ------c
B D                    Pika  ------t
B D                     Pig  ------t
B D                  Alpaca  ------t
             Bactrian camel  ------t
B D                 Dolphin  ------t
               Killer whale  ------t
           Tibetan antelope  ------t
B D                     Cow  ------t
B D                   Sheep  ------t
              Domestic goat  ------t
B D                   Horse  ------t
B D        White rhinoceros  ------t
B D                     Cat  ------t
B D                     Dog  ------t
B D                 Ferret   ------t
B D                   Panda  ------c
             Pacific walrus  ------t
               Weddell seal  ------t
           Black flying-fox  ------c
B D                 Megabat  ------c
              Big brown bat  ------t
       David's myotis (bat)  ------t
B D                Hedgehog  ------t
B D                   Shrew  ------t
            Star-nosed mole  ------t
B D                Elephant  ------t
        Cape elephant shrew  ------t
B D                 Manatee  ------t
           Cape golden mole  ------a
                   Aardvark  ------t
B D               Armadillo  ------c
B D                 Opossum  cccagct
B D         Tasmanian devil  cccagct
B D                 Wallaby  ccttcct
B D                Microbat  =======
B D                  Tenrec  =======
            Golden hamster  NNNNNNN
B D             Zebra finch  =======
  D          Painted turtle  =======
B D      American alligator  =======
B D                  Lizard  =======
B D                Platypus  =======
B D                Marmoset  =======

Alignment block 30 of 389 in window, 28932854 - 28932868, 15 bps 
B D                   Human  --------c-------tc--tat-c-tctctccc
B D                   Chimp  --------c-------tc--tat-c-tctctccc
B D                 Gorilla  --------c-------tc--tat-c-tctctccc
B D               Orangutan  --------c-------tc--tat-c-tctctccc
B D                  Gibbon  --------c-------tc--tat-c-tctctccc
B D                  Rhesus  --------c-------tc--tct-c-tctctccc
B D     Crab-eating macaque  --------c-------tc--tct-c-tctctccc
B D                  Baboon  --------c-------tc--tat-c-tctctccc
B D            Green monkey  --------c-------------t-c-tctctccc
B D         Squirrel monkey  --------c-------tc--tat-c-tctctccc
B D                Bushbaby  --------t-------tc--tgt-c-tcttgccc
         Chinese tree shrew  --------c-------tc--tgc-a-tcattc--
B D                Squirrel  --------c-------tcttcct-c-t-------
     Lesser Egyptian jerboa  --------c-------ta--gct-c-t-------
               Prairie vole  --------c-------tc--ccc-c-c-------
B D         Chinese hamster  --------c-------tc--ccc-c-t-------
B D                   Mouse  --------c-------tc--ccc-c-t-------
B D                     Rat  --------c-------tc--ccc-c-t-------
B D          Naked mole-rat  --------c-------tc--tcc-c-c-------
B D              Guinea pig  --------c-------tc--tccgc-c-------
                 Chinchilla  --------c-------tc--tcc-t-c-------
           Brush-tailed rat  --------c-------tc--tcc-c-t-------
B D                  Rabbit  --------c-------tc--tcc-tgc-------
B D                    Pika  --------t-------tc--ctt-tgg-------
B D                     Pig  --------t-------tc--t------g------
B D                  Alpaca  --------c-------tc--tct-g-tc------
             Bactrian camel  --------c-------tc--tct-g-tc------
B D                 Dolphin  --------c-------tc--tct-g-cc------
               Killer whale  --------c-------tc--tct-g-cc------
           Tibetan antelope  --------c-------tc--tct-t-cc------
B D                     Cow  --------c-------tc--tct-t-cc------
B D                   Sheep  --------c-------tc--tcc-t-cc------
              Domestic goat  --------c-------tc--tcc-t-cc------
B D                   Horse  --------c-------tc--tct-g-cc------
B D        White rhinoceros  --------c-------tc--ttt-t-tc------
B D                     Cat  --------c-------tc--tct-t-cc------
B D                     Dog  --------c-------tc--tct-g-cc------
B D                 Ferret   --------g-------tc--ttc-g-cc------
B D                   Panda  --------c-------tc--tct-g-cc------
             Pacific walrus  --------c-------tc--tct-g-cc------
               Weddell seal  --------c-------tc--tct-g-cc------
           Black flying-fox  --------c-------ac--tct-g-cc------
B D                 Megabat  --------c-------gc--tct-g-cc------
              Big brown bat  --------c-------tc--tgt-g-cc------
       David's myotis (bat)  --------t-------cc--tct-g-cc------
B D                Hedgehog  --------c-------tc--tct-c-tg------
B D                   Shrew  --------c-------tc--tgt-g---------
            Star-nosed mole  --------c-------tt--tct-t-cc------
B D                Elephant  --------c-------tc--tat-c---------
        Cape elephant shrew  --------t-------tc--tct-c---------
B D                 Manatee  --------c-------tc--tgt-c---------
           Cape golden mole  --------caagcccacc--agc-c---------
                   Aardvark  --------c-------tc--ccc-t---------
B D               Armadillo  --------c-------tc--t-c-c---------
B D                 Opossum  --------c-------cc--agc-c-ta------
B D         Tasmanian devil  --------c-------cc--aat-c-tg------
B D                 Wallaby  --------c-------ca--tct-c-ta------
B D                Platypus  ctctgtgtc-------tc--cct-t---------
B D                Microbat  ==================================
B D                  Tenrec  ==================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ==================================
  D          Painted turtle  ==================================
B D      American alligator  ==================================
B D                  Lizard  ==================================
B D                Marmoset  ==================================

Inserts between block 30 and 31 in window
              Prairie vole 10bp

Alignment block 31 of 389 in window, 28932869 - 28932873, 5 bps 
B D                   Human  --tctcc
B D                   Chimp  --tctcc
B D                 Gorilla  --tctcc
B D               Orangutan  --tctcc
B D                  Gibbon  --tctcc
B D                  Rhesus  --tctcc
B D     Crab-eating macaque  --tctcc
B D                  Baboon  --tctcc
B D            Green monkey  --tctcc
B D                Marmoset  --tctcc
B D         Squirrel monkey  --tctcc
B D                Bushbaby  --tctcc
         Chinese tree shrew  --tcttc
B D                Squirrel  --cctaa
     Lesser Egyptian jerboa  --tcaca
               Prairie vole  --tctta
B D         Chinese hamster  --tctca
B D                   Mouse  --tctcc
B D                     Rat  --tctcc
B D          Naked mole-rat  --g-tcc
B D              Guinea pig  --tttcc
                 Chinchilla  --cctcc
           Brush-tailed rat  --gctcc
B D                  Rabbit  --tctcc
B D                    Pika  --tccct
B D                     Pig  --tctcc
B D                  Alpaca  --tctcc
             Bactrian camel  --tctcc
B D                 Dolphin  --tctcc
               Killer whale  --tctcc
           Tibetan antelope  --tctcc
B D                     Cow  --tctcc
B D                   Sheep  --tctcc
              Domestic goat  --tctcc
B D                   Horse  --tctcc
B D        White rhinoceros  --tctct
B D                     Cat  --tctcc
B D                     Dog  --tttcc
B D                 Ferret   --tctcc
B D                   Panda  --tctcc
             Pacific walrus  --tctcc
               Weddell seal  --tctcc
           Black flying-fox  --tcttc
B D                 Megabat  --tcttc
              Big brown bat  --tttcc
       David's myotis (bat)  --tctcc
B D                Hedgehog  --tctgt
B D                   Shrew  ----tcc
            Star-nosed mole  --tctcc
B D                Elephant  --tctcc
        Cape elephant shrew  --tctcc
B D                 Manatee  --tctcc
           Cape golden mole  --gctcc
                   Aardvark  --tctcc
B D               Armadillo  --tctcc
B D                 Opossum  --gcccc
B D         Tasmanian devil  --tctcc
B D                 Wallaby  --tctct
B D                Platypus  tgcct--
B D                Microbat  =======
B D                  Tenrec  =======
            Golden hamster  NNNNNNN
B D             Zebra finch  =======
  D          Painted turtle  =======
B D      American alligator  =======
B D                  Lizard  =======

Inserts between block 31 and 32 in window
          Cape golden mole 72bp

Alignment block 32 of 389 in window, 28932874 - 28932943, 70 bps 
B D                   Human  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D                   Chimp  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D                 Gorilla  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D               Orangutan  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D                  Gibbon  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D                  Rhesus  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D     Crab-eating macaque  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D                  Baboon  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D            Green monkey  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--caggggagc
B D                Marmoset  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--taggggagc
B D         Squirrel monkey  tgggt--------------gtctctg---------ca-tttggt-tctgggtctcttcc--taggggagc
B D                Bushbaby  tggat--------------gtctctg---------ca-tttggt-tctgggtcttttcc--caggggagc
         Chinese tree shrew  tggat--------------gtctctg---------tg-tctggt-ttgggtctccttct--cagaggagc
B D                Squirrel  tgt------------------ctctg---------gg-tctgct-tctgtgtctcttcc--caggggagt
     Lesser Egyptian jerboa  tgt----------------gatgctg---------tg-tctggt-ttggggtctcttca--caggggagc
               Prairie vole  tg-------------------ttcta---------tg-tatggt-ttggggtttcttcc--taggggagc
B D         Chinese hamster  tg-------------------ttcta---------tg-tatggt-ttgggtttttttcc--caggggagc
B D                   Mouse  tg-------------------gtctg---------ta-tctagt-ctggggtctcttcc--caggggaga
B D                     Rat  tg-------------------atctg---------cg-tctagt-ctggggtctcttct--caggggagc
B D          Naked mole-rat  tgac---------------gtctctg---------tg-tccggt-cctgggtctcttcc--cagggaagc
B D              Guinea pig  tgat---------------gtctctg---------tg-tctgct-cctgggtctctt-c--caggggagc
                 Chinchilla  tgat---------------gtctctg---------tg-tctggg-gctgggtctcttcc--caggggagc
           Brush-tailed rat  taat---------------gtctctc---------tg-tttggt-cctgggtctcttcc--caggggagc
B D                  Rabbit  tggga--------------gcctctg---------ta-tctggt-tctgggtctctccc--caggggagc
B D                    Pika  tg-----------------gtctctg---------ta-cctggg-tgggggtctctccc--caggggagc
B D                     Pig  tggat--------------gtctctg---------ta-tctggt-tctgggtatcttcc--caggggaac
B D                  Alpaca  tggat--------------gtctctg---------ta-tctggt-tctgggtatcttcc--caggggaaa
             Bactrian camel  tggat--------------gtctcag---------ta-tctggt-tctgggtatcttcc--caggggaaa
B D                 Dolphin  tagat--------------gtctctg---------ta-tctggt-tctgggtatcttcc--caggagaac
               Killer whale  tagat--------------gtctctg---------ta-tctggt-tctgggtatcttcc--caggagaac
           Tibetan antelope  tggat--------------gtctctg---------tattctggt-tctgggtatcttcc--cagggaaac
B D                     Cow  tggatgtctctgtattctggtctctg---------tattctggt-tctgggtatcttcc--cagggaaac
B D                   Sheep  tggat--------------gtctctg---------tattctggt-tctgggtatcttcc--cagggaaac
              Domestic goat  tggat--------------gtctctg---------tattctggt-tctgggtatcttcc--cagggaaac
B D                   Horse  tggat--------------gttgccg---------ta-tttggt-tctgggtcttttcc--cagggaagc
B D        White rhinoceros  tggat--------------gtctccg---------ta-tctggt-tctgggtctcttcc--caggggagc
B D                     Cat  tggat--------------gtgtctg---------ta-tctggt-tctgggtcttttcc--caggggagc
B D                     Dog  tggat--------------gtgtctg---------ta-tctggt-tctgggtctcttcc--caggggagc
B D                 Ferret   tggat--------------gtgtccg---------ta-tctggt-tctgggtcttttcc--taggggagg
B D                   Panda  tggat--------------gtgtccg---------ta-tctggt-tctgggtctcttcc--caggggagc
             Pacific walrus  tggat--------------gtgtccg---------ta-tctggt-tctgggtctcttcc--taggggagc
               Weddell seal  tggat--------------gtgtctg---------ta-tctggt-tctgggtctcttcc--taggggagc
           Black flying-fox  tggaa--------------gtctctg---------ta-tctggt-tctgggtctttccc--caggggagc
B D                 Megabat  tggaa--------------gtctctg---------ta-tctggt-tctgggtctttccc--caggggagc
              Big brown bat  tggat--------------gtctctg---------ta-tctggt-tccgggtctcttcc--caggggagc
       David's myotis (bat)  tggat--------------gtctccg---------ca-tctggt-tctgggtctcttcc--caggggagc
B D                Hedgehog  tgggt--------------gtctctg---------ga-tctgaattccgggtctctctc--caggagagc
B D                   Shrew  tggat--------------gtctctg---------ga-tctggc-cctgc-tctctgcc--caggtgagc
            Star-nosed mole  tggat--------------atctctg---------ga-tctgga-actacaattcttcc--caggggagc
B D                Elephant  tgaat--------------gt--------------tg-gctggt-tctgggtctcttcc--caggggaga
        Cape elephant shrew  tggat--------------gt--------------tg-attggt-tctgggtctctttg--caggggaga
B D                 Manatee  tggat--------------gt--------------tg-acagct-tctgggtctcttcc--caggggaga
           Cape golden mole  taaat--------------gt--------------tg-attggt-tctgggtcttttcc--taggggaaa
B D                  Tenrec  ---------------------------------------------tctgggtctcttcc--caggggaaa
                   Aardvark  tggat--------------at--------------tg-actggt-tttgggtctcttcc--caggagaga
B D               Armadillo  tggat--------------gcctctg---------ta-cctggt-cccggctctcttcc--caggggagc
B D                 Opossum  ---------------------ttctccctttctctcc-tc-----tctgtg----ttgc--caggtgaac
B D         Tasmanian devil  ---------------------agctc---------ta-tc-----tccatg----ttgc--caggtgaac
B D                 Wallaby  -----------------------cta---------ca-tc-----tatgtg----ttgc--caggtgaac
B D                Platypus  -------------------tttcttt---------ct-ttttat-tgtgcctctctctcttcagataagc
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D      American alligator  ======================================================================
B D                  Lizard  ======================================================================

                      Human  tgttccggtggaatgtttcggacctag
                      Chimp  tgttccggtggaatgtttcggacctag
                    Gorilla  tgttccggtggaatgtttcggacctag
                  Orangutan  tgttccggtggaatgtttcggacctag
                     Gibbon  tgttccgctggaatgtttcggacctag
                     Rhesus  tgttccggtggaatgtttcggacctag
        Crab-eating macaque  tgttccggtggaatgtttcggacctag
                     Baboon  tgttccggtggaatatttcggacctag
               Green monkey  tgttccggtggaatgtttcggacttag
                   Marmoset  tgttccggtggaatgcttcggacctca
            Squirrel monkey  tgttccggtggaatgcttcggacctcg
                   Bushbaby  tgtttcggtggaatgcttcagaccta-
         Chinese tree shrew  tgttccggtggaatgcttccgacctcg
                   Squirrel  tgttccgttggaatgcttcagacttag
     Lesser Egyptian jerboa  tgttccgttggaatgtttcagacttag
               Prairie vole  tgttccgctggaatgcttcagatatag
            Chinese hamster  tgtttcgctggaatgcttcagatgtaa
                      Mouse  tgttccggtggaatgcttcagacgtca
                        Rat  tgttccggtggaatgcttcagacttgg
             Naked mole-rat  tgttccggtggaatgcatcagacttag
                 Guinea pig  tgttccggtggaattcttcggacttag
                 Chinchilla  tgttccggtggaacgcttcagatgtag
           Brush-tailed rat  tgttccggtggaatgcttcagacttag
                     Rabbit  tcttccggtggaatgcttcggacctag
                       Pika  tgttccggtggaatgcttcagacgtag
                        Pig  tgttccggtggaatgcttcagacctaa
                     Alpaca  tgttccggtggaatgcttcagacctca
             Bactrian camel  tgttccggtggaatgcttcagacctca
                    Dolphin  tgttccggtggaatgcttcagacctaa
               Killer whale  tgttccggtggaatgcttcagacctaa
           Tibetan antelope  tgttccggtggaatgcttcagacctca
                        Cow  tgttccggtggaatgcttcagacctca
                      Sheep  tgttccggtggaatgcttcagacctca
              Domestic goat  tgttccggtggaatgcttcagacctca
                      Horse  tgttccggtggaatgcttcagacctag
           White rhinoceros  tgttccggtggaatgcctcagacctag
                        Cat  tgttccgctggaatgcctcatacctaa
                        Dog  tcttccggtggaatgcttcagccctaa
                    Ferret   tgttccggtggaatgcttcggccttaa
                      Panda  tgttccggtggaatgcttcggccctaa
             Pacific walrus  tgttccggtggaatgcttcggccctaa
               Weddell seal  tgttccggtggaatgcttcggccctaa
           Black flying-fox  tgttccggtggaaggcttcagacctag
                    Megabat  tgttccggtggaaggcttcagacctag
              Big brown bat  tgttccgttggaaggcttcaaacctgg
       David's myotis (bat)  tgttccgttggaaggcttcaaacctag
                   Hedgehog  tgtttcggtggaatgcttcagacctgg
                      Shrew  tgttccggtggaatatttcagacctgt
            Star-nosed mole  tgttctcatgggacactgtagatctac
                   Elephant  tgttcaggtggaatgcttcagacctag
        Cape elephant shrew  tgttcaggtggaatgcttcagacctag
                    Manatee  tgttcaggtggaatgcttcagacctag
           Cape golden mole  tattcaggtggaatgcttcagacctag
                     Tenrec  tgttcaggtggaatgcctcagacctgg
                   Aardvark  tgttcagatggaatgcttcagacctag
                  Armadillo  tgttccggtggaatgcttcagacctag
                    Opossum  tgttccagtggaatgctactggccccg
            Tasmanian devil  tgttccagtggaatgctactggcccag
                    Wallaby  tgttccagtggaatgctacaggcccag
                   Platypus  ggttcctgtggaatcccccaaaggaag
                   Microbat  ===========================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ===========================
             Painted turtle  ===========================
         American alligator  ===========================
                     Lizard  ===========================

Alignment block 33 of 389 in window, 28932944 - 28932945, 2 bps 
B D                   Human  -gt
B D                   Chimp  -gt
B D                 Gorilla  -gt
B D               Orangutan  -gt
B D                  Gibbon  -gt
B D                  Rhesus  -gt
B D     Crab-eating macaque  -gt
B D                  Baboon  -gt
B D            Green monkey  -gt
B D                Marmoset  -gt
B D         Squirrel monkey  -gt
         Chinese tree shrew  -ct
B D                Squirrel  -ag
     Lesser Egyptian jerboa  -ag
               Prairie vole  -gg
B D         Chinese hamster  -gg
B D                   Mouse  -gg
B D                     Rat  -gg
B D          Naked mole-rat  -gg
B D              Guinea pig  -gg
                 Chinchilla  -gg
           Brush-tailed rat  -gg
B D                  Rabbit  -gt
B D                    Pika  -gc
B D                     Pig  -at
B D                  Alpaca  -at
             Bactrian camel  -at
B D                 Dolphin  -at
               Killer whale  -at
           Tibetan antelope  -at
B D                     Cow  -at
B D                   Sheep  -at
              Domestic goat  -at
B D                   Horse  -at
B D        White rhinoceros  -at
B D                     Cat  -at
B D                     Dog  -at
B D                 Ferret   -at
B D                   Panda  -ac
             Pacific walrus  -at
               Weddell seal  -at
           Black flying-fox  -at
B D                 Megabat  -at
              Big brown bat  -at
       David's myotis (bat)  -ac
B D                Hedgehog  -gt
B D                   Shrew  -at
            Star-nosed mole  -ac
B D                Elephant  -at
        Cape elephant shrew  -at
B D                 Manatee  -at
           Cape golden mole  -at
B D                  Tenrec  -c-
                   Aardvark  -at
B D               Armadillo  -ac
B D                Platypus  -ga
B D      American alligator  gg-
B D                Microbat  ===
            Golden hamster  NNN
B D                Bushbaby  ---
B D             Zebra finch  ===
B D         Tasmanian devil  ---
  D          Painted turtle  ===
B D                 Opossum  ---
B D                  Lizard  ===
B D                 Wallaby  ---

Alignment block 34 of 389 in window, 28932946 - 28933102, 157 bps 
B D                   Human  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D                   Chimp  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D                 Gorilla  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D               Orangutan  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D                  Gibbon  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D                  Rhesus  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D     Crab-eating macaque  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D                  Baboon  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D            Green monkey  ggcctgggctgtgg------c---ctgaagaacag-----------------gtcctca---gagg----
B D                Marmoset  ggtcagggctgtgg------c---ctggagaacag-----------------gtcctca---gagg----
B D         Squirrel monkey  ggccggggctgcgg------c---ctggagaacag-----------------gtcctca---gagg----
B D                Bushbaby  ------ggctgtag------c---ctgggaaacag-----------------gtcctca---gagg----
         Chinese tree shrew  gaccctcgctgtga------c---ctggagaacag-----------------gtcctca---gagg----
B D                Squirrel  gccctaaaatgtag------c---cgggggaacat-----------------gtcctct---gggg----
     Lesser Egyptian jerboa  gagctaggctgtgg------t---ccagagaacac-----------------gtcctca---gagg----
               Prairie vole  gacctgaaatgtgg------c---ctgaagaacag-----------------gtcctca---ggga----
B D         Chinese hamster  gacttggactgtgg------c---ctggagaacag-----------------gtcctca---ggga----
B D                   Mouse  gacctggactgtga------c---ctaaggaacag-----------------gtcctct---ggga----
B D                     Rat  gacctggattgtga------c---ctaggaaacag-----------------gtcctca---ggga----
B D          Naked mole-rat  gacctaagctgtgg------c---ccggggaatgg-----------------ctcatca---ggga----
B D              Guinea pig  gacttcagctgtgg------c---ccagggaatgg-----------------gtcatca---gaag----
                 Chinchilla  gacctcagctgtgg------c---ccggggaacgg-----------------gtcctca---gcgg----
           Brush-tailed rat  gacctcagctgtggtccagcc---ccggggaacag-----------------gtcctcacccacca----
B D                  Rabbit  ggcccaggctgtgg------c---ctgggcaatga-----------------gtcttcc-----------
B D                    Pika  agcccaggctgtgg------c---ttaaggaacaa-----------------ct----------------
B D                     Pig  gacccaagctgtga------c---ttgggggccag-----------------gtcctca---gagg----
B D                  Alpaca  gacccaagctgtga------c---ccggagaacag-----------------tccctca---aagg----
             Bactrian camel  gacccaagctgtga------c---ccggagaacag-----------------tccctca---aagg----
B D                 Dolphin  gacccaagctgtgg------c---ctgcggaacag-----------------gtcctca---gagg----
               Killer whale  gacccaagctgtgg------c---ctgcggaacag-----------------gtcctca---gagg----
           Tibetan antelope  gacccaagctgtga------c---ctggg-----------------------------g---aagg----
B D                     Cow  gacccaagctgtga------c---ctgaggaacaa-----------------aacctcg---aagg----
B D                   Sheep  gacccgagctgtga------c---ctggg-----------------------------g---aagg----
              Domestic goat  gacccgagctgtga------c---ctggg-----------------------------g---aagg----
B D                   Horse  aacccaggctgtgg------c---ctgggcaaaag-----------------ttcctca---gaag----
B D        White rhinoceros  gacctaggctgtgg------c---ctgggcaacag-----------------gccctca---gagg----
B D                     Cat  gacccaggctgtgg------c---ctggggaacag-----------------gtcctca---gagg----
B D                     Dog  gactcaggctgtgg------c---ctggggaaccg-----------------accctca---gagg----
B D                 Ferret   gactcaggctgcgg------c---ctggggaacag-----------------gtcctca---gagg----
B D                   Panda  gactcaggctgtgg------c---ctggggaacag-----------------gtcctca---gagg----
             Pacific walrus  gactcaggctgtgg------g---ctggggaacag-----------------gtcctca---gagg----
               Weddell seal  gactcaggctgtgg------g---ctggggaacag-----------------gtcctca---cagg----
           Black flying-fox  ggcccaggctgtga------c---ctggggaatag-----------------ttcctca---gaga----
B D                 Megabat  ggcccaggctgtga------c---ctggggaatag-----------------ttcctca---gaga----
              Big brown bat  gacccaggctgtga------c---ccggggaacag-----------------gtccaca---cagg----
       David's myotis (bat)  ggcccaggctgcga------c---ctggggaacag-----------------gtcctca---gagg----
B D                Hedgehog  ggctcaggctgtga------c---atagggaacag-----------------gtctgtg---cagg----
B D                   Shrew  gacccaggatgcga------cagggtggggaatgg-----------------atcctcc---tctg----
            Star-nosed mole  ---------tgtga------c---ttgggaaacag-----------------gtcctca---gagg----
        Cape elephant shrew  ggtcaagactgtga------c---ctggggcccac-----------------gccctca---gaag----
B D                 Manatee  ggcctaggctgtga------c---ctgtggaacat-----------------gtcctca---aagg----
           Cape golden mole  ggcctaggctgtgt------c---ctggggaacat-----------------gtcctca---gagg----
B D                  Tenrec  --------ctgtgg------c---ctggggaccac-----------------gccctca---gagg----
                   Aardvark  ggcctaggctgtgg------t---ctggggaacat-----------------gtcctca---gagg----
B D               Armadillo  ctcccaggctgtga------c---ctggggagcag-----------------tttttca---aagg----
B D                 Opossum  ----tgggctgtgg------t---ctcag-------------------------ctcca---ccgt----
B D         Tasmanian devil  ----aaggctgtgg------t---cttaggaggga-----------------attctta---tctgcaat
B D                 Wallaby  ----agggctgtgg------t---cttacgaaagt-----------------atcctca---ctgtggcc
B D                Platypus  gtaggggattgtgg------t---cccaggaaaggcgtctcccctaagccccttcctta---tggg----
B D      American alligator  ggccgggtctgggg------c---c---gggacaa-----------------gtcgttg---at------
B D                Microbat  ======================================================================
            Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Zebra finch  ======================================================================
  D          Painted turtle  ======================================================================
B D                  Lizard  ======================================================================

                      Human  --------------------gcc----------------------ccagctcccct--tccgggaagctc
                      Chimp  --------------------gcc----------------------ccagctcccct--tccgggaagctc
                    Gorilla  --------------------gct----------------------ccagctcccct--tccgggaagctc
                  Orangutan  --------------------gcc----------------------ccagctcccct--tccgggaagctc
                     Gibbon  --------------------gcc----------------------ccagctcccct--tccaggaagctc
                     Rhesus  --------------------gcc----------------------ccagctcccct--tctgggaaactc
        Crab-eating macaque  --------------------gcc----------------------ccagctcccct--tctgggaaactc
                     Baboon  --------------------gcc----------------------ccagctcccct--tctgggaaactc
               Green monkey  --------------------gcc----------------------ccagctcccct--tctgggaaactc
                   Marmoset  --------------------acc----------------------ccagctcccct--tccgggaacctc
            Squirrel monkey  --------------------acc----------------------ccagctcccct--tccgggaacctc
                   Bushbaby  --------------------acc----------------------ccaggccctct--tctggtcacccc
         Chinese tree shrew  --------------------ccc----------------------ccaggccctcc--tcaggctacccc
                   Squirrel  --------------------gca----------------------ctgggctctct--tctgctcccccc
     Lesser Egyptian jerboa  --------------------ccc----------------------agaggccctct--tctggtcaccgc
               Prairie vole  --------------------gcc----------------------atagccccgct--tctggttcccgc
            Chinese hamster  --------------------gcc----------------------ataggccctct--tctggttcccac
                      Mouse  --------------------gcc----------------------acaggtccact--tctggttccca-
                        Rat  --------------------gcc----------------------acaggtccact--tctggttccca-
             Naked mole-rat  --------------------ggc----------------------ccaggctcgct--cctcatcaccgc
                 Guinea pig  --------------------gcc----------------------ccacgccttct--tctcaacacccc
                 Chinchilla  --------------------gcc----------------------ccaggccgtct--tctccccagccc
           Brush-tailed rat  --------------------gcc----------------------ccaggctctct--ccccaccacccc
                     Rabbit  ----------------------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  --------------------gtc----------------------gcaggtcctct--tccagtcacccc
                     Alpaca  --------------------gca----------------------gcaggccctct--tctggtcaccct
             Bactrian camel  --------------------gca----------------------gcaggccctct--tctggtcaccct
                    Dolphin  --------------------gcc----------------------ccaggccctat--tctggtcacccc
               Killer whale  --------------------gcc----------------------ccaggccctct--tctggtcacccc
           Tibetan antelope  --------------------gcc----------------------ccaggcccact--tctggtcacccc
                        Cow  --------------------gcc----------------------ccaggtcctct--tctggtcacccc
                      Sheep  --------------------gcc----------------------ccaggcccact--tctggtcacccc
              Domestic goat  --------------------gcc----------------------ccaggcccact--tctggtcacccc
                      Horse  --------------------gcc----------------------tcaagacctct--tctggtcaccct
           White rhinoceros  --------------------gcc----------------------ccaggtccttt--cctggtcacccc
                        Cat  --------------------gcc----------------------ccaagccctct--tctggttacccc
                        Dog  --------------------gcc----------------------ccaagccctct--tctcgttacccc
                    Ferret   --------------------gcc----------------------ccaagccccct--tctggctatccc
                      Panda  --------------------gcc----------------------ccaagccctct--tctggttacccc
             Pacific walrus  --------------------gcc----------------------ccaagccctct--tctggttatccc
               Weddell seal  --------------------gct----------------------ccaagccctct--tctggttacccc
           Black flying-fox  --------------------agc----------------------ccaggctttct--tctggtctcacc
                    Megabat  --------------------acc----------------------ccaggctttct--tctggtctcacc
              Big brown bat  --------------------acc----------------------ccgggccctct--tctgatggcctc
       David's myotis (bat)  --------------------acc----------------------ccaggccctcc--cctgatggcctc
                   Hedgehog  --------------------acc----------------------ccagggggccc--cctgcttacccc
                      Shrew  --------------------gcc-------------------------gtg-----------------cc
            Star-nosed mole  --------------------gcc----------------------ccagga-----------------cc
        Cape elephant shrew  --------------------ggc----------------------ccaggccctct--ccgggttcccca
                    Manatee  --------------------gcc----------------------ccaggccctct--tctggttccccc
           Cape golden mole  --------------------tcc----------------------ccaggccctcc--tctagttccccc
                     Tenrec  --------------------acc----------------------ccttgtcctct--tcggactctgcc
                   Aardvark  --------------------gcc----------------------ccaggtcctta--gctggttcctcc
                  Armadillo  --------------------gct----------------------ccgggccctct--tctggtcctccc
                    Opossum  ---acctgctagcctttccagat----------------------cccggccccct--cctgatccttct
            Tasmanian devil  taagccttttgaccgttcaagat----------------------ccaagttccaa--actgctccctcc
                    Wallaby  caggcgtgtcagctttccaagat----------------------ctaggtcccga--acttatccctcc
                   Platypus  --------------------gacttccccaacacgtccgaatcgtccgggccctctggcctccctccccc
         American alligator  --------------------gct----------------------gccgtccaacc--t-----------
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================

                      Human  atgagccccaa----------gc-----tgtatgtgtgggccaaaga------ccgcc---ctg---aga
                      Chimp  atgagccccaa----------gc-----tgtatgtgtgggccaaaga------ccgcc---ctg---aga
                    Gorilla  atgagccccaa----------gc-----tgtatgtgtgggccaaaga------ccgcc---ctg---aga
                  Orangutan  atgagccccaa----------gc-----tgtatgtgtgggccaaaga------ccgcc---cta---aga
                     Gibbon  atgaaccccca----------gc-----tgtatgtgtgggccaaaga------ccgcc---cta---agg
                     Rhesus  aacagctccca----------ac-----tgtatgtgtgggccaaaga------cagac---ctg---aga
        Crab-eating macaque  aacagctccca----------ac-----tgtatgtgtgggccaaaga------cagac---ctg---aga
                     Baboon  aacagctccca----------ac-----tgtatgtgtgggccaaaga------cagac---ctg---aga
               Green monkey  aacagctccca----------tc-----tgtatgtgtgggccaaaga------cagac---ctg---aga
                   Marmoset  atgagctccca----------gc-----tgtatgtatgggccaaaga------ccgcc---cta---aga
            Squirrel monkey  atgagctccca----------gc-----tgtatgtatgggccaaaga------ccgcc---cta---aga
                   Bushbaby  accagctccca----------gg-----tgtatgtatgggccaatga------tcacc---ctg---agg
         Chinese tree shrew  cccagctccca----------gc-----tgtatgtatgggccaaaga------caaac---ccg---aga
                   Squirrel  aacacctccca----------ac-----tctatgtgtgggctaagga------ccacc---cta---aga
     Lesser Egyptian jerboa  accagctcctg----------gc-----tatatgtgtgggccaaagg------ccatc---cta---agg
               Prairie vole  aacaaatccct----------gc-----tgtatgtgtgggcgaaaga------ccatc---ctg---agg
            Chinese hamster  aacagttcctg----------gc-----tgtatgtgtgggctaaaga------ccatc---ctg---agg
                      Mouse  ---------------------gc-----tgtatgtgtgggctaaaga------ccatc---cta---agg
                        Rat  ---------------------gc-----tgtatgtgtgggctacaga------tcatc---ctg---agg
             Naked mole-rat  aacaactccca----------gc-----tgtatgtgtggaacaaagg------ccacc---ctg---aga
                 Guinea pig  aacagctccca----------gc-----tgtatgtgtgggacaaacg------cgact---ctc---cga
                 Chinchilla  cccaactccca----------gc-----tctatgtgtgggacaaggg------cctcc---ctt---gga
           Brush-tailed rat  aacagctccca----------gc-----tgtatgtgtgggacaaaga------ccgct---cca---aga
                     Rabbit  ---agctccca----------gc-----cgtacgtgtgggacagaga------ccacc---cca---agg
                       Pika  ------tgcca----------gagattgtgcatgtgtgggacaaagatgaaggcaaag---cca---agc
                        Pig  acaaggtccaa----------gc-----tgtatgtatgggccaagaa------ccaag---cta---agg
                     Alpaca  acaaggcctca----------gc-----tgtatgtgtgggtcaagga------tcacc---ctg---aga
             Bactrian camel  acaaggcctca----------gc-----tgtatgtgtgggtcaagga------tcacc---ctg---aga
                    Dolphin  acaaggtccca----------gg-----tctatgtgtgggccaagaa------cagcc---cta---aga
               Killer whale  acaaggtccca----------gg-----tctatgtgtgggccaagaa------caacc---cta---aga
           Tibetan antelope  acaaagtccca----------gc-----tgcatgtgtggggcaggga------ccact---ttaaggaga
                        Cow  acaaagtccca----------gc-----tgaatgtgtggggcacgga------ccact---ttaaggaga
                      Sheep  acaaagtccca----------gc-----tgcatgtgtggggcaagga------ccact---ttaaggaga
              Domestic goat  acaaagtccca----------gc-----tgcatgtgtggggcaggga------ccact---ttaaggaga
                      Horse  gcaagctccca----------gc-----tgtatgagtgggccaaaga------ccagc---ctc---ata
           White rhinoceros  acaagctccca----------gc-----tgtatgtgtgggacaaaga------caaac---gta---aga
                        Cat  acaagctccca----------gc-----tgtacgtgtgggccaaagg------ccacc---ctg---aga
                        Dog  acaagctccca----------gc-----tgtacgtgtgggaaaaaga------ccacc---ctg---aga
                    Ferret   acaagctccca----------gc-----tgtacgtgtgggcccaaga------ccacc---ctg---aga
                      Panda  acaagctccca----------gc-----tgtatgtgtgggccaaaga------ccacc---ctg---aga
             Pacific walrus  acaagctccca----------gc-----tgtatgtgtgggccaaaga------ccacc---ctg---aga
               Weddell seal  acaagctccca----------gc-----tgtatgtttgggccaaaga------ccacc---ctg---aga
           Black flying-fox  acaagctctca----------gc-----tgtatgtgcgggccaaaga------ccacc---ctg---aga
                    Megabat  acaagccctca----------gc-----tgtatgtgtgggccaaaga------ccacc---ctg---aga
              Big brown bat  accagctccca----------gc-----tatatgtatgggccaaagg------tcacc---ctg---aga
       David's myotis (bat)  acaagctccca----------gc-----tctatgtctgggccacgga------tcacg---ctg---aga
                   Hedgehog  ccagcctcccg----------ga-----tctatgtgtggaagaaaaa------ttacc---ctg---aga
                      Shrew  ccaagctccca----------gc-----tgtacgtgtggtacagaga------tgacg---gta---taa
            Star-nosed mole  atgagctccaa----------gc-----tgtatgtgtggaaacgaga------ccacc---ttg---aga
        Cape elephant shrew  gtcagctccca----------gg-----tgtacgtatgggacacaga------tcact---cta---ggg
                    Manatee  actagctccca----------gg-----catacgtgtgggccaaacg------tcacc---tta---aga
           Cape golden mole  accagctccca----------gg-----tgtacgtgtgggacaaaga------tcatc---ctg---agc
                     Tenrec  accagctccca----------gg-----tgtacgtgtgggccaaaga------tcacc---ctg---aga
                   Aardvark  accagctccca----------ag-----tgtacgtgtgggccaaaga------tcacc---ctg---aga
                  Armadillo  accagttccca----------gc-----tgtatgtgtgggccaggga------ccaac---ctg---aga
                    Opossum  a------ctca----------gc-----tctatgtctgggctggaga------cagac---ctg---agc
            Tasmanian devil  a------ccca----------ac-----tatacgtatgggctgagga------caaac---ctg---agc
                    Wallaby  a------ctca----------ac-----tgtatgtatgggctgagga------caaac---ctg---agc
                   Platypus  aaatgactctaatcccctcttgc-----tgtatgtgtggaataggga------tggcc---ctc---agc
         American alligator  ---------------------gt-----accgtttggagggcacgga------cctgctgatca---agg
                   Microbat  ======================================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ======================================================================
             Painted turtle  ======================================================================
                     Lizard  ======================================================================

                      Human  tctgggagggagagcctccgtg-tctcccaccgagggacagcctgaaccaga
                      Chimp  tctgggagggagagcctccatg-tggcccaccgagggacagcctgaaccaga
                    Gorilla  tctgggagggagagcctccgtg-tggcccaccgagggacagcctgaaccaga
                  Orangutan  tctgggagggagagcctccatg-tggcccaccaagggacagcctgaaccaga
                     Gibbon  tctgggagggagaggctccgtg-tggcccaccgagggacagcctgaaccaga
                     Rhesus  tgtgggagggagagcctgtgtg-tggcccaccgagggacagcctgaaccaga
        Crab-eating macaque  tgtgggagggagagcctgtgtg-tggcccaccgagggacagcctgaaccaga
                     Baboon  tctgggagggagagcctgtgtg-tggcccaccgagggacagcctgaaccaga
               Green monkey  tctgggagggagagcctgtgtg-tggcccaccgagggacagcctgaaccaga
                   Marmoset  tctgggagggagagcctccatg-tggcctactgagggacagcctgaaccaga
            Squirrel monkey  tctgggagggagagcctccgtg-tggcccactgagggacagcctgaaccaga
                   Bushbaby  tctggaagggaaggcacatgtg-tgttccacctaggcaaaatctgagccaga
         Chinese tree shrew  tctgggagacagagcctgcctg-tgtcccatctaggggcggattgaaccaga
                   Squirrel  tctggaatacagagcccgtgtg-tgccccaccaagggggagtctgaaacaga
     Lesser Egyptian jerboa  tctgggggacagagcctgtctg-tctcccaccaagatccagtctgaaccaga
               Prairie vole  tcgtggggacagagcctgtatg-tgccccacggagggttagtctgaatcaga
            Chinese hamster  tcgtggggacaaagcctgtatg-tgccccacagaggatcagtctgaatcaga
                      Mouse  tctggggaacaaagcctgtatg-tgcccctcgggggagcagtttgaatcaga
                        Rat  tctggaaaacaaagcctgtatg-tgccccacgggagatcagtctgaatcaga
             Naked mole-rat  tctgggaggcagagcctgggtg-tgccccatcgaggggcagtctgaaagaga
                 Guinea pig  gttgggagccagagccagtgtg-tgccccaccgaggggaagtctgaatgaaa
                 Chinchilla  gctgggaggcggagccggtgtg-tgccccacccaggggcagtctgaaccaga
           Brush-tailed rat  gcaggaagggaaagtcagtttg-tgccccgcctaggggcagtctgaaccaga
                     Rabbit  agtgggacatggggcctgcctg-cgcttcccccaggggtgatctgaaccaga
                       Pika  aatgggacatgatgtctgcttg-cactcccctgagggacagtctaaatgaca
                        Pig  tcttacacacagacctcacatg-ccccccaccgaacagcactgtgaaccaga
                     Alpaca  tcttatacacagaccctgcatg-tgccccacctaatggcagtttgaaccaga
             Bactrian camel  tcttatacacagaccctgcatg-tgccccacctaatggcagtttgaaccaga
                    Dolphin  tcttacacacagactctgcctg-tgccccacctaacagcactttgaaccaga
               Killer whale  tcttacacacagactctgcctg-tgccccacctaacggcactttgaaccaga
           Tibetan antelope  tctcacacacagaccgggcctg-tgctccacctaacagcacattgaaccaga
                        Cow  tctcacacgcagacctgccctg-tgctccacctaacagcacattgaaccaca
                      Sheep  tctcacacacagaccgggcctg-tgctccacctaacagcacattgaaccaga
              Domestic goat  tctcacacacagaccgggcctg-tgctccacctaacagcacattgaaccaga
                      Horse  tccgggagacagcccttgaatg-tgccccaaataggagcagtctgaaccaga
           White rhinoceros  tctggaagacagaccttaaatg-tgcctcaaataggagcagtctgaaccaga
                        Cat  tctgggagacagaccctgactg-tgcctcgcccaggggcggtctggaccaga
                        Dog  tctgggagacagaccctgaatg-tgccctgccccggggcactctgaaccaga
                    Ferret   tctgggagaccgaccctgaatg-tgccctgcccagggaccatctgaatcaga
                      Panda  cctgggagatagaccctgaatg-tgcccca------gccagtctgaaccaga
             Pacific walrus  tctgggagatagaccctgaatg-tgccctgcccaggggcagtctgaaccaga
               Weddell seal  tctgggagatagaccctgaatg-tgccccacccaggggcagtctgaaccaga
           Black flying-fox  tctgggagacaaaccctgcatg-tgccctacctaacggcagttctaacgaga
                    Megabat  tctgggtgacaaaccctgcatg-tgccctacctaacggcagttctaacgaga
              Big brown bat  tttgggagaaagaccctgcatg-tgccccacctgacggcagtgcaa------
       David's myotis (bat)  gttgggaggtagaccctgcttg-tgctccccctaaccgcagttcaa------
                   Hedgehog  tctgggagccagaacctctatg-cgccacaccgagagctcagtcaaaccgga
                      Shrew  tccggaagacagagaccatgtg-tattccaccgagactccgttcaaaccag-
            Star-nosed mole  cctgg------gatcctgcatg-tgctcccaaaaggggcaggggaaaccaga
        Cape elephant shrew  cctggaagacaggctttgcatg-ccctccacctcagggcggttcaaaccaga
                    Manatee  cctgggaggcagaccctgtgtg-tgtcccacctcggggcagtccaaaccaga
           Cape golden mole  tctgggaggcagactctgcatg-tgtcccacctcggggcagtccaaaccgga
                     Tenrec  cctggaagtcagaccctgcatg-tgccccgtctcagggcagctccaaccaga
                   Aardvark  tctgggaggcagaccctctttg-tgccccacctcagggcagtccaaaccaga
                  Armadillo  tgcagagggcaggccctgtatg-tgccccagctgggggcagtccaaaccgga
                    Opossum  tgtgggatcccttcactccctg-tacg------------------gatcaga
            Tasmanian devil  tatgggatcccttcgctccatg-tact------------------gaccaga
                    Wallaby  catgggatcccttcactccatg-taat------------------gatcaga
                   Platypus  tctggggaaagcttcctccctg-tgtggacaccgaaagcagccacaaccaaa
         American alligator  acctgaaggcggagcaggccggctggtacagctg--------ctggagcagc
                   Microbat  ====================================================
             Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Zebra finch  ====================================================
             Painted turtle  ====================================================
                     Lizard  ====================================================

Inserts between block 34 and 35 in window
B D               Platypus 1594bp

Alignment block 35 of 389 in window, 28933103 - 28933145, 43 bps 
B D                   Human  gcc---tc---agccagggtatg----------gtgatg----ac-t------------------g----
B D                   Chimp  gcc---tc---agccagggtatg----------gtgatg----ac-t------------------g----
B D                 Gorilla  gcc---tc---agccagggtatg----------gtgatg----ac-t------------------g----
B D               Orangutan  gcc---tc---agccagggtaag----------gtgatg----ac-t------------------g----
B D                  Gibbon  gcc---tc---agccagggtaag----------gtgatg----at-c------------------g----
B D                  Rhesus  gcc---tg---agccagggtaag----------gtgatg----at-t------------------g----
B D     Crab-eating macaque  gcc---tg---agccagggtaag----------gtgatg----at-t------------------g----
B D                  Baboon  gcc---tg---agccagggtaag----------gtgatg----at-t------------------g----
B D            Green monkey  gcc---tg---agccagggtaag----------gtgatg----ac-t------------------g----
B D                Marmoset  ccc---tc---agccagggtaag----------gagatg----gc-c------------------t----
B D         Squirrel monkey  ccc---tc---agccagggtaag----------gagctg----gc-c------------------t----
B D                Bushbaby  gcc---tc---agccaaggtaag----------atg--------c-a------------------g----
         Chinese tree shrew  gcc---tc---acccaaggtaag----------gtgaca--gtgc-t------------------g----
B D                Squirrel  gct---tc---aaccaaggtaag----------gggtct--ctgc-t------------------g----
     Lesser Egyptian jerboa  act---tc---agcccaggtaaa----------aggatg--acac-t------------------g----
               Prairie vole  gtctaatc---aaccaaggtgag----------gggaca-------------------------------
B D         Chinese hamster  gtctaatc---aaccaaggtaag----------gggaca-------------------------------
B D                   Mouse  gtctaatc---aaccaaggtaag----------gggaca--gtgc-t------------------g----
B D                     Rat  gtctaatc---aaccaaggtagg----------ggaaca--gggc-t------------------g----
B D          Naked mole-rat  gcc---tc---actcagggtaag----------gggaca--gggc-t------------------g----
B D              Guinea pig  acc---tc---actcaaggtaag----------gggaca--aagc-t------------------g----
                 Chinchilla  gcc---tc---actcaaggtgagggggcgcgctggggcg--gggg-t------------------g----
           Brush-tailed rat  gtc---tc---actcaaggtaag----------ggggca--gtgc-t------------------g----
B D                  Rabbit  gct---cc---agcctgggtgag----------gggaaa--tgct-------------------------
B D                    Pika  gtc---tc---agccaaggtaag----------gggaag--tgtcct------------------g----
B D                     Pig  gca---ac---agccacggtaag----------gt--------gc-t------------------g----
B D                  Alpaca  gca---at---aaccagggtaag----------gt--------gc-t------------------a----
             Bactrian camel  gca---ac---aaccagggtaag----------gt--------gc-t------------------a----
B D                 Dolphin  gca---ac---aaccatggtaag----------gt--------gc-t------------------g----
               Killer whale  gca---ac---aaccatggtaag----------gt--------gc-t------------------g----
           Tibetan antelope  gtg---ac---aaccgtggtaag----------gt--------ga-t-----------------------
B D                     Cow  gcg---ac---aaccgtggtaag----------gt--------ga-tggcgggggcgggggggggg----
B D                   Sheep  gtg---ac---aaccgtggtaag----------gt--------ga-t-----------------------
              Domestic goat  gtg---ac---aaccgtggtaag----------gt--------ga-t-----------------------
B D                   Horse  acc---ac---agccaaggtaag----------gt--------gc-t------------------g----
B D        White rhinoceros  gcc---ac---acccaaggtaag----------gt--------ac-t------------------g----
B D                     Cat  gcc---tc---aaccaaggtaag----------gt--------gc-t------------------g----
B D                     Dog  gcc---tc---aaccaaggtaag----------gt--------gc-t------------------g----
B D                 Ferret   gcc---tc---aagcaaggtaag----------gt--------gc-c------------------t----
B D                   Panda  cct---tc---aaccaaggtaag----------ct--------gt-t------------------g----
             Pacific walrus  gcc---tc---aaccaaggtaag----------gt--------gt-t------------------g----
               Weddell seal  gcc---tc---aaccaaggtaag----------gt--------gt-t------------------g----
           Black flying-fox  gct---tc---caccgaggtaag----------gt--------gc-t------------------g----
B D                 Megabat  gtt---tc---caccgaggtaag----------gt--------gc-t------------------g----
              Big brown bat  ------------accaaggtgag----------gt--------gc-t------------------a----
       David's myotis (bat)  ------------accaaggtaag----------at--------gc-t------------------a----
B D                Hedgehog  gcc---tc---agccaaggtaag----------gc--------ac-c------------------a----
B D                   Shrew  -----------agccaaggtaaa----------gg--------gc-c------------------g----
            Star-nosed mole  ccc---tcaccacccaaggtaag----------gt--------gc-t------------------g----
        Cape elephant shrew  gtc---tc---tcccaaggtaaa----------atgaca-ggggc-t------------------a----
B D                 Manatee  gcc---tc---aaccaaggtaag----------gtgaca-ggagc-t------------------g----
           Cape golden mole  gcc---tg---gaccaaggtaag----------gtaacagaagct-t------------------g----
B D                  Tenrec  gtc---tt---ggccaaggtgag----------gtgcca-aggga-t------------------g----
                   Aardvark  ggc---tc---aaccaaggtaag----------gtgaca-ggggc-t------------------g----
B D               Armadillo  gcc---tg---aaccaaggtaag----------gtgacc-tggtc-t------------------g----
B