Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1022 in window, 65819816 - 65819850, 35 bps 
B D                     Human  agcctgggcaacaagatgaaaccacggctctg---caa
B D                     Chimp  agcctgggcaacaaggtgaaaccacggctctg---caa
B D                   Gorilla  agcctgggcaacaaggtgaaaccacggctctg---caa
B D                 Orangutan  agcctgggcaacaaggtgaaaccacatctctg---caa
B D                    Gibbon  agcctgggcaacaaggtgaaaccacgtctctg---caa
B D       Crab-eating macaque  agcctgggcaacaaggtgaaaccacatctctg---caa
B D                    Baboon  agcctgggcaacaaggtgaaaccacatctctg---caa
B D              Green monkey  agcctgggcaacaaggtgaaaccacatctctg---caa
B D                  Marmoset  agcttgggcaataaagggagacaccatctctattttaa
B D           Squirrel monkey  agcttgggcaatataggaagacaccatctctattttaa
B D           Chinese hamster  ------------------aagctctagctatg---caa
             Star-nosed mole  ======================================
B D                      Pika  ======================================
         Cape elephant shrew  ======================================
B D                  Hedgehog  ======================================
B D                     Shrew  ======================================
B D                     Mouse  ======================================
                Prairie vole  ======================================
B D                       Rat  ======================================
              Golden hamster  ======================================
B D                    Rabbit  ======================================
            Black flying-fox  --------------------------------------
      Lesser Egyptian jerboa  ======================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ======================================
                  Chinchilla  ======================================
B D                Guinea pig  --------------------------------------
B D                       Pig  ======================================
B D                   Dolphin  --------------------------------------
                Weddell seal  ======================================
B D                   Megabat  --------------------------------------
                Killer whale  --------------------------------------
B D                     Panda  ======================================
               Big brown bat  --------------------------------------
B D                       Cow  ======================================
               Domestic goat  ======================================
B D                     Sheep  ======================================
            Tibetan antelope  ======================================
B D              Nile tilapia  ======================================
B D                  Microbat  --------------------------------------
        David's myotis (bat)  --------------------------------------
B D                 Armadillo  ======================================
B D                   Manatee  --------------------------------------
B D                  Elephant  ======================================
B D          White rhinoceros  ======================================
B D                     Horse  ======================================
              Bactrian camel  --------------------------------------
B D                    Alpaca  --------------------------------------
B D                  Squirrel  ======================================
          Chinese tree shrew  ======================================
B D            Naked mole-rat  --------------------------------------
B D                       Dog  ======================================
B D                   Ferret   ======================================
B D                       Cat  ======================================
              Pacific walrus  ======================================
                 Spotted gar  ======================================
          Southern platyfish  ======================================
B D                 Zebrafish  ======================================
B D               Stickleback  ======================================
      Yellowbelly pufferfish  ======================================
                 Zebra mbuna  ======================================
       Burton's mouthbreeder  ======================================
         Princess of Burundi  ======================================
B D                Coelacanth  ======================================
B D             X. tropicalis  ======================================
B D                    Lizard  ======================================
B D                    Turkey  ======================================
B D                   Chicken  ======================================
  D              Mallard duck  ======================================
B D                Budgerigar  ======================================
          Tibetan ground jay  ======================================
B D               Zebra finch  ======================================
B D       Medium ground finch  ======================================
  D    White-throated sparrow  ======================================
  D       Collared flycatcher  ======================================
  D              Saker falcon  ======================================
  D               Rock pigeon  ======================================
    Mexican tetra (cavefish)  ======================================
B D                      Fugu  ======================================
B D        American alligator  ======================================
B D                   Opossum  ======================================
B D           Tasmanian devil  ======================================
            Cape golden mole  ======================================
                    Aardvark  ======================================
B D                  Bushbaby  --------------------------------------
B D                    Rhesus  ======================================

Inserts between block 1 and 2 in window
B D          Chinese hamster 276bp

Alignment block 2 of 1022 in window, 65819851 - 65819857, 7 bps 
B D                     Human  aaaatac
B D                     Chimp  aaaatac
B D                   Gorilla  aaaatac
B D                 Orangutan  aaaatac
B D                    Gibbon  aaaatac
B D       Crab-eating macaque  aaaatac
B D                    Baboon  aaaatac
B D              Green monkey  aaaatac
B D                  Marmoset  aaag---
B D           Squirrel monkey  aaag---
             Star-nosed mole  =======
B D                      Pika  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                     Mouse  =======
                Prairie vole  =======
B D                       Rat  =======
B D           Chinese hamster  =======
              Golden hamster  =======
B D                    Rabbit  =======
            Black flying-fox  -------
      Lesser Egyptian jerboa  =======
B D                    Tenrec  NNNNNNN
            Brush-tailed rat  =======
                  Chinchilla  =======
B D                Guinea pig  -------
B D                       Pig  =======
B D                   Dolphin  -------
                Weddell seal  =======
B D                   Megabat  -------
                Killer whale  -------
B D                     Panda  =======
               Big brown bat  -------
B D                       Cow  =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
B D              Nile tilapia  =======
B D                  Microbat  -------
        David's myotis (bat)  -------
B D                 Armadillo  =======
B D                   Manatee  -------
B D                  Elephant  =======
B D          White rhinoceros  =======
B D                     Horse  =======
              Bactrian camel  -------
B D                    Alpaca  -------
B D                  Squirrel  =======
          Chinese tree shrew  =======
B D            Naked mole-rat  -------
B D                       Dog  =======
B D                   Ferret   =======
B D                       Cat  =======
              Pacific walrus  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
      Yellowbelly pufferfish  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                Coelacanth  =======
B D             X. tropicalis  =======
B D                    Lizard  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D       Collared flycatcher  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
    Mexican tetra (cavefish)  =======
B D                      Fugu  =======
B D        American alligator  =======
B D                   Opossum  =======
B D           Tasmanian devil  =======
            Cape golden mole  =======
                    Aardvark  =======
B D                  Bushbaby  -------
B D                    Rhesus  =======

Inserts between block 2 and 3 in window
B D      Crab-eating macaque 296bp

Alignment block 3 of 1022 in window, 65819858 - 65820013, 156 bps 
B D                     Human  aaaaatta-gccaggcactgtggcgtatgtctatag-tttcagctatttgggaggctgagg-tgggagga
B D                     Chimp  aaaaatta-gccaggcactgtggcgtatgtctgtag-tttcagctatttgggaggctgagg-tgggagga
B D                   Gorilla  aaaaatta-gccaggcactgtggcacatgtctgtag-tttcagctatttgggaggctaagg-tgggagga
B D                 Orangutan  aaaaatta-gccaggcactgtggcgcatgtttgtag-tttcagctatttgggaggctgaag-tgggagga
B D                    Gibbon  aaaaatta-gccaggcactgtggcgcatgtctgtag-tttcagctatttgggaggctgaggttgggagga
B D       Crab-eating macaque  aaaaatta-gccaggcactgtggcgcatgtctgtag-tctcagctatttgggaggctgagg-tgggagga
B D                    Baboon  aaaaatta-gccaggcactgtggcgcatgtctgtag-tgtcagctatttgggaggctgagg-tgggagga
B D              Green monkey  aaaaatta-gccaggcactgtggcacatgtctgtag-tctcagctatttgggaggctgagg-tgggagga
B D                  Marmoset  aaaaagga-gccgggcacggtggattatgcttgtaattcccagcattttgggaggccaagg-cgggcaga
B D           Squirrel monkey  aaaaaggaggccgggcgcagtggctcaaccctgtaa-tcccagcactttgggaagccgagg-cgggtgga
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                    Rabbit  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
                Killer whale  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D              Nile tilapia  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
          Chinese tree shrew  ======================================================================
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
B D                    Rhesus  ======================================================================

                        Human  ttgcttgagcccagcaggtggaagccgcagggaaccatgatcacaccaccgcattccagcctgagc-aac
                        Chimp  ttgcttgagcccagcaggtggaagccgcagggaaccatgatcacaccactgcattccagcctgggc-gac
                      Gorilla  ttgcttgagcccagcaggcggaagccgcagggaaccatgatcacaccactgcattccagcctgggt-gac
                    Orangutan  ttgcttgagcccaggaggtggaagccgcagggaaccatgatcacaccactgcattccagcctgggt-gac
                       Gibbon  ttgcttgagcccaggaggtggaagccgcagggaaccatgatcacaccactgcattccagcctgagc-gac
          Crab-eating macaque  ttgcttgagcccaggaggtggaagctgcagtgaaccatgatcacaccactgcactccagcctgggt-gac
                       Baboon  ttgcttgagcccaggaggtggaagccgcagtgaaccatgatcacaccactgcactccagcctgggt-gac
                 Green monkey  ttgcttgagcccaggaggtggaagccgcagtgaaccatgatcacaccactgcactccagcctgggc-aac
                     Marmoset  tcac--aaggtcaagaggtcgaga-------------------------------ctatcctggccaaac
              Squirrel monkey  tcac--aaggtcaagagatcgaga-------------------------------ccatcctggtc-aac
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                        Mouse  ======================================================================
                 Prairie vole  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                       Rabbit  ======================================================================
             Black flying-fox  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ----------------------------------------------------------------------
                          Pig  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
                 Weddell seal  ======================================================================
                      Megabat  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
                        Panda  ======================================================================
                Big brown bat  ----------------------------------------------------------------------
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Nile tilapia  ======================================================================
                     Microbat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                    Armadillo  ======================================================================
                      Manatee  ----------------------------------------------------------------------
                     Elephant  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
               Bactrian camel  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                         Fugu  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
                     Bushbaby  ----------------------------------------------------------------------
                       Rhesus  ======================================================================

                        Human  agagtgagatcctgtctcta
                        Chimp  agagtgagatcctgtctcta
                      Gorilla  agagtgagatcctgtctcta
                    Orangutan  agagtgagatcctgtcttaa
                       Gibbon  agagtgagatcctgtctcta
          Crab-eating macaque  agagtgagatcctgtctcta
                       Baboon  agagtgagatcctgtctcta
                 Green monkey  agagtgagatcctgtctcta
                     Marmoset  atggtgaaagcttgtctcta
              Squirrel monkey  atggtgaaaccccgtctcta
              Star-nosed mole  ====================
                         Pika  ====================
          Cape elephant shrew  ====================
                     Hedgehog  ====================
                        Shrew  ====================
                        Mouse  ====================
                 Prairie vole  ====================
                          Rat  ====================
              Chinese hamster  ====================
               Golden hamster  ====================
                       Rabbit  ====================
             Black flying-fox  --------------------
       Lesser Egyptian jerboa  ====================
                       Tenrec  NNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ====================
                   Chinchilla  ====================
                   Guinea pig  --------------------
                          Pig  ====================
                      Dolphin  --------------------
                 Weddell seal  ====================
                      Megabat  --------------------
                 Killer whale  --------------------
                        Panda  ====================
                Big brown bat  --------------------
                          Cow  ====================
                Domestic goat  ====================
                        Sheep  ====================
             Tibetan antelope  ====================
                 Nile tilapia  ====================
                     Microbat  --------------------
         David's myotis (bat)  --------------------
                    Armadillo  ====================
                      Manatee  --------------------
                     Elephant  ====================
             White rhinoceros  ====================
                        Horse  ====================
               Bactrian camel  --------------------
                       Alpaca  --------------------
                     Squirrel  ====================
           Chinese tree shrew  ====================
               Naked mole-rat  --------------------
                          Dog  ====================
                      Ferret   ====================
                          Cat  ====================
               Pacific walrus  ====================
                  Spotted gar  ====================
           Southern platyfish  ====================
                    Zebrafish  ====================
                  Stickleback  ====================
       Yellowbelly pufferfish  ====================
                  Zebra mbuna  ====================
        Burton's mouthbreeder  ====================
          Princess of Burundi  ====================
                   Coelacanth  ====================
                X. tropicalis  ====================
                       Lizard  ====================
                       Turkey  ====================
                      Chicken  ====================
                 Mallard duck  ====================
                   Budgerigar  ====================
           Tibetan ground jay  ====================
                  Zebra finch  ====================
          Medium ground finch  ====================
       White-throated sparrow  ====================
          Collared flycatcher  ====================
                 Saker falcon  ====================
                  Rock pigeon  ====================
     Mexican tetra (cavefish)  ====================
                         Fugu  ====================
           American alligator  ====================
                      Opossum  ====================
              Tasmanian devil  ====================
             Cape golden mole  ====================
                     Aardvark  ====================
                     Bushbaby  --------------------
                       Rhesus  ====================

Inserts between block 3 and 4 in window
B D                Orangutan 2bp
B D                   Baboon 327bp
B D          Squirrel monkey 348bp

Alignment block 4 of 1022 in window, 65820014 - 65820028, 15 bps 
B D                     Human  aataataataataat
B D                     Chimp  aataataataataat
B D                   Gorilla  aataataataataat
B D                 Orangutan  aataataatagtaat
B D                    Gibbon  aataataataataat
B D       Crab-eating macaque  aataataataataat
B D                    Baboon  aataataataataat
B D              Green monkey  aataataataataat
B D                  Marmoset  --------------c
             Star-nosed mole  ===============
B D                      Pika  ===============
         Cape elephant shrew  ===============
B D                  Hedgehog  ===============
B D                     Shrew  ===============
B D                     Mouse  ===============
                Prairie vole  ===============
B D                       Rat  ===============
B D           Chinese hamster  ===============
              Golden hamster  ===============
B D                    Rabbit  ===============
            Black flying-fox  ---------------
      Lesser Egyptian jerboa  ===============
B D                    Tenrec  NNNNNNNNNNNNNNN
            Brush-tailed rat  ===============
                  Chinchilla  ===============
B D                Guinea pig  ---------------
B D                       Pig  ===============
B D                   Dolphin  ---------------
                Weddell seal  ===============
B D                   Megabat  ---------------
                Killer whale  ---------------
B D           Squirrel monkey  ===============
B D                     Panda  ===============
               Big brown bat  ---------------
B D                       Cow  ===============
               Domestic goat  ===============
B D                     Sheep  ===============
            Tibetan antelope  ===============
B D              Nile tilapia  ===============
B D                  Microbat  ---------------
        David's myotis (bat)  ---------------
B D                 Armadillo  ===============
B D                   Manatee  ---------------
B D                  Elephant  ===============
B D          White rhinoceros  ===============
B D                     Horse  ===============
              Bactrian camel  ---------------
B D                    Alpaca  ---------------
B D                  Squirrel  ===============
          Chinese tree shrew  ===============
B D            Naked mole-rat  ---------------
B D                       Dog  ===============
B D                   Ferret   ===============
B D                       Cat  ===============
              Pacific walrus  ===============
                 Spotted gar  ===============
          Southern platyfish  ===============
B D                 Zebrafish  ===============
B D               Stickleback  ===============
      Yellowbelly pufferfish  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D                Coelacanth  ===============
B D             X. tropicalis  ===============
B D                    Lizard  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
B D       Medium ground finch  ===============
  D    White-throated sparrow  ===============
  D       Collared flycatcher  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ===============
    Mexican tetra (cavefish)  ===============
B D                      Fugu  ===============
B D        American alligator  ===============
B D                   Opossum  ===============
B D           Tasmanian devil  ===============
            Cape golden mole  ===============
                    Aardvark  ===============
B D                  Bushbaby  ---------------
B D                    Rhesus  ===============

Inserts between block 4 and 5 in window
B D             Green monkey 5bp

Alignment block 5 of 1022 in window, 65820029 - 65820036, 8 bps 
B D                     Human  taataaaa
B D                     Chimp  taataaaa
B D                   Gorilla  t-----aa
B D                 Orangutan  t-----aa
B D                    Gibbon  taataaaa
B D                    Rhesus  taataaaa
B D       Crab-eating macaque  taataaaa
B D                    Baboon  taataaaa
B D              Green monkey  aaataaaa
             Star-nosed mole  ========
B D                      Pika  ========
         Cape elephant shrew  ========
B D                  Hedgehog  ========
B D                     Shrew  ========
B D                     Mouse  ========
                Prairie vole  ========
B D                       Rat  ========
B D           Chinese hamster  ========
              Golden hamster  ========
B D                    Rabbit  ========
            Black flying-fox  --------
      Lesser Egyptian jerboa  ========
B D                    Tenrec  NNNNNNNN
            Brush-tailed rat  ========
                  Chinchilla  ========
B D                Guinea pig  --------
B D                       Pig  ========
B D                   Dolphin  --------
                Weddell seal  ========
B D                   Megabat  --------
                Killer whale  --------
B D                  Marmoset  --------
B D           Squirrel monkey  ========
B D                     Panda  ========
               Big brown bat  --------
B D                       Cow  ========
               Domestic goat  ========
B D                     Sheep  ========
            Tibetan antelope  ========
B D              Nile tilapia  ========
B D                  Microbat  --------
        David's myotis (bat)  --------
B D                 Armadillo  ========
B D                   Manatee  --------
B D                  Elephant  ========
B D          White rhinoceros  ========
B D                     Horse  ========
              Bactrian camel  --------
B D                    Alpaca  --------
B D                  Squirrel  ========
          Chinese tree shrew  ========
B D            Naked mole-rat  --------
B D                       Dog  ========
B D                   Ferret   ========
B D                       Cat  ========
              Pacific walrus  ========
                 Spotted gar  ========
          Southern platyfish  ========
B D                 Zebrafish  ========
B D               Stickleback  ========
      Yellowbelly pufferfish  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                Coelacanth  ========
B D             X. tropicalis  ========
B D                    Lizard  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
B D                Budgerigar  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
  D       Collared flycatcher  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
    Mexican tetra (cavefish)  ========
B D                      Fugu  ========
B D        American alligator  ========
B D                   Opossum  ========
B D           Tasmanian devil  ========
            Cape golden mole  ========
                    Aardvark  ========
B D                  Bushbaby  --------

Alignment block 6 of 1022 in window, 65820037 - 65820093, 57 bps 
B D                     Human  taaaataaaataaaaatgaaaggccaggcacagtggtgagtgcctataatcccagct
B D                     Chimp  taaaataaaataaaaatgaaaggccaggcacagtggtgagtgcctataatcccagct
B D                   Gorilla  taaaataaaataaaaatgaaaggccaggcacagtggtgagtgcctataatcccagct
B D                 Orangutan  taaaataaaataaaaatgaaaggccaggcacagtggtgagtgcctataatcccagct
B D                    Gibbon  taagataaaataaaaatgaaaggctaggcacagtggtgagtgcctataatcccagct
B D                    Rhesus  taaaataaaataaaaatgaaaggccgggcacagtggtgagtgcctataatcccagct
B D       Crab-eating macaque  taaaataaaataaaaatgaaaggccgggcacagtggtgagtgcctataatcccagct
B D                    Baboon  taaaataaaataaaaatgaaaggccaggcacagtggtgagtgcctataatcccagct
B D              Green monkey  taaaataaaataaaaatgaaaggccaggcacagtggtgagtgcctataatcccagct
B D                  Marmoset  taaa--aatacaaaaatta---gccaggcgtggtggtgggcacctgtaatctcagct
B D           Squirrel monkey  taaa--aatacaaaaatta---gccaggcgtggtggtgggcacctgtaatcccagct
             Star-nosed mole  =========================================================
B D                      Pika  =========================================================
         Cape elephant shrew  =========================================================
B D                  Hedgehog  =========================================================
B D                     Shrew  =========================================================
B D                     Mouse  =========================================================
                Prairie vole  =========================================================
B D                       Rat  =========================================================
B D           Chinese hamster  =========================================================
              Golden hamster  =========================================================
B D                    Rabbit  =========================================================
            Black flying-fox  ---------------------------------------------------------
      Lesser Egyptian jerboa  =========================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  =========================================================
                  Chinchilla  =========================================================
B D                Guinea pig  ---------------------------------------------------------
B D                       Pig  =========================================================
B D                   Dolphin  ---------------------------------------------------------
                Weddell seal  =========================================================
B D                   Megabat  ---------------------------------------------------------
                Killer whale  ---------------------------------------------------------
B D                     Panda  =========================================================
               Big brown bat  ---------------------------------------------------------
B D                       Cow  =========================================================
               Domestic goat  =========================================================
B D                     Sheep  =========================================================
            Tibetan antelope  =========================================================
B D              Nile tilapia  =========================================================
B D                  Microbat  ---------------------------------------------------------
        David's myotis (bat)  ---------------------------------------------------------
B D                 Armadillo  =========================================================
B D                   Manatee  ---------------------------------------------------------
B D                  Elephant  =========================================================
B D          White rhinoceros  =========================================================
B D                     Horse  =========================================================
              Bactrian camel  ---------------------------------------------------------
B D                    Alpaca  ---------------------------------------------------------
B D                  Squirrel  =========================================================
          Chinese tree shrew  =========================================================
B D            Naked mole-rat  ---------------------------------------------------------
B D                       Dog  =========================================================
B D                   Ferret   =========================================================
B D                       Cat  =========================================================
              Pacific walrus  =========================================================
                 Spotted gar  =========================================================
          Southern platyfish  =========================================================
B D                 Zebrafish  =========================================================
B D               Stickleback  =========================================================
      Yellowbelly pufferfish  =========================================================
                 Zebra mbuna  =========================================================
       Burton's mouthbreeder  =========================================================
         Princess of Burundi  =========================================================
B D                Coelacanth  =========================================================
B D             X. tropicalis  =========================================================
B D                    Lizard  =========================================================
B D                    Turkey  =========================================================
B D                   Chicken  =========================================================
  D              Mallard duck  =========================================================
B D                Budgerigar  =========================================================
          Tibetan ground jay  =========================================================
B D               Zebra finch  =========================================================
B D       Medium ground finch  =========================================================
  D    White-throated sparrow  =========================================================
  D       Collared flycatcher  =========================================================
  D              Saker falcon  =========================================================
  D               Rock pigeon  =========================================================
    Mexican tetra (cavefish)  =========================================================
B D                      Fugu  =========================================================
B D        American alligator  =========================================================
B D                   Opossum  =========================================================
B D           Tasmanian devil  =========================================================
            Cape golden mole  =========================================================
                    Aardvark  =========================================================
B D                  Bushbaby  ---------------------------------------------------------

Alignment block 7 of 1022 in window, 65820094 - 65820140, 47 bps 
B D                     Human  actcaggagactgaggttggaggatcacttgagcccaggtg-----------------------------
B D                     Chimp  actcaggagactgaggttggaggatcacttgagcccaagtg-----------------------------
B D                   Gorilla  actcaggagactgaggttggaggatcacttgagcccaggtg-----------------------------
B D                 Orangutan  actcaggagactgaggttggaggatcacttgagcccaggtg-----------------------------
B D                    Rhesus  actcaggagac--aggttggaggctcacttgagcccaggtg-----------------------------
B D       Crab-eating macaque  actcaggagac--aggttggaggctcacttgagcccaggtg-----------------------------
B D                    Baboon  actcaggagac--aggttggaggctcacttgagcccaggtg-----------------------------
B D              Green monkey  actcaggagac--aggttggaggctcacttgagcccaggtg-----------------------------
B D                  Marmoset  actcgggaggctgaggcagaagaattgcttgagcctgggaggcagaggttgcagtgagccgagatggtgc
B D           Squirrel monkey  actcgggaggctgaggcagaagaatcgcttgagcctgggaggcagaggctgcagtgagccgagatcgtac
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                    Rabbit  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
                Killer whale  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D              Nile tilapia  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
          Chinese tree shrew  ======================================================================
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --ttctaa
                        Chimp  --ttctaa
                      Gorilla  --ttctaa
                    Orangutan  --ttctaa
                       Rhesus  --ttctaa
          Crab-eating macaque  --ttctaa
                       Baboon  --ttctaa
                 Green monkey  --ttctga
                     Marmoset  cactgcac
              Squirrel monkey  cactgcac
              Star-nosed mole  ========
                         Pika  ========
          Cape elephant shrew  ========
                     Hedgehog  ========
                        Shrew  ========
                        Mouse  ========
                 Prairie vole  ========
                          Rat  ========
              Chinese hamster  ========
               Golden hamster  ========
                       Rabbit  ========
             Black flying-fox  --------
       Lesser Egyptian jerboa  ========
                       Tenrec  NNNNNNNN
             Brush-tailed rat  ========
                   Chinchilla  ========
                   Guinea pig  --------
                          Pig  ========
                      Dolphin  --------
                 Weddell seal  ========
                      Megabat  --------
                 Killer whale  --------
                        Panda  ========
                Big brown bat  --------
                          Cow  ========
                Domestic goat  ========
                        Sheep  ========
             Tibetan antelope  ========
                 Nile tilapia  ========
                     Microbat  --------
         David's myotis (bat)  --------
                    Armadillo  ========
                      Manatee  --------
                     Elephant  ========
             White rhinoceros  ========
                        Horse  ========
               Bactrian camel  --------
                       Alpaca  --------
                     Squirrel  ========
           Chinese tree shrew  ========
               Naked mole-rat  --------
                          Dog  ========
                      Ferret   ========
                          Cat  ========
               Pacific walrus  ========
                  Spotted gar  ========
           Southern platyfish  ========
                    Zebrafish  ========
                  Stickleback  ========
       Yellowbelly pufferfish  ========
                  Zebra mbuna  ========
        Burton's mouthbreeder  ========
          Princess of Burundi  ========
                   Coelacanth  ========
                X. tropicalis  ========
                       Lizard  ========
                       Turkey  ========
                      Chicken  ========
                 Mallard duck  ========
                   Budgerigar  ========
           Tibetan ground jay  ========
                  Zebra finch  ========
          Medium ground finch  ========
       White-throated sparrow  ========
          Collared flycatcher  ========
                 Saker falcon  ========
                  Rock pigeon  ========
     Mexican tetra (cavefish)  ========
                         Fugu  ========
           American alligator  ========
                      Opossum  ========
              Tasmanian devil  ========
             Cape golden mole  ========
                     Aardvark  ========
                     Bushbaby  --------
                       Gibbon  NNNNNNNN

Alignment block 8 of 1022 in window, 65820141 - 65820178, 38 bps 
B D                     Human  tccagcttgggcaatgta------gggagacaccat---ctc---tattt
B D                     Chimp  tccagcttgggcaatgta------gggagacaccat---ctc---tattt
B D                   Gorilla  tccagcttgggcaatgta------gggagacaccat---ctc---tattt
B D                 Orangutan  tccagcttgggcaatgta------gggagacaccat---ctc---tattt
B D                    Rhesus  tccagcttggggaatgta------g-------ccat---ctc---tattt
B D       Crab-eating macaque  tccagcttggggaatgta------g-------ccat---ctc---tattt
B D                    Baboon  tccagcttggggaatgta------g-------ccat---ctc---tattt
B D              Green monkey  tccagcgtggggaatgta------g-------ccat---ctc---tattt
B D                  Marmoset  tccagcctgggcgacaga------gtgagactccgc---ttcaaaaaagt
B D           Squirrel monkey  tccagcctgggcgacaaa------gtgagactccgt---ttcaaaaaagt
B D                       Rat  tcgaggttgagcactggacagcatgtgtgacgccatatgttc---agtct
             Star-nosed mole  ==================================================
B D                      Pika  ==================================================
         Cape elephant shrew  ==================================================
B D                  Hedgehog  ==================================================
B D                     Shrew  ==================================================
B D                     Mouse  ==================================================
                Prairie vole  ==================================================
B D           Chinese hamster  ==================================================
              Golden hamster  ==================================================
B D                    Rabbit  ==================================================
            Black flying-fox  --------------------------------------------------
      Lesser Egyptian jerboa  ==================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ==================================================
                  Chinchilla  ==================================================
B D                Guinea pig  --------------------------------------------------
B D                       Pig  ==================================================
B D                   Dolphin  --------------------------------------------------
                Weddell seal  ==================================================
B D                   Megabat  --------------------------------------------------
                Killer whale  --------------------------------------------------
B D                     Panda  ==================================================
               Big brown bat  --------------------------------------------------
B D                       Cow  ==================================================
               Domestic goat  ==================================================
B D                     Sheep  ==================================================
            Tibetan antelope  ==================================================
B D              Nile tilapia  ==================================================
B D                  Microbat  --------------------------------------------------
        David's myotis (bat)  --------------------------------------------------
B D                 Armadillo  ==================================================
B D                   Manatee  --------------------------------------------------
B D                  Elephant  ==================================================
B D          White rhinoceros  ==================================================
B D                     Horse  ==================================================
              Bactrian camel  --------------------------------------------------
B D                    Alpaca  --------------------------------------------------
B D                  Squirrel  ==================================================
          Chinese tree shrew  ==================================================
B D            Naked mole-rat  --------------------------------------------------
B D                       Dog  ==================================================
B D                   Ferret   ==================================================
B D                       Cat  ==================================================
              Pacific walrus  ==================================================
                 Spotted gar  ==================================================
          Southern platyfish  ==================================================
B D                 Zebrafish  ==================================================
B D               Stickleback  ==================================================
      Yellowbelly pufferfish  ==================================================
                 Zebra mbuna  ==================================================
       Burton's mouthbreeder  ==================================================
         Princess of Burundi  ==================================================
B D                Coelacanth  ==================================================
B D             X. tropicalis  ==================================================
B D                    Lizard  ==================================================
B D                    Turkey  ==================================================
B D                   Chicken  ==================================================
  D              Mallard duck  ==================================================
B D                Budgerigar  ==================================================
          Tibetan ground jay  ==================================================
B D               Zebra finch  ==================================================
B D       Medium ground finch  ==================================================
  D    White-throated sparrow  ==================================================
  D       Collared flycatcher  ==================================================
  D              Saker falcon  ==================================================
  D               Rock pigeon  ==================================================
    Mexican tetra (cavefish)  ==================================================
B D                      Fugu  ==================================================
B D        American alligator  ==================================================
B D                   Opossum  ==================================================
B D           Tasmanian devil  ==================================================
            Cape golden mole  ==================================================
                    Aardvark  ==================================================
B D                  Bushbaby  --------------------------------------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 9 of 1022 in window, 65820179 - 65820179, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  a
B D           Squirrel monkey  a
                 Prairie vole  t
B D                       Rat  c
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Rabbit  =
            Black flying-fox  -
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  -
B D                       Pig  =
B D                   Dolphin  -
                Weddell seal  =
B D                   Megabat  -
                Killer whale  -
B D                     Panda  =
               Big brown bat  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D              Nile tilapia  =
B D                  Microbat  -
        David's myotis (bat)  -
B D                 Armadillo  =
B D                   Manatee  -
B D                  Elephant  =
B D          White rhinoceros  =
B D                     Horse  =
              Bactrian camel  -
B D                    Alpaca  -
B D                  Squirrel  =
          Chinese tree shrew  =
B D            Naked mole-rat  -
B D                       Dog  =
B D                   Ferret   =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 10 of 1022 in window, 65820180 - 65820181, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Squirrel  aa
                 Prairie vole  aa
B D                       Rat  aa
B D                       Pig  aa
             Star-nosed mole  ==
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                     Mouse  ==
B D           Chinese hamster  ==
              Golden hamster  ==
B D                    Rabbit  ==
            Black flying-fox  --
      Lesser Egyptian jerboa  ==
B D                    Tenrec  NN
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                Guinea pig  --
B D                   Dolphin  --
                Weddell seal  ==
B D                   Megabat  --
                Killer whale  --
B D                     Panda  ==
               Big brown bat  --
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D              Nile tilapia  ==
B D                  Microbat  --
        David's myotis (bat)  --
B D                 Armadillo  ==
B D                   Manatee  --
B D                  Elephant  ==
B D          White rhinoceros  ==
B D                     Horse  ==
              Bactrian camel  --
B D                    Alpaca  --
          Chinese tree shrew  ==
B D            Naked mole-rat  --
B D                       Dog  ==
B D                   Ferret   ==
B D                       Cat  ==
              Pacific walrus  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==
                    Aardvark  ==
B D                  Bushbaby  --
B D                    Gibbon  NN

Alignment block 11 of 1022 in window, 65820182 - 65820183, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Squirrel  aa
                 Prairie vole  aa
B D                       Rat  ag
B D                       Pig  aa
B D                   Ferret   -a
             Star-nosed mole  ==
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                     Mouse  ==
B D           Chinese hamster  ==
              Golden hamster  ==
B D                    Rabbit  ==
            Black flying-fox  --
      Lesser Egyptian jerboa  ==
B D                    Tenrec  NN
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                Guinea pig  --
B D                   Dolphin  --
                Weddell seal  ==
B D                   Megabat  --
                Killer whale  --
B D                     Panda  ==
               Big brown bat  --
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D              Nile tilapia  ==
B D                  Microbat  --
        David's myotis (bat)  --
B D                 Armadillo  ==
B D                   Manatee  --
B D                  Elephant  ==
B D          White rhinoceros  ==
B D                     Horse  ==
              Bactrian camel  --
B D                    Alpaca  --
          Chinese tree shrew  ==
B D            Naked mole-rat  --
B D                       Dog  ==
B D                       Cat  ==
              Pacific walrus  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==
                    Aardvark  ==
B D                  Bushbaby  --
B D                    Gibbon  NN

Inserts between block 11 and 12 in window
                Prairie vole 4bp
B D                      Rat 9bp

Alignment block 12 of 1022 in window, 65820184 - 65820187, 4 bps 
B D                     Human  ag--a-a
B D                     Chimp  agaaa-a
B D                   Gorilla  agaaa-a
B D                 Orangutan  agaaa-a
B D                    Rhesus  agaaa-a
B D       Crab-eating macaque  agaaa-a
B D                    Baboon  agaaa-a
B D              Green monkey  agaaa-a
B D                  Marmoset  agaaata
B D           Squirrel monkey  agacata
B D                  Squirrel  tgaaa--
B D                       Pig  --aaa-a
B D                   Ferret   --aat-a
             Star-nosed mole  =======
B D                      Pika  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                     Mouse  =======
                Prairie vole  =======
B D                       Rat  =======
B D           Chinese hamster  =======
              Golden hamster  =======
B D                    Rabbit  =======
            Black flying-fox  -------
      Lesser Egyptian jerboa  =======
B D                    Tenrec  NNNNNNN
            Brush-tailed rat  =======
                  Chinchilla  =======
B D                Guinea pig  -------
B D                   Dolphin  -------
                Weddell seal  =======
B D                   Megabat  -------
                Killer whale  -------
B D                     Panda  =======
               Big brown bat  -------
B D                       Cow  =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
B D              Nile tilapia  =======
B D                  Microbat  -------
        David's myotis (bat)  -------
B D                 Armadillo  =======
B D                   Manatee  -------
B D                  Elephant  =======
B D          White rhinoceros  =======
B D                     Horse  =======
              Bactrian camel  -------
B D                    Alpaca  -------
          Chinese tree shrew  =======
B D            Naked mole-rat  -------
B D                       Dog  =======
B D                       Cat  =======
              Pacific walrus  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
      Yellowbelly pufferfish  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                Coelacanth  =======
B D             X. tropicalis  =======
B D                    Lizard  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D       Collared flycatcher  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
    Mexican tetra (cavefish)  =======
B D                      Fugu  =======
B D        American alligator  =======
B D                   Opossum  =======
B D           Tasmanian devil  =======
            Cape golden mole  =======
                    Aardvark  =======
B D                  Bushbaby  -------
B D                    Gibbon  NNNNNNN

Inserts between block 12 and 13 in window
B D                      Pig 1bp
B D                  Ferret  2bp

Alignment block 13 of 1022 in window, 65820188 - 65820188, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  c
B D           Squirrel monkey  a
B D                       Pig  a
B D                     Horse  a
B D                   Ferret   a
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Rabbit  =
            Black flying-fox  -
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  -
B D                   Dolphin  -
                Weddell seal  =
B D                   Megabat  -
                Killer whale  -
B D                     Panda  =
               Big brown bat  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D              Nile tilapia  =
B D                  Microbat  -
        David's myotis (bat)  -
B D                 Armadillo  =
B D                   Manatee  -
B D                  Elephant  =
B D          White rhinoceros  =
              Bactrian camel  -
B D                    Alpaca  -
B D                  Squirrel  -
          Chinese tree shrew  =
B D            Naked mole-rat  -
B D                       Dog  =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 14 of 1022 in window, 65820189 - 65820190, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  at
B D                  Squirrel  aa
                 Prairie vole  -c
B D           Chinese hamster  -a
               Golden hamster  -a
B D                       Rat  -a
             Brush-tailed rat  aa
B D                    Rabbit  ag
B D                       Pig  a-
B D                     Horse  a-
B D                   Ferret   a-
             Star-nosed mole  ==
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                     Mouse  ==
            Black flying-fox  --
      Lesser Egyptian jerboa  ==
B D                    Tenrec  NN
                  Chinchilla  ==
B D                Guinea pig  --
B D                   Dolphin  --
                Weddell seal  ==
B D                   Megabat  --
                Killer whale  --
B D                     Panda  ==
               Big brown bat  --
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D              Nile tilapia  ==
B D                  Microbat  --
        David's myotis (bat)  --
B D                 Armadillo  ==
B D                   Manatee  --
B D                  Elephant  ==
B D          White rhinoceros  ==
              Bactrian camel  --
B D                    Alpaca  --
          Chinese tree shrew  ==
B D            Naked mole-rat  --
B D                       Dog  ==
B D                       Cat  ==
              Pacific walrus  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==
                    Aardvark  ==
B D                  Bushbaby  --
B D                    Gibbon  NN

Inserts between block 14 and 15 in window
B D                  Ferret  1bp

Alignment block 15 of 1022 in window, 65820191 - 65820191, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Squirrel  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                       Rat  g
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
            Black flying-fox  -
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
                  Chinchilla  =
B D                Guinea pig  -
B D                   Dolphin  -
                Weddell seal  =
B D                   Megabat  -
                Killer whale  -
B D                     Panda  =
               Big brown bat  -
B D              Nile tilapia  =
B D                  Microbat  -
        David's myotis (bat)  -
B D                 Armadillo  =
B D                   Manatee  -
B D                  Elephant  =
B D          White rhinoceros  =
B D                     Horse  -
              Bactrian camel  -
B D                    Alpaca  -
          Chinese tree shrew  =
B D            Naked mole-rat  -
B D                       Dog  =
B D                   Ferret   =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 16 of 1022 in window, 65820192 - 65820193, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Squirrel  aa
                 Prairie vole  ga
B D           Chinese hamster  aa
               Golden hamster  aa
B D                       Rat  ag
             Brush-tailed rat  aa
B D                    Rabbit  aa
B D                       Pig  aa
             Tibetan antelope  aa
B D                       Cow  aa
B D                     Sheep  aa
                Domestic goat  aa
B D                     Horse  aa
B D                       Dog  aa
B D                   Ferret   aa
                     Aardvark  aa
             Star-nosed mole  ==
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                     Mouse  ==
            Black flying-fox  --
      Lesser Egyptian jerboa  ==
B D                    Tenrec  NN
                  Chinchilla  ==
B D                Guinea pig  --
B D                   Dolphin  --
                Weddell seal  ==
B D                   Megabat  --
                Killer whale  --
B D                     Panda  ==
               Big brown bat  --
B D              Nile tilapia  ==
B D                  Microbat  --
        David's myotis (bat)  --
B D                 Armadillo  ==
B D                   Manatee  --
B D                  Elephant  ==
B D          White rhinoceros  ==
              Bactrian camel  --
B D                    Alpaca  --
          Chinese tree shrew  ==
B D            Naked mole-rat  --
B D                       Cat  ==
              Pacific walrus  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
      Yellowbelly pufferfish  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
    Mexican tetra (cavefish)  ==
B D                      Fugu  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==
B D                  Bushbaby  --
B D                    Gibbon  NN

Inserts between block 16 and 17 in window
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                      Rat 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D                      Dog 1bp
B D                  Ferret  1bp

Alignment block 17 of 1022 in window, 65820194 - 65820194, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                       Rat  a
B D            Naked mole-rat  t
B D                Guinea pig  g
             Brush-tailed rat  t
B D                    Rabbit  g
B D                       Pig  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D                       Dog  a
B D                   Ferret   g
             Black flying-fox  g
B D                   Megabat  g
                     Aardvark  g
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
                  Chinchilla  =
                Weddell seal  =
B D                     Panda  =
               Big brown bat  -
B D              Nile tilapia  =
B D                  Microbat  -
        David's myotis (bat)  -
B D                 Armadillo  =
B D                   Manatee  -
B D                  Elephant  =
B D          White rhinoceros  =
              Bactrian camel  -
B D                    Alpaca  -
          Chinese tree shrew  =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
B D                  Bushbaby  -
B D                    Gibbon  N

Inserts between block 17 and 18 in window
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 18 of 1022 in window, 65820195 - 65820195, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Squirrel  a
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D                       Dog  t
B D                   Ferret   t
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
                     Aardvark  a
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
            Black flying-fox  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
                  Chinchilla  =
                Weddell seal  =
B D                   Megabat  =
B D                     Panda  =
B D              Nile tilapia  =
B D                 Armadillo  =
B D                   Manatee  -
B D                  Elephant  =
B D          White rhinoceros  =
              Bactrian camel  -
B D                    Alpaca  -
          Chinese tree shrew  =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
B D                  Bushbaby  -
B D                    Gibbon  N

Inserts between block 18 and 19 in window
B D                      Pig 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 19 of 1022 in window, 65820196 - 65820196, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Squirrel  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Dog  a
B D                   Ferret   a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
                     Aardvark  a
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
                  Chinchilla  =
                Weddell seal  =
B D                     Panda  =
B D              Nile tilapia  =
B D                 Armadillo  =
B D                   Manatee  -
B D                  Elephant  =
              Bactrian camel  -
          Chinese tree shrew  =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 20 of 1022 in window, 65820197 - 65820202, 6 bps 
B D                     Human  -aaggtg
B D                     Chimp  -aaggtg
B D                   Gorilla  -aaggtg
B D                 Orangutan  -aaagtg
B D                    Rhesus  -aaggta
B D       Crab-eating macaque  -aaggta
B D                    Baboon  -aaggtg
B D              Green monkey  -aatgtg
B D                  Marmoset  -aaggca
B D           Squirrel monkey  -aaggca
B D                  Squirrel  -agagca
                 Prairie vole  -agagca
B D           Chinese hamster  -agagca
               Golden hamster  -agagca
B D                       Rat  -ggagca
B D            Naked mole-rat  -aggcca
B D                Guinea pig  -agggca
             Brush-tailed rat  -agggca
B D                    Rabbit  -agggca
B D                       Pig  -aagtca
B D                    Alpaca  -aaggca
B D                   Dolphin  -aaggca
                 Killer whale  -aaggca
             Tibetan antelope  -agggca
B D                       Cow  -agggca
B D                     Sheep  -agggca
                Domestic goat  -agggca
B D                     Horse  -aagac-
B D          White rhinoceros  -aggac-
B D                       Dog  -agagc-
B D                   Ferret   -agagt-
             Black flying-fox  -agggc-
B D                   Megabat  -agggc-
                Big brown bat  -agggc-
         David's myotis (bat)  -agggt-
B D                  Microbat  -agggc-
B D                  Elephant  aaggga-
             Cape golden mole  gagggg-
                     Aardvark  -atgaa-
             Star-nosed mole  =======
B D                      Pika  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                     Mouse  =======
      Lesser Egyptian jerboa  =======
B D                    Tenrec  NNNNNNN
                  Chinchilla  =======
                Weddell seal  =======
B D                     Panda  =======
B D              Nile tilapia  =======
B D                 Armadillo  =======
B D                   Manatee  -------
              Bactrian camel  -------
          Chinese tree shrew  =======
B D                       Cat  =======
              Pacific walrus  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
      Yellowbelly pufferfish  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                Coelacanth  =======
B D             X. tropicalis  =======
B D                    Lizard  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D       Collared flycatcher  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
    Mexican tetra (cavefish)  =======
B D                      Fugu  =======
B D        American alligator  =======
B D                   Opossum  =======
B D           Tasmanian devil  =======
B D                  Bushbaby  -------
B D                    Gibbon  NNNNNNN

Alignment block 21 of 1022 in window, 65820203 - 65820203, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Squirrel  t
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                       Pig  a
B D                    Alpaca  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Elephant  g
             Cape golden mole  a
                     Aardvark  a
             Star-nosed mole  =
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  N
                  Chinchilla  =
                Weddell seal  =
B D              Nile tilapia  =
B D                 Armadillo  =
B D                   Manatee  -
              Bactrian camel  -
          Chinese tree shrew  =
B D                       Cat  =
              Pacific walrus  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 22 of 1022 in window, 65820204 - 65820206, 3 bps 
B D                     Human  gg--a
B D                     Chimp  gg--a
B D                   Gorilla  gg--a
B D                 Orangutan  gg--a
B D                    Rhesus  gg--a
B D       Crab-eating macaque  gg--a
B D                    Baboon  gg--a
B D              Green monkey  gg--a
B D                  Marmoset  gg--a
B D           Squirrel monkey  gg--a
B D                  Squirrel  gg--a
                 Prairie vole  gg--c
B D           Chinese hamster  gg--t
               Golden hamster  gg--t
B D                       Rat  gc--c
B D            Naked mole-rat  gg--g
B D                Guinea pig  aa--c
             Brush-tailed rat  ga--c
B D                    Rabbit  gg--t
B D                       Pig  ag---
B D                    Alpaca  tg---
B D                   Dolphin  gg---
                 Killer whale  gg---
             Tibetan antelope  gg---
B D                       Cow  gg---
B D                     Sheep  gg---
                Domestic goat  gg---
B D                     Horse  ga---
B D          White rhinoceros  ga---
B D                       Cat  gg---
B D                       Dog  gg---
B D                   Ferret   gg---
B D                     Panda  gg---
               Pacific walrus  gg---
             Black flying-fox  gg---
B D                   Megabat  gg---
                Big brown bat  gg---
         David's myotis (bat)  gg---
B D                  Microbat  gg---
B D                  Elephant  gg---
             Cape golden mole  gg---
                     Aardvark  gggc-
             Star-nosed mole  =====
B D                      Pika  =====
         Cape elephant shrew  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  NNNNN
                  Chinchilla  =====
                Weddell seal  =====
B D              Nile tilapia  =====
B D                 Armadillo  =====
B D                   Manatee  -----
              Bactrian camel  -----
          Chinese tree shrew  =====
                 Spotted gar  =====
          Southern platyfish  =====
B D                 Zebrafish  =====
B D               Stickleback  =====
      Yellowbelly pufferfish  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                Coelacanth  =====
B D             X. tropicalis  =====
B D                    Lizard  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
  D       Collared flycatcher  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
    Mexican tetra (cavefish)  =====
B D                      Fugu  =====
B D        American alligator  =====
B D                   Opossum  =====
B D           Tasmanian devil  =====
B D                  Bushbaby  -----
B D                    Gibbon  NNNNN

Inserts between block 22 and 23 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
                    Aardvark 2bp

Alignment block 23 of 1022 in window, 65820207 - 65820209, 3 bps 
B D                     Human  tga
B D                     Chimp  tga
B D                   Gorilla  tga
B D                 Orangutan  tga
B D                    Rhesus  tga
B D       Crab-eating macaque  tga
B D                    Baboon  tga
B D              Green monkey  tga
B D                  Marmoset  tga
B D           Squirrel monkey  tga
B D                  Squirrel  tga
                 Prairie vole  ttt
B D           Chinese hamster  ttg
               Golden hamster  ttg
B D                       Rat  ttt
B D            Naked mole-rat  tga
B D                Guinea pig  tga
             Brush-tailed rat  tga
B D                    Rabbit  ga-
B D                       Pig  taa
B D                    Alpaca  tga
               Bactrian camel  tga
B D                   Dolphin  tga
                 Killer whale  tga
             Tibetan antelope  tga
B D                       Cow  tga
B D                     Sheep  tga
                Domestic goat  tga
B D                     Horse  tga
B D          White rhinoceros  tga
B D                       Cat  tga
B D                       Dog  tca
B D                   Ferret   tga
B D                     Panda  tga
               Pacific walrus  tgg
             Black flying-fox  cga
B D                   Megabat  cga
                Big brown bat  cga
         David's myotis (bat)  tga
B D                  Microbat  tga
B D                  Elephant  tga
B D                   Manatee  tga
             Cape golden mole  gga
                     Aardvark  gcg
             Star-nosed mole  ===
B D                      Pika  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  NNN
                  Chinchilla  ===
                Weddell seal  ===
B D              Nile tilapia  ===
B D                 Armadillo  ===
          Chinese tree shrew  ===
                 Spotted gar  ===
          Southern platyfish  ===
B D                 Zebrafish  ===
B D               Stickleback  ===
      Yellowbelly pufferfish  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                Coelacanth  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
    Mexican tetra (cavefish)  ===
B D                      Fugu  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
B D                  Bushbaby  ---
B D                    Gibbon  NNN

Inserts between block 23 and 24 in window
B D                 Squirrel 23bp
                Prairie vole 17bp
B D          Chinese hamster 17bp
              Golden hamster 15bp
B D                      Rat 17bp

Alignment block 24 of 1022 in window, 65820210 - 65820234, 25 bps 
B D                     Human  tgaaaaaggtttttaaata-----g--aaagc
B D                     Chimp  tgaaaaaggtttttaaata-----g--aaagc
B D                   Gorilla  tgaaaaaggtttttaaata-----g--aaaga
B D                 Orangutan  tgaaaaaggtttttaaata-----g--aaaga
B D                    Rhesus  tgaaaaaggtttttaaata-----g--aaaga
B D       Crab-eating macaque  tgaaaaaggtttttaaata-----g--aaaga
B D                    Baboon  tgaaaaaggtttttaaata-----g--aaaga
B D              Green monkey  tgaaaaaggtttttaaata-----g--aaaga
B D                  Marmoset  tgaaaaagg-gtttaaata-----g--aaaga
B D           Squirrel monkey  tggaaaaggtttttaaata-----g--aaaga
       Lesser Egyptian jerboa  tgaaacaagttttgaaact-------------
                 Prairie vole  taaagcatgttttgaaacc-------------
B D           Chinese hamster  tgaaacacattttgaaacc-------------
               Golden hamster  ----------tttgaaacc-------------
B D                       Rat  tgaaacatattttg-aacc-------------
B D            Naked mole-rat  -tgaaaaagctttgaaact-------------
B D                Guinea pig  -tgaaaaagttttaaaact-------------
             Brush-tailed rat  -tggaaaagttctgaaact-------------
B D                    Rabbit  -tggaggagctttgaagccggaga--------
B D                       Pig  -taaaaaagttttgaaact-----a--aacag
B D                    Alpaca  -cgacaaagttttgagact-----a--aacag
               Bactrian camel  -cgacaaagttttgagact-----a--aacag
B D                   Dolphin  -tgacaaaattttggaact-----a--aagag
                 Killer whale  -tgacaaaattttggaact-----a--aagag
             Tibetan antelope  -tgaaaagatttcggaact-----a--aatag
B D                       Cow  -tgaaaaaatttcagaact-----a--aatag
B D                     Sheep  -tggaaaaatttcggaact-----a--aatag
                Domestic goat  -tgaaaaaatttcggaact-----a--aatag
B D                     Horse  -tgaaaaagttttggaact-----c--gaaag
B D          White rhinoceros  -tgaaaaagtttagaaact-----a--ga---
B D                       Cat  -tgaaaaagtct-gaaagt-----a--gtcag
B D                       Dog  -tgaaaaagttt-gaaact-----a--gatag
B D                   Ferret   -tgaaaaagcta-gaagcc-----a-------
B D                     Panda  -tgaaaaagttt-gaaact-----a--gacca
               Pacific walrus  -tgaagaagttt-gaaacc-----a--gaccg
             Black flying-fox  -tg-aaagtttt-gaaact-----a--gagag
B D                   Megabat  -tg-aaagtttt-gaaact-----a--gagag
                Big brown bat  -tgaaaagattg-gaaact-----a--gacag
         David's myotis (bat)  -tgaaaagattg-gaaact-----a--gacag
B D                  Microbat  -tgaaaagtttg-gaaact-----a--gacag
B D                  Elephant  -tggaagtgttttgaagct-----g--gaga-
B D                   Manatee  -tggaaacgttttgaaact-----ggagaga-
             Cape golden mole  -tggaaatgttctgaaacc-----a--gaga-
                     Aardvark  -tagcagcgttctgacact-----g--gaga-
             Star-nosed mole  ================================
B D                      Pika  ================================
         Cape elephant shrew  ================================
B D                  Hedgehog  ================================
B D                     Shrew  ================================
B D                     Mouse  ================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Chinchilla  ================================
                Weddell seal  ================================
B D              Nile tilapia  ================================
B D                 Armadillo  ================================
B D                  Squirrel  ================================
          Chinese tree shrew  ================================
                 Spotted gar  ================================
          Southern platyfish  ================================
B D                 Zebrafish  ================================
B D               Stickleback  ================================
      Yellowbelly pufferfish  ================================
                 Zebra mbuna  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D                Coelacanth  ================================
B D             X. tropicalis  ================================
B D                    Lizard  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
B D                Budgerigar  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
B D       Medium ground finch  ================================
  D    White-throated sparrow  ================================
  D       Collared flycatcher  ================================
  D              Saker falcon  ================================
  D               Rock pigeon  ================================
    Mexican tetra (cavefish)  ================================
B D                      Fugu  ================================
B D        American alligator  ================================
B D                   Opossum  ================================
B D           Tasmanian devil  ================================
B D                  Bushbaby  --------------------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
      Lesser Egyptian jerboa 5bp
                Prairie vole 5bp
B D          Chinese hamster 5bp
              Golden hamster 5bp
B D                      Rat 5bp
B D           Naked mole-rat 3bp
B D               Guinea pig 3bp
            Brush-tailed rat 3bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                    Panda 1bp
              Pacific walrus 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 25 of 1022 in window, 65820235 - 65820285, 51 bps 
B D                     Human  gg-t------------ggtggttgcacaa---cattg---------t-gaatgcaccaaatgccac-tg-
B D                     Chimp  gg-t------------ggtggttgcacaa---cattg---------t-gaatgcaccaaatgccac-tg-
B D                   Gorilla  gg-t------------ggtggttgcacaa---cattg---------t-gaatgcaccaaatgccac-tg-
B D                 Orangutan  gg-t------------ggtggttgcacaa---cattg---------t-gaatgcaccaaatgccac-tg-
B D                    Rhesus  cg-t------------ggtggttgcacaa---cattg---------t-gaatgcatcaaatgccac-tg-
B D       Crab-eating macaque  cg-t------------ggtggttgcacaa---cattg---------t-gaatgcatcaaatgccac-tg-
B D                    Baboon  cg-t------------ggtggttgcacaa---cattg---------t-gaatgcatcaaatgccac-tg-
B D              Green monkey  cg-t------------ggtggctgtacaa---cattg---------t-gaatgcatcagatgccac-tg-
B D                  Marmoset  gg-t------------ggtggttgca------------------------------caaatgccac-tg-
B D           Squirrel monkey  ggtt------------ggtggttgcacaa---cactg---------tggaatgcaccaaatgccac-tg-
B D                  Squirrel  -g-t------------ggtggctgggcaa---catta---------t-gaat---------gccac-t--
       Lesser Egyptian jerboa  ga-t------------gatgctttcacat---tat-------------gaatccataaaatgccac-tg-
                 Prairie vole  gg-a------------gctgatttcacta---catgg---------a-gaatgcactgaatgccac-ttg
B D           Chinese hamster  gg-t------------gctggtttcacaa---catag---------g-gaatgtactaaatgccac-tc-
               Golden hamster  gg-t------------gctggtttcacaa---catag---------t-gaatgtactaaatgccac-tc-
B D                     Mouse  gg-t------------gctggtttcacaa---catag---------c-aaatgcagtaaacgccac-ta-
B D                       Rat  gg-t------------gctagtttcacaa---cacag---------c-aaatgcactaactgccac-ga-
B D            Naked mole-rat  gg-t------------agtgctagtacaa---cattg---------t-gaatgcacaaaatgctac-tg-
B D                Guinea pig  gg-t------------ggtgcttgcacga---cactg---------c-gaatgcacagaatgccac-ca-
             Brush-tailed rat  ga-ttctgaaactagatgtgcttgcacaa---tactg---------c-gaatgcacaaaatgccac-tg-
B D                    Rabbit  ag-t------------ggcagtt--------------------------------------gctac----
B D                       Pig  gg-t------------aggggttgcacca---cagca---------t-gaatgcactaaaggctac-tg-
B D                    Alpaca  gg-t------------agtgattgcacaa---cagtg---------t-gaatgtatgaaatgccac-tg-
               Bactrian camel  gg-t------------agtgattgcacaa---cagtg---------t-gaatgtacgaaatgccac-tg-
B D                   Dolphin  gg-t------------agtcgttgcacaa---cagtg---------t-gaaggcactaaacgtcac-tg-
                 Killer whale  gg-t------------agtcgttgcacaa---cagtg---------t-gaaggcactaaacgtcac-tg-
             Tibetan antelope  gg-t------------aatcgttgcacaa---tcacg---------t-gaagacactaaatttcac-tg-
B D                       Cow  gg-t------------aatggttgcacaa---tcacg---------t-gaagacactaaatttcac-tg-
B D                     Sheep  gg-t------------aatcgttgcacaa---tcacg---------t-gaagacactaaatttcac-tg-
                Domestic goat  gg-t------------aatcgttgcataa---tcaca---------t-gaagacactaaatttcac-tg-
B D                     Horse  gg-t------------catggttacaaga---cagtg---------t-gaatgcgctaaatgccac-tg-
B D          White rhinoceros  -----------------gtggt-----------agtg---------t-gaatg----------cac-tg-
B D                       Cat  ga-t------------ggtgggtgcacg----cagaa---------c-gaacggactaaatgccac-tg-
B D                       Dog  gg-t------------ggtagttgcacaa---gagtg---------t-gaatgtactaaatatcac-tg-
B D                   Ferret   ----------------ggtagttgctcaa---cagca---------t-gaactcaccagatgccgc-tg-
B D                     Panda  gg-t------------ggtagttacacga---gagtg---------t-gagcgcgctagatgtcag-gg-
               Pacific walrus  gg-c------------ggcagttgcgtaa---gagtg---------t-gagcgcacgagacggccgctg-
             Black flying-fox  ga-a------------tg----cacacaa---cagtg---------t-gaatgcactcagtgtcac-tg-
B D                   Megabat  ga-a------------tg----cacacaa---cagtg---------t-gaatgcactcagtgtcac-tg-
                Big brown bat  gg-t------------ggtggttgcacaa---cagtg---------t-gaatgcactaaatgccac-tg-
         David's myotis (bat)  gg-t------------ggtggttacacaa---cagtg---------t-gaatgcactaaatgccac-tg-
B D                  Microbat  gg-t------------ggtggttgcacaa---cagtg---------t-gaatgcactaaatgccac-tg-
B D                  Elephant  gg-t------------ggtggtcgcacaa---catcg---------t-gaacacactaaatgccac-tg-
B D                   Manatee  gg-t------------ggtggttgtacaa---catcg---------t-gaacacactcagtgccac-cg-
             Cape golden mole  gg-t------------ggtggttgtaccatgtcacca---------c-aaatgcacttagtgcccc-tg-
                     Aardvark  gg-t------------ggtggccgcacac---catcgagaatgagct-aaatgaactaaatgtcac-tg-
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Chinchilla  ======================================================================
                Weddell seal  ======================================================================
B D              Nile tilapia  ======================================================================
B D                 Armadillo  ======================================================================
          Chinese tree shrew  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  aa-t---------tgtagg
                        Chimp  aa-t---------tgtatg
                      Gorilla  aa-t---------tgtatg
                    Orangutan  aa-t---------tgtgtg
                       Rhesus  aa-t---------ggtacg
          Crab-eating macaque  aa-t---------ggtacg
                       Baboon  aa-t---------ggtacg
                 Green monkey  aa-t---------ggtatg
                     Marmoset  ca-t---------tgtacc
              Squirrel monkey  aa-t---------tgtacg
                     Squirrel  ga-t---------tgtaac
       Lesser Egyptian jerboa  aa-t---------tgtaac
                 Prairie vole  ga-c---------tgtaac
              Chinese hamster  aa-c---------tgtaac
               Golden hamster  aa-c---------tgtaac
                        Mouse  ga-c---------tgcaac
                          Rat  ga-c---------tgtagc
               Naked mole-rat  aa-t---------tataac
                   Guinea pig  aa-a---------tatgac
             Brush-tailed rat  aa-a---------tgcaac
                       Rabbit  -------------------
                          Pig  ga-c---------tgtatg
                       Alpaca  ga-t---------cctaca
               Bactrian camel  ga-t---------cgtaca
                      Dolphin  ga-t---------cataca
                 Killer whale  ga-t---------cataca
             Tibetan antelope  ga-t---------cataca
                          Cow  ga-t---------cataca
                        Sheep  ga-t---------cataca
                Domestic goat  ga-t---------cataca
                        Horse  aa-t---------tgtaca
             White rhinoceros  aa-t---------tgtaca
                          Cat  ga-g---------tacacg
                          Dog  ga-t---------tgtaca
                      Ferret   ga-c---------tgtaca
                        Panda  ga-t---------cgtaca
               Pacific walrus  ga-g---------tacaca
             Black flying-fox  ga-t---------tttata
                      Megabat  gatt---------tttata
                Big brown bat  ga-t---------tgtaca
         David's myotis (bat)  gg-t---------tgtaca
                     Microbat  ga-t---------tgtaca
                     Elephant  ag-tccacagaatggttca
                      Manatee  aa-tccactgaacggttca
             Cape golden mole  ac-t---------gcttca
                     Aardvark  aa-t---------tggtca
              Star-nosed mole  ===================
                         Pika  ===================
          Cape elephant shrew  ===================
                     Hedgehog  ===================
                        Shrew  ===================
                       Tenrec  NNNNNNNNNNNNNNNNNNN
                   Chinchilla  ===================
                 Weddell seal  ===================
                 Nile tilapia  ===================
                    Armadillo  ===================
           Chinese tree shrew  ===================
                  Spotted gar  ===================
           Southern platyfish  ===================
                    Zebrafish  ===================
                  Stickleback  ===================
       Yellowbelly pufferfish  ===================
                  Zebra mbuna  ===================
        Burton's mouthbreeder  ===================
          Princess of Burundi  ===================
                   Coelacanth  ===================
                X. tropicalis  ===================
                       Lizard  ===================
                       Turkey  ===================
                      Chicken  ===================
                 Mallard duck  ===================
                   Budgerigar  ===================
           Tibetan ground jay  ===================
                  Zebra finch  ===================
          Medium ground finch  ===================
       White-throated sparrow  ===================
          Collared flycatcher  ===================
                 Saker falcon  ===================
                  Rock pigeon  ===================
     Mexican tetra (cavefish)  ===================
                         Fugu  ===================
           American alligator  ===================
                      Opossum  ===================
              Tasmanian devil  ===================
                     Bushbaby  -------------------
                       Gibbon  NNNNNNNNNNNNNNNNNNN

Alignment block 26 of 1022 in window, 65820286 - 65820286, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  t
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  -
                Prairie vole  -
B D                       Rat  -
B D           Chinese hamster  -
              Golden hamster  -
B D                    Rabbit  -
      Lesser Egyptian jerboa  -
B D                    Tenrec  N
            Brush-tailed rat  -
                  Chinchilla  =
B D                Guinea pig  -
                Weddell seal  =
B D              Nile tilapia  =
B D                 Armadillo  =
B D                  Squirrel  -
          Chinese tree shrew  =
B D            Naked mole-rat  -
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 27 of 1022 in window, 65820287 - 65820305, 19 bps 
B D                     Human  tat--aaaatgattaattata
B D                     Chimp  tat--agaatgattaattata
B D                   Gorilla  tat--aaaatgattaattata
B D                 Orangutan  tat--aaaatgattaattata
B D                    Rhesus  tat--aaaatgattaattata
B D       Crab-eating macaque  tat--aaaatgattaattata
B D                    Baboon  tat--aaaatgattaattata
B D              Green monkey  taa--aaaatgattaattata
B D                  Marmoset  ttt--aaaatgattcattata
B D           Squirrel monkey  ttt--aaaatgattaattata
B D                  Squirrel  atataacaatg-ttaac----
       Lesser Egyptian jerboa  ttt--aaaatggctaattata
                 Prairie vole  ttt-aaaaatgactaattaca
B D           Chinese hamster  ttt--aaaatggttaattata
               Golden hamster  ttt-aaaaatggttaattata
B D                     Mouse  ttt--acaat--ctaattata
B D                       Rat  ttt--aaaacg-ctaattata
B D            Naked mole-rat  ttt--caaatggttaattata
B D                Guinea pig  ctt--agggtggtgaatcata
                   Chinchilla  tat--aaagtggttaatcata
             Brush-tailed rat  ttt--aaagtggttaatcata
B D                    Rabbit  tct--gagatggc-gatcata
B D                       Pig  ttt---aaatggttaattata
B D                    Alpaca  ttt--caaacggttaattata
               Bactrian camel  ttt--caaatggttaattata
B D                   Dolphin  ttt--aaaatggttaattaca
                 Killer whale  ttt--aaaatggttaattata
             Tibetan antelope  ttt--aaaatggttaattata
B D                       Cow  ttt--aaaatggttaattata
B D                     Sheep  ttt--aaaatggttaattata
                Domestic goat  ttt--aaaatggttaattata
B D                     Horse  ttt--aaaatggttaattgga
B D          White rhinoceros  ttt--aaaatggttaattgta
B D                       Cat  ttt--atgagggataattaca
B D                       Dog  ttt--aaaatggataattata
B D                   Ferret   ttt--caaacagataattgta
B D                     Panda  ttt--aatgtggataattata
               Pacific walrus  ttc--acaacgggtgactgtg
             Black flying-fox  ttt--aaaa---ttcatcaca
B D                   Megabat  ttt--aaaa---ttcatcaca
                Big brown bat  ttt--aaagtggttaattata
         David's myotis (bat)  ttt--aaaatggttaattata
B D                  Microbat  ttt--aaaatggttaattata
              Star-nosed mole  tgt--aaaatggccgatgacg
B D                  Elephant  ttt--aaaatagctaattgta
B D                   Manatee  ttt--aaaatggctaattgta
             Cape golden mole  -tg--gagatggctaacgaca
                     Aardvark  ttt--aaaatggctaattgta
B D                      Pika  =====================
         Cape elephant shrew  =====================
B D                  Hedgehog  =====================
B D                     Shrew  =====================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNN
                Weddell seal  =====================
B D              Nile tilapia  =====================
B D                 Armadillo  =====================
          Chinese tree shrew  =====================
                 Spotted gar  =====================
          Southern platyfish  =====================
B D                 Zebrafish  =====================
B D               Stickleback  =====================
      Yellowbelly pufferfish  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D                Coelacanth  =====================
B D             X. tropicalis  =====================
B D                    Lizard  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
B D                Budgerigar  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D       Collared flycatcher  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  =====================
    Mexican tetra (cavefish)  =====================
B D                      Fugu  =====================
B D        American alligator  =====================
B D                   Opossum  =====================
B D           Tasmanian devil  =====================
B D                  Bushbaby  ---------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNN

Alignment block 28 of 1022 in window, 65820306 - 65820306, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  c
B D                       Pig  t
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  t
B D                       Cow  c
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
              Star-nosed mole  t
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  c
                     Aardvark  g
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  -
B D                    Tenrec  N
B D              Nile tilapia  =
B D                 Armadillo  =
B D                  Squirrel  -
          Chinese tree shrew  =
                 Spotted gar  =
          Southern platyfish  =
B D                 Zebrafish  =
B D               Stickleback  =
      Yellowbelly pufferfish  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D              Saker falcon  =
  D               Rock pigeon  =
    Mexican tetra (cavefish)  =
B D                      Fugu  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
B D                  Bushbaby  -
B D                    Gibbon  N

Alignment block 29 of 1022 in window, 65820307 - 65820329, 23 bps 
B D                     Human  gttatatgcatttcacctcaat---a
B D                     Chimp  gttatatgcatttcacctcaat----
B D                   Gorilla  gttatatgcatttcacctcaat---a
B D                 Orangutan  gttatatgcatttcacctcaat----
B D                    Rhesus  gttatatgcatttcacctcaat---a
B D       Crab-eating macaque  gttatatgcatttcacctcaat---a
B D                    Baboon  gttatatgcatttcacctcaat---a
B D              Green monkey  gttatatgcatttcacctcaat----
B D                  Marmoset  gttatatagatttcgcctcaat---c
B D           Squirrel monkey  gttacatgcatttcacctcaat---a
B D                  Squirrel  gttaggtgaaattcaccttgat---a
       Lesser Egyptian jerboa  ggtatgtgaatttcacctcaac---a
                 Prairie vole  gttatgtgaatcccatctcaat---a
B D           Chinese hamster  gttatgtgaattccacctcaat---a
               Golden hamster  gttatgtgaattccacctcaat---a
B D                     Mouse  gttatatgaatcccaactcaat---a
B D                       Rat  gttacatgaactccacatcaat---a
B D            Naked mole-rat  gctatgtgaatttcacctcaat---a
B D                Guinea pig  gctacgtgaatttcgcctcaat---a
                   Chinchilla  gctatgtgaattttgcctcaat---a
             Brush-tailed rat  gccatgtgaattttgcctcaat---a
B D                    Rabbit  ggcatgtgaatttcaccccgac---a
B D                       Pig  gttgtgtgaatttcatctcaat---a
B D                    Alpaca  gttatgtgaatttcaccttaat---a
               Bactrian camel  gttatgtgaatttcaccttaat---a
B D                   Dolphin  gttatatgaatttcacctcaat----
                 Killer whale  gttatatgcatttcacctcaat----
             Tibetan antelope  gttatgtggatttcacctcaat---a
B D                       Cow  gttatgtggatttcacctcaat---a
B D                     Sheep  gttatgtggatttcacctcaat---a
                Domestic goat  gttatgtggatttcacctcaat---a
B D                     Horse  gtcatgtgattttcatctcaat---a
B D          White rhinoceros  gttatgtagttttcacctcaat---a
B D                       Cat  gttaggtgaatgtcaccacgat---a
B D                       Dog  gttatataaatttcatcacaat---a
B D                   Ferret   gttatgtgaatttcaccacaat---a
B D                     Panda  gttatgtgaatttcaccacaat---a
               Pacific walrus  gctatgtgcacatcaccacagt---a
                 Weddell seal  gttatgtgaatttcaccacagt---a
             Black flying-fox  attatgtgaatttccccttaat---t
B D                   Megabat  attatgtgaatttccccttaat---t
                Big brown bat  gttttgtgaattttacctcgat---c
         David's myotis (bat)  gttttgtgaatttcacctcgat---c
B D                  Microbat  gttttgtgaatttcacctcgat---c
              Star-nosed mole  gctacgtgaattccaccctgac---a
B D                  Elephant  gctgtgtgaatttcccctcaataaaa
B D                   Manatee  gctatgtgaatttccccttaat---t
             Cape golden mole  --aatgtggatttcctttctat---t
B D                    Tenrec  gctgtgtggacttcccctcaat---t
                     Aardvark  gctatgtgtatttctcctcaat----
B D                      Pika  ==========================
         Cape elephant shrew  ==========================
B D                  Hedgehog  ==========================
B D                     Shrew  ==========================
B D              Nile tilapia  ==========================
B D                 Armadillo  ==========================
          Chinese tree shrew  ==========================
                 Spotted gar  ==========================
          Southern platyfish  ==========================
B D                 Zebrafish  ==========================
B D               Stickleback  ==========================
      Yellowbelly pufferfish  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
         Princess of Burundi  ==========================
B D                Coelacanth  ==========================
B D             X. tropicalis  ==========================
B D                    Lizard  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D              Mallard duck  ==========================
B D                Budgerigar  ==========================
          Tibetan ground jay  ==========================
B D               Zebra finch  ==========================
B D       Medium ground finch  ==========================
  D    White-throated sparrow  ==========================
  D       Collared flycatcher  ==========================
  D              Saker falcon  ==========================
  D               Rock pigeon  ==========================
    Mexican tetra (cavefish)  ==========================
B D                      Fugu  ==========================
B D        American alligator  ==========================
B D                   Opossum  ==========================
B D           Tasmanian devil  ==========================
B D                  Bushbaby  --------------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 29 and 30 in window
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 160bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 4bp
B D                    Horse 3bp
B D         White rhinoceros 2bp
B D                      Cat 3bp
B D                      Dog 2bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 6bp
        David's myotis (bat) 4bp
B D                 Microbat 3bp
             Star-nosed mole 3bp
B D                 Elephant 5bp
B D                  Manatee 5bp
            Cape golden mole 5bp
B D                   Tenrec 3bp

Alignment block 30 of 1022 in window, 65820330 - 65820430, 101 bps 
B D                     Human  aa--aa-a---aat------------------gaaagggcagaattgtaatataatcatt-------atg
B D                     Chimp  aa--aa-a---aat------------------gaaagggcagaattgtaatataatcatt-------atg
B D                   Gorilla  aa--aa-a---aat------------------gaaagggcagaattgtaatataatcatt-------atg
B D                 Orangutan  aa--aa-a---aat------------------gaaagggcagaattgtaatataatcatt-------atg
B D                    Rhesus  aa--aa-a---aat------------------gaaagggcagaattgtaatacaatcatt-------atg
B D       Crab-eating macaque  aa--aa-a---aat------------------gaaagggcagaattgtaatacaatcatt-------atg
B D                    Baboon  aa--aa-a---aat------------------gaaagggcagaattgtaatacaatcatt-------atg
B D              Green monkey  ----aa-a---aat------------------gaaagggcagaattgtaatacaatcatt-------atg
B D                  Marmoset  aa--aa-a---aat------------------gaaagggcagaattgtaatataatcatt-------atg
B D           Squirrel monkey  aa--aaca---aat------------------gaaagggcagaattgtaatataatcatt-------atg
B D                  Squirrel  aa--ga-a---aac------------------gaaggggcagaactgcaatataataattacagttaata
       Lesser Egyptian jerboa  aa--aa-g---aaa------------------gaaaggacagaactataataaaataatt-------atg
                 Prairie vole  ta--aa-a---aat------------------gaaaggacaaggttgtaatataataatt-------atg
B D           Chinese hamster  ta--aa-a---aat------------------aaaaggacaagattataatataataatt-------atg
               Golden hamster  -a--aa-a---aat------------------gaaaggacaggattgtaatataataatt-------atg
B D                     Mouse  tg--aa-a---aat------------------gaaaggacatgattgtaacgtaataatt-------atg
B D                       Rat  ta--aa-a---aat------------------gaaaggacaggattgtaatgtaataatt-------atg
B D            Naked mole-rat  ta--aa-a---aat------------------gaaagggcataactgtaatataataatt-------aca
B D                Guinea pig  taaaga-a---aag------------------gaaagggcataattgcaatataacaatt-------ata
                   Chinchilla  ta---a-a---aaa------------------gaaagggtataactgtaat---ataatt-------ata
             Brush-tailed rat  ta-------------------------------aaagagtataactataatgtaataatt-------ata
B D                    Rabbit  ------------gt------------------aaaagggcagaactgtgatgtagtgact-------gtg
B D                       Pig  aa--ac-aaaaaat------------------gaaagggcagaattgtaa---tataatt-------atg
B D                    Alpaca  aa--aa-a----at------------------gaaaggacagaattgtaatataataatt-------atg
               Bactrian camel  aa--aa-a----at------------------gaaaggacagaattgtaatataataatt-------atg
B D                   Dolphin  aa--aa-a---aat------------------gatagggcggaatcgtaatataataatt-------acg
                 Killer whale  aa--aa-a---aat------------------ggtagggcagaatcgtaatataataatt-------acg
             Tibetan antelope  aa--aa-a---aat------------------gaaagggcagaatcgta----aataatt-------atg
B D                       Cow  aa--aa-a------------------------gaaagggcagaatcgta----aataatt-------atg
B D                     Sheep  aa--aa-a--aaat------------------gaaagggcagaattgta----aataatt-------atg
                Domestic goat  aa--aa-a--aaat------------------gaaagggcagaattgta----aataatt-------atg
B D                     Horse  aa--aa-a---aat------------------gaaagggtagaagtgtaatataataatt-------atg
B D          White rhinoceros  aa--ag-a---aat------------------gaaagggcagaattataatataataatt-------atg
B D                       Cat  ca--aa-a---aat------------------gaaagggcagaactgtaatataataatt-------aca
B D                       Dog  ag--aa-a---aat------------------gaaagggcagagttgtaatatattaatt-------ata
B D                   Ferret   aa--aa-a---aat------------------gaaagggcagaactgtaagataataatt-------gta
B D                     Panda  aa--aa-a---aat------------------gaaagggcagagttgtaatataataatt-------ata
               Pacific walrus  aa--aa-a---aag------------------gaaagggcagagctgtaatataataatt-------ata
                 Weddell seal  aa--aa-a---aag------------------gaaagggcagagctgtaatataataatt-------ata
             Black flying-fox  aa--ag-a---aac------------------gaaagggtagaa-tgtaatataatggtt-------aca
B D                   Megabat  aa--ag-a---aac------------------gaaagggtagaa-tgtaatataatcgtt-------aca
                Big brown bat  aa--aa-a---aat------------------gaaaggacagaactgtaatataatcatt-------atg
         David's myotis (bat)  aa--aa-a---aat------------------gaaaggacagaattgtaatatactcgtt-------atg
B D                  Microbat  aa--aa-a---aat------------------gaaaggacagaattgtaatataatcatt-------atg
              Star-nosed mole  aa--aa-a---attc-----------------gaaagagcagacctgtaatgcccca--t-------atg
B D                  Elephant  aa--aa-a---aat------------------ttaagggcagaaccgtcatataatgttt-------atg
B D                   Manatee  aa--aa-a---aat------------------taaacggcagaac-----tataatattt-------acg
             Cape golden mole  ca--ac-a---aat------------------aaaagggcagaactgtaatacagtattt-------atg
B D                    Tenrec  -a--aa-a---aataggaagaaggaagaagaaaaaagggcagaactataatacaaaattt-------atg
                     Aardvark  -a--aa-a---a--------------------aaaagagcagacctgcaatataatattt-------atg
B D                 Armadillo  aa--aa-a---aat------------------gaatgggcagaat-----tataataatt-------atg
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
          Chinese tree shrew  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  atcattcctgc-tttag---acactgcaaa---------------------------tacttgatgaagt
                        Chimp  atcattcctga-tttag---acactgcaaa---------------------------tacttgatgaagt
                      Gorilla  atcattcctga-tttag---acactgcaaa---------------------------tacttgatgaagt
                    Orangutan  atcattcctga-tttag---acactgcaaa---------------------------tacttgatgaagt
                       Rhesus  atccttcctga-tttag---acactgcaaa---------------------------tacttgatgaagt
          Crab-eating macaque  atccttcctga-tttag---acactgcaaa---------------------------tacttgatgaagt
                       Baboon  atccttcctga-tttag---acactgcaaa---------------------------tacttgatgaagt
                 Green monkey  atccttcctga-tttag---accctgcaaa---------------------------tacttgatgaagt
                     Marmoset  atcctttctga-tttag---acactacgaa---------------------------tacttgatgaagt
              Squirrel monkey  atccttcctga-tttag---acactacaaa---------------------------tacttgatgaagt
                     Squirrel  atacttgatga-tttag-ccactttacaaa---------------------------tacttgatggaga
       Lesser Egyptian jerboa  ttccttgatga-tttag---acactacaaa---------------------------tactcaatgaagt
                 Prairie vole  attcttggtcg-ttaaa---gcattacagg---------------------------tctttgatgaagt
              Chinese hamster  atccctgatcg-ttaaa---gcattacaaa---------------------------tccttgatgaagt
               Golden hamster  atccctgatcg-ttaaa---gcattacaaa---------------------------tccttgatgaagt
                        Mouse  atcattgatcg-gtaaa----cagtacaaa---------------------------tcc-tgagtaagt
                          Rat  atctttgacca-gtaga----cattacaag---------------------------tccttgaggaagt
               Naked mole-rat  atccttgatga-tttag-acactctacaaa---------------------------tatttgatgaagt
                   Guinea pig  atccttgatga-ttgag-acactctacaaa---------------------------tatttgaggaaat
                   Chinchilla  atccttgatga-tttag-acactctacaca---------------------------catttgataaagt
             Brush-tailed rat  atccttgatga-tttag-acactctacaca---------------------------tatttgatgaagt
                       Rabbit  atccccgctga-ttcgg---acactacgaa---------------------------tacccagtgacgt
                          Pig  atccatgatga-tttag-aca--ctacaaa---------------------------tacttgatgtagg
                       Alpaca  gtccatgatga-tttag-acactctacaaa---------------------------gacttgatgaagt
               Bactrian camel  gtccatgatga-tttag-acactctacaaa---------------------------gacttgatgaagt
                      Dolphin  atccatgatga-ttgag-acattctacaaa---------------------------cacttgat-aagt
                 Killer whale  atccatgatga-tttag-acattctacaaa---------------------------tacttgat-aagt
             Tibetan antelope  atccatgatga-tttag-acattctacaaa---------------------------tatttgatgaagt
                          Cow  atccatgatga-tttag-acattctacaaa---------------------------tatttgatgaagt
                        Sheep  atccatgatga-tttag-acattctacaaa---------------------------tatttgatgaagt
                Domestic goat  atccatgatga-tttag-acattctacaaa---------------------------tatttgatgaagt
                        Horse  atccatggtga-tttag-acactccgcaaa---------------------------tacttgatgaagt
             White rhinoceros  atccatgatga-tttag-acactccacaaa---------------------------tacttgacgaagt
                          Cat  atcc-tgacga-tttag-acactcgacaaa---------------------------cgccgggtaaagt
                          Dog  atcc-tgatga-tttag-acactctacaaa---------------------------aatgtgataaagt
                      Ferret   atcc-caatggttttag-acactctacaaa---------------------------aacttgataaggt
                        Panda  atcc-tggtgg-tttag-acactctacaaa---------------------------aacttgataaagt
               Pacific walrus  atcc-tgacgg-tttag-gcactctacaaa---------------------------aatttgacaaagt
                 Weddell seal  atcc-tgatgg-tttag-acactctacaaa---------------------------aacttgacaaagt
             Black flying-fox  atccatgatga-tttag-acacgctacaaa---------------------------tacttgatgaagt
                      Megabat  atccatgatga-tttag-acacgctacaaa---------------------------tacttgatgaagt
                Big brown bat  atccgtgatga-tttag-acactctacaaa---------------------------tacgtgatgaagt
         David's myotis (bat)  atccatgatga-tttag-acactctacaaa---------------------------tacgggatgaagt
                     Microbat  atccgtgatga-tttag-acactctacaaa---------------------------tacgtgatgaagt
              Star-nosed mole  cgctgcggtga-cctgg-acgctctcca-------------------------------ctgcctggagg
                     Elephant  atccatgatga-cgtaa-gcactctacaga---------------------------tacttgacaaact
                      Manatee  atccgtcatga-cttaa-gcactctacaga---------------------------tacttgacaaagt
             Cape golden mole  atccatgatga-tttag-atattctacaga---------------------------tacgcggtgaagt
                       Tenrec  atc--gggagg-tacag-acactctactca---------------------------ttgctgataaagt
                     Aardvark  atccatgatga-tttat-gcactttacagatactccaagtcaacaataatgtgtaggtacttgacgaggc
                    Armadillo  atccatgatgc-cttagaatactctacaaa---------------------------cacttgatgaagt
                         Pika  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                 Nile tilapia  ======================================================================
           Chinese tree shrew  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                         Fugu  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Bushbaby  ----------------------------------------------------------------------
                       Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  caacataaagagaata----ac-tttta
                        Chimp  caacataaagagaata----ac-tttta
                      Gorilla  caacataaagagaata----ac-tttta
                    Orangutan  caacataaagagaata----ac-tttta
                       Rhesus  caacataaagagaata----ac-tttta
          Crab-eating macaque  caacataaagagaata----ac-tttta
                       Baboon  caacataaagag-ata----ac-tttta
                 Green monkey  caacataaagagaata----ac-tttta
                     Marmoset  caacatgaagagagta----ac-ttttg
              Squirrel monkey  caacataaagagagta----ac-ttttg
                     Squirrel  caacataaacagaata-----t-tccta
       Lesser Egyptian jerboa  taacataaagaa-ata----gc-tttga
                 Prairie vole  ca--acagagagctcatctctc-tctca
              Chinese hamster  caacacagagagttca----gt-tctca
               Golden hamster  caacacagagagttca----gt-tctca
                        Mouse  tggcacgcagagcacg----ac-tctca
                          Rat  ctgcatgaacagcacg----gc-tctcc
               Naked mole-rat  caacataaagagagta----ac-ttgtg
                   Guinea pig  caacataaagacagta----ac-ttgta
                   Chinchilla  caacatgaagagagta----ac-ttgta
             Brush-tailed rat  caacataaagacagta----ac-tcgta
                       Rabbit  caccctaaagagggtg----ac-ttct-
                          Pig  cagtataaggggaatg----ac-ttta-
                       Alpaca  caatacaaagagaatg----ac-tctga
               Bactrian camel  caatataaagagaatg----ac-tctga
                      Dolphin  cgatataaagagaata----ac-tttga
                 Killer whale  caatataaagagaata----ac-tttgg
             Tibetan antelope  caatataaagagaata----ac-tttga
                          Cow  caatataaagagaata----ac-tttga
                        Sheep  caatataaagagaata----ac-tttga
                Domestic goat  caatataaagagaata----ac-tttga
                        Horse  caacataaagagaaca----ac-cttta
             White rhinoceros  caacat--agagagtg----ac-cttta
                          Cat  caacacaaagacagta----acttttta
                          Dog  caatacaaagag---a----ac-tttga
                      Ferret   caatacaaagaggata----ac-ttcta
                        Panda  caacacaaagaggata----ac-tttta
               Pacific walrus  caacacaaagaggaca----ac-tttta
                 Weddell seal  caacacaaagaggaca----ac-tttta
             Black flying-fox  caacatacagagacta----ac-tttta
                      Megabat  caacatacagagaata----ac-tttta
                Big brown bat  caac--------------------tttt
         David's myotis (bat)  caac--------------------tttt
                     Microbat  caac--------------------tttt
              Star-nosed mole  ggcgagggggaggcca----gc-cctgc
                     Elephant  caacatgaagaaaata----ac-tttta
                      Manatee  caacataaagagaata----ac-tttta
             Cape golden mole  caacgtaaagagaata----at-tttta
                       Tenrec  ---ggccaggggcctg----ac-tgtga
                     Aardvark  caacccaaagagaatg----ac-tttta
                    Armadillo  cagcatcaagagacta----ac-t-tca
                         Pika  ============================
          Cape elephant shrew  ============================
                     Hedgehog  ============================
                        Shrew  ============================
                 Nile tilapia  ============================
           Chinese tree shrew  ============================
                  Spotted gar  ============================
           Southern platyfish  ============================
                    Zebrafish  ============================
                  Stickleback  ============================
       Yellowbelly pufferfish  ============================
                  Zebra mbuna  ============================
        Burton's mouthbreeder  ============================
          Princess of Burundi  ============================
                   Coelacanth  ============================
                X. tropicalis  ============================
                       Lizard  ============================
                       Turkey  ============================
                      Chicken  ============================
                 Mallard duck  ============================
                   Budgerigar  ============================
           Tibetan ground jay  ============================
                  Zebra finch  ============================
          Medium ground finch  ============================
       White-throated sparrow  ============================
          Collared flycatcher  ============================
                 Saker falcon  ============================
                  Rock pigeon  ============================
     Mexican tetra (cavefish)  ============================
                         Fugu  ============================
           American alligator  ============================
                      Opossum  ============================
              Tasmanian devil  ============================
                     Bushbaby  ----------------------------
                       Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 31 of 1022 in window, 65820431 - 65820497, 67 bps 
B D                     Human  tagagtgttc--------tacagttgacataaatgt-tttcatataaatgatttcatttgtccctcccaa
B D                     Chimp  tagagtgttc--------tacagttgacataaatgt-tttcatataaatgatttcatttgtccctcccaa
B D                   Gorilla  tagagtgctc--------tacagttgacataaatgt-tttcatataaatgatttcatttgtccctcccaa
B D                 Orangutan  tagagtgttc--------tacagttgacataaatgt-tttcatataaatgatttcatttgtccctcccaa
B D                    Gibbon  tagagtgttc--------tacagttgacataaatgt-tttcatataaatgatttcatttgtccctcccaa
B D                    Rhesus  tagagtgttc--------tacagttgacataaatg--tttcatataaatgatttcatttgtccctcccaa
B D       Crab-eating macaque  tagagtgttc--------tacagttgacataaatg--tttcatataaatgatttcatttgtccctcccaa
B D                    Baboon  tagagtgttc--------tacagttgacataaatg--tttcatataaatgatttcatttgtccctcccaa
B D              Green monkey  tagagtgttc--------tacagttgacataaatg--tttcatataaatgatttcatttgtccctcccaa
B D                  Marmoset  tacaatgttc--------tacagttgacataaacgt-tttcatataaagga-ttcatttgtccctcccaa
B D           Squirrel monkey  tacaatgttc--------tacagttgacataaacat-tttcctagaaaggatttcatttgtccctcccaa
B D                  Squirrel  tacagtgttt--------gat-gtttatacaaatgt-tttcacataaatgattccactggttcctcccaa
       Lesser Egyptian jerboa  tacagtgctt--------aatagtttacagaaatgt-ttgcacagaagtgatttcattgg-ttcctccag
                 Prairie vole  caca--gcct--------cctggtttgcataaatgg-tt-gactgaagagag---------cccctccag
B D           Chinese hamster  tgca--gtct--------cgtggtttacacaaatgg-tt-tactgaagagat---------tccctccag
               Golden hamster  tgca--gtct--------catggtttaca-aaatgg-tt-tactaaagagat---------tccctccag
B D                     Mouse  tgc---gcct--------tgtggtttacacacatgg-tt-tactgaagagat---------cccctccag
B D                       Rat  tgca--gcct--------cgtggtttacacaaatgg-tt-tactgaagagaa---------tccctccag
B D            Naked mole-rat  tccagtgctt--------gatagtttacacaaatgc-tttcacatcagtgattttgtt-gttcctcccca
B D                Guinea pig  tgcagtgcgt--------gatagtttacacaaatgcttttcacatcaatgcttttgttggttcctcgccc
                   Chinchilla  tgcagtgctt--------gacagtttacacaaatgc-tttcacaccaatgcttttgttcgttcctcgccc
             Brush-tailed rat  tgtactgctt--------aatagtttacacaaatgc-ttttacgtcattgcattagttggttcctcgccc
B D                    Rabbit  ---agtgcgt--------gaaggttcacacagatgt-tttcaca-----------------agcctccca
B D                       Pig  ---agtgcgt--------gaaagtttcc----atgt-ttccacgttaacgatttcatttgttcc-agcag
B D                    Alpaca  tacagtgcct--------gatggttggcataaatt---------------a-ttcatttgttccttgcca
               Bactrian camel  tacagtgcct--------gatggttggcataaatt---------------a-ttcatttgttccttgcca
B D                   Dolphin  tacagtgcct--------gatggtttacgtaaatgt-ttccacataagtgatttcatctgttcctcacga
                 Killer whale  tacagtgcct--------gatggtttacgtaaatgt-ttccacataagtgatttcacctgttcctcacga
             Tibetan antelope  tatagtgctt--------gatggtttacataaattt-ctccacgtaaatga-ttcatctgtgcctctcaa
B D                       Cow  tacagggctt--------gatggtttacataaatgt-ctccgcgtaaatga-ttcatcagtgcctctcaa
B D                     Sheep  tacagtgctt--------gatggtttacataaattc-ctccacgtaaatga-ttcatctgtgcctctcaa
                Domestic goat  tacagtgctt--------gatggtttacataaattt-ctccacgtaaatga-ttcatctgtacctctcaa
B D                     Horse  tacagcgctt--------gatggtttacacaaatat-ttccacataaatgatttcattggttcctcccca
B D          White rhinoceros  tacagtgctt--------gatggtttacataaatat-ttccacagaaacgatttcatttactcctcccaa
B D                       Cat  cacagtgcct--------gacggttgacatagatat-ttc--cgtaagtgattttgtctgttcctcccca
B D                       Dog  cacagtgctt--------gatggttgatataattat-ttc--tataaatgatttcatctgttcctcccaa
B D                   Ferret   caccgtgctt--------gatggtagacataaatat-ttc--tataaaggatttcatctgttcctcctga
B D                     Panda  cacagtgctt--------gatgggggacataaatat-ttc--cataaatgaattcatctgttcctcccaa
               Pacific walrus  cacagtgctt--------gatggtggacatacatat-ttc--tataaatgatttcatccgttcctcccaa
                 Weddell seal  cacagtgctt--------gatggtggacataaatat-ttc--tgtaaatgatttcatccgttcctcccaa
             Black flying-fox  caccgtgctt--------gatggttgacataaatat-ttccacacaaatgatttcatttgttcctcccgt
B D                   Megabat  caccgtgctt--------gatggttgacataaatat-ttccacacagatgatttcatttgttcctcccgt
                Big brown bat  taccatgctt--------gatggtttacataaatat-ttccacataaatgatttcatttgctcctccca-
         David's myotis (bat)  taccatgctt--------gatggttt---------------acataaatgatttcatttgctcctccca-
B D                  Microbat  taccatgctt--------gatggtttacataaatat-ttccacataaatgatttcattt-ctcctccca-
              Star-nosed mole  cacagcgcc---------gacgctgcacacaaacat-ttccacaccgac-----cacctgctccccccag
B D                  Elephant  tacaatgctt--------gatagtttacatcaacat-tttcacttaactgatttcatttgttcctcc---
B D                   Manatee  tacagtgctt--------gatagtttacataaatat-tttcacttaaccgatttcatttgttcctcccag
             Cape golden mole  gacagcgttt--------gatggtttacataaatat-tctcatttagcaactacaatttgtttctagcaa
B D                    Tenrec  cagagtgctggcgggagagctggtgtacatggcacc-tcactgatagcagc-------agtccctcccaa
                     Aardvark  tacagtgcct--------gacagggtacggaaacat-cggcacttagccgatttcc--------------
B D                 Armadillo  tagagtgcgt--------cagagctcacacaaatat-tttcacat--ttaatttcatttattcctgccca
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
          Chinese tree shrew  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                      Fugu  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------

                        Human  caagcc
                        Chimp  caagcc
                      Gorilla  caagtc
                    Orangutan  caagcc
                       Gibbon  caagcc
                       Rhesus  caagcc
          Crab-eating macaque  caagcc
                       Baboon  caagcc
                 Green monkey  caagcc
                     Marmoset  caagcc
              Squirrel monkey  caagcc
                     Squirrel  taagcc
       Lesser Egyptian jerboa  acagac
                 Prairie vole  caagc-
              Chinese hamster  caagcc
               Golden hamster  caagcc
                        Mouse  caagcc
                          Rat  cacacc
               Naked mole-rat  aaagcc
                   Guinea pig  caagcc
                   Chinchilla  aaagcc
             Brush-tailed rat  aaagcc
                       Rabbit  caagcc
                          Pig  aaagcc
                       Alpaca  caagcc
               Bactrian camel  caagcc
                      Dolphin  caagcc
                 Killer whale  caagcc
             Tibetan antelope  ctggcc
                          Cow  ctggcc
                        Sheep  ctggcc
                Domestic goat  ctggcc
                        Horse  caagcc
             White rhinoceros  caagcc
                          Cat  caagcc
                          Dog  caagcc
                      Ferret   caagcc
                        Panda  caagcc
               Pacific walrus  caagcc
                 Weddell seal  caagcc
             Black flying-fox  taagcc
                      Megabat  caagcc
                Big brown bat  -----a
         David's myotis (bat)  -----a
                     Microbat  -----a
              Star-nosed mole  caaacc
                     Elephant  caagtc
                      Manatee  caagtc
             Cape golden mole  taagcc
                       Tenrec  cccgcc
                     Aardvark  ----cc
                    Armadillo  ccagcc
                         Pika  ======
          Cape elephant shrew  ======
                     Hedgehog  ======
                        Shrew  ======
                 Nile tilapia  ======
           Chinese tree shrew  ======
                  Spotted gar  ======
           Southern platyfish  ======
                    Zebrafish  ======
                  Stickleback  ======
       Yellowbelly pufferfish  ======
                  Zebra mbuna  ======
        Burton's mouthbreeder  ======
          Princess of Burundi  ======
                   Coelacanth  ======
                X. tropicalis  ======
                       Lizard  ======
                       Turkey  ======
                      Chicken  ======
                 Mallard duck  ======
                   Budgerigar  ======
           Tibetan ground jay  ======
                  Zebra finch  ======
          Medium ground finch  ======
       White-throated sparrow  ======
          Collared flycatcher  ======
                 Saker falcon  ======
                  Rock pigeon  ======
     Mexican tetra (cavefish)  ======
                         Fugu  ======
           American alligator  ======
                      Opossum  ======
              Tasmanian devil  ======
                     Bushbaby  ------

Inserts between block 31 and 32 in window
      Lesser Egyptian jerboa 1bp
B D          Chinese hamster 930bp

Alignment block 32 of 1022 in window, 65820498 - 65820520, 23 bps 
B D                     Human  cattaatttgcaga---cgagg--aa----aa
B D                     Chimp  cattaatttgcaga---cgagg--aa----aa
B D                   Gorilla  cattaatttgcaga---cgagg--aa----aa
B D                 Orangutan  cattaacttgcaga---tgagg--aa----aa
B D                    Gibbon  cattaacttgcaga---cgagg--aa----aa
B D                    Rhesus  catgaacttgcaga---cgagg--aa----aa
B D       Crab-eating macaque  catgaacttgcaga---cgagg--aa----aa
B D                    Baboon  catgaacttgcaga---cgagg--aa----aa
B D              Green monkey  catgaacttacaga---cgagg--aa----aa
B D                  Marmoset  tattaacttgcaga---ggagg--aa----aa
B D           Squirrel monkey  tattaacttgcaaa---tgagg--aa----aa
B D                  Squirrel  -caccacgggcaga---caagg--accagc--
       Lesser Egyptian jerboa  --cacagatgtgcaggctatga--aaa-----
                 Prairie vole  --cacacatgcaca---gaggg--aaa-----
               Golden hamster  -----------aca---taggg--aaa-----
B D                     Mouse  ---acaagtgcaca---cggg-----------
B D                       Rat  ---acaagtgcaca---cggga----------
B D            Naked mole-rat  cttggacatgcaga---cagga--aa------
B D                Guinea pig  ctgggccatgcaca---caggg--aa------
                   Chinchilla  cttggccctgcaga---caggg--aa------
             Brush-tailed rat  tttggccatgcaga---caggg--aa------
B D                    Rabbit  tttggacttgcaga---caaggcaaa------
B D                       Pig  cgtggtcttgcaga---ggagg--aa----ac
B D                    Alpaca  catagattttcaga---ggagg--aa----ac
               Bactrian camel  catagattttcaga---ggagg--aa----ac
B D                   Dolphin  catggacttgcgga---ggagg--aa----ac
                 Killer whale  catggacttggaga---agagg--aa----ac
             Tibetan antelope  catggacttgccca---ggagg--aa----ac
B D                       Cow  catggacttgccca---ggagg--aa----ac
B D                     Sheep  catggacttgccca---ggagg--aa----ac
                Domestic goat  catggacttgccca---gaagg--aa----ac
B D                     Horse  cagggccttgcaga---tgcgg--aa----ac
B D          White rhinoceros  cagggacttgcaga---gg-gg--aa----ac
B D                       Cat  cacggactcgcgga---cgagg--aa----ac
B D                       Dog  catggacttgcaga---cgaga--aa----ac
B D                   Ferret   cacagacttgcaga---caagg--aa----ac
B D                     Panda  cacagacctgcaga---tgagg--aa----ac
               Pacific walrus  cgcagacctgcaga---caagg--aa----at
                 Weddell seal  cacaggcctgcaga---caagg--aa----ac
             Black flying-fox  cacgggcttgcaga---cgagg--gc----ga
B D                   Megabat  cacgggcttgcaga---cgagg--ac----ga
                Big brown bat  catagacttgcaga---caagg--ag----aa
         David's myotis (bat)  catggacttgccca---ctagg--ag----ac
B D                  Microbat  catggacttgccga---caagg--ag----aa
              Star-nosed mole  ccggctccgggaga---ggagg--cc----a-
B D                  Elephant  catggcctcacaga---tgggg--aa----ag
B D                   Manatee  catggagtggcaga---tggag--aa----ag
             Cape golden mole  catggtctggcaga---tgagg--ca----ac
B D                    Tenrec  cttggcctggtaga---ggtgg--aa----ac
                     Aardvark  ctcagcctggcaga---gtggg--ta----ac
B D                 Armadillo  agtggacttgcaga---caggg--aa----ac
B D                      Pika  ================================
         Cape elephant shrew  ================================
B D                  Hedgehog  ================================
B D                     Shrew  ================================
B D           Chinese hamster  ================================
B D              Nile tilapia  ================================
          Chinese tree shrew  ================================
                 Spotted gar  ================================
          Southern platyfish  ================================
B D                 Zebrafish  ================================
B D               Stickleback  ================================
      Yellowbelly pufferfish  ================================
                 Zebra mbuna  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D                Coelacanth  ================================
B D             X. tropicalis  ================================
B D                    Lizard  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
B D                Budgerigar  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
B D       Medium ground finch  ================================
  D    White-throated sparrow  ================================
  D       Collared flycatcher  ================================
  D              Saker falcon  ================================
  D               Rock pigeon  ================================
    Mexican tetra (cavefish)  ================================
B D                      Fugu  ================================
B D        American alligator  ================================
B D                   Opossum  ================================
B D           Tasmanian devil  ================================
B D                  Bushbaby  --------------------------------

Inserts between block 32 and 33 in window
B D                 Squirrel 17bp
      Lesser Egyptian jerboa 4024bp
                Prairie vole 9bp
              Golden hamster 9bp
B D                    Mouse 1bp
B D                      Rat 1bp

Alignment block 33 of 1022 in window, 65820521 - 65820522, 2 bps 
B D                     Human  ca-
B D                     Chimp  ca-
B D                   Gorilla  ca-
B D                 Orangutan  ca-
B D                    Gibbon  ta-
B D                    Rhesus  ca-
B D       Crab-eating macaque  ca-
B D                    Baboon  ca-
B D              Green monkey  ca-
B D                  Marmoset  ca-
B D           Squirrel monkey  ca-
B D                    Rabbit  cg-
B D                       Pig  a--
B D                    Alpaca  tg-
               Bactrian camel  tg-
B D                   Dolphin  cg-
                 Killer whale  cg-
             Tibetan antelope  ca-
B D                       Cow  ca-
B D                     Sheep  ca-
                Domestic goat  ca-
B D                     Horse  tg-
B D          White rhinoceros  tg-
B D                       Cat  gg-
B D                       Dog  ag-
B D                   Ferret   gg-
B D                     Panda  gg-
               Pacific walrus  gg-
                 Weddell seal  gg-
             Black flying-fox  cc-
B D                   Megabat  cc-
                Big brown bat  tg-
         David's myotis (bat)  tg-
B D                  Microbat  tg-
B D                  Elephant  tga
B D                   Manatee  tga
             Cape golden mole  tga
B D                    Tenrec  tga
                     Aardvark  tga
B D                 Armadillo  tga
             Star-nosed mole  ---
B D                      Pika  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                     Mouse  ===
                Prairie vole  ===
B D                       Rat  ===
B D           Chinese hamster  ===
              Golden hamster  ===
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ---
                  Chinchilla  ---
B D                Guinea pig  ---
B D              Nile tilapia  ===
B D                  Squirrel  ===
          Chinese tree shrew  ===
B D            Naked mole-rat  ---
                 Spotted gar  ===
          Southern platyfish  ===
B D                 Zebrafish  ===
B D               Stickleback  ===
      Yellowbelly pufferfish  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                Coelacanth  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D              Saker falcon  ===
  D