Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 424 in window, 9398841 - 9398848, 8 bps 
B D                     Human  aaagttta
B D                     Chimp  aaagttta
B D                   Gorilla  aaagttta
B D                 Orangutan  aaagttta
B D                    Gibbon  aaagttta
B D                    Rhesus  aaagttta
B D       Crab-eating macaque  aaagttta
B D                    Baboon  aaagttta
B D              Green monkey  aaagttta
B D                  Marmoset  aaagtttg
B D           Squirrel monkey  aaaggtta
B D                  Bushbaby  agaattta
                   Chinchilla  acaactca
             Brush-tailed rat  aaaactca
B D                    Alpaca  aacactca
               Bactrian camel  aacactta
B D                     Horse  aaaattta
B D          White rhinoceros  aaaattta
B D                       Cat  -------a
B D                       Dog  aatattta
B D                   Ferret   aaaatata
B D                     Panda  aatatgta
               Pacific walrus  aatatgta
             Black flying-fox  cgagttta
B D                   Megabat  tgagttta
B D                   Manatee  aaagttta
                     Aardvark  aaaattta
B D                 Armadillo  acaatgta
             Star-nosed mole  ========
              Golden hamster  ========
B D                  Hedgehog  ========
B D                       Rat  ========
B D                     Shrew  ========
B D                     Mouse  ========
                 Zebra mbuna  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
    Mexican tetra (cavefish)  ========
                 Spotted gar  ========
B D                Coelacanth  ========
B D                 Zebrafish  ========
  D                    Parrot  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
          Southern platyfish  ========
B D                    Medaka  ========
  D              Mallard duck  ========
B D                   Lamprey  ========
B D                 Tetraodon  ========
  D  Chinese softshell turtle  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
B D             X. tropicalis  ========
  D            Painted turtle  ========
B D               Zebra finch  ========
B D              Atlantic cod  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
  D             Scarlet macaw  ========
B D                    Lizard  ========
  D    White-throated sparrow  ========
B D               Stickleback  ========
B D                Guinea pig  ========
B D            Naked mole-rat  ========
B D                  Squirrel  ========
                Prairie vole  ========
         Cape elephant shrew  ========
B D           Chinese hamster  ========
               Domestic goat  ========
B D                     Sheep  ========
B D                   Wallaby  ========
B D           Tasmanian devil  ========
B D                  Platypus  ========
  D    Spiny softshell turtle  ========
  D           Green seaturtle  ========
B D                       Cow  ========
            Tibetan antelope  ========
B D                  Microbat  ========
        David's myotis (bat)  ========
               Big brown bat  ========
B D                       Pig  ========
          Chinese tree shrew  ========
B D                    Rabbit  ========
B D                   Opossum  ========
B D                      Pika  ========
      Lesser Egyptian jerboa  ========
B D                    Tenrec  ========
B D                  Elephant  ========
                Weddell seal  ========
                Killer whale  ========
B D                   Dolphin  ========
            Cape golden mole  ========

Alignment block 2 of 424 in window, 9398849 - 9398858, 10 bps 
B D                     Human  ctatctgcct
B D                     Chimp  ctatctgcct
B D                   Gorilla  ctatctgcct
B D                 Orangutan  ctatctgcct
B D                    Gibbon  ctatttgcct
B D                    Rhesus  ctagctacct
B D       Crab-eating macaque  ctagctacct
B D                    Baboon  ctagctacct
B D              Green monkey  ctagctgcct
B D                  Marmoset  ccatcttcct
B D           Squirrel monkey  ccatctgcct
B D                  Bushbaby  gtgttggcc-
B D                  Squirrel  ctgtctgatc
B D           Chinese hamster  ctacctggc-
                   Chinchilla  ccgcctgacc
             Brush-tailed rat  ccacttgacc
B D                    Alpaca  ctctctggcc
               Bactrian camel  ttctctggcc
B D                     Horse  ctatctggcc
B D          White rhinoceros  ccatctggtc
B D                       Cat  ctgtcaggcc
B D                       Dog  gtgcttggcc
B D                   Ferret   ccgtctggcc
B D                     Panda  ccatctggcc
               Pacific walrus  ccgtctggcc
             Black flying-fox  c--tccggcg
B D                   Megabat  c--tctggca
B D                   Manatee  ctgtctgacc
                     Aardvark  ctgtcccacc
B D                 Armadillo  ctgtctggcc
             Star-nosed mole  ==========
              Golden hamster  ==========
B D                  Hedgehog  ==========
B D                       Rat  ==========
B D                     Shrew  ==========
B D                     Mouse  ==========
                 Zebra mbuna  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
    Mexican tetra (cavefish)  ==========
                 Spotted gar  ==========
B D                Coelacanth  ==========
B D                 Zebrafish  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
          Southern platyfish  ==========
B D                    Medaka  ==========
  D              Mallard duck  ==========
B D                   Lamprey  ==========
B D                 Tetraodon  ==========
  D  Chinese softshell turtle  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                   Chicken  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
B D             X. tropicalis  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
B D              Atlantic cod  ==========
  D       Collared flycatcher  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
  D             Scarlet macaw  ==========
B D                    Lizard  ==========
  D    White-throated sparrow  ==========
B D               Stickleback  ==========
B D                Guinea pig  ==========
B D            Naked mole-rat  ==========
                Prairie vole  ==========
         Cape elephant shrew  ==========
               Domestic goat  ==========
B D                     Sheep  ==========
B D                   Wallaby  ==========
B D           Tasmanian devil  ==========
B D                  Platypus  ==========
  D    Spiny softshell turtle  ==========
  D           Green seaturtle  ==========
B D                       Cow  ==========
            Tibetan antelope  ==========
B D                  Microbat  ==========
        David's myotis (bat)  ==========
               Big brown bat  ==========
B D                       Pig  ==========
          Chinese tree shrew  ==========
B D                    Rabbit  ==========
B D                   Opossum  ==========
B D                      Pika  ==========
      Lesser Egyptian jerboa  ==========
B D                    Tenrec  ==========
B D                  Elephant  ==========
                Weddell seal  ==========
                Killer whale  ==========
B D                   Dolphin  ==========
            Cape golden mole  ==========

Alignment block 3 of 424 in window, 9398859 - 9398887, 29 bps 
B D                     Human  ctt-taaagaaaaagtctgctcactgctgt
B D                     Chimp  ctt-taaagaaaaagtctgctcactgctgt
B D                   Gorilla  ctt-taaagaaaaagtctgctcactgctgt
B D                 Orangutan  ctt-taaagaaaaagtctgctcactgctgt
B D                    Gibbon  ctt-caaagaaaaagtctgctcactgctgt
B D                    Rhesus  ctt-taaag--aaagtctgctgaccgctgt
B D       Crab-eating macaque  ctt-taaag--aaagtctgctgaccgctgt
B D                    Baboon  ctt-taaag--aaagtctgctgaccgctgt
B D              Green monkey  ctt-taaag--aaagtctgctgaccgctgt
B D                  Marmoset  ctcctaaagaaaaagt--------------
B D           Squirrel monkey  cttctaaagaaaaact--------------
B D                  Bushbaby  ctt-caaag-acaagtctgctgactgctgt
B D                  Squirrel  ctt-taaagagaatacctgct-------ct
                 Prairie vole  ctt-tgagggcaaagctggctgactatggt
B D           Chinese hamster  ctt-tgagggcaaggctggctggctgtggt
                   Chinchilla  ctt-tgaagaagg--gctgctgacggtggt
             Brush-tailed rat  ctt-tgaagaaagacactgcagacagtggt
B D                    Alpaca  atc-tacagaaaaggcttgctgaccagtgt
               Bactrian camel  atc-tacagaaaaggcttgctgaccattgt
B D                     Horse  ctt-tgaagaaaaactgtgctgagtggtat
B D          White rhinoceros  ctt-taaagaaagagtttgctgagcggtgt
B D                       Cat  ctt-tagcaagaaggtttgctgactggtgt
B D                       Dog  ctt-tagaagaaaggtttgctgcctggcat
B D                   Ferret   ctt-cagaaaaaaggttcgctgactggtgt
B D                     Panda  ctt-gagaaaaaaggttcgctgactggtgt
               Pacific walrus  ctt-tagaaaaagggttcgctgactggtgt
             Black flying-fox  ctt-taaaggagaagtttgccaagtagcat
B D                   Megabat  ctt-taaaggagaagtttgccgaatagcat
B D                   Manatee  ctt-taaagaaaaagtgtgctgacccctgt
                     Aardvark  ctt-taaagaaaaaatttgccaacctctgt
B D                 Armadillo  ctt-tca--aagaagtttgctggcccttgt
             Star-nosed mole  ==============================
              Golden hamster  ==============================
B D                  Hedgehog  ==============================
B D                       Rat  ==============================
B D                     Shrew  ==============================
B D                     Mouse  ==============================
                 Zebra mbuna  ==============================
         Pundamilia nyererei  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D              Nile tilapia  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
    Mexican tetra (cavefish)  ==============================
                 Spotted gar  ==============================
B D                Coelacanth  ==============================
B D                 Zebrafish  ==============================
  D                    Parrot  ==============================
B D                Budgerigar  ==============================
  D               Rock pigeon  ==============================
          Southern platyfish  ==============================
B D                    Medaka  ==============================
  D              Mallard duck  ==============================
B D                   Lamprey  ==============================
B D                 Tetraodon  ==============================
  D  Chinese softshell turtle  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                   Chicken  ==============================
B D       Medium ground finch  ==============================
B D                    Turkey  ==============================
B D             X. tropicalis  ==============================
  D            Painted turtle  ==============================
B D               Zebra finch  ==============================
B D              Atlantic cod  ==============================
  D       Collared flycatcher  ==============================
B D        American alligator  ==============================
          Tibetan ground jay  ==============================
  D             Scarlet macaw  ==============================
B D                    Lizard  ==============================
  D    White-throated sparrow  ==============================
B D               Stickleback  ==============================
B D                Guinea pig  ==============================
B D            Naked mole-rat  ==============================
         Cape elephant shrew  ==============================
               Domestic goat  ==============================
B D                     Sheep  ==============================
B D                   Wallaby  ==============================
B D           Tasmanian devil  ==============================
B D                  Platypus  ==============================
  D    Spiny softshell turtle  ==============================
  D           Green seaturtle  ==============================
B D                       Cow  ==============================
            Tibetan antelope  ==============================
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
               Big brown bat  ==============================
B D                       Pig  ==============================
          Chinese tree shrew  ==============================
B D                    Rabbit  ==============================
B D                   Opossum  ==============================
B D                      Pika  ==============================
      Lesser Egyptian jerboa  ==============================
B D                    Tenrec  ==============================
B D                  Elephant  ==============================
                Weddell seal  ==============================
                Killer whale  ==============================
B D                   Dolphin  ==============================
            Cape golden mole  ==============================

Alignment block 4 of 424 in window, 9398888 - 9398908, 21 bps 
B D                     Human  ctcagaggatcaggccttccc
B D                     Chimp  ctcagaggatcaggccttccc
B D                   Gorilla  ctcagaggatcaggccttccc
B D                 Orangutan  ctcagaggatcaggccttccc
B D                    Gibbon  cccagaggatcaggccttccc
B D                    Rhesus  ctcagaggatcagg-----cc
B D       Crab-eating macaque  ctcagaggatcagg-----cc
B D                    Baboon  ctcagaggatcagg-----cc
B D              Green monkey  ctcagaggatcagg-----cc
B D                  Marmoset  ----gaggatcaggccattcc
B D           Squirrel monkey  ----gaggatcaggccattcc
B D                  Bushbaby  cttagacactcgggccttccc
B D                  Squirrel  -------------------cc
                 Prairie vole  -------------------cc
B D           Chinese hamster  -------------------cc
                   Chinchilla  -------------------ct
             Brush-tailed rat  -------------------ct
B D                    Rabbit  cccagaggctcagg-----cc
B D                    Alpaca  ctca-agggtcaggccttccc
               Bactrian camel  ctca-agggtcaagccttccc
B D                     Horse  cttagaggatcaagccttccc
B D          White rhinoceros  cttaaaggatcaggccttccc
B D                       Cat  cttagaggctcaggcctttcc
B D                       Dog  cttggaggatcaggcctttcc
B D                   Ferret   cttcgagaatcaggcctttcc
B D                     Panda  ctttgaggatcaggcctttcc
               Pacific walrus  cttcgagaatcaggcctttcc
             Black flying-fox  cttagaggctcaggcctcccc
B D                   Megabat  cttagaggctcaggcctcccc
B D                   Manatee  cttataggatcaggccttcct
                     Aardvark  cttagagaattaggctgtcct
B D                 Armadillo  cttagaggatcaggcctttcc
             Star-nosed mole  =====================
              Golden hamster  =====================
B D                  Hedgehog  =====================
B D                       Rat  =====================
B D                     Shrew  =====================
B D                     Mouse  =====================
                 Zebra mbuna  =====================
         Pundamilia nyererei  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
    Mexican tetra (cavefish)  =====================
                 Spotted gar  =====================
B D                Coelacanth  =====================
B D                 Zebrafish  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
  D               Rock pigeon  =====================
          Southern platyfish  =====================
B D                    Medaka  =====================
  D              Mallard duck  =====================
B D                   Lamprey  =====================
B D                 Tetraodon  =====================
  D  Chinese softshell turtle  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D                   Chicken  =====================
B D       Medium ground finch  =====================
B D                    Turkey  =====================
B D             X. tropicalis  =====================
  D            Painted turtle  =====================
B D               Zebra finch  =====================
B D              Atlantic cod  =====================
  D       Collared flycatcher  =====================
B D        American alligator  =====================
          Tibetan ground jay  =====================
  D             Scarlet macaw  =====================
B D                    Lizard  =====================
  D    White-throated sparrow  =====================
B D               Stickleback  =====================
B D                Guinea pig  =====================
B D            Naked mole-rat  =====================
         Cape elephant shrew  =====================
               Domestic goat  =====================
B D                     Sheep  =====================
B D                   Wallaby  =====================
B D           Tasmanian devil  =====================
B D                  Platypus  =====================
  D    Spiny softshell turtle  =====================
  D           Green seaturtle  =====================
B D                       Cow  =====================
            Tibetan antelope  =====================
B D                  Microbat  =====================
        David's myotis (bat)  =====================
               Big brown bat  =====================
B D                       Pig  =====================
          Chinese tree shrew  =====================
B D                   Opossum  =====================
B D                      Pika  =====================
      Lesser Egyptian jerboa  =====================
B D                    Tenrec  =====================
B D                  Elephant  =====================
                Weddell seal  =====================
                Killer whale  =====================
B D                   Dolphin  =====================
            Cape golden mole  =====================

Inserts between block 4 and 5 in window
B D                 Squirrel 15bp
                Prairie vole 16bp
B D          Chinese hamster 16bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 5bp

Alignment block 5 of 424 in window, 9398909 - 9398915, 7 bps 
B D                     Human  tgcgagt
B D                     Chimp  tgcgagt
B D                   Gorilla  tgcgagt
B D                 Orangutan  tgcgagt
B D                    Gibbon  tgcgagt
B D                    Rhesus  tgcgagt
B D       Crab-eating macaque  tgcgagt
B D                    Baboon  tgcgagt
B D              Green monkey  tgcgagt
B D                  Marmoset  tgtgagt
B D           Squirrel monkey  tgtgagt
B D                  Bushbaby  tgtgagt
B D                  Squirrel  --tgagc
                 Prairie vole  tgggagc
B D           Chinese hamster  catgagc
B D                     Mouse  tatgagc
                   Chinchilla  tgggagc
             Brush-tailed rat  tgggagc
B D                    Rabbit  cgtgagc
B D                    Alpaca  tgtgggc
               Bactrian camel  tgtgggc
B D                     Horse  tgggagt
B D          White rhinoceros  taggagc
B D                       Cat  cgtaggc
B D                       Dog  tgtggg-
B D                   Ferret   tgtgagt
B D                     Panda  tatgggc
               Pacific walrus  tgtgggc
             Black flying-fox  cgtgagc
B D                   Megabat  cgtgagc
B D                   Manatee  ta-gagc
                     Aardvark  tatgagc
B D                 Armadillo  ta-----
             Star-nosed mole  =======
              Golden hamster  =======
B D                  Hedgehog  =======
B D                       Rat  =======
B D                     Shrew  =======
                 Zebra mbuna  =======
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
    Mexican tetra (cavefish)  =======
                 Spotted gar  =======
B D                Coelacanth  =======
B D                 Zebrafish  =======
  D                    Parrot  =======
B D                Budgerigar  =======
  D               Rock pigeon  =======
          Southern platyfish  =======
B D                    Medaka  =======
  D              Mallard duck  =======
B D                   Lamprey  =======
B D                 Tetraodon  =======
  D  Chinese softshell turtle  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                   Chicken  =======
B D       Medium ground finch  =======
B D                    Turkey  =======
B D             X. tropicalis  =======
  D            Painted turtle  =======
B D               Zebra finch  =======
B D              Atlantic cod  =======
  D       Collared flycatcher  =======
B D        American alligator  =======
          Tibetan ground jay  =======
  D             Scarlet macaw  =======
B D                    Lizard  =======
  D    White-throated sparrow  =======
B D               Stickleback  =======
B D                Guinea pig  =======
B D            Naked mole-rat  =======
         Cape elephant shrew  =======
               Domestic goat  =======
B D                     Sheep  =======
B D                   Wallaby  =======
B D           Tasmanian devil  =======
B D                  Platypus  =======
  D    Spiny softshell turtle  =======
  D           Green seaturtle  =======
B D                       Cow  =======
            Tibetan antelope  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
               Big brown bat  =======
B D                       Pig  =======
          Chinese tree shrew  =======
B D                   Opossum  =======
B D                      Pika  =======
      Lesser Egyptian jerboa  =======
B D                    Tenrec  =======
B D                  Elephant  =======
                Weddell seal  =======
                Killer whale  =======
B D                   Dolphin  =======
            Cape golden mole  =======

Inserts between block 5 and 6 in window
B D                      Dog 1bp

Alignment block 6 of 424 in window, 9398916 - 9398927, 12 bps 
B D                     Human  gttc-------------tg----tagtta
B D                     Chimp  gttc-------------tg----tagtta
B D                   Gorilla  gttc-------------tg----tagtta
B D                 Orangutan  gttc-------------tg----tagtta
B D                    Gibbon  gttc-------------tg----tagtta
B D                    Rhesus  gttc-------------cg----tagtta
B D       Crab-eating macaque  gttc-------------cg----tagtta
B D                    Baboon  gttc-------------cg----tagtta
B D              Green monkey  gttc-------------tg----tagtta
B D                  Marmoset  gttc-------------tg----tagtca
B D           Squirrel monkey  gttc-------------tg----tagtta
B D                  Bushbaby  gctc-------------tg----tagtcc
B D                  Squirrel  ctgtgtagctgagtagcta----------
                 Prairie vole  cctt-------------ca----------
B D           Chinese hamster  attt-------------ca----------
B D                     Mouse  attt-------------ca----------
                   Chinchilla  gttc-------------ggagtt------
             Brush-tailed rat  gttt-------------ggcgct------
B D                    Rabbit  ga---------------------------
B D                    Alpaca  gttt-------------tg----tagttg
               Bactrian camel  attt-------------tg----tagttg
B D                     Horse  g-tt-------------tg----tcgttg
B D          White rhinoceros  attt-------------tg----ttatgg
B D                       Cat  attt-------------tg----tagttg
B D                       Dog  ctgt-------------ca----------
B D                     Panda  cttt-------------ca----tagttg
               Pacific walrus  cttc-------------ct----tagttg
             Black flying-fox  gttt-------------cg----tcgtta
B D                   Megabat  gttt-------------cg----tcgtta
B D                   Manatee  tttt-------------cg----tagtta
                     Aardvark  ttta-------------ca----tagctg
             Star-nosed mole  =============================
              Golden hamster  =============================
B D                  Hedgehog  =============================
B D                       Rat  =============================
B D                     Shrew  =============================
                 Zebra mbuna  =============================
         Pundamilia nyererei  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  =============================
B D              Nile tilapia  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
    Mexican tetra (cavefish)  =============================
                 Spotted gar  =============================
B D                Coelacanth  =============================
B D                 Zebrafish  =============================
  D                    Parrot  =============================
B D                Budgerigar  =============================
  D               Rock pigeon  =============================
          Southern platyfish  =============================
B D                    Medaka  =============================
  D              Mallard duck  =============================
B D                   Lamprey  =============================
B D                 Tetraodon  =============================
  D  Chinese softshell turtle  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
B D                   Chicken  =============================
B D       Medium ground finch  =============================
B D                    Turkey  =============================
B D             X. tropicalis  =============================
  D            Painted turtle  =============================
B D               Zebra finch  =============================
B D              Atlantic cod  =============================
  D       Collared flycatcher  =============================
B D        American alligator  =============================
          Tibetan ground jay  =============================
  D             Scarlet macaw  =============================
B D                    Lizard  =============================
  D    White-throated sparrow  =============================
B D               Stickleback  =============================
B D                Guinea pig  =============================
B D            Naked mole-rat  =============================
         Cape elephant shrew  =============================
               Domestic goat  =============================
B D                     Sheep  =============================
B D                   Wallaby  =============================
B D           Tasmanian devil  =============================
B D                  Platypus  =============================
  D    Spiny softshell turtle  =============================
  D           Green seaturtle  =============================
B D                       Cow  =============================
            Tibetan antelope  =============================
B D                  Microbat  =============================
        David's myotis (bat)  =============================
               Big brown bat  =============================
B D                       Pig  =============================
          Chinese tree shrew  =============================
B D                   Opossum  =============================
B D                      Pika  =============================
B D                   Ferret   -----------------------------
      Lesser Egyptian jerboa  =============================
B D                    Tenrec  =============================
B D                 Armadillo  -----------------------------
B D                  Elephant  =============================
                Weddell seal  =============================
                Killer whale  =============================
B D                   Dolphin  =============================
            Cape golden mole  =============================

Inserts between block 6 and 7 in window
B D                 Squirrel 11bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                    Mouse 5bp

Alignment block 7 of 424 in window, 9398928 - 9398948, 21 bps 
B D                     Human  gggatgact--------gccggcca-gggg
B D                     Chimp  gggatgact--------gccggcca-gggg
B D                   Gorilla  gggatgact--------gccagccaggggg
B D                 Orangutan  gggatgact--------gccggcca-gggg
B D                    Gibbon  gggatgact--------gcaggcta-aggg
B D                    Rhesus  gggatgact--------gcaggcga-gggg
B D       Crab-eating macaque  gggatgact--------gcaggcga-gggg
B D                    Baboon  gggatgact--------gcaggcga-gggg
B D              Green monkey  gggatgact--------gcaggcga--ggg
B D                  Marmoset  gggatgact--------gcgggcca-gcgg
B D           Squirrel monkey  ggggtgact--------gtgggcca-gcag
B D                  Bushbaby  agggtgatt--------gcagacta--gat
B D                  Squirrel  gag-tggct--------gctggcga-gg--
                 Prairie vole  ----tgacc--------acagagta-ggtt
B D           Chinese hamster  ----tgacc--------gagaagta-ggaa
B D                     Mouse  gagttgacc--------acagaata-ggaa
B D                       Rat  gagatgacc--------atagagta-ggaa
                   Chinchilla  ggggtgac---------tgaggcca-gg--
             Brush-tailed rat  ggggtgactcccggccatcaggctg-gg--
B D                    Rabbit  ggggcgagg--------gctgacag-gg--
B D                    Alpaca  ggga-------------gatgacaa-agg-
               Bactrian camel  ggga-------------gatgacaa-agg-
B D                     Horse  gggatgact--------gaaggcga-aggg
B D          White rhinoceros  ggagtaact--------gaaggcaa-aggg
B D                       Cat  ggagtgatg--------aaaggcaa-aggg
B D                       Dog  ------act--------aaaggcag-aggg
B D                     Panda  ggggtgact--------gaaggcaa-aggg
               Pacific walrus  ggggtgact--------aaaggcaa-aggg
             Black flying-fox  g------cc--------agaggcgc-gggg
B D                   Megabat  g------cc--------agaggcgc-aggg
B D                   Manatee  gggatgact--------gaaggcta-aggg
                     Aardvark  gggatgatt--------gaaggcca-aggg
B D                 Armadillo  ------gtt--------gatggctg-acgg
             Star-nosed mole  ==============================
              Golden hamster  ==============================
B D                  Hedgehog  ==============================
B D                     Shrew  ==============================
                 Zebra mbuna  ==============================
         Pundamilia nyererei  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D              Nile tilapia  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
    Mexican tetra (cavefish)  ==============================
                 Spotted gar  ==============================
B D                Coelacanth  ==============================
B D                 Zebrafish  ==============================
  D                    Parrot  ==============================
B D                Budgerigar  ==============================
  D               Rock pigeon  ==============================
          Southern platyfish  ==============================
B D                    Medaka  ==============================
  D              Mallard duck  ==============================
B D                   Lamprey  ==============================
B D                 Tetraodon  ==============================
  D  Chinese softshell turtle  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                   Chicken  ==============================
B D       Medium ground finch  ==============================
B D                    Turkey  ==============================
B D             X. tropicalis  ==============================
  D            Painted turtle  ==============================
B D               Zebra finch  ==============================
B D              Atlantic cod  ==============================
  D       Collared flycatcher  ==============================
B D        American alligator  ==============================
          Tibetan ground jay  ==============================
  D             Scarlet macaw  ==============================
B D                    Lizard  ==============================
  D    White-throated sparrow  ==============================
B D               Stickleback  ==============================
B D                Guinea pig  ==============================
B D            Naked mole-rat  ==============================
         Cape elephant shrew  ==============================
               Domestic goat  ==============================
B D                     Sheep  ==============================
B D                   Wallaby  ==============================
B D           Tasmanian devil  ==============================
B D                  Platypus  ==============================
  D    Spiny softshell turtle  ==============================
  D           Green seaturtle  ==============================
B D                       Cow  ==============================
            Tibetan antelope  ==============================
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
               Big brown bat  ==============================
B D                       Pig  ==============================
          Chinese tree shrew  ==============================
B D                   Opossum  ==============================
B D                      Pika  ==============================
B D                   Ferret   ------------------------------
      Lesser Egyptian jerboa  ==============================
B D                    Tenrec  ==============================
B D                  Elephant  ==============================
                Weddell seal  ==============================
                Killer whale  ==============================
B D                   Dolphin  ==============================
            Cape golden mole  ==============================

Inserts between block 7 and 8 in window
B D                      Cat 200bp

Alignment block 8 of 424 in window, 9398949 - 9398964, 16 bps 
B D                     Human  gtcagccagg-----tcagtg
B D                     Chimp  gtcagccagg-----tcagtg
B D                   Gorilla  gtcagccagg-----tcagtc
B D                 Orangutan  atcagccagg-----tcagtg
B D                    Gibbon  gtcagccagg-----tcagtg
B D                    Rhesus  gtcagcctgg-----tcagtg
B D       Crab-eating macaque  gtcagcctgg-----tcagtg
B D                    Baboon  gtcagcctgg-----tcagtg
B D              Green monkey  gtcagcctgg-----tcagtg
B D                  Marmoset  gtcagccagg-----tcaggg
B D           Squirrel monkey  gtcagccagg-----tcaggg
B D                  Bushbaby  cccggccagg-----gcagct
B D                  Squirrel  ---ggcagcc-----aga---
                 Prairie vole  gtcggcaaca-----cagct-
B D           Chinese hamster  gttggccgct-----cggct-
B D                     Mouse  gttggccact-----ccact-
B D                       Rat  gttggctact-----ccact-
                   Chinchilla  gtcagcc--------------
             Brush-tailed rat  gtcagcc--------------
B D                    Alpaca  atccgcaggc-----tcagca
               Bactrian camel  atccgcaggc-----tcagca
B D                     Horse  gtgagca-ag-----tcagtg
B D          White rhinoceros  atcagca-gg-----tcgtcg
B D                       Cat  gccacccaggcgcccccagca
B D                       Dog  --------gg-----tcaatg
B D                     Panda  --------gg-----gcagca
               Pacific walrus  --------gg----agcaata
             Black flying-fox  accagcagag-----tcagcg
B D                   Megabat  accagcagag-----tcggcg
B D                   Manatee  gttggcaggc-----tcagtg
                     Aardvark  gttggcagga-----tcagta
B D                 Armadillo  gttggca--------tca---
             Star-nosed mole  =====================
              Golden hamster  =====================
B D                  Hedgehog  =====================
B D                     Shrew  =====================
                 Zebra mbuna  =====================
         Pundamilia nyererei  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
    Mexican tetra (cavefish)  =====================
                 Spotted gar  =====================
B D                Coelacanth  =====================
B D                 Zebrafish  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
  D               Rock pigeon  =====================
          Southern platyfish  =====================
B D                    Medaka  =====================
  D              Mallard duck  =====================
B D                   Lamprey  =====================
B D                 Tetraodon  =====================
  D  Chinese softshell turtle  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D                   Chicken  =====================
B D       Medium ground finch  =====================
B D                    Turkey  =====================
B D             X. tropicalis  =====================
  D            Painted turtle  =====================
B D               Zebra finch  =====================
B D              Atlantic cod  =====================
  D       Collared flycatcher  =====================
B D        American alligator  =====================
          Tibetan ground jay  =====================
  D             Scarlet macaw  =====================
B D                    Lizard  =====================
  D    White-throated sparrow  =====================
B D               Stickleback  =====================
B D                Guinea pig  =====================
B D            Naked mole-rat  =====================
         Cape elephant shrew  =====================
               Domestic goat  =====================
B D                     Sheep  =====================
B D                   Wallaby  =====================
B D           Tasmanian devil  =====================
B D                  Platypus  =====================
  D    Spiny softshell turtle  =====================
  D           Green seaturtle  =====================
B D                       Cow  =====================
            Tibetan antelope  =====================
B D                  Microbat  =====================
        David's myotis (bat)  =====================
               Big brown bat  =====================
B D                       Pig  =====================
          Chinese tree shrew  =====================
B D                    Rabbit  ---------------------
B D                   Opossum  =====================
B D                      Pika  =====================
B D                   Ferret   ---------------------
      Lesser Egyptian jerboa  =====================
B D                    Tenrec  =====================
B D                  Elephant  =====================
                Weddell seal  =====================
                Killer whale  =====================
B D                   Dolphin  =====================
            Cape golden mole  =====================

Alignment block 9 of 424 in window, 9398965 - 9398993, 29 bps 
B D                     Human  tagtgatgtctgcagagaca--tt-tacaccc
B D                     Chimp  tagtgatgtctgcagagaca--tt-tacaccc
B D                   Gorilla  taatgatgtctgcagagaca--tt-tacaccc
B D                 Orangutan  taatgatgtctgcagagaca--tt-tacaccc
B D                    Gibbon  taatgatgtctgcagagaca--tt-tacaccc
B D                    Rhesus  taatgatgtctgcagagaca--tt-tacaccc
B D       Crab-eating macaque  taatgatgtctgcagacaca--tt-tacaccc
B D                    Baboon  taatgatgtctgcagagaca--tt-tacaccc
B D              Green monkey  taatgatgtctgcagagaca--tt-tacaccc
B D                  Marmoset  gaatgatgtctgt--agaca--tt-gacaccc
B D           Squirrel monkey  gaatgatgtctatagagaca--tt-tacatcc
B D                  Bushbaby  tcatgatgtctgctgagaca--tt-tacacac
B D                  Squirrel  ----agggtctgct-ggaca--ct-tacctcc
                 Prairie vole  -tataatgtctgctaggaca--ta-tgtgccc
B D           Chinese hamster  tcataatgtctgctaggatg--tt-tgtgccc
               Golden hamster  tagtaatgtctgctaggatg--tt-tgtgccc
B D                     Mouse  taatagtgtctgctaggaca--ta-cacgccc
B D                       Rat  taataccgtctgctagggca--ta-cacgcct
                   Chinchilla  tgacgatgtttgtcaaggcg--tg-tataccc
             Brush-tailed rat  tcatgatgtctgctgaggcg--tg-tacaccc
B D                    Rabbit  --------tctgcg-agaca--tg-catgccc
B D                    Alpaca  tgat---ttctatcttgatg--tt--------
               Bactrian camel  tgat---ttctgtcttgatg--tt--------
B D                     Horse  tgatggtttctctcttgaca--tt--------
B D          White rhinoceros  tgatgatttctctcctgaca--tt--------
B D                       Cat  tggtgatttctgtcttgaca--tt--------
B D                       Dog  tgatgactcctgtcttggca--tt--------
B D                     Panda  tgatgatttctgtcttgaca--tc--------
               Pacific walrus  tgatgacttctgtcttgaca--tt--------
             Black flying-fox  tgatgagctctgtctcgaca--ct--------
B D                   Megabat  tgatgagctctgtctcgaca--ct--------
B D                   Manatee  tgataat-tctgttgagaca--gtacacacca
                     Aardvark  caaggat-cctcttgagagatgttacatgcca
B D                 Armadillo  --------tttcttgagaca--tctcacacca
             Star-nosed mole  ================================
B D                  Hedgehog  ================================
B D                     Shrew  ================================
                 Zebra mbuna  ================================
         Pundamilia nyererei  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D              Nile tilapia  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
    Mexican tetra (cavefish)  ================================
                 Spotted gar  ================================
B D                Coelacanth  ================================
B D                 Zebrafish  ================================
  D                    Parrot  ================================
B D                Budgerigar  ================================
  D               Rock pigeon  ================================
          Southern platyfish  ================================
B D                    Medaka  ================================
  D              Mallard duck  ================================
B D                   Lamprey  ================================
B D                 Tetraodon  ================================
  D  Chinese softshell turtle  ================================
      Yellowbelly pufferfish  ================================
B D                      Fugu  ================================
B D                   Chicken  ================================
B D       Medium ground finch  ================================
B D                    Turkey  ================================
B D             X. tropicalis  ================================
  D            Painted turtle  ================================
B D               Zebra finch  ================================
B D              Atlantic cod  ================================
  D       Collared flycatcher  ================================
B D        American alligator  ================================
          Tibetan ground jay  ================================
  D             Scarlet macaw  ================================
B D                    Lizard  ================================
  D    White-throated sparrow  ================================
B D               Stickleback  ================================
B D                Guinea pig  ================================
B D            Naked mole-rat  ================================
         Cape elephant shrew  ================================
               Domestic goat  ================================
B D                     Sheep  ================================
B D                   Wallaby  ================================
B D           Tasmanian devil  ================================
B D                  Platypus  ================================
  D    Spiny softshell turtle  ================================
  D           Green seaturtle  ================================
B D                       Cow  ================================
            Tibetan antelope  ================================
B D                  Microbat  ================================
        David's myotis (bat)  ================================
               Big brown bat  ================================
B D                       Pig  ================================
          Chinese tree shrew  ================================
B D                   Opossum  ================================
B D                      Pika  ================================
B D                   Ferret   --------------------------------
      Lesser Egyptian jerboa  ================================
B D                    Tenrec  ================================
B D                  Elephant  ================================
                Weddell seal  ================================
                Killer whale  ================================
B D                   Dolphin  ================================
            Cape golden mole  ================================

Alignment block 10 of 424 in window, 9398994 - 9399019, 26 bps 
B D                     Human  agagacacagatggaa------aaca--aat------ggc
B D                     Chimp  agagacacagatggaa------aaca--aat------ggc
B D                   Gorilla  agagacacagatggaa------aaca--aat------ggc
B D                 Orangutan  agagacattgatggaa------aaca--aac------ggc
B D                    Gibbon  agagacattgatggaa------aaca--aat------ggc
B D                    Rhesus  agagacattgatggaa------aaca--aat------ggc
B D       Crab-eating macaque  agagacattgatggaa------aaca--aat------ggc
B D                    Baboon  agagacattgatggaa------aaca--aat------ggc
B D              Green monkey  agagacattgatggaa------aaca--aat------ggc
B D                  Marmoset  agacacatggatggaa------aaca--aat------ggc
B D           Squirrel monkey  agagacatggatggaa------aaca--aat------ggc
B D                  Bushbaby  aacaacattgatgagg------atca--aat------ggc
B D                  Squirrel  agagcc---ggtgcag------ataagtgat---------
                 Prairie vole  agaggc---agtgggg------atca--agt---------
B D           Chinese hamster  agaggc---agtggga------atca--aat---------
               Golden hamster  agaggc---agtggga------atca--cat---------
B D                     Mouse  agaggc---agtggga------atca--aac---------
B D                       Rat  agaggc---agtggga------atca--aat---------
                   Chinchilla  agagat---gatgcag------atta--aacggt------
             Brush-tailed rat  agagag---gatggag------atta--aacgat------
B D                    Rabbit  agagacgctgctggag------ccca--gat---ggc---
B D                       Pig  ------aaggaaagaaaaaaacagca--aat------ggc
B D                    Alpaca  ---------gatggaa------aaca--aat------ggt
               Bactrian camel  ---------gatggaa------agca--aat------ggt
B D                     Horse  ---------gatggaa------atca--aat------gac
B D          White rhinoceros  ---------gatggaa------atca--gat------gac
B D                       Cat  ---------gacggga------atca--aat------gac
B D                       Dog  ---------gatggaa------gtca--aat------ggc
B D                     Panda  ---------gatggaa------atca--cat------ggt
               Pacific walrus  ---------gatggaa------gtca--cac------ggc
             Black flying-fox  ---------ggcagga------atca--gac------gac
B D                   Megabat  ---------ggcggga------atca--gac------gac
B D                   Manatee  ggagtcattgatggaa------atca--agt------ggc
                     Aardvark  ggagacattgatggga------atca--aat------ggt
B D                 Armadillo  agagatattga-------------------t------ggt
             Star-nosed mole  ========================================
B D                  Hedgehog  ========================================
B D                     Shrew  ========================================
                 Zebra mbuna  ========================================
         Pundamilia nyererei  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D              Nile tilapia  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
    Mexican tetra (cavefish)  ========================================
                 Spotted gar  ========================================
B D                Coelacanth  ========================================
B D                 Zebrafish  ========================================
  D                    Parrot  ========================================
B D                Budgerigar  ========================================
  D               Rock pigeon  ========================================
          Southern platyfish  ========================================
B D                    Medaka  ========================================
  D              Mallard duck  ========================================
B D                   Lamprey  ========================================
B D                 Tetraodon  ========================================
  D  Chinese softshell turtle  ========================================
      Yellowbelly pufferfish  ========================================
B D                      Fugu  ========================================
B D                   Chicken  ========================================
B D       Medium ground finch  ========================================
B D                    Turkey  ========================================
B D             X. tropicalis  ========================================
  D            Painted turtle  ========================================
B D               Zebra finch  ========================================
B D              Atlantic cod  ========================================
  D       Collared flycatcher  ========================================
B D        American alligator  ========================================
          Tibetan ground jay  ========================================
  D             Scarlet macaw  ========================================
B D                    Lizard  ========================================
  D    White-throated sparrow  ========================================
B D               Stickleback  ========================================
B D                Guinea pig  ========================================
B D            Naked mole-rat  ========================================
         Cape elephant shrew  ========================================
               Domestic goat  ========================================
B D                     Sheep  ========================================
B D                   Wallaby  ========================================
B D           Tasmanian devil  ========================================
B D                  Platypus  ========================================
  D    Spiny softshell turtle  ========================================
  D           Green seaturtle  ========================================
B D                       Cow  ========================================
            Tibetan antelope  ========================================
B D                  Microbat  ========================================
        David's myotis (bat)  ========================================
               Big brown bat  ========================================
          Chinese tree shrew  ========================================
B D                   Opossum  ========================================
B D                      Pika  ========================================
B D                   Ferret   ----------------------------------------
      Lesser Egyptian jerboa  ========================================
B D                    Tenrec  ========================================
B D                  Elephant  ========================================
                Weddell seal  ========================================
                Killer whale  ========================================
B D                   Dolphin  ========================================
            Cape golden mole  ========================================

Inserts between block 10 and 11 in window
                  Chinchilla 137bp
B D                   Rabbit 59bp

Alignment block 11 of 424 in window, 9399020 - 9399056, 37 bps 
B D                     Human  tagactggtcaaatggga-ggggtctttgtt--ttatgga
B D                     Chimp  tagactggtcaaatggga-ggggtctttgtt--ttatgga
B D                   Gorilla  tagactggtcaaatggga-ggggtctttgtt--ttatgga
B D                 Orangutan  tagactggtcaaatggga-ggggtctttgtt--ttatgga
B D                    Gibbon  tagacgggtcaaatggga-ggggtctttgtt--ttatgga
B D                    Rhesus  cagactggtcaaatggga-ggggtc-----t--ttatgga
B D       Crab-eating macaque  cagactggtcaaatggga-ggggtc-----t--ttatgga
B D                    Baboon  cagactggtcaaatggga-ggggtc-----t--ttatgga
B D              Green monkey  cagactggtcaaatggga-ggggtc-----t--ttatgga
B D                  Marmoset  cagactggtcaaatggga-ggggtctgtgtt--ttatg--
B D           Squirrel monkey  cagactggtcaaatggga-ggggtctgtgtt--ttatg--
B D                  Bushbaby  aagactggccaggtgtgt-ggggccttcatt--tttagg-
B D                  Squirrel  -----------------g-aggctgtcaggt--gggtgg-
                 Prairie vole  -----------------t-gggtc------t--ttatgg-
B D           Chinese hamster  -----------------t-aggtctttgctt--ttatgg-
               Golden hamster  -----------------t-gagactttgctt--ttatgg-
B D                     Mouse  -----------------t-gaaacttggctc--gtatga-
B D                       Rat  -----------------g-gagccttggctt--ttatgg-
             Brush-tailed rat  --ggc--accatatttcg-tgggcctccttt--ttagg--
B D                       Pig  gagactggtcagacttgt-gggaccttccct--t------
B D                    Alpaca  gagactggtcagactggtgggggccttcgct--t------
               Bactrian camel  gggactggtcagactggt-ggggccttcgct--t------
B D                     Horse  ------agtcagactgg--ggggccatcact--t------
B D          White rhinoceros  gagactggtcagactggt-ggggccttcgct--t------
B D                       Cat  gagacgggtcagatgagt-ggggccttcaca--c------
B D                       Dog  aggacccattgggtc-ct-ggggcctttgct--t------
B D                     Panda  aagacctgtcagatgggt-ggagccttcact--t------
               Pacific walrus  gagacctgtcaggtcggt-ggggccttcact--t------
             Black flying-fox  gggactggtcagattggc-gaggccttcagg--g------
B D                   Megabat  gggactggtcagattggc-agggccttcagg--g------
B D                   Manatee  aaggctgatcacattggt-gggatctttacttgttatg--
                     Aardvark  gaggctaatc------------------gcttgtcaag--
B D                 Armadillo  ggggcctctt-----------------------ttatg--
             Star-nosed mole  ========================================
B D                  Hedgehog  ========================================
B D                     Shrew  ========================================
                 Zebra mbuna  ========================================
         Pundamilia nyererei  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D              Nile tilapia  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
    Mexican tetra (cavefish)  ========================================
                 Spotted gar  ========================================
B D                Coelacanth  ========================================
B D                 Zebrafish  ========================================
  D                    Parrot  ========================================
B D                Budgerigar  ========================================
  D               Rock pigeon  ========================================
          Southern platyfish  ========================================
B D                    Medaka  ========================================
  D              Mallard duck  ========================================
B D                   Lamprey  ========================================
B D                 Tetraodon  ========================================
  D  Chinese softshell turtle  ========================================
      Yellowbelly pufferfish  ========================================
B D                      Fugu  ========================================
B D                   Chicken  ========================================
B D       Medium ground finch  ========================================
B D                    Turkey  ========================================
B D             X. tropicalis  ========================================
  D            Painted turtle  ========================================
B D               Zebra finch  ========================================
B D              Atlantic cod  ========================================
  D       Collared flycatcher  ========================================
B D        American alligator  ========================================
          Tibetan ground jay  ========================================
  D             Scarlet macaw  ========================================
B D                    Lizard  ========================================
  D    White-throated sparrow  ========================================
B D               Stickleback  ========================================
B D                Guinea pig  ========================================
B D            Naked mole-rat  ========================================
                  Chinchilla  ========================================
         Cape elephant shrew  ========================================
               Domestic goat  ========================================
B D                     Sheep  ========================================
B D                   Wallaby  ========================================
B D           Tasmanian devil  ========================================
B D                  Platypus  ========================================
  D    Spiny softshell turtle  ========================================
  D           Green seaturtle  ========================================
B D                       Cow  ========================================
            Tibetan antelope  ========================================
B D                  Microbat  ========================================
        David's myotis (bat)  ========================================
               Big brown bat  ========================================
          Chinese tree shrew  ========================================
B D                    Rabbit  ========================================
B D                   Opossum  ========================================
B D                      Pika  ========================================
B D                   Ferret   ----------------------------------------
      Lesser Egyptian jerboa  ========================================
B D                    Tenrec  ========================================
B D                  Elephant  ========================================
                Weddell seal  ========================================
                Killer whale  ========================================
B D                   Dolphin  ========================================
            Cape golden mole  ========================================

Alignment block 12 of 424 in window, 9399057 - 9399070, 14 bps 
B D                     Human  ataaaacaaagttc
B D                     Chimp  ataaaacaaagttc
B D                   Gorilla  ataaaacaaagttc
B D                 Orangutan  ataaaacgaagttc
B D                    Gibbon  ataaaacagagttc
B D                    Rhesus  ataaaacaaagttc
B D       Crab-eating macaque  ataaaacaaagttc
B D                    Baboon  ataaaacaaagttc
B D              Green monkey  ataaaacaaagttc
B D                  Marmoset  -------------c
B D           Squirrel monkey  -------------c
B D                  Bushbaby  -------------c
                   Chinchilla  ------------ac
             Brush-tailed rat  -------------c
B D                       Pig  ----------attt
B D                    Alpaca  ----------gttt
               Bactrian camel  ----------gttt
B D                     Horse  ----------gtta
B D          White rhinoceros  ----------gtta
B D                       Cat  ----------gtta
B D                       Dog  ----------gtca
B D                     Panda  ----------gtta
               Pacific walrus  ----------ggta
             Black flying-fox  ----------gtca
B D                   Megabat  ----------gtca
B D                   Manatee  -------------c
                     Aardvark  -------------c
B D                 Armadillo  -------------c
             Star-nosed mole  ==============
              Golden hamster  --------------
B D                  Hedgehog  ==============
B D                       Rat  --------------
B D                     Shrew  ==============
B D                     Mouse  --------------
                 Zebra mbuna  ==============
         Pundamilia nyererei  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
    Mexican tetra (cavefish)  ==============
                 Spotted gar  ==============
B D                Coelacanth  ==============
B D                 Zebrafish  ==============
  D                    Parrot  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
          Southern platyfish  ==============
B D                    Medaka  ==============
  D              Mallard duck  ==============
B D                   Lamprey  ==============
B D                 Tetraodon  ==============
  D  Chinese softshell turtle  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                    Turkey  ==============
B D             X. tropicalis  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
B D              Atlantic cod  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
  D             Scarlet macaw  ==============
B D                    Lizard  ==============
  D    White-throated sparrow  ==============
B D               Stickleback  ==============
B D                Guinea pig  ==============
B D            Naked mole-rat  ==============
B D                  Squirrel  --------------
                Prairie vole  --------------
         Cape elephant shrew  ==============
B D           Chinese hamster  --------------
               Domestic goat  ==============
B D                     Sheep  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
B D                  Platypus  ==============
  D    Spiny softshell turtle  ==============
  D           Green seaturtle  ==============
B D                       Cow  ==============
            Tibetan antelope  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
               Big brown bat  ==============
          Chinese tree shrew  ==============
B D                    Rabbit  ==============
B D                   Opossum  ==============
B D                      Pika  ==============
B D                   Ferret   --------------
      Lesser Egyptian jerboa  ==============
B D                    Tenrec  ==============
B D                  Elephant  ==============
                Weddell seal  ==============
                Killer whale  ==============
B D                   Dolphin  ==============
            Cape golden mole  ==============

Inserts between block 12 and 13 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 5bp
B D                    Panda 3bp
              Pacific walrus 3bp
            Black flying-fox 1bp
B D                  Megabat 3bp

Alignment block 13 of 424 in window, 9399071 - 9399089, 19 bps 
B D                     Human  cttttcagttcctt------------cagcg
B D                     Chimp  cttttcagttcctt------------cagag
B D                   Gorilla  cttttcagttcctt------------cagag
B D                 Orangutan  cttttcagttcctt------------ccgag
B D                    Gibbon  cttttcagttcatt------------cagag
B D                    Rhesus  cttttcagttcctt------------caaag
B D       Crab-eating macaque  cttttcagttcctt------------caaag
B D                    Baboon  cttttcagttcctt------------caaag
B D              Green monkey  cttttcagttcctt------------caaag
B D                  Marmoset  cttttcagttcctt------------gaaag
B D           Squirrel monkey  cttttcagttcctt------------gaaag
B D                  Bushbaby  cctttcactgtctt------------gaaca
B D                  Squirrel  gccctttgcttctt-----------tgaaag
                 Prairie vole  tttttcagcccctt------------gaaaa
B D           Chinese hamster  tttctcagcccctt------------gaaaa
               Golden hamster  tttgtcaacccctt------------gaaaa
B D                     Mouse  ttt-tcagtccctt-----ggggaaaaaaaa
B D                       Rat  ttt-tcagcccttt-------ggaaaaaaaa
                   Chinchilla  atagcaagatcctgtctca------------
             Brush-tailed rat  cttttcagttcctt-----------------
B D                       Pig  -tttttagttcctt------------gaaaa
B D                    Alpaca  ttttttagttcctt------------gaaaa
               Bactrian camel  ttttttagttcctt------------gaaaa
B D                     Horse  atttttagttcctt------------gaaaa
B D          White rhinoceros  ctttttagttcctt------------gaaaa
B D                       Cat  cttttaagttcctt------------gaaaa
B D                       Dog  --ttttaatttctg------------gaaaa
B D                   Ferret   cttttcagtttctt------------gaaaa
B D                     Panda  cttctgagtttctt------------gaaaa
               Pacific walrus  gttgttagtttctt------------gaaag
             Black flying-fox  ttcagtagttcctt------------ggaaa
B D                   Megabat  ctttttagttcctt------------ggaaa
B D                   Manatee  ttt-----ttcctt------------gaaaa
                     Aardvark  tttttcagttcctg------------gaaaa
B D                 Armadillo  cgtttcatttcctc-------------aaaa
             Star-nosed mole  ===============================
B D                  Hedgehog  ===============================
B D                     Shrew  ===============================
                 Zebra mbuna  ===============================
         Pundamilia nyererei  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D              Nile tilapia  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
    Mexican tetra (cavefish)  ===============================
                 Spotted gar  ===============================
B D                Coelacanth  ===============================
B D                 Zebrafish  ===============================
  D                    Parrot  ===============================
B D                Budgerigar  ===============================
  D               Rock pigeon  ===============================
          Southern platyfish  ===============================
B D                    Medaka  ===============================
  D              Mallard duck  ===============================
B D                   Lamprey  ===============================
B D                 Tetraodon  ===============================
  D  Chinese softshell turtle  ===============================
      Yellowbelly pufferfish  ===============================
B D                      Fugu  ===============================
B D                   Chicken  ===============================
B D       Medium ground finch  ===============================
B D                    Turkey  ===============================
B D             X. tropicalis  ===============================
  D            Painted turtle  ===============================
B D               Zebra finch  ===============================
B D              Atlantic cod  ===============================
  D       Collared flycatcher  ===============================
B D        American alligator  ===============================
          Tibetan ground jay  ===============================
  D             Scarlet macaw  ===============================
B D                    Lizard  ===============================
  D    White-throated sparrow  ===============================
B D               Stickleback  ===============================
B D                Guinea pig  ===============================
B D            Naked mole-rat  ===============================
         Cape elephant shrew  ===============================
               Domestic goat  ===============================
B D                     Sheep  ===============================
B D                   Wallaby  ===============================
B D           Tasmanian devil  ===============================
B D                  Platypus  ===============================
  D    Spiny softshell turtle  ===============================
  D           Green seaturtle  ===============================
B D                       Cow  ===============================
            Tibetan antelope  ===============================
B D                  Microbat  ===============================
        David's myotis (bat)  ===============================
               Big brown bat  ===============================
          Chinese tree shrew  ===============================
B D                    Rabbit  ===============================
B D                   Opossum  ===============================
B D                      Pika  ===============================
      Lesser Egyptian jerboa  ===============================
B D                    Tenrec  ===============================
B D                  Elephant  ===============================
                Weddell seal  ===============================
                Killer whale  ===============================
B D                   Dolphin  ===============================
            Cape golden mole  ===============================

Alignment block 14 of 424 in window, 9399090 - 9399111, 22 bps 
B D                     Human  t---atgagcaaa------ac--cc-----------atgt-g-atg
B D                     Chimp  t---atgagcaaa------ac--cc-----------atgt-g-atg
B D                   Gorilla  t---atgagcaaa------ac--cc-----------atgt-g-atg
B D                 Orangutan  t---atgagcaaa------at--cc-----------atgt-g-atg
B D                    Gibbon  t---atgagcaaa------ac--cc-----------gtgtgg-atg
B D                    Rhesus  t---atgagcaaa------ac--cc-----------acgt-g-atg
B D       Crab-eating macaque  t---atgagcaaa------ac--cc-----------acgt-g-atg
B D                    Baboon  t---atgagcaaa------ac--cc-----------acgt-g-atg
B D              Green monkey  t---atgagcaaa------ac--tc-----------acgt-g-atg
B D                  Marmoset  t---atgagcaaa------gc--ca-----------atgt-g-atg
B D           Squirrel monkey  t---atgaacaaa------ac--ca-----------atgt-g-atg
B D                  Bushbaby  t---gggagcaaa------ac--ca-----------ttgt-c-at-
B D                  Squirrel  c---aataacaaa------ac--ca-----------gtgt-g-gca
                 Prairie vole  t---aagaataca------ac--ca-----------a-gt-t-gtg
B D           Chinese hamster  t---taggaaaca------ac--ca-----------a-gc-c-atg
               Golden hamster  c---tagaaaaca------at--ca-----------a-gc-c--tg
B D                     Mouse  t---aagactata------ac--ca-----------a-gt-c-tcg
B D                       Rat  t---aagaataca------ac--ca-----------a-ga-c-ttg
B D            Naked mole-rat  t---aagagtcaa------aa--ca-----------gcgt-c-att
                   Chinchilla  -aaaaagagtaaa------ac--ca-----------gtgt-c-atg
             Brush-tailed rat  ----aaaaataag------aa--cagatggtactgggtgt-g-gtg
B D                       Pig  c---ttgagaaaatcagtgagctca-----------gtgt-t-gtg
B D                    Alpaca  c---atgagcaaa------ag--ca-----------gtgt-t-at-
               Bactrian camel  c---atgagcaaa------ag--ta-----------gtgt-t-gt-
B D                     Horse  t---atgagcaaa------at--ca-----------gtgt-t-ctg
B D          White rhinoceros  t---atgagcaaa------at--ca-------------gt-t-atg
B D                       Cat  t---aggtgtcaa------at--ca-----------gtgc-c-atg
B D                       Dog  t---atacataag------at--ca-----------gtgt-t-atg
B D                   Ferret   t---aggcataaa------ct--ca-----------gtgt-t-atg
B D                     Panda  t---aggcgtaaa------c------------------------tg
               Pacific walrus  t---a-tcgtaaa------ct--ca-----------gtgc-a-atg
             Black flying-fox  t---gtgagcaaa------gt--ca-----------gtgt-c-gcg
B D                   Megabat  t---gtgagcaaa------gt--ca-----------gtgt-c-gcg
B D                   Manatee  t---atgagcaaa------at--ca-----------atgc-t-gtg
                     Aardvark  t---atgagcaaa------at--ca-----------gtgt-taagg
B D                 Armadillo  t---ataagcaaa------at--cc-----------atgt-t-ctg
             Star-nosed mole  ==============================================
B D                  Hedgehog  ==============================================
B D                     Shrew  ==============================================
                 Zebra mbuna  ==============================================
         Pundamilia nyererei  ==============================================
       Burton's mouthbreeder  ==============================================
         Princess of Burundi  ==============================================
B D              Nile tilapia  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
    Mexican tetra (cavefish)  ==============================================
                 Spotted gar  ==============================================
B D                Coelacanth  ==============================================
B D                 Zebrafish  ==============================================
  D                    Parrot  ==============================================
B D                Budgerigar  ==============================================
  D               Rock pigeon  ==============================================
          Southern platyfish  ==============================================
B D                    Medaka  ==============================================
  D              Mallard duck  ==============================================
B D                   Lamprey  ==============================================
B D                 Tetraodon  ==============================================
  D  Chinese softshell turtle  ==============================================
      Yellowbelly pufferfish  ==============================================
B D                      Fugu  ==============================================
B D                   Chicken  ==============================================
B D       Medium ground finch  ==============================================
B D                    Turkey  ==============================================
B D             X. tropicalis  ==============================================
  D            Painted turtle  ==============================================
B D               Zebra finch  ==============================================
B D              Atlantic cod  ==============================================
  D       Collared flycatcher  ==============================================
B D        American alligator  ==============================================
          Tibetan ground jay  ==============================================
  D             Scarlet macaw  ==============================================
B D                    Lizard  ==============================================
  D    White-throated sparrow  ==============================================
B D               Stickleback  ==============================================
B D                Guinea pig  ==============================================
         Cape elephant shrew  ==============================================
               Domestic goat  ==============================================
B D                     Sheep  ==============================================
B D                   Wallaby  ==============================================
B D           Tasmanian devil  ==============================================
B D                  Platypus  ==============================================
  D    Spiny softshell turtle  ==============================================
  D           Green seaturtle  ==============================================
B D                       Cow  ==============================================
            Tibetan antelope  ==============================================
B D                  Microbat  ==============================================
        David's myotis (bat)  ==============================================
               Big brown bat  ==============================================
          Chinese tree shrew  ==============================================
B D                    Rabbit  ==============================================
B D                   Opossum  ==============================================
B D                      Pika  ==============================================
      Lesser Egyptian jerboa  ==============================================
B D                    Tenrec  ==============================================
B D                  Elephant  ==============================================
                Weddell seal  ==============================================
                Killer whale  ==============================================
B D                   Dolphin  ==============================================
            Cape golden mole  ==============================================

Inserts between block 14 and 15 in window
            Brush-tailed rat 136bp

Alignment block 15 of 424 in window, 9399112 - 9399117, 6 bps 
B D                     Human  ttttct
B D                     Chimp  ttttct
B D                   Gorilla  ttttct
B D                 Orangutan  ttttct
B D                    Gibbon  ttttct
B D                    Rhesus  ttttct
B D       Crab-eating macaque  ttttct
B D                    Baboon  ttttct
B D              Green monkey  ttttct
B D                  Marmoset  ttttct
B D           Squirrel monkey  ttttct
B D                  Squirrel  tttcct
                 Prairie vole  ttcttt
B D           Chinese hamster  ttcttt
               Golden hamster  ttcttt
B D                     Mouse  ttcttc
B D                       Rat  ttcttt
B D            Naked mole-rat  ttttct
                   Chinchilla  atttct
B D                       Pig  tt----
B D                    Alpaca  tt----
               Bactrian camel  tt----
B D                     Horse  ttgcac
B D          White rhinoceros  ttttct
B D                       Cat  tttct-
B D                       Dog  ttttct
B D                   Ferret   ttttct
B D                     Panda  ttttct
               Pacific walrus  ttttct
             Black flying-fox  tttcct
B D                   Megabat  tttcct
B D                   Manatee  ttttct
                     Aardvark  ttttca
B D                 Armadillo  ttttct
             Star-nosed mole  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
    Mexican tetra (cavefish)  ======
                 Spotted gar  ======
B D                Coelacanth  ======
B D                 Zebrafish  ======
  D                    Parrot  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
          Southern platyfish  ======
B D                    Medaka  ======
  D              Mallard duck  ======
B D                   Lamprey  ======
B D                 Tetraodon  ======
  D  Chinese softshell turtle  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
B D                    Turkey  ======
B D             X. tropicalis  ======
  D            Painted turtle  ======
B D               Zebra finch  ======
B D              Atlantic cod  ======
  D       Collared flycatcher  ======
B D        American alligator  ======
          Tibetan ground jay  ======
  D             Scarlet macaw  ======
B D                    Lizard  ======
  D    White-throated sparrow  ======
B D               Stickleback  ======
B D                Guinea pig  ======
            Brush-tailed rat  ======
         Cape elephant shrew  ======
               Domestic goat  ======
B D                     Sheep  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D                  Platypus  ======
  D    Spiny softshell turtle  ======
  D           Green seaturtle  ======
B D                       Cow  ======
            Tibetan antelope  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
               Big brown bat  ======
          Chinese tree shrew  ======
B D                    Rabbit  ======
B D                   Opossum  ======
B D                      Pika  ======
      Lesser Egyptian jerboa  ======
B D                    Tenrec  ======
B D                  Elephant  ======
                Weddell seal  ======
                Killer whale  ======
B D                   Dolphin  ======
            Cape golden mole  ======
B D                  Bushbaby  ------

Inserts between block 15 and 16 in window
B D                      Dog 1bp

Alignment block 16 of 424 in window, 9399118 - 9399119, 2 bps 
B D                     Human  ct-
B D                     Chimp  ct-
B D                   Gorilla  ct-
B D                 Orangutan  ct-
B D                    Gibbon  ct-
B D                    Rhesus  ct-
B D       Crab-eating macaque  ct-
B D                    Baboon  ct-
B D              Green monkey  ct-
B D                  Marmoset  ct-
B D           Squirrel monkey  at-
B D                  Squirrel  cc-
                 Prairie vole  tc-
B D           Chinese hamster  tc-
               Golden hamster  tc-
B D                     Mouse  ac-
B D                       Rat  tc-
B D            Naked mole-rat  ct-
                   Chinchilla  ct-
B D                       Pig  -t-
B D                    Alpaca  -c-
               Bactrian camel  -c-
B D                     Horse  -t-
B D          White rhinoceros  -t-
B D                       Cat  -t-
B D                   Ferret   -t-
B D                     Panda  -t-
               Pacific walrus  -t-
             Black flying-fox  -c-
B D                   Megabat  -c-
B D                   Manatee  -tc
                     Aardvark  -tc
B D                 Armadillo  -tc
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
          Southern platyfish  ===
B D                    Medaka  ===
  D              Mallard duck  ===
B D                   Lamprey  ===
B D                 Tetraodon  ===
  D  Chinese softshell turtle  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
  D             Scarlet macaw  ===
B D                    Lizard  ===
  D    White-throated sparrow  ===
B D               Stickleback  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
         Cape elephant shrew  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                  Platypus  ===
  D    Spiny softshell turtle  ===
  D           Green seaturtle  ===
B D                       Cow  ===
            Tibetan antelope  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Big brown bat  ===
          Chinese tree shrew  ===
B D                    Rabbit  ===
B D                   Opossum  ===
B D                      Pika  ===
B D                       Dog  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                  Elephant  ===
                Weddell seal  ===
                Killer whale  ===
B D                   Dolphin  ===
            Cape golden mole  ===
B D                  Bushbaby  ---

Inserts between block 16 and 17 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                    Panda 1bp
              Pacific walrus 1bp

Alignment block 17 of 424 in window, 9399120 - 9399135, 16 bps 
B D                     Human  cccttcattctgg-gac
B D                     Chimp  cccttcattctgg-gac
B D                   Gorilla  cccttcattctgg-gac
B D                 Orangutan  cccttcattctgg-gac
B D                    Gibbon  cccttcattctgg-gac
B D                    Rhesus  cccttcgttctgg-gac
B D       Crab-eating macaque  ccgttcattctgg-gac
B D                    Baboon  cccttcattctgg-gac
B D              Green monkey  cccttcattctgg-gac
B D                  Marmoset  cccttcattctgg-gac
B D           Squirrel monkey  cccttcattctgg-gac
B D                  Bushbaby  -------ttctga-ggc
B D                  Squirrel  atgtgcattctga-gac
                 Prairie vole  cctctcatcctga-gtc
B D           Chinese hamster  ctcttcatcctga-ggc
               Golden hamster  ctcttcatcctgagggc
B D                     Mouse  ctcttcgtcctga-ggc
B D                       Rat  cttttcatcctga-ggc
B D            Naked mole-rat  ggcttcattttga-gac
                   Chinchilla  gccttcattttga-gac
B D                       Pig  acctgcatcctga-ggc
B D                    Alpaca  atctccattctgt-ggc
               Bactrian camel  atctccattctgt-ggc
B D                     Horse  atcttccttctaa-gac
B D          White rhinoceros  accttccttctga-gac
B D                       Cat  acctttgttctga-gac
B D                   Ferret   cacttctgtctga-gac
B D                     Panda  accttcggtctga-gac
             Black flying-fox  cccgtctctctga-gac
B D                   Megabat  cctgtctctctga-gac
B D                   Manatee  atcttcattctga-gac
                     Aardvark  atcttcattcaga-ggc
B D                 Armadillo  actttcactccaa-gac
             Star-nosed mole  =================
B D                  Hedgehog  =================
B D                     Shrew  =================
                 Zebra mbuna  =================
         Pundamilia nyererei  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D              Nile tilapia  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
    Mexican tetra (cavefish)  =================
                 Spotted gar  =================
B D                Coelacanth  =================
B D                 Zebrafish  =================
  D                    Parrot  =================
B D                Budgerigar  =================
  D               Rock pigeon  =================
          Southern platyfish  =================
B D                    Medaka  =================
  D              Mallard duck  =================
B D                   Lamprey  =================
B D                 Tetraodon  =================
  D  Chinese softshell turtle  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D                   Chicken  =================
B D       Medium ground finch  =================
B D                    Turkey  =================
B D             X. tropicalis  =================
  D            Painted turtle  =================
B D               Zebra finch  =================
B D              Atlantic cod  =================
  D       Collared flycatcher  =================
B D        American alligator  =================
          Tibetan ground jay  =================
  D             Scarlet macaw  =================
B D                    Lizard  =================
  D    White-throated sparrow  =================
B D               Stickleback  =================
B D                Guinea pig  =================
            Brush-tailed rat  =================
         Cape elephant shrew  =================
               Domestic goat  =================
B D                     Sheep  =================
B D                   Wallaby  =================
B D           Tasmanian devil  =================
B D                  Platypus  =================
  D    Spiny softshell turtle  =================
  D           Green seaturtle  =================
B D                       Cow  =================
            Tibetan antelope  =================
B D                  Microbat  =================
        David's myotis (bat)  =================
               Big brown bat  =================
          Chinese tree shrew  =================
B D                    Rabbit  =================
B D                   Opossum  =================
              Pacific walrus  =================
B D                      Pika  =================
B D                       Dog  =================
      Lesser Egyptian jerboa  =================
B D                    Tenrec  =================
B D                  Elephant  =================
                Weddell seal  =================
                Killer whale  =================
B D                   Dolphin  =================
            Cape golden mole  =================

Inserts between block 17 and 18 in window
B D                      Cat 1bp
B D                  Ferret  2bp
B D                    Panda 2bp

Alignment block 18 of 424 in window, 9399136 - 9399139, 4 bps 
B D                     Human  tgca
B D                     Chimp  tgca
B D                   Gorilla  tgca
B D                 Orangutan  tgca
B D                    Gibbon  tgca
B D                    Rhesus  tgta
B D       Crab-eating macaque  tgta
B D                    Baboon  tgta
B D              Green monkey  tgta
B D                  Marmoset  tgca
B D           Squirrel monkey  tgca
B D                  Bushbaby  tgct
B D                  Squirrel  -gca
                 Prairie vole  tgca
B D           Chinese hamster  tgca
               Golden hamster  tgca
B D                     Mouse  tgca
B D                       Rat  tgca
B D            Naked mole-rat  tgca
                   Chinchilla  tgca
B D                       Pig  tg--
B D                    Alpaca  tg--
               Bactrian camel  tg--
B D                     Horse  ct--
B D          White rhinoceros  ta--
B D                   Ferret   ca--
B D                     Panda  ca--
             Black flying-fox  tg--
B D                   Megabat  tg--
B D                   Manatee  tgca
                     Aardvark  taca
B D                 Armadillo  tgca
             Star-nosed mole  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
    Mexican tetra (cavefish)  ====
                 Spotted gar  ====
B D                Coelacanth  ====
B D                 Zebrafish  ====
  D                    Parrot  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
          Southern platyfish  ====
B D                    Medaka  ====
  D              Mallard duck  ====
B D                   Lamprey  ====
B D                 Tetraodon  ====
  D  Chinese softshell turtle  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
B D               Zebra finch  ====
B D              Atlantic cod  ====
  D       Collared flycatcher  ====
B D        American alligator  ====
          Tibetan ground jay  ====
  D             Scarlet macaw  ====
B D                    Lizard  ====
  D    White-throated sparrow  ====
B D               Stickleback  ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
         Cape elephant shrew  ====
               Domestic goat  ====
B D                     Sheep  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
B D                  Platypus  ====
  D    Spiny softshell turtle  ====
  D           Green seaturtle  ====
B D                       Cow  ====
            Tibetan antelope  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
               Big brown bat  ====
          Chinese tree shrew  ====
B D                    Rabbit  ====
B D                   Opossum  ====
              Pacific walrus  ====
B D                      Pika  ====
B D                       Dog  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
B D                       Cat  ====
B D                  Elephant  ====
                Weddell seal  ====
                Killer whale  ====
B D                   Dolphin  ====
            Cape golden mole  ====

Inserts between block 18 and 19 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                  Ferret  16bp
B D                    Panda 8bp

Alignment block 19 of 424 in window, 9399140 - 9399187, 48 bps 
B D                     Human  ag--cattgaggcc-agacagggttcattcc--gagcagcga-------------aggg---agtg-t-c
B D                     Chimp  ag--catcgaggcc-agacagggttcattcc--gagcagcga-------------aggg---agtg-t-c
B D                   Gorilla  ag--catcgaggcc-agacagggttcattcc--gagcagcga-------------aggg---agtg-t-c
B D                 Orangutan  ag--catcgaggcc-aggccgggttcattcc--gagcagcga-------------a-gg---agta-t-c
B D                    Gibbon  ag--catcaaagtc-agacaaggttcattcc--gagcagcaa-------------aggg---agtg-t-c
B D                    Rhesus  ag--catcgaggcc-agacagggttcattcc--gagcagcaa-------------aggg---agtg-t-c
B D       Crab-eating macaque  ag--catcgaggcc-agacagggttcattcc--gagcagcaa-------------aggg---agtg-t-c
B D                    Baboon  ag--catcgaggcc-agacagggttcattcc--gagcagcaa-------------aggg---agtg-t-c
B D              Green monkey  ag--catcgaggcc-agacagggttcattcc--gagcagcaa-------------aggg---agtg-t-c
B D                  Marmoset  ag--caacgaggcc-aggcggggttcattct--gagcagcaa-------------aggg---agtg-c-c
B D           Squirrel monkey  ag--caacgaggcc-agacggggttcattcc--gagcagcaa-------------a-gg---agtg-t-c
B D                  Bushbaby  gg--caccaaggcc-caggtgtattccattg--gggcagcac-------------agaa---ag------
B D                  Squirrel  gactcccctgctct--tggtgggtacattct--gggcagcagagggagcctctgacgga---aatg-agc
                 Prairie vole  g----accagcacc-cagacagactcact-g--gggctgcag-------------agga---agtg-a-c
B D           Chinese hamster  g----accagcacc-caaatgggctcatt-g--gggctgcag-------------agga---agtg-a-c
               Golden hamster  a----accagcacc-cggatgggctcatt-g--gggctgcag-------------agga---agtg-a-c
B D                     Mouse  ca--caccagcacc-----------cact-g--ggactgcagaggaagtgtgtgaagga---agtg-a-c
B D                       Rat  ga--caccagcacc-----------cact-g--gggctgcagaggaagtgtctgaagga---agtg-a-c
B D            Naked mole-rat  aa--caccaagacc-ccagcgggtgcattcc--aggcagcag--------------gga---agggca-c
                   Chinchilla  ga--caccaagacc-caggcgggcgcattcc--cggcagcag--------------gga---agtg-g-t
B D                       Pig  gg--ctccaaggcccagacaggctgcttc-g--gggcagcag-------------agga---agct-t-c
B D                    Alpaca  ag--caccacggcctaggcagggctcctt-t--ggacagaga-------------agga---agcg-t-c
               Bactrian camel  ag--caccacggcctaggcagggctcctt-t--gggcagaga-------------agga---agca-t-c
B D                     Horse  gg--catcaaggtcgcagccgggctttgt-tcagggca-cag-------------agga---agca-t-t
B D          White rhinoceros  gg--caccaaggccccagacgggcttcat-ccagggcagcaa-------------agga---agcg-t-t
             Black flying-fox  -g--gacagaggcc----ccgggct--------gggcagcca-------------agga---agcg-t-t
B D                   Megabat  -g--gacagaggcc----ccgggct--------gggcagcca-------------agga---agcg-t-t
B D                   Manatee  ga--ctccaaggccccagactgggccattct--gggcagcaa-------------agga----gct-t-c
                     Aardvark  ga--caccaaggccctagactaggtctttct--gggtagcaa-------------aagaggaggtg-t-c
B D                 Armadillo  gg--ccacaagg----------gttcattct--gggcagcaa-------------agaa--aacat-t-c
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
          Chinese tree shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
              Pacific walrus  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
                Weddell seal  ======================================================================
                Killer whale  ======================================================================
B D                   Dolphin  ======================================================================
            Cape golden mole  ======================================================================

                        Human  g-
                        Chimp  g-
                      Gorilla  g-
                    Orangutan  g-
                       Gibbon  --
                       Rhesus  g-
          Crab-eating macaque  g-
                       Baboon  g-
                 Green monkey  g-
                     Marmoset  t-
              Squirrel monkey  t-
                     Bushbaby  --
                     Squirrel  a-
                 Prairie vole  c-
              Chinese hamster  c-
               Golden hamster  c-
                        Mouse  t-
                          Rat  c-
               Naked mole-rat  g-
                   Chinchilla  g-
                          Pig  c-
                       Alpaca  a-
               Bactrian camel  a-
                        Horse  c-
             White rhinoceros  c-
             Black flying-fox  c-
                      Megabat  c-
                      Manatee  tg
                     Aardvark  tg
                    Armadillo  tg
              Star-nosed mole  ==
                     Hedgehog  ==
                        Shrew  ==
                  Zebra mbuna  ==
          Pundamilia nyererei  ==
        Burton's mouthbreeder  ==
          Princess of Burundi  ==
                 Nile tilapia  ==
             Peregrine falcon  ==
                 Saker falcon  ==
     Mexican tetra (cavefish)  ==
                  Spotted gar  ==
                   Coelacanth  ==
                    Zebrafish  ==
                       Parrot  ==
                   Budgerigar  ==
                  Rock pigeon  ==
           Southern platyfish  ==
                       Medaka  ==
                 Mallard duck  ==
                      Lamprey  ==
                    Tetraodon  ==
     Chinese softshell turtle  ==
       Yellowbelly pufferfish  ==
                         Fugu  ==
                      Chicken  ==
          Medium ground finch  ==
                       Turkey  ==
                X. tropicalis  ==
               Painted turtle  ==
                  Zebra finch  ==
                 Atlantic cod  ==
          Collared flycatcher  ==
           American alligator  ==
           Tibetan ground jay  ==
                Scarlet macaw  ==
                       Lizard  ==
       White-throated sparrow  ==
                  Stickleback  ==
                   Guinea pig  ==
             Brush-tailed rat  ==
          Cape elephant shrew  ==
                        Panda  ==
                Domestic goat  ==
                        Sheep  ==
                      Wallaby  ==
              Tasmanian devil  ==
                     Platypus  ==
       Spiny softshell turtle  ==
              Green seaturtle  ==
                          Cow  ==
             Tibetan antelope  ==
                     Microbat  ==
         David's myotis (bat)  ==
                Big brown bat  ==
           Chinese tree shrew  ==
                       Rabbit  ==
                      Opossum  ==
               Pacific walrus  ==
                         Pika  ==
                      Ferret   ==
                          Dog  ==
       Lesser Egyptian jerboa  ==
                       Tenrec  ==
                          Cat  ==
                     Elephant  ==
                 Weddell seal  ==
                 Killer whale  ==
                      Dolphin  ==
             Cape golden mole  ==

Inserts between block 19 and 20 in window
B D                      Pig 2bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp

Alignment block 20 of 424 in window, 9399188 - 9399201, 14 bps 
B D                     Human  acagacgggagcgt----
B D                     Chimp  acagacgggagcgt----
B D                   Gorilla  acagacgggagcgt----
B D                 Orangutan  acagac-ggagcgt----
B D                    Gibbon  acagatgggagtgt----
B D                    Rhesus  acggacgggagcgt----
B D       Crab-eating macaque  acggacgggagcgt----
B D                    Baboon  acggacgggagtgt----
B D              Green monkey  acggacgggagcgt----
B D                  Marmoset  g-----------------
B D           Squirrel monkey  g-----------------
B D                  Squirrel  t-----------------
                 Prairie vole  t-----------------
B D           Chinese hamster  t-----------------
               Golden hamster  t-----------------
B D                     Mouse  t-----------------
B D                       Rat  t-----------------
B D            Naked mole-rat  t-----------------
                   Chinchilla  t-----------------
B D                       Pig  -----ccgaagtgg----
B D                    Alpaca  -----acagagcgg----
               Bactrian camel  -----acagagcgg----
B D                   Dolphin  -----acaca-cgt----
B D                     Horse  ----acgggagtga----
B D          White rhinoceros  ----atgggagcga----
             Black flying-fox  ----ccggaagtga----
B D                   Megabat  ----ccggaagtgg----
B D                   Manatee  ----ctggaagtaagcct
                     Aardvark  ----atgaaagtaagcct
B D                 Armadillo  ----aagcaagtaagcct
             Star-nosed mole  ==================
B D                  Hedgehog  ==================
B D                     Shrew  ==================
                 Zebra mbuna  ==================
         Pundamilia nyererei  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D              Nile tilapia  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
    Mexican tetra (cavefish)  ==================
                 Spotted gar  ==================
B D                Coelacanth  ==================
B D                 Zebrafish  ==================
  D                    Parrot  ==================
B D                Budgerigar  ==================
  D               Rock pigeon  ==================
          Southern platyfish  ==================
B D                    Medaka  ==================
  D              Mallard duck  ==================
B D                   Lamprey  ==================
B D                 Tetraodon  ==================
  D  Chinese softshell turtle  ==================
      Yellowbelly pufferfish  ==================
B D                      Fugu  ==================
B D                   Chicken  ==================
B D       Medium ground finch  ==================
B D                    Turkey  ==================
B D             X. tropicalis  ==================
  D            Painted turtle  ==================
B D               Zebra finch  ==================
B D              Atlantic cod  ==================
  D       Collared flycatcher  ==================
B D        American alligator  ==================
          Tibetan ground jay  ==================
  D             Scarlet macaw  ==================
B D                    Lizard  ==================
  D    White-throated sparrow  ==================
B D               Stickleback  ==================
B D                Guinea pig  ==================
            Brush-tailed rat  ==================
         Cape elephant shrew  ==================
B D                     Panda  ==================
               Domestic goat  ==================
B D                     Sheep  ==================
B D                   Wallaby  ==================
B D           Tasmanian devil  ==================
B D                  Platypus  ==================
  D    Spiny softshell turtle  ==================
  D           Green seaturtle  ==================
B D                       Cow  ==================
            Tibetan antelope  ==================
B D                  Microbat  ==================
        David's myotis (bat)  ==================
               Big brown bat  ==================
          Chinese tree shrew  ==================
B D                    Rabbit  ==================
B D                   Opossum  ==================
              Pacific walrus  ==================
B D                      Pika  ==================
B D                   Ferret   ==================
B D                       Dog  ==================
      Lesser Egyptian jerboa  ==================
B D                    Tenrec  ==================
B D                       Cat  ==================
B D                  Elephant  ==================
                Weddell seal  ==================
                Killer whale  ==================
            Cape golden mole  ==================
B D                  Bushbaby  ------------------

Inserts between block 20 and 21 in window
B D                Orangutan 474bp
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 4bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
            Black flying-fox 48bp
B D                  Megabat 66bp

Alignment block 21 of 424 in window, 9399202 - 9399204, 3 bps 
B D                     Human  aca
B D                     Chimp  aca
B D                   Gorilla  tca
B D                 Orangutan  aca
B D                    Gibbon  aca
B D                    Rhesus  aca
B D       Crab-eating macaque  aca
B D                    Baboon  aca
B D              Green monkey  aca
B D                  Marmoset  aca
B D           Squirrel monkey  aca
B D                  Bushbaby  --a
B D                  Squirrel  gtg
                 Prairie vole  gtt
B D           Chinese hamster  gct
               Golden hamster  gtt
B D                     Mouse  gct
B D                       Rat  gct
B D            Naked mole-rat  gcg
                   Chinchilla  gca
B D                       Pig  gca
B D                    Alpaca  gca
               Bactrian camel  gca
B D                   Dolphin  gt-
B D                     Horse  gca
B D          White rhinoceros  gca
             Black flying-fox  gcg
B D                   Megabat  gcg
B D                   Manatee  gca
                     Aardvark  gga
B D                 Armadillo  gta
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
          Southern platyfish  ===
B D                    Medaka  ===
  D              Mallard duck  ===
B D                   Lamprey  ===
B D                 Tetraodon  ===
  D  Chinese softshell turtle  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
  D             Scarlet macaw  ===
B D                    Lizard  ===
  D    White-throated sparrow  ===
B D               Stickleback  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
         Cape elephant shrew  ===
B D                     Panda  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                  Platypus  ===
  D    Spiny softshell turtle  ===
  D           Green seaturtle  ===
B D                       Cow  ===
            Tibetan antelope  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Big brown bat  ===
          Chinese tree shrew  ===
B D                    Rabbit  ===
B D                   Opossum  ===
              Pacific walrus  ===
B D                      Pika  ===
B D                   Ferret   ===
B D                       Dog  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                  Elephant  ===
                Weddell seal  ===
                Killer whale  ===
            Cape golden mole  ===

Inserts between block 21 and 22 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Megabat 32bp

Alignment block 22 of 424 in window, 9399205 - 9399238, 34 bps 
B D                     Human  gt-gga------------------------------aagaatcccatccttgcct------tccccttcc
B D                     Chimp  gt-gga------------------------------aagaatcccatccttgcct------tccccttcc
B D                   Gorilla  gt-gga------------------------------aagaatcccatccttgcct------tccccttcc
B D                 Orangutan  gt-gga------------------------------aagaatcccatccttgcct------tccccttcc
B D                    Gibbon  gt-gga------------------------------aagaatcccatcctttcct------tccccttcc
B D                    Rhesus  gt-gga------------------------------aagaatcccatctttgcct------tccc-----
B D       Crab-eating macaque  gt-gga------------------------------aagaatcccatctttgcct------tccc-----
B D                    Baboon  gt-gga------------------------------aagaatcccatctttgcct------ttcc-----
B D              Green monkey  gt-gga------------------------------aagaatcccatctttgcct------tccc-----
B D                  Marmoset  gt-gga------------------------------atgaatcccatccttgccc------tcgc-----
B D           Squirrel monkey  gt-gca------------------------------atgaatcccatccttgccc------ttgc-----
B D                  Bushbaby  at-gga------------------------------cagaattatgtccctgact------tccc-----
B D                  Squirrel  gg-gga------------------------------gagaaggcagcctctggcttctccc---------
                 Prairie vole  gt-gga------------------------------aagaatgccatcccaggct---------------
B D           Chinese hamster  gt-gga------------------------------aagaatgccaccctaggct---------------
               Golden hamster  gt-gga------------------------------aagaatgccaccccaggct---------------
B D                     Mouse  gc-gga------------------------------aagaatcccatcccaggct---------------
B D                       Rat  gt-gga------------------------------aagaatccctttccaggct---------------
B D            Naked mole-rat  gc-gga------------------------------gaggacac----ccgggct---------------
                   Chinchilla  gcaggg------------------------------aaggaccca---cctggct---------------
B D                       Pig  gt-gga------------------------------aggcctcttgcccctggct------tgtc-----
B D                    Alpaca  ca-gaa------------------------------gggccttccatccctcact------ggtc-----
               Bactrian camel  ca-gaa------------------------------gggcctttcatccctcact------ggtc-----
B D                   Dolphin  gt-gga------------------------------gagccgtttgtccctggct------tgtc-----
                 Killer whale  gt-gga------------------------------gagccgtttgtccctggct------tgtc-----
B D                     Horse  gt-gga------------------------------aggaatttcacccct-------------------
B D          White rhinoceros  gt-ggg------------------------------aaggatttcggcccttgct------tctc-----
             Black flying-fox  at-ggg-------------------------------acgccttcgtccctgcct------tctc-----
B D                   Megabat  gt-ggacggcgtccctccggaagtggactgcggtgggacgccttcgtccctggct------tctc-----
B D                   Manatee  ac-tgg------------------------------aagaatttccccccttgct------tctt-----
                     Aardvark  aa-gga------------------------------aagactttcccaccttact------tctt-----
B D                 Armadillo  ac-tga------------------------------aagaatttcatcccatact------gcct-----
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
          Chinese tree shrew  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Opossum  ======================================================================
              Pacific walrus  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================

                        Human  c-
                        Chimp  c-
                      Gorilla  c-
                    Orangutan  c-
                       Gibbon  t-
                       Rhesus  --
          Crab-eating macaque  --
                       Baboon  --
                 Green monkey  --
                     Marmoset  --
              Squirrel monkey  --
                     Bushbaby  --
                     Squirrel  --
                 Prairie vole  --
              Chinese hamster  --
               Golden hamster  --
                        Mouse  --
                          Rat  --
               Naked mole-rat  --
                   Chinchilla  --
                          Pig  --
                       Alpaca  --
               Bactrian camel  --
                      Dolphin  --
                 Killer whale  --
                        Horse  --
             White rhinoceros  --
             Black flying-fox  --
                      Megabat  --
                      Manatee  -c
                     Aardvark  -c
                    Armadillo  -c
              Star-nosed mole  ==
                     Hedgehog  ==
                        Shrew  ==
                  Zebra mbuna  ==
          Pundamilia nyererei  ==
        Burton's mouthbreeder  ==
          Princess of Burundi  ==
                 Nile tilapia  ==
             Peregrine falcon  ==
                 Saker falcon  ==
     Mexican tetra (cavefish)  ==
                  Spotted gar  ==
                   Coelacanth  ==
                    Zebrafish  ==
                       Parrot  ==
                   Budgerigar  ==
                  Rock pigeon  ==
           Southern platyfish  ==
                       Medaka  ==
                 Mallard duck  ==
                      Lamprey  ==
                    Tetraodon  ==
     Chinese softshell turtle  ==
       Yellowbelly pufferfish  ==
                         Fugu  ==
                      Chicken  ==
          Medium ground finch  ==
                       Turkey  ==
                X. tropicalis  ==
               Painted turtle  ==
                  Zebra finch  ==
                 Atlantic cod  ==
          Collared flycatcher  ==
           American alligator  ==
           Tibetan ground jay  ==
                Scarlet macaw  ==
                       Lizard  ==
       White-throated sparrow  ==
                  Stickleback  ==
                   Guinea pig  ==
             Brush-tailed rat  ==
          Cape elephant shrew  ==
                        Panda  ==
                Domestic goat  ==
                        Sheep  ==
                      Wallaby  ==
              Tasmanian devil  ==
                     Platypus  ==
       Spiny softshell turtle  ==
              Green seaturtle  ==
                          Cow  ==
             Tibetan antelope  ==
                     Microbat  ==
         David's myotis (bat)  ==
                Big brown bat  ==
           Chinese tree shrew  ==
                       Rabbit  ==
                      Opossum  ==
               Pacific walrus  ==
                         Pika  ==
                      Ferret   ==
                          Dog  ==
       Lesser Egyptian jerboa  ==
                       Tenrec  ==
                          Cat  ==
                     Elephant  ==
                 Weddell seal  ==
             Cape golden mole  ==

Inserts between block 22 and 23 in window
B D                      Pig 10bp
B D                   Alpaca 13bp
              Bactrian camel 13bp
B D                  Dolphin 12bp
                Killer whale 12bp
B D                    Horse 3bp
B D         White rhinoceros 11bp
            Black flying-fox 6bp
B D                  Megabat 6bp

Alignment block 23 of 424 in window, 9399239 - 9399243, 5 bps 
B D                     Human  t-tcct
B D                     Chimp  t-tcct
B D                   Gorilla  t-tcct
B D                 Orangutan  t-tctt
B D                    Gibbon  t-tccg
B D                    Rhesus  t-tcct
B D       Crab-eating macaque  t-tcct
B D                    Baboon  t-tcct
B D              Green monkey  t-tcct
B D                  Marmoset  t-tctt
B D           Squirrel monkey  t-tctt
B D                  Bushbaby  t-tcc-
B D                  Squirrel  -agcct
                 Prairie vole  --gcct
B D           Chinese hamster  --acct
               Golden hamster  --gcct
B D                     Mouse  --gcct
B D                       Rat  --gcct
B D            Naked mole-rat  --ccct
                   Chinchilla  --tcct
B D                    Rabbit  ttccgt
B D                       Pig  --ttct
B D                    Alpaca  --ctct
               Bactrian camel  --ttct
B D                   Dolphin  --ttct
                 Killer whale  --ttct
B D                     Horse  --ttcc
B D          White rhinoceros  --ctct
             Black flying-fox  --ctct
B D                   Megabat  --ctct
             Star-nosed mole  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
    Mexican tetra (cavefish)  ======
                 Spotted gar  ======
B D                Coelacanth  ======
B D                 Zebrafish  ======
  D                    Parrot  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
          Southern platyfish  ======
B D                    Medaka  ======
  D              Mallard duck  ======
B D                   Lamprey  ======
B D                 Tetraodon  ======
  D  Chinese softshell turtle  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
B D                    Turkey  ======
B D             X. tropicalis  ======
  D            Painted turtle  ======
B D               Zebra finch  ======
B D              Atlantic cod  ======
  D       Collared flycatcher  ======
B D        American alligator  ======
          Tibetan ground jay  ======
  D             Scarlet macaw  ======
B D                    Lizard  ======
  D    White-throated sparrow  ======
B D               Stickleback  ======
B D                Guinea pig  ======
            Brush-tailed rat  ======
         Cape elephant shrew  ======
B D                     Panda  ======
               Domestic goat  ======
B D                     Sheep  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D                  Platypus  ======
  D    Spiny softshell turtle  ======
  D           Green seaturtle  ======
B D                       Cow  ======
            Tibetan antelope  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
               Big brown bat  ======
          Chinese tree shrew  ======
B D                   Opossum  ======
              Pacific walrus  ======
B D                      Pika  ======
B D                   Ferret   ======
B D                       Dog  ======
      Lesser Egyptian jerboa  ======
B D                    Tenrec  ======
B D                 Armadillo  ------
B D                       Cat  ======
                    Aardvark  ------
B D                  Elephant  ======
                Weddell seal  ======
B D                   Manatee  ------
            Cape golden mole  ======

Inserts between block 23 and 24 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 24 of 424 in window, 9399244 - 9399254, 11 bps 
B D                     Human  c-cctggtcttc
B D                     Chimp  c-cctggtcttc
B D                   Gorilla  c-cctggtcttc
B D                 Orangutan  c-cctggtcttc
B D                    Gibbon  c-cctgttcttc
B D                    Rhesus  c-cctggtcttc
B D       Crab-eating macaque  c-cctggtcttc
B D                    Baboon  c-cctggtcttc
B D              Green monkey  c-cctggtcttc
B D                  Marmoset  c-cctggtcttc
B D           Squirrel monkey  c-cccggtcttc
B D                  Bushbaby  -----------c
           Chinese tree shrew  c-cccagtcctc
B D                  Squirrel  ctcctg--ctgc
                 Prairie vole  c-cctg---ttc
B D           Chinese hamster  c-cctg--cttc
               Golden hamster  c-cctg--cttc
B D                     Mouse  c-cctg--cttc
B D                       Rat  c-cctg--cttc
B D            Naked mole-rat  c-ccga--cctc
                   Chinchilla  c-cag---cttc
B D                    Rabbit  c-ccggg-ctgc
B D                       Pig  -------ccctc
B D                    Alpaca  -------ccctc
               Bactrian camel  -------ccctc
B D                   Dolphin  -------ccctc
                 Killer whale  -------ccctc
B D                     Horse  -------ccctc
B D          White rhinoceros  -------ccctc
             Black flying-fox  -------ccctc
B D                   Megabat  -------ccctc
B D                   Manatee  -ccctggtcttc
                     Aardvark  -ccctggtcttc
B D                 Armadillo  -tcccagtcttg
             Star-nosed mole  ============
B D                  Hedgehog  ============
B D                     Shrew  ============
                 Zebra mbuna  ============
         Pundamilia nyererei  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
    Mexican tetra (cavefish)  ============
                 Spotted gar  ============
B D                Coelacanth  ============
B D                 Zebrafish  ============
  D                    Parrot  ============
B D                Budgerigar  ============
  D               Rock pigeon  ============
          Southern platyfish  ============
B D                    Medaka  ============
  D              Mallard duck  ============
B D                   Lamprey  ============
B D                 Tetraodon  ============
  D  Chinese softshell turtle  ============
      Yellowbelly pufferfish  ============
B D                      Fugu  ============
B D                   Chicken  ============
B D       Medium ground finch  ============
B D                    Turkey  ============
B D             X. tropicalis  ============
  D            Painted turtle  ============
B D               Zebra finch  ============
B D              Atlantic cod  ============
  D       Collared flycatcher  ============
B D        American alligator  ============
          Tibetan ground jay  ============
  D             Scarlet macaw  ============
B D                    Lizard  ============
  D    White-throated sparrow  ============
B D               Stickleback  ============
B D                Guinea pig  ============
            Brush-tailed rat  ============
         Cape elephant shrew  ============
B D                     Panda  ============
               Domestic goat  ============
B D                     Sheep  ============
B D                   Wallaby  ============
B D           Tasmanian devil  ============
B D                  Platypus  ============
  D    Spiny softshell turtle  ============
  D           Green seaturtle  ============
B D                       Cow  ============
            Tibetan antelope  ============
B D                  Microbat  ============
        David's myotis (bat)  ============
               Big brown bat  ============
B D                   Opossum  ============
              Pacific walrus  ============
B D                      Pika  ============
B D                   Ferret   ============
B D                       Dog  ============
      Lesser Egyptian jerboa  ============
B D                    Tenrec  ============
B D                       Cat  ============
B D                  Elephant  ============
                Weddell seal  ============
            Cape golden mole  ============

Inserts between block 24 and 25 in window
B D           Naked mole-rat 6bp
                  Chinchilla 9bp
B D                   Rabbit 4bp
B D                      Pig 17bp
B D                   Alpaca 8bp
              Bactrian camel 8bp
B D                  Dolphin 7bp
                Killer whale 7bp
B D                    Horse 8bp
B D         White rhinoceros 8bp
            Black flying-fox 8bp
B D                  Megabat 8bp

Alignment block 25 of 424 in window, 9399255 - 9399269, 15 bps 
B D                     Human  ctcttctgcttctcc
B D                     Chimp  ctcttctgcttctcc
B D                   Gorilla  ctcttctgcttctcc
B D                 Orangutan  ctcttctgcttctcc
B D                    Gibbon  ctcttctgcttctcc
B D                    Rhesus  gtcttctgcttct-c
B D       Crab-eating macaque  ctcttctgcttct-c
B D                    Baboon  ctcttctgcctct-c
B D              Green monkey  ctcttttgcttctcc
B D                  Marmoset  cttttctgctgctcc
B D           Squirrel monkey  ctcttctgcttctcg
B D                  Bushbaby  cactcctggctcc-c
           Chinese tree shrew  ccatggcccactgcc
B D                  Squirrel  ---tccagcccctcc
                 Prairie vole  ---ctcagcccctcc
B D           Chinese hamster  ---ctcagcccctcc
               Golden hamster  ---ctcagcccctcc
B D                     Mouse  ---ctcagcccctcc
B D                       Rat  ---ctcagcccctcc
B D                       Pig  accccccacccctca
B D                    Alpaca  tcccatcccatgtca
               Bactrian camel  tcccgtcccgtgtca
B D                   Dolphin  tcccatcatatgtca
                 Killer whale  tcccatcatatgtca
B D                     Horse  tcccgccatgtgtca
B D          White rhinoceros  tcctggcacgtgtca
             Black flying-fox  tcccgtcccatg-ca
B D                   Megabat  tcccgtcccatg-ca
B D                   Manatee  ctctcctgctctcc-
                     Aardvark  ctcttctgctctct-
B D                 Armadillo  cttttccactctcc-
             Star-nosed mole  ===============
B D                  Hedgehog  ===============
B D                     Shrew  ===============
                 Zebra mbuna  ===============
         Pundamilia nyererei  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
    Mexican tetra (cavefish)  ===============
                 Spotted gar  ===============
B D                Coelacanth  ===============
B D                 Zebrafish  ===============
  D                    Parrot  ===============
B D                Budgerigar  ===============
  D               Rock pigeon  ===============
          Southern platyfish  ===============
B D                    Medaka  ===============
  D              Mallard duck  ===============
B D                   Lamprey  ===============
B D                 Tetraodon  ===============
  D  Chinese softshell turtle  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                   Chicken  ===============
B D       Medium ground finch  ===============
B D                    Turkey  ===============
B D             X. tropicalis  ===============
  D            Painted turtle  ===============
B D               Zebra finch  ===============
B D              Atlantic cod  ===============
  D       Collared flycatcher  ===============
B D        American alligator  ===============
          Tibetan ground jay  ===============
  D             Scarlet macaw  ===============
B D                    Lizard  ===============
  D    White-throated sparrow  ===============
B D               Stickleback  ===============
B D                Guinea pig  ===============
            Brush-tailed rat  ===============
B D            Naked mole-rat  ===============
                  Chinchilla  ===============
         Cape elephant shrew  ===============
B D                     Panda  ===============
               Domestic goat  ===============
B D                     Sheep  ===============
B D                   Wallaby  ===============
B D           Tasmanian devil  ===============
B D                  Platypus  ===============
  D    Spiny softshell turtle  ===============
  D           Green seaturtle  ===============
B D                       Cow  ===============
            Tibetan antelope  ===============
B D                  Microbat  ===============
        David's myotis (bat)  ===============
               Big brown bat  ===============
B D                    Rabbit  ===============
B D                   Opossum  ===============
              Pacific walrus  ===============
B D                      Pika  ===============
B D                   Ferret   ===============
B D                       Dog  ===============
      Lesser Egyptian jerboa  ===============
B D                    Tenrec  ===============
B D                       Cat  ===============
B D                  Elephant  ===============
                Weddell seal  ===============
            Cape golden mole  ===============

Inserts between block 25 and 26 in window
B D                  Manatee 20bp
                    Aardvark 20bp
B D                Armadillo 22bp

Alignment block 26 of 424 in window, 9399270 - 9399326, 57 bps 
B D                     Human  ag----------cccccgtcctgtgcctggctttatgctaggtcc--aggagatccaccggggagc-t--
B D                     Chimp  ag----------cccccgtcctgtgcctggctttatgctaggtcc--aggagatccaccggggagc-t--
B D                   Gorilla  ag----------cccccgtcctgtgcctggctttatgctaggtcc--aggagatccactggggagc-t--
B D                 Orangutan  ag----------cccccgtcctatgcctggctttatgctaggtcc--aggagatccaccggggagc-t--
B D                    Gibbon  ag----------ccccagtcctgtgcctggctttatgctaggtcc--aggagacccaccggggagc-t--
B D                    Rhesus  ag----------cccccgtcctgtgcctggctttatgcgaggtcc--agaagatccacgggggaac-t--
B D       Crab-eating macaque  ag----------cccccgtcctgtgcctggctttatgcgaggtcc--aggagatccacgggggaac-t--
B D                    Baboon  gag--------ccccccggcctgtgcctggctttatgctaggtcc--aggagatccacgggggaac-t--
B D              Green monkey  ag----------cccccgtcctgtgcctggctttatgctaggtcc--aggagatccacgggggaac-t--
B D                  Marmoset  ag----------cccccgtcctgtgcgtggcttcctgctaggtcc--aggagatccaccagttaac-t--
B D           Squirrel monkey  ag----------cccccatcctatgcctgacgtcatgctaggtcc--aggagatccaccagttaac-t--
B D                  Bushbaby  at----------tcctcatc-----------------------------aagacccaccgggggac-t--
           Chinese tree shrew  gt----------gccctgtggtgtgcctggcactctgt-----------gtgtgctgccag-gagc-t--
B D                  Squirrel  c---gcccacctcccg-------tgtgtggctccaccctaggtcc-acttagacccct---gctgc-t--
                 Prairie vole  caaggctcgcctgcccaattgtttgtctgacttcctgctaggtcc-c-ccagcatccctaggcaac-a--
B D           Chinese hamster  caaggct-ccctacccagttgtttctcttacttcctgctaggtcc-caccagcacccataggcaac-a--
               Golden hamster  caaggctcccctacccagctgtttctcttacttcctggtaggacc-caccagcacccctaggcaacga--
B D                     Mouse  caaggcttgcctgcccagttgtttgtcttactttctgctaggtcc-caccagcctggctaggcaac-t--
B D                       Rat  caaggcttgcctgccaagttgtttgtctca-------ctaggtcc-caccaacccagctagacaac-t--
B D            Naked mole-rat  ----------------------ctcttctgcagccccagggctct-cacctgt------------c----
                   Chinchilla  ------------------------------cagcactgtcactcc-cacc---------------c----
             Brush-tailed rat  ----------------cttttttttttttgcagaacctgggattg-aact---------------c----
B D                    Rabbit  ----------ccaccc-------cgtctctccacctgctggctccacgctagct-----------c-c--
B D                       Pig  ag----------ccccagttttgtgcctggctct-t---------------------gcagggaac-t--
B D                    Alpaca  ag----------ccccgattgtgtgcctggctccat---------------------gcagggaac-t--
               Bactrian camel  ag----------ccctgat----tgcctggctccgt---------------------gcagagaac-t--
B D                   Dolphin  gg----------ccccagttgtgtgtctggctcttt---------------------gcagagaac-t--
                 Killer whale  gg----------ccccagttgtgtgtctggctctgt---------------------gcagagaac-t--
B D                     Horse  ag----------ccccaggtgtgtgcctggctctgtgccaggtgc-actgag-----acagggaac-t--
B D          White rhinoceros  ag----------ccccgggtgtgtgcctggctccattcc------------------acagggaac-t--
             Black flying-fox  gg----------ccccgggtgtgtgcctggcta-gtgctgggtgc-agtaagtcgcagcagggaac-t--
B D                   Megabat  gg----------ccccgggtgtgtgcctggctc-gtgctgggtgc-agtaagtcgcagcagggaac-t--
B D                   Manatee  ag----------ccccatttgtgagcctcgctctgtgccgtgtcc-agcaaggtccaccagggaac-t--
             Cape golden mole  ag----------ccccagttgtgagccttgctctgt--ctggtcc-attaaggtccaccaaggaac-t--
                     Aardvark  ag----------ccccagttgtgagcctcactatgttccaggtcc-agcaaggtccaccaaggaac-t--
B D                 Armadillo  aa----------tcccagttgggtgccttgctctgtgctaagtcc-agcaagatttaccagggaac-cca
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ======================================================================
B D                Guinea pig  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
B D                   Opossum  ======================================================================
              Pacific walrus  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
                Weddell seal  ======================================================================

                        Human  -----ga
                        Chimp  -----ga
                      Gorilla  -----ga
                    Orangutan  -----ga
                       Gibbon  -----ga
                       Rhesus  -----ga
          Crab-eating macaque  -----ga
                       Baboon  -----ga
                 Green monkey  -----ga
                     Marmoset  -----ga
              Squirrel monkey  -----ga
                     Bushbaby  -----ag
           Chinese tree shrew  -----ga
                     Squirrel  -----ga
                 Prairie vole  -----ga
              Chinese hamster  -----ga
               Golden hamster  -----ga
                        Mouse  -----ga
                          Rat  -----ga
               Naked mole-rat  -------
                   Chinchilla  -------
             Brush-tailed rat  -------
                       Rabbit  -----gg
                          Pig  -----ag
                       Alpaca  -----gg
               Bactrian camel  -----gg
                      Dolphin  -----gg
                 Killer whale  -----gg
                        Horse  -----gg
             White rhinoceros  -----tg
             Black flying-fox  -----tg
                      Megabat  -----tg
                      Manatee  -----t-
             Cape golden mole  -----t-
                     Aardvark  -----t-
                    Armadillo  agagat-
              Star-nosed mole  =======
                     Hedgehog  =======
                        Shrew  =======
                  Zebra mbuna  =======
          Pundamilia nyererei  =======
        Burton's mouthbreeder  =======
          Princess of Burundi  =======
                 Nile tilapia  =======
             Peregrine falcon  =======
                 Saker falcon  =======
     Mexican tetra (cavefish)  =======
                  Spotted gar  =======
                   Coelacanth  =======
                    Zebrafish  =======
                       Parrot  =======
                   Budgerigar  =======
                  Rock pigeon  =======
           Southern platyfish  =======
                       Medaka  =======
                 Mallard duck  =======
                      Lamprey  =======
                    Tetraodon  =======
     Chinese softshell turtle  =======
       Yellowbelly pufferfish  =======
                         Fugu  =======
                      Chicken  =======
          Medium ground finch  =======
                       Turkey  =======
                X. tropicalis  =======
               Painted turtle  =======
                  Zebra finch  =======
                 Atlantic cod  =======
          Collared flycatcher  =======
           American alligator  =======
           Tibetan ground jay  =======
                Scarlet macaw  =======
                       Lizard  =======
       White-throated sparrow  =======
                  Stickleback  =======
                   Guinea pig  =======
          Cape elephant shrew  =======
                        Panda  =======
                Domestic goat  =======
                        Sheep  =======
                      Wallaby  =======
              Tasmanian devil  =======
                     Platypus  =======
       Spiny softshell turtle  =======
              Green seaturtle  =======
                          Cow  =======
             Tibetan antelope  =======
                     Microbat  =======
         David's myotis (bat)  =======
                Big brown bat  =======
                      Opossum  =======
               Pacific walrus  =======
                         Pika  =======
                      Ferret   =======
                          Dog  =======
       Lesser Egyptian jerboa  =======
                       Tenrec  =======
                          Cat  =======
                     Elephant  =======
                 Weddell seal  =======

Inserts between block 26 and 27 in window
B D                    Chimp 1bp
B D                      Pig 28bp
B D                   Alpaca 28bp
              Bactrian camel 28bp
B D                  Dolphin 25bp
                Killer whale 25bp
B D                    Horse 20bp
B D         White rhinoceros 20bp
            Black flying-fox 28bp
B D                  Megabat 28bp

Alignment block 27 of 424 in window, 9399327 - 9399340, 14 bps 
B D                     Human  ag--------c------------cac----------------------tggcactg
B D                     Chimp  ag--------c------------cag----------------------tggcactg
B D                   Gorilla  ag--------c------------cag----------------------tggcactg
B D                 Orangutan  ag--------c------------cag----------------------cggcactg
B D                    Gibbon  ag--------c------------cag----------------------tggcactg
B D                    Rhesus  ag--------c------------cagaggtcctc---------actgatggcactg
B D       Crab-eating macaque  ag--------c------------cagaggtcctc---------actgatggcactg
B D                    Baboon  ag--------c------------cagaggtcctc---------actgatggcactg
B D              Green monkey  ag--------c------------cagaggtcctc---------actgatggcattg
B D                  Marmoset  ag--------c------------cagagcccctc---------atctaaggctctg
B D           Squirrel monkey  ag--------c------------cagagcctctc---------atctacggctctg
B D                  Bushbaby  agagcttctct------------cag--cttctctga-----gacatgtggtgcta
           Chinese tree shrew  gg--------a------------cagagcccctgtcccggctcaccacaggcacc-
B D                  Squirrel  aa--------c------------gaggcctcttcttttagcccatcacagaccttt
                 Prairie vole  gg--------a------------taagg---ccctcttagccctccccagaccctg
B D           Chinese hamster  ag--------a------------taaaatatctctcttag-cctccgcagaccctg
               Golden hamster  cg--------a------------taaaatgtctgtcttagccctccgcagaccctt
B D                     Mouse  ga--------g------------gaaagcctctctcttgg-ccttcacaggccctg
B D                       Rat  gg--------g------------aaaagcttccctcttagcccttcacagaccctg
B D            Naked mole-rat  -------------------------------------aagctct-----gtccctc
                   Chinchilla  -------------------------------------tagcttt-----gtccctt
             Brush-tailed rat  -------------------------------------aggccct-----tgcactt
B D                    Rabbit  ga--------a------------gacagcgcctctctgggctcgctaagatacgtg
B D                       Pig  --------------------------aggtgtcc--------------tgtcattt
B D                    Alpaca  --------------------------agatactc--------------tgtcactt
               Bactrian camel  --------------------------agttactc--------------tgtcactt
B D                   Dolphin  --------------------------agacattct-------------tgtcactt
                 Killer whale  --------------------------agacattct-------------tgtcactt
B D                     Horse  --------------------------agaca--t--------------tgtcacct
B D          White rhinoceros  --------------------------attc------------------tgtcactt
             Black flying-fox  --------------------------agacattc--------------tgtcactc
B D                   Megabat  --------------------------agacattc--------------tgtcactc
                Big brown bat  --------------------------agacg--c--------------tgtcacgc
B D                   Manatee  ----ggctcct------------tacagacattc--------------tatcactt
             Cape golden mole  ----ggctcct------------cacag---------------------attacct
                     Aardvark  ----cgctcct------------cacagtcatcc--------------tgtcactt
B D                 Armadillo  ----ggctcctgtcttgactcaacacagacatcc--------------tgacactt
             Star-nosed mole  ========================================================
B D                  Hedgehog  ========================================================
B D                     Shrew  ========================================================
                 Zebra mbuna  ========================================================
         Pundamilia nyererei  ========================================================
       Burton's mouthbreeder  ========================================================
         Princess of Burundi  ========================================================
B D              Nile tilapia  ========================================================
  D          Peregrine falcon  ========================================================
  D              Saker falcon  ========================================================
    Mexican tetra (cavefish)  ========================================================
                 Spotted gar  ========================================================
B D                Coelacanth  ========================================================
B D                 Zebrafish  ========================================================
  D                    Parrot  ========================================================
B D                Budgerigar  ========================================================
  D               Rock pigeon  ========================================================
          Southern platyfish  ========================================================
B D                    Medaka  ========================================================
  D              Mallard duck  ========================================================
B D                   Lamprey  ========================================================
B D                 Tetraodon  ========================================================
  D  Chinese softshell turtle  ========================================================
      Yellowbelly pufferfish  ========================================================
B D                      Fugu  ========================================================
B D                   Chicken  ========================================================
B D       Medium ground finch  ========================================================
B D                    Turkey  ========================================================
B D             X. tropicalis  ========================================================
  D            Painted turtle  ========================================================
B D               Zebra finch  ========================================================
B D              Atlantic cod  ========================================================
  D       Collared flycatcher  ========================================================
B D        American alligator  ========================================================
          Tibetan ground jay  ========================================================
  D             Scarlet macaw  ========================================================
B D                    Lizard  ========================================================
  D    White-throated sparrow  ========================================================
B D               Stickleback  ========================================================
B D                Guinea pig  ========================================================
         Cape elephant shrew  ========================================================
B D                     Panda  ========================================================
               Domestic goat  ========================================================
B D                     Sheep  ========================================================
B D                   Wallaby  ========================================================
B D           Tasmanian devil  ========================================================
B D                  Platypus  ========================================================
  D    Spiny softshell turtle  ========================================================
  D           Green seaturtle  ========================================================
B D                       Cow  ========================================================
            Tibetan antelope  ========================================================
B D                  Microbat  ========================================================
        David's myotis (bat)  ========================================================
B D                   Opossum  ========================================================
              Pacific walrus  ========================================================
B D                      Pika  ========================================================
B D                   Ferret   ========================================================
B D                       Dog  ========================================================
      Lesser Egyptian jerboa  ========================================================
B D                    Tenrec  ========================================================
B D                       Cat  ========================================================
B D                  Elephant  ========================================================
                Weddell seal  ========================================================

Alignment block 28 of 424 in window, 9399341 - 9399384, 44 bps 
B D                     Human  gtc-c-----------ttag--ct--ctggag--ttgacggatcttgtg----tc-------acaccttt
B D                     Chimp  gtc-c-----------ttag--ct--ctggag--ttgacggatcttgtg----tc-------acaccttt
B D                   Gorilla  gtc-c-----------ttag--ct--ctggag--ttgacagatcttgtg----tc-------acaccttt
B D                 Orangutan  gtc-c-----------ttag--ct--ctggac--ttgacggatcttatg----tc-------acaccttt
B D                    Gibbon  gtc-c-----------ttag--ct--ctggag--ttgacggatcttgtg----tc-------acaccttt
B D                    Rhesus  ctc-c-----------ttag--ct--ctggag--ttggcggatcttgtg----cc-------acagcttt
B D       Crab-eating macaque  ctc-c-----------ttag--ct--ctggag--ttggcggatcttgtg----tc-------acagcttt
B D                    Baboon  ctc-c-----------ttag--ct--ctggag--ttggcggatcttgtg----tc-------acagcttt
B D              Green monkey  ctc-c-----------ttag--ct--ctggag--ttggcggatcttgtg----tc-------acagcttt
B D                  Marmoset  gtc-c-----------tcag--tt--ctggag--ttgtcggatcttgtg----tc-------acaccttt
B D           Squirrel monkey  gtc-c-----------ttag--tt--ctggag--ttgttggatc---tg----tc-------acaccttt
B D                  Bushbaby  -tc-t-----------gtat--tt--tgagagt-ttgacagccctggtgtcactc-------acaccttt
           Chinese tree shrew  -tg-c-----------tcag--cttctcagag--ctggcag-tctgctg----tc-------acaccctt
B D                  Squirrel  gcc-t--------cctgtccatgt--tttgaggactgac--atctggtg----tc-------acac---c
                 Prairie vole  gtc-c--------cttttct--gt--ttagagaatttgcagagctcgtg----tc-------ccatcttc
B D           Chinese hamster  gtc-c--------cttttcc--ct--ttagagaatgagcaaagttagtg----cc-------ccgccctc
               Golden hamster  gtc-c--------cttttcc--ct--ttagagaattagcaaagctagtg----cc-------ccatcctc
B D                     Mouse  ctc-c-----------------ct--ttagagaaggaacaaagctagtg----tc---------------
B D                       Rat  gtc-c--------cttttca--ct--tcagagaatgaacaaagctaatg----tc-------tcacttcc
B D            Naked mole-rat  gcc-c--------------t--ca--c--------------agctggtg----tc-------ccgtcccc
                   Chinchilla  gcc-c--------ttatttt--ca--ct-------cagcagagctgatg----tcccag---cctttctc
             Brush-tailed rat  gcc-cgggaagcgcttattc--ca--ct-------gcgcc------atg----tccccggccccttcccc
B D                    Rabbit  gcc-t--------gtgcttc--g------------cgacagagctggtg----tc-------acaccggc
B D                       Pig  gtc-c-----------ttat--tt--tgagag--ccaacagaactggtg----tc--------ccccttt
B D                    Alpaca  gtc-c-----------ttat--tc--tgagag--ttggtggggctagtg----tc-------acaccttt
               Bactrian camel  gtc-c-----------ttat--tc--tgagag--ttggcagggctagtg----tc-------acaccttt
B D                   Dolphin  gtc-c-----------ttac--tt--tgagag--ttgacagaactggtg----tc-------acaccttt
                 Killer whale  gtc-c-----------ttac--tt--tgagag--ttgacagaactggtg----tc-------acaccttt
B D                     Horse  gtc-c-----------ttat--tt--tgagag--ttggcaggactgcta----tc-------acaccttt
B D          White rhinoceros  gtc-c-----------ttat--tt--tgatag--ttggcagaactggtg----tc-------acaccttt
             Black flying-fox  gtc-c-----------ttat--tt--tgagaa--ttgacagaactgctg----tc-------acacattt
B D                   Megabat  gtc-c-----------ttat--tt--tgagaa--ttgacagaactgctg----tc-------acacattg
                Big brown bat  ggc-c-----------ttat--tc--tgaggg--ttggcacaaccaggg----gc-------tcacctct
              Star-nosed mole  gtc-c-----------ttac--tt--cgggag--gtggcaaatttcctg----tc-------acaccttt
B D                   Manatee  gtc-c-----------ttct--tt--tcagag--ttgacagaactgttg----tt-------acaccttt
             Cape golden mole  gtcac-----------ttct--ct--tcagaa--ttgacagaactgttg----tt------aacacgttt
                     Aardvark  atc---------------ct--tg--tcagag--ttgacagaactgttg----tt-------taatttct
B D                 Armadillo  gac-c-----------ttgt--tt--tgaggg--ttggcagaatggtta----tg----------ccttt
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Stickleback  ======================================================================
B D                Guinea pig  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                   Opossum  ======================================================================
              Pacific walrus  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
                Weddell seal  ======================================================================

                        Human  tgc
                        Chimp  tgc
                      Gorilla  tgc
                    Orangutan  tgt
                       Gibbon  tgc
                       Rhesus  tgc
          Crab-eating macaque  tgc
                       Baboon  tgc
                 Green monkey  tgc
                     Marmoset  cac
              Squirrel monkey  cac
                     Bushbaby  tgc
           Chinese tree shrew  tgc
                     Squirrel  tac
                 Prairie vole  tgc
              Chinese hamster  tac
               Golden hamster  tac
                        Mouse  ---
                          Rat  tgt
               Naked mole-rat  tcc
                   Chinchilla  gcg
             Brush-tailed rat  ctg
                       Rabbit  tgc
                          Pig  tgc
                       Alpaca  tgc
               Bactrian camel  tgc
                      Dolphin  tgc
                 Killer whale  tgc
                        Horse  tcc
             White rhinoceros  tac
             Black flying-fox  tgc
                      Megabat  tgc
                Big brown bat  t-c
              Star-nosed mole  cgt
                      Manatee  tgc
             Cape golden mole  cac
                     Aardvark  tgc
                    Armadillo  ttc
                     Hedgehog  ===
                        Shrew  ===
                  Zebra mbuna  ===
          Pundamilia nyererei  ===
        Burton's mouthbreeder  ===
          Princess of Burundi  ===
                 Nile tilapia  ===
             Peregrine falcon  ===
                 Saker falcon  ===
     Mexican tetra (cavefish)  ===
                  Spotted gar  ===
                   Coelacanth  ===
                    Zebrafish  ===
                       Parrot  ===
                   Budgerigar  ===
                  Rock pigeon  ===
           Southern platyfish  ===
                       Medaka  ===
                 Mallard duck  ===
                      Lamprey  ===
                    Tetraodon  ===
     Chinese softshell turtle  ===
       Yellowbelly pufferfish  ===
                         Fugu  ===
                      Chicken  ===
          Medium ground finch  ===
                       Turkey  ===
                X. tropicalis  ===
               Painted turtle  ===
                  Zebra finch  ===
                 Atlantic cod  ===
          Collared flycatcher  ===
           American alligator  ===
           Tibetan ground jay  ===
                Scarlet macaw  ===
                       Lizard  ===
       White-throated sparrow  ===
                  Stickleback  ===
                   Guinea pig  ===
          Cape elephant shrew  ===
                        Panda  ===
                Domestic goat  ===
                        Sheep  ===
                      Wallaby  ===
              Tasmanian devil  ===
                     Platypus  ===
       Spiny softshell turtle  ===
              Green seaturtle  ===
                          Cow  ===
             Tibetan antelope  ===
                     Microbat  ===
         David's myotis (bat)  ===
                      Opossum  ===
               Pacific walrus  ===
                         Pika  ===
                      Ferret   ===
                          Dog  ===
       Lesser Egyptian jerboa  ===
                       Tenrec  ===
                          Cat  ===
                     Elephant  ===
                 Weddell seal  ===

Inserts between block 28 and 29 in window
            Brush-tailed rat 28bp

Alignment block 29 of 424 in window, 9399385 - 9399445, 61 bps 
B D                     Human  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D                     Chimp  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D                   Gorilla  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D                 Orangutan  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D                    Gibbon  agatgaaagt---gctgaccctcca------------------------------caacccatttatcc-
B D                    Rhesus  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D       Crab-eating macaque  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D                    Baboon  agatgaaaat---gctgactctcca------------------------------gaacccatttatcc-
B D              Green monkey  agatgaaaat---gctggctctcca------------------------------gaacccatttatcc-
B D                  Marmoset  agatgaaaat---gccgactctcca------------------------------gaacccatttatcc-
B D           Squirrel monkey  agatgaaaat---gccgactctcca------------------------------aaacccattcatcc-
B D                  Bushbaby  agatggaagc---accaactctcag------------------------------aaacacacttatcc-
           Chinese tree shrew  ggat--cagt---gcc-accctc-----------------------------------------------
B D                  Squirrel  agatggaaat---gccagttctcag------------------------------caacccgtttacc--
                 Prairie vole  aggtgaaaa----gt--cttctctg---------------------------------------------
B D           Chinese hamster  a-gtgaaaa----gtcacttctctg---------------------------------------------
               Golden hamster  a-gtgaaaa----gccgcttctcca---------------------------------------------
B D                     Mouse  --------------ccacctctctg---------------------------------------------
B D                       Rat  agacaaaaa----gccacctctctg---------------------------------------------
B D            Naked mole-rat  agccgagtg----tactgctggcca---------------------------------------------
                   Chinchilla  ----gagca----caccttttgcaa---------------------------------------------
             Brush-tailed rat  agacgggca----ggtctcaggcagcagggaagggacgtgcggtggaaagaaccccagctggcttcctcc
B D                    Rabbit  aggtgacac----tgtggctgctgg---------------------------------------------
B D                       Pig  agatgaaagt---gcccgctcacag------------------------------aaacccatttatcc-
B D</