Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 337 in window, 17935427 - 17935457, 31 bps 
B D                   Human  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D                   Chimp  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D                 Gorilla  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D               Orangutan  gag-----------ag-a---------gcaa-------------a-----gagac----------aagag
B D                  Gibbon  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D                  Rhesus  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D     Crab-eating macaque  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D                  Baboon  gag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D            Green monkey  cag-----------ag-a---------gcaa-------------a-----gagag----------aagag
B D                Marmoset  ggg-----------ag-a---------gcaa-------------a-----gagag----------aaaa-
B D         Squirrel monkey  tgg-----------ag-a---------gcaa-------------a-----gagag----------aaaag
B D                Bushbaby  gag-----------ag-acacacacacagaa-------------g-----gggag----------aaaag
         Chinese tree shrew  gag-----------ag-a---------gaaagttagagagagaga-----gagag----------agaag
B D                Squirrel  gag-----------tgtg---------tgtg-------------t-----accag----------ccgag
               Prairie vole  aag-----------ag-a---------ggag-------------g-----aagga----------gggag
B D         Chinese hamster  gag-----------aa-a---------ggag-------------g-----aaagg----------gggag
             Golden hamster  gag--------------a---------ggag-------------g-----aaaag----------gggag
B D                   Mouse  gag-----------ag-a---------ggag-------------a-----aaggg----------gagag
B D                     Rat  gag-----------ag-a---------cggg-------------g-----aaggg----------gagag
B D              Guinea pig  gag-----------ag-a---------ggga-------------g-----agagg----------gaaa-
                 Chinchilla  gag-----------ag-a---------gaga-------------a-----agagt----------ggga-
B D                  Rabbit  gag-----------ag-a---------gaac-------------g-----atatg----------gagag
B D                     Pig  -gg-----------gg-g---------g-ag-------------a-----aagta----------aggat
B D                  Alpaca  ----------------------------------------------------gag----------ggaag
             Bactrian camel  ----------------------------------------------------gag----------ggaag
           Tibetan antelope  gag-----------ag-a---------g-aa-------------a-----gagaa----------ggaag
B D                     Cow  gag-----------ag-a---------g-ag-------------a-----gagaa----------ggaag
B D                   Sheep  gag-----------ag-a---------g-ag-------------a-----gagaa----------ggaag
              Domestic goat  gag-----------ag-a---------g-ag-------------a-----gagaa----------ggaag
B D                   Horse  ------------------------------g-------------t-----gtg------------ggaag
B D        White rhinoceros  ------------------------------g-------------t-----gtgtgtgtgagtgccagaag
B D                     Cat  ------------------------------g-------------a-----gagag----------agagg
B D                     Dog  ------------------------------g-------------a-----gacag----------ggaga
B D                 Ferret   ------------------------------g-------------a-----gagaa----------ggagg
B D                   Panda  gag-----------ag-a---------g-ag-------------a-----gagag----------ggagg
             Pacific walrus  ------------------------------g-------------a-----gagaa----------ggagg
               Weddell seal  ------------------------------g-------------a-----gagaa----------ggagg
            Star-nosed mole  ----------------------------------------------------cca----------tgaag
B D                Elephant  gaggtacctggctctg-tgtctgt---gtgt-------------gtatttgtcag----------ggaaa
B D                 Manatee  --------------tg-tgtgtg----gtgt-------------gtatctgtcag----------ggaaa
                   Aardvark  gaggtagccaact-tg-t---------gtgt-------------gtttttgtcat----------ggaaa
B D               Armadillo  g-------------tg-g---------gtgt-------------gtg---ggccg----------ggagg
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
  D            Mallard duck  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
          Brush-tailed rat  ======================================================================
B D          Naked mole-rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
B D                    Pika  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================
          Cape golden mole  ======================================================================

                      Human  ------------gcttcctgga
                      Chimp  ------------gcttcctgga
                    Gorilla  ------------gcttcctgga
                  Orangutan  ------------gcttcctgga
                     Gibbon  ------------gcttcctgga
                     Rhesus  ------------gcttcctgga
        Crab-eating macaque  ------------gcttcctgga
                     Baboon  ------------gcttcctgga
               Green monkey  ------------gcttcctgga
                   Marmoset  ------------gcttccttgg
            Squirrel monkey  ------------gcttccttgc
                   Bushbaby  ------------gcttccagga
         Chinese tree shrew  ------------gcttcctgga
                   Squirrel  --------gaaggcttcctgga
               Prairie vole  ------ggggcagcttcccgga
            Chinese hamster  ------gtgacagcttcctgga
             Golden hamster  ------gtgacagtttcctgga
                      Mouse  -------ggacagcttcctgga
                        Rat  ------tggacagcttcctgga
                 Guinea pig  ----------------------
                 Chinchilla  ----------------------
                     Rabbit  aatggaaggaaggattcttgga
                        Pig  ------------gcttcctgga
                     Alpaca  ------------gcttcctgga
             Bactrian camel  ------------gcttcctgga
           Tibetan antelope  ------------gcttcctgga
                        Cow  ------------gcttcctgga
                      Sheep  ------------gcttcctgga
              Domestic goat  ------------gcttcctgga
                      Horse  ------------gcttcctgga
           White rhinoceros  ------------gcttcctgga
                        Cat  ------------gcttcctgga
                        Dog  ------------gcttcctgga
                    Ferret   ------------gcttcctgga
                      Panda  ------------gcttcctgga
             Pacific walrus  ------------gcttcctgga
               Weddell seal  ------------gcttcctgga
            Star-nosed mole  ------------gcttca-gga
                   Elephant  ------------acttcttgga
                    Manatee  ------------gcttcctgga
                   Aardvark  ------------gcttcctgga
                  Armadillo  ------------acttcctgga
                   Hedgehog  ======================
                      Shrew  ======================
               Mallard duck  ======================
                Zebra finch  ======================
        Collared flycatcher  ======================
           Brush-tailed rat  ======================
             Naked mole-rat  ======================
        Cape elephant shrew  ======================
                   Microbat  ======================
       David's myotis (bat)  ======================
              Big brown bat  ======================
           Black flying-fox  ----------------------
                    Megabat  ----------------------
                       Pika  ======================
     Lesser Egyptian jerboa  ======================
                     Tenrec  ----------------------
               Killer whale  ======================
                    Dolphin  ======================
           Cape golden mole  ======================

Alignment block 2 of 337 in window, 17935458 - 17935485, 28 bps 
B D                   Human  ggag-gcg--acacctgagctg----ttc---a-gggct
B D                   Chimp  ggag-gcg--acacctgagctg----ttc---g-gggcg
B D                 Gorilla  ggag-gca--acacctgagctg----ttc---g-gggcg
B D               Orangutan  ggag-gcg--acacctgagctg----tta---g-gggcg
B D                  Gibbon  ggag-gtg--acacctgagttg----ttc---g-gggcg
B D                  Rhesus  ggag-gtg--acacctgagctg----ttt---g-gggcg
B D     Crab-eating macaque  ggag-gtg--acacctgagctg----ttt---g-gggcg
B D                  Baboon  ggag-gtg--acacctgagctg----ttt---g-gggcg
B D            Green monkey  ggag-gtg--acacctgagctg----ttt---g-gggcg
B D                Marmoset  ggag-gtg--acacctgagctg----ttc---g-gggcg
B D         Squirrel monkey  ggag-gtg--ttacctgagctg----ttt---g-gggca
B D                Bushbaby  ggag-gtg--acaccggcattg----ttt---gagggca
         Chinese tree shrew  gaaa-gtg--acacctgagcta----ttc---a-gagca
B D                Squirrel  gaaa-gtg--ac-ccagtgc--------t---g-ggg--
     Lesser Egyptian jerboa  ggag-atg--atgccagagcta----ttt---g-aggcc
               Prairie vole  ggag-ttgatacaccagagctg----ttt---g-gggat
B D         Chinese hamster  ggca-ttgatacacctgagctg----ttt---g-ggggt
             Golden hamster  ggagtttgatacacctgagctg----ttt---g-ggggt
B D                   Mouse  ggag-ttg--acaccagagctg----gct---g-gaga-
B D                     Rat  gtag-ttg--ataccagagttg----tct---g-ggggc
B D              Guinea pig  -------g--agagcagcgc--------t---g-gtgtg
                 Chinchilla  -------g--aggggagcact-------t---g-gagtg
B D                  Rabbit  ggag-gtg--ctgcctgagctg----ttg---g-gagca
B D                     Pig  ggag-gtg--atacctgaactg----ttg---g-ggagc
B D                  Alpaca  ggag-gtg--acacctgagctg----ttg---g-ggagc
             Bactrian camel  gaag-gtg--acacctgagctg----tcg---g-ggagc
           Tibetan antelope  ggag-gtg--acatcc--tctg----ttg---g-ggatc
B D                     Cow  ggag-gtg--acatcc--tctg----ttg---g-ggatc
B D                   Sheep  ggag-gtg--acatcc--tctg----ttg---g-ggatc
              Domestic goat  ggag-gtg--acatcc--tctg----ttg---g-ggatc
B D                   Horse  ggag-gtg--acacctgagctg----tgtccct-gggac
B D        White rhinoceros  ggaa-gtg--acacctgagcta----ttt---g-gtaac
B D                     Cat  ggag-gtc--atacctgagctg----ttt---g-ggaac
B D                     Dog  ggag-gtg--gcacctgagcta----ttc---a-ggaac
B D                 Ferret   ggtg-gtg--acatctgagcta----tat---g-ggaac
B D                   Panda  ggag-gtg--tcacctgagctg----ttt---g-ggaac
             Pacific walrus  ggag-gtg--acacctgagcta----ttt---g-ggaac
               Weddell seal  ggag-gtg--acacctgagcta----ttt---g-ggaac
            Star-nosed mole  ggag-ggg--gccgccgagccc----ttt---g-gag--
B D                Elephant  ggag-gtg--acacctgagttgggta-------------
B D                 Manatee  ggag-gtg--acacctgagccgggca-------------
                   Aardvark  agag-gtg--aca--------------------------
B D               Armadillo  ggag-gtg--acacctgagctg-----------------
B D                Hedgehog  =======================================
B D                   Shrew  =======================================
  D            Mallard duck  =======================================
B D             Zebra finch  =======================================
  D     Collared flycatcher  =======================================
          Brush-tailed rat  =======================================
B D          Naked mole-rat  =======================================
       Cape elephant shrew  =======================================
B D                Microbat  =======================================
      David's myotis (bat)  =======================================
             Big brown bat  =======================================
          Black flying-fox  ---------------------------------------
B D                 Megabat  ---------------------------------------
B D                    Pika  =======================================
B D                  Tenrec  ---------------------------------------
              Killer whale  =======================================
B D                 Dolphin  =======================================
          Cape golden mole  =======================================

Inserts between block 2 and 3 in window
B D             Guinea pig 1bp
                Chinchilla 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
           Star-nosed mole 1bp

Alignment block 3 of 337 in window, 17935486 - 17935498, 13 bps 
B D                   Human  ccag-------tctc----------tga-g--------t
B D                   Chimp  ccag-------tctc----------tga-g--------t
B D                 Gorilla  ccag-------tctc----------tga-g--------t
B D               Orangutan  ctag-------tctc----------tga-g--------t
B D                  Gibbon  ccag-------tctc----------tga-g--------t
B D                  Rhesus  ctag-------tctc----------tga-gtctggtgat
B D     Crab-eating macaque  ctag-------tctc----------tga-gtctggtgat
B D                  Baboon  ctag-------tctc----------tga-gtctggtgat
B D            Green monkey  ctag-------tctc----------tga-gtctggtgat
B D                Marmoset  ctgg-------tctg----------tga-g--------t
B D         Squirrel monkey  ctgg-------tctc----------tga-g--------t
B D                Bushbaby  ctgc-------tccc----------tga-g------agc
         Chinese tree shrew  ttag-------tttc----------tga-g------aac
B D                Squirrel  -----------gtgg----------ggg-g--------c
     Lesser Egyptian jerboa  tttta------gttc----------cca-g--------c
               Prairie vole  gtct-------gtcc----------tga-g--------c
B D         Chinese hamster  ctgt-------gttc----------tga-g--------t
             Golden hamster  ctct-------gttc----------tga-g--------c
B D                   Mouse  --ct-------gtcc----------tga-g--------c
B D                     Rat  ctct-------gttc----------t-a-g--------c
B D          Naked mole-rat  --------------ct-ggtccctggga-g--------c
B D              Guinea pig  -------------------------ggg-g--------g
                 Chinchilla  -------------------------ggg-a--------g
B D                  Rabbit  ---------------tcagtctttgaaa-g--------c
B D                     Pig  ttag-------tctt----------aga-t--------c
B D                  Alpaca  tc-g-------tctc----------aga-t--------t
             Bactrian camel  tt-g-------tctc----------aga-t--------t
           Tibetan antelope  ttgg-------tctc----------aga-t--------c
B D                     Cow  ttgg-------tctc----------aga-a--------t
B D                   Sheep  ttgg-------tctc----------aga-t--------c
              Domestic goat  ttgg-------tctc----------aga-t--------c
B D                   Horse  ttagtt-----tttg----------aga-t--------c
B D        White rhinoceros  ttagtg-----tctg----------aga-t--------c
B D                     Cat  gtag-------tctg----------aga-t--------c
B D                     Dog  ttag-------tctg----------aga-t--------c
B D                 Ferret   ttag-------tctg----------aga-t--------c
B D                   Panda  tgag-------tctg----------gga-t--------c
             Pacific walrus  ttagt------tctg----------aga-t--------c
               Weddell seal  ttagt------tctg----------aga-t--------c
            Star-nosed mole  ttgg-------cctg----------tgagg--------t
B D                Elephant  -----tcagtccctg----------aga-----------
B D                 Manatee  -----tcagtctctg----------gaa-----------
                   Aardvark  -----------tctg----------aaa-----------
B D               Armadillo  -----------tctg----------ggc-----------
B D                Hedgehog  =======================================
B D                   Shrew  =======================================
  D            Mallard duck  =======================================
B D             Zebra finch  =======================================
  D     Collared flycatcher  =======================================
          Brush-tailed rat  =======================================
       Cape elephant shrew  =======================================
B D                Microbat  =======================================
      David's myotis (bat)  =======================================
             Big brown bat  =======================================
          Black flying-fox  ---------------------------------------
B D                 Megabat  ---------------------------------------
B D                    Pika  =======================================
B D                  Tenrec  ---------------------------------------
              Killer whale  =======================================
B D                 Dolphin  =======================================
          Cape golden mole  =======================================

Inserts between block 3 and 4 in window
B D               Elephant 2bp
B D                Manatee 2bp
                  Aardvark 2bp

Alignment block 4 of 337 in window, 17935499 - 17935508, 10 bps 
B D                   Human  ctgg-tgagtt
B D                   Chimp  ctgg-tgagtt
B D                 Gorilla  ctga-tgagtt
B D               Orangutan  ctgg-tgagtt
B D                  Gibbon  ctgg-tgagtt
B D                  Rhesus  ctgg-tgagtt
B D     Crab-eating macaque  ctgg-tgagtt
B D                  Baboon  ctgg-tgagtt
B D            Green monkey  ctgg-tgagtt
B D                Marmoset  ctgg-tgagtt
B D         Squirrel monkey  ctgg-tgagtt
B D                Bushbaby  ctgg-tgagct
         Chinese tree shrew  ctgg-tgagtt
B D                Squirrel  ctgg-tgagtc
     Lesser Egyptian jerboa  ttagttgactt
               Prairie vole  ctggctgagtt
B D         Chinese hamster  gtggctaagtt
             Golden hamster  ttggctgagtt
B D                   Mouse  ctggcttagtt
B D                     Rat  ctggcttagtg
B D          Naked mole-rat  ccgt--gggtt
B D              Guinea pig  ctgg--ggagt
                 Chinchilla  ctga--aaatt
B D                  Rabbit  ctgg-tgagtt
B D                     Pig  ctgg-tgagtt
B D                  Alpaca  ccag-tgagtt
             Bactrian camel  ccag-tgagtt
           Tibetan antelope  gtgg-tgagtt
B D                     Cow  gtgg-tgagtt
B D                   Sheep  atgg-tgagtt
              Domestic goat  atgg-tgagtt
B D                   Horse  ttgg-tgagtt
B D        White rhinoceros  ctgg-tgagtt
B D                     Cat  ctgg-tgagtt
B D                     Dog  ctgg-tgagtt
B D                 Ferret   ctgg-tgagtt
B D                   Panda  ctgg-tgagtt
             Pacific walrus  ctgg-tgagtt
               Weddell seal  ctgg-tgagtt
            Star-nosed mole  ctgt-ggggtg
B D                Elephant  ctgg-cgagtt
B D                 Manatee  ctgg-tgagtt
           Cape golden mole  ctgg-tgagtt
                   Aardvark  ctgc-tgaatt
B D               Armadillo  ctgg-gcagtt
B D                Hedgehog  ===========
B D                   Shrew  ===========
  D            Mallard duck  ===========
B D             Zebra finch  ===========
  D     Collared flycatcher  ===========
          Brush-tailed rat  ===========
       Cape elephant shrew  ===========
B D                Microbat  ===========
      David's myotis (bat)  ===========
             Big brown bat  ===========
          Black flying-fox  -----------
B D                 Megabat  -----------
B D                    Pika  ===========
B D                  Tenrec  -----------
              Killer whale  ===========
B D                 Dolphin  ===========

Alignment block 5 of 337 in window, 17935509 - 17935559, 51 bps 
B D                   Human  cggttt--------gatg-ttaggg-at-aaaaccttcactgatactg-agcag-------ttg-gagt-
B D                   Chimp  cagttt--------gatg-ttaggg-at-aaaaccttcactgatactg-agcag-------gtg-gagt-
B D                 Gorilla  cagttt--------gatg-ttaggg-at-aaaaccttcactgatactg-agcag-------gtg-gagt-
B D               Orangutan  cagttt--------gatg-ttaggg-gt-aaaaccttcactgatactg-agcag-------gta-gagt-
B D                  Gibbon  cagttt--------gatg-ttaggg-at-aaaaccttcactgatactg-agcag-------gtg-gagt-
B D                  Rhesus  cagttt--------gatg-ttagag-at-aaaaccttcactgatactg-agcag-------gcg-gagt-
B D     Crab-eating macaque  cagttt--------gatg-ttagag-at-aaaaccttcactgatactg-agcag-------gcg-gagt-
B D                  Baboon  cagttt--------gatg-ttagag-at-aaaaccttcactgatactg-agcag-------gcg-gagt-
B D            Green monkey  cagttt--------gatg-ttagag-at-aaaaccttcactgatactg-agcag-------gcg-gagt-
B D                Marmoset  --gttt--------agcg-ttaggg-at-aaaaccctcactgatactg-agcag-------gtg-gagt-
B D         Squirrel monkey  --gttt--------agtg-ttaggg-at-aaaaccctcactg--actg-agcag-------gtg-gagt-
B D                Bushbaby  gagtatctgtggggcatg-ctcggg-ag-aaca----------taccg-gacgg---------g-gagt-
         Chinese tree shrew  ccctct--------------taggg-at-aaaaccttcactaatacct-ggcag-------gtg-gaat-
B D                Squirrel  cacctc--------atca-ctgggg-ag-gaaggctccactgatcctg-ggcag-------gtg-gcct-
     Lesser Egyptian jerboa  cagttc--------atgg-ttaggg-gt-cagaccttcactaatactg-gatgg-------gt----gc-
               Prairie vole  ca---------------a-ttggca-ac-caaacccttactggtgtcatcaaag-------gt----cc-
B D         Chinese hamster  ca---------------a-ctggcg-at-taaaccttcactggtgctg-caaag-------gc----ca-
             Golden hamster  ca---------------a-ctggcg-at-taaaccttcactggtgctg-caaag-------gt----ccg
B D                   Mouse  ca---------------g-ttaggg-at-aaagcaggcgttggtacag-gcaag-------ct----cc-
B D                     Rat  ca---------------g-ttgggg-ataaaaacaggctttgatactg-ccaag-------ta----cc-
B D          Naked mole-rat  ca---------------g-tttgaa-gt------ctgca-ggggcctc-cgcag-------tg----ct-
B D              Guinea pig  cc---------------gctttgga-gt------caggatggagccta-tgcag-------ag----ct-
                 Chinchilla  ca---------------g-tttgga-gt------cagcatggaggctt-tgcac-------gg----ct-
B D                  Rabbit  ggcttc--------agtg-ttaggg-at-gcca-tttcacttccgctg-gacag-------gtg-aagt-
B D                     Pig  tagttc--------agcc-ttaggg-at-aaaactttcgctgaccttg-gacag-------gt-------
B D                  Alpaca  cttttc--------ggcc-tttgagaaa-aaaaacgtcactgaccctg-gacag-------gt-------
             Bactrian camel  catttt--------ggcc-tttgggaaa-aaaaacctcactgaccctg-aacag-------gt-------
           Tibetan antelope  cagttc--------agtc-ttaggg-at-aaaaacttcactgattgag-gacag-------gt-------
B D                     Cow  cagttc--------agtc-ttaggg-at-aaaaactttgctgattgag-gacag-------gt-------
B D                   Sheep  cagttc--------agtc-ttaggg-at-aaaaacttcactgattgag-gacag-------gt-------
              Domestic goat  cagttc--------agtc-ttaggg-at-aaaaacttcactgattgag-gacag-------gt-------
B D                   Horse  caattc--------agtt-ttcagg-at-aaaaccttcattgacactg-gacag-------gt-------
B D        White rhinoceros  cagctc--------agtt-ttagga-at-aaaaccttcattgacact------g-------gt-------
B D                     Cat  tggttc--------agtt-ttaaag-at-agaaccttcactgccactg-gatgg-------gt-------
B D                     Dog  tgatgc--------agtt-ttaggg-ag-aacaccttcactatcactg-gttgg-------gt-------
B D                 Ferret   tggctt--------agtt-ttaggg-ag-aaaaccttcactgccactg-gatgg-------gt-------
B D                   Panda  tggttc--------agtt-ttaggg-ag-aaagccttcactgccattg-gatgg-------gt-------
             Pacific walrus  tggttc--------agtt-ttaggg-ag-aaaaccttcactgccactg-gatgg-------gt-------
               Weddell seal  tggttc--------agtt-ttaggg-ag-aaaaccttcactgccactg-gatgg-------gt-------
            Star-nosed mole  cagttc--------tggt-tgtagg-at-aca------------tctg-gacgg-------at-------
B D                Elephant  catttc--------agat-ttaggg-at-aaaac---cactgggaatg-gatag-------gtg-gaat-
B D                 Manatee  catttc--------agat-ttaggg-ac-aaaaccttcactgagaatg-gacag-------gtg-gaat-
           Cape golden mole  ca-ttc--------agat-acaagg-ac-aaaaccattactgggaatg-gatag-------gtgcaaat-
                   Aardvark  tatttc--------agat-ttaggg-at-aaaaccttcactgggaatg-aatag-------gtg-gaat-
B D               Armadillo  catttc--------agtc-ttgggg-ct-cagaccttccctg-----g-gacgg-------ggg-gagg-
  D            Mallard duck  cagtat--------aacg-tttggg-ac-agatctttcactgaaatca-tacggtgggatttt-------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
          Brush-tailed rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
B D                    Pika  ======================================================================
B D                  Tenrec  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  ----------------------c-----------------t
                      Chimp  ----------------------c-----------------t
                    Gorilla  ----------------------c-----------------t
                  Orangutan  ----------------------c-----------------t
                     Gibbon  ----------------------c-----------------t
                     Rhesus  ----------------------c-----------------t
        Crab-eating macaque  ----------------------c-----------------t
                     Baboon  ----------------------c-----------------t
               Green monkey  ----------------------c-----------------t
                   Marmoset  ----------------------t-----------------t
            Squirrel monkey  ----------------------t-----------------t
                   Bushbaby  ----------------------c-----------------t
         Chinese tree shrew  ----------------------c-----------------t
                   Squirrel  ----------------------c-----------------t
     Lesser Egyptian jerboa  ----------------------c-----------------t
               Prairie vole  ----------------------c-----------------t
            Chinese hamster  ----------------------c-----------------t
             Golden hamster  ttgtagattgcctcccaggtctc-----------------t
                      Mouse  ----------------------c-----------------t
                        Rat  ----------------------c-----------------t
             Naked mole-rat  ----------------------gggctgggcaggtggtg-t
                 Guinea pig  ----------------------g-----------------t
                 Chinchilla  ----------------------gaacctgacaggttgagcc
                     Rabbit  ----------------------c-----------------c
                        Pig  ----------------------c------------------
                     Alpaca  ----------------------c------------------
             Bactrian camel  ----------------------c------------------
           Tibetan antelope  ----------------------c------------------
                        Cow  ----------------------c------------------
                      Sheep  ----------------------c------------------
              Domestic goat  ----------------------c------------------
                      Horse  ----------------------c------------------
           White rhinoceros  ----------------------c------------------
                        Cat  ----------------------c------------------
                        Dog  ----------------------c------------------
                    Ferret   ----------------------c------------------
                      Panda  ----------------------c------------------
             Pacific walrus  ----------------------c------------------
               Weddell seal  ----------------------c------------------
            Star-nosed mole  ----------------------c------------------
                   Elephant  ----------------------c-----------------t
                    Manatee  ----------------------c-----------------t
           Cape golden mole  ----------------------c-----------------t
                   Aardvark  ----------------------c-----------------t
                  Armadillo  ----------------------c-----------------t
               Mallard duck  -----------------------------------------
                   Hedgehog  =========================================
                      Shrew  =========================================
                Zebra finch  =========================================
        Collared flycatcher  =========================================
           Brush-tailed rat  =========================================
        Cape elephant shrew  =========================================
                   Microbat  =========================================
       David's myotis (bat)  =========================================
              Big brown bat  =========================================
           Black flying-fox  -----------------------------------------
                    Megabat  -----------------------------------------
                       Pika  =========================================
                     Tenrec  -----------------------------------------
               Killer whale  =========================================
                    Dolphin  =========================================

Alignment block 6 of 337 in window, 17935560 - 17935633, 74 bps 
B D                   Human  gttgcctccc--agatc---ccactttcc--agccatatacactg-------------ctaatctct---
B D                   Chimp  gttgcctccc--aaatc---ccactttcc--agccatatacactg-------------ctaatctct---
B D                 Gorilla  gttgcctccc--aaatc---ccactttcc--agccatatacactg-------------ctaatctct---
B D               Orangutan  gttgcctccc--aaatc---ccagtttcc--agccatatacactg-------------ctaatctct---
B D                  Gibbon  gttgcctccc--aaatc---ccactttcc--agccatatacactg-------------ctaatctct---
B D                  Rhesus  gttgcctccc--agatc---ccactttcc--agccatatacacta-------------ctaatctct---
B D     Crab-eating macaque  gttgcctccc--agatc---ccactttcc--agccatatacacta-------------ctaatctct---
B D                  Baboon  gttgcctccc--agatc---ccactttcc--agccatatacacta-------------ctaatctct---
B D            Green monkey  gttgcctccc--agatc---ccactttcc--agccatatacacta-------------ctaatctct---
B D                Marmoset  gttgcctccc--agatc---ctacctttc--agccatatacactg-------------ctcatctct---
B D         Squirrel monkey  gttgcctccc--agatc---ccacctttc--agccatatgcaccg-------------ctcatctct---
B D                Bushbaby  gtta----gc--aggct---ccatgttcc--agccacatacactg-------------ctgattgct---
         Chinese tree shrew  gctgcctccc--acagt---ctaactccc--agccatagacactg-------------ctggtcttt---
B D                Squirrel  gttgcctggc--agact---ccacctccc--agccagatgcactg-------------ctgatcttt---
     Lesser Egyptian jerboa  attg-ctgac--agaat---ctacctcc--------cagacataattactgccttg--ctaatctct---
               Prairie vole  gtt--ccctc--atagg---ctgtctccc---gctgcatacatgg-------cttg--ctaatctct---
B D         Chinese hamster  gtt--ctgtt--gtaga---ctgcctcca---gctgcatacataa-------cgtgcactaagctct---
             Golden hamster  gtt--ctgtc--ggaga---ctgcctcct---gctgcatacacag-------catg--ctaagctct---
B D                   Mouse  -tt--ccctc--agact---ctgcctccc---acggtatacacta-------cttg--ctaacctct---
B D                     Rat  gtt--ccctcatagact---ctgcctccc---actgcatacactg-------cgtg--ctaacctct---
B D          Naked mole-rat  gtcagccact--ggacg---cc-cctccg--ggcccca-gcgctg-------------ctaagcctg---
B D              Guinea pig  gccagcttcc--agatg---cctcctccc--agccacatctgcag-------------ccaggtgcg---
                 Chinchilla  gtcagcttcc--agacg---cctcctcccggagccacctatgctg-------------ccaagcgtg---
B D                  Rabbit  gttatcccct--agact---ccacctccc--agtcaca--caggg-------cttg--ctgatctct---
B D                     Pig  --------cc---------------------agtcatagaccctg-------------ctaatctct---
B D                  Alpaca  --------cc---------------------agtcacaggcacag-------------ctaatccct---
             Bactrian camel  --------cc---------------------agtcacaggcactg-------------ctaatccct---
           Tibetan antelope  --------cc---------------------agtcacagatatgg-------------ctaatctct---
B D                     Cow  --------cc---------------------agtcacagacatgg-------------ctaatctct---
B D                   Sheep  --------cc---------------------agtcacagacatgg-------------ctaatctct---
              Domestic goat  --------cc---------------------agtcacagacatgg-------------ctaatctct---
B D                   Horse  --------cc---------------------agccacaggcactg-------------ctaatctct---
B D        White rhinoceros  --------cc---------------------agccacagacactg-------------ctaatctct---
B D                     Cat  --------cc---------------------agctgcagacggtg-------------ctaatctct---
B D                     Dog  --------cc---------------------agccacagacactg-------------tgaacctct---
B D                 Ferret   --------cc---------------------agctgcagacacgg-------------ctaatctct---
B D                   Panda  --------ca---------------------agccgcagacactg-------------ctaatctct---
             Pacific walrus  --------cc---------------------agccgcagacactg-------------ctaatctct---
               Weddell seal  --------cc---------------------agccgcagacactg-------------ctaatttct---
            Star-nosed mole  --------cc---------------------cat-gcagacactg-------------ctgggactt---
B D                Elephant  gttgccttca----------tcacctccc--agctctgtggagtg-------------ccagtctcc---
B D                 Manatee  gttgttttct----------tcatctccc--agctttggacagtg-------------ccaatcacc---
           Cape golden mole  attgctttct----------ttacctccc--agctctgtacagtg-------------ccagtctcc---
                   Aardvark  gttgccttct----------tcacctctt--agctttgtactgtg-------------ccaatttct---
B D               Armadillo  gccacctcgc----------ccccctccc--agccacgggcaccg-------------tgcgtcccc---
  D            Mallard duck  -agggattga--aagtt---ctctgacaa--aaataggaacaaca-------------tataattct---
B D                  Turkey  gatgctttcc--aaatctgactttgaaga--gaatatatacattt-------------ttggtttctatt
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
          Brush-tailed rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
B D                    Pika  ======================================================================
B D                  Tenrec  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  --------------------gcct-ctgt---ggcttctcttttct-cc-cat
                      Chimp  --------------------gcct-ctgt---ggcttctcttttct-cc-cat
                    Gorilla  --------------------gcct-ctgt---ggcttctcttttct-cc-cat
                  Orangutan  --------------------gcct-ctat---ggcttcccttttct-cc-cat
                     Gibbon  --------------------gcct-ctgt---ggcttctcttttct-cc-cat
                     Rhesus  --------------------gcct-ctgg---ggcttctcttttct-cc-cct
        Crab-eating macaque  --------------------gcct-ctgg---ggcttctcttttct-cc-cct
                     Baboon  --------------------gcct-ctgg---ggcttctcttttct-cc-cct
               Green monkey  --------------------gcct-ctgg---ggcttctcttttct-cc-cct
                   Marmoset  --------------------gcct-ctgt---ggcttctcttttct-cc-cct
            Squirrel monkey  --------------------gcct-ctgt---gacttctcttttct-cc-cac
                   Bushbaby  --------------------gccc-ctgt---gacttcccttttct-ct-ctc
         Chinese tree shrew  --------------------gctt-gttt---ggcttctctttctc-ct----
                   Squirrel  --------------------gcct-ctgtggcatctcttttctccc-gc----
     Lesser Egyptian jerboa  --------------------actt-cggt---agctctttcctc---------
               Prairie vole  --------------------acctccatt---tttctctttctccc-ct----
            Chinese hamster  --------------------acct-ctgt---tttctctttctccc-ct----
             Golden hamster  --------------------gc---ctgt---ttcctctttctcta-ct----
                      Mouse  --------------------ac---ctgt---tttctctctctccc-tt----
                        Rat  --------------------acct-ctgc---tttctctccctccc-tt----
             Naked mole-rat  --------------------gccc-ctcg---tgcctcttccctgc-ct----
                 Guinea pig  --------------------gcct-ctga---ggtctctcttctcc-cc----
                 Chinchilla  --------------------gcct-ctgc---tgtctccgttctgt-ct----
                     Rabbit  --------------------gcct-ctgg---cttctcttttctcc-ctc---
                        Pig  --------------------gcct-tctg---ggcttt----tctc-tc----
                     Alpaca  --------------------gcct-ttgg---ggcttctgtatttc-cc----
             Bactrian camel  --------------------gcct-ttgg---ggcttctgtcttcc-cc----
           Tibetan antelope  --------------------gcct-tcag---ggcttc----tttc-cc----
                        Cow  --------------------gcct-tcag---ggcttc----tttt-ct----
                      Sheep  --------------------gcct-tcag---ggcttc----tttc-cc----
              Domestic goat  --------------------gcct-tcag---ggcttc----tttc-cc----
                      Horse  --------------------gcct-tttg---ggcttctcttttct-c-----
           White rhinoceros  --------------------gcct-tttg---ggcttctcttttct-cc----
                        Cat  --------------------gcct-ttga---ggcctctctttccc-cg----
                        Dog  --------------------gcct-ttgg---gacttctctttccctcc----
                    Ferret   --------------------gcct-ttgg---ggcttctctt-----cc----
                      Panda  --------------------gcct-ttgg---ggcttctctttccc-cc----
             Pacific walrus  --------------------gcct-ttgg---ggcttctctttctc-ct----
               Weddell seal  --------------------gcct-ttgg---ggtttctctttccc-ct----
            Star-nosed mole  --------------------gctt-tcct---tactcccccaccct-ca----
                   Elephant  --------------------acct-ctat---gaattcttttctct-cc----
                    Manatee  --------------------acct-ctat---gaattctcttctct-ca----
           Cape golden mole  --------------------acat-ctat---gaattctcttttct-cc----
                   Aardvark  --------------------acct-cttt---gaattctcttctct-cc----
                  Armadillo  --------------------gcct-tcat---gactttcct--tct-gc----
               Mallard duck  --------------------gtac-gtga---cag------------------
                     Turkey  atctaatctcttcagtgctggtaa-atag---cag------------------
                   Hedgehog  =====================================================
                      Shrew  =====================================================
                Zebra finch  =====================================================
        Collared flycatcher  =====================================================
           Brush-tailed rat  =====================================================
        Cape elephant shrew  =====================================================
                   Microbat  =====================================================
       David's myotis (bat)  =====================================================
              Big brown bat  =====================================================
           Black flying-fox  -----------------------------------------------------
                    Megabat  -----------------------------------------------------
                       Pika  =====================================================
                     Tenrec  -----------------------------------------------------
               Killer whale  =====================================================
                    Dolphin  =====================================================

Inserts between block 6 and 7 in window
B D                    Pig 17bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 4bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
           Star-nosed mole 4bp
B D               Elephant 2bp
B D                Manatee 2bp
          Cape golden mole 2bp
                  Aardvark 2bp
B D              Armadillo 2bp

Alignment block 7 of 337 in window, 17935634 - 17935666, 33 bps 
B D                   Human  ----------------tttgctgaccaccc-tactttagttaaaaga-----tct
B D                   Chimp  ----------------tttgctgaccaccc-tactttagttaaaaga-----tct
B D                 Gorilla  ----------------tttgctgaccaccc-tactttagttaaaaga-----tct
B D               Orangutan  ----------------tttgctgaccaccc-tactttagttaaaaga-----tct
B D                  Gibbon  ----------------tttgctgaccaccc-tactttagttaaaaga-----tct
B D                  Rhesus  ----------------tttgctgaccaccc-tatttccgttaaaaga-----tct
B D     Crab-eating macaque  ----------------tttgctgaccaccc-tacttccgttaaaaga-----tct
B D                  Baboon  ----------------tttgctgaccaccc-tacttccgttaaaaga-----tct
B D            Green monkey  ----------------tttgctgaccaccc-tacttcccttaaaaga-----tct
B D                Marmoset  ----------------gttgctgaccaccc-tactttagttaaaaga-----tct
B D         Squirrel monkey  ----------------gttgctgaccaccc-tactttagctaaaaga-----tct
B D                Bushbaby  ----------------tttgctgaccagtc-tactttagttaaagaa-----tct
         Chinese tree shrew  -------------------------cactc-tactttagttcaagtg-----tct
B D                Squirrel  ----------------tttgctgatcatcctgcttttagagaaagga-----tcc
     Lesser Egyptian jerboa  ---------------------------------ttgtggtgaaagga-----tct
               Prairie vole  ----------------ttttctgaaccccc-ggtttt-gtggcagta-----tct
B D         Chinese hamster  ----------------tttgctcaacaccc-aattttagtggcagtg-----tct
             Golden hamster  ----------------tttgctcaacaccc-aattttagtgacagcg-----tct
B D                   Mouse  ----------------t-tgctcaacatcc-aattttagtggtagca-----tct
B D                     Rat  ----------------tctgctcaacaccc-aattttagtg-----a-----cct
B D          Naked mole-rat  ----------------tcg-ctgagcaccc-tactgccgctgcctgg-----tct
B D              Guinea pig  ----------------ttc---gagacccc-cgcctgagctgaatgg-----tct
                 Chinchilla  ----------------ttg---cagcaccc-tacctgagttgaatga-----tcg
B D                  Rabbit  ----------------tttgcagaccaccc-tgctttgggtcaagga-----tct
B D                    Pika  ----------------tttgctgacca-cc-tgctttgggtaaggaa-----tc-
B D                     Pig  ----------------tctgctgaccaccc-ctctttacttaaaggc-----tct
B D                  Alpaca  ----------------ttttccgaccaccc-ctctttagttaaagga-----tct
             Bactrian camel  ----------------tctgccaaccaccc-atctttagttaaagga-----tct
           Tibetan antelope  ----------------cctgctgaccaccc-ctctttagttaaagga-----tct
B D                     Cow  ----------------cctgctgaccaccc-ctctttagttaaagga-----tct
B D                   Sheep  ----------------cctgctgaccaccc-ctctttagttgaaggg-----tgt
              Domestic goat  ----------------cctgctgaccaccc-ctctttagctgaagga-----tct
B D                   Horse  ------------------------ccactc-tttttta-ctaaagga-----tct
B D        White rhinoceros  -----------------ctgctaaccaccc-ttcttta-ctaaagga-----tct
B D                     Cat  ----------------ggcaaccaccaccc-ttctttagttaaagga-----tct
B D                     Dog  ----------------gccaaccaacaccc-ttctttagttaaagga-----tct
B D                 Ferret   ----------------gccaactatcatcc--tctttagttaaagga-----tct
B D                   Panda  ----------------accaaccaccaccc-ttctttagttaaagga-----tct
             Pacific walrus  ----------------tccaaccaccaccc-ttctttagttaaagga-----tct
               Weddell seal  ----------------gccaaccaccaccc-ttctttagttaaagga-----tct
            Star-nosed mole  ----------------ccc-----cccccc-ttcttcagtcacagga-----act
B D                Elephant  ----------------tttgctaatttccc-ttctttagttagaagt-----tct
B D                 Manatee  ----------------tttgctaatttcc----ctttacttaaaggg-----ttt
           Cape golden mole  ----------------tttgctaatttctg-ttctttagcaaaaatg-----tct
                   Aardvark  ----------------tttgctaatttct----ctttagttaaaaga-----tct
B D               Armadillo  ----------------tttgcaggc--------cctctgttacaggt-----gca
  D            Mallard duck  gct----gttttgtcatttgaaatacacat-tttttcaaacaaatcacaatgtat
B D                  Turkey  gttcagagttgtg---------------ac-ttttctactgaaagta----gtgt
B D                Hedgehog  =======================================================
B D                   Shrew  =======================================================
B D             Zebra finch  =======================================================
  D     Collared flycatcher  =======================================================
          Brush-tailed rat  =======================================================
       Cape elephant shrew  =======================================================
B D                Microbat  =======================================================
      David's myotis (bat)  =======================================================
             Big brown bat  =======================================================
          Black flying-fox  -------------------------------------------------------
B D                 Megabat  -------------------------------------------------------
B D                  Tenrec  -------------------------------------------------------
              Killer whale  =======================================================
B D                 Dolphin  =======================================================

Inserts between block 7 and 8 in window
                  Aardvark 577bp

Alignment block 8 of 337 in window, 17935667 - 17935669, 3 bps 
B D                   Human  -ttc
B D                   Chimp  -ttc
B D                 Gorilla  -ttc
B D               Orangutan  -ttc
B D                  Gibbon  -ttc
B D                  Rhesus  -ttc
B D     Crab-eating macaque  -ttc
B D                  Baboon  -ttc
B D            Green monkey  -ttc
B D                Marmoset  -ttc
B D         Squirrel monkey  -ttc
B D                Bushbaby  -ttt
         Chinese tree shrew  -tcc
B D                Squirrel  -ttt
     Lesser Egyptian jerboa  -tta
               Prairie vole  -ttc
B D         Chinese hamster  -ttt
             Golden hamster  -ttt
B D                   Mouse  -ttc
B D                     Rat  -ttc
B D          Naked mole-rat  -ccc
B D              Guinea pig  -ccc
                 Chinchilla  -tcc
B D                  Rabbit  -ttc
B D                    Pika  -ttc
B D                     Pig  -tct
B D                  Alpaca  -tct
             Bactrian camel  -tct
           Tibetan antelope  -tct
B D                     Cow  -tct
B D                   Sheep  -tct
              Domestic goat  -tct
B D                   Horse  -tcc
B D        White rhinoceros  -tcc
B D                     Cat  -tcc
B D                     Dog  -tcc
B D                 Ferret   -tcc
B D                   Panda  -tcc
             Pacific walrus  -tcc
               Weddell seal  -tcc
            Star-nosed mole  -cca
B D               Armadillo  --cc
  D            Mallard duck  ata-
B D                  Turkey  agt-
B D                Hedgehog  ====
B D                   Shrew  ====
B D             Zebra finch  ====
  D     Collared flycatcher  ====
          Brush-tailed rat  ====
       Cape elephant shrew  ====
B D                Microbat  ====
      David's myotis (bat)  ====
             Big brown bat  ====
          Black flying-fox  ----
B D                 Megabat  ----
B D                  Tenrec  ----
                  Aardvark  ====
B D                Elephant  ----
B D                 Manatee  ----
              Killer whale  ====
B D                 Dolphin  ====
          Cape golden mole  ----

Inserts between block 8 and 9 in window
B D         Naked mole-rat 1bp

Alignment block 9 of 337 in window, 17935670 - 17935675, 6 bps 
B D                   Human  accttt--
B D                   Chimp  accttt--
B D                 Gorilla  accttt--
B D               Orangutan  accttt--
B D                  Gibbon  accttt--
B D                  Rhesus  accttt--
B D     Crab-eating macaque  accttt--
B D                  Baboon  accttt--
B D            Green monkey  accttt--
B D                Marmoset  accttt--
B D         Squirrel monkey  accttt--
B D                Bushbaby  cacctt--
         Chinese tree shrew  acc-tt--
B D                Squirrel  at------
     Lesser Egyptian jerboa  gatgtgct
               Prairie vole  accttg--
B D         Chinese hamster  accttg--
             Golden hamster  accttg--
B D                   Mouse  accttg--
B D                     Rat  accttg--
B D          Naked mole-rat  cctttg--
B D              Guinea pig  tcttgc--
                 Chinchilla  ccttgg--
B D                  Rabbit  ctcttt--
B D                    Pika  cccttt--
B D                     Pig  gctttt--
B D                  Alpaca  tccttt--
             Bactrian camel  gccttt--
           Tibetan antelope  gccttt--
B D                     Cow  gccttt--
B D                   Sheep  gccttt--
              Domestic goat  gccttt--
B D                   Horse  accttt--
B D        White rhinoceros  accttt--
B D                     Cat  accttt--
B D                     Dog  atcttt--
B D                 Ferret   atcttt--
B D                   Panda  atcttt--
             Pacific walrus  atcttt--
               Weddell seal  atcttt--
            Star-nosed mole  accctt--
B D                Elephant  gccttt--
B D                 Manatee  gccttt--
           Cape golden mole  gattgt--
                   Aardvark  gccttt--
B D               Armadillo  ttcctc--
  D            Mallard duck  ---atc--
B D                  Turkey  ---att--
B D                Hedgehog  ========
B D                   Shrew  ========
B D             Zebra finch  ========
  D     Collared flycatcher  ========
          Brush-tailed rat  ========
       Cape elephant shrew  ========
B D                Microbat  ========
      David's myotis (bat)  ========
             Big brown bat  ========
          Black flying-fox  --------
B D                 Megabat  --------
B D                  Tenrec  --------
              Killer whale  ========
B D                 Dolphin  ========

Alignment block 10 of 337 in window, 17935676 - 17935678, 3 bps 
B D                   Human  ag--a
B D                   Chimp  ag--a
B D                 Gorilla  ag--a
B D               Orangutan  ag--a
B D                  Gibbon  ag--a
B D                  Rhesus  ag--a
B D     Crab-eating macaque  ag--a
B D                  Baboon  ag--a
B D            Green monkey  ag--a
B D                Marmoset  ag--g
B D         Squirrel monkey  ag--a
B D                Bushbaby  agaca
         Chinese tree shrew  ag--a
B D                Squirrel  aa--g
     Lesser Egyptian jerboa  ga--g
               Prairie vole  tg--g
B D         Chinese hamster  ag--g
             Golden hamster  ag--g
B D                   Mouse  ag--g
B D                     Rat  ag--g
B D          Naked mole-rat  ag--g
B D              Guinea pig  a---g
                 Chinchilla  ag--g
B D                  Rabbit  ag--c
B D                    Pika  ag--a
B D                     Pig  aa--a
B D                  Alpaca  ag--a
             Bactrian camel  ag--a
           Tibetan antelope  ag--t
B D                     Cow  ag--t
B D                   Sheep  ag--t
              Domestic goat  ac--t
B D                   Horse  ag--a
B D        White rhinoceros  ag--a
B D                     Cat  ag--a
B D                     Dog  a---a
B D                 Ferret   ag--a
B D                   Panda  ag--a
             Pacific walrus  ag--a
               Weddell seal  ag--a
            Star-nosed mole  tg--t
B D                Elephant  ag--a
B D                 Manatee  ag--a
           Cape golden mole  aa--c
                   Aardvark  ag--a
B D               Armadillo  ag--g
  D            Mallard duck  at--t
B D                  Turkey  ga--a
B D           X. tropicalis  ag--a
B D                Hedgehog  =====
B D                   Shrew  =====
B D             Zebra finch  =====
  D     Collared flycatcher  =====
          Brush-tailed rat  =====
       Cape elephant shrew  =====
B D                Microbat  =====
      David's myotis (bat)  =====
             Big brown bat  =====
          Black flying-fox  -----
B D                 Megabat  -----
B D                  Tenrec  -----
              Killer whale  =====
B D                 Dolphin  =====

Inserts between block 10 and 11 in window
  D           Mallard duck 15bp
B D                 Turkey 5bp

Alignment block 11 of 337 in window, 17935679 - 17935699, 21 bps 
B D                   Human  tatgctga-------------t-a------tct-----ca-----------ttt---------------t
B D                   Chimp  tatgctga-------------t-c------tct-----ca-----------ttt---------------t
B D                 Gorilla  tatgctga-------------t-c------tct-----ca-----------ttt---------------t
B D               Orangutan  tgtgctga-------------t-c------tct-----ct-----------ttt---------------t
B D                  Gibbon  tgtgctga-------------t-c------tct-----ca---------ttttt---------------t
B D                  Rhesus  tgtactgc-------------t-c------tgt-----ctctctct--tttttt---------------t
B D     Crab-eating macaque  tgtactgc-------------t-c------tct-----ctctctct-ctttttt---------------t
B D                  Baboon  tgtgctga-------------t-c------tct-----ctctctcttttttttt---------------t
B D            Green monkey  tgtgctga-------------t-c------tct-----ctctctct--ctcttt---------------t
B D                Marmoset  tgtgctga-------------t-g------cct-----aa-----------ttt---------------t
B D         Squirrel monkey  tgcactga-------------t-g------cct-----ca-----------ttg---------------t
B D                Bushbaby  tatgttga-------------------------------------------tcc---------------t
         Chinese tree shrew  tgtgctga-------------t-c------tct-----cc------------------------------
B D                Squirrel  tgctgat--------------------------------------------tcc---------------c
     Lesser Egyptian jerboa  cattctca-------------t-c------tct-----ct-----------ctctctctctttttttttt
               Prairie vole  tgttccta-------------c-c------tcc-----ca-----------ctc---------------c
B D         Chinese hamster  tgttccta-------------c-c------tcc-----ta-----------ccc---------------c
             Golden hamster  tgttccta-------------c-c------tcc-----ta-----------ccc---------------c
B D                   Mouse  tgctctga-------------c-c------tcc-----ta-----------ccc--------------ac
B D                     Rat  tgctctga-------------c-c------tcc-----ta-----------ccc--------------ac
B D          Naked mole-rat  tgtc----------------------------------tg-----------gcc---------------c
B D              Guinea pig  tgtt----------------------------------gg-----------cct---------------c
                 Chinchilla  tgct----------------------------------ga-----------acc---------------c
B D                  Rabbit  tgtgctga------------------------------tt-----------ccc---------------c
B D                    Pika  tgtgatga------------------------------tc-----------tca---------------c
B D                     Pig  tgtgatga-------------t-c------cca-----cc------------------------------
B D                  Alpaca  tgcgctga-------------t-c------cca-----ct------------------------------
             Bactrian camel  tgcgctga-------------t-c------cca-----ct------------------------------
           Tibetan antelope  tgcaatga-------------t-c------ccc-----tt------------------------------
B D                     Cow  tgtaatga-------------t-c------ccc-----ct------------------------------
B D                   Sheep  tgcaatga-------------t-c------ccc------t------------------------------
              Domestic goat  tgcaatga-------------t-c------ccc-----tt------------------------------
B D                   Horse  tgtgctga--------------------------------------------------------------
B D        White rhinoceros  tgtgctga-------------t-c------cca-------tt----------------------------
B D                     Cat  tgtgatgg-------------t-c------tccccacccctt----------------------------
B D                     Dog  tgtgatta-------------t-c------cca---tttttt----------------------------
B D                 Ferret   catgatta-------------t-c------cct-------------------------------------
B D                   Panda  catgatta-------------t-c------cca-----tttt----------------------------
             Pacific walrus  tgtaatta-------------t-c------cca-----tttt----------------------------
               Weddell seal  tgtgatta-------------t-c------cca----ttttt----------------------------
            Star-nosed mole  tttat-----------------------------------------------------------------
B D                Elephant  tgtgttga-------------t-c------ttt-----tt-----------tt-----------------
B D                 Manatee  tgtgttga-------------t-c------ttt-----tt-----------tt-----------------
           Cape golden mole  tatgttga-------------t-c------ttt-----tt-----------tc-----------------
B D                  Tenrec  tgtgttga-------------tac------ttt-----tt-----------tt-----------------
                   Aardvark  tgtgttga-------------t-ctgtattttt-----tt-----------tc-----------------
B D               Armadillo  tgtgctga-------------c-a------cca-----tt-----------gt-----------------
  D            Mallard duck  tttcttgg-------------t------------------------------------------------
B D                  Turkey  ttcttcag-------------t------------------------------------------------
B D           X. tropicalis  tgtgctaaatctcgcactgtat------------------------------------------------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
          Brush-tailed rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  at
                      Chimp  at
                    Gorilla  at
                  Orangutan  tt
                     Gibbon  tt
                     Rhesus  tt
        Crab-eating macaque  tt
                     Baboon  tt
               Green monkey  tt
                   Marmoset  tt
            Squirrel monkey  tt
                   Bushbaby  tt
         Chinese tree shrew  --
                   Squirrel  tg
     Lesser Egyptian jerboa  tt
               Prairie vole  tt
            Chinese hamster  tt
             Golden hamster  tt
                      Mouse  tt
                        Rat  tt
             Naked mole-rat  tg
                 Guinea pig  tc
                 Chinchilla  tc
                     Rabbit  ta
                       Pika  t-
                        Pig  --
                     Alpaca  --
             Bactrian camel  --
           Tibetan antelope  --
                        Cow  --
                      Sheep  --
              Domestic goat  --
                      Horse  --
           White rhinoceros  --
                        Cat  --
                        Dog  --
                    Ferret   --
                      Panda  --
             Pacific walrus  --
               Weddell seal  --
            Star-nosed mole  --
                   Elephant  --
                    Manatee  --
           Cape golden mole  --
                     Tenrec  --
                   Aardvark  --
                  Armadillo  --
               Mallard duck  --
                     Turkey  --
              X. tropicalis  --
                   Hedgehog  ==
                      Shrew  ==
                Zebra finch  ==
        Collared flycatcher  ==
           Brush-tailed rat  ==
        Cape elephant shrew  ==
                   Microbat  ==
       David's myotis (bat)  ==
              Big brown bat  ==
           Black flying-fox  --
                    Megabat  --
               Killer whale  ==
                    Dolphin  ==

Inserts between block 11 and 12 in window
B D                    Cow 289bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D               Elephant 2bp
B D                Manatee 3bp
          Cape golden mole 3bp
B D                 Tenrec 3bp
                  Aardvark 3bp
B D              Armadillo 3bp
B D                 Turkey 5bp

Alignment block 12 of 337 in window, 17935700 - 17935749, 50 bps 
B D                   Human  tttt-tc---------------------------------------ctgt--------------------
B D                   Chimp  tttt-tc---------------------------------------ctgt--------------------
B D                 Gorilla  tttt-tc---------------------------------------ctgt--------------------
B D               Orangutan  tttt-tc---------------------------------------ctgt--------------------
B D                  Gibbon  tttt-tc---------------------------------------ctgt--------------------
B D                  Rhesus  tttt-cc---------------------------------------ctgt--------------------
B D     Crab-eating macaque  tttt-cc---------------------------------------ctgt--------------------
B D                  Baboon  tttt-cc---------------------------------------ctgt--------------------
B D            Green monkey  tttt-tc---------------------------------------ctgt--------------------
B D                Marmoset  tttt-tc---------------------------------------ctgt--------------------
B D         Squirrel monkey  tttt-tttaatttattttatttatttatttatttatttattttttgctgt--------------------
B D                Bushbaby  tttc-cc---------------------------------------ctct--------------------
         Chinese tree shrew  ctcc-tg---------------------------------------ctga--------------------
B D                Squirrel  tttt-ac---------------------------------------ctgt--------------------
     Lesser Egyptian jerboa  tttt-gc---------------------------------------ttct--------------------
               Prairie vole  tttg-tc---------------------------------------tggt--------------------
B D         Chinese hamster  tttg-tc---------------------------------------tggt--------------------
             Golden hamster  tttg-tc---------------------------------------tggt--------------------
B D                   Mouse  tttg-tc---------------------------------------tggt--------------------
B D                     Rat  tttg-tc---------------------------------------tggt--------------------
B D          Naked mole-rat  tttg-tc---------------------------------------ctgc--------------------
B D              Guinea pig  ttct-------------------------------------------tgt--------------------
                 Chinchilla  ttctttc---------------------------------------ctgt--------------------
B D                  Rabbit  ccta-cc---------------------------------------ccgt--------------------
B D                    Pika  -cta-cc---------------------------------------ctgt--------------------
B D                     Pig  cttt-tc---------------------------------------ttgt--------------------
B D                  Alpaca  tttt-cc---------------------------------------atgt--------------------
             Bactrian camel  tttt-cc---------------------------------------ctgt--------------------
           Tibetan antelope  tttt-ta---------------------------------------ctgt--------------------
B D                     Cow  ctct-ga---------------------------------------ctgt--------------------
B D                   Sheep  tttt-ta---------------------------------------ctgt--------------------
              Domestic goat  tttt-ta---------------------------------------ctgt--------------------
B D                   Horse  ---t-tc---------------------------------------ttgt--------------------
B D        White rhinoceros  tgtt-tc---------------------------------------ctgt--------------------
B D                     Cat  tttt-tc---------------------------------------ctgt--------------------
B D                     Dog  cttc-cc---------------------------------------ttgt--------------------
B D                 Ferret   ----------------------------------------------ctgt--------------------
B D                   Panda  tttc-cc---------------------------------------ttgt--------------------
             Pacific walrus  tttc-cc---------------------------------------ctgc--------------------
               Weddell seal  tttc-cc---------------------------------------ctgt--------------------
            Star-nosed mole  -tcc-tt---------------------------------------ctgtgtgtcttgggggggagcagt
B D                Elephant  cccc-tg---------------------------------------tgct--------------------
B D                 Manatee  ccct-tg---------------------------------------tggt--------------------
           Cape golden mole  cccc-tg---------------------------------------tggt--------------------
B D                  Tenrec  atcc-tg---------------------------------------tggt--------------------
                   Aardvark  ctcc-tc---------------------------------------tggt--------------------
B D               Armadillo  ccct--------------------------------------------gc--------------------
  D            Mallard duck  cttc-tt---------------------------------------gtat--------------------
B D                  Turkey  ctcc-tt---------------------------------------taac--------------------
B D           X. tropicalis  -ttt-tc---------------------------------------tcat--------------------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
          Brush-tailed rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  --ggaggtt---taaatat---gctgatat-agg-ta-actt-----------ggtgac--ttt
                      Chimp  --ggaggtt---taaatat---gctgatat-agg-ta-actt-----------ggtgac--ttt
                    Gorilla  --ggaggtt---taaatat---gctgatat-agg-ta-actt-----------ggtgac--ttt
                  Orangutan  --ggaggtt---taaatat---gctgatat-aag-ta-actt-----------tgtgac--ttt
                     Gibbon  --ggaggtc---taaatat---gctgatat-agg-ta-actt-----------tgtgac--ttt
                     Rhesus  --agaggtt---taaatat---gcagatat-agg-ta-actt-----------tgtgac--ttt
        Crab-eating macaque  --agaggtt---taaatat---gcagatat-agg-ta-actt-----------tgtgac--ttt
                     Baboon  --agaggtt---taaatat---gcagatat-agg-ta-actt-----------tgtgac--ttt
               Green monkey  --agaggtt---taaatat---gcagatat-agg-ta-actt-----------tgtgac--ttt
                   Marmoset  --ggaggtt---taaatac---gctgatat-agg-tagactt-----------tgtgac--tta
            Squirrel monkey  --ggaggtt---taaatat---gctgctat-agg-tagactt-----------tgtgac--ttt
                   Bushbaby  -----ggtt---taaaaat---gtcaatat-agg-gagacct-----------cgtg-------
         Chinese tree shrew  --ggagact---tagatag---gctcatca-gag-ag-actt-----------tgggac--ttt
                   Squirrel  --ggagatg---tagatgt---gtggatgg-ata--g-tctt-----------tgtgat--ttt
     Lesser Egyptian jerboa  --ggtggtt---catatgt---gtatatta-ag-----------------------------tt
               Prairie vole  --ggaggat---cggttgt---gcagttgt-agg-------------------tagagc--ttt
            Chinese hamster  --ggaggat---caactgt---gcagttac-agg-------------------tagaac--ttt
             Golden hamster  --ggaggat---caactgt---gcagttac-agg-------------------caggac--ttt
                      Mouse  --ag-gggt---cagctat---gtaggtac-agg-------------------cagaac--ttt
                        Rat  --ag-gggt---cagctat---gtagttac-a-g-------------------tagaac--ttt
             Naked mole-rat  --ggg-----------------gtgggtgc-agc--t-agct-----------tgccac--ctt
                 Guinea pig  --agatgtt---tgggtgt---gtggatcctggc--a-ggcc-----------gaagac--ttt
                 Chinchilla  --aggtgtc---tgggtat---gtggatac-agt--a-gact-----------tactac--ttt
                     Rabbit  --gcaggtt---cagatgt---gctgacac-aggtag-ctct-----------tgagat--ttt
                       Pika  --tgtactt---cagatgt---gtgggcac-cga--------------------aagat--tcc
                        Pig  --ggggggtgggtaacgat---gcctatag-agg-cagacat-----------tgtgac--ttt
                     Alpaca  --gggggtc---tagcgat---gcccatag-agg-tagactt-----------tgtaac--ttt
             Bactrian camel  --gggggtc---tagcgat---gcccatag-agg-tagactt-----------tgtgac--ttt
           Tibetan antelope  --ggggctt---tagcgat---gcccatat-agg-tgaactt-----------tgtgtc--ttt
                        Cow  --gggggtt---tagcgat---gcccatat-agg-tggactt-----------tgtgtcttttt
                      Sheep  --ggggctt---tagcgat---ggccatat-agg-tggactt-----------cgtgtc--ttt
              Domestic goat  --ggggctt---tagcgat---acccatat-agg-tggactt-----------tgtgtc--ttt
                      Horse  --ggaggtt---taactat---gcccatag-agc-tagactt-----------tgtgac--ttt
           White rhinoceros  --ggaggtt---tagcttt---gcccatac-agg-tagattt-----------tgtgac--ttt
                        Cat  --ggaagtt---taaccat---gcctatg-----------------------------------
                        Dog  --ggaggtt---taactat---gcccata-----------------------------------
                    Ferret   --ggaggtt---taactat---gcccata-----------------------------------
                      Panda  --ggatatt---taactct---gcccata-----------------------------------
             Pacific walrus  --agaggtt---taactat---gcccata-----------------------------------
               Weddell seal  --ggaggtt---caactat---gcccata-----------------------------------
            Star-nosed mole  tggggaggt---tattgct---gcccagac-agg-aagactt-----------catgac--ttt
                   Elephant  --ggaggtt---tagatac---gctgatac-agg-tagactt-----------cgtgac--ttt
                    Manatee  --cga-------ctgatacagtgctgatac-agg-tagactt-----------tgtaac--ttt
           Cape golden mole  --aaaggtt---tagatac---gctgatat-agg-taaactt-----------tgtgtcttttt
                     Tenrec  --caaagtt---cagctgt---gccg--at-agg-tcggctt-----------ggtgac--ttt
                   Aardvark  --ggaggtt---tagatag------------agg-tagactt-----------tgtgac--ttt
                  Armadillo  --agaggtc---tagatac---gccgacac-agg-tggact-------------gtgac--tct
               Mallard duck  --ataa--------ataat---gtaaatac-aag-aaaatt------------aatggc--taa
                     Turkey  --aagaact---tcataat---ttaaatac-caa-agtatcttgtatactttaaataac--tga
              X. tropicalis  --aaacact---tctgcgt---cctg--------------------------------------
                   Hedgehog  ================================================================
                      Shrew  ================================================================
                Zebra finch  ================================================================
        Collared flycatcher  ================================================================
           Brush-tailed rat  ================================================================
        Cape elephant shrew  ================================================================
                   Microbat  ================================================================
       David's myotis (bat)  ================================================================
              Big brown bat  ================================================================
           Black flying-fox  ----------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------
               Killer whale  ================================================================
                    Dolphin  ================================================================

Inserts between block 12 and 13 in window
B D                 Turkey 8bp

Alignment block 13 of 337 in window, 17935750 - 17935790, 41 bps 
B D                   Human  --acttgctcttc----ctgt----------------------ttttt---tttt-tta-----------
B D                   Chimp  --acttgctcttc----ctgt----------------------ttttt---tttc---a-----------
B D                 Gorilla  --acttgctcttc----ctgt----------------------ttttt---tttc---a-----------
B D               Orangutan  --acttgctcttc----ctgg----------------------ttttt---tttc---a-----------
B D                  Gibbon  --acttgctcttc----ctgt----------------------ttttt---tttc---a-----------
B D                  Rhesus  --acttgctcttc----ctgtgt--------------------ttttt---tttt---a-----------
B D     Crab-eating macaque  --acttgctcttc----ctgtg---------------------ttttt---tttt---a-----------
B D                  Baboon  --acttgctcttc----ctgttt--------------------ttttt---tttt---a-----------
B D            Green monkey  --acttgctcttc----ctgtt---------------------ttttt---tttc---a-----------
B D                Marmoset  --agttgctttta----c-------------------------ttttt---tttt-taa-----------
B D         Squirrel monkey  --agttgctcttc----c-------------------------ttttt---tttt---a-----------
B D                Bushbaby  -------------------------------------------ccttc---tctt---------------
         Chinese tree shrew  --attttctcttc----ctgg----------------------ctttt---ttgt---------------
B D                Squirrel  --gtttgct--------ct------------------------tccta---tttt---t-----------
     Lesser Egyptian jerboa  --gattttcttgtt---ct------------------------tcctt---tttt---g-----------
               Prairie vole  --gattgcttggc----ct------------------------tctgg---tttt---g-----------
B D         Chinese hamster  --gattgctccgt----ct------------------------tcttg---tttt---g-----------
             Golden hamster  --gatttcgctgt----ct------------------------tctca---tttt---g-----------
B D                   Mouse  --gattgcctggt----ct------------------------tcctg---tttt---g-----------
B D                     Rat  --gattgcctggttttatt------------------------tcttg---tttt---g-----------
B D          Naked mole-rat  --gcttgctcttt----c-------------------------ttttc---cctc---c-----------
B D              Guinea pig  --gcttgctcttt----ct------------------------tttta---tttc---c-----------
                 Chinchilla  --gcttgctgttt----c----------------------------tg---tttc---c-----------
B D                  Rabbit  --g--tgtgttca----tt------------------------tattt---attt---atttatttattg
B D                    Pika  --g--tgtcttgg----cc------------------------ttttc---cctc---a-----------
B D                     Pig  --gcttgctcttc----ctgtttg-------gtttttgttttgttttt---taca---gttttctttttt
B D                  Alpaca  --gc-tgctcttc----ttgctt--------ttgtttgttttgttt-----tgtt---g-----------
             Bactrian camel  --gcttgctcttc----ttgcttt----tgattgtgtgttttgttt-----tgtt---g-----------
           Tibetan antelope  --gcttgcttgtc----tt------------ctctttggtttgtttgc---tgtt---g-----------
B D                     Cow  --gcttgcttgtc----ct------------ctttttggtttgtttgc---tgtt---g-----------
B D                   Sheep  --gcttgcttgtc----ct------------ctctttggtttgtttgc---tgtt---g-----------
              Domestic goat  --gcttgcttgtc----ct------------ctctttggtttgtttgc---tgtt---g-----------
B D                   Horse  --gcttgttcttc----ctgt----------ttttttggttttttt-----tttt---g-----------
B D        White rhinoceros  --gcttgttctta----ctg--------------------tttttt-----tctt---g-----------
B D                     Cat  ----------------------------------------------------------------------
B D                     Dog  ----------------------------------------------------------------------
B D                 Ferret   ----------------------------------------------------------------------
B D                   Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
            Star-nosed mole  --tcttgttcttc----ctgatttgtcttattttttagtttttatttt---tttt---g-----------
B D                Elephant  --tcttgcttttc----ctg--------------------------tt---tttt---c-----------
B D                 Manatee  --tcttgctcttc----ccg--------------------------tt---ttct---t-----------
           Cape golden mole  --ttttgctcttt----ctg-----------------tatttcttttt---tttc---c-----------
B D                  Tenrec  --ccttgttcttc----ctga---------------tttttgctttct---cttt---t-----------
                   Aardvark  --tcttgctcttc----cta--------------------------tt---tttt---c-----------
B D               Armadillo  --cctt-ctcttc----ctg--------------------------tttggttgt---g-----------
  D            Mallard duck  --actagttctgt----ctagttgca-----------------gcttt---tggtacta-----------
B D                  Turkey  -----agcttt-t----ctaagctct-----------------ttttt---ttgt---------------
B D           X. tropicalis  cctttagctcatc----ct------------accgttttttatttctg---ttct---a-----------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
          Brush-tailed rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  ------ttgt---------------ttg---------cttttgg
                      Chimp  ------ttgt---------------ttg---------cttttgg
                    Gorilla  ------ttgt---------------ttg---------cttttgg
                  Orangutan  ------ttgt---------------ttg----------ttttgg
                     Gibbon  ------ttgt---------------ttg---------tttttgg
                     Rhesus  ------ttgt---------------ttg---------tttttgg
        Crab-eating macaque  ------ttgt---------------ttg---------tttttgg
                     Baboon  ------ttgt---------------ttg---------tttttcg
               Green monkey  ------ttgt---------------ttg---------tttttgg
                   Marmoset  ------ttgt---------------ttg---------gttttgg
            Squirrel monkey  ------ttgt---------------ttg---------tttttgg
                   Bushbaby  -------------------------------------------g
         Chinese tree shrew  ------ttgt---------------tta---------ttttttg
                   Squirrel  ------ttta----------accagtaa---------tatttgg
     Lesser Egyptian jerboa  ------ctgg---------------aaa---------tattgga
               Prairie vole  ------cttgcttttgtttcctcaaaac---------tgtttag
            Chinese hamster  ------attgttt------------------------tgtttgg
             Golden hamster  ------attgtttttgttttgtcagaac---------tatttgg
                      Mouse  ------tctg---------------aac---------tatttgg
                        Rat  ------tctg---------------aac---------gatttgg
             Naked mole-rat  ------cgga---------------aatgctgggtgt-------
                 Guinea pig  ------caga---------------agc----------------
                 Chinchilla  ------tgga---------------aac----------------
                     Rabbit  ------ccag---------------agg---------tatgtag
                       Pika  ------ccgg---------------aag---------tatgtag
                        Pig  ttccctccag---------------aaa---------catttgt
                     Alpaca  ------ccag---------------aaa---------tatttgg
             Bactrian camel  ------ccag---------------aaa---------tatttgg
           Tibetan antelope  ------ccag---------------caa---------tatttgg
                        Cow  ------ccag---------------caa---------tatttgg
                      Sheep  ------ccag---------------caa---------tatttgg
              Domestic goat  ------ccag---------------caa---------tatttgg
                      Horse  ------ctgg---------------aaa---------tattttg
           White rhinoceros  ------ccag---------------aaa----------gtttgg
                        Cat  ----------------------------------------ttag
                        Dog  ----------------------------------------ttag
                    Ferret   ----------------------------------------ttag
                      Panda  ----------------------------------------ttag
             Pacific walrus  ----------------------------------------ttag
               Weddell seal  ----------------------------------------ttag
            Star-nosed mole  ------ccag---------------aga---------tactcga
                   Elephant  ------acag---------------aaa---------tatttag
                    Manatee  ------ccag---------------aaa---------tatatag
           Cape golden mole  ------ccag---------------aga---------tgtttga
                     Tenrec  ------acgg---------------gac---------catttgg
                   Aardvark  ------ccag---------------aaa---------catttca
                  Armadillo  ------acaa---------------aga---------tgtttgg
               Mallard duck  ------taat---------------gtg---------cttttgg
                     Turkey  ------ttgt---------------ttg---------actttgg
              X. tropicalis  ------taag---------------ata---------t------
                   Hedgehog  ============================================
                      Shrew  ============================================
                Zebra finch  ============================================
        Collared flycatcher  ============================================
           Brush-tailed rat  ============================================
        Cape elephant shrew  ============================================
                   Microbat  ============================================
       David's myotis (bat)  ============================================
              Big brown bat  ============================================
           Black flying-fox  --------------------------------------------
                    Megabat  --------------------------------------------
               Killer whale  ============================================
                    Dolphin  ============================================

Alignment block 14 of 337 in window, 17935791 - 17935793, 3 bps 
B D                   Human  --tct
B D                   Chimp  --tct
B D                 Gorilla  --tct
B D               Orangutan  --tct
B D                  Gibbon  --tct
B D                  Rhesus  --tc-
B D     Crab-eating macaque  --tc-
B D                  Baboon  --tc-
B D            Green monkey  --tc-
B D                Marmoset  --tct
B D         Squirrel monkey  --tct
B D                Bushbaby  --tct
         Chinese tree shrew  --tct
B D                Squirrel  --cct
     Lesser Egyptian jerboa  ----t
               Prairie vole  --tct
B D         Chinese hamster  --tct
             Golden hamster  --tct
B D                   Mouse  ----t
B D                     Rat  ----t
B D                  Rabbit  --tct
B D                    Pika  --tct
B D                     Pig  --t--
B D                  Alpaca  --t--
             Bactrian camel  --t--
           Tibetan antelope  --t--
B D                     Cow  --t--
B D                   Sheep  --t--
              Domestic goat  --t--
B D                   Horse  --t--
B D        White rhinoceros  --t--
B D                     Cat  --t--
B D                     Dog  --t--
B D                 Ferret   --t--
B D                   Panda  --t--
             Pacific walrus  --t--
               Weddell seal  --t--
            Star-nosed mole  --t--
B D                Elephant  --tct
B D                 Manatee  --tct
           Cape golden mole  --tct
B D                  Tenrec  --tct
                   Aardvark  --tct
B D               Armadillo  --tct
  D            Mallard duck  --ctt
B D                  Turkey  --tta
        Princess of Burundi  ttt--
                Zebra mbuna  ttt--
        Pundamilia nyererei  ttt--
B D                Hedgehog  =====
B D                   Shrew  =====
B D           X. tropicalis  -----
B D             Zebra finch  =====
  D     Collared flycatcher  =====
B D              Guinea pig  -----
          Brush-tailed rat  =====
B D          Naked mole-rat  -----
                Chinchilla  -----
       Cape elephant shrew  =====
B D                Microbat  =====
      David's myotis (bat)  =====
             Big brown bat  =====
          Black flying-fox  -----
B D                 Megabat  -----
              Killer whale  =====
B D                 Dolphin  =====

Inserts between block 14 and 15 in window
B D               Squirrel 388bp

Alignment block 15 of 337 in window, 17935794 - 17935812, 19 bps 
B D                   Human  ctcaattg-ct------------t-gtgtacat
B D                   Chimp  ctcaattg-ct------------t-gtgtacat
B D                 Gorilla  ctcaattg-ct------------t-gtgtacat
B D               Orangutan  ctcaattg-ct------------t-gtgtacac
B D                  Gibbon  ctcaattg-ct------------t-gtgtacat
B D                  Rhesus  ctcaattg-ct------------t-gtgtacat
B D     Crab-eating macaque  ctcaattg-ct------------t-gtgtacat
B D                  Baboon  ctcaattg-ct------------t-gtgtacat
B D            Green monkey  ctcaattg-ct------------t-gtgtacat
B D                Marmoset  ctcaattg-ct------------t-gtgtagag
B D         Squirrel monkey  ctcaattg-ct------------t-gtgtagat
B D                Bushbaby  ctcatttg-ct------------t-ttgtacat
         Chinese tree shrew  ttcagttg-ct------------g-ttgtacat
B D                Squirrel  ctcagttg-ca------------t-ctgtacat
     Lesser Egyptian jerboa  ctcatttg-ct------------t-ttgtacat
               Prairie vole  ctcgcatg-c-------------t-atgtacat
B D         Chinese hamster  ctcagatg-ct------------t-atgtatac
             Golden hamster  ctcagatg-tt------------t-atgtatac
B D                   Mouse  ctcagata-ct------------t-ttgtactg
B D                     Rat  ctaagatgttt------------t-ttgtactt
B D          Naked mole-rat  ctccgttg-ct------------t-ttgta--t
B D                  Rabbit  ttcagttg-ct------------t-ttgcacat
B D                    Pika  gctagtcg-tt------------t-tcacacaa
B D                     Pig  cgcggttg-ct------------t-ttgtgtgt
B D                  Alpaca  catagttg-ct------------t-ttgtgcaa
             Bactrian camel  catagttg-ct------------t-ttgtgcaa
           Tibetan antelope  cacagttg-ct------------t-ttgtatga
B D                     Cow  cacagttg-ct------------t-ttgtatgt
B D                   Sheep  cacagttg-ct------------t-ctgtatgt
              Domestic goat  tacagttg-ct------------t-ttgtatga
B D                   Horse  tgcagttg-ct------------t-ttgtacat
B D        White rhinoceros  tgcagttg-ct------------t-ttgtacat
B D                     Cat  cacagttg-ct------------t-ttgtatat
B D                     Dog  cacagttg-ct------------t-tt-tatat
B D                 Ferret   cacagttg-ct------------t-tt-tatat
B D                   Panda  cacagttg-ct------------t-tt-tatat
             Pacific walrus  cacagttg-ct------------t-tt-tatat
               Weddell seal  cacagttg-ct------------t-tt-tatat
            Star-nosed mole  cacagatg-ct------------tggtgtaggt
B D                Elephant  cccagttg-ct------------t-ttatacac
B D                 Manatee  cccggttg-ct------------t-tt-tacat
           Cape golden mole  tccaatta-ttta----------t-ttatttat
B D                  Tenrec  cctgattg-ct------------t-ttgttcac
                   Aardvark  cccaattg-at------------t-ttacacat
B D               Armadillo  ctcccttg-ct------------t-tt-----t
  D            Mallard duck  ttagactg-cc------------t-ctgcaaat
B D                  Turkey  ttgatgta-ct------------t-gtttatgt
B D           X. tropicalis  ---------tt------------t-aagtacat
        Princess of Burundi  ctctcttt-cttgcacggccagat-gcac----
                Zebra mbuna  ctctcttt-ct------------t-gcac----
        Pundamilia nyererei  ctctcttt-ct------------t-gcac----
B D                Hedgehog  =================================
B D                   Shrew  =================================
B D             Zebra finch  =================================
  D     Collared flycatcher  =================================
B D              Guinea pig  ---------------------------------
          Brush-tailed rat  =================================
                Chinchilla  ---------------------------------
       Cape elephant shrew  =================================
B D                Microbat  =================================
      David's myotis (bat)  =================================
             Big brown bat  =================================
          Black flying-fox  ---------------------------------
B D                 Megabat  ---------------------------------
              Killer whale  =================================
B D                 Dolphin  =================================

Inserts between block 15 and 16 in window
  D           Mallard duck 4bp
B D          X. tropicalis 9bp

Alignment block 16 of 337 in window, 17935813 - 17935824, 12 bps 
B D                   Human  gcctgaaatctt
B D                   Chimp  gactgaaatctt
B D                 Gorilla  gcctgaaatctt
B D               Orangutan  gcctgaaatctt
B D                  Gibbon  gcctgaaatctt
B D                  Rhesus  gcctgaaatctc
B D     Crab-eating macaque  gcctgaaatctc
B D                  Baboon  gcctgaaatctc
B D            Green monkey  gcctgaaatctc
B D                Marmoset  gcctaaaatatt
B D         Squirrel monkey  gcctaaaatctt
B D                Bushbaby  gcctgagccctt
         Chinese tree shrew  gccagagctctc
B D                Squirrel  gcctgagttctt
     Lesser Egyptian jerboa  tccc-agtcctt
               Prairie vole  gt-c-ggttctc
B D         Chinese hamster  atcc-agtactc
             Golden hamster  atcc-ggtactc
B D                   Mouse  atcc-agtactc
B D                     Rat  atcc-atcacgc
B D          Naked mole-rat  gccg-agccctt
B D              Guinea pig  -----agctctt
                 Chinchilla  -----agctctt
B D                  Rabbit  gcctgagtgctt
B D                    Pika  acctgagctttt
B D                     Pig  gcttgagttc--
B D                  Alpaca  gcctgagctcat
             Bactrian camel  gcctgaactcat
           Tibetan antelope  gcctgagcccat
B D                     Cow  gcctgagctcat
B D                   Sheep  gcctgagcccat
              Domestic goat  gcctgagcccat
B D                   Horse  gcctgagctcaa
B D        White rhinoceros  gcctgaggtcat
B D                     Cat  gcctgagctcat
B D                     Dog  gcctgagctcat
B D                 Ferret   gcctgaaatcat
B D                   Panda  gcctgagctcat
             Pacific walrus  gcctgagctcat
               Weddell seal  gcctgagctcat
            Star-nosed mole  gcctaaactcat
B D                Elephant  accggggctcat
B D                 Manatee  acccgagctcat
           Cape golden mole  ttttaatgtt--
B D                  Tenrec  atctgagctcat
                   Aardvark  atctgagctcat
B D               Armadillo  tttcgggctcac
  D            Mallard duck  gactagta----
B D           X. tropicalis  gtcttgtctttg
        Princess of Burundi  ggataaactgtc
                Zebra mbuna  ggataaactgtc
        Pundamilia nyererei  ggataaactgtc
B D                Hedgehog  ============
B D                   Shrew  ============
B D             Zebra finch  ============
  D     Collared flycatcher  ============
          Brush-tailed rat  ============
       Cape elephant shrew  ============
B D                Microbat  ============
      David's myotis (bat)  ============
             Big brown bat  ============
          Black flying-fox  ------------
B D                 Megabat  ------------
              Killer whale  ============
B D                 Dolphin  ============

Inserts between block 16 and 17 in window
          Cape golden mole 582bp
B D              Armadillo 11bp

Alignment block 17 of 337 in window, 17935825 - 17935845, 21 bps 
B D                   Human  cctcaagcgt-------------------------ttattttatgt
B D                   Chimp  cctcaagtgt-------------------------ttattttatgt
B D                 Gorilla  cctcaagtgt-------------------------ttattttatgt
B D               Orangutan  cctcaagtgt-------------------------ttattttatat
B D                  Gibbon  cctcaagtgt-------------------------ttattttatat
B D                  Rhesus  cctcaagtgt-------------------------ttattttgtat
B D     Crab-eating macaque  cctcaagtgt-------------------------ttattttgtat
B D                  Baboon  cctcaagtgt-------------------------ttattttgtat
B D            Green monkey  cctcaagtgt-------------------------ttattttgtat
B D                Marmoset  cctcaagtgt-------------------------ttattttatat
B D         Squirrel monkey  cttcaagtgt-------------------------ttattttatat
B D                Bushbaby  ccctcagtat-------------------------tgattgtatat
         Chinese tree shrew  tatcatgtgt-------------------------tgattttatat
B D                Squirrel  ccctgtgtgt-------------------------taatct-----
     Lesser Egyptian jerboa  cttttttttt-------------------------taatttt-tat
               Prairie vole  catcttgtgt-------------------------taatttcatat
B D         Chinese hamster  catcttgtgt-------------------------tagtttcatat
             Golden hamster  catcttgtgt-------------------------taatttcatat
B D                   Mouse  catcttgtgt-------------------------taatttcctat
B D                     Rat  catcttgtgt-------------------------taatttcatat
B D          Naked mole-rat  cctccgctgc-------------------------taatctgatgc
B D              Guinea pig  cctcctgtat-------------------------cag--tgatct
                 Chinchilla  ccttgtgtgt-------------------------taatttggtgt
B D                  Rabbit  atcctggtctcccatggggtgcaggacccaagcacttgggccatcc
B D                    Pika  ctcacgatgt-------------------------tgattttatag
B D                     Pig  ---------t-------------------------tgatctgatat
B D                  Alpaca  ccttgcgtgt-------------------------tgat-agctat
             Bactrian camel  ccttgtgtgt-------------------------tgat-tgatat
           Tibetan antelope  cctcctgtgt-------------------------tgatctgatat
B D                     Cow  cctcctgtgt-------------------------tgatctgatat
B D                   Sheep  cctcctgtgt-------------------------tgatctgatat
              Domestic goat  cctcctgtgt-------------------------tgatctgatat
B D                   Horse  ccccatgtgt-------------------------tgactttatat
B D        White rhinoceros  ccccatgtgt-------------------------tgattttatat
B D                     Cat  ccccttgtgt-------------------------tggttttatat
B D                     Dog  ccccatgtgt-------------------------tgatcttatat
B D                 Ferret   ccccatgtgt-------------------------tgattttatat
B D                   Panda  ccccatgtgt-------------------------tgattttatat
             Pacific walrus  ccccatgtgt-------------------------tgattttatat
               Weddell seal  ccccatgtgt-------------------------tgattttatat
            Star-nosed mole  ccctttgtgt-------------------------gga--------
B D                Elephant  tcccatgtgt-------------------------t----------
B D                 Manatee  tcccatatgg-------------------------t----------
B D                  Tenrec  tctcatatgg-------------------------t----------
                   Aardvark  tctcatatgt-------------------------t----------
B D               Armadillo  ggttttatac-------------------------t----------
  D            Mallard duck  ctttgagtat-------------------------t----ttatgt
B D           X. tropicalis  tgtcttattt-------------------------tggatatatgt
        Princess of Burundi  tctcacacgc-------------------------ctacttatttt
                Zebra mbuna  tctcacacgc-------------------------ctacttatttt
        Pundamilia nyererei  tctcacacgc-------------------------ctacttatttt
B D                Hedgehog  ==============================================
B D                   Shrew  ==============================================
B D             Zebra finch  ==============================================
  D     Collared flycatcher  ==============================================
          Brush-tailed rat  ==============================================
       Cape elephant shrew  ==============================================
B D                Microbat  ==============================================
      David's myotis (bat)  ==============================================
             Big brown bat  ==============================================
          Black flying-fox  ----------------------------------------------
B D                 Megabat  ----------------------------------------------
              Killer whale  ==============================================
B D                 Dolphin  ==============================================
          Cape golden mole  ==============================================

Alignment block 18 of 337 in window, 17935846 - 17935846, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
     Lesser Egyptian jerboa  t
               Prairie vole  t
B D         Chinese hamster  t
             Golden hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  c
                 Chinchilla  t
B D                  Rabbit  t
B D                    Pika  t
B D                     Pig  t
B D                  Alpaca  t
             Bactrian camel  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
B D           X. tropicalis  t
        Princess of Burundi  t
                Zebra mbuna  t
        Pundamilia nyererei  t
           Star-nosed mole  -
B D                Hedgehog  =
B D                   Shrew  =
B D             Zebra finch  =
  D     Collared flycatcher  =
          Brush-tailed rat  =
B D                Squirrel  -
       Cape elephant shrew  =
B D                Microbat  =
      David's myotis (bat)  =
             Big brown bat  =
          Black flying-fox  -
B D                 Megabat  -
B D                  Tenrec  -
B D               Armadillo  -
                  Aardvark  -
B D                Elephant  -
B D                 Manatee  -
              Killer whale  =
B D                 Dolphin  =
          Cape golden mole  =

Inserts between block 18 and 19 in window
    Lesser Egyptian jerboa 931bp

Alignment block 19 of 337 in window, 17935847 - 17935851, 5 bps 
B D                   Human  taact
B D                   Chimp  taact
B D                 Gorilla  taact
B D               Orangutan  taact
B D                  Gibbon  taact
B D                  Rhesus  taact
B D     Crab-eating macaque  taact
B D                  Baboon  taact
B D            Green monkey  taact
B D                Marmoset  taact
B D         Squirrel monkey  taatt
B D                Bushbaby  taact
         Chinese tree shrew  taatt
               Prairie vole  taact
B D         Chinese hamster  tcact
             Golden hamster  taact
B D                   Mouse  taact
B D                     Rat  taact
B D          Naked mole-rat  cga--
B D              Guinea pig  cag-g
                 Chinchilla  tggct
B D                  Rabbit  ccact
B D                    Pika  caact
B D                     Pig  taacc
B D                  Alpaca  taact
             Bactrian camel  taact
           Tibetan antelope  taact
B D                     Cow  taact
B D                   Sheep  taact
              Domestic goat  taact
B D                   Horse  taact
B D        White rhinoceros  taact
B D                     Cat  taact
B D                     Dog  taact
B D                 Ferret   tagct
B D                   Panda  taact
             Pacific walrus  taact
               Weddell seal  taact
B D                Elephant  gaact
B D                 Manatee  taact
B D                  Tenrec  taatt
                   Aardvark  taact
B D               Armadillo  tgact
B D           X. tropicalis  tatca
        Princess of Burundi  tcatc
                Zebra mbuna  tcatc
        Pundamilia nyererei  tcatc
           Star-nosed mole  -----
B D                Hedgehog  =====
B D                   Shrew  =====
B D             Zebra finch  =====
  D     Collared flycatcher  =====
          Brush-tailed rat  =====
B D                Squirrel  -----
       Cape elephant shrew  =====
B D                Microbat  =====
      David's myotis (bat)  =====
             Big brown bat  =====
          Black flying-fox  -----
B D                 Megabat  -----
    Lesser Egyptian jerboa  =====
              Killer whale  =====
B D                 Dolphin  =====
          Cape golden mole  =====

Inserts between block 19 and 20 in window
              Prairie vole 1bp
B D        Chinese hamster 1bp
            Golden hamster 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
B D                 Rabbit 103bp

Alignment block 20 of 337 in window, 17935852 - 17935861, 10 bps 
B D                   Human  cggag------------------------------------------tttta
B D                   Chimp  cggag------------------------------------------tttta
B D                 Gorilla  cggag------------------------------------------tttta
B D               Orangutan  cagag------------------------------------------tttta
B D                  Gibbon  cggag------------------------------------------tttta
B D                  Rhesus  cagag------------------------------------------tttta
B D     Crab-eating macaque  cagag------------------------------------------tttta
B D                  Baboon  cagag------------------------------------------tttta
B D            Green monkey  cagag------------------------------------------tttta
B D                Marmoset  caggg------------------------------------------tttta
B D         Squirrel monkey  caggg------------------------------------------ttttg
B D                Bushbaby  ctgag------------------------------------------ttttg
         Chinese tree shrew  c--ag------------------------------------------tttgg
               Prairie vole  taccga-----------------------------------------tttt-
B D         Chinese hamster  aacag------------------------------------------tttt-
             Golden hamster  aacag------------------------------------------tttt-
B D                   Mouse  aacag------------------------------------------tttt-
B D                     Rat  aacag------------------------------------------tttt-
B D          Naked mole-rat  --cag------------------------------------------tttg-
B D              Guinea pig  ggagt------------------------------------------tctg-
                 Chinchilla  aaagt------------------------------------------tttg-
B D                  Rabbit  --cagaggattagcctattgagccacggcactggcccccgtgtgttgattt-
B D                    Pika  --caga-----------------------------------------attt-
B D                     Pig  tagtgt-----------------------------------------tttta
B D                  Alpaca  tagag------------------------------------------tttgg
             Bactrian camel  tagcg------------------------------------------tttgg
           Tibetan antelope  tagag------------------------------------------ttttg
B D                     Cow  tagag------------------------------------------ttttg
B D                   Sheep  tagag------------------------------------------ttttg
              Domestic goat  tagag------------------------------------------ttttg
B D                   Horse  cagaattaaatataacttagag-------------------------ttttg
B D        White rhinoceros  tagaattaaatataacttagag-------------------------ttttg
B D                     Cat  tagaa------------------------------------------tttgg
B D                     Dog  tagaa------------------------------------------ttt-g
B D                 Ferret   tagaa------------------------------------------tttgg
B D                   Panda  tagaa------------------------------------------tttgg
             Pacific walrus  tagaa------------------------------------------tttgg
               Weddell seal  tagaa------------------------------------------tttgg
            Star-nosed mole  ---gg------------------------------------------catta
B D                Elephant  -caaa------------------------------------------tgtgg
B D                 Manatee  -caaa------------------------------------------tgttg
B D                  Tenrec  -gaac------------------------------------------tattg
                   Aardvark  -caaa------------------------------------------ttcag
B D               Armadillo  -caga------------------------------------------tgtgg
B D           X. tropicalis  tagag------------------------------------------gttta
        Princess of Burundi  cacgg------------------------------------------tttta
                Zebra mbuna  catgg------------------------------------------tttta
        Pundamilia nyererei  catgg------------------------------------------tttta
B D                Hedgehog  ====================================================
B D                   Shrew  ====================================================
B D             Zebra finch  ====================================================
  D     Collared flycatcher  ====================================================
          Brush-tailed rat  ====================================================
B D                Squirrel  ----------------------------------------------------
       Cape elephant shrew  ====================================================
B D                Microbat  ====================================================
      David's myotis (bat)  ====================================================
             Big brown bat  ====================================================
          Black flying-fox  ----------------------------------------------------
B D                 Megabat  ----------------------------------------------------
    Lesser Egyptian jerboa  ====================================================
              Killer whale  ====================================================
B D                 Dolphin  ====================================================
          Cape golden mole  ====================================================

Inserts between block 20 and 21 in window
              Prairie vole 3bp
B D        Chinese hamster 2bp
            Golden hamster 3bp
B D                  Mouse 3bp
B D                    Rat 3bp
B D                 Rabbit 5bp
B D                   Pika 2bp
B D               Elephant 1bp
B D                Manatee 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp
B D              Armadillo 1bp

Alignment block 21 of 337 in window, 17935862 - 17935875, 14 bps 
B D                   Human  ---ggggcacttgctat
B D                   Chimp  ---ggggcacttgctat
B D                 Gorilla  ---ggggcacttgctat
B D               Orangutan  ---ggggcacttgctat
B D                  Gibbon  ---ggggcacttgctat
B D                  Rhesus  ---ggggcacttgctat
B D     Crab-eating macaque  ---ggggcacttgctat
B D                  Baboon  ---ggggcacttgctat
B D            Green monkey  ---ggggcacttgctat
B D                Marmoset  ---gggagacttgctat
B D         Squirrel monkey  ---gggacacttgctat
B D                Bushbaby  ---gggccactcgc-at
         Chinese tree shrew  ---gggatgcttgctat
B D                Squirrel  ------------gctct
     Lesser Egyptian jerboa  ---gaagtgcttgttgt
               Prairie vole  ---ggagcacttgctgt
B D         Chinese hamster  ---ggagcacttgctgt
             Golden hamster  ---ggagcgtttgctgt
B D                   Mouse  ---ggagtgc-tgtagt
B D                     Rat  ---ggagtac-tgtagt
B D          Naked mole-rat  ---ggtgtgtgtgttac
B D              Guinea pig  ---ggcgc-----ttcc
                 Chinchilla  ---ggtgtgtgtgttat
B D                  Rabbit  ---agagcactttctgt
B D                    Pika  ---ggagcatttgctgt
B D                     Pig  ---agggcacttgatag
B D                  Alpaca  ---tggacacttggtat
             Bactrian camel  ---tggacatttggtat
           Tibetan antelope  ---ggggcacttggtat
B D                     Cow  ---ggggcacttggtat
B D                   Sheep  ---gggacacttggtat
              Domestic goat  ---ggggcacttggtat
B D                   Horse  ---ggggcacttgatct
B D        White rhinoceros  ---ggtgcacttg-tat
B D                     Cat  ---ggggcaattggtat
B D                     Dog  ---ggggcaattagtat
B D                 Ferret   ---ggggcaattgttat
B D                   Panda  ---ggggcaattagtat
             Pacific walrus  ---ggggcaattggtat
               Weddell seal  ---ggggcaattgttat
            Star-nosed mole  ---ggggcacttga---
B D                Elephant  ---aggacatttgctct
B D                 Manatee  ---gggacatttgctat
B D                  Tenrec  ---ggggcccttgctat
                   Aardvark  ---ggtacacttgctat
B D               Armadillo  ---ag--cacttgtggt
B D           X. tropicalis  ---agtgtgcatcgtat
        Princess of Burundi  gggggagtatttct---
                Zebra mbuna  gggggagtatttct---
        Pundamilia nyererei  ggggaagtatttct---
B D                Hedgehog  =================
B D                   Shrew  =================
B D             Zebra finch  =================
  D     Collared flycatcher  =================
          Brush-tailed rat  =================
       Cape elephant shrew  =================
B D                Microbat  =================
      David's myotis (bat)  =================
             Big brown bat  =================
          Black flying-fox  -----------------
B D                 Megabat  -----------------
              Killer whale  =================
B D                 Dolphin  =================
          Cape golden mole  =================

Alignment block 22 of 337 in window, 17935876 - 17935895, 20 bps 
B D                   Human  ----tgtttctgtctagat--ggtt---a
B D                   Chimp  ----tgtttctgtctagat--ggtt---a
B D                 Gorilla  ----tgtttctgtctagat--ggtt---a
B D               Orangutan  ----tgtttctgtctagat--ggtt---a
B D                  Gibbon  ----tgtttctgtctggat--ggtt---a
B D                  Rhesus  ----tgtttctgtctggat--agtt---a
B D     Crab-eating macaque  ----tgtttctgtctggat--agtt---a
B D                  Baboon  ----tgtttctgtctggat--agtt---a
B D            Green monkey  ----tgtttctgtctggat--ggtt---a
B D                Marmoset  ----tgttcctgtctagat--ggtt---t
B D         Squirrel monkey  ----tgttcctgtctagat--ggtt---t
B D                Bushbaby  ----tgtccctg-ctag------------
         Chinese tree shrew  ----tgtccctgtctagat--catc---a
B D                Squirrel  ----tctccctgtctcgag--ggtc----
     Lesser Egyptian jerboa  ----ggccttcagctaggc--aatcacaa
               Prairie vole  ----tgtccccatct--------------
B D         Chinese hamster  ----tgtccccatctggag--ggac---a
             Golden hamster  ----tgtccccatctggag--ggtc---a
B D                   Mouse  ----tgttcccatctggaa--ggtt---a
B D                     Rat  ----tgtccccatctggaa--ggtc----
B D          Naked mole-rat  ----tgtcctcatccaggg--ggtc----
B D              Guinea pig  ----tgtcctcatccagag--agtc----
                 Chinchilla  ----tgtcctcttgcagag--ggtc----
B D                  Rabbit  ----tgttcctgtctagag--ggtc---t
B D                    Pika  ----tgtccctggctagaa--cgtc---t
B D                     Pig  ----tgtcccattctagag--ggtc---t
B D                  Alpaca  ----tgtctctgtctgcaa--ggtc---t
             Bactrian camel  ----tgtctctgtctataa--ggtc---t
           Tibetan antelope  ----tgtccctgtctagag--gatc---a
B D                     Cow  ----tgtccccgtctagag--gatc---a
B D                   Sheep  ----tgtccctgtccagag--gatt---a
              Domestic goat  ----tgtccctgtctagag--gatc---a
B D                   Horse  ----tgtacccatctagag--ggtt---a
B D        White rhinoceros  ----tgt-cccatctagag--gatc---a
B D                     Cat  ----tatccccatctagagcagggc---a
B D                     Dog  ----tgtgcccaccttgag--ggtc---a
B D                 Ferret   ----tgtccccatctagag--agtc---a
B D                   Panda  ----tgtccccaactaga---ggtc---a
             Pacific walrus  ----tgtccccatctagag--ggtc---a
               Weddell seal  ----tgtccccatctagag--ggtc---a
            Star-nosed mole  ----------agtctaggg--ga-----a
B D                Elephant  ----tgtctccaatgagag--ggtc---a
B D                 Manatee  ----tgtctccaattagag--ggtc---g
B D                  Tenrec  ----cgtctgtgattggag--atcc---a
                   Aardvark  ----tg-ctgtgat-agag--ggtc---a
B D               Armadillo  ----tgtccctgtcgagag--gagg---g
        Princess of Burundi  tgctcattgacagtcgaaa--ggtc---a
                Zebra mbuna  tgctcattgacagtcgaaa--ggtc---g
        Pundamilia nyererei  tgctcattgacagtcgaaa--ggtc---a
B D                Hedgehog  =============================
B D                   Shrew  =============================
B D             Zebra finch  =============================
  D     Collared flycatcher  =============================
          Brush-tailed rat  =============================
       Cape elephant shrew  =============================
B D                Microbat  =============================
      David's myotis (bat)  =============================
             Big brown bat  =============================
          Black flying-fox  -----------------------------
B D                 Megabat  -----------------------------
              Killer whale  =============================
B D                 Dolphin  =============================
          Cape golden mole  =============================

Alignment block 23 of 337 in window, 17935896 - 17935934, 39 bps 
B D                   Human  t-ggtg--------g--gcca-tt-------gtcttgtgg-cttctatgctgtgaga-cc
B D                   Chimp  t-ggtg--------g--gcca-tt-------gtcttgtgg-cttctatgctgtgaga-cc
B D                 Gorilla  t-ggtg--------g--gcca-tt-------gtcttgtgg-cttctatgctgtgaga-cc
B D               Orangutan  t-ggtg--------g--gcca-tt-------gtcttgggg-cttctatgctgtgaga-cc
B D                  Gibbon  t-ggtg--------g--gcca-tt-------gtcttggga-cttctatgctgtgaga-cc
B D                  Rhesus  t-ggtg--------g--gccc-tt-------gtcttgggg-cttctatgctgtgaga-ct
B D     Crab-eating macaque  t-ggtg--------g--gccc-tt-------gtcttgggg-cttctatgctgtgaga-ct
B D                  Baboon  t-ggtg--------g--gcca-tt-------gtcttgggg-cttctatgctgtgaga-ct
B D            Green monkey  t-ggtg--------g--gcca-tt-------gtcttgggg-cttctatgctgtgaga-cc
B D                Marmoset  t-attg--------g--gcca-tt-------gtcttggag-cttctatgc--tgaga-cc
B D         Squirrel monkey  t-actg--------g--gcca-tt-------gtcttggag-cttctatgctgtgaga-cc
B D                Bushbaby  -----g--------g--gc---tc-------atcttgggg-cttctatgcggtgaga-ct
         Chinese tree shrew  g----t--------g--gcca-tt-------accttgggg-cttctgtgctgtggga-ac
B D                Squirrel  t-tggg--------g--cctc-tacact---gt--------------------gaga-cc
     Lesser Egyptian jerboa  t-agat--------a--gttgttttgtg---gccaccacg-ctt--------gt-ga-cc
               Prairie vole  ---gac--------tacgcta-gtgatt---gccttgggg-ctt--------ggaga-cc
B D         Chinese hamster  t-agac--------t--gcta-ttcatt---gccttgggg-ctt--------ggaga-cc
             Golden hamster  t-agac--------t--gcta-ttcatt---gccttgggg-ctt--------ggaga-tt
B D                   Mouse  c-agtg--------t--gcta-ttcatt---gccttgggg-ctt--------ggaga-ct
B D                     Rat  t-agtg--------t--gcta-ttcatt---gccgtgggg-ctt--------ggaga-cc
B D          Naked mole-rat  t-tggg--------c--cttc-atctctcgag----------------------------
B D              Guinea pig  t-tggg--------a--ctca-atcgtctgggcctccgtg-cgt--------ggggt-cc
                 Chinchilla  c-tgggg-----aca--ttca-ttcttctgggcctctgtg-ctt--------ggggt-cc
B D                  Rabbit  c-agtg--------g--gctg-tt-------gtcttgggg-ctt--------ctata-c-
B D                    Pika  t-ggta--------g--gctg-tt-------gtcttgggg-ctt--------ctgcc-c-
B D                     Pig  t-ggtg--------g--gcca-tc-------gctttggga-cttttgtg-tctgaga-cc
B D                  Alpaca  t-ggcg--------g--gcca-tt-------gccttggga-tttccatgctctgaga-cc
             Bactrian camel  t-ggtg--------g--gcca-tt-------gccttggga-tttccatgctctgaga-cc
           Tibetan antelope  a-gatg--------a--gcca-tt-------gccttggga-cttccatgctctgaaa-cc
B D                     Cow  a-gatg--------a--gcca-tt-------gccttggga-cttccgtgctctgaga-cc
B D                   Sheep  a-gatg--------a--gcca-tt-------gccttggga-cttccatgctctgaaa-cc
              Domestic goat  a-gatg-----------------------------------------------gaaa-cc
B D                   Horse  tgggag--------g--gctg-tt-------gctttggga-cttctg---gctgaga-cc
B D        White rhinoceros  t-ggag--------g--gcca-tt-------gctttgaga-cttctatgctttgagaccc
B D                     Cat  c-aatg------ctg--tgca-tt-------gtcttgggg-tttatgtgccc--------
B D                     Dog  t-ggtg--------g--gcca-tc-------atcgtgggg-tttctgtgctttgaga-ct
B D                 Ferret   t-ggtg--------g--gcca-tt-------gtcttgggg-tttctgtaatctgaga-cc
B D                   Panda  t-g-tg--------g--gcca-ct-------gtcttgggg-tttctgtgctctgaga-cc
             Pacific walrus  t-gatg--------g--gtca-tt-------ttcttgggg-tttctgtgctctgaga-cc
               Weddell seal  t-gatg--------g--gcca-tt-------gtcttgggg-tttctgtgctctgaga-cc
            Star-nosed mole  t-ggtg--------g--gtcg-ct-------gtctctgga-ctttgttgctctgtac---
B D                Elephant  c-ggtg--------a--ggcc-tt-------gtcttgggg-cttct------------gt
B D                 Manatee  t-ggtg--------a--ggca-tt-------gtcttgggg-cttct------------at
           Cape golden mole  t-aatg--------a--agca-tt-------gtattggg--ctttt------------at
B D                  Tenrec  c-tgta--------c--agca-tt-------gtcttggggacgtct------------gt
                   Aardvark  t-ggtg--------a--g---------------cttggtg-cttct------------at
B D               Armadillo  t-ggca--------g--ggca-tt-------gtcctgggg-cttct------------g-
        Princess of Burundi  ------ctgcatgca--ttca-tt-------gttccatga-tgtgggtgctgaggaa-cc
                Zebra mbuna  ------ctgcatgca--ttca-tt-------gttccatga-tgtgggcgctgaggaa-cc
        Pundamilia nyererei  ------ctgcatgca--ttca-tt-------gttccatga-tgtgggcgctgaggaa-cc
B D                Hedgehog  ============================================================
B D                   Shrew  ============================================================
B D             Zebra finch  ============================================================
  D     Collared flycatcher  ============================================================
          Brush-tailed rat  ============================================================
       Cape elephant shrew  ============================================================
B D                Microbat  ============================================================
      David's myotis (bat)  ============================================================
             Big brown bat  ============================================================
          Black flying-fox  ------------------------------------------------------------
B D                 Megabat  ------------------------------------------------------------
              Killer whale  ============================================================
B D                 Dolphin  ============================================================

Alignment block 24 of 337 in window, 17935935 - 17935956, 22 bps 
B D                   Human  gctgttct--att------ttatag----aggct
B D                   Chimp  gctgttct--att------ttatag----aggct
B D                 Gorilla  gctgttct--att------ttatgg----aggct
B D               Orangutan  gctgttct--att------ttatag----aggct
B D                  Gibbon  gctgttct--att------ttatag----aggct
B D                  Rhesus  gctgttct--gtt------ttatag----aggct
B D     Crab-eating macaque  gctgttct--gtt------ttatag----aggct
B D                  Baboon  gctgttct--gtt------ttatag----aggct
B D            Green monkey  gctgttct--gtt------ttatag----aggcg
B D                Marmoset  cctattct--att------ttacag----aggct
B D         Squirrel monkey  cctattct--att------ttacag----aggct
B D                Bushbaby  cctgctgt--att------ttatca----aggct
         Chinese tree shrew  tcagtttt--att------ttatag----agatt
B D                Squirrel  cctgttct--gtt------ttatag----agggt
     Lesser Egyptian jerboa  tatgttgt--gtg------taatag----agttt
               Prairie vole  tctgctgttattt------ttttaa----gggtt
B D         Chinese hamster  tctgctgt--att------ttgtga----gtgtt
             Golden hamster  tctgttgt--gtt------ttgtga----gggtt
B D                   Mouse  ggtgctgg--att------ttttga----gggtt
B D                     Rat  tctgctgg--att-------------------tt
B D          Naked mole-rat  ---gctct--gtt------ttacag----aac--
B D              Guinea pig  --tgctgt--gtt------cctcag----act--
                 Chinchilla  --tgctcg--gct------ctacag----act--
B D                  Rabbit  --tgttct--agt------ttgtag----aagtt
B D                    Pika  --tgttct--act------ttgtag----aggtt
B D                     Pig  cctgttgt--aat---------------------
B D                  Alpaca  cctgttct--att------ttacag----aggtt
             Bactrian camel  cctgctct--att------ttacag----aggtt
           Tibetan antelope  cctgttct--att------ttatag----agatt
B D                     Cow  cctgttct--att------ttatag----agatt
B D                   Sheep  cctgttct--att------ttatag----agatt
              Domestic goat  cctgttct--att------ttatag----agatt
B D                   Horse  cctgttct--att------ttgtag----aggtt
B D        White rhinoceros  cctgttcc--att------ttatag----aggtt
B D                     Cat  ---------------------------------t
B D                     Dog  cctgtact--att------ttatgg----a-gtt
B D                 Ferret   cctgtact--att------ttatgg----a-gtt
B D                   Panda  cctgtact--att------ttatgg----a-gtt
             Pacific walrus  cctgtact--gtt------ttatgg----a-gtt
               Weddell seal  gctgtact--att------ttatgg----a-gtt
            Star-nosed mole  -----------------------------aagtt
B D                Elephant  gctagtct--gtc------ttctag----aggtt
B D                 Manatee  gctagtct--atc------tcctaa----aggtt
           Cape golden mole  gttagtct--atcttatagaggttg----aagtt
B D                  Tenrec  gctactct--atc------acctcg----agggt
                   Aardvark  gctagtct--atc------ttataa----atgtt
B D               Armadillo  ----gacg--gcc------tcacag----aggct
        Princess of Burundi  ----------ctt------tgacaatgaa-----
                Zebra mbuna  ----------ctt------tgacaa---------
B D                Hedgehog  ==================================
B D                   Shrew  ==================================
B D             Zebra finch  ==================================
  D     Collared flycatcher  ==================================
          Brush-tailed rat  ==================================
       Cape elephant shrew  ==================================
B D                Microbat  ==================================
      David's myotis (bat)  ==================================
             Big brown bat  ==================================
          Black flying-fox  ----------------------------------
B D                 Megabat  ----------------------------------
              Killer whale  ==================================
B D                 Dolphin  ==================================

Inserts between block 24 and 25 in window
B D         Naked mole-rat 1bp
B D             Guinea pig 2bp
                Chinchilla 1bp

Alignment block 25 of 337 in window, 17935957 - 17935990, 34 bps 
B D                   Human  gattaatgttaccg--ga--------------------------------------------gaagctg-
B D                   Chimp  gattaatgttactg--ga--------------------------------------------gaagctg-
B D                 Gorilla  gattaatgttactg--ga--------------------------------------------gaagctg-
B D               Orangutan  gattaatgttactg--ga--------------------------------------------gaagctg-
B D                  Gibbon  gattaatgttactg--ga--------------------------------------------gaagctg-
B D                  Rhesus  gattaatgttgctg--ga--------------------------------------------gaatctg-
B D     Crab-eating macaque  gattaatgttgctg--ga--------------------------------------------gaatctg-
B D                  Baboon  gattaatgttgctg--ga--------------------------------------------gaatctg-
B D            Green monkey  gattaatgttgctg--ga--------------------------------------------gaacctg-
B D                Marmoset  ggttaatgttactg--ga--------------------------------------------gaaactt-
B D         Squirrel monkey  ggtaaatgttactg--ga--------------------------------------------gaagctt-
B D                Bushbaby  ggcgaatgctactg--aa--------------------------------------------aaagctt-
         Chinese tree shrew  gattaatattactg--gc--------------------------------------------gaagctt-
B D                Squirrel  gatttccattactg--ga--------------------------------------------gaagctt-
     Lesser Egyptian jerboa  acttctcgggac--tcaa--------------------------------------------aaagctt-
               Prairie vole  gattcacggcactgttaa--------------------------------------------gcaatgt-
B D         Chinese hamster  gattcacagcactgttta--------------------------------------------gaaatgt-
             Golden hamster  gactcatagcactgttta--------------------------------------------gaaatgt-
B D                   Mouse  gattgatagtactgttaa--------------------------------------------gaaatat-
B D                     Rat  gatttatagcactgttaa--------------------------------------------gaaatat-
B D          Naked mole-rat  gatccccgtttct---ga--------------------------------------------gacgctt-
B D              Guinea pig  -attcctgttcctg--ga--------------------------------------------gaagctg-
                 Chinchilla  gtttcccattcctg--ga--------------------------------------------gaagctt-
           Brush-tailed rat  gattcccattcctg--ga--------------------------------------------gaagctt-
B D                  Rabbit  gattaaagttacta--ga--------------------------------------------ggagctt-
B D                    Pika  ggctaacgttattg--gagagattgtctgtcggaaaaggatataacaaggtagatgcaactggaaacta-
B D                     Pig  --------ttattg--ga--------------------------------------------gaaggtt-
B D                  Alpaca  gattgatgttattg--ga--------------------------------------------gaagctt-
             Bactrian camel  gattgatgttattg--ga--------------------------------------------gaagctt-
           Tibetan antelope  gattgatgttactg--aa--------------------------------------------gaaggtt-
B D                     Cow  gattgatgttattg--aa--------------------------------------------gaaggtt-
B D                   Sheep  gattgatgttattg--aa--------------------------------------------gaaggtt-
              Domestic goat  gattgatgttattg--aa--------------------------------------------gaaggtt-
B D                   Horse  gattaacattattg--gg--------------------------------------------gaagctt-
B D        White rhinoceros  gattaatgttactg--aa--------------------------------------------ggagctt-
B D                     Cat  ggttaata---ttg--ga--------------------------------------------aaaacat-
B D                     Dog  gtttaatagtgttg--ga--------------------------------------------aaagctt-
B D                 Ferret   ggctaatattattg--ga--------------------------------------------aaagatt-
B D                   Panda  ggttaatattattg--ga--------------------------------------------aaagctt-
             Pacific walrus  ggttaatattattg--ga--------------------------------------------aaagctt-
               Weddell seal  ggttaatattattg--ga--------------------------------------------aaagctt-
            Star-nosed mole  gatgaatggcattg--ga--------------------------------------------gaagatt-
B D                Elephant  tgttaatacca-tg--ga--------------------------------------------gaagctt-
B D                 Manatee  tgttaatatcattg--ga--------------------------------------------gaagctt-
           Cape golden mole  gattaatatcattg--aa--------------------------------------------gaagctt-
B D                  Tenrec  gactaatgttactg--aa--------------------------------------------gaagctt-
                   Aardvark  ggttaatatcatta--aa--------------------------------------------gaagttt-
B D               Armadillo  gatagatgccactg--ga--------------------------------------------gaaacct-
        Princess of Burundi  ----actgtgataa--ga--------------------------------------------aaggctga
                Zebra mbuna  ------tgtgataa--ga--------------------------------------------aaggctga
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  -taa---ct-aatgt------t
                      Chimp  -taa---ct-aatgt------t
                    Gorilla  -taa---ct-aatgt------t
                  Orangutan  -taa---ct-aatgt------t
                     Gibbon  -taa---ct-aatgt------t
                     Rhesus  -taa---ct-aatgt------t
        Crab-eating macaque  -taa---ct-aatgt------t
                     Baboon  -taa---ct-aatgt------t
               Green monkey  -taa---ct-aatgt------t
                   Marmoset  -taa---ct-aatgt------t
            Squirrel monkey  -taa---ct-aatgt------t
                   Bushbaby  -tta---ct-aacat------t
         Chinese tree shrew  -tta---ct-aacat------t
                   Squirrel  -tta---cc-------------
     Lesser Egyptian jerboa  -ttt---tt-aatga------c
               Prairie vole  -tgg---cc-accat------c
            Chinese hamster  -ttg---cc-aacat------t
             Golden hamster  -ttg---cc-gacat------t
                      Mouse  -ttg---tt-aacat------t
                        Rat  -ttg---tt-aacat------t
             Naked mole-rat  -ggg---ct-gagaa------a
                 Guinea pig  -gga---c---aggc------t
                 Chinchilla  -gga---ca-gaggc------t
           Brush-tailed rat  -gga---ag-gaggc------t
                     Rabbit  -ttg---tt-----t------t
                       Pika  -tta---tg-----t------t
                        Pig  -tct---ct-gacat------t
                     Alpaca  -t-t---ccaaacat------c
             Bactrian camel  -t-t---ccaaacat------c
           Tibetan antelope  -t-t---ct-aacat------c
                        Cow  -t-t---ct-aatgt------c
                      Sheep  -t-t---ct-aacgt------c
              Domestic goat  -t-t---ct-aacgt------c
                      Horse  -ttt---ct-aacat------t
           White rhinoceros  -ttt---tt-aacat------t
                        Cat  -ttt---ct-agcat------t
                        Dog  -ttt---ct-aacat------t
                    Ferret   -ttttttct-gacct------t
                      Panda  -ttt---ct-gatat------t
             Pacific walrus  -ttt----t-aacag------t
               Weddell seal  -ttt---ct-aacag------t
            Star-nosed mole  -ttt---gt-aacat------t
                   Elephant  -ttt---ct-aatgtttaaaat
                    Manatee  -ttt---ct-aatgt------t
           Cape golden mole  -------at-agtgt------t
                     Tenrec  -ttc---ct-gttgt------t
                   Aardvark  -ttt---ct-gatgt------t
                  Armadillo  -tcc---cg-agggt------c
        Princess of Burundi  acaa---at-aaagt------t
                Zebra mbuna  acaa---at-aaagt------t
                   Hedgehog  ======================
                      Shrew  ======================
                Zebra finch  ======================
        Collared flycatcher  ======================
        Cape elephant shrew  ======================
                   Microbat  ======================
       David's myotis (bat)  ======================
              Big brown bat  ======================
           Black flying-fox  ----------------------
                    Megabat  ----------------------
               Killer whale  ======================
                    Dolphin  ======================

Inserts between block 25 and 26 in window
       Princess of Burundi 5bp

Alignment block 26 of 337 in window, 17935991 - 17936010, 20 bps 
B D                   Human  cag-------------------------------------------------------------------
B D                   Chimp  cag-------------------------------------------------------------------
B D                 Gorilla  cag-------------------------------------------------------------------
B D               Orangutan  cag-------------------------------------------------------------------
B D                  Gibbon  gaa-------------------------------------------------------------------
B D                  Rhesus  cag-------------------------------------------------------------------
B D     Crab-eating macaque  cag-------------------------------------------------------------------
B D                  Baboon  cag-------------------------------------------------------------------
B D            Green monkey  cag-------------------------------------------------------------------
B D                Marmoset  cag-------------------------------------------------------------------
B D         Squirrel monkey  cag-------------------------------------------------------------------
B D                Bushbaby  cag-------------------------------------------------------------------
         Chinese tree shrew  cac-------------------------------------------------------------------
B D                Squirrel  -ag-------------------------------------------------------------------
     Lesser Egyptian jerboa  cag-------------------------------------------------------------------
               Prairie vole  cag-------------------------------------------------------------------
B D         Chinese hamster  gag-------------------------------------------------------------------
             Golden hamster  gag-------------------------------------------------------------------
B D                   Mouse  tag-------------------------------------------------------------------
B D                     Rat  tag-------------------------------------------------------------------
B D          Naked mole-rat  cag-------------------------------------------------------------------
B D              Guinea pig  cag-------------------------------------------------------------------
                 Chinchilla  tgg-------------------------------------------------------------------
           Brush-tailed rat  cag-------------------------------------------------------------------
B D                  Rabbit  cag-------------------------------------------------------------------
B D                    Pika  tagtgaaataagacagttcccaagagacaaaatcatatattctccttgatttgtggcaattagtatacag
B D                     Pig  cag-------------------------------------------------------------------
B D                  Alpaca  cag-------------------------------------------------------------------
             Bactrian camel  cag-------------------------------------------------------------------
           Tibetan antelope  cag-------------------------------------------------------------------
B D                     Cow  cag-------------------------------------------------------------------
B D                   Sheep  cag-------------------------------------------------------------------
              Domestic goat  cag-------------------------------------------------------------------
B D                   Horse  cag-------------------------------------------------------------------
B D        White rhinoceros  cag-------------------------------------------------------------------
B D                     Cat  cag-------------------------------------------------------------------
B D                     Dog  ctg-------------------------------------------------------------------
B D                 Ferret   cag-------------------------------------------------------------------
B D                   Panda  cag-------------------------------------------------------------------
             Pacific walrus  cgg-------------------------------------------------------------------
               Weddell seal  cgg-------------------------------------------------------------------
            Star-nosed mole  cac-------------------------------------------------------------------
B D                Elephant  tag-------------------------------------------------------------------
B D                 Manatee  tag-------------------------------------------------------------------
           Cape golden mole  tag-------------------------------------------------------------------
B D                  Tenrec  ttg-------------------------------------------------------------------
                   Aardvark  tag-------------------------------------------------------------------
B D               Armadillo  cag-------------------------------------------------------------------
        Princess of Burundi  gaa-------------------------------------------------------------------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  --------aa---atgggtattttgtac
                      Chimp  --------aa---atgggtattttgtac
                    Gorilla  --------aa---atgggtattttgtac
                  Orangutan  --------aa---atgggtattttgtac
                     Gibbon  --------aa---atgggtaatttgtac
                     Rhesus  --------aa---atgggtaatttgtac
        Crab-eating macaque  --------aa---atgggtaatttgtac
                     Baboon  --------aa---atgggtaatttgtac
               Green monkey  --------aa---atgggtaatttgtac
                   Marmoset  --------aa---atgggtgatttgtac
            Squirrel monkey  --------aa---atgggtgatttgtac
                   Bushbaby  -------aaa---aaggatggtttgtac
         Chinese tree shrew  --------aa---aagggtaatttgcac
                   Squirrel  --------aa---atgagtgtt------
     Lesser Egyptian jerboa  --------aatagtaggattgtttactc
               Prairie vole  --------aa---aagggtggtttgtac
            Chinese hamster  --------aa---aagggtggattgtgc
             Golden hamster  --------at---aagggtgaattgtgc
                      Mouse  --------aa---aagggtggtttgtac
                        Rat  --------aa---aagggtggtttgtac
             Naked mole-rat  --------g------------gtccctc
                 Guinea pig  --------ga---agagg-atgctgcac
                 Chinchilla  --------ga---agggg-gtgttgcac
           Brush-tailed rat  --------g----agggg-gtgatgcat
                     Rabbit  --------aa---aagggtgatttgcac
                       Pika  cctacagaaa---aaaagggatttgcac
                        Pig  --------aa---aaggatgattgatt-
                     Alpaca  --------aa---aagggtgatttgtgc
             Bactrian camel  --------aa---aagggtgattcgtgc
           Tibetan antelope  --------aa---atggattattcatg-
                        Cow  --------aa---agggattattcatg-
                      Sheep  --------aa---agggattattcatg-
              Domestic goat  --------aa---agggattattcatg-
                      Horse  --------aa---gaggatgatttgcat
           White rhinoceros  --------aa---aaggttgatttgcat
                        Cat  --------aa---aaggatgatttgcac
                        Dog  --------aa---aaggatgatttgcac
                    Ferret   -------aaa---agggatgatttccac
                      Panda  --------aa---agggatgatttgcgc
             Pacific walrus  --------aa---agggatgatttgcac
               Weddell seal  --------aa---agggatgatttgcac
            Star-nosed mole  --------ta---aaggaagatttgtgc
                   Elephant  --------aa---gggggttatttgcac
                    Manatee  --------aa---aagggtcatttatac
           Cape golden mole  --------aa---aagggtcattagcat
                     Tenrec  --------aa---aagggtcatgtgcac
                   Aardvark  --------aa---aaggctcttttgcac
                  Armadillo  --------ga---cagagctaagcgtac
        Princess of Burundi  --------aa---atgtgtatgtcatgc
                   Hedgehog  ============================
                      Shrew  ============================
                Zebra finch  ============================
        Collared flycatcher  ============================
        Cape elephant shrew  ============================
                   Microbat  ============================
       David's myotis (bat)  ============================
              Big brown bat  ============================
           Black flying-fox  ----------------------------
                    Megabat  ----------------------------
               Killer whale  ============================
                    Dolphin  ============================

Alignment block 27 of 337 in window, 17936011 - 17936075, 65 bps 
B D                   Human  catatggaactgccaatat-ctg--------------tcactttttgattgagaataacagcagtttca-
B D                   Chimp  catatggaactgccaatat-ctg--------------tcactttttgattgagaataacagcagtttca-
B D                 Gorilla  catatggaactgccaatat-cta--------------tcactttttgattgagaataacagcagtttca-
B D               Orangutan  catatggaactgccagtat-cta--------------tcactttttgattgagaataacagcagtttca-
B D                  Gibbon  catatggaactgccaatat-cta--------------tcactttttgattgagaataacagcagtttca-
B D                  Rhesus  catatggaactgccaatat-cta--------------tcactttttgattgagaataacagcagtttca-
B D     Crab-eating macaque  catatggaactgccaatat-cta--------------tcactttttgattgagaataacagcagtttca-
B D                  Baboon  catatggaattgccaatat-cta--------------tcactttttgattgagaataacagcagtttca-
B D            Green monkey  catatggaactgccaatat-cta--------------tcactttttgat---------------------
B D                Marmoset  catatagaactgcaaatat-ctc--------------tcattttttgattgagaatagcagctgtttca-
B D         Squirrel monkey  catatggaactgcaaatat-ctc--------------tcattttttgatttagaatagcggctgtttca-
B D                Bushbaby  gatatgaaattgccactat-c-------------------attattgagctacaataacaacagtttcg-
         Chinese tree shrew  cgtatggaattgccaatat-ttt--------------tcatttttt-atctagaataacagcaatttca-
B D                Squirrel  ---------ttgccaatat-cta--------------tcattc-ttgatctagactaacagcagtttca-
     Lesser Egyptian jerboa  catatgcaattgtcagtat-cta--------------tgattt-ttgatctaggatcacagcagtttca-
               Prairie vole  cttatgggattgtcaatat-cta--------------ttattt-ctgatataggatagcagcagtttca-
B D         Chinese hamster  catatggaattgtcaatat-cta--------------ttattt-ctgatataggataacagcagtttca-
             Golden hamster  catatggaattgtcaatat-cta--------------ttattt-ctgatataggataacagcagtttca-
B D                   Mouse  catatggaattgtcaatat-cta--------------ttattt-ttgatataggataacagcagtttca-
B D                     Rat  catatggaattgtcaatat-cta--------------ttattt-ttgatctaggacaacagcagtttca-
B D          Naked mole-rat  tggagggaactg-cagcct-ccg--------------ttattt--tggtctagaaagacagcagtttcc-
B D              Guinea pig  caggtggagccg-tggcct-tca--------------ctgttt--tggtctagaaaa-------------
                 Chinchilla  cagatggagctg-tggcct-tga--------------ctattt--ctgtgtagaaaaacagtggtttca-
           Brush-tailed rat  caggggaagctg-cagcct-tcg--------------ctaatt--tggtgtcgagaaacagcattttca-
B D                  Rabbit  catagggaaccaccaatat-tga--------------tcattt-ttgatctaggataatagcagtttca-
B D                    Pika  catagagaactaccaatat-tga--------------tcattt-ttgacctagggtagcaaccgtttca-
B D                     Pig  -----------accaggattctc--------------tcattt-ttgacctagaataacagcagtttct-
B D                  Alpaca  cgtatgaaattgccattattcta--------------tcattt-ttgacctagaatgacagcaggttcc-
             Bactrian camel  catatgaaattgccattattcta--------------tcattt-ttgacctagaatgacagcaggttcc-
           Tibetan antelope  --------------------cta--------------tta-tt-ttgacctagaataatagcagtttca-
B D                     Cow  --------------------cta--------------tta-tt-ttgacctagaataatagcagtttca-
B D                   Sheep  --------------------cta--------------tta-tt-ttgacctagaataatagcagtttca-
              Domestic goat  --------------------cta--------------tta-tt-ttgacctagaataatagcagtttca-
B D                   Horse  catatgaaattgtcattattcta--------------tcattt-ttgacctagagtaacagcagtctca-
B D        White rhinoceros  catatgaaattgtcatcattcta--------------tcgttt-ttgacccagaataacagcagtttca-
B D                     Cat  catatgacattgtcattctatca-------------gttttta-aaagtctagaataacagcagcttcc-
B D                     Dog  catatgaaattgtcattattcca---tcattttttttt---------gtctagaatcacagcagctcca-
B D                 Ferret   catatgaaattgtcattattccatcatcttttttttttttttt-ttggtctggaatcacaacagcttcaa
B D                   Panda  catatgaaattgtcattattcca---tcatttttttttttttt-ttggtctagaatcacagccacttca-
             Pacific walrus  catataaaattgtcattattcca----tcattttttttttttt-ttggtctagaatcatagcagcttca-
               Weddell seal  catatgaaattgtcattattcca---ttttttttttttttttt-ttggtctagaatcatagcagcttca-
            Star-nosed mole  cctctgaa--------------a---------------------ttgaccctgaataacaactctgcga-
B D                Elephant  cataggagattgccactagtctg--------------tcattt-tga------------cacagtttca-
B D                 Manatee  catataagattgacactattctg--------------tcattt-tg--------------acagtttca-
           Cape golden mole  cagatgatattgccactattcta--------------taattt-tga------------atcagttcca-
B D                  Tenrec  tatgtgaaattgccactcttctt--------------gcgttt-tga------------cacagtttca-
                   Aardvark  catataaaattacagtta-------------------tcattt-tga------------cacagtttca-
B D               Armadillo  cccgcgaatctgccatttttctg--------------tcattt-ttgacgtagactaacagcggtttca-
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  -ata-tggttcaa
                      Chimp  -ata-tggttcaa
                    Gorilla  -ata-tggttcaa
                  Orangutan  -ata-tggttcaa
                     Gibbon  -ata-tggttcaa
                     Rhesus  -ata-tggttcaa
        Crab-eating macaque  -ata-tggttcaa
                     Baboon  -ata-tggttcaa
               Green monkey  -----tggttcaa
                   Marmoset  -ata-tggtacaa
            Squirrel monkey  -ata-tggtacaa
                   Bushbaby  -ata-cgggtcag
         Chinese tree shrew  -ata-tggttcaa
                   Squirrel  -ata-tggttcaa
     Lesser Egyptian jerboa  -aca-tggttcaa
               Prairie vole  -ata-tggttcaa
            Chinese hamster  -ata-tggttcaa
             Golden hamster  -ata-tggttaaa
                      Mouse  -ata-tggttcag
                        Rat  -ata-tggttcaa
             Naked mole-rat  -gcg-tggttcag
                 Guinea pig  ---a-tggttaaa
                 Chinchilla  -ata-tgtttcaa
           Brush-tailed rat  ---g-tgtttcaa
                     Rabbit  -gtc-tggctcaa
                       Pika  -atcttggcctaa
                        Pig  -cta-tggttcaa
                     Alpaca  -ata-tggctcaa
             Bactrian camel  -aca-tggttcaa
           Tibetan antelope  -ata-tggtccaa
                        Cow  -ata-tggttcaa
                      Sheep  -ata-tggtccaa
              Domestic goat  -ata-tggtccaa
                      Horse  -gtg-tggtttcg
           White rhinoceros  -ata-tggttccg
                        Cat  -ata-tgattcaa
                        Dog  -ata-tgattcag
                    Ferret   tata-tgattcag
                      Panda  -gta-tgattcag
             Pacific walrus  -ata-tgattcag
               Weddell seal  -ata-tgattcag
            Star-nosed mole  -ata-ggactcta
                   Elephant  --ca-tggttcaa
                    Manatee  --ca-tggctcaa
           Cape golden mole  --ca-caacccca
                     Tenrec  --ca-tgactcaa
                   Aardvark  --ca-tggctaaa
                  Armadillo  -gta-tggttcaa
                   Hedgehog  =============
                      Shrew  =============
                Zebra finch  =============
        Collared flycatcher  =============
        Cape elephant shrew  =============
                   Microbat  =============
       David's myotis (bat)  =============
              Big brown bat  =============
           Black flying-fox  -------------
                    Megabat  -------------
               Killer whale  =============
                    Dolphin  =============

Alignment block 28 of 337 in window, 17936076 - 17936141, 66 bps 
B D                   Human  tttattgttaa--aggtttgcctcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D                   Chimp  tttattgttaa--aggtttgcctcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D                 Gorilla  tttattgttaa--aggtttgcctcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D               Orangutan  tttattgttaa--aggtttgcctcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D                  Gibbon  tttattgttaa--aggtttgcctcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D                  Rhesus  tttattgttaa--aggtttgcttcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D     Crab-eating macaque  tttattgttaa--aggtttgcttcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D                  Baboon  ttcattgttaa--aggtttgcttcatgttagca-caa---agatatttct-caagttct-tagacaag--
B D            Green monkey  tttattgttaa--aggtttgcctcatgttagca-caa---aggtatttct-caagttct-tagacaag--
B D         Squirrel monkey  tttagtgttaa--aggtttgcttcgtgttaaca-taa---aggtagtttt-catgttct-tagacaag--
B D                Bushbaby  tatagtgttaa--aggtttgcaccatgttaact-aaa---aggtgttttt-caagtt-------------
         Chinese tree shrew  tttagtgtt-a--aggattgcctcatgttagca-aaa---atgtgtttct-caagttcc-tagataaa--
B D                Squirrel  tttaa--------gtgtttgcctcatgttagca-aaa---aaatgtttct-caagttct-tagacaaa--
     Lesser Egyptian jerboa  tttgctgttaa--gaattcaccttctgttagca-aaa--tagttatttct-taggttct-taggcaaa--
               Prairie vole  tttagtgttgt--gaatttgccttctattagga-aaaaaaaagcacttct-taagttct-cagacaaa--
B D         Chinese hamster  tttagtgttgt--gagcttgccttctgttggga-aaa-----atgtttct-taagttag--agacaaa--
             Golden hamster  tttagtgttgt--gatcttgccttctgcttgga-aaa---acatgattct-taagttct-cagacaaa--
B D                   Mouse  tttagtggtgt--gagcttgccttctgttaggg-gaa---aactgtctct-taggttggacaaacaat--
B D                     Rat  tttagtggtgt--gagcttgccttctgttaggg-gaa---acatttctct-taggttaggcaaacaat--
B D          Naked mole-rat  -ttagggttaa--gggtttgccttgtgtcagca-gaa---cagtgt-tctccgagttct-tggacagc--
B D              Guinea pig  gttggtgctga--gggtttgcctcatgtcagca-cag---cagggtgtct-caa-ttct-tggacaac--
                 Chinchilla  cttagtgttaa--gggtttgccttctctcagca-aag---cagtgt-tct-caacttct-tatacagt--
           Brush-tailed rat  cttagtgttaa--gggtttgccttgtgtcagca-aag---cagagt-tct-caagttct-tagacaag--
B D                  Rabbit  tttaattttaa--gggtttgccttgtgttagca-aaa--ctggtgttgct-caagttct-ttggcaaact
B D                    Pika  tttactattaa--gggtttgccttgtgttagcagaaa--gtgatgtgtct-ccagttct-ttggcaaa--
B D                     Pig  tttcagg--------gtttgactcatgagagca-gaa---aggtgtttct-ctagttct-tatgcaaa--
B D                  Alpaca  tttaaggtta----agtttgcttcgtgttagca-aaa---aggtatttct-caagttct-tgag--aa--
             Bactrian camel  tttaaggttaa--gagtttgcctcatgttagca-aaa---aggtatttct-caagttct-tgag--aa--
           Tibetan antelope  tttaaggttaa--aagtttgccttgtgttagca-aaa---aggaatttct-caagttct-taggcaaa--
B D                     Cow  tttaaggttaa--aggtttgcctcgtgttagca-aaa---aggaatttct-caagttct-taggcaaa--
B D                   Sheep  tttaaggttaa--aagtttgccttgtgttagca-aaa---aggaatttct-caatttct-taggcaaa--
              Domestic goat  tttaaggttaa--aagtttgccttgtgttagca-aaa---aggaatttct-caatttct-taggcaaa--
B D                   Horse  tttagtgttaa--ggttttgcct-gtgttagca-gaa---aggcatttct-catg-tct-tagacaaa--
B D        White rhinoceros  tttagtgttaa--gggtttgcctcatgttagca-gaa---aggtgtttct-caagttct-tagacaaa--
B D                     Cat  tgcgatattgg--gggtttgccttatgtcagca-aaa---aggtatttct-cacgttct-taggcaaa--
B D                     Dog  tgaaatattaagggggtttgccttatgttagca-aaa---aggtgtttct-caagttct-taggcaaa--
B D                 Ferret   cataatattaa--gggtttgccttatgttaaca-aaa---aggtgtttct-caag-tct-taggcaaa--
B D                   Panda  tgtaatattaa--gggtttgccttatgttaaca-aaa---aggt---------------------aaa--
             Pacific walrus  tataatattaa--gggtttgcctcatgttagca-aaa---aagtgtttct-caagttct-taggcaaa--
               Weddell seal  tataatattaa--gggtttgcctcatgttagca-aaa---aggtgtttct-caagttct-taggcaaa--
            Star-nosed mole  tttagtgctaa--gtgtt----------------------------------aagttct-tag----a--
B D                Elephant  cttaaagataa--gagtttgcctcaggtttaca-aaa---aggtgttcct-caagttc------------
B D                 Manatee  cttaa---------gatttgtctcatgcttaca-aaa---aggtattcct-caagttct-tagaaaa---
           Cape golden mole  tttaaagatag---aatttttctcatgtttaca-caa---aggtgttcct-caagtttt-tagaaaaa--
B D                  Tenrec  cttaaagatag----gtttgcctcatgtcgtca-aaa---agatgttctt-cacatttt-ttgacaa---
                   Aardvark  cttaagggtaa--gaatttgcctcatgtttaca-aaa---agatgttccc-tgagttct-tagaaaaa--
B D               Armadillo  cttcatgataa--aggtttgtttcttgtttaca-aaa---aggtgtttct-cacattct-cagaagag--
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ------ct-tg--tg
                      Chimp  ------ct-tg--tg
                    Gorilla  ------ct-tg--tg
                  Orangutan  ------ct-tg--ta
                     Gibbon  ------ct-tg--ta
                     Rhesus  ------ct-tg--ta
        Crab-eating macaque  ------ct-tg--ta
                     Baboon  ------ct-tg--ta
               Green monkey  ------ct-tg--ta
            Squirrel monkey  ------ct-tg--tg
                   Bushbaby  ---------------
         Chinese tree shrew  ------cc-tg--tg
                   Squirrel  ------ct-tgtg--
     Lesser Egyptian jerboa  -----gtg-tg----
               Prairie vole  ----------g----
            Chinese hamster  ------cg-tg----
             Golden hamster  ------tg-tg----
                      Mouse  ------ta-gg----
                        Rat  ------ta-gg----
             Naked mole-rat  ------tg-------
                 Guinea pig  ------ca-------
                 Chinchilla  ------gg-------
           Brush-tailed rat  ------gg-------
                     Rabbit  tgtg-----------
                       Pika  ---------------
                        Pig  ------ct-tg--tg
                     Alpaca  ------ct-tg--tg
             Bactrian camel  ------ct-tg--tg
           Tibetan antelope  ------ctctg--tg
                        Cow  ------ctctg--tg
                      Sheep  ------ctctg--tg
              Domestic goat  ------ctctg--tg
                      Horse  ------ct-cg--gg
           White rhinoceros  ------ct-tg--gg
                        Cat  ------tt-tg--tg
                        Dog  ------ct-tg--tg
                    Ferret   ------ct-tg--tg
                      Panda  ------ct-tg--tg
             Pacific walrus  ------ct-tg--tg
               Weddell seal  ------ct-tg--tg
            Star-nosed mole  ------ct-tg--tc
                   Elephant  ----------a--tc
                    Manatee  ------ct-tg--tg
           Cape golden mole  ----cttg-ta--tg
                     Tenrec  ------ta-tg--tg
                   Aardvark  ------ct-tg--tg
                  Armadillo  ------ct-cg--tg
                   Hedgehog  ===============
                      Shrew  ===============
                Zebra finch  ===============
        Collared flycatcher  ===============
        Cape elephant shrew  ===============
                   Microbat  ===============
       David's myotis (bat)  ===============
              Big brown bat  ===============
           Black flying-fox  ---------------
                    Megabat  ---------------
               Killer whale  ===============
                    Dolphin  ===============
                   Marmoset  NNNNNNNNNNNNNNN

Inserts between block 28 and 29 in window
B D               Squirrel 33bp
    Lesser Egyptian jerboa 7bp
              Prairie vole 10bp
B D        Chinese hamster 358bp
            Golden hamster 69bp

Alignment block 29 of 337 in window, 17936142 - 17936171, 30 bps 
B D                   Human  gcaggtcctacctacta------catgtctggttta
B D                   Chimp  gcaggtcctatctacta------catgtctggttta
B D                 Gorilla  gcaggtcctatctactg------catgtctggttta
B D               Orangutan  gcaggtcctatctacta------catgtctggttta
B D                  Gibbon  gcaggtcctgtctacta------catgtctggttta
B D                  Rhesus  acaggtcctatctactacatgtccatgtctggttta
B D     Crab-eating macaque  acaggtcctatctactacatgtccatgtctggttta
B D                  Baboon  acaggtcctatctactacatgtccatgtctggttta
B D            Green monkey  acaggtcctatctacta------catgtctggttta
B D         Squirrel monkey  acaagtcctatctacta------tatgtctggttaa
B D                Bushbaby  --------------cta------tgtgtctggtttc
         Chinese tree shrew  actggtcttatcta---------cgtgt-tggttta
B D                Squirrel  -------------------------------ggtgg
B D                   Mouse  -------------------------------ataga
B D                     Rat  -------------------------------gcaga
B D          Naked mole-rat  -----------------------------ccaggga
B D              Guinea pig  -----------------------------gcagtgg
                 Chinchilla  -----------------------------gcagtgc
           Brush-tailed rat  -----------------------------gcattgc
B D                  Rabbit  ------------------------atgtctgattga
B D                    Pika  ----------------------------gtggttca
B D                     Pig  actggtcccagctg---------gacgtctagttta
B D                  Alpaca  actcgtcccatctg---------tatgtctagttta
             Bactrian camel  actagtcccatctg---------tatgtctagttta
           Tibetan antelope  gctggtcccatctg---------tatgtctagttta
B D                     Cow  gctggtcccatctg---------tatgtctagttta
B D                   Sheep  gctggtcccatctg---------tatgtctagttta
              Domestic goat  gctggtcccatctg---------tatgtctagttta
B D                   Horse  actgatcctgtcta---------tacgtctagttta
B D        White rhinoceros  actgatcctgtctg---------cgtgtctagttta
B D                     Cat  actggttgtctctg---------catgtttgcttta
B D                     Dog  actggtcctgtctg---------tacatctacttta
B D                 Ferret   actgatcctatctg---------tatgtctacttta
B D                   Panda  acaggtcctatctg---------tatgtctacttta
             Pacific walrus  actggtcctatctg---------tatgtctactttg
               Weddell seal  actggtcctatctg---------tatgtctacttta
            Star-nosed mole  cctgatcctagcta---------ccggtccagatca
B D                Elephant  actagtcctatgta---------tatttctggctta
B D                 Manatee  actagttctatgta---------tatttctga-tta
           Cape golden mole  actggtcctatgta---------tatttctggttta
B D                  Tenrec  actggttgtacatg---------tatttccagctta
                   Aardvark  actagtcctatgta---------tatttctgattta
B D               Armadillo  acgggtcctgtcca---------tgtgtctgcttta
            Golden hamster  ====================================
B D                Hedgehog  ====================================
B D                   Shrew  ====================================
B D             Zebra finch  ====================================
  D     Collared flycatcher  ====================================
              Prairie vole  ====================================
       Cape elephant shrew  ====================================
B D         Chinese hamster  ====================================
B D                Microbat  ====================================
      David's myotis (bat)  ====================================
             Big brown bat  ====================================
          Black flying-fox  ------------------------------------
B D                 Megabat  ------------------------------------
    Lesser Egyptian jerboa  ====================================
              Killer whale  ====================================
B D                 Dolphin  ====================================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 29 and 30 in window
B D               Squirrel 34bp
B D                  Mouse 17bp
B D                    Rat 17bp
B D         Naked mole-rat 6bp
B D             Guinea pig 5bp
                Chinchilla 5bp
          Brush-tailed rat 6bp

Alignment block 30 of 337 in window, 17936172 - 17936175, 4 bps 
B D                   Human  agga
B D                   Chimp  agga
B D                 Gorilla  agga
B D               Orangutan  agga
B D                  Gibbon  agga
B D                  Rhesus  agga
B D     Crab-eating macaque  agga
B D                  Baboon  agga
B D            Green monkey  agga
B D         Squirrel monkey  agga
B D                Bushbaby  agga
         Chinese tree shrew  agga
B D                Squirrel  aggc
     Lesser Egyptian jerboa  aggg
B D         Chinese hamster  agtg
B D                   Mouse  agtg
B D                     Rat  agtg
B D          Naked mole-rat  -ggc
                 Chinchilla  -ggg
           Brush-tailed rat  -ggg
B D                  Rabbit  agga
B D                    Pika  aggc
B D                     Pig  ggga
B D                  Alpaca  agga
             Bactrian camel  agga
           Tibetan antelope  agga
B D                     Cow  agga
B D                   Sheep  agga
              Domestic goat  agga
B D                   Horse  agga
B D        White rhinoceros  agga
B D                     Cat  agga
B D                     Dog  agga
B D                 Ferret   agga
B D                   Panda  agag
             Pacific walrus  agga
               Weddell seal  aggg
            Star-nosed mole  agga
B D                Elephant  aaga
B D                 Manatee  aaga
           Cape golden mole  aaga
B D                  Tenrec  agaa
                   Aardvark  aaga
B D               Armadillo  acgc
            Golden hamster  ====
B D                Hedgehog  ====
B D                   Shrew  ====
B D             Zebra finch  ====
  D     Collared flycatcher  ====
B D              Guinea pig  ====
              Prairie vole  ====
       Cape elephant shrew  ====
B D                Microbat  ====
      David's myotis (bat)  ====
             Big brown bat  ====
          Black flying-fox  ----
B D                 Megabat  ----
              Killer whale  ====
B D                 Dolphin  ====
B D                Marmoset  NNNN

Inserts between block 30 and 31 in window
B D               Squirrel 32bp
B D         Naked mole-rat 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp

Alignment block 31 of 337 in window, 17936176 - 17936176, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D                Squirrel  a
     Lesser Egyptian jerboa  a
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  a
B D                     Rat  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  a
B D                    Pika  a
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
            Star-nosed mole  a
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  a
                   Aardvark  a
B D               Armadillo  a
B D                Hedgehog  =
B D                   Shrew  =
B D             Zebra finch  =
  D     Collared flycatcher  =
B D              Guinea pig  =
B D          Naked mole-rat  =
              Prairie vole  =
       Cape elephant shrew  =
B D                Microbat  =
      David's myotis (bat)  =
             Big brown bat  =
          Black flying-fox  -
B D                 Megabat  -
              Killer whale  =
B D                 Dolphin  =
B D                Marmoset  N

Inserts between block 31 and 32 in window
          Cape golden mole 18712bp

Alignment block 32 of 337 in window, 17936177 - 17936178, 2 bps 
B D                   Human  -g-a
B D                   Chimp  -g-a
B D                 Gorilla  -g-a
B D               Orangutan  -g-a
B D                  Gibbon  -g-a
B D                  Rhesus  -g-a
B D     Crab-eating macaque  -g-a
B D                  Baboon  -g-a
B D            Green monkey  -g-a
B D         Squirrel monkey  -g-a
B D                Bushbaby  -g-a
         Chinese tree shrew  -g-c
B D                Squirrel  -t-a
     Lesser Egyptian jerboa  -g-a
B D         Chinese hamster  -g-a
             Golden hamster  -g-a
B D                   Mouse  -g-a
B D                     Rat  -g-a
                 Chinchilla  -g-a
           Brush-tailed rat  -g-a
B D                  Rabbit  -g-a
B D                    Pika  -g-a
B D                     Pig  -g-g
B D                  Alpaca  -g-a
             Bactrian camel  -g-a
           Tibetan antelope  -g-a
B D                     Cow  -g-a
B D                   Sheep  -g-a
              Domestic goat  -g-a
B D                   Horse  -g-a
B D        White rhinoceros  -g-a
B D                     Cat  -g-a
B D                     Dog  -g-a
B D                 Ferret   -gaa
B D                   Panda  -g-a
             Pacific walrus  -g-a
               Weddell seal  -g-a
            Star-nosed mole  -g-t
B D                  Tenrec  aa--
B D               Armadillo  -g--
B D                Hedgehog  ====
B D                   Shrew  ====
B D             Zebra finch  ====
  D     Collared flycatcher  ====
B D              Guinea pig  ====
B D          Naked mole-rat  ====
              Prairie vole  ====
       Cape elephant shrew  ====
B D                Microbat  ====
      David's myotis (bat)  ====
             Big brown bat  ====
          Black flying-fox  ----
B D                 Megabat  ----
                  Aardvark  ----
B D                Elephant  ----
B D                 Manatee  ----
              Killer whale  ====
B D                 Dolphin  ====
B D                Marmoset  NNNN
          Cape golden mole  ====

Inserts between block 32 and 33 in window
B D                 Tenrec 229bp

Alignment block 33 of 337 in window, 17936179 - 17936192, 14 bps 
B D                   Human  agtgag-------------caccagga
B D                   Chimp  agtggg-------------caccagga
B D                 Gorilla  agtggg-------------caccagga
B D               Orangutan  agtggg-------------caccagga
B D                  Gibbon  agtggg-------------caccagga
B D                  Rhesus  agtggg-------------caccagga
B D     Crab-eating macaque  agtggg-------------caccagga
B D                  Baboon  agtggg-------------caccagga
B D            Green monkey  agtggg-------------caccagga
B D         Squirrel monkey  tgtggg-------------catcagga
B D                Bushbaby  agtgcg-------------caccagga
         Chinese tree shrew  agtggg-------------cttcagga
B D                Squirrel  agtgaggtgctaagcaactcag-tgag
     Lesser Egyptian jerboa  agtggg-------------tattggga
               Prairie vole  ----ag-------------cat-agta
B D         Chinese hamster  actggg-------------cat-gggg
             Golden hamster  agtggg-------------cat-ggag
B D                   Mouse  agtgag-------------tac--ggg
B D                     Rat  agtggg-------------cat-gggg
B D          Naked mole-rat  ---------------------t-tggg
B D              Guinea pig  ---------------------t-gggg
                 Chinchilla  aagggg-------------t-t-gggg
           Brush-tailed rat  agtggg-------------tgt-gggg
B D                  Rabbit  agtgga-------------catcagtg
B D                    Pika  agtggg-------------tggcgggg
B D                     Pig  a-tggg-------------tgtcagga
B D                  Alpaca  agtggga------------cagcggga
             Bactrian camel  agtgggg------------cagcggga
           Tibetan antelope  agtggg-------------catcaaga
B D                     Cow  agtggg-------------catcagg-
B D                   Sheep  agtggg-------------catcaaga
              Domestic goat  agtggg-------------catcaaga
B D                   Horse  gctggg-------------ccttggga
B D        White rhinoceros  agtggg-------------cattggga
B D                     Cat  agtggg-------------catcagga
B D                     Dog  agtgga-------------catcaggt
B D                 Ferret   agtggg-------------catcaggg
B D                   Panda  agtggg-------------catcaggg
             Pacific walrus  agtggg-------------catcaggg
               Weddell seal  agtggg-------------catcaggg
            Star-nosed mole  cctggg-------------tctcaggg
B D                Elephant  --tggc-------------catcagga
B D                 Manatee  --tggc-------------catcagga
                   Aardvark  --tggc-------------catcagga
B D               Armadillo  ---ggg-------------cctcagga
B D                Hedgehog  ===========================
B D                   Shrew  ===========================
B D             Zebra finch  ===========================
  D     Collared flycatcher  ===========================
       Cape elephant shrew  ===========================
B D                Microbat  ===========================
      David's myotis (bat)  ===========================
             Big brown bat  ===========================
          Black flying-fox  ---------------------------
B D                 Megabat  ---------------------------
B D                  Tenrec  ===========================
              Killer whale  ===========================
B D                 Dolphin  ===========================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNN
          Cape golden mole  ===========================

Inserts between block 33 and 34 in window
          Tibetan antelope 436bp
B D                  Sheep 444bp
             Domestic goat 435bp

Alignment block 34 of 337 in window, 17936193 - 17936205, 13 bps 
B D                   Human  tgcct-----------------------------ggggattt
B D                   Chimp  tgcct-----------------------------ggggattt
B D                 Gorilla  tgcct-----------------------------ggggattt
B D               Orangutan  tgcct-----------------------------ggggattt
B D                  Gibbon  tgcct-----------------------------ggggattt
B D                  Rhesus  tgcct-----------------------------ggggattt
B D     Crab-eating macaque  tgcct-----------------------------ggggattt
B D                  Baboon  tgcct-----------------------------ggggattt
B D            Green monkey  tgcct-----------------------------ggggattt
B D         Squirrel monkey  tgcct-----------------------------ggggattt
B D                Bushbaby  agcct-----------------------------ggggcttt
         Chinese tree shrew  agcct-----------------------------ggg--ttc
B D                Squirrel  accctgtctctaaataaaatacaaaacagggctgggg-gtgt
     Lesser Egyptian jerboa  agcct-----------------------------ggg-gttt
               Prairie vole  agcct-----------------------------gga-gtct
B D         Chinese hamster  acccc-----------------------------ggg-gttt
             Golden hamster  accct-----------------------------ggg-gttt
B D                   Mouse  agcct-----------------------------ggg-gttt
B D                     Rat  agcct-----------------------------ggg-gttt
B D          Naked mole-rat  ggccc-----------------------------gga-----
B D              Guinea pig  agcct-----------------------------agg-----
                 Chinchilla  agcct-----------------------------aga-----
           Brush-tailed rat  gacct-----------------------------ag------
B D                  Rabbit  agcct-----------------------------gggcattt
B D                    Pika  agcct-----------------------------gcgggttc
B D                     Pig  agcct-----------------------------ggagattc
B D                  Alpaca  agcct-----------------------------ggggactt
             Bactrian camel  agcct-----------------------------ggggactt
B D                     Cow  ----------------------------------ggggactt
B D                   Horse  agcct-----------------------------ggggactt
B D        White rhinoceros  agcct-----------------------------ggggattt
B D                     Cat  agctt-----------------------------ggggattg
B D                     Dog  agcct-----------------------------caggagga
B D                 Ferret   agcct-----------------------------ggatactg
B D                   Panda  agcct-----------------------------ggggattg
             Pacific walrus  agact-----------------------------ggggattg
               Weddell seal  agcct-----------------------------ggggattg
            Star-nosed mole  aaccc-----------------------------agggactc
B D                Elephant  agcct-----------------------------ggggtctt
B D                 Manatee  agcct-----------------------------agggtttt
                   Aardvark  agccc-----------------------------gagatttt
B D               Armadillo  ggcc------------------------------ggggttta
B D                Hedgehog  ==========================================
B D                   Shrew  ==========================================
B D             Zebra finch  ==========================================
  D     Collared flycatcher  ==========================================
       Cape elephant shrew  ==========================================
             Domestic goat  ==========================================
B D                   Sheep  ==========================================
          Tibetan antelope  ==========================================
B D                Microbat  ==========================================
      David's myotis (bat)  ==========================================
             Big brown bat  ==========================================
          Black flying-fox  ------------------------------------------
B D                 Megabat  ------------------------------------------
B D                  Tenrec  ==========================================
              Killer whale  ==========================================
B D                 Dolphin  ==========================================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Cape golden mole  ==========================================

Inserts between block 34 and 35 in window
B D               Squirrel 17bp
B D                    Cow 429bp

Alignment block 35 of 337 in window, 17936206 - 17936254, 49 bps 
B D                   Human  aggactagcacca-ggcttgctg-----------------------------------------------
B D                   Chimp  aagactagcacca-ggcttgctg-----------------------------------------------
B D                 Gorilla  aggactagcacca-ggcttgctg-----------------------------------------------
B D               Orangutan  aggactaacaccagggcttgctg-----------------------------------------------
B D                  Gibbon  aggactagcaccagggcttgctg-----------------------------------------------
B D                  Rhesus  acgactagcaccagggtgtgctg-----------------------------------------------
B D     Crab-eating macaque  acgactagcaccagggtgtgctg-----------------------------------------------
B D                  Baboon  acgactagcaccaggatgtgctg-----------------------------------------------
B D            Green monkey  aggactagcaccagggcgtgctg-----------------------------------------------
B D         Squirrel monkey  aggactagcctcagagcttgctg-----------------------------------------------
B D                Bushbaby  agcagt-gcaccagggctcgcgg-----------------------------------------------
         Chinese tree shrew  agtattagcctcagggcattcca-----------------------------------------------
B D                Squirrel  cctctgagttcaatccctgg-taaacaccccctccccaaataaaaggatgacctgggccaggagcttggg
     Lesser Egyptian jerboa  cctgttggcaccacaactca-ca-----------------------------------------------
               Prairie vole  cctatttaccccatggctcg-ta-----------------------------------------------
B D         Chinese hamster  cctatcaactccatggcttg-ta-----------------------------------------------
             Golden hamster  cctctcaactccatggcttg-ta-----------------------------------------------
B D                   Mouse  cttgttaaccccactgctca-ta-----------------------------------------------
B D                     Rat  cctgttaaccccactgctca-ta-----------------------------------------------
B D          Naked mole-rat  agtgc--acagctcgacttg-ga-----------------------------------------------
B D              Guinea pig  cctga--atggaagggctca-ga-----------------------------------------------
                 Chinchilla  cctgt--acagca--gctca-gc-----------------------------------------------
           Brush-tailed rat  tgtgt--acggga--gctca-ga-----------------------------------------------
B D                  Rabbit  agcattagcaccacagctcacta-----------------------------------------------
B D                    Pika  agcgtcagcaccatagctcgcta-----------------------------------------------
B D                     Pig  ggtatcagctccagggctgacca-----------------------------------------------
B D                  Alpaca  ggtgccagcactggggctaatta-----------------------------------------------
             Bactrian camel  ggtatcagcactggggctaatta-----------------------------------------------
B D                   Horse  ggtctgagcaccaaggctcacta-----------------------------------------------
B D        White rhinoceros  aatatgagcaccggggctcacta-----------------------------------------------
B D                     Cat  ggtatcagcaccagggctaacga-----------------------------------------------
B D                     Dog  gttatcagcaccagagctcacca-----------------------------------------------
B D                 Ferret   ggtattagcaccagagctaac-------------------------------------------------
B D                   Panda  ggtatcagccccagagctaactg-----------------------------------------------
             Pacific walrus  ggtatcagcaccagagctaacta-----------------------------------------------
               Weddell seal  ggtatcagcaccagagctaacta-----------------------------------------------
            Star-nosed mole  agaattagcaccc-agctaatgt-----------------------------------------------
B D                Elephant  agtattagcaccacggctaacta-----------------------------------------------
B D                 Manatee  agtattagcaccacggctaacta-----------------------------------------------
                   Aardvark  agtattagctccacaactaacta-----------------------------------------------
B D               Armadillo  ggtgt--gcaccgagcc--agtg-----------------------------------------------
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
       Cape elephant shrew  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
B D                  Tenrec  ======================================================================
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Cape golden mole  ======================================================================

                      Human  --------------------gctggg----tgagtaggagat----gggggagaa
                      Chimp  --------------------gctgag----tgagtaggagat----gggggagaa
                    Gorilla  --------------------gctgga----tgagtaggagat----gggggagaa
                  Orangutan  --------------------gctggg----tgagtaggagat----gggggagaa
                     Gibbon  --------------------gctggg----tgagtaggagat----ggggaagaa
                     Rhesus  --------------------gctggg----tgagtaggagat----gggggagaa
        Crab-eating macaque  --------------------gctggg----tgagtaggagat----gggggagaa
                     Baboon  --------------------gctggg----tgagtaggagat----gggggagaa
               Green monkey  --------------------gctggg----tgagtaggagat----gggggagaa
            Squirrel monkey  --------------------gctggg----tgagtaggagat----aggggagaa
                   Bushbaby  --------------------gc-gtg----tgatcaggagac----cagggggca
         Chinese tree shrew  --------------------actgtg----tgatcaggaatc----cctgcagca
                   Squirrel  atgaagggtgcagctccccagctgta----tgagccgga--------ggccagca
     Lesser Egyptian jerboa  --------------------gctgtg----caatcag-----------accagca
               Prairie vole  --------------------gctgtgctatctatcagga--------ggtgagga
            Chinese hamster  ----------------------tgta----tgatcagga--------agtgagga
             Golden hamster  --------------------gctgta----tggtcagga--------agtgagga
                      Mouse  --------------------gctgca----tgatcagga--------agtgagaa
                        Rat  --------------------ggtgcg----tgatcagga--------agtgagaa
             Naked mole-rat  --------------------gcagag-----cgcgggag--------gctcagca
                 Guinea pig  --------------------gctg-g-----acccaagc-----------cagtg
                 Chinchilla  --------------------gctgtg-----acccgagc--------gggccgcg
           Brush-tailed rat  --------------------gctgag-----agcccagc--------aggcctca
                     Rabbit  --------------------gctgtg----tgaccacaa--c----caggctgcc
                       Pika  --------------------actgca----tggccatgg--c----caggctgca
                        Pig  --------------------gctgtg----cgaccaggaggc----caggcagcc
                     Alpaca  --------------------gctgtg----tgaccaggagac----caggcagcc
             Bactrian camel  --------------------gctgtg----tgaccaggagac----caggcagcc
                      Horse  --------------------gctgtg----tggtcaggaggc----caggcagcc
           White rhinoceros  --------------------gctgtg----tgatcaggaggc----caggaggcc
                        Cat  --------------------gctgtg----tgatcaggaggcccagcagccagcc
                        Dog  --------------------gctgtg----ccatcaggaggc----caggtgact
                    Ferret   ---------------------------------ttagctggg----caggcagcc
                      Panda  --------------------gctgtg----caatcaggacgc----caggcagcc
             Pacific walrus  --------------------gctgtg----catttaggaggc----caggcagcc
               Weddell seal  --------------------gctgtg----catttaggaggc----caggcagcc
            Star-nosed mole  --------------------gctgtg----cgaccaggaggt----cagccc-ta
                   Elephant  --------------------gttgta----taacccggaggc----cagattgct
                    Manatee  --------------------gttgta----tgatccggaggc----caggctgct
                   Aardvark  --------------------gctgtg----tgatccagaagc----caggagact
                  Armadillo  --------------------gctgtg----tgtcacgg--gc----caggtggcg
                   Hedgehog  =======================================================
                      Shrew  =======================================================
                Zebra finch  =======================================================
        Collared flycatcher  =======================================================
        Cape elephant shrew  =======================================================
              Domestic goat  =======================================================
                      Sheep  =======================================================
                        Cow  =======================================================
           Tibetan antelope  =======================================================
                   Microbat  =======================================================
       David's myotis (bat)  =======================================================
              Big brown bat  =======================================================
           Black flying-fox  -------------------------------------------------------
                    Megabat  -------------------------------------------------------
                     Tenrec  =======================================================
               Killer whale  =======================================================
                    Dolphin  =======================================================
                   Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Cape golden mole  =======================================================

Inserts between block 35 and 36 in window
B D               Elephant 2bp
B D                Manatee 2bp
                  Aardvark 2bp
B D              Armadillo 2bp

Alignment block 36 of 337 in window, 17936255 - 17936257, 3 bps 
B D                   Human  c-ct
B D                   Chimp  c-ct
B D                 Gorilla  c-ct
B D               Orangutan  c-ct
B D                  Gibbon  c-ct
B D                  Rhesus  c-ct
B D     Crab-eating macaque  c-ct
B D                  Baboon  c-ct
B D            Green monkey  c-ct
B D         Squirrel monkey  c-tt
B D                Bushbaby  c-ct
         Chinese tree shrew  t-gt
B D                Squirrel  gccc
     Lesser Egyptian jerboa  a-ca
               Prairie vole  a-ca
B D         Chinese hamster  a-ca
             Golden hamster  a-ca
B D                   Mouse  g-ca
B D                     Rat  g-ca
B D          Naked mole-rat  c-tg
B D              Guinea pig  a-cc
                 Chinchilla  c-ct
           Brush-tailed rat  c-cc
B D                  Rabbit  c-ct
B D                    Pika  a-ct
B D                     Pig  c-ct
B D                  Alpaca  c-ct
             Bactrian camel  c-ct
B D                   Horse  c-ct
B D        White rhinoceros  c-ct
B D                     Cat  c-tt
B D                     Dog  c-tt
B D                 Ferret   t-tt
B D                   Panda  t-tt
             Pacific walrus  c-tt
               Weddell seal  c-tt
            Star-nosed mole  c-ct
B D                Elephant  c-tt
B D                 Manatee  c-tt
           Cape golden mole  c-ct
                   Aardvark  c-ca
B D               Armadillo  c-ct
B D                Hedgehog  ====
B D                   Shrew  ====
B D             Zebra finch  ====
  D     Collared flycatcher  ====
       Cape elephant shrew  ====
             Domestic goat  ====
B D                   Sheep  ====
B D                     Cow  ====
          Tibetan antelope  ====
B D                Microbat  ====
      David's myotis (bat)  ====
             Big brown bat  ====
          Black flying-fox  ----
B D                 Megabat  ----
B D                  Tenrec  ====
              Killer whale  ====
B D                 Dolphin  ====
B D                Marmoset  NNNN

Alignment block 37 of 337 in window, 17936258 - 17936276, 19 bps 
B D                   Human  ctctgagcttgttttctta
B D                   Chimp  ctctgagcttgttttctta
B D                 Gorilla  ctctgagcttgttttctta
B D               Orangutan  ctctgagcttgttttctta
B D                  Gibbon  ctctgagcttgttttctta
B D                  Rhesus  ctctgagcttgttttctta
B D     Crab-eating macaque  ctctgagcttgttttctta
B D                  Baboon  ctctgagcttgttttctta
B D            Green monkey  ctctgagcttgttttctta
B D         Squirrel monkey  ctctgagcttgttttcttg
B D                Bushbaby  ccctgagctggttctctca
         Chinese tree shrew  ctttgagcttgctttttca
B D                Squirrel  ctctcagcttgtgttctca
     Lesser Egyptian jerboa  ctt----ctactgtgttct
               Prairie vole  ctcagggcttgtgttctta
B D         Chinese hamster  atcagagctggagg-----
             Golden hamster  aacggagctggagg-----
B D                   Mouse  atctgagcttgtgttctct
B D                     Rat  atcagaccttgtgtgctct
B D          Naked mole-rat  ctc---gctgttggcctgc
B D              Guinea pig  ctctcagctatttgcccac
                 Chinchilla  ctctgagctgtttgcccac
           Brush-tailed rat  ctctctgctgtttgcccac
B D                  Rabbit  ctctgagcttgctttctgg
B D                    Pika  ctcagag------------
B D                     Pig  ctctgagcttgttttctca
B D                  Alpaca  ctctgagcttgtcttctca
             Bactrian camel  ctctgagcttgttttctca
B D                   Horse  ctctga-----ttttctca
B D        White rhinoceros  ctctgagcttgttttctcc
B D                     Cat  ctctgagcttttgttc---
B D                     Dog  ctctgagcttcttttctta
B D                 Ferret   ctctgagctccttttctta
B D                   Panda  ctctgagcttcctttctta
             Pacific walrus  ctctgagctccttttctta
               Weddell seal  ctctgagctccttttctta
            Star-nosed mole  ctctgagcttgttagattc
B D                Elephant  ctctgagcttcttttctca
B D                 Manatee  ctctgagcttcttttctca
           Cape golden mole  ttttgagcttc-tttttca
B D                  Tenrec  ctctgagct---tttctca
                   Aardvark  cttggagcttcttttctca
B D               Armadillo  ctctgagctc--gttcaca
B D                Hedgehog  ===================
B D                   Shrew  ===================
B D             Zebra finch  ===================
  D     Collared flycatcher  ===================
       Cape elephant shrew  ===================
             Domestic goat  ===================
B D                   Sheep  ===================
B D                     Cow  ===================
          Tibetan antelope  ===================
B D                Microbat  ===================
      David's myotis (bat)  ===================
             Big brown bat  ===================
          Black flying-fox  -------------------
B D                 Megabat  -------------------
              Killer whale  ===================
B D                 Dolphin  ===================
B D                Marmoset  NNNNNNNNNNNNNNNNNNN

Inserts between block 37 and 38 in window
B D               Bushbaby 449bp
B D                    Pig 5bp
B D                 Alpaca 5bp
            Bactrian camel 5bp
B D                  Horse 5bp
B D       White rhinoceros 5bp
B D                    Cat 5bp
B D                    Dog 5bp
B D                Ferret  5bp
B D                  Panda 5bp
            Pacific walrus 5bp
              Weddell seal 5bp
           Star-nosed mole 3bp

Alignment block 38 of 337 in window, 17936277 - 17936291, 15 bps 
B D                   Human  -----gatttgag--atga-at---a
B D                   Chimp  -----gatttgag--atga-at---a
B D                 Gorilla  -----gatttgag--atga-at---a
B D               Orangutan  -----gatttgag--atga-at---a
B D                  Gibbon  -----gatttgag--ataa-at---a
B D                  Rhesus  -----gatttgag--atga-at---a
B D     Crab-eating macaque  -----gatttgag--atga-at---a
B D                  Baboon  -----gatttgag--atga-at---a
B D            Green monkey  -----gatttgag--atga-at---a
B D         Squirrel monkey  -----gattggag--atga-gt---g
         Chinese tree shrew  -----gattggag--gtga-gt---a
B D                Squirrel  -------gactga--aggt-ga----
     Lesser Egyptian jerboa  -------caagga--gaca-------
               Prairie vole  -------tctgga--gggg-------
B D         Chinese hamster  ----------gga--ggat-------
             Golden hamster  --------caaga--gggt-------
B D                   Mouse  -------tttgca--gagt-gt----
B D                     Rat  -------tttgga--ggggagt----
B D          Naked mole-rat  -------cctc----gcca-gt----
B D              Guinea pig  -------cccaga--gtga-gc----
                 Chinchilla  -------catg----gtga-gt----
           Brush-tailed rat  -------cctgat--gtga-gg----
B D                  Rabbit  -------gatcag--atgg-gagca-
B D                    Pika  ------------a--agga-ga----
B D                     Pig  -----gaggtgag--tg---------
B D                  Alpaca  -----gaggtgtg--tg---------
             Bactrian camel  -----gaggtgtg--tg---------
B D                   Horse  -----gaggtgag--tg---------
B D        White rhinoceros  -----gagatgag--tg---------
B D                     Cat  -----gatttaag--tg---------
B D                     Dog  -----gatttaag--tg---------
B D                 Ferret   -----gatttaag-------------
B D                   Panda  -----gatttaag--tg---------
             Pacific walrus  -----gatttaag-------------
               Weddell seal  -----gatttaag-------------
            Star-nosed mole  -----aatgtgagaatg---------
B D                Elephant  cattgaaggagag--tg---------
B D                 Manatee  tactggaggagag--tg---------
           Cape golden mole  catcgaaggaa-t--tg---------
B D                  Tenrec  cctcggaagaa----tg---------
                   Aardvark  cattggagaagaa--tg---------
B D               Armadillo  cactggaggagcg--tg---------
B D                Hedgehog  ==========================
B D                   Shrew  ==========================
B D             Zebra finch  ==========================
  D     Collared flycatcher  ==========================
       Cape elephant shrew  ==========================
             Domestic goat  ==========================
B D                   Sheep  ==========================
B D                     Cow  ==========================
          Tibetan antelope  ==========================
B D                Microbat  ==========================
      David's myotis (bat)  ==========================
             Big brown bat  ==========================
          Black flying-fox  --------------------------
B D                 Megabat  --------------------------
              Killer whale  ==========================
B D                 Dolphin  ==========================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Bushbaby  ==========================

Inserts between block 38 and 39 in window
B D                 Rabbit 354bp
B D                   Pika 3bp
B D                Ferret  2bp
            Pacific walrus 2bp
              Weddell seal 2bp

Alignment block 39 of 337 in window, 17936292 - 17936294, 3 bps 
B D                   Human  c-----at--
B D                   Chimp  t-----at--
B D                 Gorilla  t-----at--
B D               Orangutan  t-----at--
B D                  Gibbon  taggggat--
B D                  Rhesus  t-----at--
B D     Crab-eating macaque  t-----at--
B D                  Baboon  t-----gt--
B D            Green monkey  t-----at--
B D         Squirrel monkey  t-----aa--
         Chinese tree shrew  t-----aa--
B D                Squirrel  ---ggg----
B D                   Mouse  ---ggg----
B D                     Rat  ---ggg----
B D          Naked mole-rat  ---ggg----
B D              Guinea pig  ---tgg----
                 Chinchilla  ---ggc----
           Brush-tailed rat  ---gag----
B D                     Pig  -------t--
B D                  Alpaca  -------t--
             Bactrian camel  -------t--
B D                   Horse  -------t--
B D        White rhinoceros  -------t--
B D                     Cat  -------t--
B D                     Dog  -------t--
B D                   Panda  -------t--
            Star-nosed mole  -------t--
B D                Elephant  -------taa
B D                 Manatee  -------taa
           Cape golden mole  -------tag
B D                  Tenrec  -------ttc
                   Aardvark  -------taa
B D               Armadillo  -------tgc
            Golden hamster  ----------
B D                Hedgehog  ==========
B D                   Shrew  ==========
B D             Zebra finch  ==========
  D     Collared flycatcher  ==========
              Prairie vole  ----------
       Cape elephant shrew  ==========
B D         Chinese hamster  ----------
             Domestic goat  ==========
B D                   Sheep  ==========
B D                     Cow  ==========
          Tibetan antelope  ==========
B D                Microbat  ==========
      David's myotis (bat)  ==========
             Big brown bat  ==========
          Black flying-fox  ----------
B D                 Megabat  ----------
B D                  Rabbit  ==========
            Pacific walrus  ==========
B D                    Pika  ==========
B D                 Ferret   ==========
    Lesser Egyptian jerboa  ----------
              Weddell seal  ==========
              Killer whale  ==========
B D                 Dolphin  ==========
B D                Marmoset  NNNNNNNNNN
B D                Bushbaby  ==========

Inserts between block 39 and 40 in window
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                  Horse 2bp
B D       White rhinoceros 2bp
B D                    Cat 2bp
B D                    Dog 2bp
B D                  Panda 2bp
           Star-nosed mole 2bp

Alignment block 40 of 337 in window, 17936295 - 17936295, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  g
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Rabbit  c
B D                    Pika  c
B D                     Pig  c
B D                  Alpaca  t
             Bactrian camel  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
            Star-nosed mole  t
B D                Elephant  t
B D                 Manatee  t
           Cape golden mole  g
B D                  Tenrec  c
                   Aardvark  t
B D               Armadillo  t
            Golden hamster  -
B D                Hedgehog  =
B D                   Shrew  =
B D             Zebra finch  =
  D     Collared flycatcher  =
              Prairie vole  -
       Cape elephant shrew  =
B D         Chinese hamster  -
             Domestic goat  =
B D                   Sheep  =
B D                     Cow  =
          Tibetan antelope  =
B D                Microbat  =
      David's myotis (bat)  =
             Big brown bat  =
          Black flying-fox  -
B D                 Megabat  -
    Lesser Egyptian jerboa  -
              Killer whale  =
B D                 Dolphin  =
B D                Marmoset  N

Inserts between block 40 and 41 in window
B D                 Rhesus 309bp
B D    Crab-eating macaque 307bp
B D                 Baboon 306bp

Alignment block 41 of 337 in window, 17936296 - 17936297, 2 bps 
B D                   Human  aa
B D                   Chimp  aa
B D                 Gorilla  aa
B D               Orangutan  aa
B D                  Gibbon  aa
B D                  Rhesus  aa
B D     Crab-eating macaque  aa
B D                  Baboon  aa
B D            Green monkey  aa
B D         Squirrel monkey  aa
B D                Bushbaby  aa
         Chinese tree shrew  aa
B D                Squirrel  ga
     Lesser Egyptian jerboa  gg
               Prairie vole  ag
B D         Chinese hamster  ga
             Golden hamster  ga
B D                   Mouse  ga
B D                     Rat  ga
B D          Naked mole-rat  ga
B D              Guinea pig  aa
                 Chinchilla  aa
           Brush-tailed rat  aa
B D                  Rabbit  ac
B D                    Pika  aa
B D                     Pig  ac
B D                  Alpaca  aa
             Bactrian camel  aa
B D                   Horse  aa
B D        White rhinoceros  ga
B D                     Cat  aa
B D                     Dog  aa
B D                 Ferret   aa
B D                   Panda  aa
             Pacific walrus  aa
               Weddell seal  aa
            Star-nosed mole  aa
B D                Elephant  ga
B D                 Manatee  ca
           Cape golden mole  ca
B D                  Tenrec  ca
                   Aardvark  ca
B D               Armadillo  aa
B D                Hedgehog  ==
B D                   Shrew  ==
B D             Zebra finch  ==
  D     Collared flycatcher  ==
       Cape elephant shrew  ==
             Domestic goat  ==
B D                   Sheep  ==
B D                     Cow  ==
          Tibetan antelope  ==
B D                Microbat  ==
      David's myotis (bat)  ==
             Big brown bat  ==
          Black flying-fox  --
B D                 Megabat  --
              Killer whale  ==
B D                 Dolphin  ==
B D                Marmoset  NN

Inserts between block 41 and 42 in window
B D           Green monkey 314bp

Alignment block 42 of 337 in window, 17936298 - 17936506, 209 bps 
B D                   Human  ttgct---g--gaa------ttct-ttgtatccctgacacttgtataatttgctttg-ttactgcaaaat
B D                   Chimp  ttgct---g--gaa------tttt-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D                 Gorilla  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D               Orangutan  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D                  Gibbon  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D                  Rhesus  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D     Crab-eating macaque  ttgct---g--gaa------ttct-ttatatccctgacacgtgtataatttgctttg-ttactgcaaaat
B D                  Baboon  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D            Green monkey  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttgctttg-ttactgcaaaat
B D         Squirrel monkey  ttgct---g--gaa------ttct-ttatatccctgacacttgtataatttaccttg-tttctgcaaaat
B D                Bushbaby  tggct---g--tga------tcct-ttctatctctgacgcttacgaaatttgctttg-tttctactaatc
         Chinese tree shrew  ttgcc---a--gaa------tgtt-ttg-aaccctggcagttatgtaatttacttcg-tttctgcaaatt
B D                Squirrel  tagtt---gtggga------acct-ttctgtccctcacacatgggtcattttcactg-tttctgtaaatt
     Lesser Egyptian jerboa  tgagt---a--gcattgttatcct-ttctgtctcttatatttacatggtctatgttg-tttc--taaata
               Prairie vole  ttctt---a--------------t-ctgtgc-------acttg-atgatttacaatc-tctc--caagct
B D         Chinese hamster  ttact---a--gga------ccct-ttgtgcccctcacacctg-ctaatttatgttc-tccc--caagct
             Golden hamster  ttgct---a--gga------tcct-ttgtgcgccccaaacttg-ataatttatgtta-tctc--caagtt
B D                   Mouse  ttgct---a--gga---------t-ttgtggctctcacactcg-ataatttatgttc-tctc--caagct
B D                     Rat  ttgct---a--gga---------t-ttgtggctctcatatttg-ataatttatattc-tttc--caagct
B D          Naked mole-rat  ctgct---g-----------gccc-tttgagccccgacacttatgtcacttatattc-tgtc--t-----
B D              Guinea pig  ccact---g--gga------gcct-ttgggttctttacacttaaataatttatgttc-tttc--ca----
                 Chinchilla  ctgct---g--gta------gcct-tttgattctccacacgtaagtaatttatattc-tttc--t-----
           Brush-tailed rat  cagct---g--gga------gcct-tgtaattctttacatttaagtaatttatattt-ttcc--t-----
B D                  Rabbit  tggcccctg--gaa------tgct-ttctagatctgacacttaggtaatctgctttg-ttcttacaaatt
B D                    Pika  ttgtc---g--caa------tcct-tcccatatctgacacttctataatttgcattg-ttcctgcaaatt
B D                     Pig  acacc---a--gac------tcc--ttctacttctgacacttatgtaatcaactctc-tttttgaaaatt
B D                  Alpaca  ccacc---a--gat------tcct-ttctacctctgatacttacgtagttgactttc-tttttaaaaact
             Bactrian camel  ccacc---a--gat------tcct-ttctacctctgatacttacgtaattgactttc-tttttaaaaact
B D                   Horse  cctcc---a--gaa------tcct-ttctatctccgacacttacgtaatctacttcc-tttctgcaaatt
B D        White rhinoceros  tagcc---a--gaa------tcct-ttctatctctgacactgacgtaatctactttc-tttctacaaatt
B D                     Cat  tcacc---a--gaa------tcct-ttctgtcgttgacatttatgtaatctactttg-tttctgcaaact
B D                     Dog  tcacc---g--gaa------tcct-ttctatctcagacatttatgtaatgcactttcttttctgcaaatt
B D                 Ferret   tcatt---a--gaa------tcct-ttctatcttggacatttatttaattgactttc-ttcctacaaatt
B D                   Panda  tcacc---a--gaa------tcct-ttctgtcctggacatttatgtaatccactttc-tttctgcaaatt
             Pacific walrus  tcacc---a--gaa------tcct-ttctatctgggacatttatgtaattcactttc-tttctgcaattt
               Weddell seal  tcacc---a--gaa------tcct-ttctatctgggacatttatgtaattcactttc-tttctgcaaatt
            Star-nosed mole  ttacc---c--aaa------tcc--ttctatctctgacacttaagtaatctgctttc-ttcccctgaact
B D                Elephant  ttcct---g--gtg------tctt-ttctatctctgacacttacgtagtctactttg-ttcctgtaaatt
B D                 Manatee  ttcct---g--gcg------tctt-ttctagctctgacacttatgtaatctactttg-tttctg-----a
           Cape golden mole  ttcct---g--gca------tcctattttagctcctactcttatgtaatctgttttg-tttctgtaaatt
B D                  Tenrec  ctctt---g--gaa------tcct-ttctggctctgatctttacata---tttactg-cttctctaagtt
                   Aardvark  ttcct---g--gca------tcct-ttctggttctgacacttatgtg---------------tgtaagtt
B D               Armadillo  tcccc---g--ggg------gct--ttcgaacgctgacacttat----------ttg-gtcctg-aaatc
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D             Zebra finch  ======================================================================
  D     Collared flycatcher  ======================================================================
       Cape elephant shrew  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Killer whale  ======================================================================
B D                 Dolphin  ======================================================================
B D                Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ggctagttcccttctaactttgcttacattataaatgtgcatagc-------------aaaaacc--ga-
                      Chimp  ggctagttcccttctaactttgcttacattataaatgtgcatagc-------------aaaaacc--ga-
                    Gorilla  ggctagttcccttctaactttgcttacattatagatgtgcatagc-------------aaaaacc--ga-
                  Orangutan  ggctagttcccttctaactttgcttacattataaatgtgcatagc-------------aaaaact--ga-
                     Gibbon  ggctagttcccttctaactgtgcttacattataaatatgcatagc-------------aaaaacc--ga-
                     Rhesus  ggctagttcccttctaacttggctttcattataaatgtgcatagc-------------aaaaacc--ga-
        Crab-eating macaque  ggctagttcccttctaacttggctttcattataaatgtgcatagc-------------aaaaacc--ga-
                     Baboon  ggctagttcccttctaacttggctttcattataaatgtgcatagc-------------aaaaacc--ga-
               Green monkey  ggctagttcccttctaacttggctttcattataaatgtgcgtagc-------------aaaaacc--ga-
            Squirrel monkey  ggctagttcccatctagctttgcttacgttataaatgtgcatagc-------------aaaaacc--ga-
                   Bushbaby  ggctagttccc-tctaactttgttcattttataaatttgcgtagc--------------aaaact--ga-
         Chinese tree shrew  -gctagctcctctttaactttgtttacattatgaatttgcataac-------------aaaactc--aa-
                   Squirrel  gactagttcccatccaaatttgtttgcattgtaaatttgtgtagc-------------aaga------g-
     Lesser Egyptian jerboa  ggctagtttccttctaaatctgttgacattataaagttgcacaat-------------aaaaaac--ag-
               Prairie vole  ggctttgttctttccaactttgtttacattatagatttgcataat-------------aagaatc--ag-
            Chinese hamster  ggctatgttctttccaactttgtttccattatgaatttgcataat-------------aagaact--gg-
             Golden hamster  ggctacattctttccaactttgttcccattataaatttgcataat-------------aagaact--gg-
                      Mouse  gtctaagttctttccaacttcgtttattttataagtgtgcccaat-------------aagaacc--ag-
                        Rat  gtctaggttctttccgacttcgtttattttctaagtgtgcccagt-------------gagaacc--ag-
             Naked mole-rat  -tcacaatgccctatgactttgttt-cattatgaatttgcataat-------------gaaagcc--ag-
                 Guinea pig  -gaaaattgctctcagacttcatttatattataaatttgcataat----------------aacc--ag-
                 Chinchilla  -gcaaataaccctcaaactttgtttacattataaatttgtgtaat-------------aaaaacc--at-
           Brush-tailed rat  -gcaaattgcccttaaacattgcttacgttataaatttgcataat-------------ataaatt--ag-
                     Rabbit  ggctggttctcctctaattttgtt------ataattctgcatagc-------------aaaaacctgat-
                       Pika  ggccagttctcctctaactttgtttata-catcagtctgtacagt-------------aagaatctgat-
                        Pig  ggccagtgccgctctaacttggtttaggttataaatttgcat-----------------aaaact--ga-
                     Alpaca  ggctagttcccatttaactttgtttacgttgtaaatttgcat-----------------aaagct--ga-
             Bactrian camel  ggctagttcccatttaactttatttacattataaattcgcat-----------------aaaatt--ga-
                      Horse  ggcgagttcccctctaactttgttcacgttataaatttggatacc-------------aaaaacc--ga-
           White rhinoceros  agctagttctcctctggcttt----atgttataaatttgcatagc-------------aaaaacc--ga-
                        Cat  ggctagttcccctctaactttgtttacattagaaatttacatagc--------------aaatca--ga-
                        Dog  agctagttcccctctcactttgtttacattataaatttgtatagc-------------aaaaaca--ga-
                    Ferret   ggttagttcctctccaactttgtttgcattataaattcacatagcaaaaaaaaaaaagaaaaata--ga-
                      Panda  ggttagttcccctctaacttggtttacattataaatttgcatag------------caaaaacca--ga-
             Pacific walrus  ggttagttcccctctaactttgtttccattataaattcgcatagc-----------caaaaaaca--ga-
               Weddell seal  ggttagttcccctctaactttgtttacattataaatccgcatagc-----------caaaaaaca--ga-
            Star-nosed mole  gtccgttacct------ttttgtttgcattatgaatttgcatagc--------------aagacc--ca-
                   Elephant  agttatttcacctctaattttgtgtgcattaggaatttgcaaaat-------------ga----------
                    Manatee  agttatttcacctctaattttgtgtgcattaggaattcatagaat-------------ga----------
           Cape golden mole  ggttatttcacctctaattttgtgtgcatt--gagtttgtatagc-------------aaaaatt--a--
                     Tenrec  agttat--------taa---------------gaatttgcagagc-------------aaaaaaa--aaa
                   Aardvark  agttatttcacctctacttttgtgtatactaggaatttgcctagc-------------aaaaaat--ga-
                  Armadillo  agctagttcccctccaactctatttacagtacgagtttgcatagc-------------aaacgct--ga-
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                Zebra finch  ======================================================================
        Collared flycatcher  ======================================================================
        Cape elephant shrew  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
               Killer whale  ======================================================================
                    Dolphin  ======================================================================
                   Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  -------ttttaaactac----tctctg--atttttcttatc-----------t----t----------c
                      Chimp  -------ttttaaactac----tttctg--atttttcttatc-----------t----t----------c
                    Gorilla  -------ttttaaactac----tttctg--atttttcttatc-----------t----t----------c
                  Orangutan  -------ttttaaactac----tttctg--atttttcttatc-----------t----t----------c
                     Gibbon  -------ttttaaactac----tttctc--gtttttcttatc-----------t----t----------c
                     Rhesus  --------tttaaactac----tttctg--atttttcttatc-----------t----t----------c
        Crab-eating macaque  --------tttaagctac----tttctg--atttttcttatc-----------t----t----------c
                     Baboon  -------ttttaaactac----tttctg--atttttcttatc-----------t----t----------c
               Green monkey  -------ttttaaactac----tttctg--atttttcttatc-----------t----t----------c
            Squirrel monkey  -------ttttaaactac----tttctg--atttttcttatc-----------t----t----------c
                   Bushbaby  -------ttttaa-ctgc----tatcta--atttttcttgta-----------t-ctat----------a
         Chinese tree shrew  -------tttaaacctgt----tgtcta--tattttcttata-----------ttttct----------c
                   Squirrel  -------ttttaacctgc----tattta--ttctttctcaca-----------c----t----------c
     Lesser Egyptian jerboa  -------ttttaacctgc----catcta--atttttcttatg-----------t----t----------c
               Prairie vole  -------ttttaatc----------------tttttctct-------------c----t----------c
            Chinese hamster  -------ttttagtctgc----caacta--atttttcttttg-----------t----t----------c
             Golden hamster  -------ttttaatctgc----caacta--atttttctcttg-----------t----t----------c
                      Mouse  -------ttttaatttgc----caacta--atttcccttttg-----------t----t----------c
                        Rat  -------ttttaatttgc----caacta--ccttcccatttg-----------t----t----------c
             Naked mole-rat  -------ttgcaacctgt----catcta--tgctttcttata-----------t----t----------c
                 Guinea pig  -------tttcaacctgc----agtctgttttttttcttaca-----------t----t----------c
                 Chinchilla  -------tttcaacctgt----tatcta--ttttttcttata-----------t----t----------c
           Brush-tailed rat  -------tttcaacctgt----catcta--ttttttcttaaa-----------t----t----------c
                     Rabbit  -------ttttagcttgc----tatcta--actttgct--------------------------------
                       Pika  -------ttttaactttcctatttctta--tattttct--------------------------------
                        Pig  -------ttttaacccgc----catcta--atttttctttta-----------t----t----------g
                     Alpaca  -------ttttaacctgc----tgtcta--atttttctcata-----------t----t----------c
             Bactrian camel  -------ttttaacctgc----taccta--atttttctcata-----------t----t----------c
                      Horse  -------ttttaacctgc----caacta--atttttcttata-----------t----t----------c
           White rhinoceros  -------ttttaacctgc----catcta--attttttttata-----------t----t----------c
                        Cat  -------ttttaacctgc----caatga--attggtct--ta-----------t----t----------c
                        Dog  -------tttt----------------a--atttttct--ta-----------t----t----------c
                    Ferret   -------ttttaacctgc----caatga--atttttct--ta-----------t----t----------c
                      Panda  -------ttttaacctgc----caatga--atttttct--ta-----------t----t----------c
             Pacific walrus  -------ttttaacctgc----caatga--aattttct--ta-----------t----t----------c
               Weddell seal  -------ttttaacctgc----caatga--atttttct--ta-----------t----t----------c
            Star-nosed mole  -------atttaacctgc----tatcta--atgtttcttaca-----------t----t----------g
                   Elephant  -------ttttaacctgc----catcta--ccttttcttataca--------tc----t----------t
                    Manatee  -------ttttaacctgc----catcta--ctttttctgata-----------t----t----------t
           Cape golden mole  -------ttttaacttgc----cattta--ctttttcttata----------------t----------t
                     Tenrec  aagtgatttttaacctgc----tgtctg--cattttcatata----------------tatatataaaat
                   Aardvark  -------cttaaacctgc----catcta--ctttttcttatttattttattttt----t----------t
                  Armadillo  -------ttttaac-----------cta--attttccttgta-----------t----t----------c
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                Zebra finch  ======================================================================
        Collared flycatcher  ======================================================================
        Cape elephant shrew  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
               Killer whale  ======================================================================
                    Dolphin  ======================================================================
                   Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  tc-----agtag-aatcctaac-----caatgagg-ttttat-ttcctgttgttgagggc-cc-aa-gg-
                      Chimp  tc-----agtag-aatcctaac-----caatgagg-ttttat-ttcctgttgttgagggc-cc-aa-gg-
                    Gorilla  tc-----agtag-aatcctaac-----caatgagg-ttttat-ttcctgttgttgagggc-cc-aa-gg-
                  Orangutan  tc-----agtag-aatcctaac-----caatgagg-ttttat-ttcctgttgttgagggc-cc-aa-gg-
                     Gibbon  tc-----agtag-aatcctaac-----caatgagg--tttat-ttcctgttgttgagggc-cc-aa-gg-
                     Rhesus  tc-----agtag-aatcctaac-----caatgagg-ttttac-ttcctgttgttgatggc-cc-aa-gg-
        Crab-eating macaque  tc-----agtag-aatcctaac-----caatgagg-ttttac-ttcctgttgttgatggc-cc-aa-gg-
                     Baboon  tc-----agtag-aatcctaac-----caatgagg-ttttac-ttcctgttgttgatggc-cc-aa-gg-
               Green monkey  tc-----agtag-aatcctaac-----caatgagg-ttttac-ttcctgttgttgatggc-cc-aa-gg-
            Squirrel monkey  tc-----ggtag-aaccctaac-----caacaaggtttttat-tttctgttgttggtggc-cc-aa-gg-
                   Bushbaby  ta-----aatag-aatcccaac-----cattgagg-tt--------------taggtagc-cc-ag-cg-
         Chinese tree shrew  tc-----aggaa-tatccttac-----caatgagg-ttttat-ttcttgttgttgggggtact-ga-gg-
                   Squirrel  tccgctaagaag-agtcccagc-----caatgatg-tttcat-tt-ctttctagggggcc-tg-g--ag-
     Lesser Egyptian jerboa  tctgcc-agt---agtcataac-----caatgcag-tttgag-ttcctgttgcttgggat-ctgg--gg-
               Prairie vole  tcggcc-agtgg-agtcctagc-----ccttgagg-tctgtc-ct-ctgtcattggagcc-ct-g--gg-
            Chinese hamster  tcggcc-agtgg-attcctagc-----cattgaag-tctgac-tt-ctgctgctggggcc-ct-g--gg-
             Golden hamster  tcggtc-agtgg-agtcctagc-----cattgagg-tctgac-tt-ctgttgctggggcc-tt-g--gg-
                      Mouse  tcaccc-agcagaagtcctagc-----aactgagg-tctgac-tt-ctgttgttggggtc-ct-g--gg-
                        Rat  tcaccc-agcag-agtcctagctttgtcacaga-g-tcctat-at-ttgtcactggggcc-ct----gg-
             Naked mole-rat  ttacct--------tctgtagc-----cagtgaga-tttcagggt-ttgtggttgagggc-ct-gg-ga-
                 Guinea pig  ttactt--------tacctggc-----tagtgaaa-ttttgtgtt-ttattgttgagggc-cc-ag-ag-
                 Chinchilla  atacat--------tcccagac-----gattgaaa-atttatgtt-tcattgttgagggc-cc-agtgg-
           Brush-tailed rat  ttacat--------gccttggc-----cagtgaaa-ctttatgtt-ttgttgctgaaggt-tt-gaggg-
                     Rabbit  ---atc-agagg-aagcctaac-----caatgagg-ttttat-ttcttgttgctggaggt-ct-gg-tg-
                       Pika  ---atg-agaaa-aagcctaac-----caatgaga-ttttgt-tt-ttgctattgggcat-ct-gg-ag-
                        Pig  tctctc-agtgg-agtcccaac-----gaatgagg-ttccat-ttcttgttgttgggg-c-ac-gg-ca-
                     Alpaca  tctatc-agtcg-agtcctaac-----taatgagg-ttttat-ttcttgtggttggtg-c-ac-ag-gt-
             Bactrian camel  tctatc-agtcg-agccctaac-----taatgaag-ttttat-ttcttgtggttggtg-c-ac-aa-gt-
                      Horse  tctatt-agtag-agtcctaac-----caatgaag-ttttat-ttcttgttgttggggac-ac-gg-gg-
           White rhinoceros  tctctt-agtag-agtcctaac-----taatgagg-ttttat-ttcttgttattgggggc-ac-ag-gg-
                        Cat  tctgtc-agtgg-agtcctaac-----caatgaga-tcttct--------tgttgaggac-ac-ag-gg-
                        Dog  tctgtc-agtag-atttctaac-----caatgggg-ttttat-----tactgttgaggac-ac-ag-ag-
                    Ferret   tctgtc-agtag-agtgctaac-----caatgagg-ttttat-----tgctgttgcggac-ac-ag-gg-
                      Panda  tctgtc-agtac-agtgctaac-----caatgaga-ttttat-----tgctgtggaggac-ac-ca-ga-
             Pacific walrus  tctgtc-agtag-agtgctaac-----caatgagg-ttttat-----tgctgtggaggac-ac-gg-gga
               Weddell seal  tctgtc-agtag-agtgctaac-----caataagg-ttttat-----tgctgttgaggac-at-gg-gga
            Star-nosed mole  tctacc-agtag-agggctaac-----a---ggag-gcgcat-gtctttctgtgaggggc-at-gg-gg-
                   Elephant  tttatc-agtag-agtcctaac-----caatgaga-tttcat-ttcttgtcgatgagggc-gt-gg-gg-
                    Manatee  tttatc-agtag-agtcctaac-----caatgaga-tttcat-ttcttgttgttgagggc-at-gg-gg-
           Cape golden mole  tttatc-agtag-aatcctaac-----cgatgaga-tttcat-tttttattgttagggac-at-ag-gg-
                     Tenrec  ttcatc-agtag-agtcccaac-----caatgaaa-tctcac-ttatt-ttcttgggaac-ac-gg-ag-
                   Aardvark  tttgtc-agtag-aat-----c-----caatgact-tctcat-ttcttgttgttgaggac-at-ag-gg-
                  Armadillo  tctaca-agtcg-agtcctaac-----ccatgggg-attcat-ttcttgtcacgcggggc-ac--g-gg-
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
                Zebra finch  ======================================================================
        Collared flycatcher  ======================================================================
        Cape elephant shrew  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
              Big brown bat  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
               Killer whale  ======================================================================
                    Dolphin  ======================================================================
                   Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ---gattgactacctt
                      Chimp  ---gattgactacctt
                    Gorilla  ---gattgactacctt
                  Orangutan  ---gattgactacctt
                     Gibbon  ---gattgactacctt
                     Rhesus  ---gattgactacctt
        Crab-eating macaque  ---gattgactacctt
                     Baboon  ---gattgactacctt
               Green monkey  ---gattgactacctt
            Squirrel monkey  ---gattgactacctt
                   Bushbaby  ---aattagctacctt
         Chinese tree shrew  ---aactagcctcttt
                   Squirrel  ---agtcgacaacctt
     Lesser Egyptian jerboa  ---agttggatactct
               Prairie vole  ---agttggctacctt
            Chinese hamster  ---agttggctacctc
             Golden hamster  ---agttggctacctt
                      Mouse  ---agtttgctacctt
                        Rat  ---agtttgctacctt
             Naked mole-rat  ---aattgcc-tccgt
                 Guinea pig  ---agttgccttcctt
                 Chinchilla  ---agttgccttcctt
           Brush-tailed rat  ---agttactttcctt
                     Rabbit  ---aattagacacctc
                       Pika  ---agttttacatctt
                        Pig  ---aa-tagcttgcct
                     Alpaca  ---ta-tggcttgcct
             Bactrian camel  ---ta-tggcttgcct
                      Horse  ---aattggtttacct
           White rhinoceros  ---aattggcttgcct
                        Cat  ---aattggcttgctc
                        Dog  ---aattagcttgctt
                    Ferret   ---tattagcttgcct
                      Panda  ---aattagcttgcct
             Pacific walrus  attaattagcttgcct
               Weddell seal  attaattagcttgcct
            Star-nosed mole  ---aattgacttgctt
                   Elephant  ---agtcagctaactg
                    Manatee  ---agtcagctgcctg
           Cape golden mole  ---aatcagctacctg
                     Tenrec  ---actcagctgcctg
                   Aardvark  ---aatcagctgcctg
                  Armadillo  ---tcttggctgtttt
                   Hedgehog  ================
                      Shrew  ================
                Zebra finch  ================
        Collared flycatcher  ================
        Cape elephant shrew  ================
              Domestic goat  ================
                      Sheep  ================
                        Cow  ================
           Tibetan antelope  ================
                   Microbat  ================
       David's myotis (bat)  ================
              Big brown bat  ================
           Black flying-fox  ----------------
                    Megabat  ----------------
               Killer whale  ================
                    Dolphin  ================
                   Marmoset  NNNNNNNNNNNNNNNN

Inserts between block 42 and 43 in window
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp

Alignment block 43 of 337 in window, 17936507 - 17936514, 8 bps 
B D                   Human  aaaactta
B D                   Chimp  aaaactca
B D                 Gorilla  aaaactta
B D               Orangutan  aaaactta
B D                  Gibbon  aaaactta
B D                  Rhesus  aaaactta
B