Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 201 in window, 45541845 - 45541903, 59 bps 
B D                   Human  actacatcaagtactttact-g------ga---aaaa--------attgagagtgacac--aggta-taa
B D                   Chimp  actacctccagtactttact-g------ga---aaaa--------attgagagtgacac--cggta-taa
B D                 Gorilla  actacatcaagtactttact-g------ga---aaaa--------attgagagtgacac--aggta-taa
B D               Orangutan  actacatcaagtactttatt-g------ga---aaaa--------attgagagggaaac--aggta-taa
B D                  Gibbon  actacatcaagtactttatt-g------ga---aaaa--------att----gtgacac--aggta-taa
B D                  Rhesus  attacatcatgttctttatt-g------ga---aaca--------attgagagtgacac--aggta-taa
B D     Crab-eating macaque  attacatcatgttctttatt-g------ga---aaca--------attgagagtgacac--aggta-taa
B D                  Baboon  attacatcatgttctttatt-g------ga---aaca--------attgagagtgacac--aggta-tca
B D            Green monkey  attacatcatgttctttatt-g------ga---aaca--------attgagagtgacac--aggta-taa
B D                Marmoset  acttcatcaagtggttgatt-g------ga---gaaa--------atggagagtgacac--a-gta-taa
B D         Squirrel monkey  acttcatcaagtactttatt-g------ga---aaaa--------attgagagtgacac--a-gta-taa
B D                Bushbaby  accagaccaagcactttatt-g------gg---gaaa--------attgggagcttcac--aggt----a
         Chinese tree shrew  attaaatgaagcactttatt-c------ag---aaaa--------attgggagctacac--aggtt-tgc
B D                Squirrel  atgaaaccaagcactttatt-gaaaaaaaa---aaaa--------attgggagctgcac--agggg-caa
     Lesser Egyptian jerboa  actaaaacaagttctttatt-g------ag---agaa--------atagggagcgaggc--aggaa-tga
               Prairie vole  gtgaagcc-aatactttact-g------aa---taaa--------gttgaaggctacac--ggatg-taa
B D         Chinese hamster  gtgaagccaaatactttact-g------aa---tgaa--------gttgagaacgacat--ggaaa-taa
B D                   Mouse  gtgaagccaaagactttact-g------aa---cgaa--------gttgagagctacat--ggaag-taa
B D                     Rat  gcgaagtcaaatactttact-g------aa---ccaa--------gctgagagctacat--ggaaa-caa
B D          Naked mole-rat  actaaaccaagtactttatt-g------ga---aata--------aatggaagcttcag--aggga-taa
B D              Guinea pig  actaaatcaagcagtttatt-g-----aaa---aaaa--------aataggagcttcag--aggga-taa
                 Chinchilla  actaaatcaagtactttatt-g------ga---aaaa--------aataggagcttctg--agcga-caa
B D                  Rabbit  actaag-caagaactttatt-g------gg---ggaa--------attgggctatacag--agaga-cag
B D                    Pika  gctaagccaagaactttatt-t------gg---gggagggaggggattggggcatgcac--aggga-caa
B D                     Pig  actaaacagagcactttatt-g------gg--gaaaa--------agagggagctatgc--aggtattaa
B D                  Alpaca  actaaacaaagtgctttatt-a------gggggcaaa--------agggggagcttcacctaggta-taa
             Bactrian camel  actaaacaaagtgctttatt-a------gggggaaaa--------aaggggaactccacccaggta-taa
           Tibetan antelope  actaaataaagtgctttatt-g------gg----aaa--------aatgagagcttcac--ag------a
B D                     Cow  actaaataaagtgctttatt-g------gg----gaa--------aatgagagcttcac--agata-taa
B D                   Sheep  actaaattaagtgctttatt-g------gg----aaa--------aatgagagcttcac--ag------a
              Domestic goat  actaaattaagtgctttatt-g------gg----aaa--------aatgagagcttcac--ag------a
B D                   Horse  ggtaaacaga-cactttatt-g------gg---aaaa--------attggaagctacat--aggta-taa
B D        White rhinoceros  actaaataga-tactttatt-g------gg---aaaa--------attgggagctacac--aggta-aaa
B D                     Cat  actacacaaagtactttatt-g------gg---gtaa--------attgggagctatg------------
B D                     Dog  actaaacagaat-cttaatt-g------gg---gaaa--------actggg-------------------
B D                 Ferret   actaaacagcatactttatt-g------gg---gaaa--------actgggacatatgc--aggta-tag
B D                   Panda  actaaacagagtactttatt-g------gg---gaaa--------actgggagctatgc--aggta-tac
             Pacific walrus  actaaacagagtaatttatt-g------gg---gaaa--------cctgggagctatgc--aggta-tag
               Weddell seal  actaaacagagtactttatt-g------gg---gaaa--------cctgggagctatgc--aggta-tag
           Black flying-fox  gccaaacagagtactttatt-g------ag---aaaa--------attggtagctacac--aggta-taa
B D                 Megabat  gccaaacagagtactttatt-g------ag---aaaa--------attgggagctacac--aggta-taa
              Big brown bat  atcaaatagagtactttatt-g------gg---gaaa--------attgggagctacat--aggta-taa
       David's myotis (bat)  atcaaac--agtattttatt-g------gg---aaaa--------aatgggagctacat--aggta-taa
B D                Microbat  atcaaac--agtattttatt-g------gg---aaaa--------attgggagctacat--aggta-taa
B D                Hedgehog  aatagacagaaggctttatt-g------gc---agaa--------aataggagcaacat--agttg-taa
B D                Elephant  tctcaacaaagcactttatt-g------gg---aaaa--------actgggagttacac--agggg-taa
        Cape elephant shrew  actgagtgtggcactttatt-g------gg---taaa--------acagggagtgacac--aggga-taa
B D                 Manatee  actcaacaaagcactttact-g------gg---aaaa--------attggaagttacac--agcaa-taa
           Cape golden mole  actaagaagagcactttattgg------gg---aaaa--------attgggagctgcac--agaga-t-a
                   Aardvark  gctaaac--agcattttatt-g------gg---aaaa--------cttaagagctacac--agtga-taa
B D               Armadillo  acgaaat--agcactttatt-g------ga---gaaa--------atcgggcgctacat--gagta-taa
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
            Golden hamster  ----------------------------------------------------------------------
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  act-gggagtt
                      Chimp  act-gggagtt
                    Gorilla  act-gggagtt
                  Orangutan  act-gggagct
                     Gibbon  act-gggagct
                     Rhesus  gct-gggagct
        Crab-eating macaque  act-gggagct
                     Baboon  act-gggagct
               Green monkey  act-gggagct
                   Marmoset  act-gggagct
            Squirrel monkey  act-gggagct
                   Bushbaby  ata-gggagtt
         Chinese tree shrew  acc-aggagct
                   Squirrel  aca-gggattt
     Lesser Egyptian jerboa  gca-gg-agct
               Prairie vole  aca-gggagtt
            Chinese hamster  aca-ggaagcc
                      Mouse  act-gggagct
                        Rat  act-gggagct
             Naked mole-rat  cca-gggaact
                 Guinea pig  cca-aggaact
                 Chinchilla  cca-gggaa--
                     Rabbit  tgg-gggagct
                       Pika  tga-gctggct
                        Pig  aca-agggatt
                     Alpaca  gca-aggggtt
             Bactrian camel  gca-aggggtt
           Tibetan antelope  aca-agcagtt
                        Cow  aca-agcagct
                      Sheep  aca-agcagtt
              Domestic goat  aca-agcagtt
                      Horse  ata-gggggct
           White rhinoceros  aca-ggg----
                        Cat  -ca-gggggct
                        Dog  -------ggct
                    Ferret   aca-gggggtt
                      Panda  aca-gggggct
             Pacific walrus  aca-ggaggct
               Weddell seal  aca-ggaggct
           Black flying-fox  aca-gggggct
                    Megabat  aca-gggggct
              Big brown bat  aca-ggggttg
       David's myotis (bat)  aca-gggggtg
                   Microbat  aca-gggggtg
                   Hedgehog  aga-gggga-t
                   Elephant  ata-ggggct-
        Cape elephant shrew  ata-agtgca-
                    Manatee  ata-ggggct-
           Cape golden mole  aca-ggggcc-
                   Aardvark  ata-ggggcc-
                  Armadillo  atagggggta-
            Green seaturtle  ===========
             Painted turtle  ===========
             Golden hamster  -----------
                    Wallaby  ===========
            Star-nosed mole  -----------
           Brush-tailed rat  ===========
                     Tenrec  ===========
                    Dolphin  ===========

Inserts between block 1 and 2 in window
              Prairie vole 82bp

Alignment block 2 of 201 in window, 45541904 - 45541966, 63 bps 
B D                   Human  ctagaagttggagataa-----ag-----gg----gaca--------taaa-gatgaaatc--aaaacgg
B D                   Chimp  ccagaagttggagataa-----ag-----gg----gacc--------taaa-gatgaaatc--aaaacgg
B D                 Gorilla  ctagacgttggagataa-----ag-----gg----ggca--------taaa-gatgaaatc--aaaacgg
B D               Orangutan  ctagaagttggagataa-----ag-----gg----gaca--------taaa-gatgaaatc--aaaacag
B D                  Gibbon  ctagaagttggagataa-----ag-----gc----gaca--------taac-gatgaaatc--aaaacgg
B D                  Rhesus  ctagaagttggagataa-----ag-----gg----gaca--------taaa-gatgaaatc--aaaacgg
B D     Crab-eating macaque  ctagaagttggagataa-----ag-----gg----gaca--------taaa-gatgaaatc--aaaacgg
B D                  Baboon  ctagaagttggagataa-----ag-----gg----gaca--------taaa-gatgaaatc--aaaacgg
B D            Green monkey  ctagaagttggagataa-----tg-----gg----gaca--------taaa-gatgaaatc--aaaacgg
B D                Marmoset  ctagaagttggagataa-----ag-----gg----ggca--------taaa-gatgaaatc--aaaccag
B D         Squirrel monkey  ctagaggccggagataa-----ag-----gg----gaca--------taag-aatgaaatc--aaaacag
B D                Bushbaby  ctagaagtgagagataa-----gg-----ggatcaggca--------caag-gatgggata--aaaatgg
         Chinese tree shrew  ccagaactcagagttaa-----ca-----gaatgagaca--------taaa-aatgagatc--caaatgg
B D                Squirrel  ctggaagttagagatgatgggggt-----ga----ggcagag-atg----------gaatc--cacgagg
     Lesser Egyptian jerboa  ctggacattggacctga-----gc-----aa----gtgaggg-atgttaga-gttggaatc--c--atag
B D         Chinese hamster  cctgacggtggagctga-----gc-----cg----gggaggc-atggttag-tgatggttc--ctaagag
B D                   Mouse  tttgacggtggtgctga-----gcagctgag----gctagtg-atgg---------ggacc--ccaagag
B D                     Rat  tttgacggaggagctga-----gc-----ag----ggtag-----------------------ctaaggg
B D          Naked mole-rat  ctggaagagggagatga-----ag-----gg----gtgagca-tacataga-agcaagatc--caaacag
B D              Guinea pig  ctggaagatggagatgc-----ca-----gg----gtgagca-tacacaga-gatgagatc--caaacag
                 Chinchilla  ctagaagatggagatgc-----ag-----gg----gtgagca-cgcataga-gatgaaatc--caaacag
B D                  Rabbit  ca-------ggagataa-----gg-----gg----gtgaagc-gca--------tggaatc--cgactgg
B D                    Pika  cagaaagtgggagacaa-----ag-----gg----gcgaggc-aca---ga-gcgagagtc--ccagtgg
B D                     Pig  ctagaagttaggcataa-----ag-----aa----aagaggc-a---tgaa-gatgggatc--aaaccag
B D                  Alpaca  ctagaatttggacagaa-----ag-----ga----aagaagc-a---taga-gatgggatc--aaaacag
             Bactrian camel  ctagaatttggacagaa-----ag-----ga----aagaagc-a---taga-gatgggatc--aaaacag
           Tibetan antelope  ctagaagttggacataa-----ag-----gt----aagaagc-a---taga-gatgggatc--aaaagag
B D                     Cow  ctagaagttgtacataa-----ag-----at----aagaagc-a---taga-gatgggatc--aaaagag
B D                   Sheep  ctagaagttggacataa-----ag-----at----aagaagc-a---taga-gatgggatc--aaaagag
              Domestic goat  ctagaagttggacataa-----ag-----gt----aagaagc-a---taga-gatgggatc--aaaagag
B D                   Horse  ctagaagttggacataa-----aa-----ta----agaaggc-g---taga-gatgggttc--aaaacaa
B D        White rhinoceros  ---aaagttgtacataa-----aa-----ga----aggaggc-a---taga-gatgggatc--aaaac--
B D                     Cat  ctagacattggacataa-----ag-----aa----aagaagc-a---taga-gatggg-cc--aaaacag
B D                     Dog  ctagacatcggacataa-----ag-----ga----aagaagc-a---tagg-gatgggatc--aaaagag
B D                 Ferret   ctagacattggacatat-----ag-----ga----aagaagc-a---tagg-gatggaattaaaaaaaaa
B D                   Panda  gtagacatccaacataa-----ag-----ga----aagaagc-a---taga-gatgggatc--aaaagag
             Pacific walrus  ctagacatcagacatga-----ag-----ga----aagaagc-a---taga-gatgggatc--aaaagag
               Weddell seal  ctagacatcagacataa-----ag-----ga----aagaagc-a---taga-gatgagatc--aaaagag
           Black flying-fox  ccagaagttgaacataa-----aa-----ga----aggaggc-a---tagg-gatggcatc--aaaacag
B D                 Megabat  ccagaagtcgaacataa-----aa-----ga----aggaggc-a---taga-gatggcatc--aaaacag
              Big brown bat  ctggaagttggatgg--------------------------------taga-aatggaatc--aaaacat
       David's myotis (bat)  ctagaagttggactt--------------------------------taga-aatgggagc--aaaacag
B D                Microbat  ctagaagttggactt--------------------------------taga-aatgggatc--aaaacag
B D                Hedgehog  ctagaagttaaatataa-----ag-----ga----agg---------tatatgagagtatc--aaagcaa
B D                Elephant  ctgaaagttagagatta-----aa-----aa----gcaaggc-a---taga-gaaggggtt--gcaaggg
        Cape elephant shrew  taaaaagttggaagtaa-----ag-----gg----atgaggt-g---taga-gaaggggtc--tcaaggg
B D                 Manatee  ctgaaagttggagatta-----ag-----aa----gcgaggc-a---taga-gaaagggtc--acaagga
           Cape golden mole  cagaaagttgaataaaa-----ag-----ga----attaggc-a---taga-gaagggacc--acaaggg
                   Aardvark  ctgaaagttagagataa-----ag-----ga----gtgaggcaa---taga-gaagtggtc--acaaggg
B D               Armadillo  catgaagttggagataa-----aa-----gg----gtaaggc----------------------------
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
            Golden hamster  ----------------------------------------------------------------------
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
              Prairie vole  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  a------tggatattgtgcatcaa
                      Chimp  a------tggatattgtgcatcaa
                    Gorilla  g------tggatattgtgcatcaa
                  Orangutan  a------aggatattgtgcatcaa
                     Gibbon  a------aggatattgtgcatcaa
                     Rhesus  a------aggatattgtgcatcaa
        Crab-eating macaque  a------aggatattgtgcatcaa
                     Baboon  a------aggatattgtgcatcaa
               Green monkey  a------aggatattgtgcatcaa
                   Marmoset  a------aggatactgtgcatcaa
            Squirrel monkey  a------cggatattgtgcatcaa
                   Bushbaby  a------agaatgttaggcatgaa
         Chinese tree shrew  a------agaat-----gtaagaa
                   Squirrel  a------agg-tatcatgcataaa
     Lesser Egyptian jerboa  c------cga-cattaggcatcca
            Chinese hamster  g------agg-tattatg------
                      Mouse  g------agg-tgttatggatagc
                        Rat  t------agg-agttaggaatagg
             Naked mole-rat  a------aga-aattatgtacgac
                 Guinea pig  a------aga-taccatgcatgaa
                 Chinchilla  a------aga-tgctctgcatgaa
                     Rabbit  a------agg--gttgtgcgtgaa
                       Pika  c------agg-tgttgtacatgaa
                        Pig  gatatacaggatattctgtctaaa
                     Alpaca  a------gggatgttatgtcaaaa
             Bactrian camel  a------gggatgttatgtcgaaa
           Tibetan antelope  a------aaga--ttatgtttaaa
                        Cow  a------aaga--ttatgtctaaa
                      Sheep  a------aaga--ttatgtctaaa
              Domestic goat  a------aaga--ttatgtctaaa
                      Horse  a------aggatattatgtctgaa
           White rhinoceros  a------aggatattatgtctgaa
                        Cat  a------atgataccatgttt---
                        Dog  a------attataccatgtttgaa
                    Ferret   a------atgggaccatgtgtgaa
                      Panda  a------atgataccatgtgtaaa
             Pacific walrus  a------atgataccatgtgtgaa
               Weddell seal  a------atgataccatgtgtgaa
           Black flying-fox  g------ctgatattgtgtatgaa
                    Megabat  g------ctgatattgtgtatgaa
              Big brown bat  ---------gatattttatatgaa
       David's myotis (bat)  ---------gatattttatatgaa
                   Microbat  ---------gatattttatatgaa
                   Hedgehog  c------aagatattgtgtctgaa
                   Elephant  a------aga-tgctatgtctgaa
        Cape elephant shrew  a------agg-tactgtgtctgaa
                    Manatee  a------aaa-tattatgtctgaa
           Cape golden mole  g------aga-tactatgtctgaa
                   Aardvark  a------aaa-tattaagtctgaa
                  Armadillo  ---------a-tattatgtctgaa
            Green seaturtle  ========================
             Painted turtle  ========================
             Golden hamster  ------------------------
                    Wallaby  ========================
            Star-nosed mole  ------------------------
           Brush-tailed rat  ========================
                     Tenrec  ========================
               Prairie vole  ========================
                    Dolphin  ========================

Inserts between block 2 and 3 in window
B D        Chinese hamster 3bp

Alignment block 3 of 201 in window, 45541967 - 45541977, 11 bps 
B D                   Human  aagagccaaa--------g
B D                   Chimp  aagagcccaa--------g
B D                 Gorilla  aagaaccaaa--------g
B D               Orangutan  aagagccaaa--------g
B D                  Gibbon  aagagccaaa--------g
B D                  Rhesus  aagagccaaa--------g
B D     Crab-eating macaque  aagagccaaa--------g
B D                  Baboon  aagagccaaa--------g
B D            Green monkey  aagagccaaa--------g
B D                Marmoset  aagaggc--a--------g
B D         Squirrel monkey  aagaggccaa--------g
B D                Bushbaby  aagatgaaaa--------g
         Chinese tree shrew  aagaggtggc--------g
B D                Squirrel  ----aacaggtggccacag
     Lesser Egyptian jerboa  -agaagtaga--------g
               Prairie vole  -agggactgg--------a
B D         Chinese hamster  -aggaactgg--------a
B D                   Mouse  ----aactgg--------c
B D                     Rat  ----aactgg--------c
B D          Naked mole-rat  aagaagtggg--------g
B D              Guinea pig  aagaggtggg--------c
                 Chinchilla  aagaggtggg--------g
B D                  Rabbit  aagcggcagc--------t
B D                    Pika  aagagactga--------g
B D                     Pig  aagaggctga--------g
B D                  Alpaca  aagaggctga--------g
             Bactrian camel  aagaggctga--------g
           Tibetan antelope  aagaggctga--------g
B D                     Cow  aagaggctga--------g
B D                   Sheep  aagaggctga--------g
              Domestic goat  aagaggctga--------g
B D                   Horse  aagaggctga--------g
B D        White rhinoceros  aagaggctga--------g
B D                     Cat  aagagtctga--------g
B D                     Dog  aagaggctga--------g
B D                 Ferret   aagaggctga--------g
B D                   Panda  aagaggctga--------g
             Pacific walrus  acgaggctga--------g
               Weddell seal  aagaggctga--------g
           Black flying-fox  aggaggctga--------g
B D                 Megabat  aggaggctga--------g
              Big brown bat  aagaggctaa--------a
       David's myotis (bat)  aagagactga--------a
B D                Microbat  aagagactga--------a
B D                Hedgehog  a------------------
B D                Elephant  aagaggctga--------g
        Cape elephant shrew  aagaggctga--------g
B D                 Manatee  aagaggctga--------g
           Cape golden mole  aagaggctga--------a
                   Aardvark  aagtggctga--------g
B D               Armadillo  aagagg-taa--------g
  D         Green seaturtle  ===================
  D          Painted turtle  ===================
            Golden hamster  -------------------
B D                 Wallaby  ===================
           Star-nosed mole  -------------------
          Brush-tailed rat  ===================
B D                  Tenrec  ===================
B D                 Dolphin  ===================

Alignment block 4 of 201 in window, 45541978 - 45542243, 266 bps 
B D                   Human  atgga-ggaagagg-a-gg--t-----agatgcaagcgttc----tgt-tc-tgggaagggctaa-----
B D                   Chimp  atgga-ggaagagg-a-gg--t-----agatgcaagcattc----tgt-tc-tgggaagggctaa-----
B D                 Gorilla  atgga-ggaagaag-a-gg--t-----agaagcaagcgttc----tgt-tc-tgggaagggctaa-----
B D               Orangutan  atgga-ggaagagg-a-gg--t-----agatgcgagggttc----tgt-tt-tgggaagggctaa-----
B D                  Gibbon  atgga-ggaagagg-a-gg--t-----agatgcaagggttc----tgt-tt-tgggaagggctaa-----
B D                  Rhesus  atgga-ggaaaagg-a-gg--g-----agatgcaagggttc----tgt-tt-ggcgaagggctaa-----
B D     Crab-eating macaque  atgaa-ggaaaagg-a-gg--g-----agatgcaagggttc----tgt-tt-ggcgaagggctaa-----
B D                  Baboon  atgaa-ggaaaagg-a-gg--g-----agatgcaagggttc----tgt-tt-ggcgaagggctaa-----
B D            Green monkey  atgga-ggaaaagg-a-gg--g-----agatgcaagggttc----tgt-tt-ggcgaagggctaa-----
B D                Marmoset  actgg-ggaagagg-a-gg--t-----aggtgcagggcttc----tgt-tt-caggaaaggctca-----
B D         Squirrel monkey  actgg-ggaagagg-a-gg--t-----ggatgcaggcgttc----tgt-tt-tgggaaaggctag-----
B D                Bushbaby  atggg-gcaaagtg-a-ag--c-----agatcctgtggttc----agc-tt-tgagaagagctac-----
         Chinese tree shrew  ttgga-agaagggg-a-ga--c-----agatgt-ggagttc----agt-tt-ggagaagagctga-----
B D                Squirrel  aggaa-gagggagg-a-gg--c-----agatcctggggttc----aca-gt-tgggaagctctaa-----
     Lesser Egyptian jerboa  atgga-taaagggg-a-gg--c-----aggtccagggattc----act-gc-tgcgatgggctga-----
               Prairie vole  gatgg-gggagggg-a-gg--c-----a--tcctggggttc----aat-gc-tgggaggacctaa-----
B D         Chinese hamster  tggat-gggaaggg-atgg--c-----a--ttctgggattc----aat-gt-tgggaggacctaaggcct
B D                   Mouse  atggt-gggagggg-a-gg--t-----a--tcctaggaccc----cacaac-tgggaagactcaa-----
B D                     Rat  cgagt-gggcgggg-a-gg--c-----a--tcctagaatcc----agtaac-tgggaagacccaa-----
B D          Naked mole-rat  atgaa-gtaaagga-a-gg--c-----aggtctgagggttc----act-gc-tgagaacagccaa--act
B D              Guinea pig  gtgga-ggaaaggg-a-gg--c-----aggtcctagggttc----act-gt-tgagaaaagccga--act
                 Chinchilla  atgaa-ggagaggg-a-gg--c-----a-gtcctagagttc----act-gt-tgggaagagccat--act
B D                  Rabbit  atggc-agagaggg-a-gg--a-----ggagcctggggttt----ggt-tt-tgggaagagcaaa-----
B D                    Pika  atgg--ggggaggc-g-ga--c-----agtgcctggggttt----ggt-tt-ggggaagagagaa-----
B D                     Pig  atgga-ggaagtga-a-gattc-----agatcctgggattc----agt-tt-agggaagagttga-----
B D                  Alpaca  atgga-ggaagtgg-a-ga--c-----agatcctggggttc----agt-tt-tgtgaggagctga-----
             Bactrian camel  atgga-ggaagtgg-a-ga--c-----agatcctggggttc----agt-tt-tgtgaggagctga-----
           Tibetan antelope  atgga-gaaagggg-a-ga--c-----aggcaccaagatgc----agt-tt-agggaagctctca-----
B D                     Cow  atgga-gaaagggg-a-ga--c-----aggcaccaggattc----agt-tt-aggggagctctaa-----
B D                   Sheep  atgga-gaaagggg-a-ga--c-----aggcaccaggattc----agt-tt-agggacgctctca-----
              Domestic goat  atgga-gaaagggg-a-ga--c-----aggcaccaggattc----agt-tt-agggaagctctca-----
B D                   Horse  atgga-ggaaggggga-gg--c-----agatcccggagttc----cat-tt-ttggaagagctta-----
B D        White rhinoceros  aggga-ggaaggggga-gg--t-----ggatcccagagttc----agt-ct-tgggaagaggtaa-----
B D                     Cat  ataga-ggaaggcgaa-tg--c-----agatcctggggctc----cgt-aa-ggggaagagctga-----
B D                     Dog  atagg-gaaagaggaa-tg--c-----agaaaccaaggttc----tgt-ttgggggaaaacctgg-----
B D                 Ferret   gtaga-gaaaggggaa-tg--c-----agatcccagaactc----tgc-ct-ggagaagagctga-----
B D                   Panda  ctaga-gaaaggggaa-tg--c-----acttcccggggctc----tct-ct-ggggaagaaccaa-----
             Pacific walrus  ctaga-gaaaggggaa-tg--c-----agatcccagggctc----tgt-tt-gcagaagagctga-----
               Weddell seal  ctaga-gaaaggggaa-tg--c-----agatcccagggctc----tgt-tt-ggggaagagctga-----
           Black flying-fox  aagg--ggaaagggga-gg--c-----agaccctggcgttc----agt-tt-ggggaagggctga-----
B D                 Megabat  aagg--ggaaagggga-gg--c-----agaccctggggttc----agt-tt-ggggaagggctga-----
              Big brown bat  atgga-agaaggggga-ag--c-----agattcaggggttc----agt-ct-tgggaagggctaa-----
       David's myotis (bat)  acgga-agaagggggg-ag--c-----agatccaggggttt----agt-ct-tgggaagggctaa-----
B D                Microbat  acgga-agaaggggga-ag--c-----agatccaggggttt----agt-ct-tgggaagggctaa-----
B D                Hedgehog  atgaa-aggagggaca-gg--t--------tgcaggggttc----agc-tt-ttagcagagctaa-----
B D                   Shrew  atgaagaagaaagagg-ga--t--------tcccagggttc----agc-ct-ggagaagagcttt-----
B D                Elephant  ctggg-ggaggggg-a-gg--c-----agatgcctgggttt----agc-tt-tgagaagagcc-a-----
        Cape elephant shrew  ctgga-gaacaggg-a-gg--t-----agatgtcaagttca----gtt-tt-tttgaagagct-g-----
B D                 Manatee  ctgga-ggaggggg-a-ag--c-----agatgccagggttc----agt-tt-tgagaagagcc-a-----
           Cape golden mole  ctgga-g---agag-a-gg--c-----agttgccaaggctctgaaagt-tt-ttggaaacggc-a-----
                   Aardvark  ctgga-ggaaaggg-a-gg--c-----agatgtctgggctc----agt-tt-ttggaagagcc-a-----
B D               Armadillo  ctgga-ggcagggg-a-ga--aaccagagatcctgggtttc----agt-at-ttggaacagccaa-----
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
            Golden hamster  ----------------------------------------------------------------------
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  gatcttggaatgctga-g----agt----gaaac--tgga-agccagtctg--gagcatcc----gtcag
                      Chimp  gatcttggaatgctga-g----agt----gaaac--tgga-agccagtctg--gagcatca----gtcag
                    Gorilla  gatcttggaatgctga-c----agt----gaaac--tgga-agccagtctg--gagcatca----gtcag
                  Orangutan  gatcttggaatgctga-g----agt----gaaac--tgga-agccaatctg--gagcatca----gtcag
                     Gibbon  gatcttggaatgctga-g----agt----gaaac--tgga-agccaatctg--gagcatca----atcag
                     Rhesus  gatgttggaatgctgc-g----agt----gaaac--tgga-agtcaatctg--gagcatca----gtcaa
        Crab-eating macaque  gatcttggaatgctgc-g----agt----gaaac--tgga-agtcaatctg--gagcatca----gtcaa
                     Baboon  gatcttggaatgctgc-g----agt----gaaac--tgga-agtcaatctg--gagcatca----gtcaa
               Green monkey  gattttggaatgctgc-g----agt----gaaac--tgga-agtcaatatg--gagcatca----gtcaa
                   Marmoset  gatctcggaatgctga-g----agt----gaaac--tgga-agttaatcta--gagcatca----gtcag
            Squirrel monkey  gatctcggaatgctga-g----agt----gaaac--tgga-agtcaattta--gagcatca----gtcag
                   Bushbaby  agccttggaacgctga-g----agt----ggaactatgga-agccacacca--gaacatcg----gtcag
         Chinese tree shrew  ggccttgggacactgt-g----agc----agaacagtgcg-agccaagccg--gagcatcagtcggtcgg
                   Squirrel  ggccttgcagccctga-gctgagga----gaa-cagtggg-ggtcaacctg--gagcatct------cag
     Lesser Egyptian jerboa  ggccttgcagagctgg-g----agg----ggt-cgctggg-agccagcgtg--gagca--c----ggcag
               Prairie vole  tgccttggagtgcctg-g----agc----agt-caccaga-aaccactctg--gaggagac----agcag
            Chinese hamster  tgccttggaatattga-g----agc----agt-caccaga-agccattctg--gagaatcc----agtgg
                      Mouse  ggtcttgcagtgctca-a----agt----gct-ctccaga-agccagtctg--gagcacac----agcag
                        Rat  ggccttggagtgct----------------------caga-cgccagcctg--gagcatcc----agcag
             Naked mole-rat  tttcttggagtgctag-g----agt----ggagcagtaaa-agcccatctg--gatcatca----gtcaa
                 Guinea pig  cttcttggagcgctgg-g----att----gggacagggga-cgcccacttg--gagcctca----gtcag
                 Chinchilla  cttcttagagtgctgg-g----agt----ggagcagcgga-agcccacctg--gagcctca----gtcag
                     Rabbit  ggccttgggccgcgga-g----agt----ggagccccgga-agtcaacctg--tcgcatcg----gtcag
                       Pika  ggtcttggg-cgcaga-g----tgt----ggaacagctga-catcgaccta--ttgcatcc----gtcag
                        Pig  gatcttgggatgctgg-g----agt----ggaccggagga-agccagcctg--gagcatct----gtcag
                     Alpaca  ggccttggaacgctgg-g----agt----ggatgagtgga-agccagcctg--gagcatct----gtcag
             Bactrian camel  ggccttggaatgctgg-g----agt----ggacgagtgga-agccagcctg--gagcatct----gtcag
           Tibetan antelope  ggccttggaacactgg-a----agt----agaacagtgga-agccagcctg--gatcgtct----g-cag
                        Cow  ggccttggaacactgg-a----agt----ggaacagtgga-agccagcctg--gatcatct----g-cag
                      Sheep  ggccttggaacactgg-a----agt----agaagagtgga-agccagcctg--gatcgtct----g-cag
              Domestic goat  ggccttggaacactgg-a----agt----agaacagtgga-agccagcctg--gatcgtct----g-cag
                      Horse  ggccttggaacgctga-g----agt----gggacagtgga-agccaaccag--gagcatcg----gtcag
           White rhinoceros  ggccttggaccgctga-g----agt----ggaacagggga-agccaacctg--gaacgtcg----ctcgg
                        Cat  ggtcttggaatgt--gag----agt----agaacagtgga-aaccagcgtg--gaccattg----gtcag
                        Dog  ggccttggaatgt--a-g----act----ggaacagtgga-acccaacgtg--gagaatca----gccag
                    Ferret   gcccttggaatgt--g-g----aat----tcaagagtggagcatcaatatg--gagcatca----gtcgg
                      Panda  gcccttggaatgt--g-g----agt----ggaagagtgga-agccaacatg--gagcatcg----gtcag
             Pacific walrus  gcccttggaatgt--g-g----agt----ggaagagtgga-cgccaacgtg--aagcatca----gtcag
               Weddell seal  gcccttggaatgt--g-g----agt----ggaagagtgga-cgccaacgtg--gagcatcg----gtcag
           Black flying-fox  ggccttgacatgctgg-g----agt----ggagcagtgga-aaccacccta--cagcatct----gtcgg
                    Megabat  ggccttgaaatgctgg-g----agt----ggagcagtgga-aaccacccta--cagcatct----gtcgg
              Big brown bat  ggccttggaatgctgg-g----agt----ggagcagagga-agccaacttg--gagtgccg----atcag
       David's myotis (bat)  ggccttggaatgctgg-g----agt----ggaatagagga-agccaacttg--gagtgcca----atcgg
                   Microbat  ggccttggaatgctgg-g----agt----ggaacagagga-agccaacttg--gagtgccg----atggg
                   Hedgehog  ggcctcagaacgctgg-a----agc-------------ca-ggccaggtct--tca----a----gccag
                      Shrew  ggtcttgggatgctgg-g----cac----ggaagagcaaa-ggccagcttg--gcacatca----gccaa
                   Elephant  ggcctcaaa-----------------------------ga-tgccatcttt--gagcatca----gtcag
        Cape elephant shrew  gaccttggaaaac--a-g----agt----agaatggtgga-agccaactcc--aaacatca----gtcag
                    Manatee  ggccttggaaagctga-g----agt----ggaacagtaga-cgccatcttt--gagcagca----gtcag
           Cape golden mole  ggccttgaaaagctga-g----cga----ggaacaatgga-agccaacttt--gagcatca----gtcag
                   Aardvark  cgtcttggaaagcaga-g----catggaaggaacagtgga-agccaacgtt--gagcatca-----tcag
                  Armadillo  ggacctggaaagctga-g----aat----ggaatggtaga-agccaacttttagagcatta----gtcag
            Green seaturtle  ======================================================================
             Painted turtle  ======================================================================
             Golden hamster  ----------------------------------------------------------------------
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
           Brush-tailed rat  ======================================================================
                     Tenrec  ======================================================================
                    Dolphin  ======================================================================

                      Human  gtacagg----a--ac--a-gt-actcagagcatgagccacattctggcagttcttcc-----------a
                      Chimp  gtacagg----a--ac--a-gt-actcagagcatgagccacattctggcagttcttcc-----------a
                    Gorilla  gtacagg----a--ac--a-gt-cctcagagcatgagccacattctggcagttcttcc-----------a
                  Orangutan  gtacaca----a--ac--a-gt-cctcagagcatgagccacattctggcagctcttcc-----------a
                     Gibbon  ggacacg----a--ac--a-gt-cctcagagcatgagccacattctggtggctcttcc-----------a
                     Rhesus  gtacacg----a--ac--a-gt-cctcagagcatgagccacactctggtagttcttcc-----------a
        Crab-eating macaque  gtacacg----a--ac--a-gt-cctcagagcatgagccacactctggtagttcttcc-----------a
                     Baboon  gtacacg----a--ac--a-gt-cctcagagcatgagccacactctggtagttcttcc-----------a
               Green monkey  gtacacg----a--ac--a-gt-cctcagagcatgagccacactctggtagttcttcc-----------a
                   Marmoset  gtacaca----g--ac--a-gt-cttcagagcatgagccacattctggtggttcttcc-----------a
            Squirrel monkey  atacacg----g--ac--a-gt-ccacagagcatgagccacattctggtggttcttcc-----------a
                   Bushbaby  gttcatg----g--ac--aggt-ccttggagcgtgagccaaatcctggtggttgtttc-----------t
         Chinese tree shrew  gtacaca----g--------ag-cctcagagcaggagccaaacaccg---gtcacttc-----------a
                   Squirrel  gtgcaca----g------a-g---cctggagctggagccaaatcctggcggttgtccc-----------c
     Lesser Egyptian jerboa  gggcagaggctg------a-g---cctggagcaggagcccagttgtggaggctctacc-----------a
               Prairie vole  gtataca----g------a-g---ctcggaacagaagtcaaatcctgatggttttcac-----------a
            Chinese hamster  atacaca----g------a-g---ctcggagcaggagcaaaatcctggtggttttccc-----------a
                      Mouse  gcacaca----g------a-g---cttggagcagaagccaaattctgatgattttccc-----------a
                        Rat  gtccata----g------a-g---cttggagcagaagccaaatcctgatgattttccc-----------a
             Naked mole-rat  gtgcaca----c------a-g---tcgggagcaggagccaaatcccagtggttgttcc-----------g
                 Guinea pig  atgcatg----c--ag--a-g---cctggagcaggagcccaatcccagaggttgtttc-----------a
                 Chinchilla  gtgcaca----c--ag--a-g---tgtggagcaggagccaaatcctggtggttgttcc-----------a
                     Rabbit  tttcata----g-cag--a-g---ccgggtgcctgggtcagatcctggtggctgctcc-----------c
                       Pika  tgtccca----gacag--a-g---cctggtgcgtgagtcacatcctggtggctgctcc-----------a
                        Pig  gcccatg----g--ac--a-gagttttggatcatgagccagatcctggtggttgttcc-----------a
                     Alpaca  gaacatg----g--ac--a-gagccttgaatcacgagccaaatcctggtggttgtttc-----------g
             Bactrian camel  gaacatg----g--ac--a-gagccttgaatcacgagccaaatcctggtggttgtttc-----------g
           Tibetan antelope  gcacatg----g--ac--a-gcgcttgg--tcataaactgaatcccagtggcggttgc-----------a
                        Cow  ccacatg----g--ac--a-gcgcttgg--tcataaactgaatcccggtggcagctgc-----------a
                      Sheep  gcacacg----g--ac--a-gcgcttgg--tcataaactgaatcccagtggcgattgc-----------a
              Domestic goat  gcacacg----g--ac--a-gcgcttgg--tcataaactgaatcccagtggcggttgc-----------a
                      Horse  gcacacg----g--ac--a-gagccttggctcatgagccgaatcctggttgttgttct-----------g
           White rhinoceros  gcacacg----g--ac--a-gagccttggctcatgatccaaatcctggcagttgttcc-----------g
                        Cat  gcacaca----g--ac--a-gagccttggatcatgagccaaatcctggtggttgttca-----------g
                        Dog  gtgcatg----g--ac--a-caacctcagatcacgagccacctcctggtggttgttca-----------g
                    Ferret   gagcacg----g--ac--a-gagccttgaatcacgagccaactcctggtggttgttca-----------g
                      Panda  gtgtatg----g--at--a-gagccttggatcgcgagccaactcctggtagttgttca-----------g
             Pacific walrus  gtgcatg----g--ac--a-gagctttggatcacgagccaactcctggcggttgttca-----------g
               Weddell seal  gtgcatg----g--ac--a-gagctttggatcacgagccaactcctggcggttgttca-----------g
           Black flying-fox  gcacaca----g--acaaa-gagccttggatc-caagccaaatcctggcggttgttct-----------g
                    Megabat  gcacaca----g--acaaa-gagccttggacc-caagccaaatcctggcggttgttct-----------g
              Big brown bat  gcacaca----g--ac--a-gagccttgagtcatgagccaaatcctggtgg-agttcc-----------g
       David's myotis (bat)  gcacacg----g--ac--a-gagccttgaatcatgagccaaatcctggtgg-tgttcc-----------a
                   Microbat  gcacaca----g--ac--a-gagccttgaatcatgagccaaatcttggtgg-tgttcc-----------a
                   Hedgehog  gcacatg----c--gc--a-gtgcatcag-----------------tgaggcagtcccacagttctccgg
                      Shrew  gcctaca----g--ac--a-gagcactggaccatgagccaaatcctggaggctgctcc-caggtatcctg
                   Elephant  gtgcatg----g--ag--a-aagccttgggttctcagccaaatcctgg--gttgttcc-----------a
        Cape elephant shrew  atgcaca----g--at--a-gagacttgagtcttcaaccaaatccttg--gtcattcc-----------a
                    Manatee  gcgcatg----g--ag--a-gagccttgggtcctcagccaaatcctgg--atcactcc-----------a
           Cape golden mole  gcgcac------------a-gagtctcgggtcctcagccagatcctgg--atagttcc-----------a
                   Aardvark  -cacata----g--ag--a-gagcattgggtcctcagtcaaatcctgg--gttgttcc-----------a
                  Armadillo  gcacac--------ac--a-cagctttggatcttgggccaaatcctggttgttgctcc-----------a
            Green seaturtle  ======================================================================
             Painted turtle  ======================================================================
             Golden hamster  ----------------------------------------------------------------------
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
           Brush-tailed rat  ======================================================================
                     Tenrec  ======================================================================
                    Dolphin  ======================================================================

                      Human  gtgcat----------------------cctt-atccaatca-ggga---a----ag---cctgc-agag
                      Chimp  gcgcat----------------------cctt-atccaatca-ggga---a----ag---cctgt-agag
                    Gorilla  gtgcat----------------------cctt-atccaatca-ggga---a----ag---cctgt-agag
                  Orangutan  gcacat----------------------cctt-atccaatca-ggga---a----ag---cctgt-tgag
                     Gibbon  gcacat----------------------cctt-atccaatca-ggga---a----ag---cctgt-agag
                     Rhesus  gcccat----------------------cctt-atccaatca-ggga---a----ag---cctgc-agag
        Crab-eating macaque  gcccat----------------------cctt-atccaatca-ggga---a----ag---cctgt-agag
                     Baboon  gcccat----------------------cctt-atccaatca-ggga---a----ag---cctgt-agag
               Green monkey  gcccat----------------------cctt-atccaatca-ggga---a----ag---cctgt-agag
                   Marmoset  gcgcat----------------------cttt-atccattca-ggga---a----ca---cctgt-agag
            Squirrel monkey  gtgcgt----------------------gctt-atccattca-ggga---a----tg---cctgt-caag
                   Bushbaby  gtttgt----------------------cctt-atccattca-gggagaga----ag---cctgt-tgag
         Chinese tree shrew  gggtgt----------------------cctt-atccattca-ggaa---g----aggcacctgc-tgtg
                   Squirrel  atgtat----------------------cttt-atccattca-ggaa---a-ccaag---cctgt-tg--
     Lesser Egyptian jerboa  gtgcgt----------------------cctt-ctccagtca-ggaa---g-agcca---cctga-aggg
               Prairie vole  gcatgt----------------------c----ctttcttca-gggg---g-aagag---cctgt-tgag
            Chinese hamster  gcatgc----------------------t----ctctgttca-gatc---g-aaggg---cctgc-tgag
                      Mouse  gcgtat----------------------c----ctctgttca-ggtg---a-gactg---cctgt-tgag
                        Rat  gcgggt----------------------c----ccccgttca-ggtg---g-aattg---cctgt-tgtg
             Naked mole-rat  gagtgtgaagagactctgcatgaagagactct-atcc-ttgt-gtga---a-gagac---tctgt-tgag
                 Guinea pig  ctgtgt----------------------cctt-atcc-ttga-gcga---a-gtgac---tctgt-tgag
                 Chinchilla  gtgtgt----------------------cctt-atcc-ttgc-gaga---a-gagat---cctgt-tgag
                     Rabbit  acgtat----------------------ctgc-gtccgcgca-ggag---ttaggag---cctgt-ggac
                       Pika  gcaagt----------------------c-----tccatgca-ggag---ctaggta---cctgc-ggag
                        Pig  gtgtat----------------------tctt-atgcattca-ggag---t-tagag---cctgt-tgag
                     Alpaca  gtatgt----------------------cctc-ata-attga-ggaa---t-tagag---cctgt-tgag
             Bactrian camel  gtatgt----------------------cctc-atgcattga-ggaa---t-tagag---cctgt-tgag
           Tibetan antelope  gtgtat----------------------catt-tcacattca-ggaa---t-tagag---cctgt-tgag
                        Cow  gtgtat----------------------cctt-tcacattca-cgaa---t-tagag---cctgt-tgag
                      Sheep  gtgtat----------------------catt-tcacattca-ggaa---t-tagag---cctgt-tgag
              Domestic goat  gtgtat----------------------catt-tcacattca-ggaa---t-tagag---cctgt-tgag
                      Horse  gtgtat----------------------cctt-atgcattca-ggga---a-gtaaa---cctgt-tgag
           White rhinoceros  gtgtat----------------------cctt-atgcattcg-ggga---a-tgaag---cctgt-tgag
                        Cat  gtacat----------------------ccttaatgcaatga-ggat---t-ataag---cctgg-agag
                        Dog  gtgcat----------------------cctt-atgcactga-ggaa---t-aggaa---cccgg-caag
                    Ferret   gtgcat----------------------cctt-atgcactga-tgat---t-tggag---cctgg-tgag
                      Panda  gtgcat----------------------cctt-atgcactga-cgat---t-aggaa---cctgg-tgag
             Pacific walrus  gtgcat----------------------cctt-atgcactga-cagt---t-aggag---cctgg-tgag
               Weddell seal  gtgcat----------------------cctt-atgcactga-cagt---t-aggag---cctgg-tgag
           Black flying-fox  gcgtat----------------------tctc-atgcatgtatagtc---t-ttaag---cctgt-tgag
                    Megabat  gcgtat----------------------tctc-atgcatgtatagtc---t-ttaag---cctgt-tgag
              Big brown bat  gttaat----------------------tcgt-atgcattca-ggat---t-agaag---cctgt-tgag
       David's myotis (bat)  gttaat----------------------ccat-atgcattca-ggat---t-agaag---cctgt-tgac
                   Microbat  gttaat----------------------ccgt-atgcattca-ggat---t-agaag---cctgt-tgac
                   Hedgehog  gtgtat----------------------cctc-atgctttca-cgaa---g-aggag---cctgt-tgaa
                      Shrew  atgtg------------------------ctc-ctggtgttg-agaa---g-ataag---atgag-acag
                   Elephant  gtgcat----------------------cctt-atcccttca-gaaa---g-aggag---cctaa-tgag
        Cape elephant shrew  atgcat----------------------cctt-atcctttcc-gaaa---g-gtaag---cctagttgag
                    Manatee  gtgcat----------------------cctt-atccctcca-gaac---g-gggag---cctat-tgag
           Cape golden mole  gagtat----------------------cttc-aaaccttca-aaaa---t-aggag---ctttt-agag
                   Aardvark  ttgcat----------------------cctt-acaccttca-gaaa---g-aggag---cctat-tgag
                  Armadillo  gtgaat----------------------cctt-atccattca-ggaa---g-aggaa---cctgt-tgag
            Green seaturtle  ======================================================================
             Painted turtle  ======================================================================
             Golden hamster  ----------------------------------------------------------------------
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
           Brush-tailed rat  ======================================================================
                     Tenrec  ======================================================================
                    Dolphin  ======================================================================

                      Human  aacgtaggac---agaaacagctgagca------tcttgggttcagctcatctttggag-----cttgaa
                      Chimp  aacgtaggac---agaaacagctgagca------tcttgggttcagctcatctttggag-----cttgaa
                    Gorilla  aacgtaggac---agaaacagctgagca------tcttgggttcagctcatctttggag-----cttgaa
                  Orangutan  aacgtaggac---agaaacagctgagca------tcttgggttcagctcatctttggag-----cttgaa
                     Gibbon  aacgtaggac---agaaagagctgagca------tcttgggttcagcttatctttggag-----cttgaa
                     Rhesus  aacgcaggac---agaaacaggtgagta------tcttgggttcagcttatctttggag-----cttgaa
        Crab-eating macaque  aacgcaggac---aaaaacaggtgagta------tcttgggttcagcttatctttggag-----cttgaa
                     Baboon  aacgtaggac---agaaacaggtgagta------tcttgggttcagcttatctttggag-----cttgaa
               Green monkey  aacgcaggac---aaaaacaggtgagta------tcttgggttcagcttatctttggag-----cttgaa
                   Marmoset  aacgtaggac---agaaacagttgagca------tcttgggttcagcttatctttggag-----gttgaa
            Squirrel monkey  aacataggac---agaaacagttgagca------tcttgggttcaacttatctttggag-----gttgaa
                   Bushbaby  aatataggat---aggccca-ctaaata------tcttgggctcagcttacctctggga-----cttgaa
         Chinese tree shrew  atagga-gac---aggactagctgagaa------ccttgggttcggctttgctttacaa-----cttgac
                   Squirrel  -----aggtaga-aaacgtagctgg---------------------------ctttgaa-----cttgag
     Lesser Egyptian jerboa  aatgtggggg-a-agatgtagctgagcg------tcttggccacagcttccctttgaag-----catgaa
               Prairie vole  aacacagataca-agatatagctgagaa------tcttgggctcagtttacctctggag-----cctg-a
            Chinese hamster  aacacagatgca-agatacagctgagaa------tcttagactcagtttaccgcaggag-----cctg-a
                      Mouse  aacacagagata-agacagagctgagca------tctcgggctgggtttgtttctggag-----cctgga
                        Rat  aacagagagata-agagatagccacaca------tcttgggcccggcttatttctggaa-----cctgaa
             Naked mole-rat  gacgtaagtgta-agatgaaactg--------------------------------gat-----tttgaa
                 Guinea pig  ggtggaggtaca-agattaaacca--------------------------------gct-----tttgaa
                 Chinchilla  gggataggtata-gaatgaaactg--------------------------------gct-----tttgaa
                     Rabbit  aacgctgtggtcaagataccgccgagcgtgtttctctta---ccagcctctcttcacag-----ctggga
                       Pika  aaggccatggtt-agatgtgactgggca------tctta---tcagcttctattaagag-----tttgaa
                        Pig  aatgaagaac---aggaccagctgagct------tcttgggctcagctcatcttcagaaccagtctggaa
                     Alpaca  aacgaaggac---aggaccagctgtgcg------tctcaggctcagcttatctccggaactagccttgaa
             Bactrian camel  aatgaaggac---aggaccagctgtgca------tctcaggctcagcttatctccggaactagccttgaa
           Tibetan antelope  aacagaggat---aggaccagctgagct------tctaggactcagcttattttccaaactaatcttgaa
                        Cow  aacggaggat---aggaccaactgagct------tctaggactcagcttattttccaaactaatcttgaa
                      Sheep  aacagaggat---aggaccagctgagct------tctaggactcagctttttttccaaactaatcttgaa
              Domestic goat  aacagaggat---aggaccagctgagct------tctaggactcagcttattttccaaactaatcttgaa
                      Horse  aatataggac---aggaccagttgagca------tcatgggctcagctaatctttggaactagcctagaa
           White rhinoceros  aatgtaggac---aggaccagctgagca------tcacaggctcaggttatctttggaactagtcttgaa
                        Cat  aatgtaggac---aggaccagttaagca-------cttgcgctcagcttatcttcagaacaagtcttgaa
                        Dog  aatgtaggat---gggacccactaagca------tcctgggctcagcttatcttcagtgtgagtcttgaa
                    Ferret   aatgtaggac---aagacctgctaaaca------tcttggattcagcttatcttcagagtgagtc-tgaa
                      Panda  aatataggac---aggacctgctaagca------ccttgggctcagcttatcttcagcgcgagtcttgga
             Pacific walrus  aatgtaggac---aggacccgctaagca------tcttgggctcagcttatcttcagagcgagtcttgaa
               Weddell seal  aatgtaggac---aggacccactaagca------tcttgggctcagcttatcttcagagcgagtcttgaa
           Black flying-fox  aatgtaagac---acgatcagctgaaca------tcttgagctcagctcatctgtggaactagtcttgaa
                    Megabat  aatgtaagac---acgatcagctgaaca------tcttgagctcagctcatctttggaactagtcttgaa
              Big brown bat  aatgtagacc---aagaccagctgagca------tcttg-----ggcttatcttcagaactagtcttgaa
       David's myotis (bat)  aatggggacc---aagaccagtcgagca------tcttg-----ggcttatcttcagaactagtcttgaa
                   Microbat  aatgtagacc---aagaccagctgagca------tcttg-----ggcttatcttcagaactagtcttgaa
                   Hedgehog  aaaggaggat---gaaatcagctggaca------tcttggacttaga-ttatttcagaacttaactaaaa
                      Shrew  aatcgaacgt---gagattgactgtgca------gcacaggattagctttgcttcggtcctagtcagaaa
                   Elephant  aatgtaggag---gggaccaggtaagca------ggttggg-tgaacttatctttggaactagtctagaa
        Cape elephant shrew  aacacaggac---agaacaaattaaaca------gcttggacccagtttgtcttt------------gaa
                    Manatee  aatgtaggag---ag-accaggtaagca------gcttgggctgagcttatcttcagaactagtctagaa
           Cape golden mole  aatggaggtg---aggactaagtaagca------gtttgggcctagcttatctttggagccagttctaaa
                   Aardvark  aatgtaggag---aggacaaggtaagca------acctgggcctggcttatctttagaactagtcttgat
                  Armadillo  aatgttggac---agaaccaggtgagca------gcttggactctgcttatctttggaactagtcttgca
            Green seaturtle  ======================================================================
             Painted turtle  ======================================================================
             Golden hamster  ----------------------------------------------------------------------
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
           Brush-tailed rat  ======================================================================
                     Tenrec  ======================================================================
                    Dolphin  ======================================================================

                      Human  g-ttatgtttatacatctttgcacag
                      Chimp  g-ttatgtttatacatctttgcacag
                    Gorilla  g-ttatgtttatacatctttgcacag
                  Orangutan  g-ttatgtttatacatctttgcacag
                     Gibbon  g-ttatgtttatacatctttgcacag
                     Rhesus  g-ttatgcttatacatctttgcacag
        Crab-eating macaque  g-ttatgcttatacatctttgcacag
                     Baboon  g-ttatgcttatacatctttgcacag
               Green monkey  g-ttatgcttatacatctttgcacag
                   Marmoset  g-ttacgtttatacatcttttcacag
            Squirrel monkey  g-ttacatttatacatcttttcacag
                   Bushbaby  g-ttgtg-ttatacatcttttcacag
         Chinese tree shrew  a-tt-------tttgtcttt-caaag
                   Squirrel  g-ttgcgttta-gcacctttctacag
     Lesser Egyptian jerboa  g-ttctgtttatacatctttgcacag
               Prairie vole  g-ttatgtttctacatctttccatgg
            Chinese hamster  g-ctatgtttctatatctttccgtgg
                      Mouse  g-ttatgtttctactttttatcctag
                        Rat  g-ttatatttccacatcttaccgtgg
             Naked mole-rat  g-ttatgtttatgcatctttttgtgg
                 Guinea pig  g-ttatgtttatacatatttttgtag
                 Chinchilla  g-ttctgtttatacatctttctgtag
                     Rabbit  g-gtacattcacgcatgctctcctgg
                       Pika  g-ctatgttggtgcat------ttgg
                        Pig  g-ttatgtttgtacatctttccacgg
                     Alpaca  g-ttatgtttgtacatcttttcatag
             Bactrian camel  g-ttatgtttgtacatcttttcatag
           Tibetan antelope  g-ttatgtttgtacatcttttcacag
                        Cow  g-ttatgtttgtacatcttttcacag
                      Sheep  g-ttatgtttgtacatcttttcacag
              Domestic goat  g-ttatgtttgtacatcttttcacag
                      Horse  g-ttacgtttgtacatcttttcacag
           White rhinoceros  g-ttatgtttgtacatcttttcacag
                        Cat  g-ttatgctcgtatatctttgcacag
                        Dog  g-ttatgtttgtgcttctttgcacag
                    Ferret   g-tgacattcatgcatcttagcactg
                      Panda  g-tgacgtttgtgcatctttgcacag
             Pacific walrus  a-tgacgttcatgcatctttgcacgg
               Weddell seal  g-tgacgttcattcatctttgcacag
           Black flying-fox  atttatgtttgtacatctttccgtag
                    Megabat  gtttatgtttgtacatctttccgtag
              Big brown bat  g-ttgtgtttgaaca--tttccacag
       David's myotis (bat)  g-ttgtgtttgaaca--tttccacag
                   Microbat  g-ttgtgtttgaaca--tttccacag
                   Hedgehog  g-ctgtatttgtacatctttacagag
                      Shrew  a-ttctgcttgaacatctttctacag
                   Elephant  a-atatgtttgtacatcttttcagag
        Cape elephant shrew  a-ttatgcttgtacatcttttcacaa
                    Manatee  a-atatgtttgtacatcttttcacag
           Cape golden mole  a-ttatgtttgtacatgttttcacag
                   Aardvark  a-ttatgtttgtacatcttttcacag
                  Armadillo  g-ttaagtttgtacatcttttcatgg
            Green seaturtle  ==========================
             Painted turtle  ==========================
             Golden hamster  --------------------------
                    Wallaby  ==========================
            Star-nosed mole  --------------------------
           Brush-tailed rat  ==========================
                     Tenrec  ==========================
                    Dolphin  ==========================

Inserts between block 4 and 5 in window
B D           Green monkey 2bp

Alignment block 5 of 201 in window, 45542244 - 45542257, 14 bps 
B D                   Human  aaag-------acactaaaaa
B D                   Chimp  aaag-------acactaaaaa
B D                 Gorilla  aaac-------acactaaaaa
B D               Orangutan  aaag-------acactaaaaa
B D                  Gibbon  aaag-------acactaaaaa
B D                  Rhesus  aaaa-------acactaaaaa
B D     Crab-eating macaque  aaaa-------acactaaaaa
B D                  Baboon  aaaa-------acactaaaaa
B D            Green monkey  aaaa-------acactaaaaa
B D                Marmoset  aaag-------atactgaaaa
B D         Squirrel monkey  aaag-------atactaaaaa
B D                Bushbaby  gagg-------acattaaaag
         Chinese tree shrew  gagg-------agatgaaaag
B D                Squirrel  gagg-------agattca---
     Lesser Egyptian jerboa  gagg-------agattaaaa-
               Prairie vole  gagg-------gggttcaaag
B D         Chinese hamster  gagg-------aggttcaaag
B D                   Mouse  gagg-------agactcaaag
B D                     Rat  atgg-------ggattcaaag
B D          Naked mole-rat  gagg-------agatttaa--
B D              Guinea pig  gatg-------agatttaa--
                 Chinchilla  gatg-------aggtttaa--
B D                  Rabbit  gagg-------agactaaa--
B D                    Pika  gggggcggacaagatcaca--
B D                     Pig  ---g-------ggattaaaag
B D                  Alpaca  ---g-------agattaaaag
             Bactrian camel  ---g-------agattaaaag
           Tibetan antelope  ---g-------agactaaaag
B D                     Cow  ---a-------agactaaaag
B D                   Sheep  ---g-------agactaaaag
              Domestic goat  ---g-------agactaaaag
B D                   Horse  ---g-------agattaaaaa
B D        White rhinoceros  ---g-------agattaaaag
B D                     Cat  ---c-------agattaaaac
B D                 Ferret   ---g-------aagtgaaaac
B D                   Panda  ---g-------aggtgaaaac
             Pacific walrus  ---g-------aggcaaaaac
               Weddell seal  ---g-------aggcaaaaac
           Black flying-fox  ---g-------acatgaaaag
B D                 Megabat  ---g-------acatgaaaag
              Big brown bat  ---g-------acattaaaca
       David's myotis (bat)  ---g-------acattaaaca
B D                Microbat  ---g-------acattaaaca
B D                Hedgehog  ---g-------agattaaaag
B D                   Shrew  ---g--------------aaa
B D                Elephant  gaca-------atattaagaa
        Cape elephant shrew  gaga-------a----gagga
B D                 Manatee  gaga-------atgttaag--
           Cape golden mole  aaga-------atattaac--
                   Aardvark  gaga-------atattaagaa
B D               Armadillo  gagg-------agattaaaag
  D         Green seaturtle  =====================
  D          Painted turtle  =====================
            Golden hamster  ---------------------
B D                 Wallaby  =====================
           Star-nosed mole  ---------------------
          Brush-tailed rat  =====================
B D                  Tenrec  =====================
B D                     Dog  ---------------------
B D                 Dolphin  =====================

Inserts between block 5 and 6 in window
              Prairie vole 118bp
B D        Chinese hamster 58bp
B D                  Mouse 63bp
B D                    Rat 67bp

Alignment block 6 of 201 in window, 45542258 - 45542274, 17 bps 
B D                   Human  gtagtgggtttgc---------------------------------------------------------
B D                   Chimp  gtagtgggtttgc---------------------------------------------------------
B D                 Gorilla  gtattgggtttgc---------------------------------------------------------
B D               Orangutan  gtagtgggtttgc---------------------------------------------------------
B D                  Gibbon  gaagtgggtttgc---------------------------------------------------------
B D                  Rhesus  gaagtgggtttgc---------------------------------------------------------
B D     Crab-eating macaque  gaagtgggtttgc---------------------------------------------------------
B D                  Baboon  gaagtgggtttgc---------------------------------------------------------
B D            Green monkey  gaagtgggtttgc---------------------------------------------------------
B D                Marmoset  gaagtgggtttgc---------------------------------------------------------
B D         Squirrel monkey  gaagtggatttgc---------------------------------------------------------
B D                Bushbaby  gaagtgggtttcc---------------------------------------------------------
         Chinese tree shrew  aaagtagatttgc---------------------------------------------------------
B D                Squirrel  -cactgggctt-----------------------------------------------------------
     Lesser Egyptian jerboa  ---gtgggtttggtcaggtgcggggttggcaaatatgagcaaagtaccaggataaacatttgtgaaaaac
B D         Chinese hamster  ----------------------------------------------------------------------
B D                   Mouse  ----------------------------------------------------------------------
B D                     Rat  ----------------------------------------------------------------------
B D          Naked mole-rat  --agtgggtttgt---------------------------------------------------------
B D              Guinea pig  --agtgggtttgt---------------------------------------------------------
                 Chinchilla  --agtgggttggt---------------------------------------------------------
B D                  Rabbit  --agcgggtttgc---------------------------------------------------------
B D                    Pika  --agtgggcttgc---------------------------------------------------------
B D                     Pig  gaagtgagtctgc---------------------------------------------------------
B D                  Alpaca  gaagtgagtttgc---------------------------------------------------------
             Bactrian camel  gaagtgagtttgc---------------------------------------------------------
           Tibetan antelope  gaagtaggttt-c---------------------------------------------------------
B D                     Cow  gaagtgggttt-t---------------------------------------------------------
B D                   Sheep  gaagtaggttt-c---------------------------------------------------------
              Domestic goat  gaagtaggttt-c---------------------------------------------------------
B D                   Horse  gaagtgggtttgc---------------------------------------------------------
B D        White rhinoceros  gaagtgggtttgc---------------------------------------------------------
B D                     Cat  aaagtgggtttgc---------------------------------------------------------
B D                 Ferret   aaagtggattttc---------------------------------------------------------
B D                   Panda  aaaatgggttttc---------------------------------------------------------
             Pacific walrus  aaagtgggttttc---------------------------------------------------------
               Weddell seal  aaagtgggttttc---------------------------------------------------------
           Black flying-fox  gaagtggtttaac---------------------------------------------------------
B D                 Megabat  gaaatggtttaac---------------------------------------------------------
              Big brown bat  gaagtgagtttac---------------------------------------------------------
       David's myotis (bat)  gaagtgagtttac---------------------------------------------------------
B D                Microbat  gaagtgagtttac---------------------------------------------------------
B D                Hedgehog  gaagtgggtttcc---------------------------------------------------------
B D                   Shrew  gcaataggcttgc---------------------------------------------------------
B D                Elephant  gaagtgggttcgt---------------------------------------------------------
        Cape elephant shrew  aaagtggatttgc---------------------------------------------------------
B D                 Manatee  -aagtgggtttgc---------------------------------------------------------
           Cape golden mole  -aagtaggtttcc---------------------------------------------------------
                   Aardvark  gaagtgggtttgc---------------------------------------------------------
B D               Armadillo  gaagcaggtttgc---------------------------------------------------------
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
            Golden hamster  ----------------------------------------------------------------------
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Dog  ----------------------------------------------------------------------
              Prairie vole  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  ttt-g
                      Chimp  ttt-g
                    Gorilla  ttt-g
                  Orangutan  ttt-g
                     Gibbon  tgt-g
                     Rhesus  ttt-g
        Crab-eating macaque  ttt-g
                     Baboon  ttt-g
               Green monkey  ttt-g
                   Marmoset  ttt-g
            Squirrel monkey  ttt-g
                   Bushbaby  tct-g
         Chinese tree shrew  ttt-g
                   Squirrel  gca-c
     Lesser Egyptian jerboa  ata-a
            Chinese hamster  atc-g
                      Mouse  ata-g
                        Rat  gta-g
             Naked mole-rat  gta-g
                 Guinea pig  gta-g
                 Chinchilla  tca-g
                     Rabbit  tcc-g
                       Pika  tttgg
                        Pig  tct-g
                     Alpaca  tcc-g
             Bactrian camel  tct-g
           Tibetan antelope  cct-g
                        Cow  tct-g
                      Sheep  cct-g
              Domestic goat  cct-g
                      Horse  ttt-g
           White rhinoceros  ttt-g
                        Cat  ttt-g
                    Ferret   tct-g
                      Panda  tct-g
             Pacific walrus  tcc-g
               Weddell seal  tcc-g
           Black flying-fox  ttt-g
                    Megabat  ttt-g
              Big brown bat  ttt-g
       David's myotis (bat)  ttt-g
                   Microbat  ttt-g
                   Hedgehog  ttt-c
                      Shrew  ttg-g
                   Elephant  ttt-a
        Cape elephant shrew  ttt-g
                    Manatee  ttt-t
           Cape golden mole  ttt-g
                   Aardvark  tct-g
                  Armadillo  ttt-g
            Green seaturtle  =====
             Painted turtle  =====
             Golden hamster  -----
                    Wallaby  =====
            Star-nosed mole  -----
           Brush-tailed rat  =====
                     Tenrec  =====
                        Dog  -----
               Prairie vole  =====
                    Dolphin  =====

Inserts between block 6 and 7 in window
B D               Elephant 234bp
B D                Manatee 55bp

Alignment block 7 of 201 in window, 45542275 - 45542277, 3 bps 
B D                   Human  ggg
B D                   Chimp  agg
B D                 Gorilla  ggg
B D               Orangutan  ggg
B D                  Gibbon  ggg
B D                  Rhesus  ggg
B D     Crab-eating macaque  ggg
B D                  Baboon  agg
B D            Green monkey  ggg
B D                Marmoset  ggg
B D         Squirrel monkey  ggg
B D                Bushbaby  ggg
         Chinese tree shrew  ggc
B D                Squirrel  tgg
     Lesser Egyptian jerboa  tga
B D         Chinese hamster  tga
B D                   Mouse  tga
B D                     Rat  tgg
B D          Naked mole-rat  ggg
B D              Guinea pig  ggg
                 Chinchilla  ggg
B D                  Rabbit  ggg
B D                    Pika  ggg
B D                     Pig  ggg
B D                  Alpaca  ggg
             Bactrian camel  ggg
           Tibetan antelope  g--
B D                     Cow  g--
B D                   Sheep  g--
              Domestic goat  g--
B D                   Horse  gga
B D        White rhinoceros  gga
B D                     Cat  ggg
B D                 Ferret   ggg
B D                   Panda  ggg
             Pacific walrus  ggg
               Weddell seal  ggg
           Black flying-fox  gga
B D                 Megabat  gga
              Big brown bat  gga
       David's myotis (bat)  gga
B D                Microbat  gga
B D                Hedgehog  agg
B D                   Shrew  agg
B D                Elephant  ggg
        Cape elephant shrew  ggg
B D                 Manatee  gag
           Cape golden mole  gag
                   Aardvark  ggg
B D               Armadillo  gtg
  D         Green seaturtle  ===
  D          Painted turtle  ===
            Golden hamster  ---
B D                 Wallaby  ===
           Star-nosed mole  ---
          Brush-tailed rat  ===
B D                  Tenrec  ===
B D                     Dog  ---
              Prairie vole  ===
B D                 Dolphin  ===

Inserts between block 7 and 8 in window
       Cape elephant shrew 645bp

Alignment block 8 of 201 in window, 45542278 - 45542278, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  t
         Chinese tree shrew  a
B D                Squirrel  g
     Lesser Egyptian jerboa  a
B D         Chinese hamster  a
B D                   Mouse  a
B D                     Rat  a
B D          Naked mole-rat  a
B D              Guinea pig  g
                 Chinchilla  g
B D                  Rabbit  a
B D                    Pika  a
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  a
       David's myotis (bat)  a
B D                Microbat  g
B D                Hedgehog  a
B D                   Shrew  a
B D                Elephant  g
B D                 Manatee  a
           Cape golden mole  g
                   Aardvark  a
  D         Green seaturtle  =
  D          Painted turtle  =
            Golden hamster  -
B D                 Wallaby  =
           Star-nosed mole  -
          Brush-tailed rat  =
B D                  Tenrec  =
       Cape elephant shrew  =
          Tibetan antelope  -
B D                     Dog  -
B D                   Sheep  -
             Domestic goat  -
B D                     Cow  -
              Prairie vole  =
B D               Armadillo  -
B D                 Dolphin  =

Inserts between block 8 and 9 in window
B D                Manatee 164bp

Alignment block 9 of 201 in window, 45542279 - 45542279, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  t
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  a
     Lesser Egyptian jerboa  a
B D         Chinese hamster  a
B D                   Mouse  g
B D                     Rat  a
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  g
B D                  Alpaca  g
             Bactrian camel  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  g
B D                   Shrew  t
B D                Elephant  g
B D                 Manatee  g
           Cape golden mole  a
                   Aardvark  g
B D               Armadillo  g
  D         Green seaturtle  =
  D          Painted turtle  =
            Golden hamster  -
B D                 Wallaby  =
           Star-nosed mole  -
          Brush-tailed rat  =
B D                  Tenrec  =
       Cape elephant shrew  =
          Tibetan antelope  -
B D                     Dog  -
B D                   Sheep  -
             Domestic goat  -
B D                     Cow  -
              Prairie vole  =
B D                 Dolphin  =

Inserts between block 9 and 10 in window
                  Aardvark 409bp

Alignment block 10 of 201 in window, 45542280 - 45542285, 6 bps 
B D                   Human  ----ctctcc
B D                   Chimp  ----ctctcc
B D                 Gorilla  ----ctctcc
B D               Orangutan  ----ctctcc
B D                  Gibbon  ----ctctcc
B D                  Rhesus  ----ctctcc
B D     Crab-eating macaque  ----ctctcc
B D                  Baboon  ----ctctcc
B D            Green monkey  ----ctctcc
B D                Marmoset  ----ttctcc
B D         Squirrel monkey  ----ttctcc
B D                Bushbaby  ----ttatta
         Chinese tree shrew  ----ctacct
B D                Squirrel  ----gctgtc
     Lesser Egyptian jerboa  ----ctcatt
B D         Chinese hamster  ----ctcggt
B D                   Mouse  ----tttgtt
B D                     Rat  ----cttgcc
B D          Naked mole-rat  ----ctatca
B D              Guinea pig  ----ctgtga
                 Chinchilla  ----ctgtca
B D                  Rabbit  ----ctacgg
B D                    Pika  ----cttttg
B D                     Pig  ----ctccag
B D                  Alpaca  ----tgctaa
             Bactrian camel  ----tgctaa
           Tibetan antelope  ---------a
B D                     Cow  --------aa
B D                   Sheep  --------aa
              Domestic goat  --------aa
B D                   Horse  ----ctatta
B D        White rhinoceros  ----ctataa
B D                     Cat  ----ctatgg
B D                 Ferret   ----ctatag
B D                   Panda  ----ctata-
             Pacific walrus  ----ctatag
               Weddell seal  ----ctatag
           Black flying-fox  ----ctataa
B D                 Megabat  ----ctataa
              Big brown bat  ----ctatac
       David's myotis (bat)  ----ctatac
B D                Microbat  ----ctatac
B D                Hedgehog  ----ctatat
B D                   Shrew  ----ctatat
B D                Elephant  ----tt----
B D                 Manatee  ----ct----
           Cape golden mole  ----tt----
B D                  Tenrec  cccttt----
B D               Armadillo  ----ct----
  D         Green seaturtle  ==========
  D          Painted turtle  ==========
            Golden hamster  ----------
B D                 Wallaby  ==========
           Star-nosed mole  ----------
          Brush-tailed rat  ==========
       Cape elephant shrew  ==========
B D                     Dog  ----------
              Prairie vole  ==========
B D                 Dolphin  ==========
                  Aardvark  ==========

Inserts between block 10 and 11 in window
B D               Bushbaby 3bp
B D              Armadillo 4bp

Alignment block 11 of 201 in window, 45542286 - 45542287, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Gibbon  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D                Marmoset  aa
B D         Squirrel monkey  gt
B D                Bushbaby  gt
         Chinese tree shrew  gt
B D                Squirrel  ag
     Lesser Egyptian jerboa  at
B D         Chinese hamster  gt
B D                   Mouse  at
B D                     Rat  ac
B D          Naked mole-rat  gt
B D              Guinea pig  gg
                 Chinchilla  gg
B D                  Rabbit  gt
B D                    Pika  gt
B D                     Pig  at
B D                  Alpaca  at
             Bactrian camel  at
           Tibetan antelope  aa
B D                     Cow  aa
B D                   Sheep  aa
              Domestic goat  aa
B D                   Horse  at
B D        White rhinoceros  at
B D                     Cat  c-
B D                 Ferret   ct
B D                   Panda  ct
             Pacific walrus  ct
               Weddell seal  ct
           Black flying-fox  at
B D                 Megabat  at
              Big brown bat  at
       David's myotis (bat)  at
B D                Microbat  at
B D                Hedgehog  at
B D                   Shrew  ct
B D                Elephant  at
B D                 Manatee  at
           Cape golden mole  at
B D                  Tenrec  ct
                   Aardvark  ac
B D               Armadillo  gt
  D         Green seaturtle  ==
  D          Painted turtle  ==
            Golden hamster  --
B D                 Wallaby  ==
           Star-nosed mole  --
          Brush-tailed rat  ==
       Cape elephant shrew  ==
B D                     Dog  --
              Prairie vole  ==
B D                 Dolphin  ==

Inserts between block 11 and 12 in window
B D                    Cat 3bp
B D                Ferret  3bp
B D                  Panda 3bp
            Pacific walrus 3bp
              Weddell seal 3bp
B D               Elephant 4bp
B D                Manatee 4bp
          Cape golden mole 1063bp

Alignment block 12 of 201 in window, 45542288 - 45542288, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  t
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  c
         Chinese tree shrew  c
B D                Squirrel  t
     Lesser Egyptian jerboa  t
B D         Chinese hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
B D                  Rabbit  g
B D                    Pika  t
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                 Ferret   g
B D                   Panda  t
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  c
       David's myotis (bat)  c
B D                Microbat  c
B D                Hedgehog  c
B D                   Shrew  c
B D                Elephant  t
B D                 Manatee  c
B D                  Tenrec  c
                   Aardvark  c
B D               Armadillo  c
  D         Green seaturtle  =
  D          Painted turtle  =
            Golden hamster  -
B D                 Wallaby  =
           Star-nosed mole  -
          Brush-tailed rat  =
       Cape elephant shrew  =
B D                     Dog  -
              Prairie vole  =
B D                 Dolphin  =
          Cape golden mole  =

Inserts between block 12 and 13 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 6bp
B D        Chinese hamster 40bp
B D                  Mouse 43bp
B D                    Rat 43bp

Alignment block 13 of 201 in window, 45542289 - 45542290, 2 bps 
B D                   Human  tc
B D                   Chimp  tc
B D                 Gorilla  tc
B D               Orangutan  tc
B D                  Gibbon  tc
B D                  Rhesus  tt
B D     Crab-eating macaque  tc
B D                  Baboon  tc
B D            Green monkey  tc
B D                Marmoset  tt
B D         Squirrel monkey  tc
B D                Bushbaby  tc
         Chinese tree shrew  tc
B D                Squirrel  tc
     Lesser Egyptian jerboa  gc
               Prairie vole  tc
B D         Chinese hamster  tc
B D                   Mouse  cc
B D                     Rat  tc
B D          Naked mole-rat  tc
B D              Guinea pig  tc
                 Chinchilla  tc
B D                  Rabbit  tc
B D                    Pika  tc
B D                     Pig  tc
B D                  Alpaca  tc
             Bactrian camel  tc
           Tibetan antelope  tc
B D                     Cow  tc
B D                   Sheep  tc
              Domestic goat  tc
B D                   Horse  tc
B D        White rhinoceros  tc
B D                     Cat  tc
B D                 Ferret   tc
B D                   Panda  cc
             Pacific walrus  tc
               Weddell seal  tc
           Black flying-fox  tc
B D                 Megabat  tc
              Big brown bat  tc
       David's myotis (bat)  tt
B D                Microbat  tc
B D                Hedgehog  ac
B D                   Shrew  ct
B D                Elephant  tc
B D                 Manatee  tc
B D                  Tenrec  tc
                   Aardvark  tc
B D               Armadillo  tc
  D         Green seaturtle  ==
  D          Painted turtle  ==
            Golden hamster  --
B D                 Wallaby  ==
           Star-nosed mole  --
          Brush-tailed rat  ==
       Cape elephant shrew  ==
B D                     Dog  --
B D                 Dolphin  ==
          Cape golden mole  ==

Alignment block 14 of 201 in window, 45542291 - 45542311, 21 bps 
B D                   Human  cttcaagga----------------a--aaa--c-------aaatagg
B D                   Chimp  cttcaagga----------------a--aaa--c-------aaatagg
B D                 Gorilla  cttcaagga----------------a--aaa--c-------aaatagg
B D               Orangutan  cttcaagga----------------a--aaa--c-------gaatagg
B D                  Gibbon  cttcaagga----------------a--aaa--c-------gaatagg
B D                  Rhesus  cttcaagga----------------a--aaa--c-------aaatagg
B D     Crab-eating macaque  cttcaagga----------------a--aaa--c-------aaatagg
B D                  Baboon  cttcaagga----------------a--aaa--c-------aaatagg
B D            Green monkey  cttcaagga----------------a--aaa--c-------aaatagg
B D                Marmoset  cttcaagga----------------a--aaa--t-------gaatag-
B D         Squirrel monkey  cttcaaaga----------------a--aaa--t-------gaatag-
B D                Bushbaby  cttcagggg----------------a--aag--t-------gaacggg
         Chinese tree shrew  cttcgtgga----------------g--aaa--t-------gaatggg
B D                Squirrel  tttcaagga----------------a--caa--g-------gaatgag
     Lesser Egyptian jerboa  tcatgaaaaataataataataaaata--aaa--t-------gaacaaa
               Prairie vole  tttcaagga----------------a--aaa--t-------ggacaga
B D         Chinese hamster  tctggagga----------------a--aaa--t-------gagcaga
B D                   Mouse  ttctgaaga----------------g--aaa--t-------ggataga
B D                     Rat  gctcaaaga----------------g--aaa--t-------ggataga
B D          Naked mole-rat  tttcaagga----------------a--aac--t-------gagtgag
B D              Guinea pig  tttgaagga----------------a--aac--t-------gagtgag
                 Chinchilla  tttgaagga----------------a--aac--c-------gagtgag
B D                  Rabbit  tcttcaaga--------------------------------gaatggg
B D                    Pika  ctttaaaga----------------t--aaa--t-------gaatggg
B D                     Pig  cttaaagaa-------------------aaa--tgggatgtggacggg
B D                  Alpaca  ctttaagga----------------aaaaaa--taggagatggatggg
             Bactrian camel  ctttaagga----------------aaaaaa--taggaggtggatggg
           Tibetan antelope  t---------------------------gaa--tgggatgtggctggg
B D                     Cow  t---------------------------gaa--tgggatgtggctggg
B D                   Sheep  t---------------------------gaa--tgggatgtggctggg
              Domestic goat  t---------------------------aaa--tgggatgtggctggg
B D                   Horse  cttaaagga----------------a--aaaaatgggttgtagatggg
B D        White rhinoceros  tttaaagga----------------a--aaatttgggatgtggatggg
B D                     Cat  cttaaaagt----------------g--gaa--ttggatgtggttggg
B D                 Ferret   cttatagga----------------g--aac--ggagctgtggtagag
B D                   Panda  cttacagga----------------g--aaa--agggatgtggtcggg
             Pacific walrus  cttacagga----------------g--aaa--caggatgtggtcggg
               Weddell seal  cttacagga----------------g--aaa--caggatgtggttggg
           Black flying-fox  cttaaagaa----------------a--aaa--tgggatgtggataag
B D                 Megabat  cttaaagaa----------------a--aaa--tgggatatgggtaag
              Big brown bat  cttaaagga----------------a--aaa--t-ggatgtggatggg
       David's myotis (bat)  cttagagga----------------a--aaa--t-ggatgtggatggg
B D                Microbat  cttagagga----------------a--aaa--t-ggatgtggatggg
B D                Hedgehog  cttaaaggg----------------a--aaa--c--------ggagag
B D                   Shrew  cc-----ga----------------g--aat--c--------tttggg
B D                Elephant  cttaaagga----------------g--aaa--g-------aaatgag
        Cape elephant shrew  cctaaagga----------------a--aaa--c-------aaatgag
B D                 Manatee  cttaaagga----------------a--aaa--c-------aaatggg
B D                  Tenrec  cttaaagga----------------g--aac--c-------aagtgga
                   Aardvark  cttaaagga----------------a--aag--c-------gaatggg
B D               Armadillo  cttaaagga----------------a--aaa--c-------aaatgga
  D         Green seaturtle  ================================================
  D          Painted turtle  ================================================
            Golden hamster  ------------------------------------------------
B D                 Wallaby  ================================================
           Star-nosed mole  ------------------------------------------------
          Brush-tailed rat  ================================================
B D                     Dog  ------------------------------------------------
B D                 Dolphin  ================================================
          Cape golden mole  ================================================

Inserts between block 14 and 15 in window
B D               Hedgehog 235bp
B D                  Shrew 5bp

Alignment block 15 of 201 in window, 45542312 - 45542313, 2 bps 
B D                   Human  ag
B D                   Chimp  ag
B D                 Gorilla  ag
B D               Orangutan  ag
B D                  Gibbon  ag
B D                  Rhesus  ag
B D     Crab-eating macaque  ag
B D                  Baboon  ag
B D            Green monkey  ag
B D                Bushbaby  ac
         Chinese tree shrew  ag
B D                Squirrel  at
     Lesser Egyptian jerboa  ac
               Prairie vole  ac
B D         Chinese hamster  at
B D                   Mouse  ac
B D                     Rat  at
B D          Naked mole-rat  gt
B D              Guinea pig  gc
                 Chinchilla  gt
B D                  Rabbit  ag
B D                    Pika  ag
B D                     Pig  ag
B D                  Alpaca  ag
             Bactrian camel  ag
           Tibetan antelope  ag
B D                     Cow  ag
B D                   Sheep  ag
              Domestic goat  ag
B D                   Horse  ag
B D        White rhinoceros  ag
B D                     Cat  ag
B D                 Ferret   a-
B D                   Panda  a-
             Pacific walrus  a-
               Weddell seal  a-
           Black flying-fox  ag
B D                 Megabat  ag
              Big brown bat  ag
       David's myotis (bat)  ag
B D                Microbat  ag
B D                   Shrew  gg
B D                Elephant  tg
        Cape elephant shrew  aa
B D                 Manatee  tg
B D                  Tenrec  ag
                   Aardvark  ag
B D               Armadillo  aa
  D         Green seaturtle  ==
  D          Painted turtle  ==
            Golden hamster  --
B D                 Wallaby  ==
           Star-nosed mole  --
          Brush-tailed rat  ==
B D                Hedgehog  ==
B D                     Dog  --
B D                Marmoset  --
B D         Squirrel monkey  --
B D                 Dolphin  ==
          Cape golden mole  ==

Alignment block 16 of 201 in window, 45542314 - 45542327, 14 bps 
B D                   Human  tgaatcgc-tgccaa
B D                   Chimp  tgaatcgc-tgccaa
B D                 Gorilla  tgaatcgc-tgccaa
B D               Orangutan  tgaatcgc-tgccaa
B D                  Gibbon  tgaatcac-tgccaa
B D                  Rhesus  tgacttgc-tggcaa
B D     Crab-eating macaque  tgacttgc-tggcaa
B D                  Baboon  tgacttgc-tggcaa
B D            Green monkey  tgacttgc-tggcaa
B D                Marmoset  -gaattgc-tggcaa
B D         Squirrel monkey  -gaattgc-tggcaa
B D                Bushbaby  tgaattgc-tggcaa
         Chinese tree shrew  taggtcgc-tggcaa
B D                Squirrel  tggattg--aggcaa
     Lesser Egyptian jerboa  tgtatttc-tgacaa
               Prairie vole  tggattgc-tggcaa
B D         Chinese hamster  tggattgc-tggcaa
B D                   Mouse  tggcttgg-tggcaa
B D                     Rat  tggcctgg-aggcca
B D          Naked mole-rat  tgtattgc-tcgcaa
B D              Guinea pig  tggattgc-tacaaa
                 Chinchilla  cgcattgt-tgccaa
           Brush-tailed rat  tgtatggc-tgccaa
B D                  Rabbit  gggatcgc-tggcaa
B D                    Pika  cggatctt-aggcca
B D                     Pig  tggattgcttggaga
B D                  Alpaca  tggattgc-tggcaa
             Bactrian camel  tggattgc-tggaaa
           Tibetan antelope  tgggttgc-tggcga
B D                     Cow  tgggttgc-tggcga
B D                   Sheep  tgggttgc-tggcaa
              Domestic goat  t--gttgc-ttgtga
B D                   Horse  tgggttgc-tggcga
B D        White rhinoceros  tggattgc-tggcga
B D                     Cat  cagattgc-tggcaa
B D                 Ferret   tagagtgc-tgatga
B D                   Panda  tagagtgc-tggcga
             Pacific walrus  tagagtgc-tggtga
               Weddell seal  tagagtgc-tggcaa
           Black flying-fox  tggattgc-tagcaa
B D                 Megabat  tggattgc-tagcaa
              Big brown bat  tagattac-tagcaa
       David's myotis (bat)  tggattac-tagcaa
B D                Microbat  tggattac-tagcaa
B D                   Shrew  tggagcca-tgatga
B D                Elephant  tggattgc-tggtga
        Cape elephant shrew  cgggttgc-tggtga
B D                 Manatee  tggattgc-tgctaa
B D                  Tenrec  tggattgc-tggtga
                   Aardvark  tggattgc-tggtga
B D               Armadillo  tggattgc-tggtga
  D         Green seaturtle  ===============
  D          Painted turtle  ===============
            Golden hamster  ---------------
B D                 Wallaby  ===============
           Star-nosed mole  ---------------
B D                Hedgehog  ===============
B D                     Dog  ---------------
B D                 Dolphin  ===============
          Cape golden mole  ===============

Inserts between block 16 and 17 in window
        Chinese tree shrew 1283bp

Alignment block 17 of 201 in window, 45542328 - 45542340, 13 bps 
B D                   Human  agagt----tgtgttga
B D                   Chimp  agagt----tgtgttga
B D                 Gorilla  agagt----tgtgttga
B D               Orangutan  agagt----tgtgttga
B D                  Gibbon  agagt----tgtgttga
B D                  Rhesus  acagc----tatgttga
B D     Crab-eating macaque  agagc----tatgttga
B D                  Baboon  agagc----tatgttga
B D            Green monkey  atagc----tatgttga
B D                Marmoset  agagt----tgtattga
B D         Squirrel monkey  agagt----tttattga
B D                Bushbaby  agacc----tgtgttga
         Chinese tree shrew  aaagc----tgtgatat
B D                Squirrel  agacctctctctgatga
     Lesser Egyptian jerboa  agagc-------aatga
               Prairie vole  aatgg-------ggtga
B D         Chinese hamster  aagga-------ggtaa
B D                   Mouse  aagga-------agtga
B D                     Rat  aagta-------ag-ga
B D          Naked mole-rat  agagc----tgtgatga
B D              Guinea pig  agagc----tgtgacaa
                 Chinchilla  agagc----tgggatga
           Brush-tailed rat  agagc----tgtgatga
B D                  Rabbit  agggc----tgtgacga
B D                    Pika  agagc----cacagtga
B D                     Pig  agagt----tgcaa-ga
B D                  Alpaca  agagc----tgtaa-ga
             Bactrian camel  agagc----tgtga-ga
           Tibetan antelope  agagt----catga-gg
B D                     Cow  agact----catga-gg
B D                   Sheep  agagt----catga-gg
              Domestic goat  agagt----catga-gg
B D                   Horse  agagt----tgtgatga
B D        White rhinoceros  agagt----tgtgatga
           Black flying-fox  agagc----tgtaatga
B D                 Megabat  agagc----tgtaatga
              Big brown bat  ggcat----tgtaataa
       David's myotis (bat)  aatat----tgtaatga
B D                Microbat  aacat----tgtaatga
B D                Elephant  agtgt----tgtgatga
        Cape elephant shrew  ggtgt----tatgatga
B D                 Manatee  agcat----tgtgatga
B D                  Tenrec  agggt----tgtgatga
                   Aardvark  cgtgt----tgtgatga
B D               Armadillo  agggt----tgtgatga
  D         Green seaturtle  =================
  D          Painted turtle  =================
B D                   Shrew  -----------------
            Golden hamster  -----------------
B D                 Wallaby  =================
           Star-nosed mole  -----------------
B D                Hedgehog  =================
B D                   Panda  -----------------
            Pacific walrus  -----------------
B D                     Dog  -----------------
B D                     Cat  -----------------
B D                 Ferret   -----------------
B D                 Dolphin  =================
          Cape golden mole  =================
              Weddell seal  -----------------

Inserts between block 17 and 18 in window
B D               Marmoset 1bp
B D        Squirrel monkey 1bp
B D               Bushbaby 1bp
        Chinese tree shrew 3bp
B D               Squirrel 1bp
    Lesser Egyptian jerboa 3bp
              Prairie vole 1bp
B D        Chinese hamster 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp
B D                 Rabbit 1bp
B D                   Pika 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
B D               Microbat 1bp

Alignment block 18 of 201 in window, 45542341 - 45542400, 60 bps 
B D                   Human  -gacattg-atggcttagaag-----------ggttggttggtcaac-gtgtc-----tta------agt
B D                   Chimp  -gacaatg-atggcttagaag-----------ggttggttggtcaac-gtgtc-----tta------agt
B D                 Gorilla  -gacattg-atggcttagaag-----------ggttggttggtcagc-gtgtc-----tta------agt
B D               Orangutan  -gacattg-atggcttggaag-----------ggttggttggtcaac-gtgtc------ta------cgt
B D                  Gibbon  -gacattg-atggcttggaag-----------ggttggttggtcaac-gtgtc------ta------ggt
B D                  Rhesus  -gacattg-atggcttggaag-----------ggttggttggtcagc-gtgtc------ta------ggt
B D     Crab-eating macaque  -gacattg-atggcttggaag-----------ggttggttggtcagc-gtgtc------ta------ggt
B D                  Baboon  -gacattg-atggcttggaag-----------ggttggttggtcagc-gtgtc------ta------ggt
B D            Green monkey  -gacattg-atggcttggaag-----------ggttggttggtcagc-gtgtc------ta------ggt
B D                Marmoset  -gacactg-atggcttggaag-----------ggttggttggtcaac-acatc------ta------ggt
B D         Squirrel monkey  -gacatcg-atggcttggaag-----------agttgattggtcaac-ctatc------ta------gct
B D                Bushbaby  -gaagttg-atggcttgggag-----------ggttggttga-----------------ca---------
         Chinese tree shrew  -gaaaccg-atggcctggaag-----------ggttggttggtcaat-gcatccagcgcta------ggc
B D                Squirrel  -aaaaccc-atggcaaggtac-----------gacgggctggtcagc-gtgac------cg-gagccagg
     Lesser Egyptian jerboa  -gcaattc-aacattctgagt-----------ggtcggttggtccat-atgcc------catggctaact
               Prairie vole  -gaagttg-ctggcctgggat-----------ggctccctggccagc-gtgcc------ca-ggtggggc
B D         Chinese hamster  -gaagttg-atggcctgggat-----------ggttccctgctcagt-gtgcc------ca-ggcggggc
B D                   Mouse  -gaagttg--agtcttgggat-----------ggttcgttggaaaga-gtgcc------tg-ggtggggc
B D                     Rat  -ggagttgttatgcttggggt-----------ggttccttggtagga-gtgtg------ca-tgtagggc
B D          Naked mole-rat  -gaagttg-atgtcctggaat-----------tgttggttggtcaat-gtgtc------cagtacaaggc
B D              Guinea pig  -gaatttg-atgacctggagt-----------agttgattggccacc-gttcc------cagtacaaggc
                 Chinchilla  -gaatttg-atgacctggaat-----------agttgctcggccaac-atgcc------cagtacaaggc
           Brush-tailed rat  -aaatttg-atgaccccaagt-----------agttggctggccagg-a---------------------
B D                  Rabbit  -ggcacgg-atggccgggacc-----------cattggtgggtcagt-gcgcc------ca-gggtcggc
B D                    Pika  -gacacag-atggcccggaaa-----------agctggttgctcagt-gt-cc------ag-tgttcagc
B D                     Pig  -gaaatta-atggcctggaag------------ggtggttggtcagc-ctgtc------caacaccaggc
B D                  Alpaca  -gaaatta-atggcctagaag-----------gagtgatgggttgac-atgtc------cagcactaggc
             Bactrian camel  -gaaatta-atggcctagaag-----------gggtgatgggttgac-atgtc------cagcactaggc
           Tibetan antelope  -gaaattg-atggcctagaag-----------gggtgattggtccac-ctgtc------cagcactaggc
B D                     Cow  -gaaattg-atggcctggaag-----------gggtgattggtccac-ctctc------cagcactaggc
B D                   Sheep  -gaaattg-atggcctagaag-----------ggttgattggtccgc-ctgtc------cagcactaggc
              Domestic goat  -gaaattg-gtggcctagaag-----------tggtgattggtccac-ctgtc------cagcactaggc
B D                   Horse  -gaaatta-acggcctggaag-----------gggtggttagtcaac-atgtc------cagtgctaggc
B D        White rhinoceros  -aaaatta-atggcctggaag-----------ggctggttgctcaac-aagtc------cagcgctaggc
B D                     Cat  ---------------------------------------------------tc------cagcactaatc
B D                 Ferret   ---------------------------------------------------tc------cagtcctaggc
B D                   Panda  ---------------------------------------------------tc------cagcactagac
             Pacific walrus  ---------------------------------------------------tc------caacactaggt
               Weddell seal  ---------------------------------------------------tc------caacactaggc
           Black flying-fox  -aaaattg-atggcctggaaattgacggcctggggtggatggtcaac-atatc------cagcgcgagag
B D                 Megabat  -aaaattg-atgggctggaaatcgacggcctggggtggatggtcaac-atatc------cagtgagagag
              Big brown bat  ----------------ggaaattaatgggct-gggtggttggtcaac-atgcc------cagcgctaggc
       David's myotis (bat)  ----------------ggaaattaatggcct-gggtggttggtcaac-atgcc------cagtgctaggc
B D                Microbat  -gaaatta-atggtctggaaattaatggcct-gggtggttggtcaac-atgcc------cagtgcgaggc
B D                Hedgehog  -gaagttg-aaggcatgcagg-----------cagtggttggtcagc-atgtc------cagtgctaga-
B D                   Shrew  ----------------gcggt-----------gacccgctggttagc-ctgcc------cag-gctgaac
B D                Elephant  ggaagcga-gtggcctggaat-----------ggtgggttggtcaataatatc------tggt-ctgggc
        Cape elephant shrew  gtaaatca-gtggcctggaaa-----------gatgggttggtcaattacgct------ccat-ctaggc
B D                 Manatee  ggaagtga-atggcctggaat-----------ggtgggttggtcagtaatgtc------tggt-ctgggc
B D                  Tenrec  ggaaatga-gtggtctggaag-----------ggtaggttgctcagtaatgcc------tcat-caaagc
                   Aardvark  ggaaatga-gtggcctggaat-----------ggtgggttggtcaataaagtc------tagt-ctaggc
B D               Armadillo  ggcaatgg-atgacctct----------------ttggttggtcaac-atgtc------cagtgctaggc
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
            Golden hamster  ----------------------------------------------------------------------
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
B D                     Dog  ----------------------------------------------------------------------
B D                 Dolphin  ======================================================================
          Cape golden mole  ======================================================================

                      Human  ttagcgtcctgtgc----c
                      Chimp  ttagcgtcctgtgc----c
                    Gorilla  ttagcatcctgtgc----c
                  Orangutan  ttaacatcctgtgc----c
                     Gibbon  ttagcgtcctgtgc----c
                     Rhesus  ttaacgtcctgtgc----c
        Crab-eating macaque  ttaacgtcctgtgc----c
                     Baboon  ttaacgtcctgtgc----c
               Green monkey  ttaacatcctgtgc----c
                   Marmoset  ttaacgtcctgcac----c
            Squirrel monkey  ttaacgtcctgtgc----c
                   Bushbaby  -------cctgtga----c
         Chinese tree shrew  tggatgtcctatgt----c
                   Squirrel  tgggtgctctgtgg----c
     Lesser Egyptian jerboa  tggatgctcttggagtttt
               Prairie vole  tggaca----cgga----t
            Chinese hamster  tggaca--ctctga----t
                      Mouse  tggacgctctttga----t
                        Rat  tggacactctttga----c
             Naked mole-rat  tggacattctgtga----t
                 Guinea pig  tggacattctggg------
                 Chinchilla  tgggcattctgtga----t
           Brush-tailed rat  ---------cgtga----t
                     Rabbit  tga---------gc----c
                       Pika  tggatatccggtgc----t
                        Pig  tggatatcctgtga----c
                     Alpaca  tggatgccctggga----c
             Bactrian camel  tgggtgccctgggg----c
           Tibetan antelope  tggatatcctgtga----t
                        Cow  tggatgtcctgtga----t
                      Sheep  tggatgtcctgtga----t
              Domestic goat  tgaatgtcctgtga----t
                      Horse  tgaatgtcctgtga----c
           White rhinoceros  tggatgtcctgtga----c
                        Cat  tggacgtcttgtga----c
                    Ferret   tggatgtcctgtga----c
                      Panda  tggatgtcctgtga----c
             Pacific walrus  tggatgtcctgtga----c
               Weddell seal  tggatgtcctgtga----c
           Black flying-fox  tggctgtcctgtga----c
                    Megabat  tggctgtcctgtaa----c
              Big brown bat  tgggtgtcatgtga----c
       David's myotis (bat)  tgggtgtcatgtga----t
                   Microbat  tgggtgtcatgtga----t
                   Hedgehog  --------ctggag----a
                      Shrew  t-------cttgga----c
                   Elephant  t------------------
        Cape elephant shrew  t------------------
                    Manatee  t------------------
                     Tenrec  t------------------
                   Aardvark  t------------------
                  Armadillo  a------------------
            Green seaturtle  ===================
             Painted turtle  ===================
             Golden hamster  -------------------
                    Wallaby  ===================
            Star-nosed mole  -------------------
                        Dog  -------------------
                    Dolphin  ===================
           Cape golden mole  ===================

Inserts between block 18 and 19 in window
B D               Elephant 9bp
       Cape elephant shrew 8bp
B D                Manatee 9bp
B D                 Tenrec 9bp
                  Aardvark 8bp
B D              Armadillo 14bp

Alignment block 19 of 201 in window, 45542401 - 45542533, 133 bps 
B D                   Human  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D                   Chimp  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D                 Gorilla  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D               Orangutan  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D                  Gibbon  tc------ttctacaatt-ta--tctctgaga--------------------------------------
B D                  Rhesus  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D     Crab-eating macaque  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D                  Baboon  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D            Green monkey  tc------ttctgcaatt-ca--tctctgaga--------------------------------------
B D                Marmoset  tc------ttctgcagtt-ca--tctctggga--------------------------------------
B D         Squirrel monkey  tc------ttctgcagtt-ca--tctctgaga--------------------------------------
B D                Bushbaby  cc------ctctgcaata-gg--tttctgaga--------------------------------------
         Chinese tree shrew  ctatgccattctgcagct-gg--tctctgaga--------------------------------------
B D                Squirrel  c--------tttctagtt-gg--tttctgaga----------------------------------ttgc
     Lesser Egyptian jerboa  tg------ttttgttttt-gccatacttggggtgtaacccaagttttctcacatgctacacaagtgctgt
               Prairie vole  ca------ttttgcagtt-gg--tctttagga--------------------------------------
B D         Chinese hamster  ca------ttttgcagtt-agtctctttggga--------------------------------------
B D                   Mouse  ca------ttttgcagtc-tg--tcttgggga--------------------------------------
B D                     Rat  cg------gtttgcagat-gg--tctcgggga--------------------------------------
B D          Naked mole-rat  cc------ttctgcagtg-gg--cctcagaga--------------------------------------
B D              Guinea pig  -----------------g-gg--tctctgaga--------------------------------------
                 Chinchilla  cc------ttctgttctg-gg--tctctgggg--------------------------------------
           Brush-tailed rat  cc------tcctgtggtg-gg--tctctaagg--------------------------------------
B D                  Rabbit  cc------ttctgcaggt-gt--tctctgaga--------------------------------------
B D                    Pika  ct------ttctgttatg-gt--cctctgagg--------------------------------------
B D                     Pig  tt------ccctgaagct-gg--tctctggga--------------------------------------
B D                  Alpaca  at------ctctgaagtt-gg--tctctgaga--------------------------------------
             Bactrian camel  ct------ctctgaagtt-gg--tctctgaga--------------------------------------
           Tibetan antelope  ct------ctctgaagct-gg--tctctgtga--------------------------------------
B D                     Cow  ct------ctctgaagtt-gg--tctctgaga--------------------------------------
B D                   Sheep  ct------ctctgaagtt-ag--tctctgaga--------------------------------------
              Domestic goat  ct------ctctga---------------gga--------------------------------------
B D                   Horse  ct------ctctgaagtt-gg--tctctgaga--------------------------------------
B D        White rhinoceros  ct------ctctgaagtt-gg--tctctgaga--------------------------------------
B D                     Cat  ct------ctctgaagtt-gg--tctctggga--------------------------------------
B D                 Ferret   ct------ctctggagct-gg--tctctggga--------------------------------------
B D                   Panda  ct------ctctggagtt-gg--tctctggca--------------------------------------
             Pacific walrus  ct------ctgtggagct-gg--tctctggga--------------------------------------
               Weddell seal  ct------ctgtggagct-gg--tctctggga--------------------------------------
           Black flying-fox  ct------ctctgaagctggg--tctctgaga--------------------------------------
B D                 Megabat  ct------ctctgaagctggg--tctctgaga--------------------------------------
              Big brown bat  ct------ctgtgaagttagg--tctctgaga--------------------------------------
       David's myotis (bat)  ct------ctctgaagttggg--tctctgata--------------------------------------
B D                Microbat  ct------ctctgaagttggg--tctctgata--------------------------------------
B D                Hedgehog  tt------ctgtgatctt-cc--ccccc------------------------------------------
B D                   Shrew  ct------ctgagacatt-gg--tctctgaga--------------------------------------
B D                Elephant  -c------ttctggaatt-gg--tctctgaga--------------------------------------
        Cape elephant shrew  -c------ttc-agaatt-gg--tctctgaga--------------------------------------
B D                 Manatee  -c------ttctggaatt-gg--tctctgaga--------------------------------------
           Cape golden mole  tc------ttcttgaatt-gg--tctctgaga--------------------------------------
B D                  Tenrec  -c------ttcaggaatt-gg--tctctgaga--------------------------------------
                   Aardvark  tc------ttctagaact-gg--tctctgaga--------------------------------------
B D               Armadillo  cc------ttctgaaatt-tg--tgtctgaga--------------------------------------
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
            Golden hamster  ----------------------------------------------------------------------
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
B D                     Dog  ----------------------------------------------------------------------
B D                 Dolphin  ======================================================================

                      Human  -----------------------------------------tttcaccac--ttctacacccttcc-tc-
                      Chimp  -----------------------------------------tttcaccac--ttctacacccttcc-tc-
                    Gorilla  -----------------------------------------tttcagcac--ttctacacccttcc-tt-
                  Orangutan  -----------------------------------------tttcaccac--ttctacacccttcc-tc-
                     Gibbon  -----------------------------------------tttcaccac--ttctacacccttcc-tc-
                     Rhesus  -----------------------------------------cttcaccac--ttctacacccttcc-tc-
        Crab-eating macaque  -----------------------------------------cttcaccac--ttctacacccttcc-tc-
                     Baboon  -----------------------------------------cttcaccac--ttctacacccttcc-tc-
               Green monkey  -----------------------------------------cttcaccac--ttctacacccttcc-tc-
                   Marmoset  -----------------------------------------tttcaccac--ttccgtacccttcc-tc-
            Squirrel monkey  -----------------------------------------tttcaccac--ttctgtacccttcc-tc-
                   Bushbaby  -----------------------------------------tttctgccc--ttttctaccctccc-tc-
         Chinese tree shrew  -----------------------------------------tttcaccac---tccgcatcctccc-tc-
                   Squirrel  accacc-----------------------------------tccttc--------------cttcc-tt-
     Lesser Egyptian jerboa  accactaaggtacatccccggcagactggattctccttgttcccttgtca--t-------tctccc-at-
               Prairie vole  -----------------------------------------cccttctat--g-------tcccct-tc-
            Chinese hamster  -----------------------------------------ctcttctac--a-------tccccc-tcc
                      Mouse  -----------------------------------------cccttctac--a-------tccccc-tt-
                        Rat  -----------------------------------------cccttctac--a-------tccccc-tt-
             Naked mole-rat  -----------------------------------------ttttgccac--ctttgcattcttac-tc-
                 Guinea pig  -----------------------------------------ttttgtcac--t--------tttgc-at-
                 Chinchilla  -----------------------------------------ttttgccat--c--------cttac-tc-
           Brush-tailed rat  -----------------------------------------tcttgccgt--c--------cttac-tt-
                     Rabbit  -----------------------------------------ttccgccgc--c--------tcgac-cc-
                       Pika  -----------------------------------------tcctaccac--c--------tctg-----
                        Pig  -----------------------------------------tttcatcat--gtctgcatcctccc-tc-
                     Alpaca  -----------------------------------------tttcgccat--gtttgcatcctccc-tc-
             Bactrian camel  -----------------------------------------tttcgccat--gtttgcatcctccc-tc-
           Tibetan antelope  -----------------------------------------cctcaccat--gtctgcatcctctc--c-
                        Cow  -----------------------------------------cctcactat--gtctgcatcctctc--c-
                      Sheep  -----------------------------------------cctcaccat--gtctgcatcctctc--c-
              Domestic goat  -----------------------------------------cctcaccat--gtctgcatcctctc--c-
                      Horse  -----------------------------------------tttcaccac--atctgcatcctccc-tc-
           White rhinoceros  -----------------------------------------ttttaccac--gtctgcatcctccc-tc-
                        Cat  -----------------------------------------tttcatcat--gtctgcatcctcct-tc-
                    Ferret   -----------------------------------------gttcaccat--gtttgcatcctccc-tc-
                      Panda  -----------------------------------------ttccaccat--gtctgcatcctccc-tc-
             Pacific walrus  -----------------------------------------tttcaccat--gtctgcatcctccc-tg-
               Weddell seal  -----------------------------------------tttcaccat--gtatgtatgctccc-tc-
           Black flying-fox  -----------------------------------------ttttatcaa--gtctgcatcttccc-tc-
                    Megabat  -----------------------------------------ttttagcaa--gtctgcatcttccc-tc-
              Big brown bat  -----------------------------------------tttcaccac--atctgcaccctccc-tc-
       David's myotis (bat)  -----------------------------------------tttcaccac--atctgcaccctccc-tc-
                   Microbat  -----------------------------------------tttcaccac--atctgcaccctccc-tc-
                   Hedgehog  -----------------------------------------ccccaaagttgctctgcattctacc-tc-
                      Shrew  -----------------------------------------tcccaccat--ctctgcaccttccc-tc-
                   Elephant  -----------------------------------------tttcaccac--ttctgcatcctcct-tc-
        Cape elephant shrew  -----------------------------------------ttttgccat--ttctgcctcatcctctt-
                    Manatee  -----------------------------------------tttcaccac--ttctgcatcctcc--tt-
           Cape golden mole  -----------------------------------------ttttgccac--gtctgcatcctcct-tc-
                     Tenrec  -----------------------------------------tatggcctc--ttctgccttctcct-tc-
                   Aardvark  -----------------------------------------ttttgccac---tctgcatcctcct-tc-
                  Armadillo  -----------------------------------------tttcatcac--ttctgcaacctccc-tc-
            Green seaturtle  ======================================================================
             Painted turtle  ======================================================================
             Golden hamster  ----------------------------------------------------------------------
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                    Dolphin  ======================================================================

                      Human  -cacccctcctaattccc---ctcatact-tgccagcattg--------att-act-tctac------a-
                      Chimp  -caccactcctaattccc---ctcatact-tgccagcattg--------att-act-tctac------a-
                    Gorilla  -cacccctcctaattccc---ctcatact-tgccagcattg--------att-act-tctac------a-
                  Orangutan  -cacccctcccaattccg---ctcatact-tgccagcattg--------att-act-tctac------a-
                     Gibbon  -cacccctcctaactccc---ctcatact-tgccagcattg--------att-act-tctac------a-
                     Rhesus  -cagccctcctaactccc---cccatact-tgccagccttg--------att-act-tctac------a-
        Crab-eating macaque  -cagccctcctaactccc---ctcatact-tgccagccttg--------att-act-tctac------a-
                     Baboon  -cagccctcctaactccc---ctcatact-tgccagccttg--------att-act-tctac------a-
               Green monkey  -cagccctcctaactccc---ctcatact-tgccagccttg--------att-act-tctac------a-
                   Marmoset  -tacccctcctaactccc---ctcatact-tgccaatattg--------att-act-tctac------a-
            Squirrel monkey  -taccccgcctaactccc---ctcatact-tgccaacattg--------att-act-tctac------g-
                   Bushbaby  -caccccttctcactctc---ctcatgct-tgccatcttta--------attcacc-tccat------g-
         Chinese tree shrew  -aatccctcctaactact---ctcatact-taccagctttg--------attcagt-tc--c------a-
                   Squirrel  -caggctgccggaatccc---ctgatgct-tgctggcattg--------attca-c-ctcct------g-
     Lesser Egyptian jerboa  -cactcctcccaaacccagtcttcatatt-ggttaac--------------------cccat------g-
               Prairie vole  -ca-cccccctaaatccc---tttttgtt-tgctaac------------------t-ccccc------a-
            Chinese hamster  aca-ccctcctaaatccc----ttctgtt-tgctaac------------------t-cctcc------a-
                      Mouse  -cacccctcctaaatccg---ttcttgtt-tgctaac------------------t-ccccc------a-
                        Rat  -catccctcctaaatccg---tccttgtt-tgttacc------------------cgccccc------a-
             Naked mole-rat  -cacccctcctaagtccc---atcatact-tgctagctttg--------cttcatc-tccac------a-
                 Guinea pig  -ccttact--------cc---accctcct-tgttagccttg--------cttcatc-tccac------a-
                 Chinchilla  -cacccctcctaagtccc---atcatact-tgctagctttg--------cttcatc-tccac------a-
           Brush-tailed rat  -ctcccctcccatgcccc---atcctact-tgctagctttg--------cttcatc-tccac------a-
                     Rabbit  -cgcccccc-----gcca---ctgcccct-ggccagctttg--------ctccacc-ttcac------g-
                       Pika  -cacctccc-----tcca---tggctcct-cgccagccctgagtca---ctccatc-ttcat--------
                        Pig  -ca------------ctt---gtcatact-caccagctttg--------attcaca-actgc------g-
                     Alpaca  -tg------------ccc---cttatact-tgccaggtttg--------attcatg-accat------g-
             Bactrian camel  -tg------------ccc---cttatact-tgccaggtttg--------attcatg-accat------g-
           Tibetan antelope  -ta------------ctc---ctaatact-tgccagctttg--------atccaca-accac------a-
                        Cow  -ca------------ctc---ctaatact-tgccagctttg--------atccaca-accac------a-
                      Sheep  -ta------------------ctaatact-tgccagctttg--------atccaca-accac------a-
              Domestic goat  -ta------------ctc---ctaatact-tgccagctttg--------atccaca-accac------g-
                      Horse  -ca------------ccc---ctcatgcattgtcacctttg--------attcatg-accac------a-
           White rhinoceros  -ca------------ccc---ctcatgca-tgtcacctttg--------agtcatg-accac------a-
                        Cat  -ca------------tcc---ctcatact-tgccagctttg--------attcatg-accac------g-
                    Ferret   -ca------------ccc---ctcatact-tgccagctttg--------a-tcatg-gccac--------
                      Panda  -ca------------ccc---ctcatact-tgccagctttg--------attcatg-accacgctggga-
             Pacific walrus  -ca-----------cccc---ctcatact-tgccagctttg--------a-tcatg-agcac------a-
               Weddell seal  -ca------------ccc---ctcatact-tgccagctttg--------a-tcatg-agcat------a-
           Black flying-fox  -ca------------ccc---gtcatcct-tgccagctttg--------attcaca--------------
                    Megabat  -ca------------ccc---ctcatcct-tgccagctttg--------attcaca--------------
              Big brown bat  -ca------------ctc---ctcacact-tgccagctttg--------attcatg-accac------g-
       David's myotis (bat)  -ca------------ctc---ctcatact-tgccagctttg--------gttcatg-gccac------g-
                   Microbat  -ca------------ctc---ctcatact-ggccagctttg--------attcatg-accac------gt
                   Hedgehog  -tg------------ccc---ctcacatt-tactagcttt------------ccca-aaccc------ct
                      Shrew  -tg------------cct---ctcatact-taccagatttt--------tgccacg-aatac------c-
                   Elephant  -cactcctcttagctccc---cttaccct-ggccagttttg--------attaatc-accac------c-
        Cape elephant shrew  -tgcacctcttacctccc---cttttagt-ggccattttta--------attaatg-actat------c-
                    Manatee  -tacccctcttagctccc---ctgacaat-tcccctccttgactgtattattaata-accac------c-
           Cape golden mole  -cacccttcttagctccc---ttcatact-ggccagttttg--------actaatg-gccat------c-
                     Tenrec  -cacccctcttaatgccc---ctcctact-ggccagttttg--------atgagtg-accac------t-
                   Aardvark  -cactcctcttagctccc---ctcatatt-gaccagttttg--------attaatt-actac------t-
                  Armadillo  -cacccct-------------------aa-atccagtttta--------attaatg-gccat------t-
            Green seaturtle  ======================================================================
             Painted turtle  ======================================================================
             Golden hamster  ----------------------------------------------------------------------
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                    Dolphin  ======================================================================

                      Human  -----tcccttctcatcctcag-------ttcctcatactcagaaagt--a
                      Chimp  -----tcccttctcatcctcag-------ttcctcatactcagaaagt--a
                    Gorilla  -----tcccttctcatcctcag-------ttcctcatactcagaaagt--a
                  Orangutan  -----tcccttctcatcctcag-------ttcctcatactcagaaagt--a
                     Gibbon  -----tcccttctcatcctcag-------ttcctcatactcagaaagt--a
                     Rhesus  -----tcccttctcatcctcag-------ttcc-------cagaaagt--a
        Crab-eating macaque  -----tcccttctcatcctcag-------ttcc-------cagaaagt--a
                     Baboon  -----tcccttctcatcctcag-------ttcc-------cagaaagt--a
               Green monkey  -----tcccttctcatcctcag-------ttcc-------cagaaagt--a
                   Marmoset  -----tccc-tctcatcctcag-------ttcc-------cagaaagt--a
            Squirrel monkey  -----tccc-tctcatcctcag-------ttcc-------cagaaagt--a
                   Bushbaby  -----tcccgtttgatcttaag-------ttcc-------taggaagc--c
         Chinese tree shrew  -----tgcccttccatcctcaa-------tccc-------ca---------
                   Squirrel  -----tgcctc-ccaccctcag-------ttcc-------tgggaagc--c
     Lesser Egyptian jerboa  -----taccttactgtctttgg-------ttcc-------cagaaggc--t
               Prairie vole  -----taccttcccacctccag-------tttc-------cagagggc--c
            Chinese hamster  -----taccttcccatct-----------------------------t--c
                      Mouse  -----tatcttcccagcttcag-------tttc-------caggaggt--c
                        Rat  -----tatctt-ccagcttcac-------tttc-------taggaggt--c
             Naked mole-rat  -----tcctttctcatgcttag-------ttcc-------ccaaa-gt--c
                 Guinea pig  -----tcccttcccaacctcag-------ttcc-------caaaaagt--c
                 Chinchilla  -----ttccttcccatcctcac-------tccc-------caaaaggt--c
           Brush-tailed rat  -----ttccatcccaacctcag-------ttcc-------caaaaagt--c
                     Rabbit  -----ttcctgcccgccctcac-------tcac-------cagaaagc--c
                       Pika  ---------------cctcaag-------ttcc-------cagaaaac--c
                        Pig  -----tcccttcccaacctcag-------ttcc-------cagaaagc---
                     Alpaca  -----tccctgctcaacctcag-------ttcc-------cagaaagc---
             Bactrian camel  -----tccctgcccaatctcag-------ttcc-------cagaaagc---
           Tibetan antelope  -----tctcctcccaacctcag------tttcc-------caacaagc---
                        Cow  -----ccccctcccaacctcag------tttcc-------cagcaagc---
                      Sheep  -----tcccctcccaacctcag------tttcc-------caacaagc---
              Domestic goat  -----tcccctcccaacctcag------ttttc-------caacaagc---
                      Horse  -----tccactcccaatctcag-------ttcc-------cagaaag----
           White rhinoceros  -----ttccttcccaatctcaa-------ttcc-------cagaaagc---
                        Cat  -----tcccttcccaaactcaa-------ttcc-------cagaaagct--
                    Ferret   -----gaccttcccaacctcag-------ttcc-------cagaatacc--
                      Panda  -----tcccttcccaacctcag-------ttcc-------cataatgtg--
             Pacific walrus  -----tcccttcccaacctcag-------ttcc-------cagaatgcc--
               Weddell seal  -----tcccttcccaacctcag-------ttcc-------cagaatgcc--
           Black flying-fox  -----tcccttcctaacttcag-------cgtc-------cag-aaac---
                    Megabat  -----tcccttcctaacttcag-------catc-------cag-aaac---
              Big brown bat  -----ttttttcccagtctcag-------ttcc-------cagaaagc---
       David's myotis (bat)  -----ttttttcccagtctcag-------ttcc-------cactaagc---
                   Microbat  -----ttttttcccagtctcag-------ttcc-------cactaagc---
                   Hedgehog  ccctatacttccccaaactcag-------ttcc-------cagaaaac-c-
                      Shrew  -----cactttcccagtttcagcctcagtttcc-------caggaggc-c-
                   Elephant  -----tttctccccagcctcag-------ttcc-------tagaaagc--c
        Cape elephant shrew  -----ttcctccctggcctcag-------ttcc------------------
                    Manatee  -----ttcctccctagcctcag-------atcc-------cagaaa-c--t
           Cape golden mole  -----ttctttcccagcttcag-------tttc-------tagaaagc--c
                     Tenrec  -----ttcctccccagcctcag-------gtcc----cattataacgc--c
                   Aardvark  -----ttcttttccagcctcag-------ttcc-------tggaaagt--t
                  Armadillo  -----tctgttcccatcctcag-------ttcc-------cagaaagc--c
            Green seaturtle  ===================================================
             Painted turtle  ===================================================
             Golden hamster  ---------------------------------------------------
                    Wallaby  ===================================================
            Star-nosed mole  ---------------------------------------------------
                        Dog  ---------------------------------------------------
                    Dolphin  ===================================================

Alignment block 20 of 201 in window, 45542534 - 45542553, 20 bps 
B D                   Human  actttgtcttgccttttgcc
B D                   Chimp  actttgtctagccttttgcc
B D                 Gorilla  actttgtctagccttttgcc
B D               Orangutan  acttggtctagccttttgcc
B D                  Gibbon  actttgtctagccttttgcc
B D                  Rhesus  gctttgtctaccgctttgcc
B D     Crab-eating macaque  gctttgtctaccgctttgcc
B D                  Baboon  gctttgtctaccgctttgcc
B D            Green monkey  gctttgtctaccgctttgcc
B D                Marmoset  actttgtctgtccctttgcc
B D         Squirrel monkey  actttgtctacccctttgcc
B D                Bushbaby  acgttgtctgtccctttaca
         Chinese tree shrew  -ctctgtctacccctctgcg
B D                Squirrel  -c--taact-cccctctgca
     Lesser Egyptian jerboa  gc--tggct-cagctctgca
               Prairie vole  ac------------------
B D         Chinese hamster  ac------------------
B D          Naked mole-rat  ac--tatct-cctttctgca
B D              Guinea pig  ac--tgtct-cccttctgca
                 Chinchilla  ac--tgtct-ccctcctgca
           Brush-tailed rat  at--catct-cccttctgca
B D                  Rabbit  accccgtctaccccttggaa
B D                    Pika  accccgtctacttctgggaa
B D                     Pig  -cactgtccaaccctctgca
B D                  Alpaca  -caccatccgaccctctaca
             Bactrian camel  -caccatccgaccctctgca
           Tibetan antelope  -catcctcccaccctctgca
B D                     Cow  -catggtcccaccctctgca
B D                   Sheep  -catggtcccaccctctgca
              Domestic goat  -catcatcgcaccctctgca
B D                   Horse  -------ccagccctctgca
B D        White rhinoceros  c-attgtccaaccctctgca
B D                     Cat  --gctatccaaccctctgcc
B D                     Dog  cctctatcgacccctctaca
B D                 Ferret   --gccgtccatccctctgcc
B D                   Panda  --gcagtccaaccctctgcc
             Pacific walrus  --gctgtccatccctctgcc
               Weddell seal  --actgtccatccctctgcc
           Black flying-fox  -cactgtctaaccctctgtg
B D                 Megabat  -cactgtctaaccctctgtg
              Big brown bat  -ccctgtccaaccctctgtg
       David's myotis (bat)  -ccctgtccagccctctgtg
B D                Microbat  -ccctgtccaaccctctgtg
B D                Hedgehog  --actgtgccaccctcgggg
B D                   Shrew  --acttttctgcg-------
B D                Elephant  actctgcctacccctttgca
        Cape elephant shrew  ---ctggtaactgctctgca
B D                 Manatee  attctgcctacccctctgca
           Cape golden mole  actctgtctagccctctgtg
B D                  Tenrec  actctgctcacccttcttgg
                   Aardvark  actcgacctacccctctttg
B D               Armadillo  attttgcctactgctcagca
  D         Green seaturtle  ====================
  D          Painted turtle  ====================
            Golden hamster  --------------------
B D                     Rat  --------------------
B D                 Wallaby  ====================
           Star-nosed mole  --------------------
B D                   Mouse  --------------------
B D                 Dolphin  ====================

Alignment block 21 of 201 in window, 45542554 - 45542568, 15 bps 
B D                   Human  aggtgcattct-----tacc
B D                   Chimp  aggtgcattct-----tacc
B D                 Gorilla  aggtgcattct-----tacc
B D               Orangutan  aggtgcattct-----tacc
B D                  Gibbon  aggtgcattct-----tacc
B D                  Rhesus  aggtgtattct-----cacc
B D     Crab-eating macaque  aggtacatttt-----tacc
B D                  Baboon  aggtgcattct-----cacc
B D            Green monkey  aggtgcattct-----cacc
B D                Marmoset  aggtgcattct-----gatc
B D         Squirrel monkey  aggtgcattct-----gacc
B D                Bushbaby  aggtgca-tct-----tacc
         Chinese tree shrew  gggtacattct-----tacc
B D                Squirrel  aggtgcagtcc-----tctc
     Lesser Egyptian jerboa  agatgcgttct-----tacc
               Prairie vole  -agtaccgtcctgtcttccc
B D         Chinese hamster  -aatgccgccc-----ctcc
B D                   Mouse  -----ccgtct-----ctct
B D                     Rat  -----ctgtct-----cccc
B D          Naked mole-rat  aggtgaattct-----tact
B D              Guinea pig  aagcaaattct-----tact
                 Chinchilla  aggcaaattct-----tatt
           Brush-tailed rat  gggtgaattct-----tact
B D                  Rabbit  aggcgctttat-----tacc
B D                    Pika  agatgtatctt-----acac
B D                     Pig  agacaccttct-----tccc
B D                  Alpaca  aggtgaattct-----tacc
             Bactrian camel  aggtgaattct-----tacc
           Tibetan antelope  aggctcatgct-----tacc
B D                     Cow  aggctcattct-----tacc
B D                   Sheep  aggctcattct-----tacc
              Domestic goat  aggttcattct-----tacc
B D                   Horse  aggagcattct-----tacc
B D        White rhinoceros  aggcacattct-----tacc
B D                     Cat  aggtgcatact-----tacc
B D                     Dog  aggtgcattct-----tacc
B D                 Ferret   aggtgcatgct-----catc
B D                   Panda  aggtgcacgct-----cacc
             Pacific walrus  aggtgcatgct-----cacc
               Weddell seal  aggtgcatgct-----cacc
           Black flying-fox  agatgtattct-----tg-c
B D                 Megabat  agatgtattct-----tgcc
              Big brown bat  agatgtattct-----ttcc
       David's myotis (bat)  agatatattct-----tacc
B D                Microbat  agatgtattct-----tacc
B D                Hedgehog  agctacat------------
B D                   Shrew  tggtgtattct-----tacc
            Star-nosed mole  aggtgcattct-----cacc
B D                Elephant  aggtgcattct-----cacc
        Cape elephant shrew  aggtgtagtct-----ggtc
B D                 Manatee  aggtgcattct-----cacc
           Cape golden mole  atgtgcattct-----cacc
B D                  Tenrec  agatgcgtccc-----cttc
                   Aardvark  aggtgcatttt-----cacc
B D               Armadillo  aggtgtattct-----tact
  D         Green seaturtle  ====================
  D          Painted turtle  ====================
            Golden hamster  --------------------
B D                 Wallaby  ====================
B D                 Dolphin  ====================

Inserts between block 21 and 22 in window
              Prairie vole 16bp
B D        Chinese hamster 9bp

Alignment block 22 of 201 in window, 45542569 - 45542643, 75 bps 
B D                   Human  tcctgatc-------------agagctggt------tctgtcagcaccaggtctgccaaagatgtag-ct
B D                   Chimp  tcctgatc-------------agagctggt------tctgtcagcaccaggtctgccaaagatgtag-ct
B D                 Gorilla  ccctgatc-------------agagctggt------tctgtcagcaccaggtctgccaaagatgtag-ct
B D               Orangutan  tcctgatc-------------agagctggt------tctgtcagcaccacgtctgccaaagatgtag-ct
B D                  Gibbon  tcctgatc-------------ggagctggt------tctgtcagcaccaggtctgccaaagatgtag-ct
B D                  Rhesus  tcctgatc-------------agagctggt------tctgtcagcagcaggtctgccaaagatgtag-ct
B D     Crab-eating macaque  tcgtgatc-------------agagctggt------tctgtcagcagcaggtctgccaaagacgtag-ct
B D                  Baboon  tcctgatc-------------agagctggt------tctgtcagcagcaggtctgccaaagatgtag-ct
B D            Green monkey  tcctgatc-------------agagctggt------tctgtcagcagcaggtctgccaaagatgtag-ct
B D                Marmoset  tcccgatt-------------ggagctggt------tctgtcagcaccaggtctgccaaagatgtag-ct
B D         Squirrel monkey  tcctggtt-------------ggagctggt------tctatcagcaccaggtctgccaaagatgtag-ct
B D                Bushbaby  ccccactt-------------ggagctggc------tctgttagtaccaggtctgccaaggatggag-c-
         Chinese tree shrew  tccagact-------------ggagctgga------tctgtcaacaccaggtctgccaagaacattg-ct
B D                Squirrel  tcctggtt-------------ggagcgggt------tctgttg-gcactggtctgccaaggacacag-ct
     Lesser Egyptian jerboa  acctgacc-------------acagcaaga------tctttc---------------aagggcaaag-ct
               Prairie vole  tcctgagc-------------agacctaat------tctgcca------ggtctgagaaggacctag-ct
B D         Chinese hamster  tcctgatc-------------agttctagt------tctgtca------ggtctgagaagggcatag-ct
             Golden hamster  tcctgacc-------------ggttccaat------tctgtca------agtatgagaaggacacag-ct
B D                   Mouse  ccctgatc-------------agatgtagc------tctgtca------ggtcagagaaagacacag-ct
B D                     Rat  tcctgatc-------------aaatggagt------cctgtca------ggtctgagaaagacacag-ct
B D          Naked mole-rat  tcctgatt-------------acagctggt------gctgtag-cactgggtctgccaaggaaatgg-ct
B D              Guinea pig  tcctggtt-------------caagctggt------gctgtag-ctgtggatcagcccaggaaatgg-ct
                 Chinchilla  tcctgatt-------------agagctggt------gctatag-cactgggtctgccaaggaaatgg-ct
           Brush-tailed rat  tcctgcat-------------agaactggt------gctatga-cactgggtctgccaaccaaatgg-ct
B D                  Rabbit  tcccgccc-------------------------------gcag-c-ccaggtttgccaaggacaaa----
B D                    Pika  tcccacctccattccagctggggagctgga------ttggcag-caccaggtttgccaaggacaca----
B D                     Pig  tcctgatg-------------ggagttggt---------------------tccctcaaggatgtaa-cc
B D                  Alpaca  tcctggtc-------------agagttggt------tctgtctgcacctggtctgtcaaggatgtaa-cc
             Bactrian camel  tcctggta-------------agagttggt------tctgtctgcacctggtctgtcaaggacgtaa-cc
           Tibetan antelope  tgctgatc-------------agagctggtcagttcctggtcttcacctggtctgtcaaggatgcag-ct
B D                     Cow  tgctgatc-------------gtggctggtcagttcctgatcttcacttggtctgtcaaggatgcaa-ct
B D                   Sheep  tgctgatc-------------agagctggtcagttcctggtcttcacctggtctgtcaaggatgcaa-ct
              Domestic goat  tgctgatc-------------ggagctggtcagttcctggtcttcacctggtctgtcaaggatgcaa-ct
B D                   Horse  tcctgatg-------------ggagctcgt------tctatcagcatgtaatctgccaaggatataa-cc
B D        White rhinoceros  tcctgatg-------------ggagctggt------tctatcagcacctagtctgccaaggatgcag-cc
B D                     Cat  ccccaagt-------------ggagctggc------tctgccagca-ctggtctgccaaggacgtag-cc
B D                     Dog  ttgtgatt-------------gga-cttgt------tctatttgccccaggcctgccaacttcctggaat
B D                 Ferret   t-ccaagt-------------ggagttggc------tctgtcagcacctggcttgtcaaggctatggccc
B D                   Panda  tcccaagt-------------ggagttggc------actgtcagcacctggcctgccaagactgtgg-cc
             Pacific walrus  tcccaagt-------------ggagctggc------tctgtcagcacctggcctgccaaggctgtgg-cc
               Weddell seal  tcccaagt-------------ggagctggc------cctgccagcacctggcctgccaaggctgtgg-cc
           Black flying-fox  tcctgaat-------------ggagctggt------tctgtcagctcctggtctgccgaggatgtgg-ct
B D                 Megabat  tcctgaat-------------ggagctggt------tctgtcagctcctggtctgccgaggatgtgg-ct
              Big brown bat  tcctgctt-------------ggagctgat------tgtgtcagcacctagtcagccaaggatgcag-cc
       David's myotis (bat)  tcctggtt-------------gaagctgat------tgt---------------gccaaggatgcag-cc
B D                Microbat  tcctgatt-------------gaagctgat------tgt---------------gccaaggatgcag-cc
B D                Hedgehog  ----gaac-------------agagctggc------tctggtagcacctgttctgcctagattgtca-cc
B D                   Shrew  t-cctggt-------------cggggccga------tgctttggcacctggtcctccaaga-aggca-cc
            Star-nosed mole  t-ctggat-------------tggactggt------tctacctgccccagaccctgccag----------
B D                Elephant  ccctgatg-------------ggagctgc-------tctgtcagcaccaggtctg-cgaggtcataa-cc
        Cape elephant shrew  ctctga--------------------------------cgtcggggccaggtcagcctcggtcctag-cc
B D                 Manatee  ccc-gatg-------------ggagctgg-------tctgtcagcaccaggtctgccgaggtcatag-cc
           Cape golden mole  ctgtgatg-------------ggagatgc-------tctgtcagcaccaggtctgccaaggtcataa-tc
B D                  Tenrec  ccttgatg-------------ggcgctgg-------tctgtcagcatc-gctatggtgagctcacag-tc
                   Aardvark  cctttatg-------------ggaattgg-------tctgtcattgccaagtctgctgaggtcatag-cc
B D               Armadillo  ccctgatt-------------agagctggt------tctgtcaggaccaggactg-tcaggttgtag-ct
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  g-tcctggaatgga-cc----agcc-aacacc
                      Chimp  g-tcctggaatgga-cc----agcc-aacacc
                    Gorilla  g-tcctggaatgga-cc----agcc-aacacc
                  Orangutan  g-tcctggaatgga-cc----agcc-aacacc
                     Gibbon  g-tcctggaatgga-ct----agcc-aacacc
                     Rhesus  g-tcctggaaagga-cc----agtc-aacacc
        Crab-eating macaque  g-tcctggaaagga-cc----agtc-aacacc
                     Baboon  g-tcctggaaagga-cc----agtc-aacacc
               Green monkey  g-tcctggaaagga-cc----agtc-aacacc
                   Marmoset  g-tcc-ggaatg-a-cc----agca-aacacc
            Squirrel monkey  g-tcctgaaatgaa-cc----agcc-aacacc
                   Bushbaby  -------gaatgga-cc----aacc-aacacc
         Chinese tree shrew  c-tcttggaacaga-cc----agcc-atcccc
                   Squirrel  c-ccttgggacgga-tc----aatc-aacatc
     Lesser Egyptian jerboa  a-tctgca-atgat-cc----agct-agcacc
               Prairie vole  g-ctttag-acagg-cc----aacc-------
            Chinese hamster  a-ccttgggacagg-cc----aaccacacccc
             Golden hamster  g-cctaggcacaga-cc----gacc-cacgcc
                      Mouse  g-ccttgggacagg-tc----aacc-cacacc
                        Rat  g-ccttgggacagg-cc----aacc-cacacc
             Naked mole-rat  a-tcctgcaatgga-cc----agcc-aacacc
                 Guinea pig  a-ccctggaatgga-cc----agcc-aagacc
                 Chinchilla  a-tcctggaatgga-cc----agcc-aatact
           Brush-tailed rat  a-tcctggaatgga-cc----aacc-aacact
                     Rabbit  ---------gcagg-tg----agcc-agcgcg
                       Pika  ---------acagg-tg----agcc-aatgc-
                        Pig  a-tcccagaaggga-cc----aagg-gacacc
                     Alpaca  a-tcctggaatgga-cc----aacc-aacacc
             Bactrian camel  a-tcctggaatgga-cc----aacc-aacacc
           Tibetan antelope  a-tcctggaatggg-cc----aagc-aacact
                        Cow  a-ttctggtatggg-cc----aagc-aacacc
                      Sheep  a-tcctggaatggg-cc----aagc-aacact
              Domestic goat  a-tcctggaatggg-cc----aagc-aacact
                      Horse  a-tcttggaacaga-cc----agcc-aacacc
           White rhinoceros  a-tcctggaatgga-cc----agcc-aacacc
                        Cat  a-accctgaacaaa-gc----aacc-aacacc
                        Dog  g-ggcc----------c----gcca--acacc
                    Ferret   a-tgcctgaacaaa-gc----agct--gcaca
                      Panda  a-tgcctgaacaaa-gc----agcc--acaca
             Pacific walrus  g-tgcctgaacaaa-gc----agct--acaca
               Weddell seal  a-tgcctgaacaaa-gc----acct--acaca
           Black flying-fox  c-tcctggaacgga-cc----tgcc-aacacc
                    Megabat  c-tcctggaacgga-cc----tgcc-aacacc
              Big brown bat  a-t-ttagaatgga-ct----agcc-aacacc
       David's myotis (bat)  a-tcctagagtgga-ct----agcc-aacacc
                   Microbat  a-tcctagaatgga-ct----agcc-aacacc
                   Hedgehog  a-ccccagaggaca-ct----ctcc-agcacc
                      Shrew  a-accctgaaggga-cc----agcc-aatatc
            Star-nosed mole  ----tctccaggaa-cctgcgggcc-aacact
                   Elephant  a-tcctggaatgag-tc----gacc-agcacc
        Cape elephant shrew  a-tacagaaatgga-tc----actc-agcact
                    Manatee  a-tcctggaatggg-tc----accc-agcacc
           Cape golden mole  t-tcctggcatggg-ct----gagc-atcacc
                     Tenrec  a-tcctgggaggggtca----gcgc-a----c
                   Aardvark  a-tcctagaatggg-tc----aacc-agcacc
                  Armadillo  gttcctagaataga-ct----aatc-aacacc
            Green seaturtle  ================================
             Painted turtle  ================================
                    Wallaby  ================================
                    Dolphin  ================================

Alignment block 23 of 201 in window, 45542644 - 45542653, 10 bps 
B D                   Human  cagacctcc------c
B D                   Chimp  cagacctcc------c
B D                 Gorilla  cagacctcc------c
B D               Orangutan  cagacctcc------c
B D                  Gibbon  cagacctcc------c
B D                  Rhesus  cagacctcc------c
B D     Crab-eating macaque  cagacctcc------c
B D                  Baboon  cagacctcc------c
B D            Green monkey  cagacctcc------c
B D                Marmoset  cagacctcc------c
B D         Squirrel monkey  cagacctcc------c
B D                Bushbaby  cagacctcc------c
         Chinese tree shrew  ctaatctcc------c
B D                Squirrel  cagacctcc------c
     Lesser Egyptian jerboa  cacacatcc------c
               Prairie vole  cacacctcc------c
B D         Chinese hamster  cacacctcc------c
             Golden hamster  cacacctcc------c
B D                   Mouse  cacatttcc------g
B D                     Rat  aatgcttcc------c
B D          Naked mole-rat  cagacctcc------t
B D              Guinea pig  caaatctct------t
                 Chinchilla  cagatctct------t
           Brush-tailed rat  cagatcttt------t
B D                  Rabbit  cagccctcc------c
B D                    Pika  ---cctcct------c
B D                     Pig  aagaccacc------c
B D                  Alpaca  cagaactct------c
             Bactrian camel  cagaactct------c
           Tibetan antelope  ccaactccc------c
B D                     Cow  cacactccc------c
B D                   Sheep  ccgactccc------c
              Domestic goat  ccaactccc------c
B D                   Horse  cagacttcc------c
B D        White rhinoceros  cagacctcc------c
B D                     Cat  cagaccttt------c
B D                     Dog  cagatctcc------c
B D                 Ferret   caggcctgt------c
B D                   Panda  ca-gcctgc------c
             Pacific walrus  caggtctgc------t
               Weddell seal  caggtctgc------t
           Black flying-fox  cagacatcc------c
B D                 Megabat  cagacatcc------c
              Big brown bat  cagacct-c------c
       David's myotis (bat)  cagaccg-c------c
B D                Microbat  cagacct-c------c
B D                Hedgehog  cagatctcc------c
B D                   Shrew  ----cctccctta--c
            Star-nosed mole  -ggacctcggtgagcc
B D                Elephant  cagacctcc------c
        Cape elephant shrew  ccacgctct------c
B D                 Manatee  cagacctcc------c
           Cape golden mole  cagacctcc------c
B D                  Tenrec  cagacctcc------c
                   Aardvark  cagacctcc------c
B D               Armadillo  cagacctcc------c
         Southern platyfish  caggccgac------a
  D         Green seaturtle  ================
  D          Painted turtle  ================
B D                 Wallaby  ================
B D                 Dolphin  ================

Inserts between block 23 and 24 in window
B D                  Mouse 73bp
B D                    Rat 241bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp

Alignment block 24 of 201 in window, 45542654 - 45542656, 3 bps 
B D                   Human  ggc
B D                   Chimp  agc
B D                 Gorilla  agc
B D               Orangutan  aac
B D                  Gibbon  agc
B D                  Rhesus  agc
B D     Crab-eating macaque  agc
B D                  Baboon  agc
B D            Green monkey  agc
B D                Marmoset  agc
B D         Squirrel monkey  agc
B D                Bushbaby  agc
         Chinese tree shrew  agc
B D                Squirrel  agt
     Lesser Egyptian jerboa  tga
               Prairie vole  a-g
B D         Chinese hamster  agg
             Golden hamster  agg
B D                   Mouse  agg
B D                     Rat  agg
B D          Naked mole-rat  agc
B D              Guinea pig  agc
                 Chinchilla  agt
           Brush-tailed rat  agc
B D                     Pig  ccc
B D                  Alpaca  agc
             Bactrian camel  agc
           Tibetan antelope  cgc
B D                     Cow  ccc
B D                   Sheep  ctc
              Domestic goat  ccc
B D                   Horse  agc
B D        White rhinoceros  agt
B D                     Cat  agc
B D                     Dog  act
B D                 Ferret   aga
B D                   Panda  agc
             Pacific walrus  ggc
               Weddell seal  ggc
           Black flying-fox  cgc
B D                 Megabat  cgc
              Big brown bat  cac
       David's myotis (bat)  cac
B D                Microbat  cac
B D                Hedgehog  aac
B D                   Shrew  aat
            Star-nosed mole  cag
B D                Elephant  agg
        Cape elephant shrew  agc
B D                 Manatee  agg
           Cape golden mole  aac
B D                  Tenrec  agc
                   Aardvark  agc
B D               Armadillo  gac
         Southern platyfish  ggc
  D         Green seaturtle  ===
  D          Painted turtle  ===
B D                 Wallaby  ===
B D                    Pika  ---
B D                  Rabbit  ---
B D                 Dolphin  ===

Alignment block 25 of 201 in window, 45542657 - 45542658, 2 bps 
B D                   Human  a------t
B D                   Chimp  a------t
B D                 Gorilla  a------t
B D               Orangutan  a------t
B D                  Gibbon  a------t
B D                  Rhesus  a------t
B D     Crab-eating macaque  a------t
B D                  Baboon  a------t
B D            Green monkey  a------t
B D                Marmoset  c------t
B D         Squirrel monkey  c------t
B D                Bushbaby  g------t
         Chinese tree shrew  a------c
B D                Squirrel  g------t
     Lesser Egyptian jerboa  a------t
               Prairie vole  a------t
B D         Chinese hamster  a------c
             Golden hamster  a------c
B D                   Mouse  a------c
B D                     Rat  agtgaagc
B D          Naked mole-rat  a------t
B D              Guinea pig  a------t
                 Chinchilla  a------t
           Brush-tailed rat  a------t
B D                     Pig  g------c
B D                  Alpaca  a------t
             Bactrian camel  a------t
           Tibetan antelope  c------t
B D                     Cow  t------c
B D                   Sheep  t------c
              Domestic goat  a------c
B D                   Horse  g------t
B D        White rhinoceros  g------t
B D                     Cat  a------t
B D                     Dog  g------g
B D                 Ferret   a------g
B D                   Panda  a------g
             Pacific walrus  a------g
               Weddell seal  a------g
           Black flying-fox  a------t
B D                 Megabat  a------t
              Big brown bat  g------t
       David's myotis (bat)  g------t
B D                Microbat  g------t
B D                Hedgehog  a------t
B D                   Shrew  a------t
            Star-nosed mole  a------g
B D                Elephant  g------t
        Cape elephant shrew  a------t
B D                 Manatee  g------t
           Cape golden mole  a------t
B D                  Tenrec  g------t
                   Aardvark  a------a
B D               Armadillo  a------t
     Yellowbelly pufferfish  a------c
         Southern platyfish  a------g
  D         Green seaturtle  ========
  D          Painted turtle  ========
B D                 Wallaby  ========
B D                    Pika  --------
B D                  Rabbit  --------
B D                 Dolphin  ========

Inserts between block 25 and 26 in window
B D                    Pig 5bp
          Tibetan antelope 6bp
B D                    Cow 5bp
B D                  Sheep 5bp
             Domestic goat 49bp

Alignment block 26 of 201 in window, 45542659 - 45542661, 3 bps 
B D                   Human  -ggg
B D                   Chimp  -ggg
B D                 Gorilla  -ggg
B D               Orangutan  -ggg
B D                  Gibbon  -ggg
B D                  Rhesus  -gag
B D     Crab-eating macaque  -gag
B D                  Baboon  -gag
B D            Green monkey  -gag
B D                Marmoset  -ggc
B D         Squirrel monkey  -ggc
B D                Bushbaby  -cgt
         Chinese tree shrew  -ggc
B D                Squirrel  -ggc
     Lesser Egyptian jerboa  -gcc
               Prairie vole  -ggc
B D         Chinese hamster  -agc
             Golden hamster  -agc
B D                   Mouse  -gtg
B D                     Rat  -gtg
B D          Naked mole-rat  -ggt
B D              Guinea pig  -ggt
                 Chinchilla  -ggt
           Brush-tailed rat  -gat
B D                     Pig  -aac
B D                  Alpaca  -ggg
             Bactrian camel  -ggg
           Tibetan antelope  -gac
B D                     Cow  -ggc
B D                   Sheep  -gac
B D                   Horse  -ggt
B D        White rhinoceros  -ggt
B D                     Cat  -ggc
B D                     Dog  -tg-
B D                 Ferret   -ggc
B D                   Panda  -ggc
             Pacific walrus  -ggc
               Weddell seal  -ggc
           Black flying-fox  -ggc
B D                 Megabat  -ggc
              Big brown bat  -ggc
       David's myotis (bat)  -ggc
B D                Microbat  -ggc
B D                Hedgehog  -gac
B D                   Shrew  -gac
            Star-nosed mole  -gtg
B D                Elephant  -g-g
        Cape elephant shrew  -gct
B D                 Manatee  -ggt
           Cape golden mole  -gac
B D                  Tenrec  -ggc
                   Aardvark  -ggc
B D               Armadillo  -ggc
     Yellowbelly pufferfish  agt-
         Southern platyfish  aga-
  D         Green seaturtle  ====
  D          Painted turtle  ====
B D                 Wallaby  ====
B D                    Pika  ----
             Domestic goat  ====
B D                  Rabbit  ----
B D                 Dolphin  ====

Alignment block 27 of 201 in window, 45542662 - 45542687, 26 bps 
B D                   Human  ac-------tggagag--g--a-t-gaa--a------------gac---cgg------------------
B D                   Chimp  ac-------tggagag--g--a-t-gaa--a------------gac---cgg------------------
B D                 Gorilla  ac-------tggagag--g--a-t-gaa--a------------gac---tgg------------------
B D               Orangutan  ac-------tggagag--g--a-t-gaa--a------------gat---cgg------------------
B D                  Gibbon  ac-------tggagaa--g--a-t-gaa--a------------gac---cgg------------------
B D                  Rhesus  ac-------tggagag--g--a-t-gaa--a------------gac---cgg------------------
B D     Crab-eating macaque  ac-------tggagag--g--a-t-gaa--a------------gac---cgg------------------
B D                  Baboon  ac-------tggagag--g--a-t-gaa--a------------gac---cgg------------------
B D            Green monkey  ac-------tggagag--g--a-t-gaa--a------------gac---cgg------------------
B D                Marmoset  ac-------tggagaa--g--a-c-gaa--a------------gag---tgg------------------
B D         Squirrel monkey  ac-------tggagaa--g--a-t-gaa--c------------gag---cgg------------------
B D                Bushbaby  cc-------tggtga----------------------------gac---cct------------------
         Chinese tree shrew  cc-------tagtgag--g--a-t-ggg--a------------gcc---tgg------------------
B D                Squirrel  tc-------cggtgac--a--a-g-ggg--a------------aac---ggg------------------
     Lesser Egyptian jerboa  tc-------tggtaag--a--a-t-gga--a------------aac---cag------------------
               Prairie vole  cc-------tggcggg--g--a-t-att--a------------gat---ggc------------------
B D         Chinese hamster  tc-------tggtgag--g--a-t-ttt--a------------ggt---ggg------------------
             Golden hamster  tc-------gggcgag--g--a-t-ttt--a------------ggt----gg------------------
B D                   Mouse  cg-------tggtgtg--g--g-g-gtt--g------------gga---gggct----------------
B D                     Rat  tg-------cggggtg--g--g-gcgtt--gcgggatgggggcggg---aggcg----------------
B D          Naked mole-rat  tc-------tggttaa--a--a-t-gag--a------------gac---tgg------------------
B D              Guinea pig  tc-------tggttaa--c--a-t-aga--a------------gac---tgg------------------
                 Chinchilla  tc-------tggttaa--g--a-t-ggg--a------------gac---tgg------------------
           Brush-tailed rat  tc-------tggttca--a--a-a-ggg--a------------gat---agg------------------
B D                  Rabbit  ----------------------------------------------------cacgtggccctgccgagg
B D                    Pika  ----------------------------------------------------ca----------------
B D                     Pig  cc-------tggcgag--g--a-c-agg--a------------gac---tgg------------------
B D                  Alpaca  tc-------cagcgaa--g--a-t-ggg--a------------tac---tgg------------------
             Bactrian camel  cc-------cagcgaa--g--a-t-ggg--a------------ggc---tgg------------------
           Tibetan antelope  cc-------tggcaaa--g--a-t-gag--a------------gac---tgg------------------
B D                     Cow  cc-------tggcaag--g--a-t-gag--a------------gac---tgg------------------
B D                   Sheep  cc-------tggcaag--g--a-t-gag--a------------gac---tgg------------------
B D                   Horse  gc-------tagcaag--a--a-t-ggg--a--------------c---tgg------------------
B D        White rhinoceros  gc-------tgacaaa--a--a-t-gggata--------------c---tgg------------------
B D                     Cat  cc-------taatgag--g--t-t-ggg--a---------------------------------------
B D                     Dog  -c-------aggtgag--c--a-t-ggg--a------------g-a---cgg------------------
B D                 Ferret   cc-------gagtgag--g--a-t-ggg--a---------------------------------------
B D                   Panda  cc-------cagtgag--g--a-c-ggg--a---------------------------------------
             Pacific walrus  cc-------tagtgag--g--a-c-ggg--a---------------------------------------
               Weddell seal  cc-------aagtgag--g--a-c-agc--a---------------------------------------
           Black flying-fox  tc-------tggtgag--agca-t-ggg--a------------gcc---tgg------------------
B D                 Megabat  tc-------tggtgag--agca-t-ggg--a------------gcc---tgg------------------
              Big brown bat  cc-------tggtgag--g--a-t-ggg--a------------tat---cgg------------------
       David's myotis (bat)  cc-------tggggag--g--a-t-ggg--a------------ggt---caa------------------
B D                Microbat  cc-------tggtgag--g--a-t-ggg--a------------ggt---cga------------------
B D                Hedgehog  cc-------ccccagt--g----t-gag--a------------cac---aag------------------
B D                   Shrew  cc-------tcccggg--a--att-ggg--g------------cac---agg------------------
            Star-nosed mole  ccaggggggctgcggg--a--ccc-ggt--g------------ccc---ggg------------------
B D                Elephant  ct-------tggtgag--g--a-t-gga--a------------gac---tgg------------------
        Cape elephant shrew  cc-------cggtcag--g--a-c-ggg--a------------gac---tgg------------------
B D                 Manatee  cc-------tggtgag--g--a-t-gga--a------------gac---tgg------------------
           Cape golden mole  cc-------tgatgag--a--a-t-gag--a------------gac---tgg------------------
B D                  Tenrec  cc-------tggtcag--a--a-c-ggg--a------------aac---tgg------------------
                   Aardvark  cc-------tgggaag--g--a-tagga--a------------gac---tga------------------
B D               Armadillo  cc-------tggcatg--g--a-t-ggg--a------------tcc---tgg------------------
B D                    Fugu  -------attagagga--a--a-t-cag--g------------tgc---tgc------------------
     Yellowbelly pufferfish  -------attagagga--a--a-t-cag--g------------cgc---tgc------------------
         Southern platyfish  -----------gcggacgg--c-t-cag--c------------cacacaggc------------------
  D         Green seaturtle  ======================================================================
  D          Painted turtle  ======================================================================
B D                 Wallaby  ======================================================================
             Domestic goat  ======================================================================
B D                 Dolphin  ======================================================================

                      Human  ----------ggcc
                      Chimp  ----------ggcc
                    Gorilla  ----------ggcc
                  Orangutan  ----------ggcc
                     Gibbon  ----------ggcc
                     Rhesus  ----------ggcc
        Crab-eating macaque  ----------ggcc
                     Baboon  ----------ggcc
               Green monkey  ----------ggcc
                   Marmoset  ----------ggcc
            Squirrel monkey  ----------gacc
                   Bushbaby  ----------gacc
         Chinese tree shrew  ----------ggcc
                   Squirrel  ---------gggcc
     Lesser Egyptian jerboa  ----------ggcc
               Prairie vole  ----------gcct
            Chinese hamster  ----------gcct
             Golden hamster  ----------gcct
                      Mouse  ---------tggat
                        Rat  ---------tggat
             Naked mole-rat  ----------ggcc
                 Guinea pig  ----------ggcc
                 Chinchilla  ----------ggcc
           Brush-tailed rat  ----------ggcc
                     Rabbit  gcgcggcactggcc
                       Pika  ------------cc
                        Pig  ----------ggcc
                     Alpaca  ----------gccc
             Bactrian camel  ----------gccc
           Tibetan antelope  ----------ggcc
                        Cow  ----------ggcc
                      Sheep  ----------ggcc
                      Horse  ----------gtcc
           White rhinoceros  ----------ggcc
                        Cat  ----------agcc
                        Dog  ----------gacc
                    Ferret   ----------tgcc
                      Panda  ----------tgcc
             Pacific walrus  ----------cgcc
               Weddell seal  ----------cgcc
           Black flying-fox  ----------ggcc
                    Megabat  ----------ggcc
              Big brown bat  ----------gccc
       David's myotis (bat)  ----------ggcc
                   Microbat  ----------ggcc
                   Hedgehog  ----------gacc
                      Shrew  ----------ggtc
            Star-nosed mole  ----------aggc
                   Elephant  ----------ggtc
        Cape elephant shrew  ----------ggtt
                    Manatee  ----------ggtc
           Cape golden mole  ----------ggtc
                     Tenrec  ----------tgtc
                   Aardvark  ----------tgtt
                  Armadillo  ----------ggcc
                       Fugu  ----------tgcc
     Yellowbelly pufferfish  ----------tgcc
         Southern platyfish  ----------ctct
            Green seaturtle  ==============
             Painted turtle  ==============
                    Wallaby  ==============
              Domestic goat  ==============
                    Dolphin  ==============

Inserts between block 27 and 28 in window
B D                  Shrew 1bp
           Star-nosed mole 7bp

Alignment block 28 of 201 in window, 45542688 - 45542709, 22 bps 
B D                   Human  ccta----g-----gacttacgtttat----t-ctt
B D                   Chimp  ccta----g-----gacttacgtttat----t-ctt
B D                 Gorilla  ccta----g-----gacttacgtttat----t-cct
B D               Orangutan  ccta----g-----gactcacgttttt----t-ctt
B D                  Gibbon  ccta----g-----gactcacgtttat----t-ctt
B D                  Rhesus  ccta----g-----gactcacgtttat----t-ctt
B D     Crab-eating macaque  ccta----g-----gactcacgtttat----t-ctt
B D                  Baboon  ccta----g-----gactcacgtttat----t-ctt
B D            Green monkey  ccta----g-----gactcacgtttat----t-ctt
B D                Marmoset  ccta----g-----gactcacgttttt----t-ctt
B D         Squirrel monkey  ccca----g-----gactcacgttttt----t-cct
B D                Bushbaby  cc-a----g-----gactcacgttttt----t-acg
         Chinese tree shrew  t-------g-----gactcacgtttct----g-ggg
B D                Squirrel  cc-a----g-----gactcacgttttt----tgttg
     Lesser Egyptian jerboa  ca-g----a-----gactcacggcttt----t-gta
               Prairie vole  cc-a----c-----gactcacttgttt----t-ttg
B D         Chinese hamster  cc-a----a-----gactcactttttt----t-ttt
             Golden hamster  cc-a----a-----gactcactttttt----t-ttt
B D                   Mouse  cc-a----a-----gactcactttttt----t-ttc
B D                     Rat  cc-a----a-----gactcactttttt----t-ttc
B D          Naked mole-rat  cc-a----a-----gactcacttttct----t--cc
B D              Guinea pig  cc-a----a-----gacttacttttct----t--tt
                 Chinchilla  cc-g----a-----cactcacttttct----t--tt
           Brush-tailed rat  cc-c----a-----aactcacttttct----t--tg
B D                  Rabbit  cc-g----a-----gactcacggggtt----t-ctg
B D                    Pika  cc-c----c-----aactcacctgttt----t-ctg
B D                     Pig  cctg----g-----gactcaccttttttgcg-----
B D                  Alpaca  cctg----a-----gactcactttttt---------
             Bactrian camel  cctg----g-----gactcactttttt---------
           Tibetan antelope  cctg----g-----gactcaccctttg---------
B D                     Cow  cctg----g-----gactcaccctttg---------
B D                   Sheep  cctg----g-----gactcaccctttg---------
B D                   Horse  cctg----g-----gactcaccttttc----t-tga
B D        White rhinoceros  cctg----g-----gactcacgttttt----t-ggg
B D                     Cat  ccag----g-----gactcacgttttt----t-gga
B D                     Dog  cctg----g-----gacttacatattt----c-tgg
B D                 Ferret   ccgg----ggactcgactcacggttgc----t-ggg
B D                   Panda  ccag----g-----gactcacgattgc----t-ggg
             Pacific walrus  gcag----g-----gactcacgattgc----t-ggg
               Weddell seal  ccag----g-----aactcacgattgc----t-ggg
           Black flying-fox  cttg----g-----gactcacggtttt----t-gag
B D                 Megabat  cttg----g-----gactcacgttttt----t-gag
              Big brown bat  cttg----g-----gactcacgttttt----t-gga
       David's myotis (bat)  cttg----g-----tactcacgttttt----t-gga
B D                Microbat  cttg----g-----tactcacgttttt----t-gga
B D                Hedgehog  ccac----a-----gactcacttctca----a-ggg
B D                   Shrew  ccag----g-----aactcacatttgg----g-gga
            Star-nosed mole  cctg----g-----tacttacatcttt----t-ctg
B D                Elephant  cctg----g-----gactcacctctct----t-cg-
        Cape elephant shrew  cctg----g-----gacttaccctttt----t-tg-
B D                 Manatee  tctg----g-----gactcacctgttt----t-tg-
           Cape golden mole  cttg----g-----gactcacgtcttt----t-tg-
B D                  Tenrec  ccta----g-----gactcacctcttt----t-tg-
                   Aardvark  tct-----g-----gactcacctcttt----t-tg-
B D               Armadillo  cccg----g-----gactcacgtggct----tatg-
B D                 Wallaby  ccag----g-----gccttacatgtct----t-cct
B D                    Fugu  ggca----g-----gacttactgacgc----t-gct
     Yellowbelly pufferfish  ggca----g-----gacttactgacgc----t-gct
         Southern platyfish  gtcacatca-----gacttacagttgt----a-aac
  D         Green seaturtle  ====================================
  D          Painted turtle  ====================================
             Domestic goat  ====================================
B D                 Dolphin  ====================================

Inserts between block 28 and 29 in window
B D                 Alpaca 5bp
            Bactrian camel 5bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp

Alignment block 29 of 201 in window, 45542710 - 45542710, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  g
     Lesser Egyptian jerboa  g
               Prairie vole  g
B D         Chinese hamster  g
             Golden hamster  g
B D                   Mouse  g
B D                     Rat  a
B D          Naked mole-rat  a
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  g
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  a
B D                     Cow  g
B D                   Sheep  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  g
B D                   Shrew  a
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  g
B D                 Manatee  g
           Cape golden mole  g
B D                  Tenrec  g
                   Aardvark  g
B D               Armadillo  g
B D                 Wallaby  a
B D                    Fugu  g
     Yellowbelly pufferfish  g
         Southern platyfish  g
  D         Green seaturtle  =
  D          Painted turtle  =
             Domestic goat  =

Alignment block 30 of 201 in window, 45542711 - 45542711, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  c
         Chinese tree shrew  c
B D                Squirrel  c
     Lesser Egyptian jerboa  c
               Prairie vole  c
B D         Chinese hamster  c
             Golden hamster  c
B D                   Mouse  c
B D                     Rat  c
B D          Naked mole-rat  c
B D              Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  c
B D                  Rabbit  c
B D                    Pika  c
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
B D                   Panda  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  c
       David's myotis (bat)  c
B D                Microbat  c
B D                Hedgehog  c
B D                   Shrew  c
            Star-nosed mole  c
B D                Elephant  c
        Cape elephant shrew  c
B D                 Manatee  c
           Cape golden mole  c
B D                  Tenrec  c
                   Aardvark  c
B D               Armadillo  c
B D                 Opossum  c
B D                    Fugu  c
     Yellowbelly pufferfish  c
         Southern platyfish  c
  D         Green seaturtle  =
  D          Painted turtle  =
B D                 Wallaby  -
             Domestic goat  =

Alignment block 31 of 201 in window, 45542712 - 45542719, 8 bps 
B D                   Human  aggtgttc
B D                   Chimp  aggtgttc
B D                 Gorilla  aggtgttc
B D               Orangutan  aggtgttc
B D                  Gibbon  aggtgttc
B D                  Rhesus  aggtgttc
B D     Crab-eating macaque  aggtgttc
B D                  Baboon  aggtgttc
B D            Green monkey  aggtgttc
B D                Marmoset  aggtgttc
B D         Squirrel monkey  aggtgttc
B D                Bushbaby  acatgttc
         Chinese tree shrew  agatgctc
B D                Squirrel  aggcattt
     Lesser Egyptian jerboa  aggtgttc
               Prairie vole  agacgttc
B D         Chinese hamster  aggtgttc
             Golden hamster  agatgttc
B D                   Mouse  aggcgttc
B D                     Rat  aggcattc
B D          Naked mole-rat  agaagttc
B D              Guinea pig  agaagttc
                 Chinchilla  agaaactc
           Brush-tailed rat  agaaactc
B D                  Rabbit  aggcgtcc
B D                    Pika  aggcattc
B D                     Pig  agaacctc
B D                  Alpaca  agaagttc
             Bactrian camel  agaagttc
B D                 Dolphin  aggtcttc
               Killer whale  aggtcttc
           Tibetan antelope  aggcactc
B D                     Cow  aggcgctc
B D                   Sheep  aggcactc
              Domestic goat  aggcactc
B D                   Horse  agatgttc
B D        White rhinoceros  agatattc
B D                     Cat  acatgttc
B D                     Dog  agatggcc
B D                 Ferret   acatgttc
B D                   Panda  acatgttc
             Pacific walrus  acatgttc
               Weddell seal  acatgttc
           Black flying-fox  acatgttc
B D                 Megabat  acatgttc
              Big brown bat  acatattc
       David's myotis (bat)  acatattc
B D                Microbat  acatattc
B D                Hedgehog  agatgttc
B D                   Shrew  aggcattc
            Star-nosed mole  agatgtcc
B D                Elephant  aaaagttc
        Cape elephant shrew  agaagttc
B D                 Manatee  agaagttc
           Cape golden mole  agaagttc
B D                  Tenrec  agaagttc
                   Aardvark  agaagttc
B D               Armadillo  aggtggcc
B D                 Opossum  aggtctgc
B D                    Fugu  agacagac
     Yellowbelly pufferfish  agacagac
         Southern platyfish  acatgttg
  D         Green seaturtle  ========
  D          Painted turtle  ========
B D                 Wallaby  --------

Alignment block 32 of 201 in window, 45542720 - 45542787, 68 bps 
B D                   Human  aggcagttggctttggattggaagttgttattgtttccctggcagccaccatagacaaacatggagca
B D                   Chimp  aggcagttggctttggattggaagttgttattgtttccctggcagccaccatagacaaacatggagca
B D                 Gorilla  aggcagttggctttggattggaagttgttattgtttccctggcagccaccatagacaaacatggagca
B D               Orangutan  aggcagttggctttggattggaagttgttattgtttccctggcagccaccatagacaaacatggagca
B D                  Gibbon  aggcagttggctttggattggaagttgttattgtttcccgggcagccaccatagacaaacatggagca
B D                  Rhesus  aggcagttggcttcggattggaagttgttattgtttccctggcagccaccatagacaaatgtggagca
B D     Crab-eating macaque  aggcagttggcttcggattggaagttgttattgtttccctggcagccaccatagacaaatgtggagca
B D                  Baboon  aggcagttggcttcggattggaagttgttattgtttccctggcagccaccatagacaaatgtggagca
B D            Green monkey  aggcagttggcttcggattggaagttgttattgtttccctggcagccaccatagacaaatgtggagca
B D                Marmoset  aggcagttggttttggattggaagttgttattgtttccctggcaaccaccatagataaagatggagca
B D         Squirrel monkey  aggcagttggtttcagattggaagttgttattgtttccctggcagccaccatagataaagatagagca
B D                Bushbaby  aggcacaggtctatgctttggaagttgttattgtttcccaggcagccaccgtagatgaagatggagca
         Chinese tree shrew  tggcagacagtttgggattggaagttgttattgtttccctggcagccaccatagatgaaggtggagca
B D                Squirrel  tggcagatgctcttggtctggaagttgttgttgtttccttggcagccgccatacacgaagccatagca
     Lesser Egyptian jerboa  tcacacatggctttggtttggaagttgttgttgtttccacggcagccaccgtagatgaacttgtagca
               Prairie vole  tggcataggctttgggattggaagttgttgttgttcccctggcaaccaccgtagatgaagagctggca
B D         Chinese hamster  tggcatatggcttgggtttggaagttgttattgtttccctggcagcctccatagatgaagagttcgca
             Golden hamster  tggcatgtgccttgggtttggaagttgttattgtttccctggcagcctccatagatgaagagttcgca
B D                   Mouse  tggcatatactttgggattggaagttgttattgtttccttggcagccaccatagatgaagacttggca
B D                     Rat  tggcatatactttgggactggaagttgttattgtttccctggcaaccaccatagatgaagagttggca
B D          Naked mole-rat  tggcagatgcctttggtttggaagttgttactgtttccacggcagccaccatagatgaagaggtcaca
B D              Guinea pig  tcgcacatggattcagtttggaagttgttattgtttccctggcaaccaccatagatgaacatgtcaca
                 Chinchilla  tggcagatggatttggtttggaagttgttattgtttccctggcagccaccatagatgaagatgtcgca
           Brush-tailed rat  tggcagatgcttttggtttggaagttgttattgttcccctggcagccaccatagatgaagaggtcaca
B D                  Rabbit  tggcagatggcctgggtctggaagttgttgttgttccccaggcagcctccatagacgaagctgtagca
B D                    Pika  tggcagatggcttgggtctggaagttgttgttgtttcccaggcagccaccatagatgaagttgtagca
B D                     Pig  tggcacatgtcttgggattggaagttgttatggttccctttgcagccaccatagatgaagatggagca
B D                  Alpaca  tcgcatatggcttgggattggaagttgttattgtttcctttgcagccaccgtagatgaagatggagca
             Bactrian camel  tcgcatatggcttgggattggaagttgttattgtttcctttgcagccaccgtagatgaagatggagca
B D                 Dolphin  atgcagtcctgtgctgttgggaagttgttcttcttccctcggcagccgccgtatataaacatgtcgca
               Killer whale  atgcagtcctgtgctgttgggaagttgttcttcttccctcggcagccgccgtatataaacatgtcgca
           Tibetan antelope  tggcacacagcttgggattggaagttgttattgtttcctctacaaccaccatagatgaagctggagca
B D                     Cow  tggcacacggcttgggattggaaattgttattgtttcctctacaaccaccatagatgaagctggagca
B D                   Sheep  tggcacacggcttgggattggaagttgttattgtttcctctacaaccaccatagatgaagctggagca
              Domestic goat  tggcacacggcttgggattggaagttgttattgtttcctctacaaccaccatagatgaagctggagca
B D                   Horse  tggcacacggctttgctttggaagttgttattgtttccttggcagccaccatagatgaaggtggagca
B D        White rhinoceros  tggcacatggccttggtttggaagttgttattgtttccttggcagccaccatatatgaagctggagca
B D                     Cat  tggcacatgtctttggtttggaagttgttattgtttcctttgcagccaccatagatgaacctggagca
B D                     Dog  ctgcagacagcttcagattggaagttgttattgttcccactgcaaccaccatagttgaatctgtagca
B D                 Ferret   tggcacatggctttggactgaaagttgttgttgttcccttggcagccaccatagatgaatttggagca
B D                   Panda  tggcacatggctttggactggaagttgttgttgtttcctttgcagccaccatagatgaaactggagca
             Pacific walrus  tggcacatggctttggactggaaattgttgttgtttcctttgcagccaccatagatgaacctggagca
               Weddell seal  tggcacatggctttggactggaaattgttgttgtttcctttgcagccaccatagatgaaactggagca
           Black flying-fox  tggcatatgtctttggtttggaagttgttactgtttccttgacagccgccgtagatgaagctgaagca
B D                 Megabat  tggcatatgtctttggtttggaagttgttattgtttccttgacagccgccatagatgaagctgaagca
              Big brown bat  tgacacaggtctttggtttggaagttgttgttgtttccttggcagccaccatagatgaagatggaaca
       David's myotis (bat)  tgacacaggtctttggtttggaagttgttattgtttccttggcagccaccatagatgaacatggaaca
B D                Microbat  tgacacaggtctttggtttggaagttgttattgtttccttggcagccaccatagatgaaagtggaaca
B D                Hedgehog  tgacatatggatttagactggaagttgttgttgtttccttgacagccaccatagatgaagctggagca
B D                   Shrew  tggcatatgtctttggactggaagttgtttttatttcctttgcagccaccatagatgaagccgaagca
            Star-nosed mole  tggcagatagcttcagactggaagctgttactgtttccttggcagccaccgtagatgaatctagagca
B D                Elephant  tggcagagggctttggattggaagttgttgttgttcccatgacagccaccgtagatgaagctggaaca
        Cape elephant shrew  tggcagagggttttggattggaagttgttgctgttcccctggcagccaccatagatgaacatggagca
B D                 Manatee  tggcagagggatttggattggaagttgttgttgttcccatggcagccaccgtagatgaagctgctaca
           Cape golden mole  tggcaaagggcttcggtttggaagttgttgttgttcccctggcaaccaccatagatgaagatggagca
B D                  Tenrec  tggcagagggctttggtctggaaattgttgctgttcccttggcagccaccatagatgaaactggcaca
                   Aardvark  tggcagagtgttttggactggaagttgttgttgttcccctggcagccaccatagatgaagctggagca
B D               Armadillo  tcgcagatggctttggattggaagttgttattgttcccctggcagccaccatagataaaactgaagca
B D                 Opossum  ttgcaaacctcacgagactggaagttgtttttgctttctatgcagtcactgaaattgaagggaaagca
B D                 Wallaby  ---cagatctcccgggtctgaaagttgttgttatttccctcacagcccccatagaagaatttggcaca
  D          Painted turtle  agacattctgtttgggtcgcaaagttgttcttgttcccatcacaacctccataggtgaattgctcaca
B D                    Fugu  aggcagtactcctctgactcaaagttattcctgttgcctccgcagccaccgtagataaactgagcaca
     Yellowbelly pufferfish  aggcagtactcctctgactcaaagttattcctgttgcctccgcagccaccgtagataaactgagcaca
         Southern platyfish  atgcaatgaaaccatgagtggaaattgttttcgttgccacggcagccaccgtaaacaaagggcaaaca
  D         Green seaturtle  ====================================================================

Alignment block 33 of 201 in window, 45542788 - 45542869, 82 bps 
B D                   Human  agtattatctttcttgtcataccaccaatgaagaaaataagccaggcaggggccagtttcttttggcatt
B D                   Chimp  agtattatttttcttgtcataccaccaacgaagaaaataagccagacaggggccagtttcttttggcatt
B D                 Gorilla  actattgtttttcttgtcataccaccaacgaagaaaataagccaggcagggcccagtttcttttggcatt
B D               Orangutan  agtattatttttcttgtcataccaccaacgaagaaaataagccaggcaggggccagtttcttttggcatt
B D                  Gibbon  agtattatttttcttgtcataccaccaacgaagaaaataagccaggcaggggccagtttcttttggcatt
B D                  Rhesus  agtattatttttcttgtcataccaccaccgaataaaaaaagccaggcaggggccagtttcatttggcatt
B D     Crab-eating macaque  agtattatttttcttgtcataccaccaccgaataaaaaaagccaggcaggggccagtttcatttggcatt
B D                  Baboon  agtattatttttcttgtcataccaccaccgaataaaaaaagccaggcaggggccagtttcatttggcatt
B D            Green monkey  agtattatttttcttgtcataccaccaccgaataaaaaaagccaggcaggggccagtttcatttggcatt
B D                Marmoset  agtatcatttttcttgtcataccaccaacgacgaaaaaaagccatgcaggggccagtttcttttggcatt
B D         Squirrel monkey  agtatcatttttcttgtcataccaccaacgacggaaaaaagccatgcaggggccagtttctttcggcatt
B D                Bushbaby  ggtattatttttcttattataccaccaacgttcaaaaaaagccatgcaggggccaggttcttttggcata
         Chinese tree shrew  ggttttattttctttattgtaccaccaacgacggaaataagccatacaggggcccgattctttcggcatg
B D                Squirrel  ggtgttattgttcttactgtaccaccagcggcggaacagagccatgcagggcccgctttcttttggcaga
     Lesser Egyptian jerboa  ggtattattttccttactataccaccaacgtggaaaataagccaggcagagaccagtttctttcggcaga
               Prairie vole  cgtgctgttttctttattgtaaaaccagcgagggaaataagccaaacagtagccagagtccttcggcagg
B D         Chinese hamster  cgtgctattttccttattgtaccaccagcgagggaaataagccatgcagtagccagagtcttttggtagg
             Golden hamster  cgtgctgttttccttattataccaccagcgagggaaatacgccaagcagtagccagagtctttcggtagg
B D                   Mouse  cgtgctattttctttattaaaccaccaacgacgaaagtaagccatacagtagccggagtctttcggcagg
B D                     Rat  cgtgccgtttttcttattataccaccaacgagggaagtaagccatgcagtagccagagtcttttggtagg
B D          Naked mole-rat  ggtattattttccttattataccaccaacgacgaaaataagccatgcagaggcccttttcttttggcaga
B D              Guinea pig  ggtattatttttctcattataccaccaccgacggaaaaaggccatgcagaaacccgtttcttttggcaga
                 Chinchilla  ggtattattttccttgttataccaccaacgccgaaaagcagccatgcagaggcctgtttcttttggcaga
           Brush-tailed rat  ggtgttattttccttattgtaccaccagcgatgaaaagcagccatgcagaggcctgcttctttgggcaga
B D                  Rabbit  ggtgttgttttccttactgtaccaccaccgaataaaataagccatgcaggggccggagtcttttgggagt
B D                    Pika  agtgttgttttcctgactgtaccaccagcggggaaagaaagccatgcaggggcccgagtcctttggtaac
B D                     Pig  ggtattatttgtcttatcataccaccaacgatggaaaaaggcaaggcaggggccaggttctttgggcatg
B D                  Alpaca  cgaattactggtcttgttataccaccaacgacggagaaaagccatgcagggaccaggttctgtgggcatg
             Bactrian camel  cgtattactggtcttgttataccaccaacgatggagaaaagccatgcagggaccaggttctgtgggcatg
           Tibetan antelope  agtattatttgtcttatcataccaccaacgatggaaaagagccatgcaggggccagcttctttgggcata
B D                     Cow  agaattatttgtcttatcataccaccaacgatggaaaagagccatgcaggggccagcttctttgggcatg
B D                   Sheep  agtattatttgtcttatcataccaccaacgatggaaaagagccatgcatgggccagcttctttgggcata
              Domestic goat  agtattatttgtcttatcataccaccaacgatggaaaagagccatgcaggggccagcttctttgggcata
B D                   Horse  ggtatcatatttcttatcataccaccaacgttggaaaagacccaggcaggggccagtttcttttggcatt
B D        White rhinoceros  ggtgttatttttcttatcataccaccaacgacggaaaaaacccatgcaggggccaggttcttttgccata
B D                     Cat  ggtacccttttccttgtcataccaccaacgatgaaaaaaggccatgcaggggccagtttctttgggcata
B D                     Dog  gcgtttgtattccttattgtaccaccagcgtggaatgagggccaggcagaggcccacattcattggcaaa
B D                 Ferret   ggtattcttctccttatcgtaccaccaacggtggaaaaatgccatacaggggccaggttctttgggcata
B D                   Panda  ggtattcttctccttatcgtaccaccaacgatgaaaaaacgccatgcaggggccaggttctttaggcatg
             Pacific walrus  ggtattcttctccttatcgtaccaccaacgaggaaaaaatgccatgcaagggccaggttctttgggcatg
               Weddell seal  ggtattcttctccttatcgtaccaccaacgacgaaaaaatgccatgcaagggccaggttctttgggcatg
           Black flying-fox  ggtatcattatggttatcataccaccaacgacgaaaaaaagccatgcaggggccagagtcttttggcatc
B D                 Megabat  ggtatcattatggttatcataccaccaacgacgaaaaaaagccatgcaggggccggagtcttttggcatc
              Big brown bat  ggtatcatttttcttatcataccaccagcgacgaaaaaaagccatgcagggaccaggatttttcggcaaa
       David's myotis (bat)  ggtatcattcttcttatcataccaccaacgacgaaaaaaagccatgcagggaccaggatttttcggcaaa
B D                Microbat  ggtatcatttttcttatcataccaccaacgacgaaaaaaagccatgcagggcccaggatttttcggcaaa
B D                Hedgehog  ggtattattttccttatcataccaccaacgacgaaaataagccatacagggaccagatacttttggcata
B D                   Shrew  ctgttgacgttctttattataccaccagcgataaaaataagcccagcaggggccagacaccttgggcaaa
            Star-nosed mole  gacatccttttctttatcgtaccaccagcgtggaatgtaggccaggcaggggccagcggcctctggcaaa
B D                Elephant  ggtgttattttctttatcataccaccagcgaggaaaataagccatgcagaggccagcatcttttggcaat
        Cape elephant shrew  ggtgttattttccttatcataccaccagcgtcgaaaataagccatgcagacgccagtttcttttggcaat
B D                 Manatee  ggtgttattttccttatcataccaccagcgacgaaaataagccatgcagaggccagcttcttttggcaat
           Cape golden mole  ggtgttattttccttatcgtaccaccagcgtcgaaaataagccatgcaaaggccagtttctttgggcaat
B D                  Tenrec  ggtgttcttttccttatcataccaccagcgacggaagtaagccaggcacaggccagtctccttcggcaaa
                   Aardvark  ggtgttattttccttatcataccaccagcgacgaaaataagccatacagtagccagtgtcttttggcaat
B D               Armadillo  ggtatcatttcccttatcataccaccagcgacgaaaataagccatgcatggaccagcattttttggcatc
B D                 Opossum  gtcattgtcttgcacgctgtaataccaacgggtccgagtggaagaacaggagacgggactcacaggatgt
B D                 Wallaby  gtctttgatgtcatcatcatatgcccagcgcgtcatagaagccagacaatgtccacgatctgccggcagc
  D          Painted turtle  cttcttggcctgccagttgtagaaccagcgagggatcatggcataacaggacccggggtcagcagggagt
B D                    Fugu  gcgaccatcctcgcggtcaaagtaccagcggggcagcaaggcccggcatggaccagtctctgcgttggcc
     Yellowbelly pufferfish  gcgaccatcctcgcggtcaaagtaccagcggggcagcaaggcccggcatggaccagtctctgcgttggcc
         Southern platyfish  gtcatgcctctccacgtcgaagtaccatcgaggaaagtaggcgcgacagggacccgtctcactcggaagg
  D         Green seaturtle  ======================================================================

                      Human  tcgcatacatct
                      Chimp  ttgcatacatct
                    Gorilla  tcacatacatct
                  Orangutan  tcgcatacatct
                     Gibbon  tcgcatacatct
                     Rhesus  tcacatacatct
        Crab-eating macaque  tcacatacatct
                     Baboon  tcacatacatct
               Green monkey  tcacatacatct
                   Marmoset  tcgcatacatct
            Squirrel monkey  tcgcacacatct
                   Bushbaby  gtgcatacatct
         Chinese tree shrew  ttgcatacatct
                   Squirrel  gtgcatatgtct
     Lesser Egyptian jerboa  ctgcatacatct
               Prairie vole  ctgcatatatct
            Chinese hamster  ctgcatatgtct
             Golden hamster  ctgcatatgtct
                      Mouse  ctgcagatatct
                        Rat  ctgcaaatatct
             Naked mole-rat  ctgcatacatct
                 Guinea pig  ctgcatacatct
                 Chinchilla  ctgcacacatct
           Brush-tailed rat  ctgcacacatct
                     Rabbit  ttgcatatatct
                       Pika  tgacatacatct
                        Pig  ctgcatatgtct
                     Alpaca  ctgcatatgtct
             Bactrian camel  ctgcatatgtct
           Tibetan antelope  ctgcatatgtct
                        Cow  ctgcatatgtct
                      Sheep  ctgcatatgtct
              Domestic goat  ctgcatatgtct
                      Horse  ttgcatacgtct
           White rhinoceros  ttgcatatgtct
                        Cat  tcacatatgtct
                        Dog  gtgcatatgtct
                    Ferret   gagcatatatct
                      Panda  gtgcatacgtct
             Pacific walrus  gtgcatatatct
               Weddell seal  gtgcatatgtct
           Black flying-fox  ttgcatacatct
                    Megabat  ttgcatacatct
              Big brown bat  ctgcatatatct
       David's myotis (bat)  ctgcatatatct
                   Microbat  ctgcagatatct
                   Hedgehog  ctgcatatatct
                      Shrew  ctgcatatgtct
            Star-nosed mole  ctgcacaggtct
                   Elephant  ttgcatatgtct
        Cape elephant shrew  tggcatatgtct
                    Manatee  ttgcatatgtct
           Cape golden mole  ttgcatatgtct
                     Tenrec  ctgcagatatct
                   Aardvark  ttgcatatgtct
                  Armadillo  ttgcatacgtct
                    Opossum  tcacatgggtct
                    Wallaby  ttgcatatgact
             Painted turtle  ctacaaaggtct
                       Fugu  cagcacacatct
     Yellowbelly pufferfish  cagcacacatct
         Southern platyfish  gagcagatat--
            Green seaturtle  ============

Alignment block 34 of 201 in window, 45542870 - 45542876, 7 bps 
B D                   Human  gcagaga
B D                   Chimp  gcagaga
B D                 Gorilla  gcagaga
B D               Orangutan  gcagaga
B D                  Gibbon  gcagaga
B D                  Rhesus  gcagaaa
B D     Crab-eating macaque  gcagaaa
B D                  Baboon  gcagaaa
B D            Green monkey  gcagaaa
B D                Marmoset  gcagaga
B D         Squirrel monkey  gcagaga
B D                Bushbaby  gccaaga
         Chinese tree shrew  gcagaga
B D                Squirrel  gcagaga
     Lesser Egyptian jerboa  gtagaga
               Prairie vole  gcagaga
B D         Chinese hamster  gcaggga
             Golden hamster  gcaggga
B D                   Mouse  gcagagg
B D                     Rat  gcggagg
B D          Naked mole-rat  gtaggga
B D              Guinea pig  gcagaaa
                 Chinchilla  gcagaga
           Brush-tailed rat  gcagaga
B D                  Rabbit  gcagag-
B D                    Pika  gcagaaa
B D                     Pig  gcagggg
B D                  Alpaca  gcaggga
             Bactrian camel  gcaggga
           Tibetan antelope  gcaggga
B D                     Cow  gcaggga
B D                   Sheep  gcaggga
              Domestic goat  gcaggga
B D                   Horse  gcaggga
B D        White rhinoceros  gcaggga
B D                     Cat  gtaggga
B D                     Dog  gcaagaa
B D                 Ferret   gtaggga
B D                   Panda  gtaggga
             Pacific walrus  gtaggga
               Weddell seal  gtaggga
           Black flying-fox  gcaggaa
B D                 Megabat  gcgggaa
              Big brown bat  gcaggga
       David's myotis (bat)  gcaggga
B D                Microbat  gcaggga
B D                Hedgehog  gaaagga
B D                   Shrew  gcaatga
            Star-nosed mole  gcaggga
B D                Elephant  gcaggga
        Cape elephant shrew  gcaggga
B D                 Manatee  gtaggaa
           Cape golden mole  gtaaggg
B D                  Tenrec  acaggga
                   Aardvark  gcagaga
B D               Armadillo  gcaggga
B D                 Opossum  gaaagga
B D                 Wallaby  g--agga
  D          Painted turtle  gaggag-
        Southern platyfish  -------
  D         Green seaturtle  =======

Inserts between block 34 and 35 in window
           Star-nosed mole 6157bp

Alignment block 35 of 201 in window, 45542877 - 45542879, 3 bps 
B D                   Human  -ga-c
B D                   Chimp  -ga-c
B D                 Gorilla  -ga-c
B D               Orangutan  -ga-c
B D                  Gibbon  -ga-c
B D                  Rhesus  -ga-c
B D     Crab-eating macaque  -ga-c
B D                  Baboon  -ga-c
B D            Green monkey  -ga-c
B D                Marmoset  -ga-c
B D         Squirrel monkey  -ga-c
B D                Bushbaby  -ga-c
         Chinese tree shrew  -ga-a
B D                Squirrel  -ga-c
     Lesser Egyptian jerboa  -ga-c
               Prairie vole  -ga-g
B D         Chinese hamster  -ga-g
             Golden hamster  -ga-g
B D                   Mouse  -gacc
B D                     Rat  -aa-c
B D          Naked mole-rat  -aa-c
B D              Guinea pig  -ga-c
                 Chinchilla  -ga-c
           Brush-tailed rat  -ga-g
B D                    Pika  -ga-c
B D                     Pig  -ga-c
B D                  Alpaca  -ga-c
             Bactrian camel  -ga-c
           Tibetan antelope  -ga-t
B D                     Cow  -ga-t
B D                   Sheep  -ga-t
              Domestic goat  -ga-t
B D                   Horse  -ga-c
B D        White rhinoceros  -ga-c
B D                     Cat  -ga-c
B D                     Dog  -ga-t
B D                 Ferret   -ga-c
B D                   Panda  -ga-c
             Pacific walrus  -ga-c
               Weddell seal  -ga-c
           Black flying-fox  -aa-c
B D                 Megabat  -ga-c
              Big brown bat  -ga-t
       David's myotis (bat)  -ga-t
B D                Microbat  -ga-t
B D                Hedgehog  -aa-t
B D                   Shrew  -ga-c
B D                Elephant  -ga-g
        Cape elephant shrew  -ga-g
B D                 Manatee  -ga-g
           Cape golden mole  -aa-g
B D                  Tenrec  -ga-g
                   Aardvark  -aa-g
B D               Armadillo  -ga-c
B D                 Opossum  -ga-a
B D                 Wallaby  -ga-a
         Southern platyfish  ag---
  D         Green seaturtle  =====
  D          Painted turtle  -----
           Star-nosed mole  =====
B D                  Rabbit  -----

Inserts between block 35 and 36 in window
B D                Wallaby 4387bp

Alignment block 36 of 201 in window, 45542880 - 45542886, 7 bps 
B D                   Human  tccagag
B D                   Chimp  tccagag
B D                 Gorilla  ttcagag
B D               Orangutan  tccagag
B D                  Gibbon  tccggag
B D                  Rhesus  tccagag
B D     Crab-eating macaque  tccagag
B D                  Baboon  tccagag
B D            Green monkey  tccagag
B D                Marmoset  tccagag
B D         Squirrel monkey  tccagag
B D                Bushbaby  -ccgggg
         Chinese tree shrew  tccagag
B D                Squirrel  ctcggag
     Lesser Egyptian jerboa  ctccgaa
               Prairie vole  cccaggg
B D         Chinese hamster  cccaggg
             Golden hamster  cccaggg
B D                   Mouse  cccagag
B D                     Rat  cccagag
B D          Naked mole-rat  cccagag
B D              Guinea pig  cacaggg
                 Chinchilla  cccaggg
           Brush-tailed rat  cccaggg
B D                  Rabbit  ---agag
B D                    Pika  cccagag
B D                     Pig  cccaaag
B D                  Alpaca  cccagag
             Bactrian camel  cccagag
           Tibetan antelope  gccagag
B D                     Cow  gccagag
B D                   Sheep  gccagag
              Domestic goat  gccagag
B D                   Horse  cccagaa
B D        White rhinoceros  cccagaa
B D                     Cat  cccagag
B D                     Dog  ggcagag
B D                 Ferret   accagac
B D                   Panda  cccagac
             Pacific walrus  cccagac
               Weddell seal  cccagac
           Black flying-fox  cccagag
B D                 Megabat  cccagag
              Big brown bat  cccagag
       David's myotis (bat)  cccagag
B D                Microbat  cccagag
B D                Hedgehog  cccagag
B D                   Shrew  cccagag
B D                Elephant  cccagag
        Cape elephant shrew  cccagag
B D                 Manatee  cctagag
           Cape golden mole  agcagag
B D                  Tenrec  cccagag
                   Aardvark  cccagag
B D               Armadillo  cccagaa
B D                 Opossum  cccagca
  D          Painted turtle  --cagag
         Southern platyfish  ttcaggg
  D         Green seaturtle  =======
B D                 Wallaby  =======
           Star-nosed mole  =======

Inserts between block 36 and 37 in window
B D                    Dog 6528bp

Alignment block 37 of 201 in window, 45542887 - 45542897, 11 bps 
B D                   Human  ---------ttgaaaactca---
B D                   Chimp  ---------ttgaaaactca---
B D                 Gorilla  ---------ttgaaaactca---
B D               Orangutan  ---------ttgaaaactca---
B D                  Gibbon  ---------ttgaaaactca---
B D                  Rhesus  ---------ttgaaaactca---
B D     Crab-eating macaque  ---------ttgaaaactca---
B D                  Baboon  ---------ttgaaaactca---
B D            Green monkey  ---------ttgaaaactca---
B D                Marmoset  ---------ttgaaaactca---
B D         Squirrel monkey  ---------ttgaaaactca---
B D                Bushbaby  ---------ttgagaactca---
         Chinese tree shrew  ---------ttgagaactcc---
B D                Squirrel  ---------ttgagaactca---
     Lesser Egyptian jerboa  ---------ctgaaaactca---
               Prairie vole  ---------ttgtgaactca---
B D         Chinese hamster  ---------tggagaactca---
             Golden hamster  ---------atgagaactca---
B D                   Mouse  ---------ttgagaactca---
B D                     Rat  ---------ttgagagctca---
B D          Naked mole-rat  ---------ttgagatttca---
B D              Guinea pig  ---------ctgagagttca---
                 Chinchilla  ---------atcaggctgcg---
           Brush-tailed rat  ---------ttgggatttca---
B D                  Rabbit  ---------ttgagacctca---
B D                    Pika  ---------ttgagacctcg---
B D                     Pig  ---------ctgagaattta---
B D                  Alpaca  ---------ttaagaacttg---
             Bactrian camel  ---------ttaagaatttg---
           Tibetan antelope  ---------ttgagatttta---
B D                     Cow  ---------ttgagatttta---
B D                   Sheep  ---------ttgagatttta---
              Domestic goat  ---------ttgagatttta---
B D                   Horse  ---------ttgagaactta---
B D        White rhinoceros  ---------tcgagaagata---
B D                     Cat  ---------ttgagaaataa---
B D                 Ferret   ---------ttgagcaatat---
B D                   Panda  ---------ttgagcaatac---
             Pacific walrus  ---------ttgagcaatac---
               Weddell seal  ---------ttgagcaatac---
           Black flying-fox  ---------ttgaaagctta---
B D                 Megabat  ---------ttgaaagctta---
              Big brown bat  ---------ttgagaactta---
       David's myotis (bat)  ---------ttgagaactta---
B D                Microbat  ---------ttgagaactta---
B D                Hedgehog  ---------ttgtgtactta---
B D                   Shrew  ---------ctcagaattca---
B D                Elephant  --------------tactca---
        Cape elephant shrew  ---------ttgaatactca---
B D                 Manatee  ---------ttgagtactca---
           Cape golden mole  ---------ttaagttctca---
B D                  Tenrec  ---------tggagaactca---
                   Aardvark  ---------ttgagtactca---
B D               Armadillo  ---------ttgagtactta---
B D                 Opossum  ---------ttgggagatca---
  D          Painted turtle  ---------cagagagagaa---
         Southern platyfish  ctgaaacgattaatcgttaatct
  D         Green seaturtle  =======================
B D                 Wallaby  =======================
           Star-nosed mole  =======================
B D                     Dog  =======================

Inserts between block 37 and 38 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 1bp
              Prairie vole 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D                Opossum 1009bp

Alignment block 38 of 201 in window, 45542898 - 45542922, 25 bps 
B D                   Human  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D                   Chimp  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D                 Gorilla  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D               Orangutan  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D                  Gibbon  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D                  Rhesus  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D     Crab-eating macaque  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D                  Baboon  g-tgtgcccactcc----------agaa-ata--aa----------------ca--g
B D            Green monkey  g-tgtacccactcc----------agaa-ata--aa----------------ca--g
B D                Marmoset  g-agcgcctactcc----------agaa-ata--aa----------------ca--g
B D         Squirrel monkey  g-agtgcctactcc----------agaa-atg--aa----------------ca--g
B D                Bushbaby  g-agtacccacctc----------ggaa-aaaagaa----------------ca--t
         Chinese tree shrew  g-agtgcccagcct----------gggataaa--aa----------------ga--g
B D                Squirrel  c-a--gctcagctt-----------gga-aca--aa----------------ac--a
     Lesser Egyptian jerboa  g-agtgttcgttcc-----------aga-acc--ac----------------ac--a
               Prairie vole  g-agtgtgcgaccc-----------aaa-aca--ga----------------acaaa
B D         Chinese hamster  ---gtgtgcaaccc-----------caa-aca--ga----------------ac--g
             Golden hamster  g-ggtgtgcaaccg-----------caa-aca--ga----------------gc--g
B D                   Mouse  g-aatgcgcagccc-----------gaa-aca--aa----------------ac--a
B D                     Rat  g-agtgcacaaccc-----------gaa-aca--aa----------------at--a
B D          Naked mole-rat  ---gtgcttactcc-----------aga-aca--aa----------------ag--g
B D              Guinea pig  ---gtgtttactcc-----------aga-gca--aa----------------aa--g
                 Chinchilla  ---gtgcttactcc-----------aga-aca--aa----------------ga--g
           Brush-tailed rat  ---gtgcttactcc-----------aga-----------------------------
B D                  Rabbit  g-agtgccccccttcccca-----agaa-acc--ag----------------ta--g
B D                    Pika  g-catgcccaccac----------agca-gcc--ag----------------ta--g
B D                     Pig  g-agtgcccatatcaaaaaaga--aaaa-gaa--aagaaaaaaaaaaaaaagca--g
B D                  Alpaca  g-agagcccacaccaaaaagaaagaaag-aaa--aa------------aaagca--g
             Bactrian camel  g-agagcccacaccaaaaagaa--aaaa-aaa--aa------------aaagca--g
           Tibetan antelope  a-agtgcccacaccaaaaaaaa--aaaa-aaa--aa-aaaaaaaaaaaccagca--g
B D                     Cow  a-agtgcccacacc----------aaaa-aaa--aa------------aaagca--g
B D                   Sheep  a-agtgcccacacacacacaca--caaa-aaa--aa------------acagca--g
              Domestic goat  a-agtgcccacaccaaaaaaaa--aaaa-aaa--aa-----cacacacacagca--g
B D                   Horse  g-agtgcccacccc----------caaa-a-a--at----------------ct--t
B D        White rhinoceros  c-agtgcccaccct----------gaaa-aga--ag----------------ca--a
B D                     Cat  g-agtgcccacccc----------tcaa-aaa--ag----------------ga--g
B D                 Ferret   g-agtgtccagccc----------c--a-tga--ac----------------ca--a
B D                   Panda  g-agtgctcaaccc----------ccaa-gaa--ag----------------ca--g
             Pacific walrus  g-agtgtccacccc----------tcaa-gaa--ag----------------ca--g
               Weddell seal  g-agtgcccacccc----------tcaa-gaa--ag----------------ca--g
           Black flying-fox  g-agtgcctatctc----------gaaa-aaa--tg----------------ca--g
B D                 Megabat  g-agtgcctatctc----------gaaa-aaa--tg----------------ca--g
              Big brown bat  g-agtgcccaccct----------gaaa-aaa--ta----------------ca--a
       David's myotis (bat)  g-agtgcccacctg----------gaaa-aaa--ta----------------ca--a
B D                Microbat  g-agtgcccaccct----------gaaa-aaa--ta----------------ca--a
B D                Hedgehog  g-aaattctccttc----------caaa-g----------------------ag--g
B D                   Shrew  g-aacctc----tc----------aaaa-g----------------------tg--g
B D                Elephant  g-agtgct--gcct----------agga-aag--aa----------------ca--g
        Cape elephant shrew  atggtgct--gcct----------ggga-aaa--ac----------------ca--g
B D                 Manatee  g-ggtgct--gtct----------agga-aag--aa----------------ca--g
           Cape golden mole  --agtgtt--gtct----------gggt-aag--aa----------------ca--a
B D                  Tenrec  g-agtgct--gcct----------gggc-aaa--ac----------------ca-ca
                   Aardvark  g-aatgct--gcct----------ggaa-aag--aa----------------ca--g
B D               Armadillo  t-tgtgcccgccct----------ggaa-aaa--aa----------------ta--g
         Southern platyfish  g-agtttacacacc----------ggga-aaa--aa----------------aa--g
  D         Green seaturtle  =========================================================
  D          Painted turtle  ---------------------------------------------------------
B D                 Wallaby  =========================================================
           Star-nosed mole  =========================================================
B D                 Opossum  =========================================================
B D                     Dog  =========================================================

Alignment block 39 of 201 in window, 45542923 - 45543017, 95 bps 
B D                   Human  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D                   Chimp  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D                 Gorilla  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D               Orangutan  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D                  Gibbon  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D                  Rhesus  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D     Crab-eating macaque  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D                  Baboon  ttg--------------ttatt-attc-t---------------------ccct-ggcaac---------
B D            Green monkey  ttg--------------ttatt-attc-t---------------------ccca-gacaac---------
B D                Marmoset  gtg--------------ttatt-attc-t---------------------ccct-gaaaac---------
B D         Squirrel monkey  gtg--------------ttatt-attc-t---------------------ccct-gaaaac---------
B D                Bushbaby  ttg--------------tcatt-gttc-c---------------------ccc--attggc---------
         Chinese tree shrew  ctg--------------ttctt-cttc-c---------------------ccct-ggccac---------
B D                Squirrel  gct--------------gccgt-gttc-t---------------------cctt-cgcaac---------
     Lesser Egyptian jerboa  --g--------------tcatg-gttc-t---------------------ccct-ggcaactgctat---
               Prairie vole  atg--------------ccatt-cctt-t---------------------cccc-gagag----------
B D         Chinese hamster  atg--------------ccatc-cctt-t---------------------cccc-gagagccactgtaaa
             Golden hamster  atg--------------tcact-cctt-t---------------------ctcc-gagagccactgtaaa
B D                   Mouse  atg--------------ccttt-cctt-c---------------------ctct-gagagc---------
B D                     Rat  atgagagccaccttccccttct-cctt-c---------------------ccct-tggagc---------
B D          Naked mole-rat  -tg--------------ttgat-gttc-t---------------------ccct-ggcaac---------
B D              Guinea pig  ctt--------------ttaat-gtta-t---------------------ctct-agaaac---------
                 Chinchilla  ctg--------------ttaat-ggtc-t---------------------ccct-ggcaac---------
           Brush-tailed rat  -----------------tcaac-gttc-c---------------------ctct-ggcaaa---------
B D                  Rabbit  ctg--------------ctgtt-gtctcc---------------------ccct-ggtggc---------
B D                    Pika  ctg--------------ccatc-actt-----------------------ccct-ggtgac---------
B D                     Pig  cag--------------ttatt-gtc--c---------------------ccc--ggcaac---------
B D                  Alpaca  cca--------------ttact-gtc--c---------------------ccct-ggcaac---------
             Bactrian camel  cca--------------ttatt-gtc--c---------------------ccct-ggcaac---------
           Tibetan antelope  ctg--------------ttatt-gtc--t---------------------ccct-agtaac---------
B D                     Cow  ctg--------------ttatt-gtc--c---------------------ccct-agtaac---------
B D                   Sheep  ctg--------------ttatt-gtc--c---------------------ccct-agtaac---------
              Domestic goat  ctg--------------ttatt-gtc--c---------------------ccct-agtaac---------
B D                   Horse  ctg--------------ttatt-gtct-c---------------------tgct-ggcaac---------
B D        White rhinoceros  ctg--------------ttact-gccc-ccttccgccccccctgcccccacacc-ggcaac---------
B D                     Cat  ctg--------------ttatt-gtta-c---------------------ccct-ggacac---------
B D                 Ferret   ctg--------------atatt-gtta-c---------------------ccct-gcaaac---------
B D                   Panda  ctg--------------atatt-gtta-t---------------------ccct-ggaaac---------
             Pacific walrus  ctg--------------atgtt-atta-c---------------------ccct-gcagac---------
               Weddell seal  ctg--------------atatt-gtta-c---------------------ccct-gcaaat---------
           Black flying-fox  ctg--------------ttaat-gtc--c---------------------cacg-agcaac---------
B D                 Megabat  ccg--------------ttatt-gtc--c---------------------cacc-agcaac---------
              Big brown bat  ctg--------------ttatt-gtc--c---------------------cttt-ggcaac---------
       David's myotis (bat)  ctg--------------ttact-gtc--c---------------------cttt-ggcaac---------
B D                Microbat  ctg--------------ttact-gtc--c---------------------cttt-ggcaac---------
B D                Hedgehog  tga--------------atatc-att--c---------------------ct---aacagt---------
B D                   Shrew  ctg--------------ttatt-gtt--t---------------------ctctgagcaaa---------
B D                Elephant  ttg--------------ttcttcgttc-c---------------------ccct-ggcaac---------
        Cape elephant shrew  cgg--------------gtctttgcgc-c---------------------tgat--gcaat---------
B D                 Manatee  ttg--------------ttattcattc-c---------------------ccct-ggcaac---------
           Cape golden mole  ctg--------------ttctt----------------------------------ac--c---------
B D                  Tenrec  ctc--------------tccct----------------------------------gcagc---------
                   Aardvark  ctg--------------ttctttgttt-c---------------------cctg--gcaac---------
B D               Armadillo  cca--------------ttatt-gctc-c---------------------cctt-ggcaac---------
  D          Painted turtle  ---------------------------gt---------------------gtct-gaaagg---------
  D         Green seaturtle  ======================================================================
B D                 Wallaby  ======================================================================
           Star-nosed mole  ======================================================================
B D                 Opossum  ======================================================================
B D                     Dog  ======================================================================

                      Human  --tg-ctatag-a--------------ag--aaac-tggag--taggct-------c-c-ttttctctta
                      Chimp  --ta-ctatag-a--------------tg--aaac-tggaa--taggct-------c-c-tttaccctta
                    Gorilla  --ta-ctatag-a--------------tg--aaac-cggaa--taggct-------c-c-ttttccctta
                  Orangutan  --ta-ccatag-a--------------tg--aaac-cagaa--taggct-------c-c-ttttccctta
                     Gibbon  --ta-ctatag-a--------------tg--aaac-cggaa--taggct-------c-c-ttttccctta
                     Rhesus  --ca-ctatag-a--------------tg--aaac-cggaa--taggct-------c-c-ttttccctta
        Crab-eating macaque  --ca-ctatag-a--------------tg--aaac-cggaa--taggct-------c-c-ttttccctta
                     Baboon  --ca-ctatag-a--------------tg--gaac-cggaa--ttggct-------c-c-ttttccctta
               Green monkey  --ca-ctatag-a--------------tg--aaac-cacta--taga-------------ttttccctta
                   Marmoset  --ct-ctatag-a--------------tg--aaac-tggaa--ttggct-------c-c--tttcccttg
            Squirrel monkey  --cg-ctatag-a--------------tg--aaat-tggaa--taggct-------c-c-ttttcccttg
                   Bushbaby  --cc-ccatcg-a--------------tgaaaaac-tggaa--taggcc-------c-c-ttttcctgtg
         Chinese tree shrew  --ca-ccgtag-c--------------ta--aaat-cagga----aact-------c-c-tttccaccta
                   Squirrel  --ca-ccccgg-a--------------tg--accc-tggaa--ct-gct-------c-c-ttttcccta-
     Lesser Egyptian jerboa  --tg-ctacaa-a--------------cg--aaac-caaaa--cggggt-------cct-tttgccctc-
               Prairie vole  ----------------------------------------------att---------c-ctcttcctc-
            Chinese hamster  gcca-ccacga-a--------------tg--aatt-tggaa--cagatt-------c-c-ctttccctc-
             Golden hamster  gtca-ccacga-a--------------tg--aatc-tggaa--cataat---------c-ctctcctcc-
                      Mouse  --ca-ccataa-g--------------tg--aagt-tgga------att-------cgt-tttttcccc-
                        Rat  --------------------------------------aa------act-------c-t-ttctccccc-
             Naked mole-rat  --ca-gcctaa-a--------------tg--aaat-tggaa--caggct-------c-t-ctttcccta-
                 Guinea pig  --ca-gtctaa-a--------------cg---acc-tggaa--caggct-------t-t-ctttccctt-
                 Chinchilla  --ca-gcctga-a--------------tg--aaac-cggaa--caggct-------c-c-ctttccctt-
           Brush-tailed rat  --ca-gcctaa-a--------------ag--aaac-tgcaa--caggct-------c-c-ctttccctt-
                     Rabbit  --cg-ccattg-g--------------tg--aaca-cgaag--cagagt-------c-c----tccctt-
                       Pika  --ca-ccactg-----------------------a-cgaag--cagagt-------c-c-tgttcctgt-
                        Pig  --ca-tgacag-a--------------tg--aaat-tgaa---caggat-------c-c-tttcatcttt
                     Alpaca  --ta-ccatag-a--------------tg---aac-tgag---caggct-------t-c-tttcaccttt
             Bactrian camel  --ta-ccatag-a--------------ag---aac-tgag---caggct-------c-c-tctcaccttt
           Tibetan antelope  --ta-gcacag-a--------------tg--aaac-caaa---caggctccctttac-c-ttttaccttt
                        Cow  --ta-gcacag-a--------------cg--aaac-caaa---caggct-------c-c-ttttaccttt
                      Sheep  --ta-gcacag-a--------------cg--aaac-caaa---caggctccttttac-c-ttttaccttt
              Domestic goat  --ta-gcacaa-a--------------cg--aaac-caaa---caggttccttttac-c-ttttaccttt
                      Horse  --ca-ccatgg-a--------------tg--aaac-tgag---tgggct-------c-c-ttccactatg
           White rhinoceros  --ca-ccatag-a--------------tg--agac-cgaa---caggct-------c-c-tttcacctta
                        Cat  --ca-ccagag-a--------------tg--aaac-tgag---caggct-------c-c-tttcaccttt
                    Ferret   --ta-ccagac-a--------------tg--gaac-agag---caggct-------t-c-tttcccctta
                      Panda  --ca-ccagac-a--------------tg--gaat-ggag---caggct-------c-c-tttcccctta
             Pacific walrus  --ca-ccagac-a--------------tg--gaat-ggag---caggct-------c-t-tttcccctta
               Weddell seal  --ca-ccagac-a--------------tg--gaat-ggag---caagct-------c-t-tttcccctta
           Black flying-fox  --tg-ccatag-a--------------tg--aaac-tgag---caggct-------c-c-ttacgcctta
                    Megabat  --tg-ccatag-a--------------tg--aaac-tgag---taggct-------c-c-ttacgcctta
              Big brown bat  --cc-ccatagga--------------tg--aaac-tgag---caggct-------c-cttttcacctta
       David's myotis (bat)  --cc-ctgtagaa--------------ta--aaac-cgaa---ccgtct-------c-cacttcacctga
                   Microbat  --cc-ccatagga--------------ta--aaac-cgag----cgtct-------c-ctttgcatctta
                   Hedgehog  --tg-ctatag-a--------------tg--aaaa-tgag---taggtt-------c-c-ttttacctta
                      Shrew  --ca-ccatc--a--------------gg--gaga-tgagt--tgggct-------c-c-tgtcactttg
                   Elephant  --ca--catag-a--------------ca--agac-agagg--caggct-------c-c-ttgtccctta
        Cape elephant shrew  --caactacag-a--------------tg--agat-gagaa--caggca-------t-c-ccctccctcg
                    Manatee  --ca-ccatag-a--------------ca--agac-aggag--tgggct-------c-c-ttttccctta
           Cape golden mole  --ca------------------------g--gaaaaaaaag--caggct-------c-c-ttttcctttc
                     Tenrec  --ca-ctactg-a--------------tg--agatggggag--caggct-------c-c-tttgccctta
                   Aardvark  --ca-ccaca------------------g--agat-gggag--caggct-------c-t-tttgctccta
                  Armadillo  --ca-ccatac-a--------------tg--aaac-tggag--taggct-------c-c-ttttctctta
             Painted turtle  --ca-gagcaa-agccactctgagctggg--aagc-agaaaacgagggt-------t-t-ctcctccgtc
            Green seaturtle  ======================================================================
                    Wallaby  ======================================================================
            Star-nosed mole  ======================================================================
                    Opossum  ======================================================================
                        Dog  ======================================================================

                      Human  tcac-------a----tggcaggagcacagctccactgacatat--t
                      Chimp  tcac-------a----tggcaggagcacagctccactgacatat--t
                    Gorilla  tcac-------a----tggcaggagcacagctccactgacatat--t
                  Orangutan  tcac-------a----tggcaggagcacagctccattgacatat--t
                     Gibbon  tcac-------a----tggcaggagcacagctccattgacatat--t
                     Rhesus  tcac-------a----cggcaggagcacagctccactgacatat--t
        Crab-eating macaque  tcac-------a----cggcaggagcacagctccactgacatat--t
                     Baboon  tcac-------g----cggcaggagcacagctccactgacatat--t
               Green monkey  tcac-------a----cggcaggagcacagctccactgacatat--t
                   Marmoset  tcac-------a----cagcaggagtacagctccactgacatat--t
            Squirrel monkey  tcac-------a----cagcaggagtacagctccactgacatac--t
                   Bushbaby  --------------------------acagctccactgacat----t
         Chinese tree shrew  cc------------------------ccaactccaatgatgtat--t
                   Squirrel  accc-------a----ctgtgggagc-cggctctggggacatat--g
     Lesser Egyptian jerboa  tcac-------a----ccacagggggtgagcaccatggacatat--t
               Prairie vole  tcac-------a----ctcgagggctttagcaccacaaacacac--t
            Chinese hamster  tcat-------a----ctctagaggttcaaaaccacaaccatgt--t
             Golden hamster  tcac-------a----ctctaggggctcaacaccacaaccatat--c
                      Mouse  tcgc-------g----ctccagcggttcaacaccccaaacacggcgc
                        Rat  tccc-------g----ctccagtggttcaacacctgaaacat----t
             Naked mole-rat  tcac-------a----ctgtgggagcccagctccatgaacatac--t
                 Guinea pig  tcac-------a----ctgcaggag-ccagatccctgaacata---c
                 Chinchilla  gcac-------c----ttgtgggagcccagatctacgaacata---t
           Brush-tailed rat  tcac-------a----ttgtgggaacccagatccatgaacata---t
                     Rabbit  accg-------t----gcccgggagctaagctc-----ctctcc--g
                       Pika  atta-------t----ggcatgcaa--aagtgc-----atatct---
                        Pig  tcac-------a----cctcgggatcccagctccactgatgtat--c
                     Alpaca  tcac-------a----cctggggaccccagttccgctgatgtat--t
             Bactrian camel  tcac-------a----cctggggaccccagttccgttgatgtat--t
           Tibetan antelope  tcac-------a----cctcgggagcccagttccattgatatat--t
                        Cow  tcac-------a----ccttgggagcccagttccattgatatat--t
                      Sheep  tcac-------a----cctcgggagcccagttccattgatatat--t
              Domestic goat  tcac-------a----cctcgggagcccagttccattgatatat--t
                      Horse  tgac-------a----cctcaggagcccagctccattgatatat--t
           White rhinoceros  tcac-------a----ccttaggagcccagctccattgatgtat--t
                        Cat  tcac-------a----tctcaggagcccagacccattggtatat--t
                    Ferret   ttac-------a----ccacaggagcccagctccactggtgtat--g
                      Panda  tcac------------actcaggagcccagatctactggtgtat--g
             Pacific walrus  tcac-------------------agcccagctccactggagtat--g
               Weddell seal  tcac-------a----cctcaggagcccagctccactggagtat--g
           Black flying-fox  ttac-------acatacctcggaggcccagcttcaatgatgcat--c
                    Megabat  ttac-------acatacctcggaggcccagcttcaatgatgcat--c
              Big brown bat  tcac-------a-----ccttggggc------ccattgatgtat--t
       David's myotis (bat)  tcac-------a-----ccgtggggcccaaccccatttatgtat--t
                   Microbat  tcac-------a-----ccgtggggcccagctccatttatgtat--t
                   Hedgehog  ttgc-------a----tcttgaaagtctagctctattgctatgt--t
                      Shrew  tcac-------g-----ctcaggagtcaaagcctttgacagagt--t
                   Elephant  tcat-------a-----------atcctagtagctttgacatat--t
        Cape elephant shrew  ttac-------a-----------agcctagcagctctgacatgt--t
                    Manatee  tcat-------g-----------agcctagtagctttaatgcat--t
           Cape golden mole  tcct-------a-----------agcctcacagctttgacatat--t
                     Tenrec  tcat-------a-----------agcctagcggctttgatatcg--t
                   Aardvark  ccag-------a-----------agcttagcagttttgacatat--t
                  Armadillo  ccattccatggg-----------aacccagctcctttgacatat--t
             Painted turtle  cccc-------g----gtcc---cttccccctccactgcctgct---
            Green seaturtle  ===============================================
                    Wallaby  ===============================================
            Star-nosed mole  ===============================================
                    Opossum  ===============================================
                        Dog  ===============================================

Inserts between block 39 and 40 in window
B D               Elephant 1bp
       Cape elephant shrew 386bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp

Alignment block 40 of 201 in window, 45543018 - 45543028, 11 bps 
B D                   Human  gcacacatttg
B D                   Chimp  gcacacatttg
B D                 Gorilla  gcacacatttg
B D               Orangutan  gcacacatttg
B D                  Gibbon  gcatacatttg
B D                  Rhesus  gcacacatgtg
B D     Crab-eating macaque  gcacacatgtg
B D                  Baboon  gcacacatgtg
B D            Green monkey  gcacacatgtg
B D                Marmoset  gcacacatttg
B D         Squirrel monkey  gtacacatttg
B D                Bushbaby  gcacatgttgc
         Chinese tree shrew  gcacacctttg
B D                Squirrel  acgtgcatttg
     Lesser Egyptian jerboa  gcatacattgg
               Prairie vole  gcacctgcttg
B D         Chinese hamster  gcacgtccttg
             Golden hamster  acaagtccttg
B D                   Mouse  gcgtgcacttg
B D                     Rat  tcgtgtacttg
B D          Naked mole-rat  gcacctactta
B D              Guinea pig  gcaggtatttg
                 Chinchilla  gcacatatttg
           Brush-tailed rat  gcacatatttg
B D                  Rabbit  gcgcac-tttg
B D                     Pig  -tacacacttg
B D                  Alpaca  -tgcagatttg
             Bactrian camel  -tgcagatttg
           Tibetan antelope  -tgcccatttg
B D                     Cow  -tgcccatttg
B D                   Sheep  -tgcccatttg
              Domestic goat  -tgcccatttg
B D                   Horse  gtgcacatttg
B D        White rhinoceros  gtgcacatttg
B D                     Cat  gtgcaca-ttg
B D                 Ferret   gtacaga-ttg
B D                   Panda  gtgcaca-ttg
             Pacific walrus  gtacaca-ttg
               Weddell seal  gtataca-ttg
           Black flying-fox  gtgcacgtttg
B D                 Megabat  gtgcacgtttg
              Big brown bat  gtgcacatttg
       David's myotis (bat)  gtgcacattt-
B D                Microbat  gtgcacctttg
B D                Hedgehog  gtgtccatctg
B D                   Shrew  g-gtttacttt
B D                Elephant  gcatgtatttg
B D                 Manatee  gcatagatttg
           Cape golden mole  acatatatttg
B D                  Tenrec  gtagctattta
                   Aardvark  gcatatatttg
B D               Armadillo  gcatatatttg
  D          Painted turtle  gcccacactta
  D         Green seaturtle  ===========
B D                 Wallaby  ===========
           Star-nosed mole  ===========
B D                    Pika  -----------
       Cape elephant shrew  ===========
B D                 Opossum  ===========
B D                     Dog  ===========

Inserts between block 40 and 41 in window
                  Aardvark 308bp

Alignment block 41 of 201 in window, 45543029 - 45543030, 2 bps 
B D                   Human  ca
B D                   Chimp  ca
B D                 Gorilla  ca
B D               Orangutan  ca
B D                  Gibbon  ca
B D                  Rhesus  ca
B D     Crab-eating macaque  ca
B D                  Baboon  ca
B D            Green monkey  ct
B D                Marmoset  ca
B D         Squirrel monkey  ca
B D                Bushbaby  ca
         Chinese tree shrew  ca
B D                Squirrel  cc
     Lesser Egyptian jerboa  cc
               Prairie vole  ct
B D         Chinese hamster  cc
             Golden hamster  tc
B D                   Mouse  ct
B D                     Rat  -t
B D          Naked mole-rat  ca
B D              Guinea pig  ca
                 Chinchilla  ca
           Brush-tailed rat  ca
B D                  Rabbit  ca
B D                     Pig  ca
B D                  Alpaca  ca
             Bactrian camel  ca
           Tibetan antelope  ta
B D                     Cow  ta
B D                   Sheep  ta
              Domestic goat  ta
B D                   Horse  ca
B D        White rhinoceros  ca
B D                     Cat  ta
B D                 Ferret   ta
B D                   Panda  ca
             Pacific walrus  ca
               Weddell seal  ca
           Black flying-fox  ca
B D                 Megabat  ca
              Big brown bat  ca
       David's myotis (bat)  ca
B D                Microbat  ca
B D                Hedgehog  ca
B D                   Shrew  ca
B D                Elephant  ca
B D                 Manatee  ca
           Cape golden mole  ca
B D                  Tenrec  ca
B D               Armadillo  ca
  D          Painted turtle  c-
  D         Green seaturtle  ==
B D                 Wallaby  ==
           Star-nosed mole  ==
B D                    Pika  --
       Cape elephant shrew  ==
B D                 Opossum  ==
B D                     Dog  ==
                  Aardvark  ==

Inserts between block 41 and 42 in window
          Cape golden mole 9439bp
B D                 Tenrec 1696bp

Alignment block 42 of 201 in window, 45543031 - 45543046, 16 bps 
B D                   Human  aggaga------c-----cccagagtg
B D                   Chimp  aggaga------c-----cccagagtg
B D                 Gorilla  aggaga------c-----cccagagtg
B D               Orangutan  aggaga------c-----cccagagtg
B D                  Gibbon  aggaga------c-----cccagagtg
B D                  Rhesus  aggaga------c-----cccagagtg
B D     Crab-eating macaque  aggaga------c-----cccagagtg
B D                  Baboon  aggaga------c-----cccagagtg
B D            Green monkey  aggaga------c-----cccagagtg
B D                Marmoset  aggaga------c-----cccagagtg
B D         Squirrel monkey  aagaga------c-----cccaggatg
B D                Bushbaby  aggaga------c-----cctggagtg
         Chinese tree shrew  ---aga------t-----cccagagtc
B D                Squirrel  aagaga------t-----cccagaaca
     Lesser Egyptian jerboa  tggtga------c-----tctgtggtc
               Prairie vole  gggaga------c-----acgatggtg
B D         Chinese hamster  aggaga------t-----ggtatggtg
             Golden hamster  gggaga------t-----ggtgtggtg
B D                   Mouse  ggagga------t-----gttacggtg
B D                     Rat  ggaaga------t-----gctacggag
B D          Naked mole-rat  aggaga------c-----cccagaggg
B D              Guinea pig  aggaga------cactcacccataaca
                 Chinchilla  gggaga------cacccacccagaatg
           Brush-tailed rat  aggaga------cacccaccaagagag
B D                  Rabbit  aggaga------c-----tccg-----
B D                     Pig  gggaca------c-----cccagagtg
B D                  Alpaca  aggaga------c-----cccagagtg
             Bactrian camel  aggaga------c-----cccagagtg
           Tibetan antelope  gag-----------------cagagca
B D                     Cow  gac-----------------cagaaca
B D                   Sheep  gag-----------------cagagca
              Domestic goat  gag-----------------cagagca
B D                   Horse  gagaga------c-----cccagagtg
B D        White rhinoceros  gagaga------c-----cccagggtg
B D                     Cat  gggaga------c-----cccagagtg
B D                 Ferret   gggaga------c-----cccagagtg
B D                   Panda  gggaga------c-----cccagagcg
             Pacific walrus  gggaga------c-----cccagagca
               Weddell seal  gggaga------c-----cccagagca
           Black flying-fox  gggggg------c-----tccaaagtg
B D                 Megabat  gggggg------c-----tccaaagtg
              Big brown bat  gggaga------c-----cctaaagtg
       David's myotis (bat)  cggaga------c-----cgtaaagtg
B D                Microbat  gggaga------c-----cctaaagtg
B D                Hedgehog  ggga--------c-----aacggagta
B D                   Shrew  ggggaac-----c-----cccagagtg
B D                Elephant  -------------------------ta
B D                 Manatee  -------------------------ta
B D               Armadillo  gggaga------c-----ctcagagta
  D          Painted turtle  ------ccccagc-----cgcaggg--
  D         Green seaturtle  ===========================
B D                 Wallaby  ===========================
           Star-nosed mole  ===========================
B D                    Pika  ---------------------------
B D                  Tenrec  ===========================
       Cape elephant shrew  ===========================
B D                 Opossum  ===========================
B D                     Dog  ===========================
                  Aardvark  ===========================
          Cape golden mole  ===========================

Inserts between block 42 and 43 in window
B D                    Pig 10bp
B D                 Alpaca 10bp
            Bactrian camel 10bp
          Tibetan antelope 10bp
B D                    Cow 10bp
B D                  Sheep 10bp
             Domestic goat 10bp
B D                  Horse 10bp
B D       White rhinoceros 10bp
B D                    Cat 10bp
B D                Ferret  10bp
B D                  Panda 10bp
            Pacific walrus 10bp
              Weddell seal 10bp
          Black flying-fox 10bp
B D                Megabat 10bp
             Big brown bat 10bp
      David's myotis (bat) 10bp
B D               Microbat 10bp
B D               Hedgehog 10bp
B D                  Shrew 1106bp
B D               Elephant 7bp
B D                Manatee 7bp
B D              Armadillo 10bp

Alignment block 43 of 201 in window, 45543047 - 45543059, 13 bps 
B D                   Human  ggcatctgcatcc
B D                   Chimp  ggcatctgcatcc
B D                 Gorilla  ggcatctgcatcc
B D               Orangutan  ggcatctgcatcc
B D                  Gibbon  ggcatctgcatcc
B D                  Rhesus  ggcatctgcatcc
B D     Crab-eating macaque  ggcatctgcatcc
B D                  Baboon  ggcatctgcatcc
B D            Green monkey  ggtatctgcatcc
B D                Marmoset  ggcagctgtatcc
B D         Squirrel monkey  ggcagctgtatcc
B D                Bushbaby  ggt----------
         Chinese tree shrew  aaggtttatgtcc
B D                Squirrel  ggtgcccgagtcc
     Lesser Egyptian jerboa  agcgtctgtatcc
               Prairie vole  agtatctacatcc
B D         Chinese hamster  agtatctgcagcc
             Golden hamster  agtatctgcagcc
B D                   Mouse  gctatctgcatcc
B D                     Rat  gatatccgcgtcc
B D          Naked mole-rat  ggtgtctgcatcc
B D              Guinea pig  ggtgtctgcatac
                 Chinchilla  ggtgtccgcaacc
           Brush-tailed rat  gatgtctgcatcc
B D                  Rabbit  ---gctgctttca
B D                    Pika  -------ctatcc
B D                     Pig  ggtgtctgcgtcc
B D                  Alpaca  ggtgtcttcatcc
             Bactrian camel  ggtgtcttcatcc
           Tibetan antelope  gctatctgcatcc
B D                     Cow  gctatctgcatcc
B D                   Sheep  gctgtctgcatcc
              Domestic goat  gctgtctgcatcc
B D                   Horse  gatgtccatatcc
B D        White rhinoceros  gatgtctgcaccc
B D                     Cat  ggtgtctgcatcc
B D                 Ferret   gggttctgcagcc
B D                   Panda  tgtgtctgcaggc
             Pacific walrus  ggtgtctgcaggc
               Weddell seal  ggtgtctgcaggc
           Black flying-fox  ggtgtcaacatcc
B D                 Megabat  ggtgtcaacatcc
              Big brown bat  ggcatctgcctcc
       David's myotis (bat)  ggcaactgcctcc
B D                Microbat  ggcaactgcctcc
B D                Hedgehog  ggtgtctgcctcc
B D                Elephant  ggcatctgcctcc
B D                 Manatee  ggcatctgcctcc
B D               Armadillo  ggttcctgccttc
  D          Painted turtle  agcagctgggccc
  D         Green seaturtle  =============
B D                   Shrew  =============
B D                 Wallaby  =============
           Star-nosed mole  =============
B D                  Tenrec  =============
       Cape elephant shrew  =============
B D                 Opossum  =============
B