Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 377 in window, 23630115 - 23630145, 31 bps 
B D                   Human  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D                   Chimp  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D                 Gorilla  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D               Orangutan  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D                  Gibbon  agatag-a-atctgca-gtgc---------------------ctgaagt------ccagcc
B D                  Rhesus  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D     Crab-eating macaque  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D                  Baboon  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D            Green monkey  agatag-a-atctgca-gtgc---------------------ctgaaat------ccagcc
B D                Marmoset  agatag-a-atctgca-gagc---------------------cttaaac------ccagcc
B D         Squirrel monkey  agatag-a-atctgca-gagc---------------------cttaaat------ccagcc
B D                Bushbaby  atatgg-g-atcagca-gtgccaacctgttttcagataggatcagcaac------ccaacc
B D                Squirrel  agatat-a-atcagca-gggt---------------------ctgaagc------ccagcc
     Lesser Egyptian jerboa  agatat-a-atcagca-gtgt---------------------ttgaaga------ccaggc
               Prairie vole  agatat-a-atcagtg-gtgc---------------------ccgaaat------ccagct
B D         Chinese hamster  agatat-a-ataagta-gtgt---------------------ccaaaaa------ccagct
             Golden hamster  agatat-a-ataaata-gtgc---------------------ccgaaaa------ccagct
B D                   Mouse  agatag-a-atcggca-gtcc---------------------caggaaa------tcagct
B D                     Rat  agatat-a-atcagca-gtcc---------------------cagaaaa------tcagcc
B D          Naked mole-rat  agttag-a-atcagga-gtgc---------------------ctaaaac------ccagcc
B D              Guinea pig  aggtat-a-atcagca-atga---------------------gtaaaaa------ccagcg
                 Chinchilla  aggcat-a-gtcagca-gtgc---------------------ctaaaaa------acagcc
           Brush-tailed rat  aggtgt-a-atcagca-ttgc---------------------t---------------gcc
B D                  Rabbit  agatagaa-atcagca-gtgc---------------------cttgtgc--------agcc
B D                    Pika  agatag-c-atcagcaggtgc---------------------cctacac------gaggcc
B D                  Alpaca  agatag-a-atcagca-atgc---------------------ctgaaac------ccagcc
             Bactrian camel  agatag-a-atcagca-atgc---------------------ctgaaac------ccagcc
B D                 Dolphin  agatag-a-aacagca-gtgc---------------------ctgaaac------ccagcc
               Killer whale  agatag-a-aacagca-gtgc---------------------ctgaaac------ccagcc
           Tibetan antelope  tgatag-a-gtcagca-gtgc---------------------ctgaaac------ccagcc
B D                     Cow  tgatag-a------------------------------------gaaac------ccagcc
B D                   Sheep  tgatag-a-atcagca-gtgc---------------------ctgaaac------ccagcc
              Domestic goat  tgatag-a-atcagca-gtgc---------------------ctgaaac------ccagcc
B D                   Horse  agatag-g-atcagct-gtgc---------------------ctgaaag------c-agcc
B D        White rhinoceros  agata--a-atcagca-gtgc---------------------ctgaaac------c-----
B D                     Cat  agatgg-a-gtga-ca-gtgc---------------------ctgaaac------tcagcc
B D                     Dog  agatag-a-atca-ca-gggc---------------------ctgaaac------ccagcc
B D                 Ferret   ggaaag-a-atta-aa-gtac---------------------ctgaaac------ccagcc
B D                   Panda  -caaag-a-gtca-ca-gggc---------------------ctgaaac------ccagcc
             Pacific walrus  gggaag-a-atca-ca-gggc---------------------ctgaaac------ccagcc
           Black flying-fox  agataa-a-atcagca-gcac---------------------ctgaaac------ccagtc
B D                 Megabat  agataa-a-atcagca-gcac---------------------ctgaaac------ccagtc
              Big brown bat  agatag-a-atcagca-gtgc---------------------ctgagac------ccagcc
       David's myotis (bat)  agatag-a-atcggcg-gtgc---------------------ctgagac------ccagcc
B D                Microbat  agatag-a-atcggca-gtgc---------------------ctgagac------ccagcc
B D                Hedgehog  atattg-aagccaaca-ggtc---------------------tgcaaac------ccagct
B D                   Shrew  aga------attagca-gggc---------------------ctgaaat------ccagcc
            Star-nosed mole  agat-----aaaatct-ggac---------------------ctgacat------tcggac
B D                Elephant  agatat-a-accagca-gtgt---------------------ctgaaac------------
        Cape elephant shrew  agatac-g-atcagcg-gtgt---------------------ctgaaga------------
B D                 Manatee  agatat-g-atcagca-gagt---------------------ctgaaac------------
           Cape golden mole  agttat-a-atcagca-gtgt---------------------ctgaaac------------
B D                  Tenrec  agatag-c-accagca-gggt---------------------ccgaaac------------
                   Aardvark  agatgt-c-atcagca-gtgt---------------------ttgaatc------------
B D               Armadillo  agatag-a-atcagca-gtgc---------------------cccaaaccgcgcc------
        Chinese tree shrew  =============================================================
B D                     Pig  =============================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           X. tropicalis  =============================================================
  D          Painted turtle  =============================================================
B D         Tasmanian devil  =============================================================

Inserts between block 1 and 2 in window
B D                  Mouse 33bp
B D                 Rabbit 3bp
B D                   Pika 3bp

Alignment block 2 of 377 in window, 23630146 - 23630255, 110 bps 
B D                   Human  tgctgcttactcacatcctcatac----t---------------cagctg-cagactg--c---c-tgac
B D                   Chimp  tgctgcttactcacatcctcatac----t---------------cagctg-cagactg--c---c-tgac
B D                 Gorilla  tgctgcttactcacatcctcatac----t---------------cagctg-cagactg--c---t-tgac
B D               Orangutan  tgctgcttactcacatcctcatac----t---------------cagctg-cagactg--t---c-tgac
B D                  Gibbon  tgctgcttactcacatcctcatac----t---------------cagctg-aagactg--c---c-tgac
B D                  Rhesus  tgctgcttactcacatcctcacac----t---------------cagttg-cagactg--g---c-tgac
B D     Crab-eating macaque  tgctgcttactcacatcctcacac----t---------------cagttg-cagactg--g---c-tgac
B D                  Baboon  tgctgcttactcacatcctcacac----t---------------cagttg-cagactg--c---c-tgac
B D            Green monkey  tgctgcttactcacatcctcatac----t---------------cagttg-cagactg--c---c-tgac
B D                Marmoset  tgttgctcactcacatcctcacac----t---------------cagctg-cagactg--c---c-tgac
B D         Squirrel monkey  tgctgctcactcacatcctcacac----t---------------cagctg-cagactg--c---c-tgac
B D                Bushbaby  tgttgcttattcgcatcctcacaa----t---------------cagctg-cagactg--c---cacaac
B D                Squirrel  tgcatcctactcacatcctcacac----t---------------t----g-cagactt--c---a-tgac
     Lesser Egyptian jerboa  --atccctacttacacc----------------------------------tatactt--c---a-cgac
               Prairie vole  ---------------------------------------------------------c--t---a-cgac
B D         Chinese hamster  ---------------------------------------------------------c--t---a-caac
             Golden hamster  ---------------------------------------------------------c--t---a-tgac
B D                     Rat  ---------------------------------------------------------c--c---a-cgac
B D          Naked mole-rat  tgcattctgcttacatccccatac----t---------------t----g-cagacca--c---a-tggc
B D              Guinea pig  ta-attctg-ttacatcctcacat----t---------------t----g-cagacca--c---a-atgc
                 Chinchilla  tgtgtcctgcttatatccccacac----t---------------c----g-cagacca--c---a-gggc
           Brush-tailed rat  tgtattctgcttacctccccacac----t---------------c----g-catacca--c---a-cagc
B D                  Rabbit  agcttcctccctcctcacactcag----c---------------c----g-cagactc--c---c-gcag
B D                    Pika  agcctcctccctccctgcactctt----c---------------c----g-cagactc--c---c-acag
B D                  Alpaca  tgctgccccctcccgtgctggcac----g---------------cagctg-cagactc--cgtgg-cggt
             Bactrian camel  tgctgccccctcccatgctggcac----g---------------cagctg-cagactc--cgtgg-cggt
B D                 Dolphin  tgctgcctactcacattctcgcac----t---------------cagctg-caggctc--c---a-cggc
               Killer whale  tgctgcctactcacattctcgcac----t---------------cagctg-caggctc--c---a-cggc
           Tibetan antelope  tgctgcctcctcacatctctgcac----t---------------tagttg-cagactc--c---a-cagc
B D                     Cow  tgctacctagtcacatctttgcac----t---------------taattg-cagactc--c---a-cagc
B D                   Sheep  tgctgcctgctcacatctttgcac----t---------------tagttg-cagactc--c---a-cagc
              Domestic goat  tgctgcctgctcacatctttgcac----t---------------tagttg-cagactc--c---a-cagc
B D                   Horse  tgctgcccgttcacatcctcacac----c---------------cggctt-cagaccg--c---c-c-at
B D        White rhinoceros  --cggcgcattcacatccgcacac----c---------------tagctg-cagactc--c---c-cggc
B D                     Cat  tgttgtttcctcacatcttcacactcagt---------------cagctg-caggctc--c---a-cagc
B D                     Dog  tgttgcctacccacatcctcgcac----t---------------cagctgccagactc--c---a-cagc
B D                 Ferret   tgccacctccccacatcctcacac----t---------------cagctg-cagactt--t---a-cagc
B D                   Panda  tgtcacctacccacctcctcacac----t---------------cagttg-cagactt--c---a-cagc
             Pacific walrus  tgtcacctacccacatccttacgc----t---------------cagctg-cagactc--c---a-caga
           Black flying-fox  tgctgcctactcacatcctcacac----t---------------cagccg-tggactc--c---a-tggt
B D                 Megabat  tgctgcctactcacatcctcacac----t---------------cagctg-tggactc--c---a-tggt
              Big brown bat  t-ctgcctatttacatcctcacgc----t---------------cagctg-cagcccc--c---g-gggc
       David's myotis (bat)  t-ctgcctcctcacatcctcacgc----t---------------cagctg-cagcccc--c---a-cagc
B D                Microbat  t-ctgcctcctcacatcctcacgc----t---------------cagctg-cagcccc--c---a-cagc
B D                Hedgehog  ggctgccaccacccgggttctcat-------------------------------gta--c-----agct
B D                   Shrew  tgttgccggctcacctc--------------------------------------aga--c---a-gggc
            Star-nosed mole  tgcggcatactcgcatcctcccac----t---------------aagtcg-cag-gta--c---c-aggc
B D                Elephant  --ctgtttcctcatatcctcacac----t--------------ccagctg-caggccccac---a-catt
        Cape elephant shrew  --gtgcttcctcacatcctcatac----t---------------tggctc-ctgaccc--c---a-gatt
B D                 Manatee  --ctgtttcttcacatcctcacac----tcagatcctcacactctggctg-caggtcccac---a-cagt
           Cape golden mole  --ctgcttcctcacaccttcacac----tcggatcctcacact-tgactg-cagacctcac---a-aaac
B D                  Tenrec  --ccgcttcctcgc-ccctcgtcc----tcggatcctcacatt-tgacag-tggacctcac---a-ggac
                   Aardvark  --ctgcttcctcacatcctcgtag----tcggattgtcacact-cggctg-cagaccccag---a-taac
B D               Armadillo  tgctgcttactcacctcctcacat----c-----------------------agatcccac---c-caac
B D                   Mouse  ======================================================================
        Chinese tree shrew  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           X. tropicalis  ======================================================================
  D          Painted turtle  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  aga-ag--g------------gctgccaa----actgcactccaga---cagacag-gtgcacagccagg
                      Chimp  aga-ag--g------------gctgccaa----actgcactccgga---cagacag-gtgcacagccagg
                    Gorilla  aga-ag--g------------gctgccaa----actgcactccgga---cagacag-gtgcacagccagg
                  Orangutan  aga-ag--g------------gctgccaa----cctgaactccgga---cagacag-gtgcacagccagg
                     Gibbon  aga-ag--g------------gctgccaa----cctgcactctgga---cagacag-gtgcacagccagg
                     Rhesus  aga-ag--g------------gctgccga----cctgcactgctga---cagacag-gtgtacagcaagg
        Crab-eating macaque  aga-ag--g------------gctgccga----cctgcactccaga---cagacag-gtgtacagcaagg
                     Baboon  aga-ag--g------------gctgccga----cctgcactccaga---cagatgg-atgtacagcaagg
               Green monkey  aga-ag--g------------gctgccga----cctgcactccaga---cagacag-gtgtacgacaagg
                   Marmoset  aga-gg--gctcctgaccagcgctcctga----ccagcgctccaga---cagacaa-gtacacagtcagg
            Squirrel monkey  aga-gg---------------gctcctga----ctagcgctccaga---cagacag-gtacacagtcagg
                   Bushbaby  aga-ag--a------------gctcctga----cctgtgctctgaa---gagacag-tagcacagccagg
                   Squirrel  ---------------------------------------------------------------agcc-gg
     Lesser Egyptian jerboa  ag-------------------------------------------------------------agccaag
               Prairie vole  tc-------------------------------------------------------------agcc-ag
            Chinese hamster  ag-------------------------------------------------------------aacc-ag
             Golden hamster  aa-------------------------------------------------------------agtc-ag
                        Rat  ac-------------------------------------------------------------cctt-gg
             Naked mole-rat  ag-------------------------------------------------------------ggccagg
                 Guinea pig  ag-------------------------------------------------------------ggctggg
                 Chinchilla  cg-------------------------------------------------------------ggccagg
           Brush-tailed rat  ag-------------------------------------------------------------gg-cagg
                     Rabbit  ag------gc-----------gcttctca----cctg-------------------------cagccagg
                       Pika  agg-aa--gc-----------actgctga----cctg-------------------------cagccagg
                     Alpaca  gga-gg--g------------gcccctga----cccttactctaga---cagacaa-gagcacagccagg
             Bactrian camel  gga-gg--g------------gcccctga----cccttactctaga---cagacaa-gagcacagacagg
                    Dolphin  gga-gg--g------------gcccctgg----ccagtgctcagga---cagccag-gagcacaaccagg
               Killer whale  gga-gg--g------------gcccctga----ccagtgctcagga---cagccag-gagcacagccagg
           Tibetan antelope  aga-gg--a------------gaccctga----cccatgctcagga---cagacag-aagcacagcccgg
                        Cow  aga-gg--a------------gaccctga----cccatgctcagga---cagacag-aagcacagcccag
                      Sheep  aga-gg--a------------gaccttga----cccattctcagga---cagacag-aagcacagcccgg
              Domestic goat  aga-gg--a------------gaccttga----cccattctcagga---cagacag-aagcacagcccgg
                      Horse  gga-ag--a------------gctcctga----cccgcactcagga---aagagag-gagcacagccagg
           White rhinoceros  gga-ag--g------------ggtcctga----cccgcactcagga---aagacag-gagcacagccagg
                        Cat  aga-ag--g------------gctcctga----cctgcactcaggaacgacgacga-gagcatcgccagg
                        Dog  ggg-ag--g------------gctcctga----cctgggctcagga-------caa-gagcatagccagg
                    Ferret   gga-ag--g------------gctcctga----cctgcgctcagga---accacaa-gagcacaaccagg
                      Panda  aga-ag--g------------gctcctac----cctgtgctcagga---accgcga-gggcacagccagg
             Pacific walrus  gga-ag--g------------gctcctga----cctgtgctcagga---accacaa-gagcacagccagg
           Black flying-fox  gga-gg--g------------gctcc-ga----gccacactcagga---aagacag-cagcacagccagg
                    Megabat  gga-gg--g------------gctcc-ga----gccacactcagga---aagacag-cagcacagccagg
              Big brown bat  aaa-gg--g------------gctcctga----accacactcagga---aagacag-cagcacagccagg
       David's myotis (bat)  aga-gg--g------------gctcctga----gccacactcagga---aagacag-cagcacagccagg
                   Microbat  aga-gg--g------------gctcctga----gccacactcagga---aagacag-cagcacagccagg
                   Hedgehog  gca-ga--c------------gccactcaggagccagtgagcac------cgtcagtgagctctgccagg
                      Shrew  gaa-gaagg------------gtggctca----cctgtgcccag------catcgg-gagtgcagccagg
            Star-nosed mole  caa-ga--g------------gctcctca----cctgcacgcaggg---aaggcag-gagcacaagcagg
                   Elephant  gga-gg---------------gctcctga----cctggatggatga---aagacag-gagcacagccagg
        Cape elephant shrew  gga-gg---------------gttcctga----cttggactcagga---aaggctg-gaggacagccgg-
                    Manatee  ggg-gg---------------gctcctga----tctgaattcagga---aagacag-gagcatagccagg
           Cape golden mole  aga-ga---------------gctcctga----cctggactcaggg---aagacaa-cagcacaaccacg
                     Tenrec  agg-gg---------------gctcc----------ggactcagga---aagacag-gtgtctatctagg
                   Aardvark  gga-ag---------------cctcctga----tctggactcaaga---aagacag-aagcacagccaga
                  Armadillo  agaggg---------------gctcctga----cccggaggcaggg---aggacag-gagcacagccggg
                      Mouse  ======================================================================
         Chinese tree shrew  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              X. tropicalis  ======================================================================
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  -t------aagcctgggccagcatc------a
                      Chimp  -t------aagcctgggccagcatc------a
                    Gorilla  -t------aagcctgggccagcatc------a
                  Orangutan  -t------aagcctgggccagcatc------a
                     Gibbon  -t------aagcctgggccagcatc------a
                     Rhesus  -t------aagcctgggccagcatc------a
        Crab-eating macaque  -t------aagcctgggccagcatc------a
                     Baboon  -t------aagcctgggccagcatc------a
               Green monkey  -t------aagcctgggccagcatc------a
                   Marmoset  -t------aagcctgggccagcatc------a
            Squirrel monkey  -t------aagcctgggccagcatc------a
                   Bushbaby  -t------aaggctgaa-tggcatc------a
                   Squirrel  -a------taaactgagcctgcatc------a
     Lesser Egyptian jerboa  -t------aaggccgaccaggcatc------a
               Prairie vole  -t------gag---------------------
            Chinese hamster  -t------aagaccaagtcagcgtc------t
             Golden hamster  -t------aaggccgagtcagcatc------t
                        Rat  -c------aa---caggccagcatt------t
             Naked mole-rat  -t------aaggctgagctggtatc------a
                 Guinea pig  -t------aaggctgg---ggcctc------a
                 Chinchilla  -t------aaggctgagctggcatc------g
           Brush-tailed rat  -t------aaggctgagtcggcgtc------a
                     Rabbit  -t------aggc-------ggcacc------a
                       Pika  -t------aagtg------ggcacc------t
                     Alpaca  -t------gaggctgagccggcacc------a
             Bactrian camel  -t------gaggctgagctggcacc------a
                    Dolphin  -t------gaggctgagctgacgcc------g
               Killer whale  -t------gaggctgagctgacgcc------g
           Tibetan antelope  -taaggg-aaggctgagctgggctc------a
                        Cow  -taagggtaaggctgagctggcctc------a
                      Sheep  -taagggtaaggctgagctggcctc------a
              Domestic goat  -taagggtaaggctgagctggcctc------a
                      Horse  -t------aaggctgagctggcccc------a
           White rhinoceros  -t------aaggctgagctggcccc------a
                        Cat  -t------aagacca-----------------
                        Dog  -t------caggcgg-----------------
                    Ferret   -t------aaggctg-----------------
                      Panda  -t------aaggctg-----------------
             Pacific walrus  -t------aaggctg-----------------
           Black flying-fox  -t------aagactgagctggcacc------a
                    Megabat  -t------aagactgagctggcacc------a
              Big brown bat  -t------gaggtcgagcccgcacc------a
       David's myotis (bat)  -t------gaggtcgagcccgcacc------g
                   Microbat  -t------gaggtcgagcccgcacc------g
                   Hedgehog  -t------gaga-------gccagcccaaagc
                      Shrew  -t------aaggtgg----tccagc------t
            Star-nosed mole  -t------aaggaggagctgccacc------a
                   Elephant  -t------gagggtgagctggagtc------a
        Cape elephant shrew  --------------------------------
                    Manatee  -t------aaggccaagctggagtc------a
           Cape golden mole  -t------aagacatca--ggaggc------a
                     Tenrec  -t------aaggcccgagtgaaatc------a
                   Aardvark  tt------aaggctgagctggagt-------g
                  Armadillo  -g------aaggctgagctgcctc--------
                      Mouse  ================================
         Chinese tree shrew  ================================
                        Pig  ================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              X. tropicalis  ================================
             Painted turtle  ================================
            Tasmanian devil  ================================

Inserts between block 2 and 3 in window
B D                 Rhesus 1bp
B D    Crab-eating macaque 1bp
B D                 Baboon 1bp
B D           Green monkey 1bp
B D               Marmoset 1bp
B D        Squirrel monkey 1bp
B D               Bushbaby 1bp
B D               Squirrel 1bp
    Lesser Egyptian jerboa 1bp
B D        Chinese hamster 1bp
            Golden hamster 1bp
B D                    Rat 1bp
B D                 Rabbit 8bp
B D                   Pika 8bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
B D               Hedgehog 1bp
B D                  Shrew 1bp
           Star-nosed mole 1bp
B D               Elephant 1bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp
B D              Armadillo 1bp

Alignment block 3 of 377 in window, 23630256 - 23630297, 42 bps 
B D                   Human  cactg-----cc---cag----ggca----gg------catg----atgtggctcaggctgggg---ctg
B D                   Chimp  cactg-----cc---cag----ggca----gg------catg----atgtggctcaggctgggg---ctg
B D                 Gorilla  cactg-----cc---cag----ggca----gg------catg----atgtggctcaggctgggg---ctg
B D               Orangutan  cactg-----cc---tag----ggca----gg------catg----atgtggctcaggctgggg---ctg
B D                  Gibbon  cactg-----cc---cag----ggca----gg------catg----atgtggctcaggctgggg---ctg
B D                  Rhesus  cactg-----cc---cag----ggca----gg------catg----atatggctctggttgggg---cta
B D     Crab-eating macaque  cactg-----cc---cag----ggca----gg------catg----atatggctctggttgggg---cta
B D                  Baboon  cactg-----cc---cag----ggca----gg------catg----atgtggctctggttgggg---ctg
B D            Green monkey  cagtg-----cc---cag----ggca----gg------catg----atgtggttctggttgggg---ctg
B D                Marmoset  cactg-----cc---cag----gaca----gg------cagg----atgtggctcaggctggag---c--
B D         Squirrel monkey  cactg-----cc---tag----ggca----gg------cagg----atgtggttcaggctggag---c--
B D                Bushbaby  tgtag-----cc---cag----gatg----gg-------aca----gtgtggcccaggctaaga---cta
B D                Squirrel  cacag-----cc---cag----ggca----gg------aatg----gtgtggtccaagttgagg---cct
     Lesser Egyptian jerboa  agcag-----cc---caagattggta----gg------aatg----gtgtaacccaaactgagg---cca
               Prairie vole  ----g------c---cac----ggaa----gg------aatg----acgtggcccaggccacgg---ctg
B D         Chinese hamster  catag------c---caa----ggta----ga------aacg----atgtggcccaggccaagg---cca
             Golden hamster  cacag------c---caa----ggt-----ga------agcg----acgtggcccaggccaagg---cca
B D                   Mouse  cacag-----cc---caa----ggtt----gg------aatg----atgtggtctgggacaagg---cct
B D                     Rat  cacag-----cc---caa----tatt----gg------agtg----atgtggcctgggccaagg---cct
B D          Naked mole-rat  --c------------cag----ggca----gg------ggtg----gggcagcccctcctgagg---cca
B D              Guinea pig  --ctg-----cc-tgctg----aacaggatgg------ggag----gggccacccaggctgagg---cca
                 Chinchilla  --cca-----ccacgcgg----ggca----gg------ggtg----gggtggcccaggtcgagg---cca
           Brush-tailed rat  --ccg-----ccctgcag----caca-----g------tgca----gggcagccccagctgagg---ccg
B D                  Rabbit  cactgag---cc---cag----ggca----gg------gaca----gtgtggcctga-------------
B D                    Pika  ccctgggaatct---cat----ggca----ag------ggta----gcgtgacccaag------------
B D                  Alpaca  ctcgg-----ct---ca-----ggga----gt------gatg----ct----------------------
             Bactrian camel  ctcgg-----ct---ca-----ggga----gt------gatg----ct----------------------
B D                 Dolphin  ctaaa-----------------ggca----gg------gatg----ct----------------------
               Killer whale  ctaag-----------------ggta----gg------gatg----ct----------------------
           Tibetan antelope  ctcag-----ct---cag----ggca----gg------aatg----tt----------------------
B D                     Cow  ctcag-----ct---cag----ggca----gg------aatg----tt----------------------
B D                   Sheep  ctcag-----ct---cac----ggca----gg------aatg----tt----------------------
              Domestic goat  ctcag-----ct---cag----ggca----gg------aatg----tt----------------------
B D                   Horse  ctcag-----cc---cag----ggca----gg------gacagatggtgtcgcccaaggcgagg------
B D        White rhinoceros  ctcag-----cc---cag----ggca----gg------ggcaggcggtgtggcccaagacgagg------
B D                     Cat  -----------------g----agca----gg------gaca----atgtggcccaatgtaagg------
B D                     Dog  -----------------a----ggca----ac------gtca----gtgtggcctgaggtaagg------
B D                 Ferret   -----------------g----ggca----gg------gaca----atatggcccccagtcaggctg---
B D                   Panda  -----------------g----ggca----gg------gacg----acgtgggccccggtgagg------
             Pacific walrus  -----------------g----ggca----gg------gaca----atgtggcccacggtaggg------
           Black flying-fox  ctcgg-----cc---cag----ggcg----gg------gaca----gtgtggctga------gg------
B D                 Megabat  ctcgg-----cc---cag----ggcg----gg------gaca----gtgtggctga------gg------
              Big brown bat  ctcag-----cc---cag----ggca----ag------gaca----gtgtggccaa-ggccagg------
       David's myotis (bat)  ctcag-----cc---cag----ggca----ag------gacg----ctgtggccaa-ggccagg------
B D                Microbat  ctcag-----cc---cag----ggca----ag------gacg----ctgtggccaa--gccagg------
B D                Hedgehog  ctcag-----cc---t-g----ggca----gc------ttca----g-----------------------
B D                   Shrew  ctcag-----cc---c-c----ggca----gg------gtag----gt----------------------
            Star-nosed mole  ctcac-----cc---a-g----ggaa----gg------ggca----g-----------------------
B D                Elephant  ctcag-----ct---cag----gtga----ggctgcctcaca----ctgggttta---------------
        Cape elephant shrew  ----a-----ca---cag----gtga----ggctgcctcaca----ctggaatta---------------
B D                 Manatee  ctcag-----cc---cag----gtga----ggctgcctcaca----ctggggtta---------------
           Cape golden mole  ctcaa-----cc----------------------------------------------------------
B D                  Tenrec  ctcca-----cc---cag----a----------------gca----gcgggatga---------------
                   Aardvark  ttcag-----ca---cag----gtga----ggttgcctcaca----ctgggatta---------------
B D               Armadillo  ctcca-----cc---cag----gtag----ag--------------------------------------
        Chinese tree shrew  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           X. tropicalis  ======================================================================
  D          Painted turtle  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  c
                      Chimp  c
                    Gorilla  c
                  Orangutan  c
                     Gibbon  c
                     Rhesus  g
        Crab-eating macaque  g
                     Baboon  c
               Green monkey  c
                   Marmoset  -
            Squirrel monkey  -
                   Bushbaby  c
                   Squirrel  a
     Lesser Egyptian jerboa  c
               Prairie vole  c
            Chinese hamster  c
             Golden hamster  c
                      Mouse  c
                        Rat  c
             Naked mole-rat  c
                 Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  c
                     Rabbit  -
                       Pika  -
                     Alpaca  -
             Bactrian camel  -
                    Dolphin  -
               Killer whale  -
           Tibetan antelope  -
                        Cow  -
                      Sheep  -
              Domestic goat  -
                      Horse  -
           White rhinoceros  -
                        Cat  -
                        Dog  -
                    Ferret   -
                      Panda  -
             Pacific walrus  -
           Black flying-fox  -
                    Megabat  -
              Big brown bat  -
       David's myotis (bat)  -
                   Microbat  -
                   Hedgehog  -
                      Shrew  -
            Star-nosed mole  -
                   Elephant  -
        Cape elephant shrew  -
                    Manatee  -
           Cape golden mole  -
                     Tenrec  -
                   Aardvark  -
                  Armadillo  -
         Chinese tree shrew  =
                        Pig  =
               Weddell seal  N
              X. tropicalis  =
             Painted turtle  =
            Tasmanian devil  =

Inserts between block 3 and 4 in window
          Brush-tailed rat 150bp

Alignment block 4 of 377 in window, 23630298 - 23630341, 44 bps 
B D                   Human  ct---tgcctcactgcctt--------------gggtt-gggtcta-taatgac------tg-gaactgc
B D                   Chimp  ct---tgcctcactgcctt--------------gggtt-gggtcta-taatgac------tg-gaactgc
B D                 Gorilla  ct---tgcctcactgcctt--------------gggtt-gggtcta-taatgac------tg-gaactgc
B D               Orangutan  ct---tgcctcactgcctt--------------gggtt-gggtcta-taatgac------tg-gaactgc
B D                  Gibbon  ct---tgccttactgcctt--------------gggtt-gggtcta-taatgac------tg-gaactgc
B D                  Rhesus  tg---tgcctcactgcctt--------------gtgtt-gggtcta-taatgac------tg-gaaccgc
B D     Crab-eating macaque  tg---tgcctcactgcctt--------------gtgtt-gggtcta-taatgac------tg-gaaccgc
B D                  Baboon  tg---tgcctcactgcctt--------------gtgtt-gggtcta-taatgac------tg-gaaccgc
B D            Green monkey  tg---tgcttcactgcctt--------------gtgtt-gggtcta-taatgac------tg-gaaccgc
B D                Marmoset  -----tgcctcactgcctt--------------gtgttggggtcta-taatgac------tg-aaactgc
B D         Squirrel monkey  -----tgcctccctgcctt--------------gtgtttgggtcta-taatgac------tg-gaactgc
B D                Bushbaby  ttcactgtctccctgcctt--------------gctttggggtcaa-tggaaac------tg-aaactat
B D                Squirrel  --------atggccatgct--------------g-----gggtcca-tgatggg------tg-gaactgc
     Lesser Egyptian jerboa  --------ttagcttcact--------------g-----gggtgca-tgatgcc------tg-aaactcc
               Prairie vole  --------a---------c--------------t-----ggccaga-cgactcc------tg-gaacagt
B D         Chinese hamster  --------aaggctgcacc--------------a-----gagcaaa-tgactcc------tg-gaattgt
             Golden hamster  --------atggctgcgcc--------------g-----gggca----gactcc------tg-gaagcgt
B D                   Mouse  --------atggctatacc--------------a-----gggcaaa-cgactct------tg-gagcgg-
B D                     Rat  --------atggctaccct--------------g-----ggacaaa-cgactct------tg-gaactg-
B D          Naked mole-rat  --------atggccatgtt--------------g-----agatcca--gccagc------tg-gaacttc
B D              Guinea pig  --------atgcctgtgtt--------------g-----gggtcca--accagc------tg-gagctgc
                 Chinchilla  --------atgaccgtgtt--------------g-----gagtcca--gcctgc------tt-gagctgc
B D                  Rabbit  ------gcccgtctgcccc--------------a-----cgccagagcggcgac------cg-cac----
B D                    Pika  ------gcctggctgccac--------------c-----c-------tgccccc------ta-ctc----
B D                  Alpaca  --------gtgcctatatt--------------g-----gggtcag-tgatg-c------ta-gaacggc
             Bactrian camel  --------gtgcctatatt--------------g-----gggtcag-tgatg-c------ta-gaatggc
B D                 Dolphin  --------gtgcccaggtt--------------g-----gtgttcg-tgatg-c------cg-gaactgc
               Killer whale  --------gtgcccacgtt--------------g-----gtgttcg-tgatg-c------cg-gaactgc
           Tibetan antelope  --------gtgcccaggtt--------------g-----gggtctg-tgatg-c------ca-gagttgc
B D                     Cow  --------gtacccaggtt--------------g-----gggtctg-tgatg-c------ca-gaactgc
B D                   Sheep  --------gtgcccaggtt--------------g-----gggtctg-tgatg-c------ca-gagctgc
              Domestic goat  --------gtgcccaggtt--------------g-----gggtctg-tgatg-c------ca-gagctgt
B D                   Horse  --------ctgtgcagttt--------------g-----gggttca-tgaca-c------ca-gaactgc
B D        White rhinoceros  --------ctgccccggtt--------------g-----gggtcca-tgacg-c------gg-gaactgc
B D                     Cat  --------ctggctgggct--------------g-----gggtccc-tgtca-c------ca-ctactgc
B D                     Dog  --------ctgtcccggttgggggttgggggttg-----gggtccg-tgaca-c------tg-gacccac
B D                 Ferret   -------actgtccaggtg--------------g-----gggtccc-tgaca-c------tg-gg-ctgc
B D                   Panda  --------ctgtccagatt--------------g-----cggtcag-cgaca-c------tc-ggcccac
             Pacific walrus  --------ctgtgtagcttg-------------g-----gggtccg-tgaca-c------tg-gacctgc
           Black flying-fox  --------ctgcccaggtc--------------a-----gggttcc-tgatg-t------ta-gaa----
B D                 Megabat  --------ctgcccaggtc--------------a-----gggttcc-tgatg-t------ta-gaa----
              Big brown bat  --------ctgcccaggtc--------------g-----gggtccc-tgacc-c------tg-ggactgc
       David's myotis (bat)  --------ctgcccaggtc--------------g-----ggatccc-cgacc-c------tg-gaactgc
B D                Microbat  --------ctgccccggtc--------------g-----gggtccc-cgacc-c------tg-gaactgc
B D                Hedgehog  -------------------------------------------------atg-c------tg-gaagtgc
B D                   Shrew  ---------------------------------g-----agac------cca-c------agcaactccc
            Star-nosed mole  ---------------------------------g-----aggc------aca-t------ag-gaggccc
B D                Elephant  --------------aggct--------------g-----ggaccca-gccag-c------ta-gaactgc
        Cape elephant shrew  --------------aggct--------------g-----ggatcca-actgg-c------ca-gaatgat
B D                 Manatee  --------------aggct--------------g-----ggaccca-gctgg-c------ta-gaactac
           Cape golden mole  --------------aggta--------------a-----ggttccc-tcatg-ctggaatta-agactga
B D                  Tenrec  --------------aggct--------------g-----ggaccca-cctag-c------ta-tcacggg
                   Aardvark  --------------aacct--------------g-----ggacaca-gcagg-c------ta-gaactgc
B D               Armadillo  --------------atggt--------------g-----ggggcta-ccg----------cg-agactgc
          Brush-tailed rat  ======================================================================
        Chinese tree shrew  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           X. tropicalis  ======================================================================
  D          Painted turtle  ======================================================================
B D         Tasmanian devil  ======================================================================

Alignment block 5 of 377 in window, 23630342 - 23630350, 9 bps 
B D                   Human  ccatc--t-----tca
B D                   Chimp  ccatc--t-----tca
B D                 Gorilla  ccatc--t-----tca
B D               Orangutan  ccatc--t-----tca
B D                  Gibbon  ccatc--t-----tca
B D                  Rhesus  acatc--t-----tca
B D     Crab-eating macaque  acatc--t-----tca
B D                  Baboon  acatc--t-----tca
B D            Green monkey  acatc--t-----tca
B D                Marmoset  ctatc--t-----tca
B D         Squirrel monkey  cta-------------
B D                Bushbaby  ccacc--t-----tca
B D                Squirrel  ccatc--c-----tca
     Lesser Egyptian jerboa  acatc--t-----tca
               Prairie vole  gtgtc--t-----tcg
B D         Chinese hamster  ctgtc--t-----tta
             Golden hamster  ctgcc--t-----tca
B D                   Mouse  -agtc--t-----tca
B D                     Rat  -agtc--t-----tca
B D          Naked mole-rat  -ctac--t-----cca
B D              Guinea pig  -tcgc--t-----tca
                 Chinchilla  -tcag--t-----tca
           Brush-tailed rat  -ccag--tccctgtct
B D                  Rabbit  tcgcc--t-----tca
B D                    Pika  ctact--c-----ttc
B D                  Alpaca  ccacc--t-----tca
             Bactrian camel  ccacc--t-----tca
B D                 Dolphin  ccacc--t-----tca
               Killer whale  ccacc--t-----tca
           Tibetan antelope  cca-c--t-----tca
B D                     Cow  cca-c--t-----tca
B D                   Sheep  cca-c--t-----tca
              Domestic goat  cca-c--t-----tca
B D                   Horse  ccaccttt-----tca
B D        White rhinoceros  ccacc--t-----tca
B D                     Cat  ccacc--t-----tca
B D                     Dog  ccact--t-----ttg
B D                 Ferret   ccacc--t-----tca
B D                   Panda  ccccc--t-----tcg
             Pacific walrus  ccacc--t-----tcg
              Big brown bat  tcact--t-----tcg
       David's myotis (bat)  tcact--t-----tca
B D                Microbat  tcact--t-----tca
B D                Hedgehog  ctgtc--t-----tca
B D                   Shrew  ccagc--t-----tgg
            Star-nosed mole  ctagc--t-----ggg
B D                Elephant  ccacc----------t
        Cape elephant shrew  ccact--t-----tat
B D                 Manatee  ccacc--t-----tcc
           Cape golden mole  ctacc--t-----tcc
B D                  Tenrec  ccaca--t-----ttc
                   Aardvark  ctacc--t-----ttc
B D               Armadillo  ctaac-----------
          Black flying-fox  ----------------
        Chinese tree shrew  ================
B D                     Pig  ================
              Weddell seal  NNNNNNNNNNNNNNNN
B D           X. tropicalis  ================
B D                 Megabat  ----------------
  D          Painted turtle  ================
B D         Tasmanian devil  ================

Inserts between block 5 and 6 in window
B D               Marmoset 9556bp
           Star-nosed mole 6bp

Alignment block 6 of 377 in window, 23630351 - 23630384, 34 bps 
B D                   Human  ctcctgttc------ac-ttt-ttatg---------ttgatgc-tc-tttctt
B D                   Chimp  ctcctgttt------ac-ttt-ttatg---------ttgatgc-tc-tttctt
B D                 Gorilla  ctcctgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D               Orangutan  ctcctgttt------ac-ttt-tcatg---------ttgatgcttc-tttctt
B D                  Gibbon  ctcctgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D                  Rhesus  ctcctattt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D     Crab-eating macaque  ctcctgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D                  Baboon  ctcctgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D            Green monkey  ctcctgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D                Marmoset  ctactgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D         Squirrel monkey  ---ctgttt------ac-ttt-ttatg---------ttgatgcttc-tttctt
B D                Bushbaby  ttccttttt------at-tct-ttgca---------ctgatgtttc---tctc
B D                Squirrel  ctccttttt------ac-ctt-ttatt---------ttgatgttta-tttctc
     Lesser Egyptian jerboa  t-tcttttt------ac-ttt-ttgtg---------ctgatgtttc-tttctc
               Prairie vole  cgtttttgttttttaaa-ctc-ttgtg----------caccatctc-cttctc
B D         Chinese hamster  ctccttttt------aa-tta-ttgtg----------taccatctc-cctctc
             Golden hamster  cgccttttt------aa-ttc-ctgtg----------agccgtctc-cctctc
B D                   Mouse  tgccttttc------ac-tt---catg----------tcccatcgc-tttctc
B D                     Rat  caccttttc------ac-tt---tgtg----------tcccaccac-tctatc
B D          Naked mole-rat  ctcctttct------ac-ttt-ttgtg---------ctgatgtttc-tttctc
B D              Guinea pig  ttccttttt------tt-ttt-tt-tactttttgccctgatgtttc-tttctc
                 Chinchilla  ttccttttt------ta-agt-tt-tt---------gtgctgtttc-tttctc
           Brush-tailed rat  tttcttttt------tc-act-tt-tg---------ctgatgtttc-tttctc
B D                  Rabbit  ctccttccc------cc-ttt-ctggg---------ctggtagtcc-tttctc
B D                    Pika  cttttcatc------cc-ttt-ctgga---------gtcatatttc-ttttct
B D                  Alpaca  ccccttttt------ac-ttt-ttgtg---------ccagtgcttc-ttcctc
             Bactrian camel  ccccttttt------ac-ttt-ttgtg---------ccagtgcttc-ttcccc
B D                 Dolphin  ctcctgttt------ac-ttt-tcgtg---------ctggtg---c-tttctc
               Killer whale  ctcctgttt------ac-ttt-tcgtg---------ctggtgcttc-tttctc
           Tibetan antelope  ttccttttt------ac-ttt-ttgtg---------ctggggcttc-tttctc
B D                     Cow  ttccttttt------ac-ttt-ttgtg---------ctggggcttc-tttatc
B D                   Sheep  ttcctttta------ac-ttt-ttgtg---------ctggggcttc-tttctc
              Domestic goat  ttccttttt------ac-ttt-ttgtg---------ctggggcttc-tttctc
B D                   Horse  ctcctcttg------ac-ttt-ttgtg---------ctgatgcttc-tgtctc
B D        White rhinoceros  ctcctcttg------ac--tt-ttgtg---------ctgatgcttc-tttctc
B D                     Cat  ccctttttt------aatttt-ttgtg---------ctgatgcttc-cttctc
B D                     Dog  ctcttttgt------attttt-ttatg---------ctgctgctgc-tttctg
B D                 Ferret   ctttttacc------at-ttt-ttgtg---------ttgatgcttc-tttctt
B D                   Panda  cttttaaaa------at-gtt-ttgtg---------ccgatgcttc-tttctc
             Pacific walrus  ctttttaaa------at--tt-ttgtg---------ctgatgcttc-tttctc
           Black flying-fox  ---ctcttt------ac-ttt-ttctg---------ctgatactccttttttc
B D                 Megabat  ---ctcttt------ac-ttt-ttctg---------ctgatactccttttttc
              Big brown bat  ctccttttt------ac-ctt-ttgtg---------ctgatgctcc-tttctc
       David's myotis (bat)  ctccttttt------cc-tat-ttgtg---------ctgatgcttc-ttcctc
B D                Microbat  ctccttttt------ac-cgt-ttgtg---------ctgatgctcc-tttctc
B D                Hedgehog  -caccctag------tc-cttgctgtg---------ccggaaatct-ct---c
B D                   Shrew  --gcctgtg------ac-tct----------------tgaggcttc-cttagc
            Star-nosed mole  ctgctttgg------ac-ttt-ctgtg---------ctgatgcttc-tttctc
B D                Elephant  ttcctcttt------aa-ttt-ttgtg---------ttaatgtttt-tttct-
        Cape elephant shrew  ttcctcttt------ac-ttt-gtgtg---------ttc---ttat-tttct-
B D                 Manatee  ctcctcttt------ag-ttt-ttgtg---------ct----ttgt-tttct-
           Cape golden mole  ttcctcttt------ac-ttt-ctgtg---------ctaatatttt-tttct-
B D                  Tenrec  ctcctcttc------ac-tca-ctgta---------ctggtgcttc-ttcct-
                   Aardvark  cacctcttt------ac-ctt-ctgtg---------ctaatgtttc-ttcct-
B D               Armadillo  -tcctgtgt------ac-ttt-ctgtg---------acgacggttt-ttctc-
        Chinese tree shrew  =====================================================
B D                     Pig  =====================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           X. tropicalis  =====================================================
  D          Painted turtle  =====================================================
B D         Tasmanian devil  =====================================================

Inserts between block 6 and 7 in window
B D               Elephant 1bp
       Cape elephant shrew 1bp
B D                Manatee 5bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp

Alignment block 7 of 377 in window, 23630385 - 23630422, 38 bps 
B D                   Human  cctgcctctatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D                   Chimp  cctgcctctatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D                 Gorilla  cctgcctctatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D               Orangutan  cctgcctctatgtctgcagctca----------gtc--t--gttt-----------cttcttt
B D                  Gibbon  cctgcctctatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D                  Rhesus  cctggctctatgtctgcagctca----------gtg--t--attt-----------cttcttt
B D     Crab-eating macaque  cctggctctatgtctgcagctca----------gtg--t--attt-----------cttcttt
B D                  Baboon  cctggctctatgtctacagctca----------gtc--t--attt-----------cttcttt
B D            Green monkey  cctggctcgatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D                Marmoset  cctggctgcatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D         Squirrel monkey  cctggctgtatgtctgcagctca----------gtc--t--attt-----------cttcttt
B D                Bushbaby  cttggctctgtgtttacagcctg----------gtcttt--attt-----------cttcttt
B D                Squirrel  cctaactctatgcctgcaactcc----------gtg--t--atttctcctctgatt-------
     Lesser Egyptian jerboa  cctagactcatgtctgcagctca----------gtc--t--ctttctggcctgatt-------
               Prairie vole  tc-ggatc--tgtctgcagctca----------ctc--t--gttt------------------
B D         Chinese hamster  cctggact--tgtctgcccctca------------c--t--gttt------------------
             Golden hamster  cctgggct--tgtctgcggctca------------c--t--gttt------------------
B D                   Mouse  tctggact--tgtctgcagctgt------------c--t--gttg------------------
B D                     Rat  tctggact--tgtctgcagctgt------------c--t--gttt------------------
B D          Naked mole-rat  cctggctctatgtctggagctca----------gtc--t--attt-----------c----tt
B D              Guinea pig  tctggctctat----ggagcaca----------gtc--t--attt-----------c----tt
                 Chinchilla  tctggctccatattggctgctca----------gtc--t--attt-----------ctttttt
           Brush-tailed rat  cctagctctatgcctgcagctca----------gtc--t--attt-----------c-ttttt
B D                  Rabbit  ct-ggccgtgtgtccgctgggcaggcttcacttctc--t--ggtc------------------
B D                    Pika  cc-tgcttcatgtctg-----------------ctc--t--gatt------------------
B D                  Alpaca  tttggctc--tgcctgcagctcc----------gtc--ttgattt-----------cctacct
             Bactrian camel  tttggctc--tgcctgcatctcc----------gtc--ttgattt-----------cctacct
B D                 Dolphin  ctgggctc--tgtctgcagctca----------gtc--ttttttt-----------ttttt--
               Killer whale  ctgggctc--tgtttgcagctca----------gtc--ttttttt-----------ttttt--
           Tibetan antelope  cctggctc--tgtctgcagctca----------atc--ttgattt-----------cttctct
B D                     Cow  cctggctc--tctctgcagctca----------atc--ttgattt-----------cttctct
B D                   Sheep  cctggctc--tgtctgcagctca----------att--ttgattt-----------cttttct
              Domestic goat  cctggctc--tgtctgcagctca----------att--ttgattt-----------cttctct
B D                   Horse  tctggctc--tgtcttcagctca----------atc--tttattt-----------cttctct
B D        White rhinoceros  cctggctc--tgtctgcagctca----------gtc--tttattt-----------cttctct
B D                     Cat  cctggctc--tgtctgcagct------------gtc--tttattt-----------cttcttt
B D                     Dog  cctggctc--tatgtgcagct------------gtc--tttattt-----------ctccttc
B D                 Ferret   cctgggtc--tgtgagcagct------------gcc--ttaattt-----------ctcctta
B D                   Panda  cccgactc--tgtgtccagct------------gcc--tttatgt-----------cttctcc
             Pacific walrus  cctggctc--tgtgtgcagct------------gcc--tttattt-----------cttctct
           Black flying-fox  cctggctc--tgtctgcagctca----------gtc--tttattt-----------cttcctt
B D                 Megabat  cctggctc--tgtctgcagctca----------gtc--tttattt-----------cttcctt
              Big brown bat  cttgtctc--tgtctgcagctca----------gtc--tttattt-----------ctcccct
       David's myotis (bat)  cttgtctc--tgtctgcagctca----------ggc--tttattt-----------ctcccct
B D                Microbat  cttgtctc--tgtctgcagctca----------gtc--tttattt-----------ctcccct
B D                Hedgehog  tcctgctc--tgtctgcagctc-----------agt--cctgtgt-----------cctccct
B D                   Shrew  tccg--gc--tgtctgcagcccc----------aga--tttcttt-----------cttcgcc
            Star-nosed mole  tctggtgc--tgtctgctgttt------------ag--cctgttt-----------cttcttt
B D                Elephant  ccgggctccatgtctgcacctca----------ggc--tttattt-----------cttctct
        Cape elephant shrew  cctgactctgtgctggtaccgca-----------gt--tttattc-----------tgttccc
           Cape golden mole  cctggctttgtgtccgtacctca----------gga--tttattt-----------attcttt
B D                  Tenrec  ccgggatcagtgtctgctcctta----------ggc--ttaac--------------ttcttt
                   Aardvark  ccttgctctgtttctgca---------------------------------------ttgttt
B D               Armadillo  cctggctctgtgtctgcggctca----------gtc--ttcattt-----------cttc---
B D                 Manatee  ===============================================================
        Chinese tree shrew  ===============================================================
B D                     Pig  ===============================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           X. tropicalis  ===============================================================
  D          Painted turtle  ===============================================================
B D         Tasmanian devil  ===============================================================

Inserts between block 7 and 8 in window
B D                Dolphin 471bp
              Killer whale 469bp

Alignment block 8 of 377 in window, 23630423 - 23630426, 4 bps 
B D                   Human  gatt
B D                   Chimp  gatt
B D                 Gorilla  gatt
B D               Orangutan  gatt
B D                  Gibbon  gatt
B D                  Rhesus  gatt
B D     Crab-eating macaque  gatt
B D                  Baboon  gatt
B D            Green monkey  gatt
B D                Marmoset  gatt
B D         Squirrel monkey  gatt
B D                Bushbaby  gatt
B D          Naked mole-rat  gatt
B D              Guinea pig  gatt
                 Chinchilla  gatt
           Brush-tailed rat  gatt
B D                  Alpaca  aatt
             Bactrian camel  aatt
           Tibetan antelope  gatt
B D                     Cow  gatt
B D                   Sheep  gatt
              Domestic goat  gatt
B D                   Horse  gatt
B D        White rhinoceros  gatt
B D                     Cat  gatt
B D                     Dog  gatt
B D                 Ferret   gatt
B D                   Panda  gatt
             Pacific walrus  gact
           Black flying-fox  gatt
B D                 Megabat  gatt
              Big brown bat  gatt
       David's myotis (bat)  gatt
B D                Microbat  gatt
B D                Hedgehog  aatc
B D                   Shrew  agtt
            Star-nosed mole  aatt
B D                Elephant  gctg
        Cape elephant shrew  gacg
           Cape golden mole  gata
B D                  Tenrec  gatg
                   Aardvark  tatg
B D                   Mouse  ----
B D                     Rat  ----
    Lesser Egyptian jerboa  ----
              Prairie vole  ----
            Golden hamster  ----
B D         Chinese hamster  ----
B D                    Pika  ----
B D                  Rabbit  ----
B D                 Manatee  ====
              Killer whale  ====
B D               Armadillo  ----
        Chinese tree shrew  ====
B D                Squirrel  ----
B D                     Pig  ====
              Weddell seal  NNNN
B D                 Dolphin  ====
B D           X. tropicalis  ====
  D          Painted turtle  ====
B D         Tasmanian devil  ====

Inserts between block 8 and 9 in window
          Brush-tailed rat 317bp

Alignment block 9 of 377 in window, 23630427 - 23630446, 20 bps 
B D                   Human  atcaatacaaagctcttggg
B D                   Chimp  atcaatacaaagctcttggg
B D                 Gorilla  atcaatacaaagctcttggg
B D               Orangutan  atcaatacaaagctcttggg
B D                  Gibbon  atcaatacaaagctcttggg
B D                  Rhesus  atcgttacaaacctcttggg
B D     Crab-eating macaque  atcgttacaaacctcttggg
B D                  Baboon  atcattacaaacctcttggg
B D            Green monkey  atcattacaaacctcttagg
B D                Marmoset  atcattacaaagcttgtggg
B D         Squirrel monkey  atcattaccaagctcgtggg
B D                Bushbaby  cttatagcaaagctcttggt
B D                Squirrel  ctcagaataaag-ctcttgg
     Lesser Egyptian jerboa  ctcataacaaag-ctgtggg
               Prairie vole  -------------ctgtggg
B D         Chinese hamster  -------------ctgtggg
             Golden hamster  -------------ctgtggg
B D                   Mouse  -------------ctgttgg
B D                     Rat  -------------ctgtcgg
B D          Naked mole-rat  ctcctaacaaagttcttggg
B D              Guinea pig  ctcctaacaaggatcttggg
                 Chinchilla  ctcctaacgaagaccttggg
B D                  Rabbit  ttcccaatgaagttctgggg
B D                    Pika  cttccatcagagtccctgga
B D                  Alpaca  ctcataacaaagctcttgca
             Bactrian camel  ctcataacaaagctcttgca
           Tibetan antelope  ctcgtaacaaagctcttggc
B D                     Cow  ctcataacaaagctcttggg
B D                   Sheep  ctcataacaaagctcttggg
              Domestic goat  ctcataacaaagctcttggg
B D                   Horse  ctcatgacaaagctcttggg
B D        White rhinoceros  ctcacaacaaatctcttggg
B D                     Cat  ctcataataaggctcttggg
B D                     Dog  ctcataacaaagatcttgga
B D                 Ferret   ctcataacaaagctcttggg
B D                   Panda  ttcctaacaaagctcttgga
             Pacific walrus  ctcctaacaaagttcttggg
           Black flying-fox  ctcataataaagctcttggg
B D                 Megabat  ctcataataaagctcttggg
              Big brown bat  ctcataacaaggctcttggg
       David's myotis (bat)  cacaaaacaaggctcttggg
B D                Microbat  ctcataacaaggctcttggg
B D                Hedgehog  ctcataata---ctctgtg-
B D                   Shrew  ctcataacaaagatcttggg
            Star-nosed mole  ctcacgagaa--atca----
B D                Elephant  cttgtaacagagccctta--
        Cape elephant shrew  ttcatgactgaaccctta--
           Cape golden mole  ttcat-atagaactctta--
B D                  Tenrec  ctcatgaccgagccctta--
                   Aardvark  ctcattacagagcccttc--
B D               Armadillo  ---------aagtcctta--
B D                 Manatee  ====================
              Killer whale  ====================
          Brush-tailed rat  ====================
        Chinese tree shrew  ====================
B D                     Pig  ====================
              Weddell seal  NNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ====================
B D           X. tropicalis  ====================
  D          Painted turtle  ====================
B D         Tasmanian devil  ====================

Inserts between block 9 and 10 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 3bp
              Prairie vole 3bp
B D        Chinese hamster 3bp
            Golden hamster 3bp
B D                  Mouse 3bp
B D                    Rat 3bp
                Chinchilla 1162bp
B D                    Cat 1bp
B D                    Dog 7bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
B D                  Shrew 269bp

Alignment block 10 of 377 in window, 23630447 - 23630447, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
B D                Squirrel  g
     Lesser Egyptian jerboa  a
               Prairie vole  a
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  g
B D                     Rat  g
B D          Naked mole-rat  g
B D              Guinea pig  g
B D                  Rabbit  g
B D                    Pika  g
B D                  Alpaca  g
             Bactrian camel  g
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  g
            Star-nosed mole  g
B D                  Tenrec  -
       Cape elephant shrew  -
B D                   Shrew  =
B D                 Manatee  =
              Killer whale  =
B D               Armadillo  -
B D                Elephant  -
          Brush-tailed rat  =
                Chinchilla  =
        Chinese tree shrew  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
                  Aardvark  -
          Cape golden mole  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Inserts between block 10 and 11 in window
B D         Naked mole-rat 328bp
B D             Guinea pig 339bp

Alignment block 11 of 377 in window, 23630448 - 23630456, 9 bps 
B D                   Human  ctatca---aag
B D                   Chimp  ctatca---aag
B D                 Gorilla  ctatca---aag
B D               Orangutan  ctatca---aag
B D                  Gibbon  ctatca---aag
B D                  Rhesus  ctatca---gag
B D     Crab-eating macaque  ctatca---gag
B D                  Baboon  ctatca---gag
B D            Green monkey  ctatca---gag
B D                Marmoset  ccatca---gag
B D         Squirrel monkey  ccatca---gag
B D                Bushbaby  caatgg---gag
B D                Squirrel  ---ctattggag
     Lesser Egyptian jerboa  ---tca---gag
               Prairie vole  ---tcacacaag
B D         Chinese hamster  ---tcatataag
             Golden hamster  ---tcatataag
B D                   Mouse  ---tcacggaaa
B D                     Rat  ---tcatgtaag
B D                  Rabbit  ctctca---g-g
B D                    Pika  agctct---gag
B D                  Alpaca  ctgtca---gag
             Bactrian camel  ctgtca---gag
           Tibetan antelope  ctgtca---cag
B D                     Cow  ctgtca---cag
B D                   Sheep  ctgtca---cag
              Domestic goat  ctgtca---cag
B D                   Horse  ctatca---gag
B D        White rhinoceros  ctatca---gag
B D                     Cat  ctatca---gag
B D                     Dog  ctatca---gaa
B D                 Ferret   ctattg---gag
B D                   Panda  ctctca---gag
             Pacific walrus  ctgtca---gag
           Black flying-fox  ctatca---gag
B D                 Megabat  ctatca---gag
              Big brown bat  ctatca---gag
       David's myotis (bat)  cgatca---gag
B D                Microbat  ctctca---gag
B D                Hedgehog  ccagca---gg-
            Star-nosed mole  ttatca---gag
B D                  Tenrec  ------------
       Cape elephant shrew  ------------
B D                   Shrew  ============
B D                 Manatee  ============
              Killer whale  ============
B D               Armadillo  ------------
B D                Elephant  ------------
B D              Guinea pig  ============
          Brush-tailed rat  ============
B D          Naked mole-rat  ============
                Chinchilla  ============
        Chinese tree shrew  ============
B D                     Pig  ============
              Weddell seal  NNNNNNNNNNNN
B D                 Dolphin  ============
B D           X. tropicalis  ============
                  Aardvark  ------------
          Cape golden mole  ------------
  D          Painted turtle  ============
B D         Tasmanian devil  ============

Inserts between block 11 and 12 in window
B D               Hedgehog 1bp
           Star-nosed mole 5956bp

Alignment block 12 of 377 in window, 23630457 - 23630468, 12 bps 
B D                   Human  t------------------cctttgga-cca
B D                   Chimp  t------------------cctttgga-cca
B D                 Gorilla  t------------------cctttgga-cca
B D               Orangutan  t------------------cctttgga-cca
B D                  Gibbon  t------------------cctttgga-cca
B D                  Rhesus  t------------------cctttgga-cca
B D     Crab-eating macaque  t------------------cctttgga-cca
B D                  Baboon  tgatagcttttggactatgactttgga-cca
B D            Green monkey  t------------------cctttgga-cca
B D                Marmoset  c------------------ccttagga-cca
B D         Squirrel monkey  c------------------ccttagga-cca
B D                Bushbaby  c------------------ccttagga-cca
B D                Squirrel  c------------------ccttagga-cca
     Lesser Egyptian jerboa  c------------------cattaaga-tct
               Prairie vole  c------------------ccttagaa-atg
B D         Chinese hamster  c------------------ccttaggatttt
             Golden hamster  c------------------ccttagga-ttt
B D                   Mouse  c------------------cctcagga-tca
B D                     Rat  c------------------cctcagga-tcg
B D                  Rabbit  c------------------ccttagga-cca
B D                    Pika  c------------------ccttagga-cca
B D                  Alpaca  c------------------ccttagga-cca
             Bactrian camel  c------------------ccttagga-cca
           Tibetan antelope  c------------------ccttagga-cca
B D                     Cow  c------------------ccttcagt-tca
B D                   Sheep  c------------------ccttagga-cca
              Domestic goat  c------------------ccttagga-cca
B D                   Horse  c------------------ccttagga-cca
B D        White rhinoceros  -------------------ccttagga-cca
B D                     Cat  c------------------ccttaggg-cca
B D                     Dog  c------------------ccttaggg-ctc
B D                 Ferret   c------------------cct---------
B D                   Panda  c------------------ccttaggg-ccc
             Pacific walrus  c------------------ccttaggg-ccc
           Black flying-fox  c------------------ctatagga-cca
B D                 Megabat  c------------------ctatagga-cca
              Big brown bat  c------------------ccata-ga-cct
       David's myotis (bat)  c------------------ccatagga-cca
B D                Microbat  c------------------ccatagga-cca
B D                Hedgehog  c------------------cttcgtga-cca
B D                Elephant  ------------------------gga-tag
        Cape elephant shrew  ------------------------gga-aca
           Cape golden mole  ------------------------gga-cca
B D                  Tenrec  ------------------------gga-cca
                   Aardvark  --------------------------a-cca
B D               Armadillo  ------------------------aaa-tca
B D                   Shrew  ===============================
           Star-nosed mole  ===============================
B D                 Manatee  ===============================
              Killer whale  ===============================
B D              Guinea pig  ===============================
          Brush-tailed rat  ===============================
B D          Naked mole-rat  ===============================
                Chinchilla  ===============================
        Chinese tree shrew  ===============================
B D                     Pig  ===============================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ===============================
B D           X. tropicalis  ===============================
  D          Painted turtle  ===============================
B D         Tasmanian devil  ===============================

Inserts between block 12 and 13 in window
B D                    Cow 3737bp

Alignment block 13 of 377 in window, 23630469 - 23630500, 32 bps 
B D                   Human  cccaagtcaaccccttattttactgtgataca
B D                   Chimp  cccaagtcaaccccttattttactgtgataca
B D                 Gorilla  cccaagtcaaccccttaatttactgtgataca
B D               Orangutan  cccatgttaactccttattttactgtgataca
B D                  Gibbon  cccaagtcaaccccttattttactgtgacaca
B D                  Rhesus  cccaagtcaaccccttattttactgtgatatg
B D     Crab-eating macaque  cccaagtcaaccccttattttactgtgatatg
B D                  Baboon  cccaagtcaaccccttattttactgtgatatg
B D            Green monkey  cccaagtcaaccccttattttactgtgatatg
B D                Marmoset  cccaaatgaaccccttattgtactgcgacaca
B D         Squirrel monkey  cccaagtcaaccccttattttactgcgataca
B D                Bushbaby  cccaaatcagacccttgttgtatcaaggtgca
B D                Squirrel  cccaagtcagcttctcattttaccaagttaca
     Lesser Egyptian jerboa  cccaagccagtgcctccttatgtcaacgtgca
               Prairie vole  ccagggcca---cctc------------agca
B D         Chinese hamster  cccaggcta---cctcagctttccaaggagca
             Golden hamster  cccgggtca---cctcagctttccaaggagca
B D                   Mouse  cccaagtca---cctcggcttttggaggagca
B D                     Rat  ccaaagtca---ccctaattttcctcggaaca
B D                  Rabbit  tccagggcagcccctcctcctcctaagctgca
B D                    Pika  ---------------------cataagctgta
B D                  Alpaca  -ccaactcaa---ctcttctgactgagaagct
             Bactrian camel  -ccaactcaa---ctcttctgactgagaagct
           Tibetan antelope  cccaacttag-------tcttatcaaggtgcc
B D                   Sheep  cccaacttag-------tcttatcaaggtgcc
              Domestic goat  cccaacttag-------tcttatcaaggtgcc
B D                   Horse  cccaactcagtttctcatgctaccaaggtcca
B D        White rhinoceros  cccgactcagctcctcatcttactggggtgcg
B D                     Cat  cccaactcagcacctcatcttacccaggtgca
B D                     Dog  cccaactcagcccctcatcttaccaaggtgca
B D                 Ferret   --------------ttatcttatctaggtgta
B D                   Panda  cccacctcggcacctcatcttaccgaggtgca
             Pacific walrus  ctcagctcagcgcctcatcttaccgaggtgca
           Black flying-fox  cccagctcagctcctcatcttacccaagtaca
B D                 Megabat  cccagctcagctcctcatcttacccaactaca
              Big brown bat  tccaactcagtccctcatcttacacaggtgca
       David's myotis (bat)  tccaactcagttcctcctgtgacccaagtgca
B D                Microbat  tccaactcagttcctcctgtgacccaagtgca
B D                Hedgehog  gctgatttagctctcagtttcac---------
B D                Elephant  cccagcccagtccctcatctcactgggcagca
        Cape elephant shrew  ctcaacctagagccttgccttaccaagaagcg
           Cape golden mole  -ccaactcagcccttcatgtcccggaagatta
B D                  Tenrec  gccagcccagcccctcatcccactgaagaaca
                   Aardvark  cccaactcagctcctcatctcaccgaagaacc
B D               Armadillo  cccagtgcagcccctcatcttaccgaggagca
B D                   Shrew  ================================
           Star-nosed mole  ================================
B D                 Manatee  ================================
B D                     Cow  ================================
              Killer whale  ================================
B D              Guinea pig  ================================
          Brush-tailed rat  ================================
B D          Naked mole-rat  ================================
                Chinchilla  ================================
        Chinese tree shrew  ================================
B D                     Pig  ================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ================================
B D           X. tropicalis  ================================
  D          Painted turtle  ================================
B D         Tasmanian devil  ================================

Inserts between block 13 and 14 in window
B D                 Rabbit 32bp
B D                 Tenrec 5bp

Alignment block 14 of 377 in window, 23630501 - 23630518, 18 bps 
B D                   Human  -ga---tggaggcaa--gag-ggga--
B D                   Chimp  -ga---tggagacaa--gag-ggga--
B D                 Gorilla  -ga---tggaggcaa--gag-ggga--
B D               Orangutan  -ga---tggaggcaa--gag-ggga--
B D                  Gibbon  -ga---tggaggcaa--gag-ggga--
B D                  Rhesus  -ga---tggag-caa--gag-ggga--
B D     Crab-eating macaque  -ga---tggag-caa--gag-ggga--
B D                  Baboon  -ga---tggag-cag--gag-ggga--
B D            Green monkey  -ga---tggag-cag--gag-ggga--
B D                Marmoset  -ga---tggaggcgagagag-ggga--
B D         Squirrel monkey  -ga---tggaggcgagggag-ggga--
B D                Bushbaby  -ga---aaatggcta--gagagaga--
B D                Squirrel  -gac--tgagg-cca--gag-aggg--
     Lesser Egyptian jerboa  -ga---tggggacca--gag-agta--
               Prairie vole  -ga---tgggt-cga--gag-gggg--
B D         Chinese hamster  -ga---tgggt-caa--gag-aggg--
             Golden hamster  -ga---tgggt-tga--gag-aggg--
B D                   Mouse  -ga---ggagc-tga--gag-ggga--
B D                     Rat  -ga---tgggc-aga--gag-ggga--
B D                    Pika  ---gctggagg-cca--gaa-agga--
B D                  Alpaca  -ga---tggag-cca--gag-aggg--
             Bactrian camel  -ga---tggag-cca--gag-aggg--
           Tibetan antelope  -ga---tggag-tca--gag-agag--
B D                   Sheep  -ga---tggag-tca--gag-agag--
              Domestic goat  -ga---tggag-tca--gag-agag--
B D                   Horse  -ga---cggag-tca--gag-aggg--
B D        White rhinoceros  -ga---tggag-cca--gag-aggg--
B D                     Cat  -ga---cggag-cca--gag-tggg--
B D                     Dog  -gt---tggag-cca--gag-------
B D                 Ferret   -ga---tggag-cca--gag-cggg--
B D                   Panda  -ga---tggag-cca--gag-cggg--
             Pacific walrus  -ga---tggag-cca--gag-tggg--
           Black flying-fox  -gt---gggac-cca--gag-aggg--
B D                 Megabat  -gt---gggag-cca--gag-aggg--
              Big brown bat  -ga---tggag-cca--gag-aggg--
       David's myotis (bat)  -ga---tggag-cca--gag-agga--
B D                Microbat  -gg---tggag-cca--gag-aggg--
B D                Hedgehog  --------aag-aca--gat-gggg--
B D                Elephant  ctt---agaag-cca--gag-agagca
        Cape elephant shrew  -ta---acagg-cca--gag-aaggga
           Cape golden mole  ttt---acagg-cca--ga-----gga
B D                  Tenrec  act---ggaga-cca--gag-tgggga
                   Aardvark  ttt---ggagg-cca--gag-agggga
B D               Armadillo  ggc---agaag-cca--gag-aggggt
B D                   Shrew  ===========================
           Star-nosed mole  ===========================
B D                  Rabbit  ===========================
B D                 Manatee  ===========================
B D                     Cow  ===========================
              Killer whale  ===========================
B D              Guinea pig  ===========================
          Brush-tailed rat  ===========================
B D          Naked mole-rat  ===========================
                Chinchilla  ===========================
        Chinese tree shrew  ===========================
B D                     Pig  ===========================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ===========================
B D           X. tropicalis  ===========================
  D          Painted turtle  ===========================
B D         Tasmanian devil  ===========================

Inserts between block 14 and 15 in window
B D               Squirrel 2bp
    Lesser Egyptian jerboa 2bp
              Prairie vole 2bp
B D        Chinese hamster 2bp
            Golden hamster 2bp
B D                  Mouse 352bp
B D                   Pika 35bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
          Tibetan antelope 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                  Horse 2bp
B D       White rhinoceros 2bp
B D                    Cat 2bp
B D                Ferret  2bp
B D                  Panda 2bp
            Pacific walrus 2bp
          Black flying-fox 2bp
B D                Megabat 2bp
             Big brown bat 2bp
      David's myotis (bat) 2bp
B D               Microbat 2bp
B D               Hedgehog 2bp

Alignment block 15 of 377 in window, 23630519 - 23630531, 13 bps 
B D                   Human  acagacttg--tcca
B D                   Chimp  acagacttg--tcca
B D                 Gorilla  acagacttg--tcca
B D               Orangutan  acagacttg--ccca
B D                  Gibbon  acagactcg--ccca
B D                  Rhesus  acagacttg--ccca
B D     Crab-eating macaque  acagacttg--ccca
B D                  Baboon  acagacttg--ccca
B D            Green monkey  acagacttg--ccca
B D                Marmoset  acagacttgctctca
B D         Squirrel monkey  acagacttgctctca
B D                Bushbaby  acagacttg--tcca
B D                Squirrel  acatacttt--tcca
     Lesser Egyptian jerboa  acagatttg--ttta
               Prairie vole  acagacgag--tcca
B D         Chinese hamster  acagaagag--ccca
             Golden hamster  gcagaggag--ccca
B D                     Rat  atgcaggag--ccca
B D                  Alpaca  acagacttg--ccca
             Bactrian camel  acagacttg--ccca
           Tibetan antelope  acaaa--tg--ccca
B D                   Sheep  acaaa--tg--ccca
              Domestic goat  acaaa--tg--ccca
B D                   Horse  actggcttg--ccca
B D        White rhinoceros  accaa-tcg--ccca
B D                     Cat  acagacttg--ccca
B D                 Ferret   acagactgg--ccca
B D                   Panda  acagacttc--ccca
             Pacific walrus  acagacttg--ccca
           Black flying-fox  acagagtta--ccca
B D                 Megabat  acagagtta--ccca
              Big brown bat  acagacttg--tcca
       David's myotis (bat)  acacacttg--tcca
B D                Microbat  acagacttg--tcca
B D                Hedgehog  atacattta--ccca
B D                Elephant  atagacttg--ccca
        Cape elephant shrew  gtcaaggtg--ccca
           Cape golden mole  acagacttg--ccca
B D                  Tenrec  acagacgtg--ccca
                   Aardvark  gcagactt---ccca
B D               Armadillo  acagccttg--ccca
B D                   Mouse  ===============
B D                   Shrew  ===============
           Star-nosed mole  ===============
B D                    Pika  ===============
B D                  Rabbit  ===============
B D                     Dog  ---------------
B D                 Manatee  ===============
B D                     Cow  ===============
              Killer whale  ===============
B D              Guinea pig  ===============
          Brush-tailed rat  ===============
B D          Naked mole-rat  ===============
                Chinchilla  ===============
        Chinese tree shrew  ===============
B D                     Pig  ===============
              Weddell seal  NNNNNNNNNNNNNNN
B D                 Dolphin  ===============
B D           X. tropicalis  ===============
  D          Painted turtle  ===============
B D         Tasmanian devil  ===============

Inserts between block 15 and 16 in window
B D               Hedgehog 543bp

Alignment block 16 of 377 in window, 23630532 - 23630532, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
B D                Squirrel  a
     Lesser Egyptian jerboa  a
               Prairie vole  a
B D         Chinese hamster  a
             Golden hamster  a
B D                     Rat  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  g
B D                     Cat  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  a
       David's myotis (bat)  a
B D                Microbat  a
B D                Elephant  a
        Cape elephant shrew  a
           Cape golden mole  a
B D                  Tenrec  c
                   Aardvark  a
B D               Armadillo  a
B D                   Mouse  =
B D                Hedgehog  =
B D                   Shrew  =
           Star-nosed mole  =
B D                    Pika  =
B D                  Rabbit  =
B D                     Dog  -
B D                 Manatee  =
B D                     Cow  =
              Killer whale  =
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
        Chinese tree shrew  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
  D          Painted turtle  =
B D         Tasmanian devil  =

Inserts between block 16 and 17 in window
              Prairie vole 13bp
            Golden hamster 344bp

Alignment block 17 of 377 in window, 23630533 - 23630534, 2 bps 
B D                   Human  ga
B D                   Chimp  ga
B D                 Gorilla  ga
B D               Orangutan  ga
B D                  Gibbon  ga
B D                  Rhesus  ga
B D     Crab-eating macaque  ga
B D                  Baboon  ga
B D            Green monkey  ga
B D                Marmoset  ga
B D         Squirrel monkey  ga
B D                Bushbaby  gt
B D                Squirrel  gg
     Lesser Egyptian jerboa  ga
B D         Chinese hamster  ca
B D                     Rat  ga
B D                  Alpaca  ga
             Bactrian camel  ga
           Tibetan antelope  ga
B D                   Sheep  ga
              Domestic goat  ga
B D                   Horse  ga
B D        White rhinoceros  ga
B D                     Cat  -a
B D                 Ferret   -a
B D                   Panda  -a
             Pacific walrus  -a
           Black flying-fox  ga
B D                 Megabat  ga
              Big brown bat  ga
       David's myotis (bat)  ga
B D                Microbat  ga
B D                Elephant  ga
        Cape elephant shrew  ga
           Cape golden mole  ga
B D                  Tenrec  ga
                   Aardvark  ga
B D               Armadillo  ga
B D                   Mouse  ==
B D                Hedgehog  ==
B D                   Shrew  ==
              Prairie vole  ==
            Golden hamster  ==
           Star-nosed mole  ==
B D                    Pika  ==
B D                  Rabbit  ==
B D                     Dog  --
B D                 Manatee  ==
B D                     Cow  ==
              Killer whale  ==
B D              Guinea pig  ==
          Brush-tailed rat  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
        Chinese tree shrew  ==
B D                     Pig  ==
              Weddell seal  NN
B D                 Dolphin  ==
B D           X. tropicalis  ==
  D          Painted turtle  ==
B D         Tasmanian devil  ==

Inserts between block 17 and 18 in window
B D        Chinese hamster 6bp
B D                    Rat 317bp

Alignment block 18 of 377 in window, 23630535 - 23630540, 6 bps 
B D                   Human  tcacac
B D                   Chimp  tcacac
B D                 Gorilla  tcacac
B D               Orangutan  tcacac
B D                  Gibbon  tcacac
B D                  Rhesus  tcacag
B D     Crab-eating macaque  tcacag
B D                  Baboon  tcacac
B D            Green monkey  tcacac
B D                Marmoset  tcacac
B D         Squirrel monkey  tcacac
B D                Bushbaby  tcacac
B D                Squirrel  tcatat
     Lesser Egyptian jerboa  ttacac
B D         Chinese hamster  tcaagc
B D                  Alpaca  tcacac
             Bactrian camel  tcacac
           Tibetan antelope  tcatgc
B D                   Sheep  tcacgc
              Domestic goat  tcacgc
B D                   Horse  tcacgc
B D        White rhinoceros  tcacgc
B D                     Cat  tcatgc
B D                     Dog  tcacac
B D                 Ferret   tcctgc
B D                   Panda  accagc
             Pacific walrus  tcccac
           Black flying-fox  tcacac
B D                 Megabat  tcacac
              Big brown bat  tcactc
       David's myotis (bat)  tcactc
B D                Microbat  tcactc
B D                Elephant  tcactc
        Cape elephant shrew  gcctgc
           Cape golden mole  tcgcgc
B D                  Tenrec  tcacac
                   Aardvark  tcacac
B D               Armadillo  tggtgc
B D                   Mouse  ======
B D                     Rat  ======
B D                Hedgehog  ======
B D                   Shrew  ======
              Prairie vole  ======
            Golden hamster  ======
           Star-nosed mole  ======
B D                    Pika  ======
B D                  Rabbit  ======
B D                 Manatee  ======
B D                     Cow  ======
              Killer whale  ======
B D              Guinea pig  ======
          Brush-tailed rat  ======
B D          Naked mole-rat  ======
                Chinchilla  ======
        Chinese tree shrew  ======
B D                     Pig  ======
              Weddell seal  NNNNNN
B D                 Dolphin  ======
B D           X. tropicalis  ======
  D          Painted turtle  ======
B D         Tasmanian devil  ======

Inserts between block 18 and 19 in window
B D        Chinese hamster 2bp

Alignment block 19 of 377 in window, 23630541 - 23630547, 7 bps 
B D                   Human  agcttct
B D                   Chimp  agcttct
B D                 Gorilla  agcttct
B D               Orangutan  agcttct
B D                  Gibbon  agtgtct
B D                  Rhesus  agcttct
B D     Crab-eating macaque  agcttct
B D                  Baboon  agcttct
B D            Green monkey  agcttct
B D                Marmoset  atcttct
B D         Squirrel monkey  gtcttct
B D                Bushbaby  aacttct
B D                Squirrel  agcttct
     Lesser Egyptian jerboa  agcctct
B D                  Alpaca  agcttct
             Bactrian camel  agcttct
           Tibetan antelope  agctttt
B D                   Sheep  acttttt
              Domestic goat  agctttt
B D                   Horse  agcttct
B D        White rhinoceros  agcttct
B D                     Cat  accttct
B D                     Dog  gccttct
B D                 Ferret   ttcttct
B D                   Panda  accttct
             Pacific walrus  accttct
           Black flying-fox  agcttct
B D                 Megabat  agcttct
              Big brown bat  agcttct
       David's myotis (bat)  agcttct
B D                Microbat  agcttct
B D                Elephant  agcttct
        Cape elephant shrew  agct--t
           Cape golden mole  agcttct
B D                  Tenrec  agcttct
                   Aardvark  agcttct
B D               Armadillo  agtttct
B D                   Mouse  =======
B D                     Rat  =======
B D                Hedgehog  =======
B D                   Shrew  =======
              Prairie vole  =======
            Golden hamster  =======
B D         Chinese hamster  =======
           Star-nosed mole  =======
B D                    Pika  =======
B D                  Rabbit  =======
B D                 Manatee  =======
B D                     Cow  =======
              Killer whale  =======
B D              Guinea pig  =======
          Brush-tailed rat  =======
B D          Naked mole-rat  =======
                Chinchilla  =======
        Chinese tree shrew  =======
B D                     Pig  =======
              Weddell seal  NNNNNNN
B D                 Dolphin  =======
B D           X. tropicalis  =======
  D          Painted turtle  =======
B D         Tasmanian devil  =======

Inserts between block 19 and 20 in window
    Lesser Egyptian jerboa 935bp

Alignment block 20 of 377 in window, 23630548 - 23630555, 8 bps 
B D                   Human  gctgatat
B D                   Chimp  gctgatat
B D                 Gorilla  gctgatat
B D               Orangutan  gctgatat
B D                  Gibbon  gctgatat
B D                  Rhesus  gctgatat
B D     Crab-eating macaque  gctgatat
B D                  Baboon  gttgatgt
B D            Green monkey  gttgatgt
B D                Marmoset  gttaacat
B D         Squirrel monkey  gttaacat
B D                Bushbaby  gctgattt
B D                Squirrel  gttgactt
B D                  Alpaca  gttgacat
             Bactrian camel  gttgacat
           Tibetan antelope  gttgacat
B D                   Sheep  gttgacat
              Domestic goat  gttgacat
B D                   Horse  gttgacat
B D        White rhinoceros  gttgacat
B D                     Cat  gttgaaat
B D                     Dog  gtggatag
B D                 Ferret   gtggacat
B D                   Panda  gtggacat
             Pacific walrus  gtggacat
           Black flying-fox  gttgacat
B D                 Megabat  gttgacat
              Big brown bat  gttgacct
       David's myotis (bat)  gtggaact
B D                Microbat  gtcgacct
B D                Elephant  gttaccat
        Cape elephant shrew  gttaccat
           Cape golden mole  attgccat
B D                  Tenrec  gctgccat
                   Aardvark  gttgctcc
B D               Armadillo  gtcgacat
B D                   Mouse  ========
B D                     Rat  ========
    Lesser Egyptian jerboa  ========
B D                Hedgehog  ========
B D                   Shrew  ========
              Prairie vole  ========
            Golden hamster  ========
B D         Chinese hamster  ========
           Star-nosed mole  ========
B D                    Pika  ========
B D                  Rabbit  ========
B D                 Manatee  ========
B D                     Cow  ========
              Killer whale  ========
B D              Guinea pig  ========
          Brush-tailed rat  ========
B D          Naked mole-rat  ========
                Chinchilla  ========
        Chinese tree shrew  ========
B D                     Pig  ========
              Weddell seal  NNNNNNNN
B D                 Dolphin  ========
B D           X. tropicalis  ========
  D          Painted turtle  ========
B D         Tasmanian devil  ========

Alignment block 21 of 377 in window, 23630556 - 23630559, 4 bps 
B D                   Human  ctcc
B D                   Chimp  ctcc
B D                 Gorilla  ctcc
B D               Orangutan  ctcc
B D                  Gibbon  ctcc
B D                  Rhesus  ctcc
B D     Crab-eating macaque  ctcc
B D                  Baboon  ctcc
B D            Green monkey  ctcc
B D                Marmoset  ctcc
B D         Squirrel monkey  ctcc
B D                Bushbaby  ctcc
B D                Squirrel  ctct
B D                  Alpaca  ctcc
             Bactrian camel  ctcc
           Tibetan antelope  gtcc
B D                   Sheep  gtcc
              Domestic goat  gtcc
B D                   Horse  ctcc
B D        White rhinoceros  ctcc
B D                     Cat  ctcc
B D                     Dog  ctcc
B D                 Ferret   ctcc
B D                   Panda  ctcc
             Pacific walrus  ctcc
           Black flying-fox  ctcc
B D                 Megabat  ctcc
              Big brown bat  ctcc
       David's myotis (bat)  ctcc
B D                Microbat  ctcc
B D                Elephant  ttct
        Cape elephant shrew  cttg
           Cape golden mole  ctta
B D                  Tenrec  ctcc
B D               Armadillo  tgcc
B D                   Mouse  ====
B D                     Rat  ====
    Lesser Egyptian jerboa  ====
B D                Hedgehog  ====
B D                   Shrew  ====
              Prairie vole  ====
            Golden hamster  ====
B D         Chinese hamster  ====
           Star-nosed mole  ====
B D                    Pika  ====
B D                  Rabbit  ====
B D                 Manatee  ====
B D                     Cow  ====
              Killer whale  ====
B D              Guinea pig  ====
          Brush-tailed rat  ====
B D          Naked mole-rat  ====
                Chinchilla  ====
        Chinese tree shrew  ====
B D                     Pig  ====
              Weddell seal  NNNN
B D                 Dolphin  ====
B D           X. tropicalis  ====
                  Aardvark  ----
  D          Painted turtle  ====
B D         Tasmanian devil  ====

Inserts between block 21 and 22 in window
             Big brown bat 250bp
      David's myotis (bat) 250bp
B D               Microbat 253bp

Alignment block 22 of 377 in window, 23630560 - 23630561, 2 bps 
B D                   Human  tt
B D                   Chimp  tt
B D                 Gorilla  tt
B D               Orangutan  tt
B D                  Gibbon  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D                  Baboon  tt
B D            Green monkey  tt
B D                Marmoset  tt
B D         Squirrel monkey  tt
B D                Bushbaby  tt
B D                Squirrel  tt
B D                  Alpaca  ct
             Bactrian camel  ct
           Tibetan antelope  ct
B D                   Sheep  ct
              Domestic goat  ct
B D                   Horse  ct
B D        White rhinoceros  ct
B D                     Cat  ct
B D                     Dog  ct
B D                 Ferret   ct
B D                   Panda  ct
             Pacific walrus  ct
           Black flying-fox  ca
B D                 Megabat  ca
B D                Elephant  tt
        Cape elephant shrew  tt
           Cape golden mole  tt
B D                  Tenrec  ct
B D               Armadillo  tt
B D                   Mouse  ==
B D                     Rat  ==
    Lesser Egyptian jerboa  ==
B D                Hedgehog  ==
B D                   Shrew  ==
              Prairie vole  ==
            Golden hamster  ==
B D         Chinese hamster  ==
           Star-nosed mole  ==
B D                    Pika  ==
B D                  Rabbit  ==
      David's myotis (bat)  ==
B D                 Manatee  ==
B D                Microbat  ==
             Big brown bat  ==
B D                     Cow  ==
              Killer whale  ==
B D              Guinea pig  ==
          Brush-tailed rat  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
        Chinese tree shrew  ==
B D                     Pig  ==
              Weddell seal  NN
B D                 Dolphin  ==
B D           X. tropicalis  ==
                  Aardvark  --
  D          Painted turtle  ==
B D         Tasmanian devil  ==

Inserts between block 22 and 23 in window
          Tibetan antelope 3bp

Alignment block 23 of 377 in window, 23630562 - 23630563, 2 bps 
B D                   Human  ag
B D                   Chimp  ag
B D                 Gorilla  ag
B D               Orangutan  ag
B D                  Gibbon  ag
B D                  Rhesus  ag
B D     Crab-eating macaque  ag
B D                  Baboon  ag
B D            Green monkey  ag
B D                Marmoset  ag
B D         Squirrel monkey  ag
B D                Bushbaby  ag
B D                Squirrel  ag
B D                  Alpaca  tg
             Bactrian camel  tg
B D                   Sheep  cg
              Domestic goat  cg
B D                   Horse  ag
B D        White rhinoceros  ag
B D                     Dog  ag
B D                 Ferret   ag
B D                   Panda  ag
             Pacific walrus  ag
           Black flying-fox  ag
B D                 Megabat  ag
B D                Elephant  ag
        Cape elephant shrew  ag
           Cape golden mole  cg
B D                  Tenrec  ag
B D               Armadillo  ag
B D                   Mouse  ==
B D                     Rat  ==
    Lesser Egyptian jerboa  ==
B D                Hedgehog  ==
B D                   Shrew  ==
              Prairie vole  ==
            Golden hamster  ==
B D         Chinese hamster  ==
           Star-nosed mole  ==
B D                    Pika  ==
B D                  Rabbit  ==
      David's myotis (bat)  ==
B D                 Manatee  ==
B D                Microbat  ==
             Big brown bat  ==
B D                     Cow  ==
          Tibetan antelope  ==
              Killer whale  ==
B D                     Cat  --
B D              Guinea pig  ==
          Brush-tailed rat  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
        Chinese tree shrew  ==
B D                     Pig  ==
              Weddell seal  NN
B D                 Dolphin  ==
B D           X. tropicalis  ==
                  Aardvark  --
  D          Painted turtle  ==
B D         Tasmanian devil  ==

Inserts between block 23 and 24 in window
B D               Bushbaby 2bp
            Pacific walrus 4bp

Alignment block 24 of 377 in window, 23630564 - 23630564, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Squirrel  t
B D                  Alpaca  t
             Bactrian camel  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
B D                Elephant  t
        Cape elephant shrew  t
           Cape golden mole  t
B D                  Tenrec  t
B D               Armadillo  t
B D                   Mouse  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
B D                Hedgehog  =
B D                   Shrew  =
              Prairie vole  =
            Golden hamster  =
B D         Chinese hamster  =
           Star-nosed mole  =
B D                    Pika  =
B D                  Rabbit  =
      David's myotis (bat)  =
B D                 Manatee  =
B D                Microbat  =
             Big brown bat  =
B D                     Cow  =
          Tibetan antelope  =
              Killer whale  =
          Black flying-fox  -
B D                     Cat  -
B D                Bushbaby  =
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
        Chinese tree shrew  =
            Pacific walrus  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
                  Aardvark  -
B D                 Megabat  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Inserts between block 24 and 25 in window
B D               Squirrel 5bp
B D                 Alpaca 5bp
            Bactrian camel 5bp
B D                  Horse 3bp
B D       White rhinoceros 5bp
B D                    Dog 5bp
B D                Ferret  5bp
B D                  Panda 5bp
B D               Elephant 4bp
       Cape elephant shrew 5bp
          Cape golden mole 7bp
B D                 Tenrec 1bp
B D              Armadillo 485bp

Alignment block 25 of 377 in window, 23630565 - 23631225, 661 bps 
B D                   Human  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D                   Chimp  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D                 Gorilla  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D               Orangutan  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D                  Gibbon  gctgatgaaaaagaatcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D                  Rhesus  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D     Crab-eating macaque  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D                  Baboon  gctgatgaaaaagagtcaaactgtaaaatatttgaagagatttattctgagccaaatgtgaggaccatga
B D            Green monkey  gctgatgaaaaagagtcaaactgtgaaatatttgaagagatttactctgagccaaatgtgaggaccatga
B D                Marmoset  gctgatgaaaaagagtcaagctgtaaaatatttgaagagatttattctgaaccaaatgtgagga------
B D         Squirrel monkey  gctgatgaaaaagagtcaagctgtaaaatatttgaagagatttattctgaaccaaatgtgaggaccatga
B D                   Mouse  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Dog  ======================================================================
B D                   Panda  ======================================================================
B D                 Ferret   ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Manatee  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
             Domestic goat  ----------------------------------------------------------------------
B D                   Sheep  ----------------------------------------------------------------------
          Tibetan antelope  ======================================================================
              Killer whale  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
            Bactrian camel  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                     Cat  ----------------------------------------------------------------------
B D                Bushbaby  ======================================================================
B D                Elephant  ======================================================================
B D              Guinea pig  ======================================================================
          Brush-tailed rat  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
        Chinese tree shrew  ======================================================================
            Pacific walrus  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ======================================================================
B D           X. tropicalis  ======================================================================
                  Aardvark  ----------------------------------------------------------------------
          Cape golden mole  ======================================================================
B D                 Megabat  ----------------------------------------------------------------------
  D          Painted turtle  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  cccatgacacaggtccaggaggtcctgggaatatattcccaaggtggttgggttgcagcttgattttata
                      Chimp  cccatgacacaggtccaggaggtcctgagaatatattcccaaggtggttgggttgcagcttgattttata
                    Gorilla  cccgtgacacaggtccaggaggtcctgagaatatattcccaaggtggttgggttgcagcttgattttata
                  Orangutan  cccatgacacaggtccaggaggtcctgagaatatattcccaaggtggttgggttgcagcttgattttata
                     Gibbon  cccacgatacaggtccaggaggtcctgagaatatattcccaaggtggttgggttgcagcttgattttata
                     Rhesus  cccatgacacaggtccaggaggtcctgagaatatatgcccaaggtggttgggttacagcttgattttata
        Crab-eating macaque  cccatgacacaggtccaggaggtcctgagaatatatgcccaaggtggttgggttacagcttgattttata
                     Baboon  cccatgacacaggtccaggaggtcctgagaatatatgcccaaggtggttgggttacagcttgattttgta
               Green monkey  cccatgacacaggtccaggaggtcctgagaatatatgcccaaggaggttgggttacagcttgattttata
                   Marmoset  -ccatcacataggtccagggggtcctgagaatatatgcccaaggtggttgggttacagcttgattttata
            Squirrel monkey  cccatcacataggtccaggggttcctgagaatatatgctcaaggtggttgggttacagcttgattttata
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  catcttaggagaacagaagctacaggcagagacacaaatcaatacatgtaaggattacattgttttggcc
                      Chimp  catcttaggagaacagaagctacaggcagagacataaatcaatacatgtaaggattacattgttttggcc
                    Gorilla  catcttaggagaacagaagctacaggcagagacataaatcaatacatgtaaggattacattgttttggcc
                  Orangutan  catcttaggagaacagaagctacaggcagagacataaatcaatacatgtaaggattacattgttttggca
                     Gibbon  catcttaggagaacagaagctacaggcagagacataaatcaatacatgtaaggattacattgttttggcc
                     Rhesus  catcttaggagaacagaagctacaggcagagacacaagtcaatacatgtaagggttacattgtttaggcc
        Crab-eating macaque  catcttaggagaacagaagctacaggcagagacacaagtcaatacatgtaagggttacattgtttaggcc
                     Baboon  catcttaggagaacagaagctacaggcagagacacaagtcaatacatgtaagaattacattgtttaggcc
               Green monkey  catcttaggagaacagaagctacaggcagatacacaagtcaatacatgtaagaattacattggttaggcc
                   Marmoset  cattttaggagaacagaagctacaggcagagacataaatcaatacatgtaaggattacattgttttggcc
            Squirrel monkey  cattttaggagaacagatgctacaggcagagatataaatcaatacatgtaaggattatattgttttggcc
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  cagaaaggcaggacatcttgaagtgggggcttccaggtcacaggtagatttaaaga-ttttctgattggc
                      Chimp  cagaaaggcaggacatcttgaagtgggggcttccaggtcacaggtagatttaaaga-ttttctgattggc
                    Gorilla  cagaaaggcaggacatcttgaagtgggggcttccaggtcacaggtagatttaaaga-ttttctgattggc
                  Orangutan  cagaaaggcaggatatcttgaagtgggggcttccaggtcacaggtagatttaaaga-ttttctgattggc
                     Gibbon  cagaaaggcaggacatcttgaagtgggggcttccaggtcacaggtagatttaaaga-ttttctgattggc
                     Rhesus  cagaaaggcaggacatcttggagtgggggcttccaggtcataggtggatttaaaga-ttttctgattggc
        Crab-eating macaque  cagaaaggcaggacatcttggagtgggggcttccaggtcataggtggatttaaaga-ttttctgattggc
                     Baboon  cagaaaggcaggacatcttgaagtgggggcttccaggtcataggtggatttaaaga-ttttctgattggc
               Green monkey  cagaaaggcaggacatcttgaagtgggggcttccaggtcataggtggatttaaaga-ttttctgattggc
                   Marmoset  cagaaaggctggacatcttgaagtgggggcttccaagtcataggtggatttggagatttttcggattggc
            Squirrel monkey  cagaaaggctggacatcttgaagtgggggcttccaaatcataggtagatttagagatttttcggattggc
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  aagtggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagatatgtttgtagttaagat
                      Chimp  aagtggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagaaatgtttgtagttaagat
                    Gorilla  aagtggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagaaatgtttgtagttaagat
                  Orangutan  aagtggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagaaatgtttgtagt-----t
                     Gibbon  aagtggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagaaatgtttgtagttaagat
                     Rhesus  aactggttgaaagggttaagctctgcccaaagagttgaggtcaatagaaagaaatgtttgcagttaagat
        Crab-eating macaque  aactggttgaaagggttaagctctgcccaaagagttgaggtcaatagaaagaaatgtttgcagttaagat
                     Baboon  aactggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagaaatgtttgtagttaagat
               Green monkey  aactggttgaaagggttaagctctgcctaaagagttgaggtcaatagaaagaaatgtttgtagttaagat
                   Marmoset  aattggttgaaagggttaagctcttcctaaagagttgaggtcaatagaaagaaatgtttgtagttaagat
            Squirrel monkey  aattggttgaaagggttaagctcttcctaaagagttgaggtcaacagaaagaaacgtttgttgttaagat
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  aaggggagttgtgggagccaaggttcttgttaacgtagatgaagcctccaggtagtaggcatcatagata
                      Chimp  aaggggagttgtgggagccaaggttcttgtta-cgtagatgaagcctccagatagtaggcatcatagata
                    Gorilla  aaggggagttgtgggagccaaggttcttgtta-cgtagatgaagcctccaggtagtaggcatcatagata
                  Orangutan  aaggggagttgtggaagccaaggttcttgtta-tgtagatgaagcctccaggtagtaggcgtcagagata
                     Gibbon  aaggggagttgtggaagccaagattcttgtta-tgtacatgaagcctccaggtagtaggcgtcatagata
                     Rhesus  aaggggagttgtggaagccaaggttcttgtta-tgtagatgaagcctccaggtagtaggcctgatagata
        Crab-eating macaque  aaggggagttgtggaagccaaggttcttgtta-tgtagatgaagcctccaggtagtaggcctgatagata
                     Baboon  aaggggagttgtggaagccaaggttcttgtta-tgtagatgaagcctccaggtagtaggcctgatagata
               Green monkey  aaggggagttgtggaagccaaggttcttgtta-tgtagatgatgcctccaggtagtaggcctgatagata
                   Marmoset  taggggagttgtggaagccaaggttcttgtta-tttagatcaagcctccaggcagcaggcttcatagaga
            Squirrel monkey  taggggagttgtggaagccaacgttcttctta-tttagatcaagcctccaggcagcaggcttcatagaga
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  atagattgtaaatattttttatcagatcctaaaaggtgccagactcttagttaaatctctcttggatcag
                      Chimp  atagattgtaaatattttttatcagaccctaaaaggtgccagactcttagttaaatctctcttggatcag
                    Gorilla  atagattgtaaatattttttatcagaccctaaaaggtgccagactcttagttcaatctctcttggatcag
                  Orangutan  atagattgtaaatattttttattggaccctaaaaggtgccacactcttagttaaatctctcttggatcag
                     Gibbon  atagatggtaaatatcttttatcagaccctaaaaggtgccagactcttagttaaatctctcttggatcag
                     Rhesus  atagattgtaaatatattttatcagaccctaaaaggtgccagactcttagttaaatctctcttggatcag
        Crab-eating macaque  atagattgtaaatatattttatcagaccctaaaaggtgccagactcttagttaaatctctcttggatcag
                     Baboon  atagattgtaaatatattttatcagaccctaaaaggtgccagactcttagttaaatctctcttggatcag
               Green monkey  atagattgtaaatatattttatcagaccctaaaaggtgccagactcttagttaaatctctcttggatcag
                   Marmoset  atagattgtaaatgtcttttatcataccctaaaaggtgccagactctcagttaaatctctcttggatcag
            Squirrel monkey  atagactgtaaatgtcttttatcataccctaaaaggtaccagactcttagttaaatctctcttggatcag
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  gaaaagacctggaaagagaaggggattttctataggatgtaaattttcctcacaagagacagctttgcag
                      Chimp  gaaaagacctggaaagagaaggggattttctataggatgtaaattttcctcacaagagacagctttgcag
                    Gorilla  gaaaagacctggaaagagaatgggattttctataggatgtaaattttgctcacaagagacagccttgcag
                  Orangutan  gaaaagacctggaaagggaaggggattttctataggatgtaaattttcctcacaagagacagcattgcag
                     Gibbon  gaaaagacctggaaagggaaggggattttctgtaggatgtaaattttcctcacaagagacagctttgcag
                     Rhesus  gaaaagacctggaaagggaagggcattttctataggatgtaaattttcctcacgaaagacagctttgcaa
        Crab-eating macaque  gaaaagacctggaaagggaaggggattttctataggatgtaaattttcctcacgaaagacagctttgcaa
                     Baboon  gaaaagacctggaaagggaaggggattttctataggatgtaaattttcctcacaaaagacagctttgcaa
               Green monkey  gaaaagacctggaaagggaaggggattttctataggatgtaaattttcctcacaaaagacagctttgcaa
                   Marmoset  gaaaagacctagaaagggaaggggattttctataggatgtaaattttcctcacaagagacagctttgcag
            Squirrel monkey  gaaaagacctggaaagagaaggggattttctatagaatgtaaattttcctcacaagagatagttttgcag
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  ggccatttc-aaaaaatgtcaaagaaatgcattttgatgtaaaatacttcag-tttttttcaggacctgc
                      Chimp  ggccatttc-aaaaaatgtcaaagaaatgcattttgatgtaaaatacttcag-tttttttcaggacctgc
                    Gorilla  ggccatttc-aaaaaatgtcaaagaaatgcattttgatgtaaaatacttcag-tttttttcaggacctgc
                  Orangutan  ggccatttc-aaaaaatgtcaaagaaatgcattttgatgtaaaatacttcag-tttttttcaggacctgc
                     Gibbon  ggccatttc-aaaaaatgtcaaagaaatgcattttggtgtaaaatacttcagttttttttcaggacctgc
                     Rhesus  ggccatttc-aaaaaatgtcaaagaaatgcattttggtgtaaaatacttcagttttttttcaggacctgc
        Crab-eating macaque  ggccatttc-aaaaaatgtcaaagaaatgcattttggtgtaaaatacttcag-tttttttcaggacctgc
                     Baboon  ggccatttc-aaaaaatgtcaaataaatgcattttggtgtaaaatacttcag-tttttttcaggacctgc
               Green monkey  ggccatttcaaaaaaatgtcaaagaaatgcattttggtgtaaaatacttcag-tttttttcaggacctgc
                   Marmoset  ggccatttc-aaaaaatatcaaagaaatgcattttggtgtaaaatacttcaa-tttctttcaggacctgc
            Squirrel monkey  ggccatttc-aaaaaatgtcaaagaaatgtattttggtgtaaaatacttcaa-tttctttcaggacctgc
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  tatctgtcatgtgatgctatactagagtcaggtt
                      Chimp  tatctgtcatgtgatgctatactagagtcaggtt
                    Gorilla  tatctgtcatgtgatgctatactagagtcaggtt
                  Orangutan  tatctgtcacgtgatgctatactagagtcaggtt
                     Gibbon  tatctgtcatgtgatgctatactagagtcaggtt
                     Rhesus  tatctgtcatgtgatgctatactagagtcaggtt
        Crab-eating macaque  tatctgtcatgtgatgctatactagagtcaggtt
                     Baboon  tatctgtcatgtgatgctatactagagtcaggtt
               Green monkey  tatctgtcatgtgatgctatactagagtcaggtt
                   Marmoset  tatctgtcatgtgatgctatactagagtcagatt
            Squirrel monkey  tatctgtcatatgatgctatactagagtcaggtc
                      Mouse  ==================================
                        Rat  ==================================
     Lesser Egyptian jerboa  ==================================
                     Tenrec  ==================================
        Cape elephant shrew  ==================================
                   Hedgehog  ==================================
                      Shrew  ==================================
               Prairie vole  ==================================
             Golden hamster  ==================================
            Chinese hamster  ==================================
            Star-nosed mole  ==================================
                       Pika  ==================================
                     Rabbit  ==================================
                        Dog  ==================================
                      Panda  ==================================
                    Ferret   ==================================
       David's myotis (bat)  ==================================
                    Manatee  ==================================
                   Microbat  ==================================
              Big brown bat  ==================================
                        Cow  ==================================
              Domestic goat  ----------------------------------
                      Sheep  ----------------------------------
           Tibetan antelope  ==================================
               Killer whale  ==================================
                  Armadillo  ==================================
                     Alpaca  ==================================
             Bactrian camel  ==================================
           Black flying-fox  ----------------------------------
                        Cat  ----------------------------------
                   Bushbaby  ==================================
                   Elephant  ==================================
                 Guinea pig  ==================================
           Brush-tailed rat  ==================================
             Naked mole-rat  ==================================
                 Chinchilla  ==================================
         Chinese tree shrew  ==================================
             Pacific walrus  ==================================
           White rhinoceros  ==================================
                      Horse  ==================================
                   Squirrel  ==================================
                        Pig  ==================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ==================================
              X. tropicalis  ==================================
                   Aardvark  ----------------------------------
           Cape golden mole  ==================================
                    Megabat  ----------------------------------
             Painted turtle  ==================================
            Tasmanian devil  ==================================

Inserts between block 25 and 26 in window
B D               Marmoset 309bp

Alignment block 26 of 377 in window, 23631226 - 23631241, 16 bps 
B D                   Human  agaatttggtatctta
B D                   Chimp  agaatttggtatctta
B D                 Gorilla  agaatttggtatctta
B D               Orangutan  agaatttggtatctta
B D                  Gibbon  agaatttggtatctta
B D                  Rhesus  agaatttcgtatctta
B D     Crab-eating macaque  agaatttggtatctta
B D                  Baboon  agaatttggtatctta
B D            Green monkey  agaatttggtatctta
B D                Marmoset  agaagttggtatctta
B D         Squirrel monkey  agaatttgttatctta
B D                   Mouse  ================
B D                     Rat  ================
    Lesser Egyptian jerboa  ================
B D                  Tenrec  ================
       Cape elephant shrew  ================
B D                Hedgehog  ================
B D                   Shrew  ================
              Prairie vole  ================
            Golden hamster  ================
B D         Chinese hamster  ================
           Star-nosed mole  ================
B D                    Pika  ================
B D                  Rabbit  ================
B D                     Dog  ================
B D                   Panda  ================
B D                 Ferret   ================
      David's myotis (bat)  ================
B D                 Manatee  ================
B D                Microbat  ================
             Big brown bat  ================
B D                     Cow  ================
             Domestic goat  ----------------
B D                   Sheep  ----------------
          Tibetan antelope  ================
              Killer whale  ================
B D               Armadillo  ================
B D                  Alpaca  ================
            Bactrian camel  ================
          Black flying-fox  ----------------
B D                     Cat  ----------------
B D                Bushbaby  ================
B D                Elephant  ================
B D              Guinea pig  ================
          Brush-tailed rat  ================
B D          Naked mole-rat  ================
                Chinchilla  ================
        Chinese tree shrew  ================
            Pacific walrus  ================
B D        White rhinoceros  ================
B D                   Horse  ================
B D                Squirrel  ================
B D                     Pig  ================
              Weddell seal  NNNNNNNNNNNNNNNN
B D                 Dolphin  ================
B D           X. tropicalis  ================
                  Aardvark  ----------------
          Cape golden mole  ================
B D                 Megabat  ----------------
  D          Painted turtle  ================
B D         Tasmanian devil  ================

Inserts between block 26 and 27 in window
B D        Squirrel monkey 293bp

Alignment block 27 of 377 in window, 23631242 - 23631380, 139 bps 
B D                   Human  ttgcta-aaagtctgttttttcagccctaagatctccattttactgttaatgctggtcagtcatgcctga
B D                   Chimp  ttgcta-aaagtctgttttctcagccctaagatctccattttaatgttaatgctggtcagtcgtgcctga
B D                 Gorilla  ttgcta-aaagtctgttttttcagccctaagatctccattttaatgttaatgctggtcagtcgtgcctga
B D               Orangutan  ttgctacaaagtctgttttttcagccctaagatctccattttaatgttaatgctggtcagtcgtgcctga
B D                  Gibbon  ttgctacaaagtctgttttttcagccctaaggtctccattttaatattaatgctggtcagtcgtacctga
B D                  Rhesus  ttgctacaaagtctgttttttgagccataagatctccattttaatg-taatgctggtcagtcatgcctga
B D     Crab-eating macaque  ttgctacaaagtctgttttttgagccataagatctccattttaatg-taatgctggtcagtcatgcctga
B D                  Baboon  ttgctacaaagtctgttttttgagccataagatctccattttaatg-taatgctggtcagtcatgcctga
B D            Green monkey  ttgctacaaagtctgtttttggagccctaagatctccattttaatg-taatgctggtcagtcatgcctga
B D                Marmoset  ttgctacaaagtctgttttttcagccccaagattcctgttttaatgttaacatgggtcagtggagcctga
B D                   Mouse  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Dog  ======================================================================
B D                   Panda  ======================================================================
B D                 Ferret   ======================================================================
B D         Squirrel monkey  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Manatee  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
             Domestic goat  ----------------------------------------------------------------------
B D                   Sheep  ----------------------------------------------------------------------
          Tibetan antelope  ======================================================================
              Killer whale  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
            Bactrian camel  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                     Cat  ----------------------------------------------------------------------
B D                Bushbaby  ======================================================================
B D                Elephant  ======================================================================
B D              Guinea pig  ======================================================================
          Brush-tailed rat  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
        Chinese tree shrew  ======================================================================
            Pacific walrus  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ======================================================================
B D           X. tropicalis  ======================================================================
                  Aardvark  ----------------------------------------------------------------------
          Cape golden mole  ======================================================================
B D                 Megabat  ----------------------------------------------------------------------
  D          Painted turtle  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  actcaaaagggaggagggtataatgaggcatgtccaaccctgtattcccatcatggcctgcactggtttt
                      Chimp  actcaaaagggaggagggtataatgaggcatgtccaaccctgtattcccatcatggcctgcactggtttt
                    Gorilla  actcaaaagggaggagggtataatgaggcatgtccaaccctgtattcccatcatggcctgcgctggtttt
                  Orangutan  actcaaaagggaggagggtataatgaggcatgtccaaccctgcattcccatcatggcctgcactggtttt
                     Gibbon  actcaaaagggaggagggtataataaggcatgtccaactctgcattcccatcatggcctgcactggtttt
                     Rhesus  actcaaaagggaggagggtataatgaggcatgtccaatcccacattcccatcatggcctgcactggtttt
        Crab-eating macaque  actcaaaagggaggagggtataatgaggcatgtccaaccccacattcccatcatggcctgcactggtttt
                     Baboon  actcaaaagggaggagggtataatgaggcatgtccaaccccacattcccatcatggcctgcactggtttt
               Green monkey  actcaaaagggaggagggtataatgaggcatgtccaaccccacattcccatcatggtctgcactggtttt
                   Marmoset  acttgaaagggaggagggtgtaatgaggcatgtccaactttgcattcccgtcatggcctacactgttttt
                      Mouse  ======================================================================
                        Rat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Shrew  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
            Star-nosed mole  ======================================================================
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                        Dog  ======================================================================
                      Panda  ======================================================================
                    Ferret   ======================================================================
            Squirrel monkey  ======================================================================
       David's myotis (bat)  ======================================================================
                    Manatee  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
                        Cow  ======================================================================
              Domestic goat  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
           Tibetan antelope  ======================================================================
               Killer whale  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
           Black flying-fox  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                   Bushbaby  ======================================================================
                   Elephant  ======================================================================
                 Guinea pig  ======================================================================
           Brush-tailed rat  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
         Chinese tree shrew  ======================================================================
             Pacific walrus  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
               Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Dolphin  ======================================================================
              X. tropicalis  ======================================================================
                   Aardvark  ----------------------------------------------------------------------
           Cape golden mole  ======================================================================
                    Megabat  ----------------------------------------------------------------------
             Painted turtle  ======================================================================
            Tasmanian devil  ======================================================================

Inserts between block 27 and 28 in window
B D               Marmoset 5bp

Alignment block 28 of 377 in window, 23631381 - 23631456, 76 bps 
B D                   Human  ttaagttgactttggaatgccctttgccaagcagaggagtgctttcagttggttggggagcttagaattt
B D                   Chimp  ttaagttgactttggaatgccctttgccaagcagaggagtgctttcagttggttggggagcttagaattt
B D                 Gorilla  ttaagttgactttgcaatgccttttgccaagcagaggagtgctttcagttggttggggagcttagaattt
B D               Orangutan  ttaggttgactttggaatgccctttgccaagcagaggagtgctttcagttggttggggagcttagaattt
B D                  Gibbon  ttaggttgactttggaatgccctttgccaagcagaggagtgctttcagttgg-----------------t
B D                  Rhesus  taaggttgactttggaatgccctttgccaagtggaggagtgctttcagttcgttggggagcttagaattt
B D     Crab-eating macaque  taaggttgactttggaatgccctttgccaagtggaggagtgctttcagttcgttggggagcttagaattt
B D                  Baboon  taaggttgactttggaatgccctttgccaagtggaggagtgctttcagttcgttggggagcttagaattt
B D            Green monkey  taaggttgactttggaatgccctttgccaagtggaggagtgctttcagttcgttggggagcttagaattt
B D                Marmoset  ttaggttgactttggaatgccctttgccaagagga--agtgcattcagtcggctggggaacttagaattc
B D         Squirrel monkey  ttaggttgactttggaatgccctttgccaagagga--agtgcattcagtcggttggggaacttcgaattc
B D                   Mouse  ======================================================================
B D                     Rat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
           Star-nosed mole  ======================================================================
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Dog  ======================================================================
B D                   Panda  ======================================================================
B D                 Ferret   ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Manatee  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
B D                     Cow  ======================================================================
             Domestic goat  ----------------------------------------------------------------------
B D                   Sheep  ----------------------------------------------------------------------
          Tibetan antelope  ======================================================================
              Killer whale  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
            Bactrian camel  ======================================================================
          Black flying-fox  ----------------------------------------------------------------------
B D                     Cat  ----------------------------------------------------------------------
B D                Bushbaby  ======================================================================
B D                Elephant  ======================================================================
B D              Guinea pig  ======================================================================
          Brush-tailed rat  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
        Chinese tree shrew  ======================================================================
            Pacific walrus  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D                     Pig  ======================================================================
              Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  ======================================================================
B D           X. tropicalis  ======================================================================
                  Aardvark  ----------------------------------------------------------------------
          Cape golden mole  ======================================================================
B D                 Megabat  ----------------------------------------------------------------------
  D          Painted turtle  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  tatttc
                      Chimp  tatttc
                    Gorilla  tatttc
                  Orangutan  tatttc
                     Gibbon  tatttc
                     Rhesus  tatttc
        Crab-eating macaque  tatttt
                     Baboon  tatttt
               Green monkey  tatttt
                   Marmoset  tatttc
            Squirrel monkey  tatttc
                      Mouse  ======
                        Rat  ======
     Lesser Egyptian jerboa  ======
                     Tenrec  ======
        Cape elephant shrew  ======
                   Hedgehog  ======
                      Shrew  ======
               Prairie vole  ======
             Golden hamster  ======
            Chinese hamster  ======
            Star-nosed mole  ======
                       Pika  ======
                     Rabbit  ======
                        Dog  ======
                      Panda  ======
                    Ferret   ======
       David's myotis (bat)  ======
                    Manatee  ======
                   Microbat  ======
              Big brown bat  ======
                        Cow  ======
              Domestic goat  ------
                      Sheep  ------
           Tibetan antelope  ======
               Killer whale  ======
                  Armadillo  ======
                     Alpaca  ======
             Bactrian camel  ======
           Black flying-fox  ------
                        Cat  ------
                   Bushbaby  ======
                   Elephant  ======
                 Guinea pig  ======
           Brush-tailed rat  ======
             Naked mole-rat  ======
                 Chinchilla  ======
         Chinese tree shrew  ======
             Pacific walrus  ======
           White rhinoceros  ======
                      Horse  ======
                   Squirrel  ======
                        Pig  ======
               Weddell seal  NNNNNN
                    Dolphin  ======
              X. tropicalis  ======
                   Aardvark  ------
           Cape golden mole  ======
                    Megabat  ------
             Painted turtle  ======
            Tasmanian devil  ======

Alignment block 29 of 377 in window, 23631457 - 23631463, 7 bps 
B D                   Human  ctgttta
B D                   Chimp  ctgttta
B D                 Gorilla  ctgttta
B D               Orangutan  ctgttta
B D                  Gibbon  ctgttta
B D                  Rhesus  ctgttta
B D     Crab-eating macaque  ctgttta
B D                  Baboon  ctgttta
B D            Green monkey  ctgttta
B D                Marmoset  cagttta
B D         Squirrel monkey  cagttta
B D                  Rabbit  ctgtcca
B D                   Mouse  =======
B D                     Rat  =======
    Lesser Egyptian jerboa  =======
B D                  Tenrec  =======
       Cape elephant shrew  =======
B D                Hedgehog  =======
B D                   Shrew  =======
              Prairie vole  =======
            Golden hamster  =======
B D         Chinese hamster  =======
           Star-nosed mole  =======
B D                    Pika  =======
B D                     Dog  =======
B D                   Panda  =======
B D                 Ferret   =======
      David's myotis (bat)  =======
B D                 Manatee  =======
B D                Microbat  =======
             Big brown bat  =======
B D                     Cow  =======
             Domestic goat  -------
B D                   Sheep  -------
          Tibetan antelope  =======
              Killer whale  =======
B D               Armadillo  =======
B D                  Alpaca  =======
            Bactrian camel  =======
          Black flying-fox  -------
B D                     Cat  -------
B D                Bushbaby  =======
B D                Elephant  =======
B D              Guinea pig  =======
          Brush-tailed rat  =======
B D          Naked mole-rat  =======
                Chinchilla  =======
        Chinese tree shrew  =======
            Pacific walrus  =======
B D        White rhinoceros  =======
B D                   Horse  =======
B D                Squirrel  =======
B D                     Pig  =======
              Weddell seal  NNNNNNN
B D                 Dolphin  =======
B D           X. tropicalis  =======
                  Aardvark  -------
          Cape golden mole  =======
B D                 Megabat  -------
  D          Painted turtle  =======
B D         Tasmanian devil  =======

Alignment block 30 of 377 in window, 23631464 - 23631467, 4 bps 
B D                   Human  catt
B D                   Chimp  catt
B D                 Gorilla  catt
B D               Orangutan  catt
B D                  Gibbon  catt
B D                  Rhesus  catt
B D     Crab-eating macaque  catt
B D                  Baboon  catt
B D            Green monkey  catt
B D                Marmoset  catt
B D         Squirrel monkey  catt
B D                  Rabbit  cagc
B D                     Cat  catc
B D                   Mouse  ====
B D                     Rat  ====
    Lesser Egyptian jerboa  ====
B D                  Tenrec  ====
       Cape elephant shrew  ====
B D                Hedgehog  ====
B D                   Shrew  ====
              Prairie vole  ====
            Golden hamster  ====
B D         Chinese hamster  ====
           Star-nosed mole  ====
B D                    Pika  ====
B D                     Dog  ====
B D                   Panda  ====
B D                 Ferret   ====
      David's myotis (bat)  ====
B D                 Manatee  ====
B D                Microbat  ====
             Big brown bat  ====
B D                     Cow  ====
             Domestic goat  ----
B D                   Sheep  ----
          Tibetan antelope  ====
              Killer whale  ====
B D               Armadillo  ====
B D                  Alpaca  ====
            Bactrian camel  ====
          Black flying-fox  ----
B D                Bushbaby  ====
B D                Elephant  ====
B D              Guinea pig  ====
          Brush-tailed rat  ====
B D          Naked mole-rat  ====
                Chinchilla  ====
        Chinese tree shrew  ====
            Pacific walrus  ====
B D        White rhinoceros  ====
B D                   Horse  ====
B D                Squirrel  ====
B D                     Pig  ====
              Weddell seal  NNNN
B D                 Dolphin  ====
B D           X. tropicalis  ====
                  Aardvark  ----
          Cape golden mole  ====
B D                 Megabat  ----
  D          Painted turtle  ====
B D         Tasmanian devil  ====

Inserts between block 30 and 31 in window
B D                    Cat 1bp

Alignment block 31 of 377 in window, 23631468 - 23631468, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                  Rabbit  t
B D                   Shrew  a
B D                   Mouse  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
B D                  Tenrec  =
       Cape elephant shrew  =
B D                Hedgehog  =
              Prairie vole  =
            Golden hamster  =
B D         Chinese hamster  =
           Star-nosed mole  =
B D                    Pika  =
B D                     Dog  =
B D                   Panda  =
B D                 Ferret   =
      David's myotis (bat)  =
B D                 Manatee  =
B D                Microbat  =
             Big brown bat  =
B D                     Cow  =
             Domestic goat  -
B D                   Sheep  -
          Tibetan antelope  =
              Killer whale  =
B D               Armadillo  =
B D                  Alpaca  =
            Bactrian camel  =
          Black flying-fox  -
B D                     Cat  =
B D                Bushbaby  =
B D                Elephant  =
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
        Chinese tree shrew  =
            Pacific walrus  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
                  Aardvark  -
          Cape golden mole  =
B D                 Megabat  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Alignment block 32 of 377 in window, 23631469 - 23631469, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  g
B D         Squirrel monkey  g
               Prairie vole  t
B D                  Rabbit  c
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                     Cat  c
B D                   Shrew  t
B D                  Tenrec  t
B D                   Mouse  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
       Cape elephant shrew  =
B D                Hedgehog  =
            Golden hamster  =
B D         Chinese hamster  =
           Star-nosed mole  =
B D                    Pika  =
B D                     Dog  =
B D                   Panda  =
B D                 Ferret   =
      David's myotis (bat)  =
B D                 Manatee  =
B D                Microbat  =
             Big brown bat  =
              Killer whale  =
B D               Armadillo  =
B D                  Alpaca  =
            Bactrian camel  =
          Black flying-fox  -
B D                Bushbaby  =
B D                Elephant  =
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
        Chinese tree shrew  =
            Pacific walrus  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
                  Aardvark  -
          Cape golden mole  =
B D                 Megabat  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Inserts between block 32 and 33 in window
              Prairie vole 2bp
B D                 Rabbit 7bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                    Cat 2bp
B D                  Shrew 2bp
B D                 Tenrec 1bp

Alignment block 33 of 377 in window, 23631470 - 23631470, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
           Cape golden mole  t
B D                  Tenrec  c
B D                   Mouse  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
       Cape elephant shrew  =
B D                Hedgehog  =
B D                   Shrew  =
              Prairie vole  =
            Golden hamster  =
B D         Chinese hamster  =
           Star-nosed mole  =
B D                    Pika  =
B D                  Rabbit  =
B D                     Dog  =
B D                   Panda  =
B D                 Ferret   =
      David's myotis (bat)  =
B D                 Manatee  =
B D                Microbat  =
             Big brown bat  =
B D                     Cow  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
              Killer whale  =
B D               Armadillo  =
B D                  Alpaca  =
            Bactrian camel  =
          Black flying-fox  -
B D                     Cat  =
B D                Bushbaby  =
B D                Elephant  =
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
        Chinese tree shrew  =
            Pacific walrus  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
                  Aardvark  -
B D                 Megabat  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Alignment block 34 of 377 in window, 23631471 - 23631471, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Elephant  c
           Cape golden mole  c
B D                  Tenrec  c
                   Aardvark  c
B D                   Mouse  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
       Cape elephant shrew  =
B D                Hedgehog  =
B D                   Shrew  =
              Prairie vole  =
            Golden hamster  =
B D         Chinese hamster  =
           Star-nosed mole  =
B D                    Pika  =
B D                  Rabbit  =
B D                     Dog  =
B D                   Panda  =
B D                 Ferret   =
      David's myotis (bat)  =
B D                 Manatee  =
B D                Microbat  =
             Big brown bat  =
B D                     Cow  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
              Killer whale  =
B D               Armadillo  =
B D                  Alpaca  =
            Bactrian camel  =
          Black flying-fox  -
B D                     Cat  =
B D                Bushbaby  =
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
        Chinese tree shrew  =
            Pacific walrus  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D                     Pig  =
              Weddell seal  N
B D                 Dolphin  =
B D           X. tropicalis  =
B D                 Megabat  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Inserts between block 34 and 35 in window
B D                 Rhesus 2bp
B D    Crab-eating macaque 2bp
B D                 Baboon 2bp
B D           Green monkey 2bp
B D               Marmoset 2bp
B D        Squirrel monkey 2bp

Alignment block 35 of 377 in window, 23631472 - 23631474, 3 bps 
B D                   Human  tct
B D                   Chimp  tct
B D                 Gorilla  tct
B D               Orangutan  tct
B D                  Gibbon  tct
B D                  Rhesus  tct
B D     Crab-eating macaque  tct
B D                  Baboon  tct
B D            Green monkey  tct
B D                Marmoset  tct
B D         Squirrel monkey  tct
B D                Bushbaby  tct
B D                Squirrel  tct
               Prairie vole  ttt
B D         Chinese hamster  tct
B D                  Rabbit  tct
B D                  Alpaca  tct
             Bactrian camel  tct
B D                 Dolphin  tct
               Killer whale  tct
           Tibetan antelope  tct
B D                     Cow  tct
B D                   Sheep  tct
              Domestic goat  tct
B D                   Horse  tct
B D        White rhinoceros  tct
B D                     Cat  tct
B D                     Dog  tct
B D                 Ferret   tct
B D                   Panda  tct
             Pacific walrus  ttg
B D                   Shrew  tct
B D                Elephant  tct
        Cape elephant shrew  tct
           Cape golden mole  tct
B D                  Tenrec  tct
                   Aardvark  tct
B D                   Mouse  ===
B D                     Rat  ===
    Lesser Egyptian jerboa  ===
B D                Hedgehog  ===
            Golden hamster  ===
           Star-nosed mole  ===
B D                    Pika  ===
      David's myotis (bat)  ===
B D                 Manatee  ===
B D                Microbat  ===
             Big brown bat  ===
B D               Armadillo  ===
          Black flying-fox  ---
B D              Guinea pig  ===
          Brush-tailed rat  ===
B D          Naked mole-rat  ===
                Chinchilla  ===
        Chinese tree shrew  ===
B D                     Pig  ===
              Weddell seal  NNN
B D           X. tropicalis  ===
B D                 Megabat  ---
  D          Painted turtle  ===
B D         Tasmanian devil  ===

Inserts between block 35 and 36 in window
B D                  Shrew 2bp

Alignment block 36 of 377 in window, 23631475 - 23631480, 6 bps 
B D                   Human  tttctg
B D                   Chimp  tttctg
B D                 Gorilla  tttctg
B D               Orangutan  tttctg
B D                  Gibbon  tttctg
B D                  Rhesus  tttctg
B D     Crab-eating macaque  tttctg
B D                  Baboon  tttctg
B D            Green monkey  tttctg
B D                Marmoset  tttctg
B D         Squirrel monkey  tttctg
B D                Bushbaby  cttctg
         Chinese tree shrew  tctctg
B D                Squirrel  tttccg
               Prairie vole  ttgttg
B D         Chinese hamster  ttgctg
B D                  Rabbit  c-----
B D                  Alpaca  ttccca
             Bactrian camel  ttccca
B D                 Dolphin  tccctg
               Killer whale  tccctg
           Tibetan antelope  ctcctg
B D                     Cow  ctcctg
B D                   Sheep  ctcctg
              Domestic goat  ctcctg
B D                   Horse  ttcctg
B D        White rhinoceros  ttcctg
B D                     Cat  ttcctg
B D                     Dog  tccctg
B D                 Ferret   ttcctg
B D                   Panda  ttcctg
             Pacific walrus  ttcctg
           Black flying-fox  tctc--
B D                 Megabat  tctc--
B D                   Shrew  ctcct-
B D                Elephant  ttcctg
        Cape elephant shrew  ttccta
           Cape golden mole  ttcttg
B D                  Tenrec  ttctcc
                   Aardvark  ttcctg
B D                   Mouse  ======
B D                     Rat  ======
    Lesser Egyptian jerboa  ======
B D                Hedgehog  ======
            Golden hamster  ======
           Star-nosed mole  ======
B D                    Pika  ======
      David's myotis (bat)  ======
B D                 Manatee  ======
B D                Microbat  ======
             Big brown bat  ======
B D               Armadillo  ======
B D              Guinea pig  ======
          Brush-tailed rat  ======
B D          Naked mole-rat  ======
                Chinchilla  ======
B D                     Pig  ======
              Weddell seal  NNNNNN
B D           X. tropicalis  ======
  D          Painted turtle  ======
B D         Tasmanian devil  ======

Inserts between block 36 and 37 in window
B D                 Rabbit 1bp

Alignment block 37 of 377 in window, 23631481 - 23631481, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  t
         Chinese tree shrew  a
B D                Squirrel  a
               Prairie vole  a
B D         Chinese hamster  a
B D                  Rabbit  t
B D                    Pika  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
B D                Elephant  a
        Cape elephant shrew  a
           Cape golden mole  a
B D                  Tenrec  a
                   Aardvark  a
B D                   Mouse  =
B D                     Rat  =
    Lesser Egyptian jerboa  =
B D                Hedgehog  =
B D                   Shrew  -
            Golden hamster  =
           Star-nosed mole  =
      David's myotis (bat)  =
B D                 Manatee  =
B D                Microbat  =
             Big brown bat  =
B D               Armadillo  =
          Black flying-fox  -
B D              Guinea pig  =
          Brush-tailed rat  =
B D          Naked mole-rat  =
                Chinchilla  =
B D                     Pig  =
              Weddell seal  N
B D           X. tropicalis  =
B D                 Megabat  -
  D          Painted turtle  =
B D         Tasmanian devil  =

Alignment block 38 of 377 in window, 23631482 - 23631495, 14 bps 
B D                   Human  ttttcaatatttct
B D                   Chimp  ttttcaatatttct
B D                 Gorilla  ttttcaatatttct
B D               Orangutan  ttttcaatatttct
B D                  Gibbon  ttttcaatgtttcc
B D                  Rhesus  ttttcaatgtttct
B D     Crab-eating macaque  ttttcaatgtttct
B D                  Baboon  ttttcaatgtttct
B D            Green monkey  ttttcaatgtttct
B D                Marmoset  ttttcaatgtttct
B D         Squirrel monkey  ttttcaatgtttct
B D                Bushbaby  ttttcagtgtttct
         Chinese tree shrew  ttttcagtgtgtct
B D                Squirrel  ttttcaatgtttct
               Prairie vole  ttttcagtgtttct
B D         Chinese hamster  ttttcagtgtttct
B D                  Rabbit  tcccagggaccccc
B D                    Pika  tctccatggtctct
B D                  Alpaca  ttttcaatgtttct
             Bactrian camel  ttttcagtgtttct
B D                 Dolphin  ttttcgatgtttct
               Killer whale  tttttgatgtttct
           Tibetan antelope  ttatcaatgtttct
B D                     Cow  ttatcaatgtttct
B D                   Sheep  ttatcaatgtttct
              Domestic goat  ttatcaatgtttct
B D                   Horse  tcttcagtgtttct
B D        White rhinoceros  tcttcaatgtttct
B D                     Cat  ttgtcaatgtttct
B D                     Dog  cttt-aatgtttct
B D                 Ferret   ttttcagtggttct
B D                   Panda  ttgccaatgtttct
             Pacific walrus  tttccagtgtttct
           Black flying-fox  ttctccatgtttca
B D                 Megabat  ttctccatgtttca
              Big brown bat  ttttcagtatttct
       David's myotis (bat)  ttgtcagtatttct
B D                Microbat  ttgtcagtatttct
B D                   Shrew  tgtacaatcactct
B D                Elephant  ttttcagtgtttct
        Cape elephant shrew  attttcatgtttct
           Cape golden mole  tttttaatgtttct
B D                  Tenrec  -tggcaacgtttct
                   Aardvark  -attaaatgtttct
B D                   Mouse  ==============
B D                     Rat  ==============
    Lesser Egyptian jerboa  ==============
B D                Hedgehog  ==============
            Golden hamster  ==============
           Star-nosed mole  ==============
B D                 Manatee  ==============
B D               Armadillo  ==============
B D              Guinea pig  ==============
          Brush-tailed rat  ==============
B D          Naked mole-rat  ==============
                Chinchilla  ==============
B D                     Pig  ==============
              Weddell seal  NNNNNNNNNNNNNN
B D           X. tropicalis  ==============
  D          Painted turtle  ==============
B D         Tasmanian devil  ==============

Alignment block 39 of 377 in window, 23631496 - 23631498, 3 bps 
B D                   Human  aac
B D                   Chimp  aac
B D                 Gorilla  aac
B D               Orangutan  aac
B D                  Gibbon  aac
B D                  Rhesus  aac
B D     Crab-eating macaque  aac
B D                  Baboon  aac
B D            Green monkey  aac
B D                Marmoset  aac
B D         Squirrel monkey  aac
B D                Bushbaby  aat
         Chinese tree shrew  gat
B D                Squirrel  aag
               Prairie vole  aag
B D         Chinese hamster  aag
B D                  Rabbit  gc-
B D                    Pika  gt-
B D                  Alpaca  aat
             Bactrian camel  aat
B D                 Dolphin  aat
               Killer whale  aat
           Tibetan antelope  aat
B D                     Cow  aat
B D                   Sheep  aat
              Domestic goat  aat
B D                   Horse  aac
B D        White rhinoceros  aac
B D                     Cat  aac
B D                     Dog  aac
B D                 Ferret   ca-
B D                   Panda  cgc
             Pacific walrus  cgc
           Black flying-fox  aac
B D                 Megabat  aac
              Big brown bat  aac
       David's myotis (bat)  aac
B D                Microbat  aac
B D                Hedgehog  cac
B D                   Shrew  gac
B D                Elephant  aac
        Cape elephant shrew  aac
           Cape golden mole  aag
B D                  Tenrec  aac
                   Aardvark  aac
B D                   Mouse  ===
B D                     Rat  ===
    Lesser Egyptian jerboa  ===
            Golden hamster  ===
           Star-nosed mole  ===
B D                 Manatee  ===
B D               Armadillo  ===
B D              Guinea pig  ===
          Brush-tailed rat  ===
B D          Naked mole-rat  ===
                Chinchilla  ===
B D                     Pig  ===
              Weddell seal  NNN
B D           X. tropicalis  ===
  D          Painted turtle  ===
B D         Tasmanian devil  ===

Alignment block 40 of 377 in window, 23631499 - 23631502, 4 bps 
B D                   Human  tctt
B D                   Chimp  tctt
B D                 Gorilla  tctt
B D               Orangutan  tctt
B D                  Gibbon  tctt
B D                  Rhesus  tctt
B D     Crab-eating macaque  tctt
B D                  Baboon  tctt
B D            Green monkey  tctt
B D                Marmoset  tctt
B D         Squirrel monkey  tctt
B D                Bushbaby  tatt
         Chinese tree shrew  gatt
B D                Squirrel  tatt
               Prairie vole  tttt
B D         Chinese hamster  tatt
B D          Naked mole-rat  tctt
B D              Guinea pig  tctt
                 Chinchilla  tctt
B D                  Rabbit  tgtg
B D                    Pika  ttct
B D                  Alpaca  gatt
             Bactrian camel  gatt
B D                 Dolphin  gact
               Killer whale  gact
           Tibetan antelope  gact
B D                     Cow  gacc
B D                   Sheep  gact
              Domestic goat  gact
B D                   Horse  tctt
B D        White rhinoceros  tgtt
B D                     Cat  tac-
B D                     Dog  tgtt
B D                 Ferret   tatt
B D                   Panda  tgtt
             Pacific walrus  tatt
           Black flying-fox  tatt
B D                 Megabat  tatt
              Big brown bat  tatt
       David's myotis (bat)  tatt
B D                Microbat  tatt
B D                Hedgehog  ctct
B D                   Shrew  ctct
B D                Elephant  tttt
        Cape elephant shrew  tatt
           Cape golden mole  tgtt
B D                  Tenrec  tatt
                   Aardvark  tatt
B D                   Mouse  ====
B D                     Rat  ====
    Lesser Egyptian jerboa  ====
            Golden hamster  ====
           Star-nosed mole  ====
B D                 Manatee  ====
B D               Armadillo  ====
          Brush-tailed rat  ====
B D                     Pig  ====
              Weddell seal  NNNN
B D           X. tropicalis  ====
  D          Painted turtle  ====
B D         Tasmanian devil  ====

Inserts between block 40 and 41 in window
              Prairie vole 479bp

Alignment block 41 of 377 in window, 23631503 - 23631505, 3 bps 
B D                   Human  cca
B D                   Chimp  cca
B D                 Gorilla  cca
B D               Orangutan  cca
B D                  Gibbon  cct
B D                  Rhesus  cca
B D     Crab-eating macaque  cca
B D                  Baboon  cca
B D            Green monkey  cca
B D                Marmoset  cta
B D         Squirrel monkey  cta
B D                Bushbaby  cca
         Chinese tree shrew  c--
B D         Chinese hamster  ttg
             Golden hamster  cca
B D          Naked mole-rat  ttc
B D              Guinea pig  ttc
                 Chinchilla  ttc
B D                  Rabbit  ccc
B D                    Pika  cct
B D                  Alpaca  aca
             Bactrian camel  aca
B D                 Dolphin  gta
               Killer whale  gta
           Tibetan antelope  gca
B D                     Cow  ggg
B D                   Sheep  gcg
              Domestic goat  gcg
B D                   Horse  cca
B D        White rhinoceros  cca
B D                     Dog  gca
B D                 Ferret   gca
B D                   Panda  gca
             Pacific walrus  gca
           Black flying-fox  cca
B D                 Megabat  cca
              Big brown bat  cca
       David's myotis (bat)  cca
B D                Microbat  cca
B D                Hedgehog  ccc
B D                   Shrew  cca
B D                Elephant  cca
        Cape elephant shrew  cca
           Cape golden mole  cca
B D                  Tenrec  cca
                   Aardvark  cca
B D                   Mouse  ===
B D                     Rat  ===
    Lesser Egyptian jerboa  ===
              Prairie vole  ===
           Star-nosed mole  ===
B D                 Manatee  ===
B D               Armadillo  ===
B D                     Cat  ---
          Brush-tailed rat  ===
B D                Squirrel  ---
B D                     Pig  ===
              Weddell seal  NNN
B D           X. tropicalis  ===
  D          Painted turtle  ===
B D         Tasmanian devil  ===

Alignment block 42 of 377 in window, 23631506 - 23631512, 7 bps 
B D                   Human  tgtctct
B D                   Chimp  tgtctct
B D                 Gorilla  tgtctct
B D               Orangutan  tgtctct
B D                  Gibbon  tgtctct
B D                  Rhesus  tgtttct
B D     Crab-eating macaque  tgtttct
B D                  Baboon  tgtttct
B D            Green monkey  tgtctct
B D                Marmoset  catccct
B D         Squirrel monkey  tgtctct
B D                Bushbaby  tgtctct
         Chinese tree shrew  tgccttg
B D                Squirrel  tgtgtct
B D         Chinese hamster  tgcttct
             Golden hamster  ggcctgg
B D          Naked mole-rat  tgtctct
B D              Guinea pig  tgtctct
                 Chinchilla  tgtccct
B D                  Rabbit  ggcctct
B D                    Pika  --tctct
B D                  Alpaca  tgtctct
             Bactrian camel  tgtctct
B D                 Dolphin  cgtctct
               Killer whale  cgtctct
           Tibetan antelope  catcttt
B D                     Cow  catcttt
B D                   Sheep  catcttt
              Domestic goat  catcttt
B D                   Horse  catctct
B D        White rhinoceros  tgtctct
B D                     Cat  tagctct
B D                     Dog  tatttct
B D                 Ferret   tgtctct
B D                   Panda  tgtctct
             Pacific walrus  tgtctct
           Black flying-fox  tgtttct
B D                 Megabat  tgtttct
              Big brown bat  tgtctct
       David's myotis (bat)  tgtgtct
B D                Microbat  tgtctct
B D                Hedgehog  tctctct
B D                   Shrew  tgctggt
B D                Elephant  tgtctct
        Cape elephant shrew  tgactct
           Cape golden mole  tgtatct
B D                  Tenrec  tggctct
                   Aardvark  cgttttt
B D               Armadillo  tgcttcc
B D                   Mouse  =======
B D                     Rat  =======
    Lesser Egyptian jerboa  =======
              Prairie vole  =======
           Star-nosed mole  =======
B D                 Manatee  =======
          Brush-tailed rat  =======
B D                     Pig  =======
              Weddell seal  NNNNNNN
B D           X. tropicalis  =======
  D          Painted turtle  =======
B D         Tasmanian devil  =======

Inserts between block 42 and 43 in window
B D                 Rabbit 5bp
B D                   Pika 5bp
          Tibetan antelope 2bp

Alignment block 43 of 377 in window, 23631513 - 23631516, 4 bps 
B D                   Human  c-----------att
B D                   Chimp  c-----------att
B D                 Gorilla  c-----------att
B D               Orangutan  c-----------att
B D                  Gibbon  c-----------att
B D                  Rhesus  c-----------att
B D     Crab-eating macaque  c-----------att
B D                  Baboon  c-----------att
B D            Green monkey  c-----------att
B D                Marmoset  c-----------att
B D         Squirrel monkey  c-----------att
B D                Bushbaby  c-----------att
         Chinese tree shrew  c-----------att
B D                Squirrel  c--------------
B D         Chinese hamster  c--------------
             Golden hamster  c--------------
B D                  Rabbit  t--------------
B D                    Pika  c--------------
B D                  Alpaca  c--------------
             Bactrian camel  c--------------
B D                 Dolphin  c--------------
               Killer whale  c--------------
           Tibetan antelope  c--------------
B D                     Cow  c--------------
B D                   Sheep  c--------------
              Domestic goat  c--------------
B D                   Horse  caatctc--------
B D        White rhinoceros  cggtttc--------
B D                     Cat  c--------------
B D                     Dog  c--------------
B D                 Ferret   c--------------
B D                   Panda  c--------------
             Pacific walrus  c--------------
           Black flying-fox  c--------------
B D                 Megabat  c--------------
              Big brown bat  c--------------
       David's myotis (bat)  c--------------
B D                Microbat  c--------------
B D                Hedgehog  ctctctctcttc---
B D                   Shrew  cttcatcattgc---
B D                Elephant  -----------cagt
        Cape elephant shrew  -----------tgat
           Cape golden mole  -----------cagt
B D                  Tenrec  -----------ccgt
                   Aardvark  -----------tact
B D               Armadillo  -----------cact
B D                   Mouse  ===============
B D                     Rat  ===============
    Lesser Egyptian jerboa  ===============
              Prairie vole  ===============
           Star-nosed mole  ===============
B D                 Manatee  ===============
B D              Guinea pig  ---------------
          Brush-tailed rat  ===============
B D          Naked mole-rat  ---------------
                Chinchilla  ---------------
B D                     Pig  ===============
              Weddell seal  NNNNNNNNNNNNNNN
B D           X. tropicalis  ===============
  D          Painted turtle  ===============
B D         Tasmanian devil  ===============

Inserts between block 43 and 44 in window
B D               Squirrel 3bp
B D        Chinese hamster 26bp
            Golden hamster 3bp
B D                  Horse 2bp
B D       White rhinoceros 2bp

Alignment block 44 of 377 in window, 23631517 - 23631523, 7 bps 
B D                   Human  --ctttctc
B D                   Chimp  --ctttctc
B D                 Gorilla  --ctttctc
B D               Orangutan  --ctttctc
B D                  Gibbon  --ctttctc
B D                  Rhesus  --ctttctc
B D     Crab-eating macaque  --ctttctc
B D                  Baboon  --ctttctc
B D            Green monkey  --ctttctc
B D                Marmoset  --ctctctc
B D         Squirrel monkey  --ctctctc
B D                Bushbaby  --ctctctc
         Chinese tree shrew  --ctgtctc
B D                Squirrel  --cttactc
               Prairie vole  --ctctctc