Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 228 in window, 72301647 - 72301678, 32 bps 
B D                     Human  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                     Chimp  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                   Gorilla  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                 Orangutan  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                    Gibbon  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                    Rhesus  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D       Crab-eating macaque  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                    Baboon  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D              Green monkey  ctctttgta-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                  Marmoset  ctctttgca-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D           Squirrel monkey  ctctttgca-------ag--taa-c-------------ttta-----ttttt--atttaca-a
B D                  Bushbaby  ctctttgta-------ag--taatt-------------ttta-----ttttt--atttaca-a
           Chinese tree shrew  ctctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                  Squirrel  ctctttgca-------ag--taa-g-------------ttta-----ttttt--atttaca-t
       Lesser Egyptian jerboa  ctctttgca-------ag--taa-c-------------ttta-----ttttt--atttaca-a
                 Prairie vole  ctctttgca-------ag--taa-c-----------------------tttt--atttaca-a
B D           Chinese hamster  ctctttgca-------ag--taa-c-----------------------tttt--atttaca-a
               Golden hamster  ctctttgca-------ag--taa-c-----------------------tttt--atttaca-a
B D                     Mouse  ctctttgca-------ag-ttaa-c-----------------------tttt--atttaca-a
B D                       Rat  ctctttgca-------ag-ttaa-c-----------------------tttt--atttaca-a
B D            Naked mole-rat  ctctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                Guinea pig  ctctttgca-------ag--taa-c------------gttta-----ttttt--atttaca-a
                   Chinchilla  ctctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
             Brush-tailed rat  ctctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                    Rabbit  ctctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                      Pika  atctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                       Pig  ctctttgta-------ag--taa-c------------cttta-----ttttt--atttaca-a
B D                    Alpaca  ctctttgta-------at--taa-t------------tttta-----ttttt--atttaca-a
               Bactrian camel  ctctttgta-------at--taa-t------------tttta-----ttttt--atttaca-a
B D                   Dolphin  ctc-ttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
                 Killer whale  ctc-ttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
             Tibetan antelope  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                       Cow  ctctttgca-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                     Sheep  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
                Domestic goat  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                     Horse  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D          White rhinoceros  ctc--tgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                       Cat  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                       Dog  tactttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                   Ferret   ctctctgta-------ag--taa-c------------tttta----tttttt--atttaca-a
B D                     Panda  ctctttgta-------cg--taa-c------------tttta-----ttttt--atttaca-a
               Pacific walrus  ctctttgta-------ag--taa-c------------tttta---ttttttt--atttaca-a
                 Weddell seal  ctctttgta-------ag--taa-c------------tttta----tttttt--atttaca-a
             Black flying-fox  gtctctgta-------ag--tag-c------------tttta-----ttttt--atttaca-a
B D                   Megabat  gtctctgta-------ag--tag-c-----------ttttta-----ttttt--atttaca-a
                Big brown bat  ctctctgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
         David's myotis (bat)  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                  Microbat  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                  Hedgehog  ctctttgta-------ag--taa-c------------tttta-----tttgt--atttaca-a
B D                     Shrew  cactttgca-------gg--taa-c------------tttta-----ttttt--atttaca-t
              Star-nosed mole  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                  Elephant  ctctttgta-------a------------------------------ctttt--atttaca-a
B D                   Manatee  ctctttgta-------ag--taa-c------------tttta----tttttt--atttaca-a
             Cape golden mole  ctctttgta-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                    Tenrec  ctctttgca-------at--taa-c------------atttattaattttttaaatttaca-a
                     Aardvark  ctctttgtg-------ag--taa-t------------tttta-----ttttt--atttaca-a
B D                 Armadillo  ctctttata-------ag--taa-c------------tttta-----ttttt--atttaca-a
B D                  Platypus  ctcccccca-------gg--cat-caacggtcctccccaccc-----tcttt--cttcgga--
B D              Nile tilapia  cttgttgtc-------aa--tca-a------------ttcca------cttt--atccatg--
          Princess of Burundi  ctcgttgtc-------aa--tca-a------------ttcca------cttt--atccgtg--
        Burton's mouthbreeder  ctcgttgtc-------aa--tca-a------------ttcca------cttt--atccatg--
                  Zebra mbuna  ctcgttgtc-------aa--tca-a------------ttcca------cttt--atccatg--
          Pundamilia nyererei  ctcgttgtc-------aa--tca-a------------ttcca------cttt--atccatg--
           Southern platyfish  ctctttgtc-------ga--tca-a------------ttctg------ctgt--ctccga---
B D              Atlantic cod  tcttttgtcgacgcaaaa--tgt-a------------ctttt------cttt--ttttgaaa-
B D                 Zebrafish  ttcattgac-------aaactca-a------------ttgcc------attc--aa-------
B D                 Tetraodon  ===============================================================
B D                    Lizard  ===============================================================
B D               Stickleback  ===============================================================
B D                    Medaka  ===============================================================
  D           Green seaturtle  ===============================================================
  D  Chinese softshell turtle  ===============================================================
  D          Peregrine falcon  ===============================================================
B D                   Wallaby  ===============================================================
    Mexican tetra (cavefish)  ===============================================================
  D              Mallard duck  ===============================================================
B D                      Fugu  ===============================================================
                 Spotted gar  ===============================================================
  D    Spiny softshell turtle  ---------------------------------------------------------------
B D           Tasmanian devil  ===============================================================
B D                   Opossum  ===============================================================
  D              Saker falcon  ===============================================================
B D                    Turkey  ===============================================================
  D       Collared flycatcher  ===============================================================
B D       Medium ground finch  ===============================================================
  D    White-throated sparrow  ===============================================================
B D                   Chicken  ===============================================================
          Tibetan ground jay  ===============================================================
B D        American alligator  ===============================================================
B D               Zebra finch  ===============================================================
  D               Rock pigeon  ===============================================================

Inserts between block 1 and 2 in window
B D                 Platypus 4bp

Alignment block 2 of 228 in window, 72301679 - 72301679, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  t
                     Aardvark  c
B D                 Armadillo  c
B D           Tasmanian devil  c
B D                  Platypus  c
B D              Atlantic cod  c
          Southern platyfish  -
       Burton's mouthbreeder  -
B D              Nile tilapia  -
         Pundamilia nyererei  -
B D                 Tetraodon  =
B D                    Lizard  =
                 Zebra mbuna  -
B D               Stickleback  =
B D                 Zebrafish  -
B D                    Medaka  =
  D           Green seaturtle  =
         Princess of Burundi  -
  D  Chinese softshell turtle  =
  D          Peregrine falcon  =
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
  D              Mallard duck  =
B D                      Fugu  =
                 Spotted gar  =
  D    Spiny softshell turtle  -
B D                   Opossum  =
  D              Saker falcon  =
B D                    Turkey  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D               Zebra finch  =
  D               Rock pigeon  =

Alignment block 3 of 228 in window, 72301680 - 72301686, 7 bps 
B D                     Human  agaattg
B D                     Chimp  agaattg
B D                   Gorilla  agaattg
B D                 Orangutan  agaattg
B D                    Gibbon  agaattg
B D                    Rhesus  agaattg
B D       Crab-eating macaque  agaattg
B D                    Baboon  agaattg
B D              Green monkey  agaattg
B D                  Marmoset  agaattg
B D           Squirrel monkey  agaattg
B D                  Bushbaby  agaattg
           Chinese tree shrew  agaattg
B D                  Squirrel  acaattg
       Lesser Egyptian jerboa  agaatag
                 Prairie vole  tgaattg
B D           Chinese hamster  agaatcg
               Golden hamster  agaattg
B D                     Mouse  agaatcg
B D                       Rat  agaactg
B D            Naked mole-rat  agaattg
B D                Guinea pig  agaattg
                   Chinchilla  agaactg
             Brush-tailed rat  agaattg
B D                    Rabbit  agaattg
B D                      Pika  agaatcg
B D                       Pig  agaattg
B D                    Alpaca  agaattg
               Bactrian camel  agaattg
B D                   Dolphin  agaattg
                 Killer whale  agaattg
             Tibetan antelope  agaattg
B D                       Cow  agaattg
B D                     Sheep  agaattg
                Domestic goat  agaattg
B D                     Horse  agaattg
B D          White rhinoceros  agaattg
B D                       Cat  agaatcg
B D                       Dog  agaattg
B D                   Ferret   agaatcg
B D                     Panda  agaatcg
               Pacific walrus  agaatcg
                 Weddell seal  agagtcg
             Black flying-fox  agaatcg
B D                   Megabat  agaatcg
                Big brown bat  agaattg
         David's myotis (bat)  agaattg
B D                  Microbat  agaattg
B D                  Hedgehog  aaaactg
B D                     Shrew  agtatgg
              Star-nosed mole  agaat-t
B D                  Elephant  aggctta
B D                   Manatee  aagattg
             Cape golden mole  agaact-
B D                    Tenrec  acaattg
                     Aardvark  aggatt-
B D                 Armadillo  agaatca
B D           Tasmanian devil  acaatgg
B D                  Platypus  ata----
     Mexican tetra (cavefish)  aaaagtg
          Southern platyfish  -------
       Burton's mouthbreeder  -------
B D              Nile tilapia  -------
         Pundamilia nyererei  -------
B D                 Tetraodon  =======
B D              Atlantic cod  -------
B D                    Lizard  =======
                 Zebra mbuna  -------
B D               Stickleback  =======
B D                 Zebrafish  -------
B D                    Medaka  =======
  D           Green seaturtle  =======
         Princess of Burundi  -------
  D  Chinese softshell turtle  =======
  D          Peregrine falcon  =======
B D                   Wallaby  =======
  D              Mallard duck  =======
B D                      Fugu  =======
                 Spotted gar  =======
  D    Spiny softshell turtle  -------
B D                   Opossum  =======
  D              Saker falcon  =======
B D                    Turkey  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D               Rock pigeon  =======

Inserts between block 3 and 4 in window
B D          Tasmanian devil 2bp

Alignment block 4 of 228 in window, 72301687 - 72301693, 7 bps 
B D                     Human  gtggc-tt------------------
B D                     Chimp  gtggc-tt------------------
B D                   Gorilla  gtggc-tt------------------
B D                 Orangutan  gtggc-tt------------------
B D                    Gibbon  gtggc-tt------------------
B D                    Rhesus  gtggc-tt------------------
B D       Crab-eating macaque  gtggc-tt------------------
B D                    Baboon  gtggc-tt------------------
B D              Green monkey  gtggc-tt------------------
B D                  Marmoset  gtggc-tt------------------
B D           Squirrel monkey  gtggc-tt------------------
B D                  Bushbaby  gtggc-tt------------------
           Chinese tree shrew  gtggc-tt------------------
B D                  Squirrel  gtggc-tt------------------
       Lesser Egyptian jerboa  gtggc-tt------------------
                 Prairie vole  gtggc-tt------------------
B D           Chinese hamster  gtggc-tt------------------
               Golden hamster  gtggc-tt------------------
B D                     Mouse  gtggc-tt------------------
B D                       Rat  gtggc-tt------------------
B D            Naked mole-rat  gtggc-tt------------------
B D                Guinea pig  gtggc-tt------------------
                   Chinchilla  gtggc-tt------------------
             Brush-tailed rat  gtggc-tt------------------
B D                    Rabbit  gtggc-tt------------------
B D                      Pika  gtggc-tt------------------
B D                       Pig  gtggcttt------------------
B D                    Alpaca  gtggc-tt------------------
               Bactrian camel  gtggc-tt------------------
B D                   Dolphin  gtggc-tt------------------
                 Killer whale  gtggc-tt------------------
             Tibetan antelope  gtggc-tt------------------
B D                       Cow  gtggc-tt------------------
B D                     Sheep  gtggc-tt------------------
                Domestic goat  gtggc-tt------------------
B D                     Horse  gtggc-tt------------------
B D          White rhinoceros  gtggc-tt------------------
B D                       Cat  gtggc-tt------------------
B D                       Dog  gtggc-tt------------------
B D                   Ferret   gtggc-tt------------------
B D                     Panda  ggggc-tt------------------
               Pacific walrus  gtggc-tt------------------
                 Weddell seal  gtggc-tt------------------
             Black flying-fox  gtggc-tt------------------
B D                   Megabat  gtggc-tt------------------
                Big brown bat  gtggc-tt------------------
         David's myotis (bat)  gtggc-tt------------------
B D                  Microbat  gtggc-tt------------------
B D                  Hedgehog  gtggc-tt------------------
B D                     Shrew  gtggt-tt------------------
              Star-nosed mole  gtggc-tt------------------
B D                  Elephant  gtagt-tt------------------
B D                   Manatee  gtggc-tt------------------
             Cape golden mole  gtggc-tt------------------
B D                    Tenrec  gtggc-tt------------------
                     Aardvark  gtggc-tt------------------
B D                 Armadillo  gtggc-tt------------------
B D           Tasmanian devil  gcggc-tg------------------
B D                   Wallaby  gtggc-cc------------------
B D                  Platypus  gtggc-tt------------------
B D                 Tetraodon  -------------------cggagtt
B D              Nile tilapia  -------------------------t
          Princess of Burundi  -------------------------t
        Burton's mouthbreeder  -------------------------t
                  Zebra mbuna  -------------------------t
          Pundamilia nyererei  -------------------------t
           Southern platyfish  ------------atgtttgtgtgggt
B D              Atlantic cod  -----------agttagtgtgttcct
B D                 Zebrafish  -------tg-ga-------------c
     Mexican tetra (cavefish)  ------atgtgg-------------t
B D                    Lizard  ==========================
B D               Stickleback  ==========================
B D                    Medaka  ==========================
  D           Green seaturtle  ==========================
  D  Chinese softshell turtle  ==========================
  D          Peregrine falcon  ==========================
  D              Mallard duck  ==========================
B D                      Fugu  ==========================
                 Spotted gar  ==========================
  D    Spiny softshell turtle  --------------------------
B D                   Opossum  ==========================
  D              Saker falcon  ==========================
B D                    Turkey  ==========================
  D       Collared flycatcher  ==========================
B D       Medium ground finch  ==========================
  D    White-throated sparrow  ==========================
B D                   Chicken  ==========================
          Tibetan ground jay  ==========================
B D        American alligator  ==========================
B D               Zebra finch  ==========================
  D               Rock pigeon  ==========================

Alignment block 5 of 228 in window, 72301694 - 72301694, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
           Chinese tree shrew  -t
B D                  Squirrel  -t
       Lesser Egyptian jerboa  -t
                 Prairie vole  -t
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -t
                   Chinchilla  -t
             Brush-tailed rat  -t
B D                    Rabbit  -t
B D                      Pika  -t
B D                       Pig  -t
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                       Cow  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                     Horse  -t
B D          White rhinoceros  -t
B D                       Cat  -c
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
B D                  Hedgehog  -t
B D                     Shrew  -c
              Star-nosed mole  -t
B D                  Elephant  -t
B D                   Manatee  -t
             Cape golden mole  -t
B D                    Tenrec  -t
                     Aardvark  -t
B D                 Armadillo  -t
B D           Tasmanian devil  -g
B D                   Wallaby  -c
B D                  Platypus  -c
  D          Peregrine falcon  -t
B D                 Tetraodon  g-
B D              Nile tilapia  g-
          Princess of Burundi  g-
        Burton's mouthbreeder  g-
                  Zebra mbuna  g-
          Pundamilia nyererei  g-
           Southern platyfish  t-
B D              Atlantic cod  a-
B D                 Zebrafish  g-
     Mexican tetra (cavefish)  g-
B D                    Lizard  ==
B D               Stickleback  ==
B D                    Medaka  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
B D                      Fugu  ==
                 Spotted gar  ==
  D    Spiny softshell turtle  --
B D                   Opossum  ==
  D              Saker falcon  ==
B D                    Turkey  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D               Rock pigeon  ==

Inserts between block 5 and 6 in window
  D         Peregrine falcon 3bp

Alignment block 6 of 228 in window, 72301695 - 72301707, 13 bps 
B D                     Human  att--cctcca--tctt
B D                     Chimp  att--cctcca--tctt
B D                   Gorilla  att--cctcca--tctt
B D                 Orangutan  att--cctcca--tctt
B D                    Gibbon  att--cctcca--tctt
B D                    Rhesus  att--cctcca--tctt
B D       Crab-eating macaque  att--cctcca--tctt
B D                    Baboon  att--cctcca--tctt
B D              Green monkey  att--cctcca--tctt
B D                  Marmoset  att--cctcca--tctt
B D           Squirrel monkey  att--cctcca--tctt
B D                  Bushbaby  att--cctcca--tctt
           Chinese tree shrew  att--cctcca--tctt
B D                  Squirrel  att--cctcca--tcat
       Lesser Egyptian jerboa  gtt--cctcca--tctt
                 Prairie vole  gtt--cctcaa--tttt
B D           Chinese hamster  gtt--cctcga--tttt
               Golden hamster  gct--cctcga--tttt
B D                     Mouse  ttt--tcctcatttttt
B D                       Rat  ttt--tcctcatttttt
B D            Naked mole-rat  att--cctcca--tctt
B D                Guinea pig  att--ccttca--tctt
                   Chinchilla  act--cctcca--tctt
             Brush-tailed rat  att--cctcca--tctt
B D                    Rabbit  att--cctcca--tctt
B D                      Pika  att--cctcca--taat
B D                       Pig  att--cctcca--tctt
B D                    Alpaca  att--cctcca--tctt
               Bactrian camel  att--cctcca--tctt
B D                   Dolphin  att--cctcca--tctt
                 Killer whale  att--cctcca--tctt
             Tibetan antelope  att--cctcca--tctt
B D                       Cow  att--cctcca--tctt
B D                     Sheep  att--cctcca--tctt
                Domestic goat  att--cctcca--tctt
B D                     Horse  att--cctcca--tctt
B D          White rhinoceros  att--cctcca--tctt
B D                       Cat  gtt--cctcca--tctt
B D                       Dog  ctt--cctcca--tctt
B D                   Ferret   gtt--cctcca--tctt
B D                     Panda  gtt--cctccg--tctt
               Pacific walrus  gtt--cctcca--tctt
                 Weddell seal  gtt--cctcca--tctt
             Black flying-fox  att--cctcca--tctt
B D                   Megabat  att--cctcca--tctt
                Big brown bat  att--ccttca--tgtt
         David's myotis (bat)  att--ccttca--tgtt
B D                  Microbat  att--ccttca--tgtt
B D                  Hedgehog  att--cctcca--tctt
B D                     Shrew  att--cttcca--ccgt
              Star-nosed mole  att--cctcca--tctt
B D                  Elephant  att--cctcca--tctt
B D                   Manatee  att--cctcca--tc-t
             Cape golden mole  att--gctcca--tctt
B D                    Tenrec  att--cctcca--tctt
                     Aardvark  ttt--ccttca--tctt
B D                 Armadillo  att--cctcca--tctt
B D           Tasmanian devil  ccc--cctgcc--cccc
B D                   Wallaby  ccc--cct-cc--ccct
B D                  Platypus  -----catcca--tctc
  D          Peregrine falcon  ccc--cctccc--c---
  D              Mallard duck  acc--cctcaa--c---
B D                 Tetraodon  gtttatttctg--ccca
B D              Nile tilapia  cttccccccca--ccct
          Princess of Burundi  ctt--ccccca--ccct
        Burton's mouthbreeder  ctt--ccccca--ccct
                  Zebra mbuna  ctt--ccccca--ccct
          Pundamilia nyererei  ctt--ccccca--ccct
           Southern platyfish  ttt--tgtctt--tctt
B D              Atlantic cod  ttc--tctcta--tct-
B D                 Zebrafish  ctt--tggatt--tcta
     Mexican tetra (cavefish)  att--aagcct--tctt
B D                    Lizard  =================
B D               Stickleback  =================
B D                    Medaka  =================
  D           Green seaturtle  =================
  D  Chinese softshell turtle  =================
B D                      Fugu  =================
                 Spotted gar  =================
  D    Spiny softshell turtle  -----------------
B D                   Opossum  =================
  D              Saker falcon  =================
B D                    Turkey  =================
  D       Collared flycatcher  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
B D                   Chicken  =================
          Tibetan ground jay  =================
B D        American alligator  =================
B D               Zebra finch  =================
  D               Rock pigeon  =================

Inserts between block 6 and 7 in window
B D             Atlantic cod 7bp

Alignment block 7 of 228 in window, 72301708 - 72301708, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D           Tasmanian devil  g
B D                   Wallaby  g
B D                  Platypus  t
B D                 Tetraodon  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
           Southern platyfish  t
B D                 Zebrafish  a
     Mexican tetra (cavefish)  c
B D              Atlantic cod  =
B D                    Lizard  =
B D               Stickleback  =
B D                    Medaka  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D          Peregrine falcon  -
  D              Mallard duck  -
B D                      Fugu  =
                 Spotted gar  =
  D    Spiny softshell turtle  -
B D                   Opossum  =
  D              Saker falcon  =
B D                    Turkey  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
B D               Zebra finch  =
  D               Rock pigeon  =

Inserts between block 7 and 8 in window
B D                    Horse 1bp

Alignment block 8 of 228 in window, 72301709 - 72301714, 6 bps 
B D                     Human  aggg---------ac
B D                     Chimp  aggg---------ac
B D                   Gorilla  aggg---------ac
B D                 Orangutan  aggg---------ac
B D                    Gibbon  aggg---------ac
B D                    Rhesus  aggg---------ac
B D       Crab-eating macaque  aggg---------ac
B D                    Baboon  aggg---------ac
B D              Green monkey  aggg---------ac
B D                  Marmoset  aggg---------ac
B D           Squirrel monkey  aggg---------ac
B D                  Bushbaby  acag---------ac
           Chinese tree shrew  aggg---------gt
B D                  Squirrel  tgag---------at
       Lesser Egyptian jerboa  aggg---------ac
                 Prairie vole  aggg---------ac
B D           Chinese hamster  aggg---------ac
               Golden hamster  aggg---------ac
B D                     Mouse  aggg---------gc
B D                       Rat  aggg---------gc
B D            Naked mole-rat  aggg---------at
B D                Guinea pig  aggg---------at
                   Chinchilla  aggg---------at
             Brush-tailed rat  atgg---------gt
B D                    Rabbit  aggg---------gc
B D                      Pika  aggg--------agc
B D                       Pig  agga---------ac
B D                    Alpaca  agga---------ac
               Bactrian camel  agga---------ac
B D                   Dolphin  agga---------ac
                 Killer whale  agga---------ac
             Tibetan antelope  agga---------ac
B D                       Cow  agga---------ac
B D                     Sheep  agga---------aa
                Domestic goat  agga---------ac
B D                     Horse  aggg---------ac
B D          White rhinoceros  aggg---------ac
B D                       Cat  aggg---------ac
B D                       Dog  agtg---------gc
B D                   Ferret   aggg---------ac
B D                     Panda  aggg---------ac
               Pacific walrus  aggg---------ac
                 Weddell seal  aggg---------ac
             Black flying-fox  aggg---------ac
B D                   Megabat  aggg---------ac
                Big brown bat  aggg---------ac
         David's myotis (bat)  aggg---------ac
B D                  Microbat  aggg---------ac
B D                  Hedgehog  agga---------ac
B D                     Shrew  aggg---------gc
              Star-nosed mole  aggg---------gc
B D                  Elephant  agga---------at
B D                   Manatee  aggg---------at
             Cape golden mole  aggg---------at
B D                    Tenrec  aggg---------at
                     Aardvark  agag---------ac
B D                 Armadillo  tggg---------ac
B D           Tasmanian devil  ggat---------gc
B D                   Wallaby  gggt---------gc
B D                  Platypus  -ggg-----------
  D          Peregrine falcon  --aa---------gc
  D              Mallard duck  --ag---------ct
B D        American alligator  aggt---------ct
B D                 Tetraodon  tgggcgc--------
B D              Nile tilapia  atag-----------
          Princess of Burundi  atag-----------
        Burton's mouthbreeder  atag-----------
                  Zebra mbuna  atag-----------
          Pundamilia nyererei  atag-----------
           Southern platyfish  gtg------------
B D                 Zebrafish  tgaa---g-------
     Mexican tetra (cavefish)  tgag-----------
                  Spotted gar  -tgg----gggc---
B D              Atlantic cod  ===============
B D                    Lizard  ===============
B D               Stickleback  ===============
B D                    Medaka  ===============
  D           Green seaturtle  ===============
  D  Chinese softshell turtle  ===============
B D                      Fugu  ===============
  D    Spiny softshell turtle  ---------------
B D                   Opossum  ===============
  D              Saker falcon  ===============
B D                    Turkey  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
  D    White-throated sparrow  ===============
B D                   Chicken  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
  D               Rock pigeon  ===============

Inserts between block 8 and 9 in window
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
          Southern platyfish 4bp

Alignment block 9 of 228 in window, 72301715 - 72301715, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  c
B D           Tasmanian devil  c
B D                   Wallaby  a
  D          Peregrine falcon  g
  D              Mallard duck  g
B D        American alligator  g
B D                 Zebrafish  a
          Southern platyfish  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
B D                 Tetraodon  -
B D              Atlantic cod  =
B D                    Lizard  =
                 Zebra mbuna  =
B D               Stickleback  =
B D                    Medaka  =
  D           Green seaturtle  =
         Princess of Burundi  =
  D  Chinese softshell turtle  =
    Mexican tetra (cavefish)  -
B D                      Fugu  =
                 Spotted gar  -
  D    Spiny softshell turtle  -
B D                   Opossum  =
  D              Saker falcon  =
B D                    Turkey  =
  D       Collared flycatcher  =
B D                  Platypus  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D               Rock pigeon  =

Inserts between block 9 and 10 in window
  D         Peregrine falcon 4bp
  D             Mallard duck 6bp

Alignment block 10 of 228 in window, 72301716 - 72301717, 2 bps 
B D                     Human  ct-
B D                     Chimp  ct-
B D                   Gorilla  ct-
B D                 Orangutan  ct-
B D                    Gibbon  ct-
B D                    Rhesus  ct-
B D       Crab-eating macaque  ct-
B D                    Baboon  ct-
B D              Green monkey  ct-
B D                  Marmoset  tt-
B D           Squirrel monkey  tt-
B D                  Bushbaby  ct-
           Chinese tree shrew  ct-
B D                  Squirrel  at-
       Lesser Egyptian jerboa  tg-
                 Prairie vole  ca-
B D           Chinese hamster  ct-
               Golden hamster  ct-
B D                     Mouse  ct-
B D                       Rat  ct-
B D            Naked mole-rat  ct-
B D                Guinea pig  ct-
                   Chinchilla  ct-
             Brush-tailed rat  ct-
B D                    Rabbit  ct-
B D                      Pika  ct-
B D                       Pig  gt-
B D                    Alpaca  gt-
               Bactrian camel  gt-
B D                   Dolphin  gt-
                 Killer whale  gt-
             Tibetan antelope  at-
B D                       Cow  at-
B D                     Sheep  at-
                Domestic goat  at-
B D                     Horse  gt-
B D          White rhinoceros  gt-
B D                       Cat  gt-
B D                       Dog  gt-
B D                   Ferret   gt-
B D                     Panda  gg-
               Pacific walrus  gt-
                 Weddell seal  gt-
             Black flying-fox  gt-
B D                   Megabat  gt-
                Big brown bat  gt-
         David's myotis (bat)  gt-
B D                  Microbat  gt-
B D                  Hedgehog  ct-
B D                     Shrew  tt-
              Star-nosed mole  gt-
B D                  Elephant  at-
B D                   Manatee  ct-
             Cape golden mole  tt-
B D                    Tenrec  ca-
                     Aardvark  gg-
B D                 Armadillo  cg-
B D           Tasmanian devil  ca-
B D                   Wallaby  ca-
  D          Peregrine falcon  c--
           Tibetan ground jay  c--
  D              Mallard duck  c--
B D        American alligator  c--
B D                 Zebrafish  -tt
          Southern platyfish  ===
       Burton's mouthbreeder  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
B D                 Tetraodon  ---
B D              Atlantic cod  ===
B D                    Lizard  ===
                 Zebra mbuna  ===
B D               Stickleback  ===
B D                    Medaka  ===
  D           Green seaturtle  ===
         Princess of Burundi  ===
  D  Chinese softshell turtle  ===
    Mexican tetra (cavefish)  ---
B D                      Fugu  ===
                 Spotted gar  ---
  D    Spiny softshell turtle  ---
B D                   Opossum  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D       Collared flycatcher  ===
B D                  Platypus  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                   Chicken  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===

Alignment block 11 of 228 in window, 72301718 - 72301718, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D           Tasmanian devil  g
B D                   Wallaby  t
  D          Peregrine falcon  c
           Tibetan ground jay  c
  D              Mallard duck  t
B D        American alligator  t
  D           Green seaturtle  t
  D            Painted turtle  t
B D                 Zebrafish  t
          Southern platyfish  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
B D                 Tetraodon  -
B D              Atlantic cod  =
B D                    Lizard  =
                 Zebra mbuna  =
B D               Stickleback  =
B D                    Medaka  =
         Princess of Burundi  =
  D  Chinese softshell turtle  =
    Mexican tetra (cavefish)  -
B D                      Fugu  =
                 Spotted gar  -
  D    Spiny softshell turtle  -
B D                   Opossum  =
  D              Saker falcon  =
B D                    Turkey  =
  D       Collared flycatcher  =
B D                  Platypus  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                   Chicken  =
B D               Zebra finch  =
  D               Rock pigeon  =

Inserts between block 11 and 12 in window
  D             Mallard duck 1bp
B D       American alligator 1bp

Alignment block 12 of 228 in window, 72301719 - 72301719, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  g
B D           Tasmanian devil  g
B D                   Wallaby  g
  D               Rock pigeon  g
  D          Peregrine falcon  a
           Tibetan ground jay  a
  D              Mallard duck  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
B D                 Zebrafish  g
     Mexican tetra (cavefish)  a
                  Spotted gar  a
          Southern platyfish  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
B D                 Tetraodon  -
B D              Atlantic cod  =
B D                    Lizard  =
                 Zebra mbuna  =
B D               Stickleback  =
B D                    Medaka  =
         Princess of Burundi  =
  D  Chinese softshell turtle  =
B D                      Fugu  =
  D    Spiny softshell turtle  -
B D                   Opossum  =
  D              Saker falcon  =
B D                    Turkey  =
  D       Collared flycatcher  =
B D                  Platypus  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                   Chicken  =
B D               Zebra finch  =

Alignment block 13 of 228 in window, 72301720 - 72301721, 2 bps 
B D                     Human  --g---c
B D                     Chimp  --g---c
B D                   Gorilla  --g---c
B D                 Orangutan  --g---c
B D                    Gibbon  --g---c
B D                    Rhesus  --g---c
B D       Crab-eating macaque  --g---c
B D                    Baboon  --g---c
B D              Green monkey  --g---c
B D                  Marmoset  --g---g
B D           Squirrel monkey  --g---g
B D                  Bushbaby  --g---c
           Chinese tree shrew  --g---c
B D                  Squirrel  --a---c
       Lesser Egyptian jerboa  --a---c
                 Prairie vole  --g---a
B D           Chinese hamster  --g---c
               Golden hamster  --g---c
B D                     Mouse  --c---c
B D                       Rat  --g---c
B D            Naked mole-rat  --g---c
B D                Guinea pig  --g---c
                   Chinchilla  --g---c
             Brush-tailed rat  --g---c
B D                    Rabbit  --g---c
B D                      Pika  --g---c
B D                       Pig  --g---c
B D                    Alpaca  --g---c
               Bactrian camel  --g---c
B D                   Dolphin  --g---c
                 Killer whale  --g---c
             Tibetan antelope  --g---c
B D                       Cow  --g---c
B D                     Sheep  --g---c
                Domestic goat  --g---c
B D                     Horse  --g---c
B D          White rhinoceros  --g---c
B D                       Cat  --g---c
B D                       Dog  --g---c
B D                   Ferret   --gcatc
B D                     Panda  --g---c
               Pacific walrus  --g---c
                 Weddell seal  --g---c
             Black flying-fox  --g---c
B D                   Megabat  --g---c
                Big brown bat  --g---c
         David's myotis (bat)  --g---c
B D                  Microbat  --g---c
B D                  Hedgehog  --g---c
B D                     Shrew  --gc--c
              Star-nosed mole  --g---c
B D                  Elephant  --a---c
B D                   Manatee  --g---c
             Cape golden mole  --g---c
B D                    Tenrec  --a---c
                     Aardvark  --g---c
B D                 Armadillo  --g---c
B D           Tasmanian devil  --a---c
B D                   Wallaby  --g---c
B D                  Platypus  ------c
  D               Rock pigeon  --g---c
  D          Peregrine falcon  --g---c
  D       Collared flycatcher  --g---c
           Tibetan ground jay  --g---c
B D        American alligator  --g---c
  D           Green seaturtle  --g---c
  D            Painted turtle  --g---c
B D                 Tetraodon  gt-----
B D                      Fugu  at-----
B D                 Zebrafish  g------
     Mexican tetra (cavefish)  g------
                  Spotted gar  gc-----
          Southern platyfish  =======
       Burton's mouthbreeder  =======
B D              Nile tilapia  =======
         Pundamilia nyererei  =======
B D              Atlantic cod  =======
B D                    Lizard  =======
                 Zebra mbuna  =======
B D               Stickleback  =======
B D                    Medaka  =======
         Princess of Burundi  =======
  D  Chinese softshell turtle  =======
  D              Mallard duck  -------
  D    Spiny softshell turtle  -------
B D                   Opossum  =======
  D              Saker falcon  =======
B D                    Turkey  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
B D                   Chicken  =======
B D               Zebra finch  =======

Alignment block 14 of 228 in window, 72301722 - 72301722, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -a
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -a
B D           Chinese hamster  -a
               Golden hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                    Rabbit  -a
B D                      Pika  -a
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Hedgehog  -a
B D                     Shrew  -a
              Star-nosed mole  -a
B D                  Elephant  -a
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -a
                     Aardvark  -a
B D                 Armadillo  -a
B D           Tasmanian devil  -t
B D                   Wallaby  -c
B D                  Platypus  -a
  D               Rock pigeon  -c
  D          Peregrine falcon  -c
  D       Collared flycatcher  -c
           Tibetan ground jay  -c
B D        American alligator  -a
  D           Green seaturtle  -a
  D            Painted turtle  -a
B D                Coelacanth  -a
B D                 Tetraodon  t-
B D                      Fugu  t-
                  Spotted gar  t-
          Southern platyfish  ==
       Burton's mouthbreeder  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
B D              Atlantic cod  ==
B D                    Lizard  ==
                 Zebra mbuna  ==
B D               Stickleback  ==
B D                 Zebrafish  --
B D                    Medaka  ==
         Princess of Burundi  ==
  D  Chinese softshell turtle  ==
    Mexican tetra (cavefish)  --
  D              Mallard duck  --
  D    Spiny softshell turtle  --
B D                   Opossum  ==
  D              Saker falcon  ==
B D                    Turkey  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
B D               Zebra finch  ==

Inserts between block 14 and 15 in window
B D                Tetraodon 8bp
B D                     Fugu 5bp
                 Spotted gar 4bp

Alignment block 15 of 228 in window, 72301723 - 72301726, 4 bps 
B D                     Human  ttag
B D                     Chimp  ttag
B D                   Gorilla  ttag
B D                 Orangutan  ttag
B D                    Gibbon  ttag
B D                    Rhesus  tcag
B D       Crab-eating macaque  tcag
B D                    Baboon  tcag
B D              Green monkey  tcag
B D                  Marmoset  tcag
B D           Squirrel monkey  tcag
B D                  Bushbaby  tcag
           Chinese tree shrew  tcag
B D                  Squirrel  tcag
       Lesser Egyptian jerboa  tcag
                 Prairie vole  tcag
B D           Chinese hamster  tcag
               Golden hamster  tcag
B D                     Mouse  tcag
B D                       Rat  tcag
B D            Naked mole-rat  tcag
B D                Guinea pig  tcag
                   Chinchilla  tcag
             Brush-tailed rat  tcag
B D                    Rabbit  tcag
B D                      Pika  tcag
B D                       Pig  tcag
B D                    Alpaca  tcag
               Bactrian camel  tcag
B D                   Dolphin  tcag
                 Killer whale  tcag
             Tibetan antelope  tcag
B D                       Cow  tcag
B D                     Sheep  tcag
                Domestic goat  tcag
B D                     Horse  tcag
B D          White rhinoceros  tcag
B D                       Cat  tcag
B D                       Dog  tcag
B D                   Ferret   tcag
B D                     Panda  tcag
               Pacific walrus  tcag
                 Weddell seal  tcag
             Black flying-fox  tcag
B D                   Megabat  tcag
                Big brown bat  tcag
         David's myotis (bat)  tcag
B D                  Microbat  tcag
B D                  Hedgehog  tcag
B D                     Shrew  ttag
              Star-nosed mole  tcag
B D                  Elephant  tcaa
B D                   Manatee  tcag
             Cape golden mole  tcag
B D                    Tenrec  tcaa
                     Aardvark  tcag
B D                 Armadillo  tcag
B D           Tasmanian devil  t---
B D                   Wallaby  t---
B D                  Platypus  tcag
  D               Rock pigeon  tcag
  D          Peregrine falcon  tcag
  D       Collared flycatcher  tcag
           Tibetan ground jay  tcag
  D              Mallard duck  ---g
B D        American alligator  tcag
  D           Green seaturtle  tcag
  D            Painted turtle  tcag
B D                Coelacanth  tcag
B D                 Tetraodon  tcag
B D                      Fugu  tcag
B D              Nile tilapia  tcag
          Princess of Burundi  tcag
        Burton's mouthbreeder  tcag
                  Zebra mbuna  tcag
          Pundamilia nyererei  tcag
B D                    Medaka  tcag
           Southern platyfish  tcag
B D              Atlantic cod  tcag
B D                 Zebrafish  tcag
     Mexican tetra (cavefish)  tcaa
                  Spotted gar  -cgt
B D                    Lizard  ====
B D               Stickleback  ====
  D  Chinese softshell turtle  ====
  D    Spiny softshell turtle  ----
B D                   Opossum  ====
  D              Saker falcon  ====
B D                    Turkey  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
B D                   Chicken  ====
B D               Zebra finch  ====

Alignment block 16 of 228 in window, 72301727 - 72301735, 9 bps 
B D                     Human  cagctagat
B D                     Chimp  cagctagat
B D                   Gorilla  cagctagat
B D                 Orangutan  cagctagat
B D                    Gibbon  cagctagat
B D                    Rhesus  cagctagat
B D       Crab-eating macaque  cagctagat
B D                    Baboon  cagctagat
B D              Green monkey  cagctagat
B D                  Marmoset  cagctagat
B D           Squirrel monkey  cagctagat
B D                  Bushbaby  cagccagat
           Chinese tree shrew  caaccagat
B D                  Squirrel  cagccggag
       Lesser Egyptian jerboa  cagccagag
                 Prairie vole  cagccagag
B D           Chinese hamster  cagccagag
               Golden hamster  cagccagag
B D                     Mouse  cagccagag
B D                       Rat  cagccagag
B D            Naked mole-rat  cagccagag
B D                Guinea pig  cagctagag
                   Chinchilla  cagccagac
             Brush-tailed rat  cagccagac
B D                    Rabbit  caaccagac
B D                      Pika  caaccagtc
B D                       Pig  cagccagac
B D                    Alpaca  cagccagat
               Bactrian camel  cagccagat
B D                   Dolphin  cagccagat
                 Killer whale  cagccagat
             Tibetan antelope  ctgccagat
B D                       Cow  ctgccagat
B D                     Sheep  ctgccagat
                Domestic goat  ctgccagat
B D                     Horse  cagccagat
B D          White rhinoceros  cagccagat
B D                       Cat  cagccagat
B D                       Dog  cagccagat
B D                   Ferret   cagccagat
B D                     Panda  cagccagat
               Pacific walrus  cagccagat
                 Weddell seal  cagccagat
             Black flying-fox  cagccagac
B D                   Megabat  cagccagac
                Big brown bat  cagccagac
         David's myotis (bat)  cagccagac
B D                  Microbat  cagccagac
B D                  Hedgehog  cagccagag
B D                     Shrew  cagcaggtt
              Star-nosed mole  cagccagat
B D                  Elephant  cagccagtt
B D                   Manatee  cagccagat
             Cape golden mole  caagtagat
B D                    Tenrec  cagtcagat
                     Aardvark  cagctagat
B D                 Armadillo  cagccattt
B D                   Opossum  cagctggag
B D           Tasmanian devil  tagctgggg
B D                   Wallaby  cagctagag
B D                  Platypus  cagccggag
  D               Rock pigeon  cagccggcc
  D          Peregrine falcon  cagccgg--
  D       Collared flycatcher  cagcgggcc
           Tibetan ground jay  gagccggcc
  D              Mallard duck  ctgctgttt
B D        American alligator  cagctggaa
  D           Green seaturtle  cgactggaa
  D            Painted turtle  cggctggaa
B D                Coelacanth  catccagat
B D                 Tetraodon  cacccggcg
B D                      Fugu  catccggcc
B D              Nile tilapia  catccagct
          Princess of Burundi  catccagct
        Burton's mouthbreeder  catccagct
                  Zebra mbuna  catccagct
          Pundamilia nyererei  catccagct
B D                    Medaka  catccagcc
           Southern platyfish  catccggcc
B D              Atlantic cod  cagccggct
B D                 Zebrafish  cagccagca
     Mexican tetra (cavefish)  cacccagca
                  Spotted gar  cagctagcc
B D                    Lizard  =========
B D               Stickleback  =========
  D  Chinese softshell turtle  =========
  D    Spiny softshell turtle  ---------
  D              Saker falcon  =========
B D                    Turkey  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
B D                   Chicken  =========
B D               Zebra finch  =========

Alignment block 17 of 228 in window, 72301736 - 72301737, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  gg
B D                  Squirrel  gg
       Lesser Egyptian jerboa  gg
                 Prairie vole  gg
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                    Rabbit  gg
B D                      Pika  gg
B D                       Pig  gg
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  gg
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                  Hedgehog  gg
B D                     Shrew  gg
              Star-nosed mole  gg
B D                  Elephant  gc
B D                   Manatee  gg
             Cape golden mole  gg
B D                    Tenrec  ga
                     Aardvark  gg
B D                 Armadillo  gg
B D                   Opossum  gg
B D           Tasmanian devil  gg
B D                   Wallaby  gg
B D                  Platypus  gg
  D               Rock pigeon  gg
  D       Collared flycatcher  gg
           Tibetan ground jay  gg
  D              Mallard duck  gc
B D        American alligator  gg
  D           Green seaturtle  gg
  D            Painted turtle  gg
B D                Coelacanth  ga
B D                 Tetraodon  gg
B D                      Fugu  gg
B D              Nile tilapia  gg
          Princess of Burundi  gg
        Burton's mouthbreeder  gg
                  Zebra mbuna  gg
          Pundamilia nyererei  gg
B D                    Medaka  gg
           Southern platyfish  gg
B D               Stickleback  gg
B D              Atlantic cod  gg
B D                 Zebrafish  gg
     Mexican tetra (cavefish)  gg
                  Spotted gar  ga
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D          Peregrine falcon  --
  D    Spiny softshell turtle  --
  D              Saker falcon  ==
B D                    Turkey  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
B D               Zebra finch  ==

Inserts between block 17 and 18 in window
  D             Mallard duck 4bp

Alignment block 18 of 228 in window, 72301738 - 72301738, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -a
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -g
B D           Chinese hamster  -a
               Golden hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                    Rabbit  -a
B D                      Pika  -a
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Hedgehog  -a
B D                     Shrew  -g
              Star-nosed mole  -a
B D                  Elephant  -a
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -a
                     Aardvark  -a
B D                 Armadillo  -a
B D                   Opossum  -c
B D           Tasmanian devil  -c
B D                   Wallaby  -c
B D                  Platypus  -a
  D               Rock pigeon  -c
  D              Saker falcon  -a
  D       Collared flycatcher  -c
  D    White-throated sparrow  -a
B D       Medium ground finch  -a
B D               Zebra finch  -a
           Tibetan ground jay  -c
  D              Mallard duck  -a
B D                   Chicken  -a
B D                    Turkey  -a
B D        American alligator  -a
  D           Green seaturtle  -g
  D            Painted turtle  -g
  D  Chinese softshell turtle  -a
B D                    Lizard  -a
B D                Coelacanth  -a
B D                 Tetraodon  c-
B D                      Fugu  c-
       Yellowbelly pufferfish  a-
B D              Nile tilapia  c-
          Princess of Burundi  c-
        Burton's mouthbreeder  c-
                  Zebra mbuna  c-
          Pundamilia nyererei  c-
B D                    Medaka  c-
           Southern platyfish  g-
B D               Stickleback  c-
B D              Atlantic cod  c-
B D                 Zebrafish  c-
     Mexican tetra (cavefish)  t-
                  Spotted gar  g-
  D          Peregrine falcon  --
  D    Spiny softshell turtle  --

Alignment block 19 of 228 in window, 72301739 - 72301741, 3 bps 
B D                     Human  aag
B D                     Chimp  aag
B D                   Gorilla  aag
B D                 Orangutan  aag
B D                    Gibbon  aag
B D                    Rhesus  aag
B D       Crab-eating macaque  aag
B D                    Baboon  aag
B D              Green monkey  agg
B D                  Marmoset  aag
B D           Squirrel monkey  aag
B D                  Bushbaby  aag
           Chinese tree shrew  aag
B D                  Squirrel  aag
       Lesser Egyptian jerboa  aaa
                 Prairie vole  aaa
B D           Chinese hamster  aaa
               Golden hamster  aaa
B D                     Mouse  aaa
B D                       Rat  aaa
B D            Naked mole-rat  aag
B D                Guinea pig  aag
                   Chinchilla  aag
             Brush-tailed rat  aag
B D                    Rabbit  aag
B D                      Pika  aag
B D                       Pig  aag
B D                    Alpaca  aag
               Bactrian camel  aag
B D                   Dolphin  aag
                 Killer whale  aag
             Tibetan antelope  aag
B D                       Cow  aag
B D                     Sheep  aag
                Domestic goat  aag
B D                     Horse  aag
B D          White rhinoceros  aag
B D                       Cat  aag
B D                       Dog  aag
B D                   Ferret   aag
B D                     Panda  aag
               Pacific walrus  aag
                 Weddell seal  aag
             Black flying-fox  aag
B D                   Megabat  aag
                Big brown bat  aag
         David's myotis (bat)  aag
B D                  Microbat  aag
B D                  Hedgehog  aag
B D                     Shrew  aaa
              Star-nosed mole  aag
B D                  Elephant  aag
B D                   Manatee  aag
             Cape golden mole  aag
B D                    Tenrec  aat
                     Aardvark  aag
B D                 Armadillo  aag
B D                   Opossum  aca
B D           Tasmanian devil  agg
B D                   Wallaby  aca
B D                  Platypus  aag
  D               Rock pigeon  aag
  D              Saker falcon  aag
  D       Collared flycatcher  agc
  D    White-throated sparrow  aag
B D       Medium ground finch  aag
B D               Zebra finch  aag
           Tibetan ground jay  agg
B D                Budgerigar  aag
  D                    Parrot  aag
  D             Scarlet macaw  aag
  D              Mallard duck  aag
B D                   Chicken  aag
B D                    Turkey  aag
B D        American alligator  aaa
  D           Green seaturtle  aaa
  D            Painted turtle  aaa
  D  Chinese softshell turtle  aag
  D    Spiny softshell turtle  aag
B D                    Lizard  aag
B D                Coelacanth  -ag
B D                 Tetraodon  acg
B D                      Fugu  acg
       Yellowbelly pufferfish  aag
B D              Nile tilapia  acg
          Princess of Burundi  acg
        Burton's mouthbreeder  acg
                  Zebra mbuna  aca
          Pundamilia nyererei  acg
B D                    Medaka  aca
           Southern platyfish  acg
B D               Stickleback  acg
B D              Atlantic cod  acg
B D                 Zebrafish  acg
     Mexican tetra (cavefish)  acg
                  Spotted gar  acg
  D          Peregrine falcon  ---

Inserts between block 19 and 20 in window
B D               Coelacanth 1bp

Alignment block 20 of 228 in window, 72301742 - 72301879, 138 bps 
B D                     Human  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                     Chimp  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                   Gorilla  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                 Orangutan  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                    Gibbon  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                    Rhesus  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D       Crab-eating macaque  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                    Baboon  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D              Green monkey  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                  Marmoset  tccgaagtgaagtcaaactcattctgccccagcca----------------------------------c
B D           Squirrel monkey  tccgaagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                  Bushbaby  tctgcagtgaagtcaaactcattctgccccagcca----------------------------------c
           Chinese tree shrew  tccgcagtgaagtcaaactcattctgccccagccacagctccggaagctcattcatctccccccagcccc
B D                  Squirrel  tccgcagtgaagtcaaactcgttctgccccagcca----------------------------------c
       Lesser Egyptian jerboa  tctgcagtgaagtcaaactcattctgccccagcca----------------------------------c
                 Prairie vole  tctgcagtgaaatcaaactcattctgccccagcca----------------------------------c
B D           Chinese hamster  tctgcagtgaaatcaaactcattctgccccagcca----------------------------------c
               Golden hamster  tctgcagtgaaatcgaactcattctgccccagcca----------------------------------c
B D                     Mouse  tctgcagtgaaatcaaactcattctgccccagcca----------------------------------c
B D                       Rat  tctgcagtgaaatcaaactcattctgccctagcca----------------------------------c
B D            Naked mole-rat  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                Guinea pig  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
                   Chinchilla  tccgcactgaagtcaaactcgttctgccccagcca----------------------------------c
             Brush-tailed rat  tccgcggtgaagtcaaactcgttctgccccagcca----------------------------------c
B D                    Rabbit  tctgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                      Pika  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                       Pig  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
B D                    Alpaca  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
               Bactrian camel  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
B D                   Dolphin  tctgcagtgaagtcaaactcattctgtcccagcca----------------------------------c
                 Killer whale  tctgcagtgaagtcaaactcattctgtcccagcca----------------------------------c
             Tibetan antelope  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
B D                       Cow  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
B D                     Sheep  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
                Domestic goat  tctgccgtgaagtcaaactcattctgccccagcca----------------------------------c
B D                     Horse  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D          White rhinoceros  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                       Cat  tccgccgtgaagtcaaactcattctgccccagcca----------------------------------c
B D                       Dog  tccgcagtgaagtcaaactcattctgtcccagcca----------------------------------c
B D                   Ferret   tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                     Panda  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
               Pacific walrus  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
                 Weddell seal  tccgcagtgaagtcaaactcattctgccccagcca----------------------------------c
             Black flying-fox  tctgcggtgaagtcaaactcattctgccctagcca----------------------------------c
B D                   Megabat  tctgcggtgaagtcaaactcattctgccctagcca----------------------------------c
                Big brown bat  tctgcagtgaagtcaaattcattctgccccagcca----------------------------------c
         David's myotis (bat)  tctgcagtgaagtcaaattcattctgccccagcca----------------------------------c
B D                  Microbat  tctgcagtgaagtcaaattcattctgccccagcca----------------------------------c
B D                  Hedgehog  tctgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                     Shrew  tccgaggtgaaatcaaactcattctggcccagcca----------------------------------c
              Star-nosed mole  tctgcagtgaagtcaaactcattctgccccagcca----------------------------------c
B D                  Elephant  tccgcagtaaagtcaaattcattctgccccagcca----------------------------------c
B D                   Manatee  tccgcagtgaagtcaaattcattctgccccagcca----------------------------------c
             Cape golden mole  tctgcagtgaagtcaaattcattctgccccaacca----------------------------------c
B D                    Tenrec  tctgctgtgaagtcaaattcattctgccccagcca----------------------------------c
                     Aardvark  tctgcagtgaagtcaaattcattctgccccagcca----------------------------------c
B D                 Armadillo  tctgcagtgaagtcaaattcattctgccccagcca----------------------------------c
B D                   Opossum  tcagtagtgaaatcaaactcatcctggcccaacca----------------------------------g
B D           Tasmanian devil  tcggtggacaagtcaaggtcatcttggtccagcca----------------------------------g
B D                   Wallaby  tctgtagtgaaatcaaactcatcctggcccagcca----------------------------------g
B D                  Platypus  tctgcggcgaagtcaaactcgttctgcccgagcca----------------------------------c
  D               Rock pigeon  cccgcggggaagtcgaactcgtggtggccgagcca----------------------------------g
  D              Saker falcon  tctgaaatgaagtcgaactcgttctgtcccaagaa----------------------------------t
  D          Peregrine falcon  cgtgcggggaagatgaactcgtgatgggcgagcca----------------------------------g
  D       Collared flycatcher  tccgacggggagtcgagctcgtggtgaccgagcca----------------------------------g
  D    White-throated sparrow  tctgaaatgaagtcgaactcgttctgtcccaagaa----------------------------------t
B D       Medium ground finch  tctgaaatgaagtcgaactcgttctgtcccaagaa----------------------------------t
B D               Zebra finch  tctgaaatgaagtcgaactcgttctgtcccaagaa----------------------------------t
           Tibetan ground jay  tccgacgaggaatcgagctcgtggtgaccgagcca----------------------------------g
B D                Budgerigar  tctgtcatgaagtcaaactcgttctgtcccaacca----------------------------------c
  D                    Parrot  tctgtcatgaagtcaaactcgttctgtcccaacca----------------------------------c
  D             Scarlet macaw  tctgtcatgaagtcaaactcgttctgtcccaacca----------------------------------c
  D              Mallard duck  tctgaaatgaagtcgaactcgttttgtcccaagaa----------------------------------c
B D                   Chicken  tctgaaatgaagtcgaactcgttctgtcccaagaa----------------------------------c
B D                    Turkey  tctgaaatgaagtcgaactcgttctgtcccaagaa----------------------------------c
B D        American alligator  tctgcagtgaagtcaaactcattctggccaagcca----------------------------------c
  D           Green seaturtle  tctgcagcaaagtcaaactcgttctggcccagcca----------------------------------c
  D            Painted turtle  tctgcagcaaagtcaaactcgttctggcccagcca----------------------------------c
  D  Chinese softshell turtle  tctgaaatgaagtcaaattcattctgtcccaagaa----------------------------------g
  D    Spiny softshell turtle  tctgtcatgaaatcaaactcgttctgtcccaacca----------------------------------c
B D                    Lizard  tctgtcatgaaatcaaactcattctgtcccaacca----------------------------------g
B D             X. tropicalis  tctggagtaaagtcaaactcattctgccccagcca----------------------------------c
B D                Coelacanth  tcagagatgaaatcaaactcattctgtcctaacca----------------------------------c
B D                 Tetraodon  tcggacatgaagtcaaactcgttctggcccagcca----------------------------------g
B D                      Fugu  tctgacatgaagtcaaattcgttctggcccagcca----------------------------------g
       Yellowbelly pufferfish  tctgagataaagtcaaactcattctgtcccagaaa----------------------------------g
B D              Nile tilapia  tccgacatgaaatcgaactcgttctgtcccagcca----------------------------------g
          Princess of Burundi  tccgacataaagtcgaactcgttctgtcccagcca----------------------------------g
        Burton's mouthbreeder  tccgacatgaagtcgaactcgttctgtcccagcca----------------------------------g
                  Zebra mbuna  tccgacatgaagtcgaactcgttctgtcccagcca----------------------------------g
          Pundamilia nyererei  tccgacatgaagtcgaactcgttctgtcccagcca----------------------------------g
B D                    Medaka  tcgcacatgaaatcaaactcgttctgtcccagcca----------------------------------g
           Southern platyfish  tctgacatgaagtcaaactcgttctgtcccagcca----------------------------------g
B D               Stickleback  ttggccatgaagacaaactcgttctgggccccgca----------------------------------c
B D              Atlantic cod  tcggccatgaagtcgaactcgttctggcccagcca----------------------------------c
B D                 Zebrafish  tccgcaatgaagtcaaactcattctgacccaacca----------------------------------c
     Mexican tetra (cavefish)  tctgaaatgaagtcaaattcgttctggcccagcca----------------------------------c
                  Spotted gar  tcggagatgaagtcaaactcgttctgacccagcca----------------------------------g

                        Human  agctc-cg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacttcctcatc
                        Chimp  agctc-cg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacttcctcatc
                      Gorilla  agctc-cg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacttcctcatc
                    Orangutan  agctc-cg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacttcctcatc
                       Gibbon  agctc-tg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacttcctcatc
                       Rhesus  agctc-tg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacctcctcatc
          Crab-eating macaque  agctc-tg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacctcctcatc
                       Baboon  agctc-tg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacctcctcatc
                 Green monkey  agctc-tg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacctcctcatc
                     Marmoset  agctc-cg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacctcctcatc
              Squirrel monkey  agctc-cg-gaagctcattggctcggtccaaccccagttccaccaccagcgacatcagcacctcctcatc
                     Bushbaby  agctc-cg-gaagctcattggctctgtccagtcccaattccaccaccagcgacatcagcacctcttcatc
           Chinese tree shrew  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                     Squirrel  agctc-ag-gaagctcattggcccggtccagtcccagttccaccaccagtgacatcagcacctcctcatc
       Lesser Egyptian jerboa  agctc-tg-gcagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                 Prairie vole  agctc-gg-gaagctcattggctcggtctagccccagctctactaccagagacatcagcacttcctcatc
              Chinese hamster  agctc-ag-gaagctcattggctcggtctaggcccagttccaccaccagagacatcagcacctcctcatc
               Golden hamster  agctc-ag-ggagctcattggctcggtctagccccagttctaccaccagagacatcagcacctcctcatc
                        Mouse  agctc-gg-gaagctcattggctcggtctagccccaattcaaccaccagagacatcagcacctcctcatc
                          Rat  agctc-gg-gaagctcattggctcggtctagccccaattctaccaccagagacatcagcacctcctcatc
               Naked mole-rat  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacttcctcatc
                   Guinea pig  agctc-tg-gaagctctttagcccggtccagtcccagttccaccaccagcgacatcagcacttcctcatc
                   Chinchilla  agctc-tg-gaagctcattggctcggtccagtcccagttccaccaccagtgacatcagcacttcctcatc
             Brush-tailed rat  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacttcctcatc
                       Rabbit  agctc-cg-gaagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                         Pika  agctc-tg-gaagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                          Pig  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                       Alpaca  agctc-cg-gcagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
               Bactrian camel  agctc-cg-gcagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                      Dolphin  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagtgacatcagcacctcctcatc
                 Killer whale  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagtgacatcagcacctcctcatc
             Tibetan antelope  agctc-cg-gaagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcttcatc
                          Cow  agctc-cg-gaagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcttcatc
                        Sheep  agctc-cg-gaagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcttcatc
                Domestic goat  agctc-cg-gaagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcttcatc
                        Horse  agctc-cg-gaagctcattggctcggtccagtcccagctctaccaccagcgacatcagcacctcctcatc
             White rhinoceros  agctc-cg-gaagctcattcgctcggtccagtcccagttctaccaccagcgacatcagcacctcttcatc
                          Cat  agctc-tg-gcagctcattggcccggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                          Dog  agctc-cg-gaagctcattggctcggtccagtcccagttccactaccagggacatcagcacctcttcatc
                      Ferret   agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                        Panda  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
               Pacific walrus  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
                 Weddell seal  agctc-cg-gaagctcattggctcggtccagtcccagttccaccaccagcgacatcagcacctcctcatc
             Black flying-fox  agctc-cg-gaagctcgttggcccggtccagtcccagctccaccaccagcgacatcagcacctcctcatc
                      Megabat  agctc-cg-gaagctcgttggcccggtccagtcccagctccaccaccagcgacatcagcacctcctcatc
                Big brown bat  agctc-tg-gaagctcattagcccggtccagtcccagttccaccaccagtgacatcagcacctcctcatc
         David's myotis (bat)  agctc-tg-gaagctcattagcccggtccagtcccagttccaccaccaatgacatcagcacctcctcatc
                     Microbat  agctc-tg-gaagctcattagcccggtccagtcccagttccaccaccagtgacatcagcacctcctcatc
                     Hedgehog  agctc-tg-gaagctcattggctcggtccagtcctagttccaccaccagcgacatcagcacttcctcatc
                        Shrew  agctc-ag-gaagctcattggcttggtcgagacccaattccaccaccagcgacattagcacctcctcatc
              Star-nosed mole  agctc-cg-gaagctcgttggctcggtccagtcccagttccaccaccagtgacatcagcacttcttcatc
                     Elephant  agctc-tg-gaaggtcactagcttggtccagtcccagttctaccaccagcgacatcagcacctcttcgtc
                      Manatee  agctc-tg-gaagttcattggctcggtccagtcccagttctaccaccagtgacatcagcacctcttcatc
             Cape golden mole  agctc-tg-gaagttcattggctcggtccagtcccagttccaccaccagtgacattagcacctcttcatc
                       Tenrec  agctc-tg-gaagctcattgatctggtccaggcccagctccaccaccagcgacattagcacctcctcatc
                     Aardvark  agctc-tg-gaagttcattggcttggtctagtcccagttccaccaccagtgacatcagcacttcttcatc
                    Armadillo  agctc-cg-gaagctcattggcttggtctagtcccagttccaccaccagcgacatcagcacctcctcatc
                      Opossum  agctcggg-gcagctccccagcttggtccagtcccaactcca-caccagggacataaggacctcctcatc
              Tasmanian devil  agctc-gg-gtagctcaccagcttggtccaagcccagctccatcaccagggacatgagcaactcctcgtc
                      Wallaby  agctc-ag-gcagctcgccatcttggtccaaacccagctccaccaccaaggacatgagcacctcctcatc
                     Platypus  agctc-gg-gtagctcattggcccggtccagtcccagctccaccaccagggacatcagcacctcctcgtc
                  Rock pigeon  agctc-cg-gcagctcgtccgccctgtccagcccaagctccagcaccagcgccctcagcaccttctcgtc
                 Saker falcon  agctc-tg-gcagctcctgaatccggtccaaccccagttccaggacaagggacgtcaagacctcctcatc
             Peregrine falcon  ggctc-tg-gtagctcgtccgctctgtagaggccaagctccagcaccaatgccctgagcacctcctcgtc
          Collared flycatcher  agctc-cg-gcagctcgtcggtcctgttgaggcagagctccaccaccag---cgccccgagcaccttgtc
       White-throated sparrow  aactc-tg-gcagctcctgaatccggtccaagcccagttccaggacaagggatgtcaagacctcctcgtc
          Medium ground finch  aactc-tg-gcagctcctgaatccggtccaaccccagttccaggacaagggatgtcaagacctcctcatc
                  Zebra finch  aactc-tg-gcagctcctgaatccgatccaaccccaattccaggacaagggatgtcaagacctcctcatc
           Tibetan ground jay  agctc-cg-gcagctcgtccgccctgttgaggccaagctccaccaccagcg----catgagcaccttgtc
                   Budgerigar  agctc-gg-gaagctccttgatgcgatccagccccatttcgatgactaaggacatgaggacctcctcgtc
                       Parrot  agctc-gg-gaagctccttgatgcgatccagccccatttcgatgactaaggacatgaggacctcctcgtc
                Scarlet macaw  agctc-gg-gaagctccttgatgcgatccagccccatttcgatgactaaggacatgaggacctcctcgtc
                 Mallard duck  agctc-tg-gcagctcctgaatccggtccaaccccagttccaggacaagggacgtcaaaacctcctcatc
                      Chicken  agctc-tg-gcagctcctgaatccggtccaaccccagttccaggacaagggatgtcaaaacctcctcatc
                       Turkey  agctc-tg-gcagctcctgaatccggtccaaccccagttccaggacaagggacgtcaaaacctcctcgtc
           American alligator  agctc-tg-ggagttcatcagctcggtccagacccagttccacgaccagcgacatcagtacttcctcatc
              Green seaturtle  agctc-tg-ggagctcattagctctatccaggcccagttccaccaccagtgacatcagcacctcctcatc
               Painted turtle  agctc-tg-ggagctcattagctctatccaggcccagttccaccaccagtgacatcagcacctcctcgtc
     Chinese softshell turtle  agctc-gg-gcagctcctgaatccggtccaagcccagttcctggaccagagaggtcaagacctcctcatc
       Spiny softshell turtle  agctc-ag-gaagctccttgatgcggtccaaacccatttctatgactaaggacatgagcacctcctcatc
                       Lizard  agctc-ag-gcagctccttgatacgatccaagcccatttccaccactaaggacataaggacttcctcgtc
                X. tropicalis  agctc-tg-ggagctcatttgccctgtccagacccagctccaaaaccagggacatgagcacttcttcatc
                   Coelacanth  agttc-tg-ggagttcatccaccctatccaaacccagctccatgactaaagacatcaagacatcttcatc
                    Tetraodon  agctc-gg-ggagctcgttggcccggtccaaacccagctccaccaccagcgacatcagcacctcctcgtc
                         Fugu  agctc-gg-gcagctcgttggcccgatccaaacccagttccaccaccaacgacatgagaacctcctcatc
       Yellowbelly pufferfish  agttc-tg-gcagctcttggacccggtctaagccgagctccatgaccaaagaggtcaagacgtcctc---
                 Nile tilapia  agctc-gg-gaagctcgttggcccggtccaaacctagctccaccaccagagacatgaggacctcctcgtc
          Princess of Burundi  agctc-gg-gcagctcgttggcccggtccaaacctagctccaccaccagagacatgaggacctcctcgtc
        Burton's mouthbreeder  agctc-gg-gcagctcgttggcccggtccaaacctagctccaccaccagagacatgaggacctcctcgtc
                  Zebra mbuna  agctc-gg-gcagctcgttggcccggtccaaacctagctccaccaccagagacatgaggacctcttcgtc
          Pundamilia nyererei  agctc-gg-gcagctcgttggcccggtccaaacctagctccaccaccagagacatgaggacctcctcgtc
                       Medaka  agttc-ag-ggagctcgttggctcggtccagacccagttccaccaccagggacatgaggacctcctcgtc
           Southern platyfish  agctc-cg-gcagctcgttggctctgtccaaacccagctcaaccaccagagacatgagaacttcctcgtc
                  Stickleback  agctc-ggagcagctcgttggtccggtccaggcccagcttccccaccagcgacatggtgacctccttctc
                 Atlantic cod  agctc-gg-ggagctcgttggcccggtccagacccaactccaccaccagcgacatcagcacctcctcgtc
                    Zebrafish  agctc-tg-gaagctcattggcacgatccaaacccagctccaccaccagtgacatcaaaacctcctcatc
     Mexican tetra (cavefish)  agctc-tg-gaagctcgttagctctgtccaaacccaactccaccaccagagacatgagaacctcctcgtc
                  Spotted gar  agctc-tg-gcagctcgttggcccggtccagacccaactccacgaccagggacatcaggacctcctcgtc

                        Human  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                        Chimp  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                      Gorilla  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                    Orangutan  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                       Gibbon  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                       Rhesus  cactgggtccgaatcgatgatagcagg--g------ttctgg-
          Crab-eating macaque  cactgggtccgaatcgatgatagcagg--g------ttctgg-
                       Baboon  caccgggtccgaatcgatgatagcagg--g------ttctgg-
                 Green monkey  cactgggtctgaatcgatgatagcagg--g------ttctgg-
                     Marmoset  cactgggtccgaatcgatgatagcagg--g------ctctgg-
              Squirrel monkey  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                     Bushbaby  cactgggtccgaatcgatgatagcagg--a------ctctgg-
           Chinese tree shrew  caccgggtccgaatcgatgatagcagg--g------ctctgg-
                     Squirrel  cactgggtcagaatcaatgatagtagg--g------ctctgg-
       Lesser Egyptian jerboa  cactgggtcagaatcaatgatagcagg--g------ctctgg-
                 Prairie vole  cactgggtcagaatcaatgatagcagg--g------ctctgg-
              Chinese hamster  cactgggtcagaatcaatgatagcagg--g------ctctga-
               Golden hamster  cactgggtcagaatcaatgatagctgg--g------ctctgg-
                        Mouse  caccgggtcagaatcaatgagagcagg--g------ctctgg-
                          Rat  cactgggtcagaatcaatgatagcagg--g------ctctgg-
               Naked mole-rat  cactggatctgaatcgattatagcagg--g------ctctgg-
                   Guinea pig  cactgggtctgaatcgattatagcagg--g------ctctgg-
                   Chinchilla  cactgggtcagaatcgattatagcagg--g------ctctgg-
             Brush-tailed rat  cactgggtcagaatcgattatagcagg--g------ctctgg-
                       Rabbit  cactgggtcagaatcaatgatagcagg--g------ctctgg-
                         Pika  caccgggtcagaatcaatgatagcggg--a------ttctgg-
                          Pig  caccgggtccgagtcgatgatggcagg--g------ctctgg-
                       Alpaca  caccgggtccgaatcgatgatggcagg--g------ctctgg-
               Bactrian camel  caccgggtccgaatcgatgatggcagg--g------ctctgg-
                      Dolphin  caccgggtctgaatcgatgatggcaga--g------ctctgg-
                 Killer whale  caccgggtctgaatcgatgatggcaga--g------ctctgg-
             Tibetan antelope  caccgggtctgaatcgatgatggcagg--g------ctctgg-
                          Cow  caccgggtctgaatcgatgatggcagg--g------ctctgg-
                        Sheep  caccgggtctgaatcgatgatggcagg--g------ctctgg-
                Domestic goat  caccgggtctgaatcgatgatggcagg--g------ctctgg-
                        Horse  caccgggtctgaatcgatgatagcagg--g------ctctgg-
             White rhinoceros  cactgggtccgaatcaatgatagcagg--g------ctctgg-
                          Cat  cactgggtccgagtcgatgatagcagg--g------ctctgg-
                          Dog  cactgggtcggagtcaatgatagcagg--g------ctctgg-
                      Ferret   cacggggtccgagtcgatgatagcagg--g------ctctgg-
                        Panda  cactgggtccgagtcgatgatagcggg--g------ctctgg-
               Pacific walrus  cactgggtccgagtcaatgatagcagg--g------ctctgg-
                 Weddell seal  cactgggtctgagtcgatgatagcagg--g------ctctgg-
             Black flying-fox  caccgggtccgaatcgatgatagcagg--g------ctctgg-
                      Megabat  caccgggtccgaatcgatgatagcagg--g------ctctgg-
                Big brown bat  cactgggtccgaatcgatgatagcagg--a------ctctgg-
         David's myotis (bat)  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                     Microbat  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                     Hedgehog  cactgggtctgaatcgattaaggcagg--g------ctctgg-
                        Shrew  tactgggtctgaatcaatga---cagg--a------ttctgg-
              Star-nosed mole  cactgggtccgaatcgatgatggcagg--g------ctctgg-
                     Elephant  cacggggtctgaatcgatgatagccgg--g------ctctgg-
                      Manatee  cactgggtctgaatcgatgatagccgg--g------ctctgg-
             Cape golden mole  cactgggtccgaatcaatgatagcagg--g------ctttgg-
                       Tenrec  caccgggtctgaatcgatgatagcagg--g------ctttgg-
                     Aardvark  cactgggtccgaatcgatgatagcagg--g------ctctgg-
                    Armadillo  cactggatccgaatcaatgatagcagg--g------ctctgg-
                      Opossum  tatggggtcagaatcaatgagattggg--g------ttatag-
              Tasmanian devil  tatggggtcaaaatcgaagaggttg-----------ttgaag-
                      Wallaby  cacggggtcagaatcaaggaggttggc--a------tcaggg-
                     Platypus  caccgggtcggagtctatgatgccggg--a------ccgggg-
                  Rock pigeon  caccgagtccgagtcgatgatgccgggacc------attggc-
                 Saker falcon  tatgagatcagtgtccataacgttcaa--g------gtcagt-
             Peregrine falcon  caccgggtccgagttgatgatg-ccgg--g------gccggc-
          Collared flycatcher  caccggctccgagcccggcggcctgga---------ggcagc-
       White-throated sparrow  tataagatcagtgtccataacattcaa--t------gtcagc-
          Medium ground finch  tataagatcagtgtccataacattcaa--t------gtcagc-
                  Zebra finch  tataagatcagtgtccataacattcaa--t------gtcagc-
           Tibetan ground jay  cccagggtcggtg-------aggccgg--g------gtcaga-
                   Budgerigar  gatgaagtcagtgtctatgacattggg--c------ggcagc-
                       Parrot  gatgaagtcagtgtctatgacattggg--c------ggcagc-
                Scarlet macaw  gatgaagtcagtgtctatgacattggg--c------ggcagc-
                 Mallard duck  tatgagatcagtgtccataacattcaa--g------gtcagc-
                      Chicken  tatgagatcagtgtccataacgttcaa--g------gtcaga-
                       Turkey  tatgagatcagtgtccataacgttcaa--g------gtcaga-
           American alligator  cacgggatccgaatcaataatgcctgggtt------gtgggt-
              Green seaturtle  caccggatcggaatcaataatgccagg--g----ctgtgggt-
               Painted turtle  cactggatcagaatcaataatgccagg--g----ctgtgggc-
     Chinese softshell turtle  gacgaggtcagtgtccataacattcaa--g------gtcagc-
       Spiny softshell turtle  tatgaagtcagtgtctatgacattgga--a------ggcagc-
                       Lizard  tatgaagtcagtgtctatgacattggg--c------ggcagc-
                X. tropicalis  cacacgatccagctcaa-----gcagg--t------tactgg-
                   Coelacanth  aacgggatcagagtcaattat----------------------
                    Tetraodon  cacggggtcaaagtcgatgatcccgcc--t------gcgcccg
                         Fugu  cacgggttcaaagtcaataatcccacc--t------gcccctg
       Yellowbelly pufferfish  ------------gtcaatcatgtcagc--g------tccattc
                 Nile tilapia  cacagggtcaaagtcgataatcccacc--a------gcgccgg
          Princess of Burundi  cacagggtcaaagtcgataatcccacc--a------gcgctgg
        Burton's mouthbreeder  cacagggtcaaagtcgataatcccacc--a------gcgctgg
                  Zebra mbuna  cacagggtcaaagtcgataatcccacc--a------gcgctgg
          Pundamilia nyererei  cacagggtcaaagtcgataatcccacc--a------gcgctgg
                       Medaka  caccaagtcaaagtcaatcatgcttcc--t------gctccag
           Southern platyfish  cacggggtcaaagtcgataatcccggc--c------gctccgg
                  Stickleback  accgga--ctaagtcgatga-gccgcc--gggccgcgctctgg
                 Atlantic cod  taccgcctcaaagtcgatccccccgcc--a------ccgccgg
                    Zebrafish  cactgggtccgaatcgatgatgccgga--t------gcttgc-
     Mexican tetra (cavefish)  aactggatctgaatctatgatgcctgg--a------ccttga-
                  Spotted gar  gacagggtccaagtcaatgatgccggg--a------cccagg-

Inserts between block 20 and 21 in window
  D              Rock pigeon 1855bp
  D             Mallard duck 2bp
B D                  Chicken 2bp
B D                   Turkey 2bp
B D                   Lizard 21bp
B D                Tetraodon 38bp
B D                     Fugu 38bp
      Yellowbelly pufferfish 18bp
B D             Nile tilapia 60bp
         Princess of Burundi 60bp
       Burton's mouthbreeder 81bp
                 Zebra mbuna 81bp
         Pundamilia nyererei 81bp
B D                   Medaka 14bp
          Southern platyfish 14bp
B D              Stickleback 21bp
B D             Atlantic cod 13bp
B D                Zebrafish 3bp
    Mexican tetra (cavefish) 3bp
                 Spotted gar 2bp

Alignment block 21 of 228 in window, 72301880 - 72301881, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                  Bushbaby  gc
           Chinese tree shrew  gc
B D                  Squirrel  ga
       Lesser Egyptian jerboa  gc
                 Prairie vole  ga
B D           Chinese hamster  gc
               Golden hamster  gc
B D                     Mouse  gc
B D                       Rat  gc
B D            Naked mole-rat  gc
B D                Guinea pig  gc
                   Chinchilla  gc
             Brush-tailed rat  gc
B D                    Rabbit  gc
B D                      Pika  gc
B D                       Pig  gc
B D                    Alpaca  gc
               Bactrian camel  gc
B D                   Dolphin  gc
                 Killer whale  gc
             Tibetan antelope  gc
B D                       Cow  gc
B D                     Sheep  gc
                Domestic goat  gc
B D                     Horse  gc
B D          White rhinoceros  gc
B D                       Cat  gc
B D                       Dog  gc
B D                   Ferret   gc
B D                     Panda  gc
               Pacific walrus  gc
                 Weddell seal  gc
             Black flying-fox  gc
B D                   Megabat  gc
                Big brown bat  gc
         David's myotis (bat)  gc
B D                  Microbat  gc
B D                  Hedgehog  gc
B D                     Shrew  gc
              Star-nosed mole  gc
B D                  Elephant  cc
B D                   Manatee  gc
             Cape golden mole  gc
B D                    Tenrec  gc
                     Aardvark  gc
B D                 Armadillo  gc
B D                   Opossum  a-
B D           Tasmanian devil  gc
B D                   Wallaby  tc
B D                  Platypus  gt
B D             X. tropicalis  c-
B D                 Tetraodon  gc
B D                      Fugu  gc
       Yellowbelly pufferfish  gc
B D              Nile tilapia  gc
          Princess of Burundi  gc
B D                    Medaka  at
           Southern platyfish  at
B D               Stickleback  gc
B D              Atlantic cod  gc
B D                 Zebrafish  gc
     Mexican tetra (cavefish)  at
                  Spotted gar  gc
       Burton's mouthbreeder  ==
         Pundamilia nyererei  ==
  D             Scarlet macaw  --
B D                    Lizard  ==
                 Zebra mbuna  ==
  D                    Parrot  --
  D           Green seaturtle  --
  D  Chinese softshell turtle  --
B D                Budgerigar  --
  D          Peregrine falcon  --
  D              Mallard duck  ==
  D            Painted turtle  --
  D    Spiny softshell turtle  --
B D                Coelacanth  --
  D              Saker falcon  --
B D                    Turkey  ==
  D       Collared flycatcher  --
B D       Medium ground finch  --
  D    White-throated sparrow  --
B D                   Chicken  ==
          Tibetan ground jay  --
B D        American alligator  --
B D               Zebra finch  --
  D               Rock pigeon  ==

Alignment block 22 of 228 in window, 72301882 - 72301894, 13 bps 
B D                     Human  ac---ca----------------------gcagaagga
B D                     Chimp  ac---ca----------------------gcagaagga
B D                   Gorilla  ac---ca----------------------gcagaagga
B D                 Orangutan  ac---ca----------------------gcagaagga
B D                    Gibbon  ac---ca----------------------gcagaagga
B D                    Rhesus  ac---ca----------------------gcagaagga
B D       Crab-eating macaque  ac---ca----------------------gcagaagga
B D                    Baboon  ac---ca----------------------gcagaagga
B D              Green monkey  ac---ca----------------------gcagaagga
B D                  Marmoset  ac---ca----------------------gcagaagga
B D           Squirrel monkey  ac---ca----------------------gcagaagga
B D                  Bushbaby  ac---ca----------------------gcagaaaga
           Chinese tree shrew  ac---tg----------------------gcaggggga
B D                  Squirrel  ac---ca----------------------gcagaagga
       Lesser Egyptian jerboa  ac---cc----------------------gaagaagga
                 Prairie vole  ac---ca----------------------gaagcagga
B D           Chinese hamster  ac---ct----------------------gcaggagga
               Golden hamster  ac---cg----------------------gcaggagga
B D                     Mouse  ac---ca----------------------gcaggagga
B D                       Rat  ac---ca----------------------gc---agga
B D            Naked mole-rat  ac---ca----------------------gtaggagaa
B D                Guinea pig  ac---ca----------------------gtaggagaa
                   Chinchilla  ac---ca----------------------gcaggagag
             Brush-tailed rat  ac---ca----------------------gcaggagaa
B D                    Rabbit  actggca----------------------gcagcagga
B D                      Pika  cccagcg----------------------gcaggaggg
B D                       Pig  ac---ca----------------------gtagaggga
B D                    Alpaca  ac---cg----------------------gcagaggga
               Bactrian camel  ac---cg----------------------gcagaggga
B D                   Dolphin  ac---ca----------------------gcagaagga
                 Killer whale  ac---ca----------------------gcagaagga
             Tibetan antelope  ac---cg----------------------gcagaagga
B D                       Cow  ac---cg----------------------gcagaagga
B D                     Sheep  ac---cg----------------------gcagaagga
                Domestic goat  ac---cg----------------------gcagaagga
B D                     Horse  ac---cg----------------------gtagaagga
B D          White rhinoceros  ac---cg----------------------gtagaagga
B D                       Cat  ac---ca----------------------gtagaagga
B D                       Dog  ac---ca----------------------gtagaagga
B D                   Ferret   ac---cg----------------------gtagaagga
B D                     Panda  ac---cg----------------------gtagaagga
               Pacific walrus  ac---cg----------------------gtagaagga
                 Weddell seal  ac---cg----------------------gtagaagga
             Black flying-fox  ac---cg----------------------gcaggggga
B D                   Megabat  ac---cg----------------------gcaggggga
                Big brown bat  ac---ca----------------------gcaggagga
         David's myotis (bat)  ac---ca----------------------gcaggagga
B D                  Microbat  ac---ca----------------------gcaggagga
B D                  Hedgehog  ac---ca----------------------gcaggagga
B D                     Shrew  at---ca----------------------ttaggagga
              Star-nosed mole  ac---ca----------------------gcaggagga
B D                  Elephant  ac---ca----------------------gtaggagat
B D                   Manatee  ac---ca----------------------gtagaaggt
             Cape golden mole  ac---ca----------------------gtagaagga
B D                    Tenrec  aa---ca----------------------gcagaagga
                     Aardvark  ac---ca----------------------gtagaaaga
B D                 Armadillo  ac---ca----------------------gcaggag--
B D                   Opossum  ct---cg----------------------tcagaggca
B D           Tasmanian devil  ct---cg----------------------atagaggcc
B D                   Wallaby  ct---cg----------------------atggaggca
B D                  Platypus  cc---cg----------------------ggggtgggg
  D               Rock pigeon  ----------------------------------ggca
  D              Saker falcon  gc---cg----------------------gtgagg---
  D          Peregrine falcon  gg---tg----------------------gcgggggga
  D       Collared flycatcher  gg---ct----------------------ctggggggg
  D    White-throated sparrow  gc---cg----------------------gtgagggca
B D       Medium ground finch  gc---cg----------------------gtgagggca
B D               Zebra finch  gc---tg----------------------gtgagggca
           Tibetan ground jay  gg---cc----------------------tggaggggg
B D                Budgerigar  at---tg----------------------ctgcgggaa
  D                    Parrot  at---tg----------------------ctgcgggga
  D             Scarlet macaw  at---tg----------------------ctgcgggga
  D              Mallard duck  -----tg----------------------gtgagg---
B D                   Chicken  -----cg----------------------gtgagg---
B D                    Turkey  -----cg----------------------gtgagg---
B D        American alligator  gc---ca----------------------gcaggagga
  D           Green seaturtle  gc---ca----------------------gcaggggga
  D            Painted turtle  gc---ca----------------------gcaggggga
  D  Chinese softshell turtle  gc---gg----------------------gcgagggca
  D    Spiny softshell turtle  at---tg----------------------ctgcaggga
B D                    Lizard  ac---cg----------------------aggtggg--
B D             X. tropicalis  gc---ca----------------------ctgaggg--
B D                Coelacanth  tc---ca----------------------gcaggtggt
B D                 Tetraodon  tc---cg-------------------------------
B D                      Fugu  tc---cg-------------------------------
       Yellowbelly pufferfish  cc---ag-------------------------------
B D              Nile tilapia  gc---ca-------------------------------
          Princess of Burundi  gc---ca-------------------------------
B D                    Medaka  gc---ct-------------------------------
           Southern platyfish  gc---cg-------------------------------
B D               Stickleback  cc---cg-------------------------------
B D              Atlantic cod  cc---gg-------------------------------
B D                 Zebrafish  cc---ca-------------------------------
     Mexican tetra (cavefish)  ac---cg-------------------------------
                  Spotted gar  cc---ccagaggttgccagatggcctggg---------
       Burton's mouthbreeder  ======================================
         Pundamilia nyererei  ======================================
                 Zebra mbuna  ======================================

Inserts between block 22 and 23 in window
  D              Rock pigeon 5bp
  D         Peregrine falcon 1884bp
  D      Collared flycatcher 12bp
  D   White-throated sparrow 12bp
B D      Medium ground finch 12bp
B D              Zebra finch 12bp
          Tibetan ground jay 2bp
B D               Budgerigar 12bp
  D                   Parrot 12bp
  D            Scarlet macaw 12bp
B D               Coelacanth 2bp
B D                Tetraodon 37bp
B D                     Fugu 37bp
      Yellowbelly pufferfish 31bp
B D             Nile tilapia 15bp
         Princess of Burundi 15bp
B D                   Medaka 28bp
          Southern platyfish 64bp
B D              Stickleback 19bp
B D             Atlantic cod 47bp
B D                Zebrafish 19bp
    Mexican tetra (cavefish) 19bp

Alignment block 23 of 228 in window, 72301895 - 72301901, 7 bps 
B D                     Human  gagagtg
B D                     Chimp  gagagtg
B D                   Gorilla  gagagtg
B D                 Orangutan  gagagtg
B D                    Gibbon  gagagtg
B D                    Rhesus  gagagtg
B D       Crab-eating macaque  gagagtg
B D                    Baboon  gagagtg
B D              Green monkey  gacagtg
B D                  Marmoset  gagagtg
B D           Squirrel monkey  gagagtg
B D                  Bushbaby  gagagtg
           Chinese tree shrew  gagaggg
B D                  Squirrel  gaaactg
       Lesser Egyptian jerboa  gacagtg
                 Prairie vole  gtggctg
B D           Chinese hamster  gaggctg
               Golden hamster  gaggccg
B D                     Mouse  gagacag
B D                       Rat  gagactg
B D            Naked mole-rat  agggt--
B D                Guinea pig  acggt--
                   Chinchilla  agggt--
             Brush-tailed rat  agggt--
B D                    Rabbit  gagagtg
B D                      Pika  ggaagtg
B D                       Pig  gagagtg
B D                    Alpaca  gagagtg
               Bactrian camel  gagagtg
B D                   Dolphin  gagagtg
                 Killer whale  gagagtg
             Tibetan antelope  gagagtg
B D                       Cow  gagagtg
B D                     Sheep  gagccca
                Domestic goat  gagagtg
B D                     Horse  gagagtg
B D          White rhinoceros  gagagtg
B D                       Cat  gagagtg
B D                       Dog  gagagtg
B D                   Ferret   gagagtg
B D                     Panda  gagagtg
               Pacific walrus  gagagtg
                 Weddell seal  gagagtg
             Black flying-fox  gagaccg
B D                   Megabat  gagcctg
                Big brown bat  gagagtg
         David's myotis (bat)  gagagtg
B D                  Microbat  gagagtg
B D                  Hedgehog  gagactg
B D                     Shrew  g---gtg
              Star-nosed mole  gagagtg
B D                  Elephant  tc---tg
B D                   Manatee  gagagtg
             Cape golden mole  gagagtg
B D                    Tenrec  gagagtg
                     Aardvark  gagagtg
B D                 Armadillo  -agaaag
B D                   Opossum  gtctcag
B D           Tasmanian devil  gtctctg
B D                   Wallaby  gtctctg
B D                  Platypus  ggcagcg
  D              Saker falcon  gcatgtg
  D          Peregrine falcon  ----gtg
  D       Collared flycatcher  ggggg--
  D    White-throated sparrow  ccgggtg
B D       Medium ground finch  ccgggtg
B D               Zebra finch  ccgggtg
B D                Budgerigar  caggcgg
  D                    Parrot  caggagg
  D             Scarlet macaw  caggcgg
  D              Mallard duck  gcatgtg
B D                   Chicken  gcatgtg
B D                    Turkey  gcatgtg
B D        American alligator  gccagtg
  D           Green seaturtle  gccaatg
  D            Painted turtle  gccagtg
  D  Chinese softshell turtle  cgtgctg
  D    Spiny softshell turtle  catgagg
B D                    Lizard  cacagcg
B D                Coelacanth  tagag--
          Southern platyfish  =======
       Burton's mouthbreeder  =======
B D              Nile tilapia  =======
         Pundamilia nyererei  =======
B D                 Tetraodon  =======
B D              Atlantic cod  =======
                 Zebra mbuna  =======
B D               Stickleback  =======
B D                 Zebrafish  =======
B D                    Medaka  =======
         Princess of Burundi  =======
    Mexican tetra (cavefish)  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
                 Spotted gar  -------
          Tibetan ground jay  =======
B D             X. tropicalis  -------
  D               Rock pigeon  =======

Inserts between block 23 and 24 in window
  D      Collared flycatcher 214bp
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D              Zebra finch 3bp
B D               Budgerigar 12bp
  D                   Parrot 12bp
  D            Scarlet macaw 12bp
B D       American alligator 6bp
  D          Green seaturtle 15bp
  D           Painted turtle 15bp
  D   Spiny softshell turtle 30bp
B D               Coelacanth 8bp

Alignment block 24 of 228 in window, 72301902 - 72301907, 6 bps 
B D                     Human  a---------ttctg
B D                     Chimp  a---------ttctg
B D                   Gorilla  a---------ttctg
B D                 Orangutan  a---------ttctg
B D                    Gibbon  a---------ttctg
B D                    Rhesus  a---------ttccg
B D       Crab-eating macaque  a---------ttccg
B D                    Baboon  a---------ttccg
B D              Green monkey  a---------ttccg
B D                  Marmoset  a---------tcccg
B D           Squirrel monkey  a---------tcccg
B D                  Bushbaby  a---------ccccg
           Chinese tree shrew  g---------gcccg
B D                  Squirrel  a---------tcctg
       Lesser Egyptian jerboa  a---------ccccg
                 Prairie vole  attctcccccttccg
B D           Chinese hamster  atcctgcccctccag
               Golden hamster  atcccgcccctcccg
B D                     Mouse  atcccggagaccctc
B D                       Rat  atccgggtgatcccc
B D            Naked mole-rat  ----------cccca
B D                Guinea pig  ----------cccca
                   Chinchilla  ----------ccccg
             Brush-tailed rat  ----------cccca
B D                    Rabbit  a---------ctccg
B D                      Pika  a---------ctccg
B D                       Pig  a---------ccccg
B D                    Alpaca  a---------ccccg
               Bactrian camel  a---------ccccg
B D                   Dolphin  a---------ccccg
                 Killer whale  a---------ccccg
             Tibetan antelope  a---------tcccg
B D                       Cow  a---------tcccg
B D                     Sheep  c---------ccccc
                Domestic goat  a---------tcccg
B D                     Horse  a---------ccccg
B D          White rhinoceros  a---------ccccg
B D                       Cat  a---------ccccg
B D                       Dog  a---------ccccg
B D                   Ferret   a---------tcccg
B D                     Panda  a---------ccccg
               Pacific walrus  a---------ccccg
                 Weddell seal  a---------ccccg
             Black flying-fox  a---------ccccg
B D                   Megabat  a---------ccccg
                Big brown bat  a---------ccccg
         David's myotis (bat)  a---------ccccg
B D                  Microbat  a---------ccccg
B D                  Hedgehog  a---------ccccg
B D                     Shrew  a---------ctgtg
              Star-nosed mole  a---------tcccg
B D                  Elephant  a---------ccctt
B D                   Manatee  a---------ccctg
             Cape golden mole  a---------ccctg
B D                    Tenrec  a---------ctccg
                     Aardvark  a---------ccctg
B D                 Armadillo  a---------ccccg
B D                   Opossum  a---------ctcct
B D           Tasmanian devil  a---------ctcca
B D                   Wallaby  a---------ctcct
B D                  Platypus  g---------gcctg
  D              Saker falcon  ----------ctgca
  D          Peregrine falcon  ----------gggga
  D              Mallard duck  ----------ctgca
B D                   Chicken  ----------ctgca
B D                    Turkey  ----------ctgca
B D                    Lizard  ------------cca
B D             X. tropicalis  --------------t
B D                Coelacanth  a---------ctgtg
          Southern platyfish  ===============
       Burton's mouthbreeder  ===============
B D              Nile tilapia  ===============
         Pundamilia nyererei  ===============
B D                 Tetraodon  ===============
  D             Scarlet macaw  ===============
B D              Atlantic cod  ===============
                 Zebra mbuna  ===============
B D               Stickleback  ===============
  D                    Parrot  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
  D           Green seaturtle  ===============
         Princess of Burundi  ===============
  D  Chinese softshell turtle  ===============
B D                Budgerigar  ===============
    Mexican tetra (cavefish)  ===============
  D            Painted turtle  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
                 Spotted gar  ---------------
  D    Spiny softshell turtle  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
  D    White-throated sparrow  ===============
          Tibetan ground jay  ===============
B D        American alligator  ===============
B D               Zebra finch  ===============
  D               Rock pigeon  ===============

Alignment block 25 of 228 in window, 72301908 - 72301915, 8 bps 
B D                     Human  cccctccc--------
B D                     Chimp  cccctccc--------
B D                   Gorilla  cccctccc--------
B D                 Orangutan  cccctccc--------
B D                    Gibbon  cccctccc--------
B D                    Rhesus  cccctccc--------
B D       Crab-eating macaque  cccctccc--------
B D                    Baboon  cccctccc--------
B D              Green monkey  cccctccc--------
B D                  Marmoset  cccctccc--------
B D           Squirrel monkey  cccctccc--------
B D                  Bushbaby  cccctccc--------
           Chinese tree shrew  cccctccc--------
B D                  Squirrel  tccctcct--------
       Lesser Egyptian jerboa  cctctccc--------
                 Prairie vole  ccccttcc--------
B D           Chinese hamster  ccgctcct--------
               Golden hamster  ctgctccg--------
B D                     Mouse  ccactacc--------
B D                       Rat  ctgctcct--------
B D            Naked mole-rat  ctcctccc--------
B D                Guinea pig  atcctccc--------
                   Chinchilla  ctcctccc--------
             Brush-tailed rat  ctcctccc--------
B D                    Rabbit  ctcctcct--------
B D                      Pika  ctcctccc--------
B D                       Pig  cccctccc--------
B D                    Alpaca  cccctccc--------
               Bactrian camel  cccnnnnn--------
B D                   Dolphin  cccctccc--------
                 Killer whale  cccctccc--------
             Tibetan antelope  cccccccc--------
B D                       Cow  cccccccg--------
B D                     Sheep  cccccccc--------
                Domestic goat  cccccccc--------
B D                     Horse  cccctccc--------
B D          White rhinoceros  cccctccc--------
B D                       Cat  cccctccc--------
B D                       Dog  cccctccc--------
B D                   Ferret   cccctccc--------
B D                     Panda  cccctccc--------
               Pacific walrus  cccctccc--------
                 Weddell seal  cccctccc--------
             Black flying-fox  cccctccc--------
B D                   Megabat  cccctccc--------
                Big brown bat  tccctccc--------
         David's myotis (bat)  tccctccc--------
B D                  Microbat  tccctccc--------
B D                  Hedgehog  cccctccc--------
B D                     Shrew  ccccttca--------
              Star-nosed mole  cccctccc--------
B D                  Elephant  cctctccc--------
B D                   Manatee  cccctccc--------
             Cape golden mole  cctctccc--------
B D                    Tenrec  cccctccc--------
                     Aardvark  tccctccc--------
B D                 Armadillo  cccctcct--------
B D                   Opossum  ct--------------
B D           Tasmanian devil  cg--------------
B D                   Wallaby  ca--------------
B D                  Platypus  ctggcccc--------
  D              Saker falcon  t---------------
  D          Peregrine falcon  c---------------
  D              Mallard duck  tgcctg----------
B D                   Chicken  tgcctg----------
B D                    Turkey  tgcctg----------
B D                    Lizard  ctgctg----------
B D             X. tropicalis  cccct-----------
B D                 Tetraodon  ---tgctca-----tc
B D                      Fugu  ---tggtca-----tc
       Yellowbelly pufferfish  ----gttca-----t-
B D              Nile tilapia  ---ctccca-----gc
          Princess of Burundi  ---ctccca-----gc
        Burton's mouthbreeder  ---ctccca-----gt
                  Zebra mbuna  ---ctccca-----gc
          Pundamilia nyererei  ---ctccca-----gc
B D                    Medaka  ---tgccag-----ac
           Southern platyfish  ---tgctca-----gc
B D               Stickleback  ----gccca-----ga
B D              Atlantic cod  ---cgacca-----gc
B D                 Zebrafish  ---ggcttaacatgga
     Mexican tetra (cavefish)  ---gactca-----ga
                  Spotted gar  -----ccca-----gg
  D             Scarlet macaw  ================
  D                    Parrot  ================
  D           Green seaturtle  ================
  D  Chinese softshell turtle  ================
B D                Budgerigar  ================
  D            Painted turtle  ================
  D    Spiny softshell turtle  ================
B D                Coelacanth  ----------------
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
          Tibetan ground jay  ================
B D        American alligator  ================
B D               Zebra finch  ================
  D               Rock pigeon  ================

Inserts between block 25 and 26 in window
B D                 Marmoset 3bp
B D          Squirrel monkey 3bp
              Bactrian camel 196bp
B D                 Platypus 3bp
  D             Saker falcon 5bp
  D         Peregrine falcon 5bp
  D             Mallard duck 7bp
B D                  Chicken 7bp
B D                   Turkey 7bp
B D                   Lizard 32bp
B D              Stickleback 1bp
B D             Atlantic cod 33bp

Alignment block 26 of 228 in window, 72301916 - 72301919, 4 bps 
B D                     Human  ---gcc------------t
B D                     Chimp  ---gcc------------t
B D                   Gorilla  ---gcc------------t
B D                 Orangutan  ---acc------------t
B D                    Gibbon  ---gcc------------t
B D                    Rhesus  ---gcc------------t
B D       Crab-eating macaque  ---gcc------------t
B D                    Baboon  ---gcc------------t
B D              Green monkey  ---gcc------------t
B D                  Marmoset  ---gcc------------t
B D           Squirrel monkey  ---gcc------------t
B D                  Bushbaby  ---gcc------------t
B D                  Squirrel  ---ccc------------t
       Lesser Egyptian jerboa  ---gcc------------t
                 Prairie vole  ---accccttccacccctt
B D           Chinese hamster  ---gcc------------t
               Golden hamster  ---gcc------------t
B D                     Mouse  ---aga------------g
B D                       Rat  ---gcc------------t
B D            Naked mole-rat  ---acc------------t
B D                Guinea pig  ---acc------------t
                   Chinchilla  ---acc------------t
             Brush-tailed rat  ---acc------------t
B D                    Rabbit  ---gcc------------t
B D                      Pika  ---acc------------t
B D                       Pig  ---gcc------------t
B D                    Alpaca  ---gcc------------t
B D                   Dolphin  ---gcc------------t
                 Killer whale  ---gcc------------t
             Tibetan antelope  ---gcc------------t
B D                       Cow  ---gcc------------t
B D                     Sheep  ---ccc------------t
                Domestic goat  ---gcc------------t
B D                     Horse  ---acc------------t
B D          White rhinoceros  ---acc------------t
B D                       Cat  ---gcc------------t
B D                       Dog  ---acc------------t
B D                   Ferret   ---gcc------------t
B D                     Panda  ---gcc------------t
               Pacific walrus  ---gcc------------t
                 Weddell seal  ---gcc------------t
             Black flying-fox  ---gcc------------t
B D                   Megabat  ---gcc------------t
                Big brown bat  ---gcc------------t
         David's myotis (bat)  ---gcc------------t
B D                  Microbat  ---gcc------------t
B D                  Hedgehog  ---acc------------t
B D                     Shrew  ---gcc------------a
              Star-nosed mole  ---gcc------------t
B D                  Elephant  ---tcc------------a
B D                   Manatee  ---gcc------------t
             Cape golden mole  ---act------------t
B D                    Tenrec  ---acc------------g
                     Aardvark  ---gcc------------t
B D                 Armadillo  ---acc------------t
B D                  Platypus  ---ggc------------t
  D               Rock pigeon  ----gc------------c
  D              Saker falcon  ----gg------------t
  D          Peregrine falcon  ----gc------------c
  D    White-throated sparrow  ----gc------------c
B D       Medium ground finch  ----gc------------c
B D               Zebra finch  ----gc------------c
           Tibetan ground jay  ----gc------------t
B D                Budgerigar  ----gc------------t
  D                    Parrot  ----gc------------t
  D             Scarlet macaw  ----gc------------t
  D              Mallard duck  ----gc------------t
B D                   Chicken  ----gc------------t
B D                    Turkey  ----gc------------t
B D        American alligator  ----gt------------c
  D           Green seaturtle  ----gc------------t
  D            Painted turtle  ----gc------------t
  D  Chinese softshell turtle  ----gc------------t
  D    Spiny softshell turtle  ----gc------------t
B D                    Lizard  ----gc-------------
B D             X. tropicalis  ---ggt------------t
B D                Coelacanth  ----cc------------t
B D                 Tetraodon  gggg---------------
B D                      Fugu  ggcg---------------
       Yellowbelly pufferfish  ---g---------------
B D              Nile tilapia  tgcg---------------
          Princess of Burundi  tgcg---------------
        Burton's mouthbreeder  tgcg---------------
                  Zebra mbuna  tgcg---------------
          Pundamilia nyererei  tgcg---------------
B D                    Medaka  tgtg---------------
           Southern platyfish  ggcg---------------
B D               Stickleback  ggcg---------------
B D              Atlantic cod  agtg---------------
B D                 Zebrafish  ggcg---------------
     Mexican tetra (cavefish)  gatg---------------
                  Spotted gar  ctgg---------------
          Chinese tree shrew  -------------------
              Bactrian camel  ===================
B D                   Wallaby  -------------------
B D           Tasmanian devil  -------------------
B D                   Opossum  -------------------
  D       Collared flycatcher  ===================

Inserts between block 26 and 27 in window
  D              Rock pigeon 4bp
  D             Saker falcon 19bp
  D         Peregrine falcon 5bp
  D   White-throated sparrow 12bp
B D      Medium ground finch 12bp
B D              Zebra finch 12bp
          Tibetan ground jay 30bp
B D               Budgerigar 8bp
  D                   Parrot 8bp
  D            Scarlet macaw 8bp
  D             Mallard duck 12bp
B D                  Chicken 12bp
B D                   Turkey 12bp
B D       American alligator 17bp
B D               Coelacanth 1bp

Alignment block 27 of 228 in window, 72301920 - 72301977, 58 bps 
B D                     Human  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                     Chimp  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                   Gorilla  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                 Orangutan  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                    Gibbon  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                    Rhesus  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D       Crab-eating macaque  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                    Baboon  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D              Green monkey  ggg--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                  Marmoset  gag--------------cccc------------c-aagtcc----c-----a-gttt-----------tg
B D           Squirrel monkey  gag--------------cccc------------c-aagtcc----c-----a-gttc-----------tg
B D                  Bushbaby  gag--------------cccc------------a-aagctc----c-----a-attt-----------tg
           Chinese tree shrew  -----------------cccc------------g-aggccc----c-----a------------------
B D                  Squirrel  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
       Lesser Egyptian jerboa  gag--------------cccc------------a-aggccc----c-----a-gttt-----------tg
                 Prairie vole  cca--------------cccc------------g-aagccc----c-----a-gttt-----------tg
B D           Chinese hamster  ggg--------------ctcc------------a-aagccc----c-----a-gttt-----------tg
               Golden hamster  ggg--------------cccc------------a-aaaccc----c-----a-gttt-----------tg
B D                     Mouse  ggg-----------------c------------g-gtgacc----c-----a-gttt-----------tg
B D                       Rat  gga--------------tccc------------a-gtgccc----c-----a-gttt-----------ag
B D            Naked mole-rat  gag--------------cccc------------a-aaaccc----c-----a-gttt-----------tg
B D                Guinea pig  gtg--------------cccc------------a-aagccc----c-----a-gttt-----------tg
                   Chinchilla  gtg--------------cccc------------a-atgccc----c-----a-gttt-----------tg
             Brush-tailed rat  gtg--------------ctcc------------a-aagccc----c-----a-gttt-----------tg
B D                    Rabbit  gag--------------cctc------------g-cagccc----c-----a-gttt-----------tg
B D                      Pika  gag--------------cctc------------a-cagccc----c-----a-gttt-----------tg
B D                       Pig  gag--------------cccc------------g-aagccc----c-----a-gttc-----------tg
B D                    Alpaca  gag--------------cccc------------g-aagccc----c-----a-gttt-----------tg
B D                   Dolphin  gag--------------cccc------------g-aagccc----c-----a-gttt-----------gg
                 Killer whale  gag--------------cccc------------g-aagccc----c-----a-gttt-----------gg
             Tibetan antelope  gag--------------cccc------------a-aagccc----c-----a-gttt-----------gg
B D                       Cow  gag--------------cccc------------a-aagccc----c-----a-gttt-----------gg
B D                     Sheep  gag--------------cccc------------a-gggccc----c-----a-gttt-----------gg
                Domestic goat  gag--------------cccc------------a-aagccc----c-----a-gttt-----------gg
B D                     Horse  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D          White rhinoceros  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                       Cat  gag--------------ctgc------------a-aagccc----c-----a-gttt-----------tg
B D                       Dog  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                   Ferret   gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                     Panda  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
               Pacific walrus  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
                 Weddell seal  gag--------------cccc------------a-aggccc----c-----a-gttt-----------tg
             Black flying-fox  gag--------------cccc------------t-aagccc----c-----a-gttt-----------tg
B D                   Megabat  gag--------------cccc------------t-aagccc----c-----a-gttt-----------tg
                Big brown bat  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
         David's myotis (bat)  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                  Microbat  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                  Hedgehog  gag----g-------accccc------------a-aggccc----c-----a-gttt-----------gg
B D                     Shrew  gat--------------cccc------------a-agaggc----c-----a------------------
              Star-nosed mole  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                  Elephant  gag--------------cccc------------a-agggcc----c-----a-gttt-----------tg
B D                   Manatee  gag--------------cccc------------a-aagccc----c-----a-gttt-----------tg
             Cape golden mole  gag--------------cccc------------a-aagtcc----c-----a-gttt-----------tg
B D                    Tenrec  aag--------------cctc------------c-agaccc----c-----a-gtct-----------gg
                     Aardvark  gag--------------cccc------------a-tagccc----c-----a-gttt-----------tg
B D                 Armadillo  ggg--------------cccc------------a-aagccc----c-----a-gttt-----------tg
B D                   Opossum  -------ggctggctcccccc------------c-actggc----c-----a-gttt-----------gg
B D           Tasmanian devil  -------ggctcgtcgccctc------------c-atcggc----c-----a-cgag-----------gg
B D                   Wallaby  -------ggctcactacctcc------------c-atgggc----c-----a-gt---------------
B D                  Platypus  ggg--------------cccc------------g-aagccc----c-----a-ggtc-----------tg
  D               Rock pigeon  -----------------------------------------------------ggac-----------gt
  D              Saker falcon  gta--------------ctgc------------t-gggcac----c-----a-gctc-----------cc
  D          Peregrine falcon  --g--------------cggc------------g-gggccc----c-----a-gccc-----------cc
  D       Collared flycatcher  a------------------gc------------g-gcgagc----c-----gagctc-----------cg
  D    White-throated sparrow  gta--------------ctgc------------t-ggccac----c-----c-gctc-----------cc
B D       Medium ground finch  gta--------------ctgc------------t-gcgcac----c-----c-gctc-----------cc
B D               Zebra finch  gta--------------ctgc------------t-gggcac----c-----g-gctc-----------cc
           Tibetan ground jay  a------------------gc------------g-acgagc---ac-----c-gttc-----------tg
B D                Budgerigar  -------------------------------------------------------tc-----------cc
  D                    Parrot  -------------------------------------------------------tc-----------cc
  D             Scarlet macaw  -------------------------------------------------------tc-----------cc
  D              Mallard duck  gta--------------ctgc------------t-gagcac----c-----a-gctc-----------cc
B D                   Chicken  gta--------------ctgc------------t-gagcac----c-----a-gctc-----------cc
B D                    Turkey  gta--------------ctgc------------t-gagcac----c-----a-gctc-----------cc
B D        American alligator  -----------------------------------aagccc----c-----a-gctc-----------tg
  D           Green seaturtle  ggg--------------ctcc------------a-aagccc----c-----a-gctc-----------tg
  D            Painted turtle  ggg--------------ctcc------------a-aagccc----c-----a-gctc-----------tg
  D  Chinese softshell turtle  gtg--------------ctcc------------g-aaggcc----c-----a-gctc-----------tg
  D    Spiny softshell turtle  atgctttgggttgcagtctct------------g-aaatgc----t-----g-gctcgttccgttcatcg
B D                    Lizard  --------------agtccct------------a-aaatgctggtt-----a-gctc-----------ca
B D             X. tropicalis  -----------------gttt------------a-aagtcc----a-----t-gcct-------------
B D                Coelacanth  gag--------------tacc------------atgaaccc----t-----a-gact-------------
B D                 Tetraodon  cgg--------------tggc------------g-aagccc----ctcggaggcgcc-----------gc
B D                      Fugu  agg--------------tccc------------g-aagccc----cgctgag-cgcc-----------gc
       Yellowbelly pufferfish  cgg--------------tact------------g-g----------gctgtg--gcc-----------cc
B D              Nile tilapia  ggg--------------ttcc------------a-aagcct----ctttgag-gccc-----------tc
          Princess of Burundi  ggg--------------gtcc------------a-aagcct----ctttgag-gccc-----------tc
        Burton's mouthbreeder  ggg--------------gtcc------------a-aagcct----ctttgag-gccc-----------tc
                  Zebra mbuna  ggg--------------gtcc------------a-aagcct----ctttgag-gccc-----------tc
          Pundamilia nyererei  ggg--------------gtcc------------a-aagcct----ctttgag-gccc-----------tc
B D                    Medaka  ggc--------------cctc------------a-aaggcc----ttctgag-ctcc-----------a-
           Southern platyfish  agc--------------cccc------------g-aaggtc----ttctgag-cccc-----------gc
B D               Stickleback  agg--------------cccc------------g-tagtcc----ttgagag-agcc-----------gg
B D              Atlantic cod  agg--------------tcccggcgccggggggg-aacccc----ctctgag----c-----------aa
B D                 Zebrafish  gtg--------------t------------------accct----cggccgg-gccc-----------ag
     Mexican tetra (cavefish)  tag--------------ttcc------------a-aaccct----cggtttg-gccc-----------ac
                  Spotted gar  cgg--------------tgct------------a-taagtc----ttcgggg-ggcc-----------tg
              Bactrian camel  ======================================================================

                        Human  caggggtcctgcctcc-----------c-c---------gg------gttg------gcctgga------
                        Chimp  caggggccctgcctcc-----------c-c---------gg------gttg------gcctgga------
                      Gorilla  caggggccctgcctcc-----------c-c---------gg------gttg------gcctgga------
                    Orangutan  caggggccctgcctcc-----------c-c---------gg------gttg------gcccgga------
                       Gibbon  caggggccctgcctcc-----------c-c---------gg------gttg------gcccaga------
                       Rhesus  caggggctctgcctcc-----------c-c---------gg------gttg------gcccgga------
          Crab-eating macaque  caggggctctgcctcc-----------c-c---------gg------gttg------gcccgga------
                       Baboon  caggggctctgcctcc-----------c-c---------gg------gttg------gcccgga------
                 Green monkey  caggggccctgcctcc-----------c-c---------gg------gttg------gcccgga------
                     Marmoset  caggggccctgcctct-----------c-c---------ag------gttg------gcccgga------
              Squirrel monkey  caggggccctgcctcc-----------c-c---------gg------gttg------gcccgga------
                     Bushbaby  caggggccctgcctcc-----------c-c---------ag------gttg------gccagga------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  cagagaccctgcctcc-----------c-c---------gg------gttg------gcctgga------
       Lesser Egyptian jerboa  cagggcccctgcctcc-----------c-c---------ca------gttg------gcctgga------
                 Prairie vole  caggggccctgcctcc-----------c-c---------tg------gttg------gtctgga------
              Chinese hamster  gagcggccctgcctcc-----------g-c---------ag------gttg------gcctgga------
               Golden hamster  taggggccctgcctcc-----------c-c---------tg------gctg------gcctgga------
                        Mouse  catgggctcttcctcc-----------c-c---------tg------gtag------gcctgca------
                          Rat  caggggctcatcctct-----------c-c---------tg------gttg------gcttggt------
               Naked mole-rat  caggggcccagcctcc-----------c-c---------tg------gttg------gctggga------
                   Guinea pig  caggggcccggcctcc-----------c-c---------ag------attg------gctggga------
                   Chinchilla  cagaggcccagcctcc-----------c-c---------ag------actg------actggga------
             Brush-tailed rat  cagaggcccggcttcc-----------c-c---------ag------actg------gttggga------
                       Rabbit  cagggcccctgcctcc-----------c-c---------ag------gttg------gccagga------
                         Pika  cagggcccctgcctct-----------c-c---------ag------attg------gctcggg------
                          Pig  caggggacctgcctcc-----------c-c---------gg------gttg------gcccgga------
                       Alpaca  caggggccctgcctcc-----------c-c---------gg------gttg------gcccggagcagtg
                      Dolphin  caggggccctgcctct-----------c-c---------ag------gttg------gcccgga------
                 Killer whale  caggggccctgcctct-----------c-c---------ag------gttg------gcccgga------
             Tibetan antelope  caggggctctgcctct-----------c-c---------gg------gttg------gcccgga------
                          Cow  caggggctctgcctct-----------c-c---------gg------gttg------gcccgga------
                        Sheep  caggggctctgcctct-----------c-c---------gg------gttg------gcccgga------
                Domestic goat  caggggctctgcctct-----------c-c---------gg------gttg------gcccgga------
                        Horse  cagtggccctgcctcc-----------c-c---------gg------gttg------gcctgga------
             White rhinoceros  caggggccctgcctcc-----------c-c---------ag------gttg------gcccgga------
                          Cat  gaggggccctgcctcc-----------c-c---------ag------gttg------gcccgta------
                          Dog  taggggccctgcctcc-----------c-c---------ag------cttg------tcccgga------
                      Ferret   taggggccctgcctcc-----------c-c---------ag------gttg------gcccgga------
                        Panda  taggggccctgcctcc-----------c-c---------cg------gttg------gcccgga------
               Pacific walrus  taggggccctgcctcc-----------c-c---------ag------gttg------gcccgga------
                 Weddell seal  taggggccctgcctcc-----------c-c---------ag------gttg------gcctgga------
             Black flying-fox  aaggggccctgcctccgcggctt--gga-c---------gg------gttg------gcctgga------
                      Megabat  aaggggccccgcctccgcggctt--gga-c---------gg------gttg------gcctgga------
                Big brown bat  caggggccctgcctcc-----------c-c---------tg------gttg------gcccgga------
         David's myotis (bat)  caggggccctgcctcc-----------c-c---------tg------gttg------gcctgga------
                     Microbat  caggggccctgcctcc-----------c-c---------tg------gttg------gcccgga------
                     Hedgehog  cagggcccctgcctca-----------t-t---------ag------cttg------gcctgga------
                        Shrew  caggggttcttcctcc-----------t-c---------ag------gctc------tccgggg------
              Star-nosed mole  caggggccctgcctcc-----------c-c---------gg------gttg------gccctga------
                     Elephant  taggaacccttcctcc-----------c-c---------gg------gttg------gtctgga------
                      Manatee  cagggatcctgcctcc-----------c-c---------gg------gttg------gcctgga------
             Cape golden mole  caggggccctgcctcc-----------c-c---------ag------gttg------acttgga------
                       Tenrec  cagggactctgcttcc-----------t-c---------ca------gttg------atctgga------
                     Aardvark  caggggccctgcctcc-----------c-c---------gg------gttg------gcctgga------
                    Armadillo  ctgggaccctgcctcc-----------c-c---------gg------gttg------gcctgga------
                      Opossum  catgggagtttcctcc-----------t-c---------tg------gggc------ctctgt-------
              Tasmanian devil  caaggccatttcctcg-----------t-c---------tt------gggg------ctcggt-------
                      Wallaby  --------tttcctcc-----------t-c---------tg------gagg------ttctgt-------
                     Platypus  gagggtccccgactcc-----------c-c---------cg------c----------------------
                  Rock pigeon  gggggacggcggtttg---------tgctt---------gg------ggtt------gc-----------
                 Saker falcon  atgggcccgttgctca---------tac-c---------ca------gcgg------gt-----------
             Peregrine falcon  ccccccccgcccct--------------------------------------------------------
          Collared flycatcher  cggggctccgggctc----------tcc-c---------cg------tgag------gc-----------
       White-throated sparrow  atgggcccgttgctca---------tgc-c---------ca------gcgg------gt-----------
          Medium ground finch  atgggcccgttgctca---------tgc-c---------ca------gcgg------gt-----------
                  Zebra finch  acgggcccgttgctca---------tgc-c---------ca------gcgg------gt-----------
           Tibetan ground jay  cggcactccgggatc------------------------ca------gcg--------------------
                   Budgerigar  gccgccgccgtgctt------------------------gg------gatt------gc-----------
                       Parrot  gccgccgccgtgctt------------------------gg------ggtt------gc-----------
                Scarlet macaw  gccgccgccgtgctt------------------------gg------ggtt------gc-----------
                 Mallard duck  atgggcccgttgctca---------tac-c---------ca------gcgg------gt-----------
                      Chicken  atgggcccattgctca---------tgc-c---------ca------gcgg------gt-----------
                       Turkey  atgggcccgttgctca---------tgc-c---------ca------gtgg------gt-----------
           American alligator  gatggaaccaacctca-------actgg-g---------tg------ccct------ga-----------
              Green seaturtle  gatggacccagcctc----------cgc-t---------gg------gtgc---cccga-----------
               Painted turtle  gatggacccagcctc----------tgc-t---------gg------gtgc---cctga-----------
     Chinese softshell turtle  gatggagccagcctc----------tgc-c---------gg------gtgc---cccga-----------
       Spiny softshell turtle  gatga--------tt----------tgc-a---------gg------gtgcaagtccgg-----------
                       Lizard  ttaagctgatggctggcagggtgcatgt-c---------cg------gcat------gt-----------
                X. tropicalis  --------gtatctct------------------------------------------------------
                   Coelacanth  --ggacaccaacatct-----------g-c---------ag------gatt------gcttga-------
                    Tetraodon  ccggcggcgggtgtcc---------agc-g---------ga------ggc--------------------
                         Fugu  cgggcggcgggtgtcc---------ggc-a---------ga------ggc--------------------
       Yellowbelly pufferfish  catgtggttggcggc------------c-a---------ta------ggc--------------------
                 Nile tilapia  caggcccagagtgtcc---------gcc-a---------ga------ggc--------------------
          Princess of Burundi  caggcccagagtgtcc---------gcc-a---------ga------ggc--------------------
        Burton's mouthbreeder  caggcccagagtgtcc---------gcc-a---------ga------ggc--------------------
                  Zebra mbuna  caggcccagagtgtcc---------gcc-a---------ga------ggc--------------------
          Pundamilia nyererei  caggcccagagtgtcc---------gcc-a---------ga------ggc--------------------
                       Medaka  -----------------------------g---------ga------agc--------------------
           Southern platyfish  cgggtgccgagtggcc---------ggc-g---------ga------gac--------------------
                  Stickleback  cgggcgccgagtgccc---------cgc-c---------ga------ggc--------------------
                 Atlantic cod  cgggtcccactcctcc---------tcc-gacccctcccac------gga--------------------
                    Zebrafish  ttg------------------------t-g---------gc------tgt--------------------
     Mexican tetra (cavefish)  cgg------------------------c-a---------actcctggtga--------------------
                  Spotted gar  ctgtggggg------------------c-t---------gc------tgc--------------------
               Bactrian camel  ======================================================================

                        Human  ---------gt------------ggc
                        Chimp  ---------gt------------ggc
                      Gorilla  ---------gt------------ggc
                    Orangutan  ---------gt------------ggc
                       Gibbon  ---------gt------------ggc
                       Rhesus  ---------gt------------ggc
          Crab-eating macaque  ---------gt------------ggc
                       Baboon  ---------gt------------ggc
                 Green monkey  ---------gt------------ggc
                     Marmoset  ---------gt------------ggc
              Squirrel monkey  ---------gt------------ggc
                     Bushbaby  ---------gt------------ggc
           Chinese tree shrew  --------------------------
                     Squirrel  ---------gt------------ggc
       Lesser Egyptian jerboa  ---------gt------------ggc
                 Prairie vole  ---------gt------------ggc
              Chinese hamster  ---------gt------------ggc
               Golden hamster  ---------gt------------ggc
                        Mouse  ---------cc------------agt
                          Rat  ---------gc------------agc
               Naked mole-rat  ---------gt------------ggc
                   Guinea pig  ---------gt------------ggc
                   Chinchilla  ---------gt------------ggc
             Brush-tailed rat  ---------gc------------agc
                       Rabbit  ---------gt------------ggt
                         Pika  ---------gt------------ggt
                          Pig  ---------gt------------ggc
                       Alpaca  gaggcggcggc------------ggc
                      Dolphin  ---------gt------------ggc
                 Killer whale  ---------gt------------ggc
             Tibetan antelope  ---------gt------------ggc
                          Cow  ---------gt------------ggc
                        Sheep  ---------gt------------ggc
                Domestic goat  ---------gt------------ggc
                        Horse  ---------gt------------ggc
             White rhinoceros  ---------gt------------ggc
                          Cat  ---------gt------------agc
                          Dog  ---------gt------------ggc
                      Ferret   ---------gtggcggcagcggcggc
                        Panda  ---------gt------------ggc
               Pacific walrus  ---------gtg------gcggcggc
                 Weddell seal  ---------gt------------ggc
             Black flying-fox  ---------gt------------ggc
                      Megabat  ---------gt------------ggc
                Big brown bat  ---------gt------------ggc
         David's myotis (bat)  ---------gt------------ggc
                     Microbat  ---------gt------------ggc
                     Hedgehog  ---------gt------------ggc
                        Shrew  ---------gt------------gac
              Star-nosed mole  ---------at------------ggc
                     Elephant  ---------gg------------ggt
                      Manatee  ---------gt------------ggt
             Cape golden mole  ---------gt------------ggt
                       Tenrec  ---------gg------------ggt
                     Aardvark  ---------gt------------ggt
                    Armadillo  ---------at------------gtt
                      Opossum  --------------------------
              Tasmanian devil  --------------------------
                      Wallaby  --------------------------
                     Platypus  --------------------------
                  Rock pigeon  --------------------------
                 Saker falcon  --------------------------
             Peregrine falcon  --------------------------
          Collared flycatcher  --------------------------
       White-throated sparrow  --------------------------
          Medium ground finch  --------------------------
                  Zebra finch  --------------------------
           Tibetan ground jay  --------------------------
                   Budgerigar  --------------------------
                       Parrot  --------------------------
                Scarlet macaw  --------------------------
                 Mallard duck  --------------------------
                      Chicken  --------------------------
                       Turkey  --------------------------
           American alligator  --------------------------
              Green seaturtle  --------------------------
               Painted turtle  --------------------------
     Chinese softshell turtle  --------------------------
       Spiny softshell turtle  --------------------------
                       Lizard  --------------------------
                X. tropicalis  --------------------------
                   Coelacanth  --------------------------
                    Tetraodon  --------------------------
                         Fugu  --------------------------
       Yellowbelly pufferfish  --------------------------
                 Nile tilapia  --------------------------
          Princess of Burundi  --------------------------
        Burton's mouthbreeder  --------------------------
                  Zebra mbuna  --------------------------
          Pundamilia nyererei  --------------------------
                       Medaka  --------------------------
           Southern platyfish  --------------------------
                  Stickleback  --------------------------
                 Atlantic cod  --------------------------
                    Zebrafish  --------------------------
     Mexican tetra (cavefish)  --------------------------
                  Spotted gar  --------------------------
               Bactrian camel  ==========================

Inserts between block 27 and 28 in window
B D                 Platypus 1bp

Alignment block 28 of 228 in window, 72301978 - 72301978, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
B D                  Squirrel  g
       Lesser Egyptian jerboa  t
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  c
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                      Pika  a
B D                       Pig  g
B D                    Alpaca  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  a
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  a
B D                     Shrew  c
              Star-nosed mole  a
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  t
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  g
  D               Rock pigeon  a
  D              Saker falcon  g
  D       Collared flycatcher  a
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  c
B D                    Lizard  a
B D                Coelacanth  g
B D                 Tetraodon  g
B D                      Fugu  g
       Yellowbelly pufferfish  c
B D              Nile tilapia  g
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D                    Medaka  c
           Southern platyfish  c
B D               Stickleback  g
B D              Atlantic cod  g
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
                  Spotted gar  a
          Chinese tree shrew  -
              Bactrian camel  =
  D          Peregrine falcon  -
B D                  Platypus  =
          Tibetan ground jay  -
B D             X. tropicalis  -
B D                    Rhesus  N

Inserts between block 28 and 29 in window
B D                 Hedgehog 30bp

Alignment block 29 of 228 in window, 72301979 - 72302016, 38 bps 
B D                     Human  g------c---agccat------------------------------cccc-------------------
B D                     Chimp  g------c---agccat------------------------------cccc-------------------
B D                   Gorilla  g------c---agccat------------------------------cccc-------------------
B D                 Orangutan  g------c---agccat------------------------------cccc-------------------
B D                    Gibbon  g------c---agccat------------------------------cccc-------------------
B D                    Rhesus  g------c---agccat------------------------------accc-------------------
B D       Crab-eating macaque  g------c---agccat------------------------------accc-------------------
B D                    Baboon  g------c---agccat------------------------------accc-------------------
B D              Green monkey  g------c---agccat------------------------------accc-------------------
B D                  Marmoset  t------c---agccat------------------------------ccca-------------------
B D           Squirrel monkey  g------c---ggccat------------------------------ccca-------------------
B D                  Bushbaby  g------c---ggccat------------------------------ccca-------------------
           Chinese tree shrew  ----------------------------------------------------------------------
B D                  Squirrel  g------c---agccat------------------------------ccca-------------------
       Lesser Egyptian jerboa  a------c---agcagtagcagtagcagtagcagcagcagcggccatccca-------------------
                 Prairie vole  g------c---agcagctgctgctgcagcggcggc------------ccca-------------------
B D           Chinese hamster  g------g---ggc-----------------cggc------------cccg-------------------
               Golden hamster  g------c---agcagccgct---------gctgc------------ccca-------------------
B D                     Mouse  a------g---ggcagcagcagcagtagccgcagc------------ccct-------------------
B D                       Rat  a------g---ggcagcagcagcagtcgctgcagc------------ccct-------------------
B D            Naked mole-rat  g------c---ggccat------------------------------ccca-------------------
B D                Guinea pig  g------c---agccat------------------------------ccca-------------------
                   Chinchilla  g------c---ggccat------------------------------ccca-------------------
             Brush-tailed rat  g------c---agccat------------------------------ccca-------------------
B D                    Rabbit  g------c---agccac------------------------------ccca-------------------
B D                      Pika  g------c---agccac------------------------------ccca-------------------
B D                       Pig  g------c---ggccat------------------------------ccca-------------------
B D                    Alpaca  g------c---ggccat------------------------------cccg-------------------
B D                   Dolphin  g------c---ggccat------------------------------ccca-------------------
                 Killer whale  g------c---ggccat------------------------------ccca-------------------
             Tibetan antelope  g------c---agccat------------------------------ccca-------------------
B D                       Cow  g------c---ggccat------------------------------ccca-------------------
B D                     Sheep  g------c---agccat------------------------------ccca-------------------
                Domestic goat  g------c---agccat------------------------------ccca-------------------
B D                     Horse  g------c---ggccat------------------------------ccca-------------------
B D          White rhinoceros  g------c---ggacat------------------------------ccca-------------------
B D                       Cat  g------c---agccat------------------------------ccca-------------------
B D                       Dog  g------c---agccat------------------------------ccca-------------------
B D                   Ferret   gcggcggc---agccat------------------------------ccca-------------------
B D                     Panda  g---------------------------------------------------------------------
               Pacific walrus  gcggcggc---ggccat------------------------------ccca-------------------
                 Weddell seal  acggcggc---ggccat------------------------------ccca-------------------
             Black flying-fox  g------c---ggccgc------------------------------ccca-------------------
B D                   Megabat  g------c---ggccgc------------------------------ccca-------------------
                Big brown bat  g------c---agccat------------------------------ccca-------------------
         David's myotis (bat)  g------c---agccat------------------------------ccca-------------------
B D                  Microbat  g------c---agccat------------------------------ccca-------------------
B D                  Hedgehog  g------c---agccat------------------------------ccct-------------------
B D                     Shrew  a------c---agtcac------------------------------ccca-------------------
              Star-nosed mole  g------t---ggccat------------------------------ccca-------------------
B D                  Elephant  g------t---atccat------------------------------ccca-------------------
B D                   Manatee  g------t---ggccat------------------------------ccca-------------------
             Cape golden mole  g------t---ggccac------------------------------ccca-------------------
B D                    Tenrec  g------t---gtccat------------------------------ccct-------------------
                     Aardvark  g------t---ggccat------------------------------ccca-------------------
B D                 Armadillo  g------t---agccat------------------------------tcca-------------------
B D                   Opossum  ------cc---aggccc------------------------------cccc-------------------
B D           Tasmanian devil  ------ct---aggcac------------------------------cccc-------------------
B D                   Wallaby  ------tc---aggcat------------------------------ctcc-------------------
B D                  Platypus  ------ac---ggccac------------------------------cccg-------------------
  D               Rock pigeon  -----------------------------------------------gtcc--------c--tgaaa---
  D              Saker falcon  -----------------------------------------------gccc-------------------
  D          Peregrine falcon  -----------------------------------------------gccg-------------------
  D       Collared flycatcher  -----------------------------------------------gct--------------------
  D    White-throated sparrow  -----------------------------------------------cccc-------------------
B D       Medium ground finch  -----------------------------------------------gccc-------------------
B D               Zebra finch  -----------------------------------------------gccc-------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  -----------------------------------------------gtcc--------c--tgaaa---
  D                    Parrot  -----------------------------------------------gtcc--------c--tgaaa---
  D             Scarlet macaw  -----------------------------------------------gtcc--------c--tgaaa---
  D              Mallard duck  -----------------------------------------------gccc-------------------
B D                   Chicken  -----------------------------------------------accc-------------------
B D                    Turkey  -----------------------------------------------accc-------------------
B D        American alligator  -----------------------------------------------accc--------ccatggca---
  D           Green seaturtle  -----------------------------------------------accc--------ccatggca---
  D            Painted turtle  -----------------------------------------------accc--------ccatggca---
  D  Chinese softshell turtle  -----------------------------------------------atgc--------ccagggca---
  D    Spiny softshell turtle  -----------------------------------------------atgtagtggttgtgaggata---
B D                    Lizard  -----------------------------------------------gtgg--------ttgtgagggta
B D             X. tropicalis  ------------tccga------------------------------atcc-------------------
B D                Coelacanth  ------aa---agtcat------------------------------gcca-------------------
B D                 Tetraodon  ------cc---ggcgag------------------------------gttc-------------------
B D                      Fugu  ------cc---ggcaag------------------------------attc-------------------
       Yellowbelly pufferfish  ------cc---agtggg------------------------------tgtc--------cg---------
B D              Nile tilapia  ------ct---ggcgag------------------------------gttc-------------------
          Princess of Burundi  ------ct---ggcaag------------------------------gttc-------------------
        Burton's mouthbreeder  ------ct---ggcaag------------------------------gttt-------------------
                  Zebra mbuna  ------ct---ggcaag------------------------------gttt-------------------
          Pundamilia nyererei  ------ct---ggcaag------------------------------gttt-------------------
B D                    Medaka  ------c----gggcag------------------------------gttc-------------------
           Southern platyfish  ------cccgaggcgag------------------------------gctc-------------------
B D               Stickleback  ------cc---ggccag------------------------------gctc-------------------
B D              Atlantic cod  ------cc---caccag------------------------------gttc-------------------
B D                 Zebrafish  ------ga---ggtcag------------------------------attc-------------------
     Mexican tetra (cavefish)  ------cc---agccag------------------------------gctc-------------------
                  Spotted gar  ------tt---ggccaa------------------------------gctc-------------------
              Bactrian camel  ======================================================================

                        Human  -------------tga-------------tactggctatta-agtttctgca-----g
                        Chimp  -------------tga-------------tactggctatta-agtttctgca-----g
                      Gorilla  -------------tga-------------tactggctatta-agtttctgca-----g
                    Orangutan  -------------tga-------------tactggctatta-agtttctgca-----g
                       Gibbon  -------------tga-------------tactggctatta-agtttctgca-----g
                       Rhesus  -------------tga-------------tactggctgtta-agtttctgca-----g
          Crab-eating macaque  -------------tga-------------tactggctgtta-agtttctgca-----g
                       Baboon  -------------tga-------------tactggctgtta-agtttctgca-----g
                 Green monkey  -------------tga-------------tactggctgtta-agtttctgca-----g
                     Marmoset  -------------tga-------------tactggctatta-agtttctgca-----g
              Squirrel monkey  -------------tga-------------tactggctatta-agtttctgca-----g
                     Bushbaby  -------------tga-------------tactggctatta-agtttctgta-----g
           Chinese tree shrew  ------------------------------actggctatta-agtttctgca-----g
                     Squirrel  -------------tga-------------tactggctatta-agtttctgca-----g
       Lesser Egyptian jerboa  -------------tga-------------tactggctatta-agtttctgca-----g
                 Prairie vole  -------------tga-------------tactggctatta-agcttctgca-----g
              Chinese hamster  ---------------------------------------gc-ggcgcctgca-----g
               Golden hamster  -------------tga-------------tactggctattc-agcttctgca-----g
                        Mouse  -------------tgg-------------tactggctatta-agcttctgaa-----g
                          Rat  -------------tgg-------------tactggctatta-agcttctgaa-----g
               Naked mole-rat  -------------tga-------------tactggctatta-agtttctgca-----g
                   Guinea pig  -------------tga-------------tactgactatta-agtttctgca-----g
                   Chinchilla  -------------tga-------------tactggttatta-agtttctgca-----g
             Brush-tailed rat  -------------tga-------------tactggctatta-agtttctgca-----g
                       Rabbit  -------------tga-------------tactggctatta-agtttctgca-----g
                         Pika  -------------tga-------------tactggctatta-agtttctgca-----g
                          Pig  -------------tga-------------tactggctatta-agtttctgca-----g
                       Alpaca  -------------tga-------------tattggctatta-agtttctgca-----g
                      Dolphin  -------------tga-------------tactggctatta-agtttctgca-----g
                 Killer whale  -------------tga-------------tactggctatta-agtttctgca-----g
             Tibetan antelope  -------------tga-------------tactggctattt-agtttctgca-----g
                          Cow  -------------tga-------------tactggctattt-agtttctgca-----g
                        Sheep  -------------tga-------------tactggctattt-agtttctgca-----g
                Domestic goat  -------------tga-------------tactggctattt-agtttctgca-----g
                        Horse  -------------tga-------------tactggctgtta-agcttctgca-----g
             White rhinoceros  -------------tga-------------tactggctatta-agtttctgca-----g
                          Cat  -------------tga-------------tactggctattg-agtttctgca-----g
                          Dog  -------------tga-------------tactggctatta-agtttctgca-----g
                      Ferret   -------------tga-------------tactggctatta-agtttctgca-----g
                        Panda  -------------------------------------------------gaa-----g
               Pacific walrus  -------------tga-------------tactggctatta-agtttctgca-----g
                 Weddell seal  -------------tga-------------tactggctatta-agtttctgca-----g
             Black flying-fox  -------------tga-------------tactggttgtta-agtttctgca-----g
                      Megabat  -------------tga-------------tactggttgtta-agtttctgca-----g
                Big brown bat  -------------tga-------------tattggctatta-agtttctgca-----g
         David's myotis (bat)  -------------tga-------------tactggctatta-agtttctgca-----g
                     Microbat  -------------tga-------------tactggctatta-agtttctgca-----g
                     Hedgehog  -------------tga-------------tactgactatta-agtttctgca-----g
                        Shrew  -------------tga-------------tagtggttatta-agcttctgca-----g
              Star-nosed mole  -------------tga-------------tactggctatta-agtttctgca-----g
                     Elephant  -------------taa-------------tactggctatta-agtttctgca-----g
                      Manatee  -------------tga-------------tactggctatta-agtttctgca-----g
             Cape golden mole  -------------tga-------------tactggctatta-agtttctgca-----g
                       Tenrec  -------------tga-------------tactggctatta-agtttctgca-----g
                     Aardvark  -------------tga-------------tactggctatta-agtttttgca-----g
                    Armadillo  -------------tga-------------tactggctatta-agtttctgga-----g
                      Opossum  -------------tgg-------------tactggttatta-aacttctgca-----g
              Tasmanian devil  -------------tgg-------------tactgactgtta-agcttctgca-----g
                      Wallaby  -------------tgg-------------tactggctatta-agctgctgca-----g
                     Platypus  -------------tgg-------------tactggctattg-agtttctgca-----g
                  Rock pigeon  ----------tgctgc-------------tgctggctgctg-ccgttcagct-----g
                 Saker falcon  -------------tgg-------------tactgggtgttg-agtttttgta-----g
             Peregrine falcon  -------------ctg-------------tgcttggggttgcagtccctgaaatgctg
          Collared flycatcher  -------------------------------ctaggtgtgg-agcttctgcc-----g
       White-throated sparrow  -------------tgg-------------tactgggtgttg-agtttttgta-----g
          Medium ground finch  -------------tgg-------------tactgggtgttg-agtttttgta-----g
                  Zebra finch  -------------tgg-------------tactgggtgttg-agtttttgta-----g
           Tibetan ground jay  -------------cgg-------------ttctggacgtgg-agtttctgca-----g
                   Budgerigar  -------------tgc-------------tgctggctgctg-ccgttcagct-----g
                       Parrot  -------------tgc-------------tgctggctgctg-ccgttcagct-----g
                Scarlet macaw  -------------tgc-------------tgctggctgctg-ccgttcagct-----g
                 Mallard duck  -------------tgg-------------tactgggtgttg-agtttttgta-----g
                      Chicken  -------------tgg-------------tactgggtgttg-agtttttgta-----g
                       Turkey  -------------tgg-------------tactgggtgttg-agtttttgta-----g
           American alligator  -------------tgg-------------tactggctgttg-agtttctgca-----g
              Green seaturtle  -------------tgg-------------tactggctgttg-agtttctgca-----g
               Painted turtle  -------------tgg-------------tactggctgttg-agtttctgca-----g
     Chinese softshell turtle  -------------tgg-------------tactggctgttg-agtttctgca-----a
       Spiny softshell turtle  -------------aggatggtggctaaaatactggttgttt-aacttctgca-----g
                       Lizard  ggggtggtggctgaag-------------tactgattgttg-agcttttgca-----a
                X. tropicalis  -------------tgg-------------tactgactgttg-agcatctgaa-----g
                   Coelacanth  -------------tgg-------------tactgactattc-agtttctgaa-----g
                    Tetraodon  -------------tgg-------------tagtgagagttg-agcttctgca-----g
                         Fugu  -------------tgg-------------tagtgggagttc-agcttctgca-----g
       Yellowbelly pufferfish  -------------tgg-------------tactgcgtgttc-agcttctgga-----g
                 Nile tilapia  -------------tgg-------------tagtgtgagttg-agcttctgca-----g
          Princess of Burundi  -------------tgg-------------tagtgtgagttg-agcttctgca-----g
        Burton's mouthbreeder  -------------tgg-------------tagtgtgagttg-agcttctgca-----g
                  Zebra mbuna  -------------tgg-------------tagtgtgagttg-agcttctgca-----g
          Pundamilia nyererei  -------------tgg-------------tagtgtgagttg-agcttctgca-----g
                       Medaka  -------------tgg-------------tagtgggagttg-agcttctgca-----g
           Southern platyfish  -------------tgg-------------tagtgagagttg-agcttctgca-----g
                  Stickleback  -------------tgg-------------tagtgcgagttg-agcttctgca-----g
                 Atlantic cod  -------------tgg-------------tagtgggagttg-agcttctgga-----g
                    Zebrafish  -------------tgg-------------tagtggctgttg-agtttctgaa-----g
     Mexican tetra (cavefish)  -------------tgg-------------tagtggctgttg-agcttctgca-----g
                  Spotted gar  -------------tgg-------------tagtggctgttg-agtttctgga-----g
               Bactrian camel  ==========================================================

Alignment block 30 of 228 in window, 72302017 - 72302034, 18 bps 
B D                     Human  gtgcatactagccagcaa
B D                     Chimp  ctgcatactagccagcaa
B D                   Gorilla  ttgcatactagccagcaa
B D                 Orangutan  ctgcatactagccagcaa
B D                    Gibbon  ctgcatactagccagcaa
B D                    Rhesus  ctgcatactagccagcaa
B D       Crab-eating macaque  ctgcatactagccagcaa
B D                    Baboon  ctgcatactagccagcaa
B D              Green monkey  ctgcatactagccagcaa
B D                  Marmoset  ctgcatactggccagcaa
B D           Squirrel monkey  ctgcatactggccagcaa
B D                  Bushbaby  ctgcatactggccagcag
           Chinese tree shrew  ctgcatgctggccagcaa
B D                  Squirrel  ctgcatactagccagcag
       Lesser Egyptian jerboa  ctgcatactggccagtag
                 Prairie vole  ctgcatactggccagcag
B D           Chinese hamster  ctgcatacttgccagcag
               Golden hamster  ctgcatactcgccagcag
B D                     Mouse  ctgcatgctggccatcag
B D                       Rat  ctgcatactggccagcag
B D            Naked mole-rat  ctgcatactggccagcag
B D                Guinea pig  ctgcatactggccagcag
                   Chinchilla  ctgcatactggccagcag
             Brush-tailed rat  ctgcatactagccagcag
B D                    Rabbit  ctgcatactggctagcag
B D                      Pika  ctgcatactggccagcag
B D                       Pig  ctgcatactggccagcag
B D                    Alpaca  ctgcatactggccagcag
B D                   Dolphin  ctgcatactggccagcag
                 Killer whale  ctgcatactggccagcag
             Tibetan antelope  ctgcatactggccagcag
B D                       Cow  ctgcatactggccagcag
B D                     Sheep  ctgcatactggccagcag
B D                     Horse  ctgcatactggccagcag
B D          White rhinoceros  ctgcatactggccagcag
B D                       Cat  ctgcatactggccagcag
B D                       Dog  ctgcatactggccagcag
B D                   Ferret   ctgcatactggccagcag
B D                     Panda  c------ctggccagcag
               Pacific walrus  ctgcatactggccaggag
                 Weddell seal  ctgcatactggccagcag
             Black flying-fox  ctgcatactagccagcag
B D                   Megabat  ctgcatactagccagcag
                Big brown bat  ctgcatactggccatcag
         David's myotis (bat)  ctgcatactggccagcag
B D                  Microbat  ctgcatactggccagcag
B D                  Hedgehog  ctgcatactggccatcag
B D                     Shrew  ctgcatgctggccagcag
              Star-nosed mole  ctgcatactggccagcag
B D                  Elephant  ctgcatactggccagcag
B D                   Manatee  ctgcatactggccagcag
             Cape golden mole  ttgcatactggccagcag
B D                    Tenrec  ctgcatactggccatcag
                     Aardvark  ctgcatactggccagcag
B D                 Armadillo  ctgcatactggccagcag
B D                   Opossum  ctgcatgtttgtcaccaa
B D           Tasmanian devil  ctgcatgctggccaccaa
B D                   Wallaby  ttgcatgctggccagaaa
B D                  Platypus  ctgcatggtggccagcag
  D               Rock pigeon  gtggctgccgg-------
  D              Saker falcon  gtgcatgctagcca----
  D          Peregrine falcon  ctggctgctgccgt----
  D       Collared flycatcher  gcgcaagccggcca----
  D    White-throated sparrow  gtgcatgctggcca----
B D       Medium ground finch  gtgcatgctggcca----
B D               Zebra finch  gtgcatgctggcca----
           Tibetan ground jay  gcacaggctggccc----
B D                Budgerigar  gtggctgccgg-------
  D                    Parrot  gtggctgccgg-------
  D             Scarlet macaw  gtggctgccgg-------
  D              Mallard duck  gtgcatgctagcca----
B D                   Chicken  gtgcatactagcca----
B D                    Turkey  gtgcatactagcca----
B D        American alligator  ctgcatgctggccagcag
  D           Green seaturtle  ctgcatgctggccagtag
  D            Painted turtle  ctgcatgctggccagcag
  D  Chinese softshell turtle  ctgcatgctggccagcag
  D    Spiny softshell turtle  ctgcatgctagccgtcaa
B D                    Lizard  ctgcatgctggccgtcaa
B D             X. tropicalis  ctgcatgctggccaggag
B D                Coelacanth  atgcatgctggccagcaa
B D                 Tetraodon  ctgcatgctggcgatgag
B D                      Fugu  ctgcatgctggcgatgag
       Yellowbelly pufferfish  ctgcatgctggccatgag
B D              Nile tilapia  ctgcatgctggcgatgag
          Princess of Burundi  ctgcatgctggcgatgag
        Burton's mouthbreeder  ctgcatgctggcgatgag
                  Zebra mbuna  ctgcatgctggcgatgag
          Pundamilia nyererei  ctgcatgctggcgatgag
B D                    Medaka  ctgcatggtggcgatgag
           Southern platyfish  ctgcatgctggctatgag
B D               Stickleback  ctgcatgctggcgaggag
B D              Atlantic cod  ctgcatgctggcgatgag
B D                 Zebrafish  ctgcatggaggctatgag
     Mexican tetra (cavefish)  ctgcatggaggcaatgag
                  Spotted gar  ctgcatgctggccaggag
               Domestic goat  NNNNNNNNNNNNNNNNNN
              Bactrian camel  ==================

Alignment block 31 of 228 in window, 72302035 - 72302037, 3 bps 
B D                     Human  gtg
B D                     Chimp  gtg
B D                   Gorilla  gtg
B D                 Orangutan  gtg
B D                    Gibbon  gtg
B D                    Rhesus  gtg
B D       Crab-eating macaque  gtg
B D                    Baboon  gtg
B D              Green monkey  gtg
B D                  Marmoset  gtg
B D           Squirrel monkey  gtg
B D                  Bushbaby  gtg
           Chinese tree shrew  gtg
B D                  Squirrel  gtg
       Lesser Egyptian jerboa  gtg
                 Prairie vole  atg
B D           Chinese hamster  gtg
               Golden hamster  gtg
B D                     Mouse  gtg
B D                       Rat  gtg
B D            Naked mole-rat  gtg
B D                Guinea pig  gtg
                   Chinchilla  gtg
             Brush-tailed rat  gtg
B D                    Rabbit  gtg
B D                      Pika  gtg
B D                       Pig  gtg
B D                    Alpaca  gtg
B D                   Dolphin  gtg
                 Killer whale  gtg
             Tibetan antelope  gtg
B D                       Cow  gtg
B D                     Sheep  gtg
                Domestic goat  gtg
B D                     Horse  gtg
B D          White rhinoceros  gtg
B D                       Cat  atg
B D                       Dog  atg
B D                   Ferret   atg
B D                     Panda  atg
               Pacific walrus  atg
                 Weddell seal  atg
             Black flying-fox  gtg
B D                   Megabat  gtg
                Big brown bat  gtg
         David's myotis (bat)  gtg
B D                  Microbat  gtg
B D                  Hedgehog  gtg
B D                     Shrew  gtg
              Star-nosed mole  gtg
B D                  Elephant  gtg
B D                   Manatee  gtg
             Cape golden mole  gtg
B D                    Tenrec  gtg
                     Aardvark  gtg
B D                 Armadillo  gtg
B D                   Opossum  ggg
B D           Tasmanian devil  tgg
B D                   Wallaby  ggg
B D                  Platypus  gtg
  D              Saker falcon  -tg
  D          Peregrine falcon  -tc
  D       Collared flycatcher  -gg
  D    White-throated sparrow  -tg
B D       Medium ground finch  -tg
B D               Zebra finch  -tg
           Tibetan ground jay  -gg
  D              Mallard duck  -tg
B D                   Chicken  -tg
B D                    Turkey  -tg
B D        American alligator  gtg
  D           Green seaturtle  gtg
  D            Painted turtle  gtg
  D  Chinese softshell turtle  gtg
  D    Spiny softshell turtle  ggg
B D                    Lizard  ggg
B D             X. tropicalis  gtt
B D                Coelacanth  gtg
B D                 Tetraodon  gtg
B D                      Fugu  gtg
       Yellowbelly pufferfish  ctg
B D              Nile tilapia  gtg
          Princess of Burundi  gtg
        Burton's mouthbreeder  gtg
                  Zebra mbuna  gtg
          Pundamilia nyererei  gtg
B D                    Medaka  atg
           Southern platyfish  gtg
B D               Stickleback  gtg
B D              Atlantic cod  gtg
B D                 Zebrafish  gtg
     Mexican tetra (cavefish)  gtg
                  Spotted gar  gtg
              Bactrian camel  ===
  D             Scarlet macaw  ---
  D                    Parrot  ---
B D                Budgerigar  ---
  D               Rock pigeon  ---

Alignment block 32 of 228 in window, 72302038 - 72302050, 13 bps 
B D                     Human  agg-----------gg-----cggg-------gtgc
B D                     Chimp  agg-----------gg-----cggg-------gtgc
B D                   Gorilla  agg-----------gg-----cggg-------gtgc
B D                 Orangutan  agg-----------gg-----cggg-------gtgc
B D                    Gibbon  agg-----------gg-----cggg-------gtgc
B D                    Rhesus  agg-----------gg-----tggg-------gtgc
B D       Crab-eating macaque  agg-----------gg-----tggg-------gtgc
B D