Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1009 in window, 6775643 - 6775656, 14 bps 
B D                   Human  gtgatg----c----caggcca
B D                   Chimp  gtgatg----c----caggcca
B D                 Gorilla  gtgatg----c----caggcca
B D               Orangutan  gtgatg----c----caggcca
B D                  Gibbon  gtgatg----c----caggcca
B D                  Rhesus  gtgatg----c----caggcca
B D     Crab-eating macaque  gtgatg----c----caggcca
B D                  Baboon  gtgatg----c----caggcca
B D            Green monkey  gtgatg----c----caggcca
B D                Marmoset  atgaag----c----caggcca
B D         Squirrel monkey  atgaag----c----caggcca
B D                Bushbaby  atgatg----c----caagcca
         Chinese tree shrew  ctgatg----c----caagcca
B D                Squirrel  atgatg----c----cag----
     Lesser Egyptian jerboa  atgatg----c----caggcta
               Prairie vole  atgatg----c----tgggcca
B D         Chinese hamster  atgatg-----------ggtca
             Golden hamster  atgatg----c----taggtca
B D                   Mouse  agcatgtattt----gaggtca
B D          Naked mole-rat  gtgatg----c----caggcca
B D              Guinea pig  atggtc----c----caggcca
                 Chinchilla  atgatc----c----caggcca
           Brush-tailed rat  ctgatc----c----caggcca
B D                  Rabbit  gccatg----c----ctgtcca
B D                    Pika  ggggtc----c----tgctcca
B D                     Pig  atgatg----c----caggcca
B D                  Alpaca  atgatg----c----caggcca
             Bactrian camel  atgatg----c----caggcca
B D                 Dolphin  atgatg----c----caggcca
               Killer whale  atgatg----c----caggcca
           Tibetan antelope  acgatg----c----cagcccc
B D                     Cow  atgatg----c----cagcccc
B D                   Sheep  atgatg----c----cagcccc
              Domestic goat  atgatg----c----cagcccc
B D                   Horse  ctgatg----c----taggccg
B D        White rhinoceros  ctgatg----c----cgggcca
B D                     Cat  acgatg----c----caggcca
B D                     Dog  aggatg----c----taggcca
B D                 Ferret   ctgatg----c----taggcca
B D                   Panda  atgatg----c----taggcca
             Pacific walrus  atgata----c----gaggcca
               Weddell seal  atgata----c----aaggcca
           Black flying-fox  ataatg----c----caggcca
B D                 Megabat  ataatg----c----caggcca
              Big brown bat  atgatg----c----caggcca
       David's myotis (bat)  atgatg----c----caggcca
B D                Microbat  atgatg----c----caggcca
B D                Hedgehog  atgctt----c----catgcct
B D                   Shrew  aggacg----g----gcagagc
            Star-nosed mole  atgatg----c----caggccc
B D                Elephant  atgatg----c----caggca-
        Cape elephant shrew  atgatg----c----taggca-
B D                 Manatee  gtgatg----c----caggca-
           Cape golden mole  atgatg----c----caggcc-
B D                  Tenrec  ctgatg----c----caggca-
                   Aardvark  atgatg----c----caggta-
B D               Armadillo  -----g----c----tggcca-
B D                 Opossum  a-aatg----c----caggctg
B D         Tasmanian devil  a-gatg----ctgaacagggtg
B D                Platypus  a-ggtc----c-aagcaggccg
B D             Stickleback  ----------------------
    Yellowbelly pufferfish  ======================
B D                    Fugu  ======================
B D                  Turkey  ======================
B D                 Chicken  ======================
  D            Mallard duck  ======================
        Tibetan ground jay  ======================
B D             Zebra finch  ======================
  D  White-throated sparrow  ======================
B D               Zebrafish  ======================
B D           X. tropicalis  ======================
  D         Green seaturtle  ======================
B D      American alligator  ======================
B D              Budgerigar  ======================
  D             Rock pigeon  ======================
  D     Collared flycatcher  ======================
B D     Medium ground finch  ======================
B D                  Lizard  ----------------------
  D        Peregrine falcon  ----------------------
  D            Saker falcon  ======================
B D                 Wallaby  ======================
B D                     Rat  ======================

Inserts between block 1 and 2 in window
              Prairie vole 506bp
B D                  Mouse 26bp

Alignment block 2 of 1009 in window, 6775657 - 6775657, 1 bps 
B D                   Human  -c
B D                   Chimp  -c
B D                 Gorilla  -c
B D               Orangutan  -c
B D                  Gibbon  -c
B D                  Rhesus  -c
B D     Crab-eating macaque  -c
B D                  Baboon  -c
B D            Green monkey  -c
B D                Marmoset  -c
B D         Squirrel monkey  -c
B D                Bushbaby  -t
         Chinese tree shrew  -c
     Lesser Egyptian jerboa  -c
B D         Chinese hamster  -a
             Golden hamster  -a
B D                   Mouse  -c
B D          Naked mole-rat  -c
B D              Guinea pig  -c
                 Chinchilla  -c
           Brush-tailed rat  -c
B D                     Pig  -c
B D                  Alpaca  -t
             Bactrian camel  -t
B D                 Dolphin  -c
               Killer whale  -c
           Tibetan antelope  -c
B D                     Cow  -c
B D                   Sheep  -c
              Domestic goat  -c
B D                   Horse  -c
B D        White rhinoceros  -c
B D                     Cat  -c
B D                     Dog  -c
B D                 Ferret   -g
B D                   Panda  -g
             Pacific walrus  -c
               Weddell seal  -c
           Black flying-fox  -c
B D                 Megabat  -c
B D                Hedgehog  -t
B D                   Shrew  -c
            Star-nosed mole  -c
B D                Elephant  -c
        Cape elephant shrew  -c
B D                 Manatee  -c
           Cape golden mole  -c
B D                  Tenrec  -c
                   Aardvark  -c
B D               Armadillo  -c
B D                 Opossum  -c
B D         Tasmanian devil  -t
B D                Platypus  g-
B D                    Pika  --
B D                  Rabbit  --
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                 Wallaby  ==
              Prairie vole  ==
B D                     Rat  ==
B D                Squirrel  --
      David's myotis (bat)  --
             Big brown bat  --
B D                Microbat  --

Inserts between block 2 and 3 in window
    Lesser Egyptian jerboa 598bp

Alignment block 3 of 1009 in window, 6775658 - 6775669, 12 bps 
B D                   Human  --tgggcacaagt-t
B D                   Chimp  --tgggcacaagt-t
B D                 Gorilla  --tgggcacaagt-t
B D               Orangutan  --t-ggcacaagt-t
B D                  Gibbon  --tgggcacaagt-t
B D                  Rhesus  --tgggcacaagt-t
B D     Crab-eating macaque  --tgggcacaagt-t
B D                  Baboon  --tgggcacaagt-t
B D            Green monkey  --tgggcacaagt-t
B D                Marmoset  --tgggcacgagt-t
B D         Squirrel monkey  --tgggcacaagt-t
B D                Bushbaby  --tgggcacaagt-t
         Chinese tree shrew  --tgggcacaagt-t
B D                Squirrel  ---gatcacaagt-t
B D         Chinese hamster  --tcgactcaagc-t
             Golden hamster  --tcgactcaagc-t
B D                   Mouse  --tctacccacct-t
B D          Naked mole-rat  --tgggcacaagt-c
B D              Guinea pig  --tgggcacaagt-c
                 Chinchilla  --tgggcacaagc-t
           Brush-tailed rat  --tgggtacaacc-c
B D                     Pig  --tgggtacaagt-t
B D                  Alpaca  --ggggcacaggt-t
             Bactrian camel  --ggggcgcaggt-t
B D                 Dolphin  --tgggcacaagt-t
               Killer whale  --tgggcacaagt-t
           Tibetan antelope  --tgggcacagttgt
B D                     Cow  --tgggcacaattgt
B D                   Sheep  --tgggcacaattgt
              Domestic goat  --tgggcacaattgt
B D                   Horse  --tgggcacaagt-t
B D        White rhinoceros  --tgggcacaagt-t
B D                     Cat  --tgggcagaagt-c
B D                     Dog  --caggcacaagt-t
B D                 Ferret   --tgggcacaagt-c
B D                   Panda  --ggggcgcaagt-t
             Pacific walrus  --catgtgcaagt-t
               Weddell seal  --cgtgtgcaagt-t
           Black flying-fox  --agggtacaagt-t
B D                 Megabat  --tgggtacaagt-t
              Big brown bat  --tgggcacaatt-t
       David's myotis (bat)  --taggcacaatt-t
B D                Microbat  --tgggcacaatt-t
B D                Hedgehog  --tgggtg-------
B D                   Shrew  --tgggcaggtgc-a
            Star-nosed mole  --tgggcacatgt-c
B D                Elephant  --tgggcacaagt-t
        Cape elephant shrew  --tgggcacaagt-t
B D                 Manatee  --tgggcacaagt-t
           Cape golden mole  --tgggcacaaac-t
B D                  Tenrec  --tgggcacaagt-t
                   Aardvark  --tgggcacatgt--
B D               Armadillo  --taggtgccagc-t
B D                 Opossum  --tgggcaggggc-t
B D         Tasmanian devil  --t---cagggtt-t
B D                Platypus  tctgtccgtatg---
B D                    Pika  ---------------
B D                  Rabbit  ---------------
B D             Stickleback  ---------------
    Yellowbelly pufferfish  ===============
B D                    Fugu  ===============
B D                  Turkey  ===============
B D                 Chicken  ===============
  D            Mallard duck  ===============
        Tibetan ground jay  ===============
B D             Zebra finch  ===============
  D  White-throated sparrow  ===============
B D               Zebrafish  ===============
B D           X. tropicalis  ===============
  D         Green seaturtle  ===============
B D      American alligator  ===============
B D              Budgerigar  ===============
    Lesser Egyptian jerboa  ===============
  D             Rock pigeon  ===============
  D     Collared flycatcher  ===============
B D     Medium ground finch  ===============
B D                  Lizard  ---------------
  D        Peregrine falcon  ---------------
  D            Saker falcon  ===============
B D                 Wallaby  ===============
              Prairie vole  ===============
B D                     Rat  ===============

Inserts between block 3 and 4 in window
B D        Chinese hamster 455bp
B D                  Mouse 10bp

Alignment block 4 of 1009 in window, 6775670 - 6775673, 4 bps 
B D                   Human  cca-g
B D                   Chimp  cca-g
B D                 Gorilla  cca-g
B D               Orangutan  cta-g
B D                  Gibbon  cca-g
B D                  Rhesus  cct-g
B D     Crab-eating macaque  cct-g
B D                  Baboon  cct-g
B D            Green monkey  cct-g
B D                Marmoset  cca-g
B D         Squirrel monkey  gca-g
B D                Bushbaby  tca-g
         Chinese tree shrew  cta-g
B D                Squirrel  gtg-g
             Golden hamster  gta-g
B D                   Mouse  cta-g
B D          Naked mole-rat  gtg-g
B D              Guinea pig  cta-g
                 Chinchilla  gtg-g
           Brush-tailed rat  atg-g
B D                     Pig  cca-g
B D                  Alpaca  aga-g
             Bactrian camel  aca-g
B D                 Dolphin  gcagg
               Killer whale  gcagg
           Tibetan antelope  gca--
B D                     Cow  gcg--
B D                   Sheep  gca--
              Domestic goat  gca--
B D                   Horse  gca-a
B D        White rhinoceros  gca-g
B D                     Cat  gca-g
B D                     Dog  gca-g
B D                 Ferret   gca-g
B D                   Panda  gca-g
             Pacific walrus  gca-g
               Weddell seal  gca-g
              Big brown bat  cca-g
       David's myotis (bat)  cca-g
B D                Microbat  cca-g
B D                Hedgehog  --c-c
B D                   Shrew  ccc-c
            Star-nosed mole  ata-g
B D                Elephant  cca-g
        Cape elephant shrew  cca-g
B D                 Manatee  cca-g
           Cape golden mole  cca-g
B D                  Tenrec  cca-g
B D               Armadillo  cca-g
B D                Platypus  tcg-g
B D                    Pika  -----
B D                  Rabbit  -----
B D             Stickleback  -----
    Yellowbelly pufferfish  =====
B D                    Fugu  =====
B D                  Turkey  =====
B D                 Chicken  =====
  D            Mallard duck  =====
        Tibetan ground jay  =====
B D             Zebra finch  =====
  D  White-throated sparrow  =====
B D         Tasmanian devil  -----
B D               Zebrafish  =====
B D           X. tropicalis  =====
  D         Green seaturtle  =====
B D      American alligator  =====
B D              Budgerigar  =====
B D                 Opossum  -----
    Lesser Egyptian jerboa  =====
  D             Rock pigeon  =====
  D     Collared flycatcher  =====
B D     Medium ground finch  =====
B D                  Lizard  -----
  D        Peregrine falcon  -----
  D            Saker falcon  =====
B D                 Wallaby  =====
B D         Chinese hamster  =====
              Prairie vole  =====
                  Aardvark  -----
B D                 Megabat  -----
B D                     Rat  =====
          Black flying-fox  -----

Inserts between block 4 and 5 in window
            Golden hamster 688bp

Alignment block 5 of 1009 in window, 6775674 - 6775675, 2 bps 
B D                   Human  ag
B D                   Chimp  ag
B D                 Gorilla  ag
B D               Orangutan  ag
B D                  Gibbon  ag
B D                  Rhesus  ag
B D     Crab-eating macaque  ag
B D                  Baboon  ag
B D            Green monkey  ag
B D                Marmoset  ag
B D         Squirrel monkey  ag
B D                Bushbaby  ag
         Chinese tree shrew  ag
B D                   Mouse  gg
B D                     Pig  gg
B D                  Alpaca  gg
             Bactrian camel  gg
B D                 Dolphin  gg
               Killer whale  gg
           Tibetan antelope  -g
B D                     Cow  -g
B D                   Sheep  -g
              Domestic goat  -g
B D                   Horse  ag
B D        White rhinoceros  ag
B D                     Cat  ag
B D                     Dog  ag
B D                 Ferret   ag
B D                   Panda  ag
             Pacific walrus  ag
               Weddell seal  ag
              Big brown bat  ag
       David's myotis (bat)  ag
B D                Microbat  ag
B D                Hedgehog  ag
B D                   Shrew  ag
            Star-nosed mole  ag
B D                Elephant  ag
        Cape elephant shrew  ag
B D                 Manatee  ag
           Cape golden mole  ag
B D                  Tenrec  ag
B D               Armadillo  gg
B D                Platypus  gg
B D              Guinea pig  --
B D                    Pika  --
B D                  Rabbit  --
            Golden hamster  ==
          Brush-tailed rat  --
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D         Tasmanian devil  --
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
B D                 Opossum  --
                Chinchilla  --
B D          Naked mole-rat  --
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                 Wallaby  ==
B D         Chinese hamster  ==
              Prairie vole  ==
                  Aardvark  --
B D                 Megabat  --
B D                     Rat  ==
          Black flying-fox  --
B D                Squirrel  --

Alignment block 6 of 1009 in window, 6775676 - 6775683, 8 bps 
B D                   Human  --cctgcc-ca
B D                   Chimp  --cctgcc-ca
B D                 Gorilla  --cctgcc-ca
B D               Orangutan  --cctgcc-ca
B D                  Gibbon  --cctgcc-ca
B D                  Rhesus  --cctgcc-ca
B D     Crab-eating macaque  --cctgcc-ca
B D                  Baboon  --cctgcc-ca
B D            Green monkey  --cctgcc-ca
B D                Marmoset  --cctgcc-ca
B D         Squirrel monkey  --cctgcc-ca
B D                Bushbaby  --gctgcc-ca
         Chinese tree shrew  --ggtgcc-c-
     Lesser Egyptian jerboa  --cctacc-ag
B D                   Mouse  --tttgca-ca
B D                     Pig  --actgct-tc
B D                  Alpaca  --gctgcc-cc
             Bactrian camel  --gctgcc-cc
B D                 Dolphin  --gatgcc-cc
               Killer whale  --gatgcc-cc
           Tibetan antelope  --gctgcc-cc
B D                     Cow  --gctgcc-cc
B D                   Sheep  --gctgcc-cc
              Domestic goat  --gctgcc-cc
B D                   Horse  --gctgcccct
B D        White rhinoceros  --gctgccact
B D                     Cat  --gctgcc-ct
B D                     Dog  --gctgcc-ct
B D                 Ferret   --gcaacc-ct
B D                   Panda  --gctgcc-ct
             Pacific walrus  --gctgcc-ct
               Weddell seal  --gctgcc-ct
           Black flying-fox  --gttgcc-cc
B D                 Megabat  --gttgcc-cc
              Big brown bat  --gctgcc-cc
       David's myotis (bat)  --gctgcc-cc
B D                Microbat  --gctgcc-cc
B D                Hedgehog  --ttcccc-cc
B D                   Shrew  --gacgcc---
            Star-nosed mole  --gctgtc-cc
B D                Elephant  --gctgcc-ca
        Cape elephant shrew  --gctgcc-ca
B D                 Manatee  --gctgcc-ca
           Cape golden mole  --gctgtc-ca
B D                  Tenrec  --actgcc-ca
B D               Armadillo  --gctgcc-ca
B D                 Opossum  ---cgggc-cc
B D         Tasmanian devil  ---cagtt-ca
B D                Platypus  cctctgtt-ca
B D              Guinea pig  -----------
B D                    Pika  -----------
B D                  Rabbit  -----------
            Golden hamster  ===========
          Brush-tailed rat  -----------
B D             Stickleback  -----------
    Yellowbelly pufferfish  ===========
B D                    Fugu  ===========
B D                  Turkey  ===========
B D                 Chicken  ===========
  D            Mallard duck  ===========
        Tibetan ground jay  ===========
B D             Zebra finch  ===========
  D  White-throated sparrow  ===========
B D               Zebrafish  ===========
B D           X. tropicalis  ===========
  D         Green seaturtle  ===========
B D      American alligator  ===========
B D              Budgerigar  ===========
                Chinchilla  -----------
B D          Naked mole-rat  -----------
  D             Rock pigeon  ===========
  D     Collared flycatcher  ===========
B D     Medium ground finch  ===========
B D                  Lizard  -----------
  D        Peregrine falcon  -----------
  D            Saker falcon  ===========
B D                 Wallaby  ===========
B D         Chinese hamster  ===========
              Prairie vole  ===========
                  Aardvark  -----------
B D                     Rat  ===========
B D                Squirrel  -----------

Inserts between block 6 and 7 in window
B D                  Mouse 122bp
B D                    Pig 8bp
B D                 Alpaca 7bp
            Bactrian camel 7bp
B D                Dolphin 8bp
              Killer whale 8bp
          Tibetan antelope 7bp
B D                    Cow 7bp
B D                  Sheep 7bp
             Domestic goat 7bp
B D                  Horse 7bp
B D       White rhinoceros 7bp
B D                    Cat 7bp
B D                    Dog 7bp
B D                Ferret  7bp
B D                  Panda 7bp
            Pacific walrus 7bp
              Weddell seal 7bp
          Black flying-fox 7bp
B D                Megabat 7bp
             Big brown bat 8bp
      David's myotis (bat) 8bp
B D               Microbat 8bp
B D               Hedgehog 8bp
B D                  Shrew 4bp
           Star-nosed mole 8bp
B D               Elephant 8bp
       Cape elephant shrew 8bp
B D                Manatee 8bp
          Cape golden mole 8bp
B D                 Tenrec 8bp
B D              Armadillo 8bp
B D                Opossum 8bp
B D        Tasmanian devil 8bp

Alignment block 7 of 1009 in window, 6775684 - 6775695, 12 bps 
B D                   Human  tctc----ggccccca
B D                   Chimp  tctc----ggccccca
B D                 Gorilla  tctc----ggccccca
B D               Orangutan  tctc----ggccccca
B D                  Gibbon  tctc----ggccccca
B D                  Rhesus  tctc----ggccccca
B D     Crab-eating macaque  tctc----ggccccca
B D                  Baboon  tctc----ggccccca
B D            Green monkey  tctc----ggccccca
B D                Marmoset  tctcg---ggccccca
B D         Squirrel monkey  tctc----ggccccca
B D                Bushbaby  ctat----ggtctcct
         Chinese tree shrew  --tt----ggtggctt
B D                Squirrel  -------------ct-
     Lesser Egyptian jerboa  ----------cccct-
B D          Naked mole-rat  ------------cct-
B D              Guinea pig  ------------cct-
                 Chinchilla  ------------cct-
           Brush-tailed rat  ------------tct-
B D                  Rabbit  ------------ccg-
B D                    Pika  ------------cct-
B D                     Pig  tcct------------
B D                  Alpaca  tcct------------
             Bactrian camel  tcct------------
B D                 Dolphin  tcct------------
               Killer whale  tcct------------
           Tibetan antelope  tctt------------
B D                     Cow  tctt------------
B D                   Sheep  tctt------------
              Domestic goat  tctt------------
B D                   Horse  tcct------------
B D        White rhinoceros  tcct------------
B D                     Cat  tcct------------
B D                     Dog  tcct------------
B D                 Ferret   tcct------------
B D                   Panda  tcc-------------
             Pacific walrus  ccct------------
               Weddell seal  tcct------------
           Black flying-fox  tctt------------
B D                 Megabat  tctt------------
              Big brown bat  tcct------------
       David's myotis (bat)  tctt------------
B D                Microbat  tctt------------
B D                Hedgehog  tcct------------
B D                   Shrew  gact------------
            Star-nosed mole  cctt------------
B D                Elephant  gccc------------
        Cape elephant shrew  tcct------------
B D                 Manatee  tcct------------
           Cape golden mole  tcct------------
B D                  Tenrec  tcct------------
                   Aardvark  -cct------------
B D               Armadillo  tcct------------
B D                 Opossum  tac-------------
B D         Tasmanian devil  tac-------------
B D                Platypus  ----gtccggtctgcg
            Golden hamster  ================
B D             Stickleback  ----------------
    Yellowbelly pufferfish  ================
B D                    Fugu  ================
B D                  Turkey  ================
B D                 Chicken  ================
  D            Mallard duck  ================
        Tibetan ground jay  ================
B D             Zebra finch  ================
  D  White-throated sparrow  ================
B D               Zebrafish  ================
B D           X. tropicalis  ================
  D         Green seaturtle  ================
B D      American alligator  ================
B D              Budgerigar  ================
  D             Rock pigeon  ================
  D     Collared flycatcher  ================
B D     Medium ground finch  ================
B D                  Lizard  ----------------
  D        Peregrine falcon  ----------------
  D            Saker falcon  ================
B D                 Wallaby  ================
B D         Chinese hamster  ================
              Prairie vole  ================
B D                     Rat  ================
B D                   Mouse  ================

Inserts between block 7 and 8 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 8bp

Alignment block 8 of 1009 in window, 6775696 - 6775696, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  c
         Chinese tree shrew  c
B D                Squirrel  c
B D                   Mouse  t
B D          Naked mole-rat  c
B D              Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  t
B D                  Rabbit  c
B D                    Pika  c
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  c
       David's myotis (bat)  t
B D                Microbat  c
B D                Hedgehog  c
B D                   Shrew  c
            Star-nosed mole  c
B D                Elephant  c
        Cape elephant shrew  t
B D                 Manatee  c
           Cape golden mole  c
B D                  Tenrec  c
                   Aardvark  g
B D               Armadillo  c
B D                Platypus  c
            Golden hamster  =
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D         Tasmanian devil  -
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
B D                 Opossum  -
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                 Wallaby  =
B D         Chinese hamster  =
              Prairie vole  =
B D                     Rat  =
B D                   Panda  -

Alignment block 9 of 1009 in window, 6775697 - 6775704, 8 bps 
B D                   Human  ttttctca
B D                   Chimp  ttttctca
B D                 Gorilla  ttttctca
B D               Orangutan  ttttctca
B D                  Gibbon  ttttctca
B D                  Rhesus  ttttctca
B D     Crab-eating macaque  ttttctca
B D                  Baboon  ttttctca
B D            Green monkey  ttttctca
B D                Marmoset  ttttctca
B D         Squirrel monkey  ttttctca
B D                Bushbaby  ttttctta
         Chinese tree shrew  tcttctcg
B D                Squirrel  tttattca
     Lesser Egyptian jerboa  cttttcca
               Prairie vole  ttttttca
B D         Chinese hamster  ttccttca
             Golden hamster  tttcttca
B D                   Mouse  ttttttca
B D                     Rat  ttttttta
B D          Naked mole-rat  tttcttca
B D              Guinea pig  ttttctca
                 Chinchilla  ttttctca
           Brush-tailed rat  ttttctca
B D                  Rabbit  ttttctca
B D                    Pika  tgttctga
B D                     Pig  tttcctcg
B D                  Alpaca  ttttctcg
             Bactrian camel  ttttctcg
B D                 Dolphin  ttttttcg
               Killer whale  ttttttcg
           Tibetan antelope  ttttctca
B D                     Cow  ttttctcg
B D                   Sheep  ttttctca
              Domestic goat  ttttctca
B D                   Horse  ttttctcg
B D        White rhinoceros  ttttctcg
B D                     Cat  ttttctcg
B D                     Dog  ttttctca
B D                 Ferret   ctttctcg
B D                   Panda  -tttctcg
             Pacific walrus  ttttctcg
               Weddell seal  ttttctcg
           Black flying-fox  ttttctca
B D                 Megabat  ttttctca
              Big brown bat  ttttctcg
       David's myotis (bat)  ttttctca
B D                Microbat  ttttctcg
B D                Hedgehog  ttgactca
B D                   Shrew  ttccctca
            Star-nosed mole  ttccctca
B D                Elephant  ttttctca
        Cape elephant shrew  ttgtctta
B D                 Manatee  ttttctca
           Cape golden mole  tttcctca
B D                  Tenrec  ttttttaa
                   Aardvark  ttttctca
B D               Armadillo  tttcctta
B D                 Opossum  -atcccca
B D         Tasmanian devil  -tttccta
B D                Platypus  gagtccca
B D             Stickleback  --------
    Yellowbelly pufferfish  ========
B D                    Fugu  ========
B D                  Turkey  ========
B D                 Chicken  ========
  D            Mallard duck  ========
        Tibetan ground jay  ========
B D             Zebra finch  ========
  D  White-throated sparrow  ========
B D               Zebrafish  ========
B D           X. tropicalis  ========
  D         Green seaturtle  ========
B D      American alligator  ========
B D              Budgerigar  ========
  D             Rock pigeon  ========
  D     Collared flycatcher  ========
B D     Medium ground finch  ========
B D                  Lizard  --------
  D        Peregrine falcon  --------
  D            Saker falcon  ========
B D                 Wallaby  ========

Inserts between block 9 and 10 in window
B D               Platypus 984bp

Alignment block 10 of 1009 in window, 6775705 - 6775832, 128 bps 
B D                   Human  cccccata-at-aaa---------------ga---aacgaaactg-aa---aatctcctc-ttgagtcac
B D                   Chimp  cccccata-at-aaa---------------ga---aacgaaactg-aa---aatctcctc-ttgagtcac
B D                 Gorilla  cccccata-at-aaa---------------ga---aacgaaactg-aa---aatctcctc-ttgagtcac
B D               Orangutan  cccccata-at-aaa---------------ga---aacgaaactg-aa---aatctcctc-ttgagtcac
B D                  Gibbon  cccccata-at-aaa---------------ga---aacgaaactg-aa---aatctcctc-ttgagtcac
B D                  Rhesus  cccccata-at-aaa---------------ga---atcgaaactg-aa---aatctcctc-ttgagtcac
B D     Crab-eating macaque  cccccata-at-aaa---------------ga---atcgaaactg-aa---aatctcctc-ttgagtcac
B D                  Baboon  cccccata-at-aaa---------------ga---atcgaaactg-aa---aatctcctc-ttgagtcac
B D            Green monkey  cccccata-at-aaa---------------ga---atcgaaactg-aa---aatctcctc-ttgagtcac
B D                Marmoset  cccccata-ataaaa---------------ga---accgaaactg-aa---aatctcctc-ttgagtcac
B D         Squirrel monkey  ccccc----ataaaa---------------ga---accgaaactg-aa---aatctcttc-ttgagtcac
B D                Bushbaby  cccacatt-at-aaa---------------ta---actg-aactg-aa---aatctcccc-ttgagtcac
         Chinese tree shrew  ccccc-tt-at-aaa---------------ga---atcgaaactg-aa---aatctcccc--tgagtcat
B D                Squirrel  tccccttc-at-aaa---------------ga---acggaaactg-aa---aatctccccattgagtcac
     Lesser Egyptian jerboa  cccttatg-at-------------------ga---actgaaattg--a---aatctctcc--tgagtcac
               Prairie vole  cccccacg-at-aaaacaaaagaaaaaacaaa---accgaaactg-aa---aatctcccc-ttgactcac
B D         Chinese hamster  ccccaatg-at-aaaacaaaacaaaaaacaaa---actgaaactg-aa---aatctcccc-ttgagtcac
             Golden hamster  ccccaatg-at-aaaacaaaacaaaaaacaaa---actgaaactg-aa---aatctcccc-ttgagtcac
B D                   Mouse  cccctgtg-at-aaaacaaaacaaaaaacaaa---actgaaactg-aa---aatctcccc-ttgagtcac
B D                     Rat  cccctgtg-at-aaaacaaaacaaaaaacaaa---actgaaactg-aa---aatctcccc-ttgagtcac
B D          Naked mole-rat  cccccgtg-at-aaa---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
B D              Guinea pig  gtcct----gt-ga----------------ta---actgaaactgaaa---aatctccct--tgactcac
                 Chinchilla  cccca-tg-at-aaa---------------ga---actgaaactg-aa---aatctccct--tgagtcac
           Brush-tailed rat  ccccc----at-aac---------------ta---actgaaactg-aa---aatctccct--tgagtcac
B D                  Rabbit  cccgtgtt-at-------------------aa---accgaagtgg-ga---caccttccc-cggagtcgc
B D                    Pika  tccctgtt-ag-------------------aa---gccaaaacag-aaaacctccttcct-ctgacccac
B D                     Pig  cccccat--at-aat---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
B D                  Alpaca  cccccat--at-aat---------------ga---actgaaactg-aa---aatctcccc--tgagtcat
             Bactrian camel  cccccat--at-aat---------------ga---actgaaactg-aa---aatctcccc--tgagtcat
B D                 Dolphin  cccccat--at-aac---------------ga---acagaaactg-aa---aacttcccc--tgagtcac
               Killer whale  cccccat--at-aac---------------ga---acagaaactg-aa---aacctcccc--tgagtcac
           Tibetan antelope  cccccgt--at-aat---------------ga---acagaaactg-aa---aatctcccc--tgagtcac
B D                     Cow  cccccat--at-aat---------------ga---acagaaactg-aa---aatctcccc--tgagtcac
B D                   Sheep  cccccgt--at-aat---------------ga---acagaaactg-aa---aatctcccc--tgagtcac
              Domestic goat  cccccgt--at-aat---------------ga---acagaaactg-aa---aatctcccc--tgagtcac
B D                   Horse  cccccat--at-aga---------------ga---accgaaactg-aa---aatctc-cc--tgagtcac
B D        White rhinoceros  cccccat--ag-aga---------------aa---actgaaactg-aa---aatctc-cc--tgagtcac
B D                     Cat  cccccac--at-aag---------------gaaccaccgaaacag-aa---agtctcccc--tgagtcac
B D                     Dog  cccccacatat-aaa---------------aa---actgaaactg-aa---aacctcccc--tgagtcac
B D                 Ferret   cccccac--at-aaa---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
B D                   Panda  cccccac--at-aaa---------------ga---actgaaactg-aa---aatctctcc--tgagtcac
             Pacific walrus  cccccac--at-gaa---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
               Weddell seal  cccccac--at-aaa---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
           Black flying-fox  cccccatatgt-gaa---------------ga---actgaaactg-aa---aatctctct--tgagtcac
B D                 Megabat  cccccatatgt-aaa---------------ga---actgaaactg-aa---aatctctct--tgagtcac
              Big brown bat  cccccacatat-taa----------------a---actgaaacta-aa---aatctcccc--tgagtcac
       David's myotis (bat)  cccccacatat-aaa----------------a---actgaaacta-aa---aatctcccc--tgagtcac
B D                Microbat  cccccatatat-aaa----------------a---actgaaacta-aa---aatctcccc--tgagtcac
B D                Hedgehog  ccccccta-aa-aaa---------------ga---agcgaaactg-aa---agtcttccc--tgagtcac
B D                   Shrew  cccc--------------------------------ctctaatgg-aa---aatcacccc--tgagtcac
            Star-nosed mole  cccccat--gt-aaa---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
B D                Elephant  cccccttt-gt-aaa---------------ga---actgaaactg-aa---aatctcccc--tgagtcac
        Cape elephant shrew  cccctttt-gt-aaa---------------ga---actgaaactg-aa---aatctcccc-ttgagtcac
B D                 Manatee  cccccttt-gt-aaa---------------ga---actgaaactg-aa---aatctcccc-ttgagtcac
           Cape golden mole  cccccttt-gt-aaa---------------ga---actgaaactg-aa---aatctcccc-ttgagtcac
B D                  Tenrec  cccccttt-gt-aaa---------------ga---actgaaactg-aa---aatgccccc-ttgagtcac
                   Aardvark  cccccttt-gt-aaa---------------ga---actgaaactg-aa---aatctcccc-ttgagtcac
B D               Armadillo  cccccttt-ag-aaa---------------ga---aacgaaactg-aa---aatctcccc-ttgagtcac
B D                 Opossum  cccctt---at-aaa---------------gg---acaaaa-----ag---agactcctg----------
B D         Tasmanian devil  gccctt---at-aaa---------------gt---accaaa-----ag---tgccagctt----------
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================

                      Human  aa----------gataaaagttccac-cgttctct--at---gggact-cccct-gctct----caatt-
                      Chimp  aa----------gataaaagttccac-cgttctct--at---gggact-cccct-gctct----caatt-
                    Gorilla  aa----------gataaaagttccac-cgttctct--at---gggact-cccct-gctct----caatt-
                  Orangutan  aa----------gataaaagttccac-tgttctct--at---gggact-cccct-gctct----caatt-
                     Gibbon  aa----------gataaaagttccac-cgttctct--at---gggact-cccct-gctct----cagtt-
                     Rhesus  aa----------gataaaagttccac-tgttctct--at---gggact-cccct-gctct----caatt-
        Crab-eating macaque  aa----------gataaaagttccac-tgttctct--at---gggact-cccct-gctct----caatt-
                     Baboon  aa----------gataaaagttccac-tgttctct--at---gggact-cccct-gctct----caatt-
               Green monkey  aa----------gataaaagttccac-tgttctct--at---gggact-cccct-gctct----caatt-
                   Marmoset  aa----------gat-aaagttccac-cattctct--at---gggcct-cccct-gctct----gaact-
            Squirrel monkey  aa----------gat-aaagttccac-cattctct--ac---gggact-cccct-gctct----gaatt-
                   Bushbaby  aa----------cataaatgttccac-tgttcttt--at---gggact-cccct-gctct----gaatt-
         Chinese tree shrew  ga----------tataaatgttccac-ttttctct--aa---gggact-cccct-gctct----gaatt-
                   Squirrel  aa----------aataaatgttccat-tgttctct--aa---gggact-cccct-gctct----gaact-
     Lesser Egyptian jerboa  ag----------aataaa-gttccac-tgttcgct--aa---gggact-cccct-gctct----gaact-
               Prairie vole  aa----------aataaaaatcccacttcttttct--aa---gggact-cccct-actct----gagct-
            Chinese hamster  aa----------aataaaaatcccacttcttctct--aa---gggact-cccct-actct----gaatt-
             Golden hamster  aa----------aataaaaatcccgcttcttctct--ga---gggact-cccct-accct----gaatt-
                      Mouse  aa----------aataaacgttccac-tcttctct--ga---gggact-cccct-actct----gaatt-
                        Rat  aa----------aataaaagttccac-tcttccccaaga---gggact-cccct-actct----gaatt-
             Naked mole-rat  ag----------aacaagcgttccac-tctccttt--aa---gggact-cccct-gctct----gaatt-
                 Guinea pig  ag----------aataagtgttctac-tcttctct--aa---gggact-cccct-gctct----gagtt-
                 Chinchilla  ag----------aataagtgttccac-tcttctct--aa---gggact-cccct-gctct----gaatt-
           Brush-tailed rat  ag----------agtaagcgtttcac-tcttctct--aa---gggact-cccct-gctct----gagtt-
                     Rabbit  ac----------aatgaacgttcca------gtct--aa---gggactccccct-gatct----gaatt-
                       Pika  accaaccaactgactggatattccac-atgtatct--aa---gggacg-cccct-gatct----aaact-
                        Pig  tg----------gatgaacgttccac-tcttctgt--aa---gggact-cccct-gctct----caattg
                     Alpaca  tg----------gatgaacgtcccac-tcttttgt--aa---gggact-cccct-gctct----gaatt-
             Bactrian camel  tg----------gatgaacgtcccac-tcttttgt--aa---gggact-cccct-gctct----gaatt-
                    Dolphin  tg----------gatgaatgttccac-tcttccgt--aa---gggact-cccct-gctct----gaatt-
               Killer whale  tg----------gatgaatgttccac-tcttccgt--aa---gggact-cccct-gctct----gaatt-
           Tibetan antelope  tg----------gatgaatgttccac-ccttctgt--aa---gggact-cccca-gctct----gaatt-
                        Cow  tg----------gatgaatgttccac-tcttctgt--aa---gggact-cccca-gctct----gaatt-
                      Sheep  tg----------gataaatgttccac-ccttctgt--aa---gggact-cccca-gctct----gaatt-
              Domestic goat  tg----------gataaatgttccac-ccttctgt--aa---gggact-cccca-gctct----gaatt-
                      Horse  ta----------ggtgaacgttccac-tcttctcc--aa---gggact-cccct-gctct----gaact-
           White rhinoceros  ta----------ggtgatcgttccac-tcttctct--aa---gggact-cccct-gctct----gaatt-
                        Cat  ta----------gatgaacattccac-cctgctct--gaatggggg---------gcggg----ggggg-
                        Dog  ta----------ggtgaacattccat-tcttctct--ga---gggact-cccct-gctct----caatt-
                    Ferret   ta----------ggtgaacattccac-tctcctct--aa---gggact-cccct-gctgt----gaatt-
                      Panda  ta----------ggtgaacattccac-tcttctct--ga---gggact-cccct-gctct----gaatt-
             Pacific walrus  ta----------ggtgaacattccac-tctcctct--aa---gggact-cccct-gctct----gaatt-
               Weddell seal  ta----------ggtgaacattccac-tctcctct--aa---gggact-cccct-gctct----gaatt-
           Black flying-fox  ta----------gatgagtgttccac-tctactct--aa---ggggat-cccct-tctct----gaatt-
                    Megabat  ta----------gatgagtgttccac-tctactct--aa---ggggat-cccct-tctcc----gaatt-
              Big brown bat  ta----------gatgaatgttccac-tcttctct--aa---ggggat-cccct-gctct----gaatt-
       David's myotis (bat)  ta----------gatgcatgttccac-tcttctct--aa---ggggat-cccct-gctct----gaatt-
                   Microbat  ta----------gatgcatgttccac-tcttctct--aa---ggggat-cccct-gctct----gaatt-
                   Hedgehog  ca----------gatg-ttgttccac-ttctgtgt--aa---gggact-cccct-gctct----gagct-
                      Shrew  ca----------ggcgaacattccac-tcagagtt--aa---gggact-cccct-tctctccaggagcc-
            Star-nosed mole  ca----------gataaacgttccat-tcatgtct--aa---gggact-cccct-gttct----gaatt-
                   Elephant  aa----------gataaacgttccat-tgttctct--aa---gggact-cccct-gccct----aaatt-
        Cape elephant shrew  aa----------gacaaacgttccac-tgttctca--aa---gggact-cccct-gccct----gaatt-
                    Manatee  aa----------gataaacgttccat-tgttctct--aa---gggact-cccct-gccct----gaatt-
           Cape golden mole  aa----------gataaacgttccac-tgttctct--aa---gggact-cccct-gccct----gaatt-
                     Tenrec  aa----------gataaacgttccac-tgttcttg--aa---gggact-cctct-gctct----gaatt-
                   Aardvark  ag-------------aaatgttccac-tgttctct--aa---ggggct-cccct-gccct----gaatt-
                  Armadillo  aa----------gataaacgttccgc-tgttctct--aa---gggact-cccct-gccct----gaatt-
                    Opossum  gg----------gaaaaggc-tatat-tacctgcc--ag---gggatt-ctctgagtcct----tggct-
            Tasmanian devil  ta----------gaaaaatcttacct-tacctgct--aa---gtgatt-ctctcagtctt----tggct-
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================

                      Human  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                      Chimp  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                    Gorilla  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                  Orangutan  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                     Gibbon  ggc----------gggag---g---gtctg----------------ggaa----gttggaaggaaagg-t
                     Rhesus  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
        Crab-eating macaque  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                     Baboon  ggc----------ggaag---g---gtctg----------------ggaa----gttagaaggaaagg-t
               Green monkey  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                   Marmoset  ggc----------gggag---g---gtctg----------------ggaa----gttagaaggaaaga-t
            Squirrel monkey  ggc----------aggag---g---gtctg----------------ggaa----gttagaaggaaagg-t
                   Bushbaby  ggc----------tggaa---g---gtcta----------------gaaa----gttagaaggagagg-t
         Chinese tree shrew  ggc----------gggag---g---gtctg----------------agag----gttaacaagagagg-t
                   Squirrel  ggt----------gggag---g---gtctg----------------agaa----gttccgag---agg-t
     Lesser Egyptian jerboa  ggc----------tgcag---g---ttctg----------------agaa----gctagaaggagagg-t
               Prairie vole  gtc----------agaag---g---t--tg----------------agga----gttag-aac--agt-a
            Chinese hamster  ggc----------gggag---g---t-ctg----------------aaaa----gttagaaac--aga-t
             Golden hamster  ggc----------gggag---g---t-ctg----------------agaa----gttagaaac--aga-t
                      Mouse  gcc----------aggat---g---t-cca----------------agaa----ggtagaaacagaga-t
                        Rat  gcc----------gggat---g---t-ctg----------------agaa----gctagatacagaga-t
             Naked mole-rat  ggt----------gggag---a---gtctg----------------agaa----attagaaggggagg-t
                 Guinea pig  ggt----------gggag---g---gtctg----------------acaa----gttagaaggggaggtt
                 Chinchilla  ggt----------gggag---g---gtctg----------------agaa----gttagaagaggagg-t
           Brush-tailed rat  ggt----------gggaa---g---gcctg----------------agaa----gtcagaaggggagg-t
                     Rabbit  ggc----------tggag---g---gtctg----------------agac----attaggaggagggg-t
                       Pika  g----------------a---g---gtctg----------------gggc----atcagaaggaggaa-t
                        Pig  ggg----------gggag---g---gtctg----------------agac----gtgagatggagagg-t
                     Alpaca  ggg----------cggag---g---gtctg----------------agaa----gttaggaggagagg-t
             Bactrian camel  ggg----------gggag---g---gtctg----------------agaa----gttaggaggagagg-t
                    Dolphin  ggg----------gggag---g---gtcag----------------agaa----gttagaaggagagg-t
               Killer whale  ggg----------gggag---g---gtcag----------------agaa----gttagaaggagagg-t
           Tibetan antelope  ggg----------gggag---g---gtcag----------------agaa----gttagaaagagagg-t
                        Cow  ggg----------gggag---g---gtcag----------------agac----gttagaaggagagg-t
                      Sheep  ggg----------gggag---g---gtcag----------------agaa----gttagaaggagagg-t
              Domestic goat  ggg----------gggag---g---gtcag----------------agaa----gttagaaggagagg-t
                      Horse  ggg----------gggaa---g---gtctg----------------agaa----gttagaagaagagg-t
           White rhinoceros  gga----------gggaa---g---gtctg----------------agaa----gttagaaggagagg-t
                        Cat  agg----------ggaag---g---gtctg----------------agaa----gttacaaggacagg-t
                        Dog  ggg----------agggg---gggcgtcta----------------agat----gttacaaagagagg-t
                    Ferret   ggg----------aggag---g---gtctg----------------agaa----gttagaaggagagg-t
                      Panda  ggg----------aggag---g---gtctg----------------agaa----gtaagaaggagaag-t
             Pacific walrus  ggg----------aggag---g---gtctg----------------aaaa----gttagaaggagagg-t
               Weddell seal  ggg----------aggag---g---gtctg----------------agaa----gttagaaggagagg-t
           Black flying-fox  ggg----------gggag---g---gtctg----------------agaa----gttagaaagagagg-t
                    Megabat  ggg----------gggag---g---gtctg----------------agaa----gttagaaagagagg-t
              Big brown bat  gggcgggggggggggggg---g---gtctg----------------agaa----gttagaaggagaag-t
       David's myotis (bat)  ggg-ggg---gtggggag---g---gtctg----------------agaa----gttagaaggagaag-t
                   Microbat  ggg-gggggtggggggaa---g---gtctg----------------agaa----gttagaaggagaag-t
                   Hedgehog  ggg-----------ggagggag---gtctg----------------agaagctacttagaaggacaag-t
                      Shrew  ggg-----------ggag---g---ctctg----------------agaaa--gggcagagagatggt-t
            Star-nosed mole  tca-----------ggag---g---gtctg----------------agaa----gttagaaggggagg-t
                   Elephant  ggc----------gggag---g---gtgtg----------------aaca----gttggaagaagaga-t
        Cape elephant shrew  tgt----------gggag---g---gtcag----------------agca----attggaagaagaga-t
                    Manatee  ggc----------gggag---g---gtctg----------------agca----gttgggagaagaga-t
           Cape golden mole  ggt----------gggag---g---gtatg----------------agca----gttggaagaagag---
                     Tenrec  ggt----------gggag---g---gtctg----------------agca----gttagaagaagag---
                   Aardvark  ggc----------aggag---g---gtctg----------------agca----gctggaagaagaga-c
                  Armadillo  gta----------gggac---g---ggctg----------------agaa----attggacggagggg-t
                    Opossum  ggg----------gaaaa---g---gagtgggttttaccaacttctagaa----gtgaagcaagaagg-c
            Tasmanian devil  agg----------gagga---g---gaatgggcttt-taaatatctagca----atgagacatggaga-t
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================

                      Human  gac
                      Chimp  gac
                    Gorilla  gac
                  Orangutan  gac
                     Gibbon  gac
                     Rhesus  gac
        Crab-eating macaque  gac
                     Baboon  gac
               Green monkey  gac
                   Marmoset  gac
            Squirrel monkey  gcc
                   Bushbaby  gac
         Chinese tree shrew  ggc
                   Squirrel  gac
     Lesser Egyptian jerboa  ggc
               Prairie vole  ggt
            Chinese hamster  gat
             Golden hamster  gat
                      Mouse  gat
                        Rat  gat
             Naked mole-rat  ggc
                 Guinea pig  ggc
                 Chinchilla  ggc
           Brush-tailed rat  ggc
                     Rabbit  g-c
                       Pika  g-c
                        Pig  ggc
                     Alpaca  ggc
             Bactrian camel  ggc
                    Dolphin  ggc
               Killer whale  ggc
           Tibetan antelope  cac
                        Cow  cac
                      Sheep  cac
              Domestic goat  cac
                      Horse  ggc
           White rhinoceros  ggc
                        Cat  ggc
                        Dog  ggc
                    Ferret   ggc
                      Panda  ggc
             Pacific walrus  ggc
               Weddell seal  ggc
           Black flying-fox  gac
                    Megabat  gac
              Big brown bat  ggc
       David's myotis (bat)  ggc
                   Microbat  ggt
                   Hedgehog  gac
                      Shrew  tga
            Star-nosed mole  ggc
                   Elephant  ggc
        Cape elephant shrew  ggc
                    Manatee  ggc
           Cape golden mole  ---
                     Tenrec  ---
                   Aardvark  ggc
                  Armadillo  ggc
                    Opossum  tgc
            Tasmanian devil  tac
                Stickleback  ---
     Yellowbelly pufferfish  ===
                       Fugu  ===
                     Turkey  ===
                    Chicken  ===
               Mallard duck  ===
         Tibetan ground jay  ===
                Zebra finch  ===
     White-throated sparrow  ===
                  Zebrafish  ===
              X. tropicalis  ===
            Green seaturtle  ===
         American alligator  ===
                 Budgerigar  ===
                Rock pigeon  ===
        Collared flycatcher  ===
        Medium ground finch  ===
                     Lizard  ---
           Peregrine falcon  ---
               Saker falcon  ===
                   Platypus  ===
                    Wallaby  ===

Inserts between block 10 and 11 in window
B D               Marmoset 3bp
B D        Squirrel monkey 5bp
        Chinese tree shrew 832bp

Alignment block 11 of 1009 in window, 6775833 - 6775852, 20 bps 
B D                   Human  ---------------aaaaa--------------------------------ttctgaatggttcga
B D                   Chimp  ---------------aaaaa--------------------------------ttctgaatggttcaa
B D                 Gorilla  ---------------aaaaa--------------------------------ttctgaatggttcaa
B D               Orangutan  ---------------aaaaa--------------------------------ttctgaatggttcaa
B D                  Gibbon  ---------------aaaaa--------------------------------ttccgaatggttcaa
B D                  Rhesus  ---------------aaaaa--------------------------------ttccaaatggttcaa
B D     Crab-eating macaque  ---------------aaaaa--------------------------------ttccaaatggttcaa
B D                  Baboon  ---------------aaaaa--------------------------------ttccaaatggttcaa
B D            Green monkey  ---------------aaaaa--------------------------------ttccaaatggttcaa
B D                Marmoset  ---------------aagaa--------------------------------tttcgaatgattcaa
B D         Squirrel monkey  ---------------aaaaa--------------------------------tttcgaatgattcaa
B D                Bushbaby  ---------------aagag--------------------------------tt-tgagtggttcaa
B D                Squirrel  ----------------aaaa--------------------------------gcttgaatgattcaa
     Lesser Egyptian jerboa  ----------------aaaa--------------------------------aattgaatggctcag
               Prairie vole  ----------------aaga--------------------------------gtttaaatggttcaa
B D         Chinese hamster  ----------------aaa-----------------------------------------agctcag
             Golden hamster  ----------------aaac--------------------------------attcaaatggttcag
B D                   Mouse  ----------------aaaaatttgaaagaaaa-------------------atttgaatggttaaa
B D                     Rat  ----------------aaaaatttgaaaaaaaatt-----------------ttttgaatggttaaa
B D          Naked mole-rat  ----------------aaaa--------------------------------atttgaatgtttcaa
B D              Guinea pig  ----------------aaaa--------------------------------atttgaatgtttcaa
                 Chinchilla  ----------------aaa---------------------------------atttgaatgtttcaa
           Brush-tailed rat  ----------------aaac--------------------------------atttgaatgtttcga
B D                  Rabbit  ----------------aaaa--------------------------------gtttgaatggttcca
B D                    Pika  ----------------agga--------------------------------gctgaaatagttcca
B D                     Pig  ----------------aaag--------------------------------gtttgaatggttcaa
B D                  Alpaca  ----------------aaaa--------------------------------gttcgaatggttcaa
             Bactrian camel  ----------------aaaa--------------------------------gttcgaatggttcaa
B D                 Dolphin  ----------------agaa--------------------------------gtttgaatggttcaa
               Killer whale  ----------------agaa--------------------------------gtttgaatggttcaa
           Tibetan antelope  ----------------aaaa--------------------------------gtttgaatgtttcca
B D                     Cow  ----------------agaa--------------------------------gtttgaatggttcca
B D                   Sheep  ----------------aaaa--------------------------------gtttgaatgtttcca
              Domestic goat  ----------------aaaa--------------------------------gtttgaatgtttcca
B D                   Horse  ----------------aaaa--------------------------------atttgaatatttcaa
B D        White rhinoceros  ----------------aaaa--------------------------------gtttgaatatttcaa
B D                     Cat  ----------------aaaa--------------------------------gtttgaatggttcag
B D                     Dog  ----------------aaaaaaaaaaaaaaaagacaaagagaggtggcagatagtcgagtggctcaa
B D                 Ferret   ----------------aaaa--------------------------------gtttgaatggttcaa
B D                   Panda  ----------------aaaa--------------------------------gtttgaatggttcaa
             Pacific walrus  ----------------aaaa--------------------------------gtttgaatggttcaa
               Weddell seal  ----------------aaaa--------------------------------gtttgaatggttcaa
           Black flying-fox  ----------------gaaa--------------------------------gtttgaatggttcaa
B D                 Megabat  ----------------aaaa--------------------------------gtttgaatggttcaa
              Big brown bat  ----------------aaaa--------------------------------gtttgaatggttcaa
       David's myotis (bat)  ----------------aaaa--------------------------------gtttgaatggttcca
B D                Microbat  ----------------aaaa--------------------------------gtttgaatggttcca
B D                Hedgehog  ----------------aaac--------------------------------atgtgaatggttcag
B D                   Shrew  ----------------gcaa--------------------------------gtgtgagtggtttca
            Star-nosed mole  ----------------aaaa--------------------------------ggttgaatggtttcc
B D                Elephant  ----------------aaaa--------------------------------gtttgaatggttcaa
        Cape elephant shrew  ----------------aata--------------------------------gtttgaatgattcaa
B D                 Manatee  ----------------aaaa--------------------------------gtctgaatggttcaa
           Cape golden mole  ----------------------------------------------------------atggc----
B D                  Tenrec  -----------------------------------------------------tctgagtggttcaa
                   Aardvark  ----------------aaca--------------------------------gtttgaatgattcca
B D               Armadillo  ----------------aaaa--------------------------------gtttgaatggttcaa
B D                 Opossum  aaggagggaatcggaggaagtggt----------------------------ggtagactgatttac
B D         Tasmanian devil  aagaaaataattgtagtaaa--------------------------------gctagattgattttc
B D             Stickleback  -------------------------------------------------------------------
    Yellowbelly pufferfish  ===================================================================
B D                    Fugu  ===================================================================
B D                  Turkey  ===================================================================
B D                 Chicken  ===================================================================
  D            Mallard duck  ===================================================================
        Tibetan ground jay  ===================================================================
B D             Zebra finch  ===================================================================
  D  White-throated sparrow  ===================================================================
B D               Zebrafish  ===================================================================
B D           X. tropicalis  ===================================================================
  D         Green seaturtle  ===================================================================
B D      American alligator  ===================================================================
B D              Budgerigar  ===================================================================
  D             Rock pigeon  ===================================================================
  D     Collared flycatcher  ===================================================================
B D     Medium ground finch  ===================================================================
B D                  Lizard  -------------------------------------------------------------------
  D        Peregrine falcon  -------------------------------------------------------------------
  D            Saker falcon  ===================================================================
        Chinese tree shrew  ===================================================================
B D                Platypus  ===================================================================
B D                 Wallaby  ===================================================================

Inserts between block 11 and 12 in window
B D        Squirrel monkey 319bp
B D        Tasmanian devil 3bp

Alignment block 12 of 1009 in window, 6775853 - 6775863, 11 bps 
B D                   Human  aagaggtagaa
B D                   Chimp  aagaggtagaa
B D                 Gorilla  aagaggtagaa
B D               Orangutan  aagaggtagaa
B D                  Gibbon  aagaggtagaa
B D                  Rhesus  aagaggtagaa
B D     Crab-eating macaque  aagaggtagaa
B D                  Baboon  aagaggtagaa
B D            Green monkey  aagaggtagaa
B D                Marmoset  aagaggtagaa
B D         Squirrel monkey  aagaggtagaa
B D                Bushbaby  aagaggtggag
         Chinese tree shrew  aagaggtagaa
B D                Squirrel  agtaggtagaa
     Lesser Egyptian jerboa  aggaggttgca
               Prairie vole  aggaggcagca
B D         Chinese hamster  aggaggcagca
             Golden hamster  aggaagcagca
B D                   Mouse  agaatgaggca
B D                     Rat  agaatgaggca
B D          Naked mole-rat  aggaggtggaa
B D              Guinea pig  aagaggtggaa
                 Chinchilla  aagaggt-gaa
           Brush-tailed rat  aagaggtggaa
B D                  Rabbit  aagacatggaa
B D                    Pika  aagaggtggaa
B D                     Pig  aagaggtggac
B D                  Alpaca  aagagacggag
             Bactrian camel  aagagacggag
B D                 Dolphin  gagaagtggaa
               Killer whale  gagaagtggaa
           Tibetan antelope  aagaagtggaa
B D                     Cow  aagaggtggaa
B D                   Sheep  aagaagtggaa
              Domestic goat  aagaagtagaa
B D                   Horse  aagaggtggaa
B D        White rhinoceros  aagaggaggaa
B D                     Cat  aagagatggaa
B D                     Dog  acaaa------
B D                 Ferret   aagagggggac
B D                   Panda  aagaggtggac
             Pacific walrus  aagaggtggac
               Weddell seal  aagaggtggac
           Black flying-fox  aagtgatggaa
B D                 Megabat  aagtgatggaa
              Big brown bat  aaggggtggac
       David's myotis (bat)  aaggggtggac
B D                Microbat  aaggggtggac
B D                Hedgehog  gaaaagcaaat
B D                   Shrew  gaggagcagga
            Star-nosed mole  aagaactggga
B D                Elephant  aagaggtggaa
        Cape elephant shrew  gtaaggtaaac
B D                 Manatee  aagaggtggaa
           Cape golden mole  agcagtttgag
B D                  Tenrec  aagaggtggaa
                   Aardvark  aagaggtggaa
B D               Armadillo  aaaaagtggaa
B D                 Opossum  ------tggaa
B D         Tasmanian devil  gggaggtggaa
B D             Stickleback  -----------
    Yellowbelly pufferfish  ===========
B D                    Fugu  ===========
B D                  Turkey  ===========
B D                 Chicken  ===========
  D            Mallard duck  ===========
        Tibetan ground jay  ===========
B D             Zebra finch  ===========
  D  White-throated sparrow  ===========
B D               Zebrafish  ===========
B D           X. tropicalis  ===========
  D         Green seaturtle  ===========
B D      American alligator  ===========
B D              Budgerigar  ===========
  D             Rock pigeon  ===========
  D     Collared flycatcher  ===========
B D     Medium ground finch  ===========
B D                  Lizard  -----------
  D        Peregrine falcon  -----------
  D            Saker falcon  ===========
B D                Platypus  ===========
B D                 Wallaby  ===========

Inserts between block 12 and 13 in window
B D                  Shrew 1489bp

Alignment block 13 of 1009 in window, 6775864 - 6775917, 54 bps 
B D                   Human  ta--ta-ttt-ctagaatcct---tgt---c-tactttgcagccagggct-t-ggg---ttagagttgca
B D                   Chimp  ta--ta-ttt-ctagaatcct---tgt---c-tactttgtggccagggct-t-ggg---ttaaagttgca
B D                 Gorilla  ta--ta-ttt-ctagaatcct---tgt---c-tactttgcggccagggct-t-ggg---ttaaagttgca
B D               Orangutan  tg--ta-ttt-ctagaatcct---tgt---c-tactttacggccagggct-t-ggg---ttaaagttgca
B D                  Gibbon  ta--ta-ttt-ctagaatcct---tgt---c-tactttgcagccagggct-t-ggg---ttaaagttgca
B D                  Rhesus  aa--ta-ttt-ctagaaccct---ttt---c-tactttgcagacagggct-t-ggg---ttaaagttgca
B D     Crab-eating macaque  aa--ta-ttt-ctagaaccct---ttt---c-tactttgcagacagggct-t-ggg---ttaaagttgca
B D                  Baboon  ta--ta-ttt-ctagaaccct---ttt---c-tactttgcggacagggct-t-ggg---ttaaagttgca
B D            Green monkey  ta--ta-ttt-ctagaaccct---ttt---c-tactttgcggacaaggct-t-ggg---ttaaagttgca
B D                Marmoset  tc--ta-ttt-ctagaatcct---tgt---c-tattttgcggccagggct-t-ggg---ttaaagttgca
B D         Squirrel monkey  ta--ta-ttt-ctagaatcct---tgt---c-tactttgcggccagggct-t-ggg---ttaaagttgca
B D                Bushbaby  ta--ta-ttt-gtagaatctt---tgt---c-cactttgaggccagggct-t-ggg---ttaaagttgca
         Chinese tree shrew  ta--ta-ttt-ctagaatcct---cgt---c-cactttggggccaggact-t-ggg---ttacagttgca
B D                Squirrel  ta--ta-ttt-ctagaatgct---t-t---t-tgctttggggctggggctct-gg----ataaagtttca
     Lesser Egyptian jerboa  gg--ta-ttt-ctagaatcct---tgt---c-tgctttaggtc-ggggct-t-ag----ttaaacttgta
               Prairie vole  ta--ta--tt-ctcaattcct---tgc---c-tgcttttggtctgggact-t-ga----ttaaagttgtg
B D         Chinese hamster  tg--ta--tt-ctcaaatcct---tgt---t-tgc--ttggtctggggat-t-gg----ttaaagttgtg
             Golden hamster  cc--ca--gc-ctcagatcct---tgt---t-tgc--ttgatctggggct-t-gg----ttaacggtgtg
B D                   Mouse  ta--ta--tt-tttgaaccct---tgt---c-tgcttttggcctagggct-c-tg----ttaaaattgtg
B D                     Rat  ta--ta--tt-ctcaaaccct---tgt---c-tgcttttggcctagggct-c-gg----ttaaaattgtg
B D          Naked mole-rat  ta--gg-ttt-ctagaatcct---ctt---c-catcttgggaccagtgct-g-ggg---ttaaagttaca
B D              Guinea pig  ta--ga-ttt-ctaggattcg---tgt---c-tgttttggagccaaggtt-t-gga---ttaaagttgca
                 Chinchilla  ta--ga-ttt-ctaaaatcct---cat---c-tgttttggggtcagggtt-t-ggg---ttaaagttgca
           Brush-tailed rat  tg--ga-ttt-ctagaattct---cat---c-tattttggggccagggtt-t-ggg---ttaaagttgca
B D                  Rabbit  ta--ca-tgt-ctagaatctt---tgt---c-cactttggggccagggct-t-ggg---ttcaagttgca
B D                    Pika  ta--tgtttt-cttgcatcat---catctcc-cactttggggtgagggct-t-ggg---ttaaagtcaca
B D                     Pig  ta--ta-ttt-ccagaatcct---cac---c-cactttggaggcagggct-t-ggg---taaaagttgca
B D                  Alpaca  ta--ca-ttt-taagagtcct---tgt---c-catgttggggtcagggct-t-ggg---gtaaagttgca
             Bactrian camel  ta--ca-ttt-taagagtcct---tgt---c-cacgttggggtcagggct-t-ggg---gtaaagttgca
B D                 Dolphin  ta--ta-gtt-caagaacccg---tgt---c-cactttggagccagggcc-t-ggg---ttaaagtcgca
               Killer whale  ta--ta-gtt-caagaacccg---tgt---c-cactttggagccagggcc-t-ggg---ttaaagtcgca
           Tibetan antelope  tattta-ttt-tcagaatttt---tgc---c-cattttggagccagggat-t-gaa---ttaaagttgca
B D                     Cow  tattta-ttt-tcagaatcct---tgc---c-cactttggagccagggat-t-gag---ttaaagttgca
B D                   Sheep  tattta-ttt-tcagaattct---tgc---c-cattttggagccagggat-t-gaa---ttaaagttgca
              Domestic goat  tattta-ttt-tcagaattct---tac---c-cattttggagccagggat-t-gaa---ttaaagttgca
B D                   Horse  tc--ta-ttt-ctagaatcct---tgt---c-cactttcgggccagggct-t-gga---ttaaagttgca
B D        White rhinoceros  ta--ta-ttt-ctagaatcct---tgc---c-cactttggggccagggct-t-ggg---ttaaagttgca
B D                     Cat  ta--ta-gct-ctggaatcct---tgt---c-tacttcgggaccagggct-t-ggg---ttaaagttgca
B D                     Dog  ta--ta-tct-ctagaatctt---tgt---c-tactttgggaccagtgct-tgggg---ggaaagttgca
B D                 Ferret   tc--ta-tct-ctagaatcct---cct---c-tacttggggaccaatgct-t-tgg---ttcaaattgca
B D                   Panda  tc--ta-tct-ctagaatcct---cat---c-tacttggagaccagtgct-t-ggg---ttaaagttgca
             Pacific walrus  tc--ta-tct-ctagaatcct---cgt---c-tacttggggaccagtgct-t-ggc---ttaaagttgca
               Weddell seal  tc--ta-ttt-ctagaatcct---cat---c-tacttggggaccagtgct-t-ggc---ttaacgttgca
           Black flying-fox  ta--ta-ttt-ctagaatcct---tgt---cacactttggggccagggct-t-ggg---ttaaagttgaa
B D                 Megabat  ta--ta-ttt-ctagaatcct---cgt---cacactttggggccagggct-t-ggg---ttaaagttgaa
              Big brown bat  ta--ta-ttt-ctagaatcct---tgt---cccactttggggccagggct-t-ggg---ttaaagttgca
       David's myotis (bat)  ta--ta-ttt-ctagaatcct---tgt---cccactttggggccagggct-t-ggg---ttaaagttgca
B D                Microbat  ta--ta-ttt-ctagaatcct---tgt---cccactttggggccagggct-t-ggg---ttaaagttgca
B D                Hedgehog  tg--ga-att-ctagaatact---tgt---t-catgctgggactaggact-g-aag---ttaaggttgca
B D                   Shrew  cc--ta-ttt-ct--agtcccgagtgt---c-caccctggggccggggct-t-ggg---ttaaagttgca
            Star-nosed mole  ta--ta-ttt-ctagagtcct---cgt---c-cactttgggactagggct-t-ggg---gtaaagtcaca
B D                Elephant  ta--ta-ttt-ccataatccg---tgt---c-cactttggggacagggct-t-gga---ttaaagttgca
        Cape elephant shrew  ta--ta-tttcccataatcca---tgt---t-cactttgggaccagggct-t-ggg---ttaaaattaca
B D                 Manatee  ta--ta-ttt-ccataatcct---tgt---c-cactttggggacaaggct-t-ggg---ttaaagttgca
           Cape golden mole  tg---a-ttt-ccataatcct---tgc---c-cattttggggccagggtt-----------aaaattgca
B D                  Tenrec  tg--ca-ttt-ccatcattct---ggc---c-cactttggggccagggct-g-ggg---tgaaagttgca
                   Aardvark  ta--ta-ttt-ccataatcct---tgt---c-cactttggggctaggctt-t-ggg---ttaaagttgca
B D               Armadillo  ta--ga-ttt-ctgtaatcct---tgt---c-tactttagggccagggct-t-ggg---ttaaagttgca
B D                 Opossum  ta--aa--tt-ttgcaaaccc---------c-ctctttatg---aggact-t-ctg---cca--------
B D         Tasmanian devil  ta--ta--ct-ctataagtcc---------c-ctctttataaataggaca-c-ataggttca--------
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================

Inserts between block 13 and 14 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 4024bp

Alignment block 14 of 1009 in window, 6775918 - 6775925, 8 bps 
B D                   Human  ggaagtgg
B D                   Chimp  ggaagtgg
B D                 Gorilla  ggaagtgg
B D               Orangutan  ggaagtgg
B D                  Gibbon  ggaagtgg
B D                  Rhesus  ggaagtgg
B D     Crab-eating macaque  ggaagtgg
B D                  Baboon  ggaagtgg
B D            Green monkey  ggaagtgg
B D                Marmoset  ggaagtgg
B D         Squirrel monkey  ggaagtgg
B D                Bushbaby  ggaagtgg
         Chinese tree shrew  ggaaatgg
B D                Squirrel  gaagttg-
               Prairie vole  ctagttga
B D         Chinese hamster  ggagttga
             Golden hamster  ggagttga
B D                   Mouse  ggagttga
B D                     Rat  agagttga
B D          Naked mole-rat  ggaagtgg
B D              Guinea pig  ggaagtgg
                 Chinchilla  ggaagtgg
           Brush-tailed rat  ggaattgg
B D                  Rabbit  ggaagtgg
B D                    Pika  agaagtgg
B D                     Pig  gatggtgg
B D                  Alpaca  ggaaatga
             Bactrian camel  gtaaatga
B D                 Dolphin  ggaagtgg
               Killer whale  ggaagtgg
           Tibetan antelope  ggaggcaa
B D                     Cow  ggaggcag
B D                   Sheep  ggaggcaa
              Domestic goat  ggaggcaa
B D                   Horse  ggaagtgg
B D        White rhinoceros  ggaagtgg
B D                     Cat  ggaagtgg
B D                     Dog  ggaagtgg
B D                 Ferret   ggaagtgg
B D                   Panda  ggaagtgg
             Pacific walrus  ggaagtgg
               Weddell seal  ggaagtgg
           Black flying-fox  ggaaatgg
B D                 Megabat  ggaaatgg
              Big brown bat  ggaagtgg
       David's myotis (bat)  ggaagtgg
B D                Microbat  ggaagtgg
B D                Hedgehog  ggaaatgg
B D                   Shrew  ggaagtga
            Star-nosed mole  gaaaatgg
B D                Elephant  ggacgttg
        Cape elephant shrew  ggatgttg
B D                 Manatee  ggacattg
           Cape golden mole  ggacgttg
B D                  Tenrec  ggatggtg
                   Aardvark  gactgttg
B D               Armadillo  ggaagttg
B D                 Opossum  gga-----
B D         Tasmanian devil  gga-----
B D             Stickleback  --------
    Yellowbelly pufferfish  ========
B D                    Fugu  ========
B D                  Turkey  ========
B D                 Chicken  ========
  D            Mallard duck  ========
        Tibetan ground jay  ========
B D             Zebra finch  ========
  D  White-throated sparrow  ========
B D               Zebrafish  ========
B D           X. tropicalis  ========
  D         Green seaturtle  ========
B D      American alligator  ========
B D              Budgerigar  ========
    Lesser Egyptian jerboa  ========
  D             Rock pigeon  ========
  D     Collared flycatcher  ========
B D     Medium ground finch  ========
B D                  Lizard  --------
  D        Peregrine falcon  --------
  D            Saker falcon  ========
B D                Platypus  ========
B D                 Wallaby  ========

Inserts between block 14 and 15 in window
B D               Hedgehog 1392bp

Alignment block 15 of 1009 in window, 6775926 - 6775959, 34 bps 
B D                   Human  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D                   Chimp  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D                 Gorilla  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D               Orangutan  cctgga----tttgggaggagagaa-------taaat-ccgtccct
B D                  Gibbon  cctgga----tttgggaggagtgaa-------taaat-ccgtccct
B D                  Rhesus  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D     Crab-eating macaque  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D                  Baboon  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D            Green monkey  cctaga----tttgggaggagttaa-------taaat-ccgtccct
B D                Marmoset  cttgga----tttgggaggagttaa-------taaat-ccgtccct
B D         Squirrel monkey  cttgga----tttgggaggagttaa-------taaat-ccgtccct
B D                Bushbaby  cctgga----tttgggaggagttaa-------taaat-cagttcca
         Chinese tree shrew  cctgga----tgtgggaggagttta-------aaaat-cagtccgt
B D                Squirrel  cctgga----tttggaaggagttaa-------taaat-cagcccct
               Prairie vole  cctgga----ttcggaaggagttaa-------taaat-cagtccct
B D         Chinese hamster  cctgga----tttggaaggggctaa-------taaat-cagtccct
             Golden hamster  cctgga----tttggagggagttaa-------taaac-cagtccct
B D                   Mouse  cctggg----tttcgaaggagctga-------taaat-ccgtccct
B D                     Rat  cctggg----tttagaaggagctaa-------taaat-cagtccct
B D          Naked mole-rat  cctgga----tttggaaggagttaa-------caaat-cgatctct
B D              Guinea pig  cctgga----tttggaaggagttaa-------taaat-cagtc-ca
                 Chinchilla  cctgga----tttggaaggagttaa-------taaat-cagtccct
           Brush-tailed rat  cctgga----tttggaaggagttaa-------taaat-cagtctct
B D                  Rabbit  cctggg----tttgggaggagctga-------taaag-cagtgcct
B D                    Pika  cctgga----tttggaaggagttaa-------taaaa-catgctga
B D                     Pig  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                  Alpaca  cctgga----tttgggaggagttaa-------taaat-cagtccct
             Bactrian camel  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                 Dolphin  cctgga----ttggggaggaatgaa-------taaat-ccgtccct
               Killer whale  cctgga----ttggggaggaattaa-------taaat-ccgtccct
           Tibetan antelope  tctgga----ctgggg-ggagttga-------taaat-cagtccct
B D                     Cow  tctgga----ctgggg-ggagttga-------taaat-cagtcctg
B D                   Sheep  tctgga----ctgggg-ggagttga-------taaat-cagtccct
              Domestic goat  tctgga----ctgggg-ggagttga-------taaat-cagtccct
B D                   Horse  cctgga----tttcggaggaattaa-------gaaat-cagtccct
B D        White rhinoceros  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                     Cat  cctgga----tttgggaggagttaa-------tcaat-cagtccct
B D                     Dog  cctgga----tttgggaggagctaa-------taaat-cagtccct
B D                 Ferret   tttgga----tttgggaggagttaa-------taaatccagtccct
B D                   Panda  cctgga----tttgggaggagttaa-------taaat-cagtccct
             Pacific walrus  cttgga----tttgg--ggagttaa-------caaat-cagtccct
               Weddell seal  cttgga----tttgggaggagttaa-------taaat-cagtcctt
           Black flying-fox  cctgga----tttgggaggagttaa-------taaat-cagtccct
B D                 Megabat  cctgga----tttgggaggagttaa-------taaat-cagtccct
              Big brown bat  cctggg----tttgggaggagttaa-------tacat-cagttcct
       David's myotis (bat)  cctgga----tctgggaggagttaa-------tacat-cagttcct
B D                Microbat  cctgga----tttgggaggagttaa-------tacat-cagttcct
B D                Hedgehog  cctgaa----tttggaaagagttaa-------taaat-cggt-ctt
B D                   Shrew  cctgga----tttgg------------------gaat-ctgtcccc
            Star-nosed mole  cctggg----ttggg-aggagttaa-------taaat-cagcccct
B D                Elephant  cttgga----tttgggagaagttaa-------taaat-catgccct
        Cape elephant shrew  attgga----ttggggaagagttga-------taaat-caggccct
B D                 Manatee  cttgga----tttgggaggagtc------------at-cagtccct
           Cape golden mole  cttgga----ttggggaggagttga-------taaat-cagtctct
B D                  Tenrec  cttgga---tttggggaggagttga-------taaat-c-------
                   Aardvark  cttgga----tttgggaggagttga-------taaat-cagttctt
B D               Armadillo  cttgga----tttgggagaagttaa-------taaat-cagtcgct
B D                 Opossum  --tggactatctgtgaaagaataac---tttctatat-cgatccag
B D         Tasmanian devil  --tgaa----ctgtgaaacagtaacaaatttctatat-tgatccac
B D             Stickleback  ----------------------------------------------
    Yellowbelly pufferfish  ==============================================
B D                    Fugu  ==============================================
B D                  Turkey  ==============================================
B D                 Chicken  ==============================================
  D            Mallard duck  ==============================================
        Tibetan ground jay  ==============================================
B D             Zebra finch  ==============================================
  D  White-throated sparrow  ==============================================
B D               Zebrafish  ==============================================
B D           X. tropicalis  ==============================================
  D         Green seaturtle  ==============================================
B D      American alligator  ==============================================
B D              Budgerigar  ==============================================
    Lesser Egyptian jerboa  ==============================================
  D             Rock pigeon  ==============================================
  D     Collared flycatcher  ==============================================
B D     Medium ground finch  ==============================================
B D                  Lizard  ----------------------------------------------
  D        Peregrine falcon  ----------------------------------------------
  D            Saker falcon  ==============================================
B D                Platypus  ==============================================
B D                 Wallaby  ==============================================

Inserts between block 15 and 16 in window
          Tibetan antelope 319bp

Alignment block 16 of 1009 in window, 6775960 - 6775960, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  g
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
               Prairie vole  a
B D         Chinese hamster  t
             Golden hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Rabbit  t
B D                    Pika  a
B D                     Pig  t
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
B D                Hedgehog  g
B D                   Shrew  g
            Star-nosed mole  t
B D                Elephant  t
        Cape elephant shrew  t
B D                 Manatee  t
           Cape golden mole  t
                   Aardvark  t
B D               Armadillo  t
B D                 Opossum  t
B D         Tasmanian devil  t
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D                  Tenrec  -

Inserts between block 16 and 17 in window
B D                  Sheep 318bp

Alignment block 17 of 1009 in window, 6775961 - 6775961, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  a
B D                   Shrew  g
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  a
B D                 Manatee  g
           Cape golden mole  g
                   Aardvark  g
B D               Armadillo  t
B D                 Opossum  g
B D         Tasmanian devil  g
            Golden hamster  -
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  -
              Prairie vole  -
B D                  Tenrec  -
B D                     Rat  -
B D                   Mouse  -

Inserts between block 17 and 18 in window
B D                    Cow 319bp
             Domestic goat 316bp

Alignment block 18 of 1009 in window, 6775962 - 6775965, 4 bps 
B D                   Human  gtca
B D                   Chimp  gtca
B D                 Gorilla  gtca
B D               Orangutan  gtca
B D                  Gibbon  gtca
B D                  Rhesus  gtca
B D     Crab-eating macaque  gtca
B D                  Baboon  gtca
B D            Green monkey  gtca
B D                Marmoset  gtca
B D         Squirrel monkey  gtca
B D                Bushbaby  atca
         Chinese tree shrew  gtca
B D                Squirrel  gtca
               Prairie vole  gtca
B D         Chinese hamster  gtca
             Golden hamster  gtca
B D                   Mouse  gtca
B D                     Rat  gaca
B D          Naked mole-rat  gata
B D              Guinea pig  gtca
                 Chinchilla  gtca
           Brush-tailed rat  gtca
B D                  Rabbit  gtca
B D                    Pika  gtca
B D                     Pig  gtca
B D                  Alpaca  gtcg
             Bactrian camel  gtca
B D                 Dolphin  gtca
               Killer whale  gtca
           Tibetan antelope  gtca
B D                     Cow  gtca
B D                   Sheep  gtca
              Domestic goat  gtca
B D                   Horse  gtcc
B D        White rhinoceros  gtca
B D                     Cat  gtca
B D                     Dog  gtca
B D                 Ferret   gtca
B D                   Panda  gtca
             Pacific walrus  gtca
               Weddell seal  gtca
           Black flying-fox  gtca
B D                 Megabat  gtca
              Big brown bat  gcca
       David's myotis (bat)  gtca
B D                Microbat  gtca
B D                Hedgehog  gtca
B D                   Shrew  gtca
            Star-nosed mole  gtca
B D                Elephant  gtta
        Cape elephant shrew  gtta
B D                 Manatee  gtta
           Cape golden mole  gtta
B D                  Tenrec  ---a
                   Aardvark  gtta
B D               Armadillo  gtca
B D                 Opossum  atca
B D         Tasmanian devil  atca
B D             Stickleback  ----
    Yellowbelly pufferfish  ====
B D                    Fugu  ====
B D                  Turkey  ====
B D                 Chicken  ====
  D            Mallard duck  ====
        Tibetan ground jay  ====
B D             Zebra finch  ====
  D  White-throated sparrow  ====
B D               Zebrafish  ====
B D           X. tropicalis  ====
  D         Green seaturtle  ====
B D      American alligator  ====
B D              Budgerigar  ====
    Lesser Egyptian jerboa  ====
  D             Rock pigeon  ====
  D     Collared flycatcher  ====
B D     Medium ground finch  ====
B D                  Lizard  ----
  D        Peregrine falcon  ----
  D            Saker falcon  ====
B D                Platypus  ====
B D                 Wallaby  ====

Inserts between block 18 and 19 in window
B D                Opossum 22bp
B D        Tasmanian devil 1664bp

Alignment block 19 of 1009 in window, 6775966 - 6776061, 96 bps 
B D                   Human  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                   Chimp  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                 Gorilla  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D               Orangutan  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                  Gibbon  gcaa----a-tatttactgagcaagg-----------ctt------------------------------
B D                  Rhesus  gcaa----a-tatttactgagtaagg-----------gtt------------------------------
B D     Crab-eating macaque  gcaa----a-tacttactgagtaagg-----------gtt------------------------------
B D                  Baboon  gcaa----a-tatttactgagtaagg-----------gtt------------------------------
B D            Green monkey  gcaa----a-tatttactgagtaagg-----------gtt------------------------------
B D                Marmoset  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D         Squirrel monkey  gcaa----a-tatttactgagcgagg-----------gtt------------------------------
B D                Bushbaby  gcaa----a-tatttacagagcaagg-----------gtt------------------------------
         Chinese tree shrew  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                Squirrel  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
               Prairie vole  gcaa----a-tattt-----gttagg-----------gtt------------------------------
B D         Chinese hamster  gtaa----a-tattt-----gtaagg-----------gtt------------------------------
             Golden hamster  gtaa----a-tattt-----gtaagg-----------gtt------------------------------
B D                   Mouse  g---------tatttagtgaataaggtttttgtttttgtt------------------------------
B D                     Rat  gcaa----attatttagtgaataagg-----------att------------------------------
B D          Naked mole-rat  gcaa----a-tatttactgagcaaga-----------gtt------------------------------
B D              Guinea pig  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
                 Chinchilla  gcaa----a-tatttactgaacaagg-----------gtt------------------------------
           Brush-tailed rat  gtaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                  Rabbit  gcaa----a-tatttactgagcgagg-----------gtt------------------------------
B D                    Pika  gcat----a-tgttt--taagccaga-----------gtt------------------------------
B D                     Pig  gcaa----c-tgtttactgaacgagg-----------gct------------------------------
B D                  Alpaca  gcaa----a-tatttaccgagtgagg-----------act------------------------------
             Bactrian camel  gcaa----a-tatctaccgagtgagg-----------gct------------------------------
B D                 Dolphin  gcaa----a-tatttactgagcgagg-----------gct------------------------------
               Killer whale  gcaa----a-tatttactgagcgagg-----------gct------------------------------
           Tibetan antelope  gcaa----a-tatttactgaacaagg-----------gct------------------------------
B D                     Cow  gcaa----a-tatttactgaacaagg-----------gct------------------------------
B D                   Sheep  gcaa----a-tatttactgaacgagg-----------gct------------------------------
              Domestic goat  gcaa----a-tatttactgaatgagg-----------gcg------------------------------
B D                   Horse  gcaa----a-tatttactgagcaagg-----------gct------------------------------
B D        White rhinoceros  gcaa----a-tatttactgagcaagg-----------gct------------------------------
B D                     Cat  gcaa----a-tatttactgagcaagg-----------gct-----------------------------t
B D                     Dog  gcaa----a-tatttactgagcgaga-----------gctttttt------------------------t
B D                 Ferret   gcaa----a-tatttacagagcaagg-----------gctttttttttcctttctttttctttttctttt
B D                   Panda  gcaa----a-tatttactgagcaagg--------------gcttt------------------------t
             Pacific walrus  gcaa----a-tatttactgagcgagg-----------actgtttt------------------------t
               Weddell seal  gcaa----a-tatttactgagcaagg-----------actgtttttt-------------------tggt
           Black flying-fox  gcaa----a-tatttactgagcgtgg-----------gat------------------------------
B D                 Megabat  gcaa----a-tatttactgagcgtgg-----------gat------------------------------
              Big brown bat  gcaa----a-tatttactgatcatgg-----------gct------------------------------
       David's myotis (bat)  gcaa----a-tatttactgatcatgg-----------gct------------------------------
B D                Microbat  gcaa----g-tatttactgatcatgg-----------gct------------------------------
B D                Hedgehog  gcaaagtca-gctttacttagcaagg-----------gct------------------------------
B D                   Shrew  gcaa----a-tatttactgagcaaag-----------act------------------------------
            Star-nosed mole  gcaa----a-tatttactaagcaagg-----------gtt------------------------------
B D                Elephant  gcaa----a-tatttactgaacaaag-----------gcc------------------------------
        Cape elephant shrew  gcaa----a-tatttactgagcaaag-----------gcc------------------------------
B D                 Manatee  gcaa----a-tatttactgaacaaag-----------gcc------------------------------
           Cape golden mole  gcaa----a-tatttactgagcaaag-----------gcc------------------------------
B D                  Tenrec  gcaa----a-tatttactgagcaaag-----------ggc------------------------------
                   Aardvark  gcaa----a-tatttactgagcaaag-----------gcc------------------------------
B D               Armadillo  gcaa----a-tatttactgagcaagg-----------gtt------------------------------
B D                 Opossum  acaa----g-tatttat-------gg-----------gct------------------------------
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================

                      Human  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                      Chimp  -------ttccaagacggta-ta----aaacaaacaca---g------a-------------aaaaa---
                    Gorilla  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                  Orangutan  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                     Gibbon  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                     Rhesus  -------ttccaagacggta-ta----aaacaaacaca---g------a-------------aaaaa---
        Crab-eating macaque  -------ttccaagatggta-ta----aaacaaacaca---g------a-------------aaaaa---
                     Baboon  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
               Green monkey  -------ttccaagacggta-ta----aaacaaacaca---g------a-------------aaaaa---
                   Marmoset  -------ttccaagacagta-ca----aaacaaacaaa---g------a-------------aaaaa---
            Squirrel monkey  -------ttccaagacagta-ca----aaacaaataaa---g------a-------------aaaaa---
                   Bushbaby  -------ttccaagacagta-ta----aaacaaacaga---a------a-------------aaaag---
         Chinese tree shrew  -------ctccaagacagtg-ta----acacaaacaca---c------acacacacaccaacacaca---
                   Squirrel  ----t--ttttaagacagta-ta----aaacaaacata---gaa----a-------------aaaag---
               Prairie vole  -------ttccaagagaata-ta----aaacaaaaaca---ggc---ca-------------aaaaa---
            Chinese hamster  -------ttccaagacaata-taa---aaacaaaaaca---ggcaaaaa-------------aaaaa---
             Golden hamster  -------ttccaagacaat--------aaacaaaaaca---ggc----g-------------aaaaa---
                      Mouse  ----ttattttaaggcaaaa-ta----aaacaaataga---ggcaaaac-------------caaaacca
                        Rat  ----ttttttaaagacagca-ta----aaacaaataca---ggcaaaaa-------------caaaaaca
             Naked mole-rat  -------ttccaagacaata-ga----aaacagacaca---g------a-------------aaa-----
                 Guinea pig  -------ttcgaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
                 Chinchilla  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
           Brush-tailed rat  -------ttccaagacagta-ta----aaacaaacaga----------a-------------aaaaa---
                     Rabbit  -------ttccaagacagta-taaagcaaacagaaaaa----------a-------------aaaaa---
                       Pika  -------ttccaagacagta-aaag--aaaaaaacaca----------g-------------aaaaa---
                        Pig  -------tttcaagacagtg-ta----aaaccaacaca---g------a-------------agaaa---
                     Alpaca  -------tttcaagacagtctta----aaacaagcaca---g------g-------------aaaa----
             Bactrian camel  -------tttcaagacagtc-ta----aaacaagcaca---g------a-------------aaaaa---
                    Dolphin  -------tttcaagacagta-ta----aaacaaacata---g------a-------------agaaa---
               Killer whale  -------tttcaagacagta-ta----aaacaaacata---g------a-------------agaaa---
           Tibetan antelope  -------tttcaagacagtg-ta----aaagaaacata---g------g-------------agaaa---
                        Cow  -------tttcaagacagtg-ta----aaagaaacata---g------g-------------agaaa---
                      Sheep  -------tttcaagacaatg-ta----aaagaaacata---g------g-------------agaaa---
              Domestic goat  -------tttcaagacagtg-ta----gaagaaacata---g------g-------------agaaa---
                      Horse  -------tttcaagacaata-ta----aaacaaacaca---g-----------------------aa---
           White rhinoceros  -------tttcaagacaata-tg----aaacaaacaga---g------a-------------aaaaa---
                        Cat  tttttttttttaagacagta-ta----aaacaaacaca---g------g-------------aagaa---
                        Dog  tttttttttt---aatagtg-ta----aaacaaacaca---g------a-------------aaaaa---
                    Ferret   tttttttttttaagagagta-ta----acgtaaacaca---g------g-------------aaaaa---
                      Panda  tttttttttttaagagagta-ta----aaacaaacaca---g------a-------------aaaaa---
             Pacific walrus  tttttttttttaagagagta-ta----aaacaaacaca---g------a-------------aaaaa---
               Weddell seal  tttttttttttaagagagta-ta----aaacaaacaca---g------a-------------aaaaa---
           Black flying-fox  -------tttcaagaccatg-ta----aaacaaacacacatt------t-------------aaaaa---
                    Megabat  -------tttcaagaccatg-ta----aaacaaacacaca-t------t-------------aaaaa---
              Big brown bat  -------tttcaagacagtg-ta----aaacaaacaca---t------t-------------taaaa---
       David's myotis (bat)  -------tttcaagacagtg-ta----aaacaaacaca---t------t-------------aaaaa---
                   Microbat  -------tttcaagacagtg-ta----aaacaaacaca---t------t-------------aaaaa---
                   Hedgehog  -------taccaagacagca-tc----cagcaagcacc---t------a-------------tacaa---
                      Shrew  -------ttctcagacagta-ga----aaacaaacccc---a------g-------------cctcc---
            Star-nosed mole  -------ttccaagacagca-ta----aagcaaacgca---a------a-------------cacaa---
                   Elephant  -------ttccaagacagta-ta----aaacaaataga---a------a-------------aaaaa---
        Cape elephant shrew  -------ttcc-agacagta-ta----aaacaaacacg---g------g-------------gagaa---
                    Manatee  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaaa---
           Cape golden mole  -------tttcaagacagta-ta----aaacaaacaga---a------a-------------aag-----
                     Tenrec  -------ttccaagacagta-ta----aaacaaacaca---g------a-------------aaaca---
                   Aardvark  -------ttccaagacagtt-ta----aaacaaacaca---g------g-------------aaaaa---
                  Armadillo  -------ttccaggacagta-ta----aaacagacata---g------a-------------agaaa---
                    Opossum  -----agctttgggggaata-tt----aattaataaaa---a------g-------------gggaa---
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================

                      Human  ---------------gaat---------------------------------actc---a---gagagta
                      Chimp  ---------------gaat---------------------------------actc---a---gagagta
                    Gorilla  ---------------gaat---------------------------------actc---a---gagagta
                  Orangutan  ---------------gaat---------------------------------actc---a---gagagta
                     Gibbon  ---------------gaat---------------------------------actc---a---gagagta
                     Rhesus  ---------------taat---------------------------------actc---a---gagagta
        Crab-eating macaque  ---------------taat---------------------------------actc---a---gagagta
                     Baboon  ---------------taat---------------------------------actc---a---gagagta
               Green monkey  ---------------taat---------------------------------actc---a---gagagta
                   Marmoset  ---------------gaat---------------------------------actc---a---gaaagta
            Squirrel monkey  ---------------gaat---------------------------------actc---a---gaaagta
                   Bushbaby  ---------------g--------------------------------------tc---a---gaaagta
         Chinese tree shrew  ---------------aaaa---------------------------------accc---a---gaaagtc
                   Squirrel  ---------------cat------------------------------------tc---a---aaaaata
               Prairie vole  ---------------aaa------------------------------------tc---a---gaaagta
            Chinese hamster  ---------------aaa------------------------------------tc---a---gaaagta
             Golden hamster  ---------------taa------------------------------------tc---a---gaaagta
                      Mouse  aaccaaaacaaccccaaa------------------------------------tc---a---gaaagta
                        Rat  aaacaaaacaaccccaaa------------------------------------tc---a---gaaagta
             Naked mole-rat  -----------------------------------------------------------ac-ttaaagtg
                 Guinea pig  ---------------aaa------------------------------------tt---ac-tcaaagtg
                 Chinchilla  ---------------aaa------------------------------------tt---ac-tcaaagtg
           Brush-tailed rat  ---------------aaa------------------------------------tt---ac-tcaaagtg
                     Rabbit  ---------------aaa------------------------------------tc---tcagaaaaaca
                       Pika  ---------------aaa------------------------------------tt---atatataaaag
                        Pig  ---------------aaaaccccaag-----------------------cgccctt---a---gaaagca
                     Alpaca  --------------------------------------------------aaactc---a---gaaagta
             Bactrian camel  ---------------a-ac----aaa-----------------------caaactc---a---gaaagta
                    Dolphin  ---------------aaac---taaa-----------------------caaactc---g---gaaggta
               Killer whale  ---------------aaac---taaa-----------------------caaactc---a---gaaggta
           Tibetan antelope  ---------------acac------------------------------cagactc---a---gaaagta
                        Cow  ---------------acac------------------------------cagactc---a---gaaagta
                      Sheep  ---------------acac------------------------------cagactc---a---gaaagta
              Domestic goat  ---------------acac------------------------------cagactc---a---gaaagta
                      Horse  ---------------aaaa---aacc---------------------------ctc---a---gaaagga
           White rhinoceros  ---------------aaaa---aacc---------------------------ctc---a---gaaagta
                        Cat  ---------------aaaa---aa-----------------aaaccctcaaaactc---a---gaa-gta
                        Dog  ---------------aaaa---ga-------------gaacaaccaccaaaaactc---a---gaaagta
                    Ferret   ---------------aaaa---caaaa-caaaa----caacaaaacccaaaaactt---a---gaaagta
                      Panda  ---------------aaaa---aaca--cacca----caacaaaactcaaaaactc---a---gaaagtg
             Pacific walrus  ---------------aaaa---aaccaccaccaccaccaacaaaaagccaaaactc---a---gaaggtg
               Weddell seal  ----------------------------caacaacaacaacaaaaagccaaaactc---a---gaaagcg
           Black flying-fox  ---------------aaaa---aaaa----------------------aaaaccttcaga---aaa----
                    Megabat  ---------------aaaa---aaaa----------------------aaaaccttcaga---aaa----
              Big brown bat  ---------------aaac---acac----------------------aaaacctc---a---aaa----
       David's myotis (bat)  ---------------aaa----acac-----------------------acacctc---a---aaa----
                   Microbat  ---------------aaac---aaaa-----------------------ccacctc---a---aaa----
                   Hedgehog  ---------------gcaa---acaa-----------------------tacccgc---a---caaaata
                      Shrew  ---------------ctg----------------------------------tccc---c---aggggcc
            Star-nosed mole  ---------------acaa---aaaa------------------------attctc---a---ggaagta
                   Elephant  ---------------aa--------------------------------aatactc---a---gaaagtg
        Cape elephant shrew  ---------------aa--------------------------------tattc----------aaagtg
                    Manatee  ---------------aa--------------------------------tactc-----a---gaaagta
           Cape golden mole  -----------------------------------------------------------a---gaaaata
                     Tenrec  ---------------ca--------------------------------cactc-----a---gaaacga
                   Aardvark  ---------------aa--------------------------------aatactc---a---gaaagta
                  Armadillo  ---------------aaaa---------aaaagtgacaaaaaaacacagaacactc---a---caaagca
                    Opossum  ---------------aaac---------------------------------acta---g---gagtgct
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================

                      Human  tg-tgttgactgg-ttga-------t---------aactat
                      Chimp  tg-tgttgactgg-ttga-------t---------aactat
                    Gorilla  tg-tgttgactgc-ttga-------t---------aactat
                  Orangutan  tg-tgttgactgg-ttga-------t---------aactat
                     Gibbon  tg-tgttgactgg-ttga-------t---------aactat
                     Rhesus  tg-tgttgactgg-ttga-------t---------aactat
        Crab-eating macaque  tg-tgttgactgg-ttga-------t---------aactat
                     Baboon  tg-tgttgactgg-ttga-------t---------aactat
               Green monkey  tg-tgttgactgg-ttga-------t---------aactat
                   Marmoset  tg-tgttcactgg-ttga-------t---------aactat
            Squirrel monkey  tg-tgttcagtgg-ttga-------t---------aactct
                   Bushbaby  tg-tattaactga-ttgg-------t---------aactat
         Chinese tree shrew  tg-tgtcaattga-ctg--------t---------gacggt
                   Squirrel  tg---ttaattga-ttgg-------t---------agctat
               Prairie vole  cg-tgttcaatga-ttgg-------c---------agctac
            Chinese hamster  tg-tgttcattga-ttgg-------t---------agctgt
             Golden hamster  tg-tgttcattga-ttgg-------t---------aactgt
                      Mouse  tg-tgttcattga-ttgg-------c---------agctgt
                        Rat  cgccaatcaatga-gtgg-------c---------agctgt
             Naked mole-rat  tg-tgttcattga-ttgg-------t---------gattat
                 Guinea pig  tg-tgttcattga-tcag-------t---------gattat
                 Chinchilla  tg-tgttcattga-ttgg-------t---------gattat
           Brush-tailed rat  tg-tgtgcattga-tggg-------t---------gattat
                     Rabbit  tg-tgttcgttga-ctgg-------t---------cattgt
                       Pika  ta-tgtttcctgc-ctgg-------g---------agttat
                        Pig  tg-tgttgattga-tcag-------a---------gactgt
                     Alpaca  tg-tgctgattga-tcag-------t---------aactat
             Bactrian camel  tg-tgctgattga-tcgg-------t---------aactac
                    Dolphin  tg-tgttgattga-tcgg-------t---------aactat
               Killer whale  tg-tgttgattga-tcgg-------t---------aactat
           Tibetan antelope  tg-tgttgattga-tcgg-------t---------aactat
                        Cow  tg-tgttgattga-ctgg-------t---------aactat
                      Sheep  tg-tgttgattga-tcgg-------t---------aactat
              Domestic goat  tg-tgttgattga-tcgg-------t---------aactat
                      Horse  ca-tgttgattga-ttgg-------t---------aactat
           White rhinoceros  ca-tgttgattga-ttgg-------t---------aactat
                        Cat  tg-tgttgattga-ttgg-------t---------aactat
                        Dog  ca-tgttgattga-ttgg-------t---------aactat
                    Ferret   tg-tgttgatgga-ttag-------t---------aactat
                      Panda  tg-tgttgatgga-ttgg-------t---------a-----
             Pacific walrus  tg-tgttgatgga-ttgg-------t---------aactag
               Weddell seal  tg-tgttgatgga-ttgg-------t---------aactag
           Black flying-fox  tg-ttttcattga-ttgg-------t---------aactat
                    Megabat  tg-ttttcattga-ttgg-------t---------aactat
              Big brown bat  tg-tgtcgattga-ttgg-------ttattcagtcaatgac
       David's myotis (bat)  tg-tgttgattga-ttgg-------ttattcaatcaattac
                   Microbat  ta-tgttgattga-ttag-------ttattcaatcaattac
                   Hedgehog  tg-tctgtgttca-taggcaaccccc---------agcccc
                      Shrew  cg-cgtgcgttta-ttgg-------t---------cgctgt
            Star-nosed mole  tg-tgtgtatgga-ttgg-------t---------aacggt
                   Elephant  tg-tgttgatgga-ttgg-------t---------aactat
        Cape elephant shrew  tg-tgttgattga-ctga-------t---------aactat
                    Manatee  tg-tgtggattga-ttgg-------t---------aactat
           Cape golden mole  tg-tattgattga-ttgg-------t---------aactat
                     Tenrec  tg-tgctgactgc-ttgg-------t---------aactat
                   Aardvark  tg-tgtagaatga-ttgg-------t---------aactgt
                  Armadillo  tg-tgggaattgatttgg-------t---------agc---
                    Opossum  ta-aatttttcct-ttgt-------t---------aaatat
                Stickleback  -----------------------------------------
     Yellowbelly pufferfish  =========================================
                       Fugu  =========================================
                     Turkey  =========================================
                    Chicken  =========================================
               Mallard duck  =========================================
         Tibetan ground jay  =========================================
                Zebra finch  =========================================
     White-throated sparrow  =========================================
            Tasmanian devil  =========================================
                  Zebrafish  =========================================
              X. tropicalis  =========================================
            Green seaturtle  =========================================
         American alligator  =========================================
                 Budgerigar  =========================================
     Lesser Egyptian jerboa  =========================================
                Rock pigeon  =========================================
        Collared flycatcher  =========================================
        Medium ground finch  =========================================
                     Lizard  -----------------------------------------
           Peregrine falcon  -----------------------------------------
               Saker falcon  =========================================
                   Platypus  =========================================
                    Wallaby  =========================================

Inserts between block 19 and 20 in window
B D                Opossum 1621bp

Alignment block 20 of 1009 in window, 6776062 - 6776121, 60 bps 
B D                   Human  cggccatgac--agattagccatgt-ctgcag---cacgcacctgcggcc-----------act------
B D                   Chimp  cagccatgac--agattagccatat-ctgcag---cacgcacctgcggcc-----------act------
B D                 Gorilla  cagccatgac--agattagccatgt-ctgcag---cacgcacctgcggcc-----------act------
B D               Orangutan  cagccatgac--agattagccatgt-ctgtag---cactcacctgcggcc-----------act------
B D                  Gibbon  cagccatgac--agattagccatgt-ctgcag---cactcacctgcggcc-----------act------
B D                  Rhesus  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D     Crab-eating macaque  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D                  Baboon  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D            Green monkey  cagccatgac--agatta-ctatgt-ctgcag---cactcacctgcggtc-----------act------
B D                Marmoset  cagccatgac--aggttagcctcgt-ctgcag---cactcatctccggcc-----------act------
B D         Squirrel monkey  cagccgcgac--gggttagcctcgt-ctgcag---cactcaccttcagcc-----------act------
B D                Bushbaby  cagccatgac--agattagtcatgt-ctgctg---cactcatttgcggcc-----------act------
         Chinese tree shrew  cagttatgac--agattagctacgt-ctgcag---tacttacctataacc-----------act------
B D                Squirrel  cagccatgac--attttagcaacat-ctgcag---tagttacctgtcacctgttactgtttagt------
               Prairie vole  cagccacgat---gattagctgtgt-ctgcag---tggtcacctgtggcc-----------atc------
B D         Chinese hamster  gagccatgat---aattagctgtgt-cggcgg---tattcacctgtggcc-----------aat------
             Golden hamster  cagccatgat---aattagctgtgt-ctgcag---tattcactggtggcc-----------att------
B D                   Mouse  cagctgtgac--agatcagctacat-ctatgg--ttatttattttcggct-----------att------
B D                     Rat  cggctgtgacaaagatcagctacat-ttgcag--gtattttccttcggcc-----------att------
B D          Naked mole-rat  cagccgggac--aggttagctacgc-c--tcg---ggttcacctgaggcc-----------act------
B D              Guinea pig  cagtcatgac--agtttaactacat-tggcag---tgttcccctgaggtc-----------act------
                 Chinchilla  tagccatgac--aggttagctacat-cggcag---tgttccc--gagacc-----------act------
           Brush-tailed rat  tagccataac--aggttagctacgt-gggcag---tattcccctgaggtc-----------act------
B D                  Rabbit  cagcgatgac--agattaaccatgt-ctgctg---tgtttacctgtggcc-----------act------
B D                    Pika  cagctgtttc--agattagctggat-ctgcca---tgtttactcctggcc-----------act------
B D                     Pig  ca-------c--agcactgccgtgt-ctgc-----tggccatccatgacc-----------act------
B D                  Alpaca  ca-------c--agcttggctgcca-ctgcag---tgctcgcctgtgggc-----------act------
             Bactrian camel  ca-------c--agcttggctgcca-ctgcag---tgctcgcctgtggcc-----------act------
B D                 Dolphin  ca-------c--cgcttggttgtgt-ctgccg---tactcacctac-gcc-----------act------
               Killer whale  ca-------c--tgcttggttgtgt-ctgccg---tactcacctat-gcc-----------act------
           Tibetan antelope  ca-------c--agcttgtccgagt-ctgcag---tgctcatctataggc-----------act------
B D                     Cow  ca-------c--agcttgtccgtgt-ctgcag---tgctcatctgtggcc-----------act------
B D                   Sheep  ca-------c--aacttgtccgagt-ctgcag---tgctcatctatagcc-----------act------
              Domestic goat  ca-------c--agcttgtccgagt-ctgcag---tgctcatctatagcc-----------act------
B D                   Horse  cagccagggc--accttggctgtgt-ctgcag---tgctcacctgtgg-c-----------tct------
B D        White rhinoceros  cagccaggac--accttggctgtgt-ctgcgg---tactcacctgtgg-c-----------act------
B D                     Cat  gagccacaga--agcttggctgtgtcctgccg---tactcacctgtggcc-----------gct------
B D                     Dog  gagccacgac--agctcagctgtgc-ctgtaa---cactcacct--agca-----------act------
B D                 Ferret   gagccacgac--agctgggctgta---tgttg---tgttcacctgtggtc-----------act------
B D                   Panda  -agccacgac--agcttggctgtgt-ctgtaa---cactcacctgtggtc-----------act------
             Pacific walrus  gagccacaac--agcccagctgtgt-ctgtag---tattcacctggggtc-----------act------
               Weddell seal  gagccacaac--agctcagctatgt-ctgtag---tattcacctggggtc-----------act------
           Black flying-fox  cagc-atgac--aggttggctatgt-ctgcag---tactcacctgtggcc-----------act------
B D                 Megabat  cagc-atgac--aggttggctatgt-ctgcag---tactcacctgtggcc-----------act------
              Big brown bat  caatggtggc--tacctaactgtgt-ctgcag---tactaatctgtggcc-----------act------
       David's myotis (bat)  cagtggtggt--tacttgactgtgt-ctgcag---tactgacctgtggaa-----------act------
B D                Microbat  cagtggtggt--tacttgactgtgt-ctgcag---tactaacctgtggaa-----------act------
B D                Hedgehog  cagccagggc--aaattggttgtgt-ctgcag---tgctcactcatggtc-----------gct------
B D                   Shrew  gggccacagc--ta-------gtga-cc-cag---cgtccacct---gtc-----------cct------
            Star-nosed mole  tagccatgac--cgtttgg-tgtgt-ctacag---gactcacct---gtg-----------gct------
B D                Elephant  tagccatgac--agcttggctatgt-ctggag---tcctcacctg-ggcc-----------act------
        Cape elephant shrew  tggccatgac--agcctggttgtat-ttgtggtcttcttcacctgtggcc-----------act------
B D                 Manatee  cagccatgac--agcttggctatgt-ctgcgg---tcctcatctc-ggcc-----------act------
           Cape golden mole  tagccacaat--agcttgactatgt-ctgcag---tctttacctgtggtc-----------att------
B D                  Tenrec  tagccttgac--agcttggcgatgc-ctgcag---tctttacctgtggct-----------gctgagtag
                   Aardvark  tagccatgac--agcttggctaagt-ctgcag---tcttcacctgtgggc-----------act------
B D               Armadillo  -agccat-ac--agcttgactgcac-ctgcag---tcct-------------------------------
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
B D                 Opossum  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================

                      Human  cagtagtagcacc
                      Chimp  cagtagtagcacc
                    Gorilla  cagtagtagcacc
                  Orangutan  aagtagtagcacc
                     Gibbon  aagtagtagcacc
                     Rhesus  aagtagtagcacc
        Crab-eating macaque  aagtagtagcacc
                     Baboon  aagtagtagcacc
               Green monkey  aagtagtagcacc
                   Marmoset  aagtagtagcacc
            Squirrel monkey  aagtagtagcacc
                   Bushbaby  gaatagtaacacc
         Chinese tree shrew  aaat-gtagcacc
                   Squirrel  aata-gtagcacc
               Prairie vole  ag---------cc
            Chinese hamster  aa---------cc
             Golden hamster  aa---------cc
                      Mouse  aa---gcagcacc
                        Rat  aa---gtagcgcc
             Naked mole-rat  gaacaggagcatc
                 Guinea pig  gaacagtagcatc
                 Chinchilla  gaac-atagcatc
           Brush-tailed rat  gaa--atagcatc
                     Rabbit  gaatagtagcgcc
                       Pika  aactagtaactcc
                        Pig  aaatagtggcgcc
                     Alpaca  aaatggtagcact
             Bactrian camel  aaatggtagcact
                    Dolphin  aaatagctcc---
               Killer whale  aaatagctcc---
           Tibetan antelope  aaatagtagtgcc
                        Cow  aaatggtagtgcc
                      Sheep  aaatagtagtgcc
              Domestic goat  aaatagtagtgcc
                      Horse  aaatagtagcacc
           White rhinoceros  aaatagtagcctt
                        Cat  aaatagtggtacc
                        Dog  aaacagtagcatc
                    Ferret   gaaccgtaacatc
                      Panda  aaacagtagcacc
             Pacific walrus  aaagagtagcacc
               Weddell seal  aaacagtagcacc
           Black flying-fox  gcatagtagcacc
                    Megabat  gcatagtagcacc
              Big brown bat  aaatagtagcacc
       David's myotis (bat)  aaataatagcacc
                   Microbat  aaataatagcacc
                   Hedgehog  caataacagtagt
                      Shrew  cagccgccactac
            Star-nosed mole  gataagtagcagc
                   Elephant  aaatagtagtacc
        Cape elephant shrew  aaatagt------
                    Manatee  aaatagtagtatc
           Cape golden mole  aaatagc------
                     Tenrec  gaacagc------
                   Aardvark  aaatagtagcagc
                  Armadillo  aaatagtaggacc
                Stickleback  -------------
     Yellowbelly pufferfish  =============
                       Fugu  =============
                     Turkey  =============
                    Chicken  =============
               Mallard duck  =============
         Tibetan ground jay  =============
                Zebra finch  =============
     White-throated sparrow  =============
            Tasmanian devil  =============
                  Zebrafish  =============
              X. tropicalis  =============
            Green seaturtle  =============
         American alligator  =============
                 Budgerigar  =============
                    Opossum  =============
     Lesser Egyptian jerboa  =============
                Rock pigeon  =============
        Collared flycatcher  =============
        Medium ground finch  =============
                     Lizard  -------------
           Peregrine falcon  -------------
               Saker falcon  =============
                   Platypus  =============
                    Wallaby  =============

Inserts between block 20 and 21 in window
          Tibetan antelope 213bp
B D                  Sheep 213bp
B D               Elephant 52bp
       Cape elephant shrew 54bp
B D                Manatee 185bp

Alignment block 21 of 1009 in window, 6776122 - 6776124, 3 bps 
B D                   Human  cca
B D                   Chimp  cca
B D                 Gorilla  cca
B D               Orangutan  cca
B D                  Gibbon  cca
B D                  Rhesus  cca
B D     Crab-eating macaque  cca
B D                  Baboon  cca
B D            Green monkey  cca
B D                Marmoset  cca
B D         Squirrel monkey  tca
B D                Bushbaby  aca
         Chinese tree shrew  aca
B D                Squirrel  aca
               Prairie vole  aca
B D         Chinese hamster  gca
             Golden hamster  aca
B D                   Mouse  acg
B D                     Rat  aca
B D          Naked mole-rat  aca
B D              Guinea pig  aca
                 Chinchilla  act
           Brush-tailed rat  act
B D                  Rabbit  gca
B D                    Pika  acc
B D                     Pig  aca
B D                  Alpaca  aca
             Bactrian camel  aca
B D                 Dolphin  aca
               Killer whale  aca
           Tibetan antelope  aca
B D                     Cow  aca
B D                   Sheep  aca
              Domestic goat  aca
B D                   Horse  ata
B D        White rhinoceros  acg
B D                     Cat  gaa
B D                     Dog  tca
B D                 Ferret   tca
B D                   Panda  tca
             Pacific walrus  ttg
               Weddell seal  tcg
           Black flying-fox  aca
B D                 Megabat  aca
              Big brown bat  aca
       David's myotis (bat)  aca
B D                Microbat  aca
B D                Hedgehog  gca
B D                   Shrew  acc
            Star-nosed mole  aca
B D                Elephant  cta
        Cape elephant shrew  ctg
           Cape golden mole  ata
B D                  Tenrec  aca
                   Aardvark  aca
B D               Armadillo  tca
B D             Stickleback  ---
    Yellowbelly pufferfish  ===
B D                    Fugu  ===
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
  D  White-throated sparrow  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D         Green seaturtle  ===
B D      American alligator  ===
B D              Budgerigar  ===
B D                 Opossum  ===
    Lesser Egyptian jerboa  ===
  D             Rock pigeon  ===
  D     Collared flycatcher  ===
B D     Medium ground finch  ===
B D                  Lizard  ---
  D        Peregrine falcon  ---
  D            Saker falcon  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===

Inserts between block 21 and 22 in window
B D               Elephant 7bp
       Cape elephant shrew 5bp
B D                 Tenrec 1715bp

Alignment block 22 of 1009 in window, 6776125 - 6776127, 3 bps 
B D                   Human  cgg
B D                   Chimp  cgg
B D                 Gorilla  cgg
B D               Orangutan  cgg
B D                  Gibbon  cgg
B D                  Rhesus  tgg
B D     Crab-eating macaque  tgg
B D                  Baboon  tgg
B D            Green monkey  tgg
B D                Marmoset  cag
B D         Squirrel monkey  cag
B D                Bushbaby  tgg
         Chinese tree shrew  tag
B D                Squirrel  tag
               Prairie vole  tag
B D         Chinese hamster  cag
             Golden hamster  caa
B D                   Mouse  tga
B D                     Rat  tgt
B D          Naked mole-rat  tag
B D              Guinea pig  tag
                 Chinchilla  tag
           Brush-tailed rat  tag
B D                  Rabbit  tag
B D                    Pika  tcg
B D                     Pig  tag
B D                  Alpaca  tgg
             Bactrian camel  tgg
B D                 Dolphin  aag
               Killer whale  aag
           Tibetan antelope  tag
B D                     Cow  tag
B D                   Sheep  tag
              Domestic goat  tag
B D                   Horse  tag
B D        White rhinoceros  tag
B D                     Cat  tag
B D                     Dog  tag
B D                 Ferret   tag
B D                   Panda  tag
             Pacific walrus  tag
               Weddell seal  tag
           Black flying-fox  cag
B D                 Megabat  cag
              Big brown bat  tag
       David's myotis (bat)  tag
B D                Microbat  tag
B D                Hedgehog  tag
B D                   Shrew  ata
            Star-nosed mole  taa
B D                Elephant  --g
           Cape golden mole  --g
                   Aardvark  -tg
B D               Armadillo  -tg
B D             Stickleback  ---
    Yellowbelly pufferfish  ===
B D                    Fugu  ===
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
  D  White-throated sparrow  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D         Green seaturtle  ===
B D      American alligator  ===
B D              Budgerigar  ===
B D                 Opossum  ===
    Lesser Egyptian jerboa  ===
  D             Rock pigeon  ===
  D     Collared flycatcher  ===
B D     Medium ground finch  ===
B D                  Lizard  ---
  D        Peregrine falcon  ---
  D            Saker falcon  ===
       Cape elephant shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                  Tenrec  ===

Inserts between block 22 and 23 in window
B D                    Cow 217bp
             Domestic goat 213bp

Alignment block 23 of 1009 in window, 6776128 - 6776129, 2 bps 
B D                   Human  ca-
B D                   Chimp  ca-
B D                 Gorilla  ca-
B D               Orangutan  ca-
B D                  Gibbon  ca-
B D                  Rhesus  ca-
B D     Crab-eating macaque  ca-
B D                  Baboon  ca-
B D            Green monkey  ca-
B D                Marmoset  ta-
B D         Squirrel monkey  ta-
B D                Bushbaby  ta-
         Chinese tree shrew  ta-
B D                Squirrel  ta-
               Prairie vole  ta-
B D         Chinese hamster  ga-
             Golden hamster  ga-
B D                   Mouse  ta-
B D                     Rat  ta-
B D          Naked mole-rat  ta-
B D              Guinea pig  ta-
                 Chinchilla  ta-
           Brush-tailed rat  ta-
B D                  Rabbit  tc-
B D                    Pika  ta-
B D                     Pig  tc-
B D                  Alpaca  ta-
             Bactrian camel  ta-
B D                 Dolphin  ta-
               Killer whale  ta-
           Tibetan antelope  ta-
B D                     Cow  ta-
B D                   Sheep  ta-
              Domestic goat  ta-
B D                   Horse  ta-
B D        White rhinoceros  ta-
B D                     Cat  ta-
B D                     Dog  ta-
B D                 Ferret   ta-
B D                   Panda  ta-
             Pacific walrus  ta-
               Weddell seal  ta-
           Black flying-fox  ta-
B D                 Megabat  ta-
              Big brown bat  ta-
       David's myotis (bat)  ta-
B D                Microbat  ta-
B D                Hedgehog  ta-
B D                   Shrew  ta-
            Star-nosed mole  ta-
B D                Elephant  -gg
        Cape elephant shrew  -aa
           Cape golden mole  -ag
                   Aardvark  -aa
B D               Armadillo  -gt
B D             Stickleback  ---
    Yellowbelly pufferfish  ===
B D                    Fugu  ===
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
  D  White-throated sparrow  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D         Green seaturtle  ===
B D      American alligator  ===
B D              Budgerigar  ===
B D                 Opossum  ===
    Lesser Egyptian jerboa  ===
  D             Rock pigeon  ===
  D     Collared flycatcher  ===
B D     Medium ground finch  ===
B D                  Lizard  ---
  D        Peregrine falcon  ---
  D            Saker falcon  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                  Tenrec  ===

Inserts between block 23 and 24 in window
B D               Elephant 2bp
       Cape elephant shrew 2bp
          Cape golden mole 2bp
                  Aardvark 838bp
B D              Armadillo 1bp

Alignment block 24 of 1009 in window, 6776130 - 6776130, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  g
               Prairie vole  g
B D         Chinese hamster  g
             Golden hamster  g
B D                   Mouse  g
B D                     Rat  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  a
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  g
B D                   Shrew  g
            Star-nosed mole  g
B D                Elephant  g
        Cape elephant shrew  g
           Cape golden mole  g
                   Aardvark  g
B D               Armadillo  g
B D             Stickleback  -
    Yellowbelly pufferfish  =
B D                    Fugu  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  =
B D      American alligator  =
B D              Budgerigar  =
B D                 Opossum  =
    Lesser Egyptian jerboa  =
  D             Rock pigeon  =
  D     Collared flycatcher  =
B D     Medium ground finch  =
B D                  Lizard  -
  D        Peregrine falcon  -
  D            Saker falcon  =
B D                Platypus  =
B D                 Wallaby  =
B D                 Manatee  =
B D                  Tenrec  =

Inserts between block 24 and 25 in window
B D               Elephant 127bp
       Cape elephant shrew 26bp

Alignment block 25 of 1009 in window, 6776131 - 6776142, 12 bps 
B D                   Human  gtgcttaa----------------------ta----at
B D                   Chimp  gtgcttaa----------------------ta----at
B D                 Gorilla  gtgcttaa----------------------ta----at
B D               Orangutan  gtgcttaa----------------------taatgtat
B D                  Gibbon  gtgcttaa----------------------ca----at
B D                  Rhesus  gtgcttaa----------------------ta----at
B D     Crab-eating macaque  gtgcttaa----------------------ta----at
B D                  Baboon  gtgcttaa----------------------ta----at
B D            Green monkey  gtgcttaa----------------------ta----at
B D                Marmoset  gtacttaa----------------------ta----at
B D         Squirrel monkey  gtgctcaa----------------------ta----at
B D                Bushbaby  gtgattaa----------------------ta----at
         Chinese tree shrew  gtgcttaa----------------------ta----ac
B D                Squirrel  gtgcttaa----------------------ta----at
               Prairie vole  gtgcttgg----------------------ta----gt
B D         Chinese hamster  gcgcttagtcac------------------tg----gt
             Golden hamster  gtgcttagtgatggtcacgggagccaggcatg----gt
B D                   Mouse  ccgcttag----------------------ca----at
B D                     Rat  gtgcttag----------------------ca----at
B D          Naked mole-rat  gtgcctaa----------------------t-----ag
B D              Guinea pig  gtgcttaa----------------------ta----ag
                 Chinchilla  gtgcttaa----------------------ta----ag
           Brush-tailed rat  gtgcttaa----------------------ta----ag
B D                  Rabbit  gtgcttaa----------------------ta----at
B D                    Pika  gtgcttac----------------------tc----ct
B D                     Pig  gtgcttag----------------------tg----at
B D                  Alpaca  gtgcttaa----------------------ta----at
             Bactrian camel  gtgcttaa----------------------ta----at
B D                 Dolphin  gcacttaa----------------------ta----at
               Killer whale  gcacttaa----------------------ta----at
           Tibetan antelope  gtgcttaa----------------------ta----at
B D                     Cow  gtgcttaa----------------------ta----at
B D                   Sheep  gtgcttaa----------------------ta----at
              Domestic goat  gtgcttaa----------------------ta----at
B D                   Horse  gtcctgaa----------------------ta----at
B D        White rhinoceros  gtgctgaa----------------------ta----at
B D                     Cat  gtgcttaa----------------------ta----ag
B D                     Dog  gtgcttaa----------------------ta----at
B D                 Ferret   gtgctcag----------------------ta----at
B D                   Panda  gtgcttaa----------------------ta----ct
             Pacific walrus  gtgcttaa----------------------ta----gt
               Weddell seal  gtgcttaa----------------------ta----at
           Black flying-fox  gtgcttaa----------------------ta----ct
B D                 Megabat  gtgcttaa----------------------ta----ct
              Big brown bat  gtgcttaa-----------------------------t
       David's myotis (bat)  gtgcttaa-----------------------------t
B D                Microbat  gtgctgaa-----------------------------t
B D                Hedgehog  gtgctcag----------------------ta----gt
B D                   Shrew  gaac----------------------------------
            Star-nosed mole  gggcttca----------------------ta----at
B D                Elephant  ttgcttaa----------------------ta----at
        Cape elephant shrew  gtcctcaa----------------------ta----at
B D                 Manatee  gtgcttaa----------------------ta----at
           Cape golden mole  gtatttaa----------------------ca----at
                   Aardvark  gtgcttag----------------------ta----gt
B D               Armadillo  gggctta-----------------------ta----at
B D             Stickleback  --------------------------------------
    Yellowbelly pufferfish  ======================================
B D                    Fugu  ======================================
B D                  Turkey  ======================================
B D                 Chicken  ======================================
  D            Mallard duck  ======================================
        Tibetan ground jay  ======================================
B D             Zebra finch  ======================================
  D  White-throated sparrow  ======================================
B D         Tasmanian devil  ======================================
B D               Zebrafish  ======================================
B D           X. tropicalis  ======================================
  D         Green seaturtle  ======================================
B D      American alligator  ======================================
B D              Budgerigar  ======================================
B D                 Opossum  ======================================
    Lesser Egyptian jerboa  ======================================
  D             Rock pigeon  ======================================
  D     Collared flycatcher  ======================================
B D     Medium ground finch  ======================================
B D                  Lizard  --------------------------------------
  D        Peregrine falcon  --------------------------------------
  D            Saker falcon  ======================================
B D                Platypus  ======================================
B D                 Wallaby  ======================================
B D                  Tenrec  ======================================

Inserts between block 25 and 26 in window
        Chinese tree shrew 951bp
B D                Ferret  175bp
B D               Hedgehog 3bp
B D                  Shrew 1bp

Alignment block 26 of 1009 in window, 6776143 - 6776144, 2 bps 
B D                   Human  gt
B D                   Chimp  gt
B D                 Gorilla  gt
B D               Orangutan  gt
B D                  Gibbon  gt
B D                  Rhesus  gt
B D     Crab-eating macaque  gt
B D                  Baboon  gt
B D            Green monkey  gt
B D                Marmoset  at
B D         Squirrel monkey  gt
B D                Bushbaby  gt
         Chinese tree shrew  gt
B D                Squirrel  gc
               Prairie vole  gt
B D         Chinese hamster  ga
             Golden hamster  gg
B D                   Mouse  tt
B D                     Rat  gt
B D          Naked mole-rat  gt
B D              Guinea pig  gt
                 Chinchilla  gt
           Brush-tailed rat  tt
B D                  Rabbit  at
B D                    Pika  gt
B D                     Pig  gt
B D                  Alpaca  gc
             Bactrian camel  gc
B D                 Dolphin  gg
               Killer whale  gt
           Tibetan antelope  gt
B D                     Cow  gt
B D                   Sheep  gt
              Domestic goat  gt
B D                   Horse  gc
B D        White rhinoceros  at
B D                     Cat  gt
B D                     Dog  gt
B D                 Ferret   gt
B D                   Panda  gt
             Pacific walrus  gt
               Weddell seal  gt
           Black flying-fox  gt
B D                 Megabat  gt
              Big brown bat  gt
       David's myotis (bat)  ga
B D                Microbat  ga
B D                Hedgehog  gc
B D                Elephant  gt
        Cape elephant shrew  gt
B D                 Manatee  gt
           Cape golden mole  tt
                   Aardvark  at
B D               Armadillo  gt
B D                   Shrew  ==
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D         Tasmanian devil  ==
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
B D                 Opossum  ==
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                  Tenrec  ==
           Star-nosed mole  --

Inserts between block 26 and 27 in window
              Prairie vole 134bp
B D        Chinese hamster 106bp
            Golden hamster 109bp

Alignment block 27 of 1009 in window, 6776145 - 6776146, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Gibbon  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D                Marmoset  gt
B D         Squirrel monkey  gg
B D                Bushbaby  at
         Chinese tree shrew  at
B D                Squirrel  at
               Prairie vole  at
B D         Chinese hamster  at
             Golden hamster  at
B D                   Mouse  at
B D                     Rat  at
B D          Naked mole-rat  ac
B D              Guinea pig  ac
                 Chinchilla  ac
           Brush-tailed rat  ac
B D                  Rabbit  gc
B D                    Pika  gt
B D                     Pig  at
B D                  Alpaca  at
             Bactrian camel  at
B D                 Dolphin  ac
               Killer whale  ac
           Tibetan antelope  at
B D                     Cow  at
B D                   Sheep  at
              Domestic goat  at
B D                   Horse  at
B D        White rhinoceros  at
B D                     Cat  ac
B D                     Dog  at
B D                 Ferret   ac
B D                   Panda  at
             Pacific walrus  ac
               Weddell seal  ac
           Black flying-fox  at
B D                 Megabat  at
              Big brown bat  ac
       David's myotis (bat)  at
B D                Microbat  at
B D                Hedgehog  at
            Star-nosed mole  at
B D                Elephant  gt
        Cape elephant shrew  gt
B D                 Manatee  gt
           Cape golden mole  gt
                   Aardvark  at
B D               Armadillo  gt
B D                   Shrew  ==
B D             Stickleback  --
    Yellowbelly pufferfish  ==
B D                    Fugu  ==
B D                  Turkey  ==
B D                 Chicken  ==
  D            Mallard duck  ==
        Tibetan ground jay  ==
B D             Zebra finch  ==
  D  White-throated sparrow  ==
B D         Tasmanian devil  ==
B D               Zebrafish  ==
B D           X. tropicalis  ==
  D         Green seaturtle  ==
B D      American alligator  ==
B D              Budgerigar  ==
B D                 Opossum  ==
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
  D     Collared flycatcher  ==
B D     Medium ground finch  ==
B D                  Lizard  --
  D        Peregrine falcon  --
  D            Saker falcon  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                  Tenrec  ==

Inserts between block 27 and 28 in window
B D                    Rat 160bp

Alignment block 28 of 1009 in window, 6776147 - 6776151, 5 bps 
B D                   Human  a-gag--a----
B D                   Chimp  a-gag--g----
B D                 Gorilla  a-gag--g----
B D               Orangutan  a-gag--g----
B D                  Gibbon  a-gag--g----
B D                  Rhesus  a-gag--a----
B D     Crab-eating macaque  a-gag--a----
B D                  Baboon  a-gag--a----
B D            Green monkey  a-gag--a----
B D                Marmoset  a-gag--g----
B D         Squirrel monkey  aggag--g----
B D                Bushbaby  a-----------
         Chinese tree shrew  a-ttg--g----
B D                Squirrel  -------a----
               Prairie vole  -------a----
B D         Chinese hamster  -------g----
             Golden hamster  -------g----
B D                   Mouse  -------a----
B D          Naked mole-rat  -------c----
B D              Guinea pig  -------c----
                 Chinchilla  -------c----
           Brush-tailed rat  -------c----
B D                  Rabbit  ---agtgg----
B D                    Pika  -----tgg----
B D                     Pig  -------c----
B D                  Alpaca  -------g----
             Bactrian camel  -------g----
B D                 Dolphin  -------a----
               Killer whale  -------a----
           Tibetan antelope  -------a----
B D                     Cow  -------a----
B D                   Sheep  -------a----
              Domestic goat  -------a----
B D                   Horse  -------a----
B D        White rhinoceros  -------a----
B D                     Cat  -------a----
B D                     Dog  -------a----
B D                 Ferret   -------a----
B D                   Panda  -------a----
             Pacific walrus  -------a----
               Weddell seal  -------a----
           Black flying-fox  -------a----
B D                 Megabat  -------a----
              Big brown bat  -------a----
       David's myotis (bat)  -------a----
B D                Microbat  -------a----
B D                Hedgehog  -------a----
            Star-nosed mole  -------a----
B D                Elephant  -------attgg
        Cape elephant shrew  -------accag
B D                 Manatee  -------ttcgg
           Cape golden mole  -------attgg
                   Aardvark  -------atcag
B D               Armadillo  -------attgg
B D                   Shrew  ============
B D             Stickleback  ------------
    Yellowbelly pufferfish  ============
B D                    Fugu  ============
B D                  Turkey  ============
B D                 Chicken  ============
  D            Mallard duck  ============
        Tibetan ground jay  ============
B D             Zebra finch  ============
  D  White-throated sparrow  ============
B D         Tasmanian devil  ============
B D               Zebrafish  ============
B D           X. tropicalis  ============
  D         Green seaturtle  ============
B D      American alligator  ============
B D              Budgerigar  ============
B D                 Opossum  ============
    Lesser Egyptian jerboa  ============
  D             Rock pigeon  ============
  D     Collared flycatcher  ============
B D     Medium ground finch  ============
B D                  Lizard  ------------
  D        Peregrine falcon  ------------
  D            Saker falcon  ============
B D                Platypus  ============
B D                 Wallaby  ============
B D                  Tenrec  ============
B D                     Rat  ============

Inserts between block 28 and 29 in window
B D                    Pig 4bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 4bp
              Killer whale 4bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp
B D                  Horse 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 191bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
          Black flying-fox 4bp
B D                Megabat 4bp
             Big brown bat 3bp
      David's myotis (bat) 3bp
B D               Microbat 3bp
B D               Hedgehog 4bp
           Star-nosed mole 4bp

Alignment block 29 of 1009 in window, 6776152 - 6776156, 5 bps 
B D                   Human  ttgaa
B D                   Chimp  ttgaa
B D                 Gorilla  ttgaa
B D               Orangutan  ttgaa
B D                  Gibbon  ttgaa
B D                  Rhesus  ttgaa
B D     Crab-eating macaque  ttgaa
B D                  Baboon  ttgaa
B D            Green monkey  ttgaa
B D                Marmoset  ttgaa
B D         Squirrel monkey  ttgaa
B D                Bushbaby  ttgaa
         Chinese tree shrew  ttgag
B D                Squirrel  ttgat
               Prairie vole  ttgat
B D         Chinese hamster  ttgat
             Golden hamster  ttgat
B D                   Mouse  ttgga
B D          Naked mole-rat  ttggc
B D              Guinea pig  ctggc
                 Chinchilla  ttagc
           Brush-tailed rat  ttggc
B D                  Rabbit  ttgaa
B D                    Pika  ttggg
B D                     Pig  ttaaa
B D                  Alpaca  ttgaa
             Bactrian camel  ttaaa
B D                 Dolphin  ttgaa
               Killer whale  ttgaa
           Tibetan antelope  ttgaa
B D                     Cow  ttgaa
B D                   Sheep  ttgaa
              Domestic goat  ttgaa
B D                   Horse  ttgaa
B D        White rhinoceros  ttgaa
B D                     Cat  ttgaa
B D                     Dog  ttaag
B D                 Ferret   ttcag
B D                   Panda  ttgag
             Pacific walrus  ttgag
               Weddell seal  ttgag
           Black flying-fox  ttgaa
B D                 Megabat  ttgaa
              Big brown bat  ttgaa
       David's myotis (bat)  ttgaa
B D                Microbat  ttgaa
B D                Hedgehog  ctgca
B D                   Shrew  cgggg
            Star-nosed mole  ctgag
B D                Elephant  ctgaa
        Cape elephant shrew  ttg--
B D                 Manatee  ttgaa
           Cape golden mole  ttgaa
                   Aardvark  ttgaa
B D               Armadillo  ttgaa
B D             Stickleback  -----
    Yellowbelly pufferfish  =====
B D                    Fugu  =====
B D                  Turkey  =====
B D                 Chicken  =====
  D            Mallard duck  =====
        Tibetan ground jay  =====
B D             Zebra finch  =====
  D  White-throated sparrow  =====
B D         Tasmanian devil  =====
B D               Zebrafish  =====
B D           X. tropicalis  =====
  D         Green seaturtle  =====
B D      American alligator  =====
B D              Budgerigar  =====
B D                 Opossum  =====
    Lesser Egyptian jerboa  =====
  D             Rock pigeon  =====
  D     Collared flycatcher  =====
B D     Medium ground finch  =====
B D                  Lizard  -----
  D        Peregrine falcon  -----
  D            Saker falcon  =====
B D                Platypus  =====
B D                 Wallaby  =====
B D                  Tenrec  =====
B D                     Rat  =====

Inserts between block 29 and 30 in window
B D               Squirrel 4bp
              Prairie vole 4bp
B D        Chinese hamster 4bp
            Golden hamster 4bp
B D                  Mouse 143bp
B D         Naked mole-rat 4bp
B D             Guinea pig 4bp
                Chinchilla 4bp
          Brush-tailed rat 4bp

Alignment block 30 of 1009 in window, 6776157 - 6776182, 26 bps 
B D                   Human  tgaatacgtgaacatgctaatggata
B D                   Chimp  tgaatacgtgaacatgctaatggatg
B D                 Gorilla  tgaatacgtgaacatgctaatggata
B D               Orangutan  tgaatacgtgaacatgctaatggata
B D                  Gibbon  tgaatacgtgaacatgctaatggata
B D                  Rhesus  tgaatacatgaacatgctaatggata
B D     Crab-eating macaque  tgaatacatgaacatgctaatggata
B D                  Baboon  tgaatacatgaacgtgctaatggata
B D            Green monkey  tgaatacatgaacatgctaatggata
B D                Marmoset  tgaatacgtgaacatgctaatagata
B D         Squirrel monkey  tgaatatgtgaacatgctaatagata
B D                Bushbaby  tgaataaatgaacatgctaacaaata
         Chinese tree shrew  tgaataaataaataagctaacaaaca
B D                Squirrel  aaaataaatgaatacactaataaata
               Prairie vole  tgaccaagtaaacgaattaacaaaca
B D         Chinese hamster  tgactaagtaagcgaactaacaagca
             Golden hamster  tgactaagtaaacgaactaacaagca
B D                   Mouse  tgaatgagtaaatgacctaaca----
B D          Naked mole-rat  tgaatgaatgagtaagctaacaaata
B D              Guinea pig  tgaataaatgaataagctaacaaata
                 Chinchilla  tgaataaatgaaaaagctaacgaata
           Brush-tailed rat  tgaataaattaataagctaacaaata
B D                  Rabbit  tgactga-caaataagctgacagata
B D                    Pika  tgactt----aacaag----------
B D                     Pig  taaataaatgaacatgttaatgaata
B D                  Alpaca  tgaataaatgactatgctaacaagta
             Bactrian camel  tgaataaatgactatgctaacaagta
B D                 Dolphin  tgaataaatgaatctgcc----aacg
               Killer whale  tgaataaatgaatctgcc----aaca
           Tibetan antelope  tgaataaatgaatctactaataaata
B D                     Cow  tgaataaatgaatctactaataaata
B D                   Sheep  tgaataaatgaatctactaataaata
              Domestic goat  tgaataaatgaatctactaataaata
B D                   Horse  tgaataaa-gaatacacccgcaaatt
B D        White rhinoceros  tgaataaa-gaacacaccagcaaaca
B D                     Cat  ggaataaatgaatatgttaaca-gtc
B D                     Dog  caaataaatgaacatgctaacaggtc
B D                 Ferret   caaatcagtgaatatgctaataggtc
B D                   Panda  cgaatcagtgaacacgctgacaggtc
             Pacific walrus  tgactcagtgagtgcgctgacaggtc
               Weddell seal  tgaatcagtgagtacactgacaggtc
           Black flying-fox  taagtaaatgaatatgttaagaaata
B D                 Megabat  taaataaatgaatatgttaagaaata
              Big brown bat  tgactaagtgattatgctagcaaata
       David's myotis (bat)  tgaataagtgattatgctagcaaata
B D                Microbat  tgaataagtgattatgctagcaaata
B D                Hedgehog  ggagttagccactgtgcttacaggga
B D                   Shrew  tggatacatgagtttcctgatagata
            Star-nosed mole  tgaaaacatggagacactgacgagag
B D                Elephant  tgaatcaatgaataagctaacaaata
        Cape elephant shrew  ------aatgattaagttagcaacta
B D                 Manatee  tgaataaatgaataagctaacaaata
           Cape golden mole  tgaataaatgaataagctaacaaata
                   Aardvark  tgaatacatgaataagttaacaaata
B D               Armadillo  tg----aatgaataagttaacaggta
B D             Stickleback  --------------------------
    Yellowbelly pufferfish  ==========================
B D                    Fugu  ==========================
B D                  Turkey  ==========================
B D                 Chicken  ==========================
  D            Mallard duck  ==========================
        Tibetan ground jay  ==========================
B D             Zebra finch  ==========================
  D  White-throated sparrow  ==========================
B D         Tasmanian devil  ==========================
B D               Zebrafish  ==========================
B D           X. tropicalis  ==========================
  D         Green seaturtle  ==========================
B D      American alligator  ==========================
B D              Budgerigar  ==========================
B D                 Opossum  ==========================
    Lesser Egyptian jerboa  ==========================
  D             Rock pigeon  ==========================
  D     Collared flycatcher  ==========================
B D     Medium ground finch  ==========================
B D                  Lizard  --------------------------
  D        Peregrine falcon  --------------------------
  D            Saker falcon  ==========================
B D                Platypus  ==========================
B D                 Wallaby  ==========================
B D                  Tenrec  ==========================
B D                     Rat  ==========================

Inserts between block 30 and 31 in window
B D                  Shrew 1375bp

Alignment block 31 of 1009 in window, 6776183 - 6776203, 21 bps 
B D                   Human  atac----atc--tcctgaagg----ccaat
B D                   Chimp  atac----atc--tcctgaagg----ccaat
B D                 Gorilla  atac----atc--tcctgaagg----ccaat
B D               Orangutan  atac----atc--tcctgaagg----ccaat
B D                  Gibbon  atac----atc--tcctgaagg----ccaat
B D                  Rhesus  atac----atc--tcctgaagg----ccaat
B D     Crab-eating macaque  atac----atc--tcctgaagg----ccaat
B D                  Baboon  atac----atc--tcctgaagg----ccaat
B D            Green monkey  atac----att--tcctgaagg----ccaa-
B D                Marmoset  atac----atc--tcctgaagg----ccagt
B D         Squirrel monkey  acac----gtc--tcctgaagg----ccagt
B D                Bushbaby  atac----atc--tcctgaggg----ccaat
         Chinese tree shrew  gaac----acc--ccctgagga----ccgat
B D                Squirrel  atat----gcc--tcctcagag----tcaat
               Prairie vole  acat----atc--tctaggctg----ttaac
B D         Chinese hamster  acat----atc--tctagaatg----ttagc
             Golden hamster  ccat----atc--tctaggatg----ttagt
B D                   Mouse  -cat----ac----------tg----gtaac
B D          Naked mole-rat  ccgc----agg--tcctgagtg----ccat-
B D              Guinea pig  a------------tcctgaatg----caat-
                 Chinchilla  gttc----atg--tcctgaatg----caat-
           Brush-tailed rat  atgc----atg--tgctgaatg----caat-
B D                  Rabbit  atac----atcggtcctgaggg----ccaat
B D                    Pika  ---------------ctgaggg----ctgac
B D                     Pig  agac----atc--tcccagagg----ccaa-
B D                  Alpaca  atac----atc--tcccaaagg----ccagt
             Bactrian camel  atac----atc--tcccaaagg----ccaat
B D                 Dolphin  acac----acc--tcctgaagc----ccagt
               Killer whale  acac----atc--tcctgaaga----ccagt
           Tibetan antelope  accc----ata--tctcaaaga----ccagg
B D                     Cow  accc----ata--tctcaaaga----ccagg
B D                   Sheep  accc----ata--tctcaaaga----ccagg
              Domestic goat  accc----ata--tctcgaaga----ccagg
B D                   Horse  atacgtctgtc--tcctgagag----ccaat
B D        White rhinoceros  gtac----atc--tcccgaggg----ccaat
B D                     Cat  gtac----atc--tcctgaggg----tcagt
B D                     Dog  atat----ctc--tcctggggg----cccat
B D                 Ferret   ttac----atc--tccttaggg----ccaat
B D                   Panda  acac----atc--tcctgaggg----ccagt
             Pacific walrus  atac----atc--tcccaaggg----ccaat
               Weddell seal  atac----atc--ttccaaggg----ccaat
           Black flying-fox  atat----ata--ttctgaggg----ccaat
B D                 Megabat  atat----ata--ttctgaggg----ccaat
              Big brown bat  atac----atc--ccctgtctg----ccaat
       David's myotis (bat)  atac----atc--ccctatctg----ccagt
B D                Microbat  atac----atc--ccctgtctg----ccagt
B D                Hedgehog  acac----agc--tcctgaggg----ccttc
            Star-nosed mole  atac----atc--ccctgacag----ttcat
B D                Elephant  atac----ctc--tcctaaggg----tcaac
        Cape elephant shrew  atac----att--ttctgagggttaatcaac
B D                 Manatee  atac----atc--tcctgaggg----tcagc
           Cape golden mole  atac----atc--tcctgaggg----ctaat
                   Aardvark  atac----atc--tcctgaggg----tcagt
B D               Armadillo  acac----atc--tcctgaggg----ccagc
B D                   Shrew  ===============================
B D             Stickleback  -------------------------------
    Yellowbelly pufferfish  ===============================
B D                    Fugu  ===============================
B D                  Turkey  ===============================
B D                 Chicken  ===============================
  D            Mallard duck  ===============================
        Tibetan ground jay  ===============================
B D             Zebra finch  ===============================
  D  White-throated sparrow  ===============================
B D         Tasmanian devil  ===============================
B D               Zebrafish  ===============================
B D           X. tropicalis  ===============================
  D         Green seaturtle  ===============================
B D      American alligator  ===============================
B D              Budgerigar  ===============================
B D                 Opossum  ===============================
    Lesser Egyptian jerboa  ===============================
  D             Rock pigeon  ===============================
  D     Collared flycatcher  ===============================
B D     Medium ground finch  ===============================
B D                  Lizard  -------------------------------
  D        Peregrine falcon  -------------------------------
  D            Saker falcon  ===============================
B D                Platypus  ===============================
B D                 Wallaby  ===============================
B D                  Tenrec  ===============================
B D                     Rat  ===============================

Inserts between block 31 and 32 in window
B D               Squirrel 1bp

Alignment block 32 of 1009 in window, 6776204 - 6776321, 118 bps 
B D                   Human  cctgagtt-ttcacttgctttctggat---------acctctaactagatgtt--------------ata
B D                   Chimp  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------ata
B D                 Gorilla  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------ata
B D               Orangutan  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------ata
B D                  Gibbon  cctgagtt-ttcacttgcgttctggat---------acctctaactagatatt--------------ata
B D                  Rhesus  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------cta
B D     Crab-eating macaque  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------cta
B D                  Baboon  cctgagtt-ttcacttgctttctggat---------acctctaactagatatt--------------cta
B D            Green monkey  cctgagtt-ttcacttgctttct-gat---------acctctaactagatatt--------------cta
B D                Marmoset  tctgagtt-ttcacttgctttctggat---------acctgtacctagatact--------------ata
B D         Squirrel monkey  tctgagtt-ttcacttgc-ttctggat---------acctctacctagatact--------------ata
B D                Bushbaby  cctgaatt-tctacctgctttctggat---------atctctatctagatacc--------------ata
         Chinese tree shrew  cctgaatt-ttcacctgctttttagggtgaaaattaatttctgcctagatatt--------------ata
B D                Squirrel  ccaaa-ta-tctacctgcttttagaat---------a------------------------------tct
               Prairie vole  cctga-at-cccgctcaccttatctat---------aactctgtctggacatatta-------------t
B D         Chinese hamster  cctga-at-cctacgtgccttttctat---------aactctgtctaggtactgtgttg--------act
             Golden hamster  cctga-at-cctacacactttttctgt---------a------------------------------act
B D                   Mouse  cctga-at-cccacacacattttctat---------aactttatcttgatattatgttg--------act
B D                     Rat  cctga-at-cccacgcatgttttccat---------aactctatctagatatggtattg--------act
B D          Naked mole-rat  cctgactt-tctgcctgctttctgaat---------atctctccctagctatg--------------aca
B D              Guinea pig  cctgactt-tctacctgcttcctgaat---------atct--------ctatt--------------aga
                 Chinchilla  cttgactt-tccacctacttcctgaat---------atctttccctcgctatt--------------aga
           Brush-tailed rat  cctgactt-tctacctgcttcctgaat---------ctctctccctagctatt--------------aga
B D                  Rabbit  cgtgaatt-tcctcgcattttctggat---------gtcttcacctagatatta-------------tat
B D                    Pika  cccaggtcgcccttccattttctgggc---------atctgtg--tagataatg-------------cac
B D                     Pig  gctaaatt-tccacgtgcttcccacat---------atctctccctagatgtgg-------------tcc
B D                  Alpaca  gctgaatt-tctacctgcttccca--c---------atctttgcctagatcttg-------------tac
             Bactrian camel  gctgaatt-tccacctgcttccca--c---------atctctacctagatcttg-------------tac
B D                 Dolphin  gctggatt-tccacctgcttcccaggt---------atctctacgtagatatgg-------------tac
               Killer whale  gctggatt-tccacctgcttcccaggt---------atctctacgtagatatgg-------------tac
           Tibetan antelope  gctgaatt-tccacttgtttcccat-t---------gtctctacctagatatgg-------------tac
B D                     Cow  gctgaatt-tccacttgtttcccacgt---------atctctacctagatatgg-------------tac
B D                   Sheep  gctgaatt-tgcacttgtttcccatgt---------ttctctacctagatatgg-------------tac
              Domestic goat  gctgaatt-tccacttgtttcccatgt---------gtctctacctagatatgg-------------tac
B D                   Horse  ggtgaa-t-tccacctgcttcctggat---------atctctacctagatatgg-------------tac
B D        White rhinoceros  gctgaatt-tctacctacttcctgggt---------gtctctacctagatatgg-------------tac
B D                     Cat  gctgaatt-tccacctgt-tccaggat---------a------cctagatatgg-------------tac
B D                     Dog  gctaactt-tctgcctgc-tccaggat---------atctctacctagacatcg-------------tac
B D                 Ferret   gctgactt-----------tccaggag---------agctctgcttatatggca-------------tac
B D                   Panda  gccgactt-tccacctgc-tccaggct---------agctctacctagatgtca-------------tac
             Pacific walrus  gctgactt-tccacctgc-tccaggat---------cgctctccctagatgtca-------------tac
               Weddell seal  gctgactt-tccacctgc-tccaggat---------agctctccctcgatgtca-------------tac
           Black flying-fox  attgaatt-ctcacatgcttcctggat---------a-tcatagctgcac--------------------
B D                 Megabat  attgaatt-ctcacatgcttcctggat---------a-tcatagctgtac--------------------
              Big brown bat  gctgaatt-tccatatacttcctggaa---------atttctacctagatctcc-------------tag
       David's myotis (bat)  gctgaatt-tccatatacttcctggaa---------atttctacctagat--------------------
B D                Microbat  gctgaatt-tccatatacttcctggaa---------atttctacctagat--------------------
B D                Hedgehog  actgagct-tccatctggctcctgagc---------agttcctcctggatatcacacaccccaccccacc
            Star-nosed mole  gatggatt-ttcacctgctcgctgtct---------acttctacctagata----------------gtt
B D                Elephant  actgcatt-tccacctgtttcctggct---------gtctctacctagatatcg-------------tac
        Cape elephant shrew  actgtgtt-ttcatctacttcctagtt---------agcttgacctaggtattg-------------ta-
B D                 Manatee  actgcatt-tccacctgtttcctggct---------atctctacctagatatcg-------------tac
           Cape golden mole  actgcatt-tctatctgcttcctggat---------ctct----ctagatattg-------------tac
                   Aardvark  actgcatt-tccacctgcttcctggat---------atttctgtctagatattg-------------tat
B D               Armadillo  a--------------------ctagag---------agctctccct------------------------
B D                   Shrew  ======================================================================
B D             Stickleback  ----------------------------------------------------------------------
    Yellowbelly pufferfish  ======================================================================
B D                    Fugu  ======================================================================
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
  D  White-throated sparrow  ======================================================================
B D         Tasmanian devil  ======================================================================
B D               Zebrafish  ======================================================================
B D           X. tropicalis  ======================================================================
  D         Green seaturtle  ======================================================================
B D      American alligator  ======================================================================
B D              Budgerigar  ======================================================================
B D                 Opossum  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
  D             Rock pigeon  ======================================================================
  D     Collared flycatcher  ======================================================================
B D     Medium ground finch  ======================================================================
B D                  Lizard  ----------------------------------------------------------------------
  D        Peregrine falcon  ----------------------------------------------------------------------
  D            Saker falcon  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                  Tenrec  ======================================================================

                      Human  -ccacc---tctcagccgcc--------------ttaccctgaaccccagctttttctccca---c-caa
                      Chimp  -ccacc---tctcagccgcc--------------tcaccctgaaccccagctttttctccca---c-caa
                    Gorilla  -ccacc---tctcagccgcc--------------tcaccctgaaccccagctttttctccca---c-caa
                  Orangutan  -ccacc---tctcagccgcc--------------tcaccctgaaccccatctttttctccca---c-caa
                     Gibbon  -ccacc---tctcagccacc--------------tcaccctgaaccccatctttttctccca---c-caa
                     Rhesus  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
        Crab-eating macaque  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
                     Baboon  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
               Green monkey  -ccacc---tctcagccgcc--------------tcaccctgaatcccatctttttctacca---c-caa
                   Marmoset  -ccacc---tctcagctgcc--------------tcaccctgaaccccatctttttctccca---c-caa
            Squirrel monkey  -ccacc---tctcagctgcc--------------tcaccctgaaccccatctttttctccca---c-caa
                   Bushbaby  -ccatc---cctcag---ca--------------tcaccctgaactctatcttttcctcaca---c-caa
         Chinese tree shrew  cccacc---cttcag---cc--------------tcactctgaaccccaccttccccctact---c-caa
                   Squirrel  -acatt---cctcag---cc--------------tcatcctgaaccccattattgtcttatg---c-caa
               Prairie vole  -ctacc---cctcag---ct--------------tcactgggaaccccgtcttt---tcacg---t-cag
            Chinese hamster  -ctacc---cctcag---ct--------------tcactgggaacctcatcttc---tccct---t-cag
             Golden hamster  -ctacc---cctcag---ct--------------tcactgggaaccccatcttt---tcact---t-cag
                      Mouse  -caacc---cttcag---ct--------------tcacagggaaccccatcttt---ttaag---t-cac
                        Rat  -caacc---cctcag---ct--------------tcacagggaaccccatcttt---tcaag---t-cac
             Naked mole-rat  -ccac----ccttag---gc--------------acacctggg--cctaccttttctttatg---c-cag
                 Guinea pig  -ctact---ccttag---cc--------------tcatcctggaccctacc-attccttata---c-cag
                 Chinchilla  -ccact---ccttag---cc--------------tcaccctggaccctgccttttcgttatg---t-caa
           Brush-tailed rat  -ccact---ccttag---cc--------------tcaccctggatcctgccttttccttgtg---c-cga
                     Rabbit  -gtact---ccg-gg---cc--------------tccctctgagccccatttttttctgaca---c-cag
                       Pika  -ccact---cctcag---cc--------------tcatgcggagtgccatcttttccc-acg---c-cag
                        Pig  -ccgca---cttcag---cc--------------tcaccttgaacctcatcttttcccc--ac--c-cag
                     Alpaca  -ccaca---cctcag---ccgttgggagcactttttccccacagtaccatcttttccccacat--c-cag
             Bactrian camel  -ccaca---cctcag---ccgttgggagcactttttccccacagtaccatcttttccccacat--c-cag
                    Dolphin  -ccaca---cctcag---cc--------------tcactctgagccccatcttttcctcgcac--c-caa
               Killer whale  -ccaca---cctcag---cc--------------tcactctgagccccatcttttcctcgcac--c-cag
           Tibetan antelope  -ccaca----ctcag---cc--------------tcactctgaaccccatcttttcctcatac--c-cag
                        Cow  -ccaca----ctcag---cc--------------tcactctgatccccatcttttcctcatac--c-cag
                      Sheep  -ccaaa----ctcag---cc--------------tcactctgaaccccatcttttcctcatac--c-cag
              Domestic goat  -ccaca----ctcag---cc--------------tcactctgaaccccatcttttcctcatac--c-cag
                      Horse  -ccaca---cctcag---ct--------------ttactctgaataccgtctttgcctcagcc--t-cag
           White rhinoceros  -ccata---cctcag---cc--------------tcactctgaaccccatcttttcctcacac--t-caa
                        Cat  -cccca---cctcag---cc--------------tcactctgaaccccatcttttcctcacac--t-gag
                        Dog  -ccaca---ccccag---cc--------------tcgctctgaa-tccatcctttcctcatac--t-gca
                    Ferret   -ccaca---gcccag---ct--------------tcactccaagccccatcctttcctcacaccat-gtg
                      Panda  -ccaca---cccctg---cc--------------tcactccgaaccccatccttccctcaca---c-gtg
             Pacific walrus  -ccaca---ccgcag---cc--------------tcactccgaaccccatcctttcctcacaccgc-gag
               Weddell seal  -ccaca---ccccag---cc--------------tcaccccgaaccccatcctttcctcacaccac-gtg
           Black flying-fox  ----------ctcag---cc--------------tcactctggatcccatcttttcctcatgc--c-caa
                    Megabat  ----------ctcaa---cc--------------tcactctggatcccatcttttcctcatgc--c-caa
              Big brown bat  -tcaca---cctcag---cc--------------tcactctgaaccccatcttttcctcatgt--t-aag
       David's myotis (bat)  ----------ctcag---cc--------------tcactctgaaccccatcttttcctcatgc--t-aag
                   Microbat  ----------ctcag---cc--------------gcactctgaaccccatcttttcctcatgc--t-aag
                   Hedgehog  -ccaccccacccccg---cc--------------ttgctctgaacttcatcttttcatcaccc--tcaaa
            Star-nosed mole  -ctatc---cctcgg---cc--------------tcacattgaaccccat-tttccatcacac--t-gga
                   Elephant  -ccaca---ctgcag---cc--------------tcatgctgaaccccatcttttcctcacac--c-cag
        Cape elephant shrew  -ccaca---ccacaa---ct--------------tcatgctgag-cccattttttcctcatac--t-caa
                    Manatee  -ccaca---ctgcag---tg--------------taatgctgaaccccatcttttcctcacac--c-caa
           Cape golden mole  -ccaca---tagcag---tc--------------ttatgctgaacgccat--------------------
                   Aardvark  -ccaca---ctgcag---cc--------------tcatgctgaaccccatcttttcctcaaac--c-caa
                  Armadillo  ------------cag---cc--------------tcaccctgaagtccgtcttttcctcacac--c-tac
                      Shrew  ======================================================================
                Stickleback  ----------------------------------------------------------------------
     Yellowbelly pufferfish  ======================================================================
                       Fugu  ======================================================================
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
     White-throated sparrow  ======================================================================
            Tasmanian devil  ======================================================================
                  Zebrafish  ======================================================================
              X. tropicalis  ======================================================================
            Green seaturtle  ======================================================================
         American alligator  ======================================================================
                 Budgerigar  ======================================================================
                    Opossum  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                Rock pigeon  ======================================================================
        Collared flycatcher  ======================================================================
        Medium ground finch  ======================================================================
                     Lizard  ----------------------------------------------------------------------
           Peregrine falcon  ----------------------------------------------------------------------
               Saker falcon  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
                     Tenrec  ======================================================================

                      Human  tccccttgctgactca-gcctgtca----
                      Chimp  tccccttgccgactca-gcctgtca----
                    Gorilla  tccccttgtcgactca-gcctgtca----
                  Orangutan  tccccttgctgactca-gcctgtca----
                     Gibbon  tccccttgctgactca-gcctgtca----
                     Rhesus  tccccttgctgactca-gcctgtca----
        Crab-eating macaque  tccccttgctgactca-gcctgtca----
                     Baboon  tccccttgctgactca-gcctgtca----
               Green monkey  tccccttgctgactca-gcctgtca----
                   Marmoset  tccccttgctgactca-gcctgtca----
            Squirrel monkey  tccccttgctggttca-gcctgtcg----
                   Bushbaby  acctctggctgactca-gcctgtca----
         Chinese tree shrew  tcctcgtgtggactca-ggctgtca----
                   Squirrel  ttcactttctcactta-gcctgtca----
               Prairie vole  -ccctttgctaactca-gtctattg----
            Chinese hamster  tctttttgcttactca-gcctgtta----
             Golden hamster  gctttttgctgactca-gcctatta----
                      Mouse  -ccctttgccgactta-gtctatta----
                        Rat  -cccttggctgactca-gtctatta----
             Naked mole-rat  tcccctggctgattta-gcctgtta----
                 Guinea pig  tcctcttggtgattta-gcctgtta----
                 Chinchilla  tcctcttgctgattta-gcctgtta----
           Brush-tailed rat  ttgccttgctgattta-tcctgtta----
                     Rabbit  -cctcggcctgg-----------ga----
                       Pika  -cctctagctg------------------
                        Pig  tcctctggctaagatg--cccttct----
                     Alpaca  tcctcttgtgaagtct--gctttct----
             Bactrian camel  tccccttgtgaagtct--gctttcc----
                    Dolphin  tcctcttgctaagtca--ccttccc----
               Killer whale  tcctcttgctaagtca--ccttccc----
           Tibetan antelope  tcctcttgctaagtca--tttctgc----
                        Cow  tcctcttgctaagtca--cttctgc----
                      Sheep  tcctcttgctaagtca--cttctgc----
              Domestic goat  tcctcttgctaagtca--cttctgc----
                      Horse  tcctcttgccgactta-gcctttct----
           White rhinoceros  tcctcttactgacttg-gcctttct----
                        Cat  ccctcttgctgactta-gcctttct----
                        Dog  ttctcttgctgactta-gccactct----
                    Ferret   tcctcttgctgactta-gcctttct----
                      Panda  tcctcctgctgactta-gcctttct----
             Pacific walrus  tcctcttgctgactta-gcctttct----
               Weddell seal  tcctcttgctgactta-gcctttct----
           Black flying-fox  tcctcttgctgactta-gcctttct----
                    Megabat  tcctcttgctgactta-gcctttct----
              Big brown bat  ---tctcgctgacgtc-gcctttct----
       David's myotis (bat)  ---tcttgctgactta-tcctttct----
                   Microbat  ---tcttgctgactta-gcctttct----
                   Hedgehog  tcctcttgctgactta-acctttta----
            Star-nosed mole  tcttcctattgactta-gcctttca----
                   Elephant  tcttcttaatgacttaagtctttctgtca
        Cape elephant shrew  tccttttgctgacgtaagcctttctgtta
                    Manatee  tcctcttactgccttaagcctttctgtca
           Cape golden mole  --ctcttgttgacttaagcagttttgtca
                   Aardvark  tccttttgctgacataagcctttctgtca
                  Armadillo  tccttttgct--cttaagctttcctgtca
                      Shrew  =============================
                Stickleback  -----------------------------
     Yellowbelly pufferfish  =============================
                       Fugu  =============================
                     Turkey  =============================
                    Chicken  =============================
               Mallard duck  =============================
         Tibetan ground jay  =============================
                Zebra finch  =============================
     White-throated sparrow  =============================
            Tasmanian devil  =============================
                  Zebrafish  =============================
              X. tropicalis  =============================
            Green seaturtle  =============================
         American alligator  =============================
                 Budgerigar  =============================
                    Opossum  =============================
     Lesser Egyptian jerboa  =============================
                Rock pigeon  =============================
        Collared flycatcher  =============================
        Medium ground finch  =============================
                     Lizard  -----------------------------
           Peregrine falcon  -----------------------------
               Saker falcon  =============================
                   Platypus  =============================
                    Wallaby  =============================
                     Tenrec  =============================

Inserts between block 32 and 33 in window
B D                    Pig 4bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 4bp
              Killer whale 4bp
          Tibetan antelope 4bp
B D                    Cow 4bp
B D                  Sheep 4bp
             Domestic goat 4bp
B D                  Horse 4bp
B D       White rhinoceros 4bp
B D                    Cat 4bp
B D                    Dog 2bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
          Black flying-fox 4bp
B D                Megabat 4bp
             Big brown bat 4bp
      David's myotis (bat) 4bp
B D               Microbat 4bp
B D               Hedgehog 8207bp
           Star-nosed mole 4bp

Alignment block 33 of 1009 in window, 6776322 - 6776412, 91 bps 
B D                   Human  g---taat-cc-----------------actggta-tccatcca-cctcg-aaacctgg-cctcctcc-t
B D                   Chimp  g---taat-cc-----------------accggta-tccaccaa-cctcg-aaacctgg-cctcctcc-t
B D                 Gorilla  g---taat-cc-----------------actggta-tccaccca-ccttg-aaacctgg-cctcctcc-t
B D               Orangutan  g---taat-cc-----------------actggta-tccactca-cctcg-aaacctgg-cctcctcc-t
B D                  Gibbon  g---taat-cc-----------------actggta-tccaccca-ccccg-aaacctgg-cctcctcc-t
B D                  Rhesus  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-ccgcctcc-t
B D     Crab-eating macaque  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-ccgcctcc-t
B D                  Baboon  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-cctcctcc-t
B D            Green monkey  g---taat-cc-----------------actggta-tccaccca-cctcg-aaacctgg-cctcctcc-t
B D                Marmoset  t---taat--c-----------------cctggta-tctactca-ctttg-aaacctgg-cctactcc-t
B D         Squirrel monkey  t---taat-cc-----------------cctggta-tccaccca-cttcgaaaacctgg-cctactcc-t
B D                Bushbaby  g---tca--cc-----------------actggtattccactta-ccctg-aaacctgg-cctcttcctt
         Chinese tree shrew  g---taac-cc----------------tactggtg-tccactta-ccccg-aagcct------------t
B D                Squirrel  t---taactcc-----------------attggaa-ttccactc-atcct-aaccctgg-agtcctcc-t
               Prairie vole  g---taagtcc-----------------actggaa-ttccacac-ccccc-taac--------tcttc-t
B D         Chinese hamster  g---taaatcc-----------------attggaa-ttccacac-atccc-taaa--------cctgc-t
             Golden hamster  g---taaatcc-----------------attggaa-ttccatgc-atccc-taac--------ccttc-t
B D                   Mouse  g---caacgcc-----------------attggaa-tcccactc-ctccc-aaac--------ccccc-c
B D                     Rat  g---taactcc-----------------actggaa-tcccactc-agccc-aaac--------ccttc-t
B D          Naked mole-rat  t---ttact-c-----------------actggaa-tcccaact-cccca-gagcttgg-cctcctct-t
B D              Guinea pig  t---ttacact-----------------gttggaa-tctcagtg-cccca-tatcctgg-ccccctct-t
                 Chinchilla  t---ttatgct-----------------gctggac-tcccagtg-cctca-gatcctgg-tctcctct-t
           Brush-tailed rat  t---ttatg---------------------------ttccagtg-cctca-gactctgg-cctcctct-t
B D                  Rabbit  g---tagcccc-----------------actggtgtcccctcct-ccaca-aagcctgg-ggtccttc-t
B D                    Pika  ------------------------------------tccttccc-acatg-aagc------------c-t
B