Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 629 in window, 65425675 - 65428286, 2612 bps 
B D      Human  agaagaactaactatcctaaataca----tat---gcacccaacatgagagtacccagattcatataaca
B D  Orangutan  --aagaactaactatcctaaatacacgagtatttaggatactacatgagagtacccagattcatataaca
B D    Gorilla  ----------------------------------------------------------------------
B D      Chimp  ======================================================================

         Human  agttcctagagatcttcaaagagacttagacaccctcactttaatagtgagagattttaacacaccactg
     Orangutan  agttcctagagatctccaaagagacttagacaccctcactttaatagtgagagattttaacacaccactg
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  acaatattagacagatcattgagacagaaaattaacaaagatattcaggacctgaacttagctctggata
     Orangutan  acaa---tagacagatcattgagacagaaaattaacaaagatattcaggacttgaacttagctctggatc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  aaatggatgtgatagatatttacagaactatcta-ccccaaatagcagaatacattcttctcatcaccac
     Orangutan  aaatggatgtgatagatatttacagaactatctacccccaaatagcagaatacattcttcttgtcaccac
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  atggcacatttgctgaaatcagccacatagttggaagtaaaacactcctcagcaaatacaaagaactaaa
     Orangutan  atggcacattcactgaaatcagccacatagttggaagtaaaacactcctcagcaaatgcaaagaactaaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  attataataaatagtgtctcagactgcagcacaatcaaattagaactcaagactaataaatttactgtaa
     Orangutan  attataataaacagtgtctcagactgcagcacaatcaaattagtactcaagactaataaatttactgaaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  accataaaattacacggaaattgaaaaacctgctcctgaattaattttgaataaataatgaaattaaggc
     Orangutan  accataaaattacatggaaattaaataacctgctcctgaattaattttgaataaataatgaaattaaggc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tagtatcgagaagttctctgaaaccaatgagaacaaagacaaaacataccagaatctctgggacacagct
     Orangutan  tagtatcaagaagttctttgaaaccaatgagaacaaagacaaaacatatcagaatctctgggacacagct
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  aaggcagtattaagaggaaaatttatagcactaaatgcccacattaaaaagctagaaagatcccaagtta
     Orangutan  aaggcagtattaagaggaaaatttatatcactaaatgcccacattaaaaagctagaaagatcccaag---
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agaacttaacaacacaactaaaataactacagaaaaaagagcaaagaaatcctagagctaccagaagaca
     Orangutan  -----ttaacaacacaactaaaataactacagaaacaagaacaaagaaatcttagagctaccagaagaca
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agaaataactaaaatcagagttgaactcaaggaaataaagacatgagaaaccattcagaagatcaacaaa
     Orangutan  agaaataactaaaatcagagttgaactgaaggaaataaagacatgagaaaccattcagaagatcaacaaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ttcaagagctga--tttttttaaaccaataaagtagatagaccactagatagactaacaagaaagaaaag
     Orangutan  ttcaggggctgatttttttttaaaccaataaagtagatagaccactagatagactaacaagaaagaaaag
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ataaaaaattcaaataaacacagtcagaaataatagaggttaccactgactccacagaaataaaaataac
     Orangutan  ataaaaaattcaaataaacacaatcagaaataataggggttaccactgactccacagaaataaaaataac
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tattagagaatattataaacaactctatgcacataagctgaaaatccagtagaaatggataaatgtctgg
     Orangutan  tattagagaatattagaaacaactctatgcacataagctgaaaatctagtagaaatggataaatttctgg
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ccacacacaccctttcaagactaaaccaggaataaatttaatccctgaaaagacaaaaaacaggctctga
     Orangutan  ccacacacaccctttcaagactaaaccaggaataaatttaatccctgaaaagacaaataacaggctctga
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  aattgaggcagtaataaatagcataaccacaaaaagcacaggaccagaaagattaatggttgaatcctac
     Orangutan  aattgaggcaataataaatagcataaccacaaaaagcacaggaccagaaagattaatggctgaatcctac
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  cagatttacaaagaactggaacaattcctactaaaactatttcaaaaacttgaaacagagggttttctcc
     Orangutan  cagatttacaaagaactggaacaattcctactaaaactatttcaaaaacttgaaacagagggttttctcc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ctaactctttctatgagacaagcatcatcctggtaccaaaacccggcagagacacaagaaaaaaagaaaa
     Orangutan  ctaactctttctatgagacaagcatcatcctggtaccaaaacctggcagagacacaagaaaaaaagaaaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  cttcaggccaatattcctgatgaacattgatgcaaaaattctcaaaaaagtactggcaaaccaaaaccag
     Orangutan  cttcaggccaatattcctgatgaacattgatgcaaaaattctcaaaaaagtactggcaaaccaaatccag
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  cagaatatcaaaaatcttatccaccacaatcaagtaggcttcatctgtgggatgcaagtttggttcaaca
     Orangutan  cagaatatcaaaaatcttatccaccacaatcaagtaggcttcatctgtgggatgcaagtatggttcaaca
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tctacaaatcaatatgtgattcatcacataaacagaactaaagaaaaaaatcccacatgattatctcaat
     Orangutan  tctacaaatcaatatgtgattcatcacataaacagaactaaagaaaaaaatcccacatgattatctcaat
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agatgcagaaaaatctttcaataaaattcaacatccattcatgttaaaaaccctcaataaactaagtatt
     Orangutan  agacgcagaaaaagctttcaataaaattcaacaaccattcatgttaaaaactctcaataaactaagtgtt
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  gaaaaaacatacctcaaaataataagaaccatatatgacaaacccacagccaacatcatactgaaagggc
     Orangutan  gaaaaaacatacctcaaaataataagaaccatatatgacaaacccacagccaacatcatactgaaagggc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  aaaagctgaaagcattcccctttgaaacccctataagataaggatgccctcttccaccacttctatttga
     Orangutan  aagagctgaaagcattcccctttaaaacccctataagataaggatgccctcttccaccactcctatttaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  gatagtattggaagttactggccagagcaatcaggcaagagaaagaaataaaaggcattcaaattgaaag
     Orangutan  gatagtattggaagttactggccagagcaatcaggcaagagaaagaaataaaaggcattcaaattgaaag
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agaggaagttaaactacacctgatgttacataacatgatcctatatccagaaaatcctatcgtctcagcc
     Orangutan  agaggaagttaaacaacacctgatgttacataacacgatcctatatctagaaaatcctatcatctcagcc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ccaaagcttcttaagctgataaacatctttagcaaagtctcaagatacaaaatccatgtgcaaaaatcac
     Orangutan  ccaaagcttcttaagctgataaacatctttggcaaagtctcaagatatgaaatcaatgtgcaaaaatcac
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  taggattcttatacaccaacaacagtcaagctgagagtaaaatcgtaaatgaactcccattcacaattgc
     Orangutan  tagcattcttatacaccaacaacagtcaagccgagagtaaaatcatgaatgaactcccattcacaattgc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  cac-aaaagaataaaatacctaggaatgcatctaacaagggaagtgaacatttctacaaggagaactata
     Orangutan  cacaaaaagaataaaatacctaggaatgcatctaacaagggaagtgaaaatttctacaaggagaactata
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  aactcagataaatcagatatgacataaacaaatggaaaaacatttcatgcttacagataggaagaattca
     Orangutan  aactcaaataaatcagatatgacataaacaaatggaaaaacatttcatgcttacagataggaagaattca
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tattgttaaaatagccatgctaacccccaaaatttatagagttaatactattctcattaaactaccactg
     Orangutan  tattgttaaaatagccatgctaacccccaaaatttatagagttaatactattctcattaaactaccactg
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  acatttttcacaaaactagaaaaatctattttaaaacttatatggaaccaaaaaattgcctgaatagtca
     Orangutan  acatttttcacaaaactagaaaaatctattttaaaacttatatggaaccaaaaaattgcctgaatagtga
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agacaatcctaaggaaaaaagaacaaagctggagacattatgctctccaacttcaaactacactacgggg
     Orangutan  agacaatcctaagggaaaaagaacaaagctggagacattatgctctccaacttcaaactatgctacgggg
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ctatagtaaccaaaacagcatggtactggtacaagaacagacacatatactaatgaaaaagaataaagaa
     Orangutan  ctatagtaacctaaacagcacggtactggtacaaaaacagacacatatactaatgaaaaagaataaagaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tgcagaaataagactgcacagctacaactatctgatctttgacaaacctgacaaaaacaagcaatggaaa
     Orangutan  tgcagaaataagactgcacacctacaactatctgatttttgacaaacctgacaaaaacaagcaatggaaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  atgactacctattcaataaatggtgctgggataactggctagccatatgcagaaaattgaaacagaaccc
     Orangutan  atgactccctattcaataaatggtgctgggataactggctagccatatgcagaaaattgaaacagaaccc
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  cttcctccatcatcctcagcaaactaacacaggaacagaaaaccaaacagcacgttctcactcataagtg
     Orangutan  cttcctccatcatcctcagcaaactaacacaggaacagaaaaccaaacagcatgttctcactcataagtg
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  gaagttgaacaataagaatacatggacactggg
     Orangutan  ggagttgaacaataagaatacatggacactggg
       Gorilla  ---------------------------------
         Chimp  =================================

Alignment block 2 of 629 in window, 65428287 - 65428499, 213 bps 
B D      Human  gtggggggaaaacaatacacaccgggggctagtcgggggttgggggtgaggggagggagagcattaggac
B D  Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D    Gorilla  ----------------------------------------------------------------------
B D      Chimp  ======================================================================

         Human  aaacagctaatgcatgcagggcttgaagcctggatgatgggttgataagtgcagcaattcaccatggcac
     Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  acatatacctatgtaacaaacctacacgttctgcacttgtatcccagaaattaaactaaaattaaaaaac
     Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  aaa
     Orangutan  NNN
       Gorilla  ---
         Chimp  ===

Alignment block 3 of 629 in window, 65428500 - 65429437, 938 bps 
B D      Human  aaagaaactgaattccttccttacaccctatagaaaaatttactcaagatagtttaatgagttaaatgca
B D  Orangutan  aaagaaaatgaattccttccttacactgtatacaaaaatttactcaagatagtttaacgagttaaatgca
B D    Gorilla  ----------------------------------------------------------------------
B D      Chimp  ======================================================================

         Human  aaacctaaaattataaaaattttagaagacaacctaggcaataccataggcatgggcaaatattatataa
     Orangutan  aaacctaaaattataaaaattttagaagacaacctaagcaataccataggcatgggcaaatattatg--a
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tgaagatgccaaagcaattgcaacaaaggaaacattgacagatgggttctaattaaactaaagagcttct
     Orangutan  tgaagatgccaaagcaattggaacaaaggaaacattgacagatgggttctcattaaactaaagagcttct
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  gcacagcaaaagaaactatcaacagagtaaacagacaatatacagaatgggagaaaatttttgtgaacta
     Orangutan  gcacagcaaaagaaactatcgacagagtaaacaaacaatatagagaatgggagaaaatttttgcaaacta
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tgcatctgacaaagatctaattttcagcatctataagggacttaaatttacaagaaaaaaacaaccttat
     Orangutan  tgcatctgacaaagatctaatttctagcatctataagggacttaaatttataagaaaaaaacaaccttat
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  taaaaagtgggcaaaggacatgaagagacacttttcaaaagaagacatacatgcagccaataa-------
     Orangutan  taaaaagtgggcaaag-acatgaagagacacttttcaaaagaagacatacatgcagccaataagtgtatg
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  ------aatttcaccatcactgatcattagggaaatgcaaatccaaaccacaatgagataccattttata
     Orangutan  aaaaaaaagtttaccatcactgatcattagggaaatgcaaatccaaaccacaatgagataccattttata
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  acaatcaaaatggctattactaaaaagtcaaaaaataacagatgctggcaaagttgtggcgaaaaaggaa
     Orangutan  tcaatcaaaatggctattactaaaaagtcaaaaaataacagatgttggcaaagttgtggcaaaaaaggaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  cgtttttaccctgttggtggaagtgtaaatgagttcaaccattgtggaagacagcgtggtgattcttcaa
     Orangutan  tgtttttaccctgttggtggaagtgtaaatgagttcaacgattgtggaagacagcatggtgattcttcaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agatctaaagacaaaaataccatttgaccaagcaatctcattactgggtatatacccaaagcaatataag
     Orangutan  agatctaaagacaaaaataccatttgaccaagcaatctcattattcggtatatacccaaagcaatgtaag
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tcattctattataaagacacatgcacacacaaattcattggagccctattcataatagcaaagacatcaa
     Orangutan  tcattctattataaagacacatgcacacacaaattcattggagccctattcataatagcaaagacatcaa
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  atcaacccacatgttcatctgtaatagactggatgaagaaaatgtagtacatatacaccatggagtacta
     Orangutan  atcaacccacatgttcatcaataatagactggatgaagaaaatgtagtacatatacaccatggagtacta
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  tgtagccataaaaaagaacaagatcatatcctttgaagggacgtgaatggagctggagaccattatcctt
     Orangutan  tgtagccataaaaaagaacaagatcatatcctttgtagggacatggatggagctggagaccattattctt
       Gorilla  ----------------------------------------------------------------------
         Chimp  ======================================================================

         Human  agcaaataaacacatgaacaggaaacccaacaccacatgtt
     Orangutan  agcaaataaacacacgaacagaaaacccaacaccacatgtt
       Gorilla  -----------------------------------------
         Chimp  =========================================

Alignment block 4 of 629 in window, 65429438 - 65429447, 10 bps 
B D      Human  ctcacttata
B D  Orangutan  ctcacttata
B D   Platypus  cctgctcatg
B D    Gorilla  ----------
B D      Chimp  ==========

Alignment block 5 of 629 in window, 65429448 - 65429512, 65 bps 
B D      Human  agtgggagctagatgatgggagaac--acag-------acacatagaagggagcagcatgca------ct
B D  Orangutan  agtgggagctagatgatgggagcac--acag-------acacatagaggggaacagcatgca------ct
B D   Platypus  catgggagagagggaaggggagaa------------------atggaagggggtcagaagaagggaatcc
B D    Lamprey  agagagagacagacagagagagcacagacagagagagcacagacagagagagacagacagag--------
B D    Gorilla  ----------------------------------------------------------------------
B D      Chimp  ======================================================================

         Human  ggggcctatc
     Orangutan  ggggcctatc
      Platypus  tggtcccatg
       Lamprey  agagac----
       Gorilla  ----------
         Chimp  ==========

Alignment block 6 of 629 in window, 65429513 - 65429525, 13 bps 
B D        Human  aggaggtggaggg
B D    Orangutan  aggaagtggaggg
B D     Platypus  agaaggtgaaggc
B D  Stickleback  aggaaacaaggga
B D      Lamprey  agacagagagaga
B D      Gorilla  -------------
B D        Chimp  =============

Alignment block 7 of 629 in window, 65429526 - 65429549, 24 bps 
B D        Human  tgggaggaggaa------gagaaa---cagaaa
B D        Chimp  tgggaggaggaa------gagaaa---cagaac
B D    Orangutan  tgggaggaggaa------gagaaa---cagaaa
B D     Platypus  ----aggaaaga------aagaaagtccagagc
B D  Stickleback  tgagaggaggaaaccagggaggag---cggagg
B D      Lamprey  cagacagaggga------gacaga---cagaga
B D      Gorilla  ---------------------------------

Inserts between block 7 and 8 in window
B D    Platypus 2bp

Alignment block 8 of 629 in window, 65429550 - 65429591, 42 bps 
B D        Human  aaataa--ctgatggttagtaggcttaatgcctgggtgataaaa-
B D        Chimp  atataa--ctaatggttagtaggcttaatgcctgggtgataaaa-
B D    Orangutan  aaataa--ctaatggttagtaggcttaatgcctgggtgataaaa-
B D     Platypus  cagcag--cagctgatctgtggccctggtga--gagtcagaagg-
B D  Stickleback  aaacaagggtaaagaggaggaaacaagggatgtgaggaagaaac-
B D      Lamprey  agacac--ctgacgtgtgagacacctggtac--gtgtgagacacc
B D      Gorilla  ---------------------------------------------

Alignment block 9 of 629 in window, 65429592 - 65429593, 2 bps 
B D        Human  ta
B D        Chimp  ta
B D    Orangutan  ta
B D     Platypus  tc
B D   Budgerigar  tg
B D  Stickleback  -a
B D      Lamprey  ta
B D      Gorilla  --

Inserts between block 9 and 10 in window
B D Stickleback 2bp

Alignment block 10 of 629 in window, 65429594 - 65429615, 22 bps 
B D        Human  atgtgtacaaacaacctttatg
B D        Chimp  atctgtacaaacaacctttatg
B D    Orangutan  atctgtacaaacaacctttatg
B D     Platypus  aagagttctaattccagctctg
  D  Rock pigeon  acgcgcgtgtgcgacacgtgtg
B D   Budgerigar  --ataggtacgggacatgtatg
B D  Stickleback  tgatagagaagagacaggcatg
B D      Lamprey  acgcgtgtgagacacctg----
B D      Gorilla  ----------------------

Inserts between block 10 and 11 in window
B D  Budgerigar 2bp

Alignment block 11 of 629 in window, 65429616 - 65429618, 3 bps 
B D        Human  aca
B D        Chimp  aca
B D    Orangutan  aca
B D     Platypus  cca
  D  Rock pigeon  cga
  D       Parrot  --a
B D  Stickleback  aga
B D      Lamprey  acg
B D   Budgerigar  ===
B D      Gorilla  ---

Alignment block 12 of 629 in window, 65429619 - 65429640, 22 bps 
B D        Human  c--gtttaacac----------------acacatt---------taagt
B D        Chimp  c--atttattac----------------acacatt---------taagt
B D    Orangutan  catgtctaacac----------------atacatt---------tgagt
B D     Platypus  cttgtctgctgtggggagatgtgggggaagggatc---------gtagc
  D  Rock pigeon  c--acctgacac----------------gcgcgtg---------tgtga
B D   Budgerigar  ----------------------------ataggta---------tggga
  D       Parrot  t--acgtgttac----atacgtg-----ctgcgta---------tgggt
B D  Stickleback  ----cagataag----------------agacaca---------taaga
B D    Zebrafish  ----catgtaat----------------tgacatagttagtgtgtagtt
B D      Lamprey  --tgtgtgacac--------ctg-----gtacgtg---------tgaga
B D      Gorilla  -------------------------------------------------

Inserts between block 12 and 13 in window
B D Stickleback 3bp
B D   Zebrafish 3bp

Alignment block 13 of 629 in window, 65429641 - 65429641, 1 bps 
B D                Human  t
B D                Chimp  t
B D            Orangutan  t
B D             Platypus  t
  D          Rock pigeon  c
B D  Medium ground finch  t
B D           Budgerigar  t
  D               Parrot  t
B D              Lamprey  c
B D            Zebrafish  =
B D          Stickleback  =
B D              Gorilla  -

Inserts between block 13 and 14 in window
B D Medium ground finch 4bp
B D          Budgerigar 2bp
  D              Parrot 2bp

Alignment block 14 of 629 in window, 65429642 - 65429648, 7 bps 
B D                Human  acgtgtc--
B D                Chimp  gcatgtc--
B D            Orangutan  acatgtc--
B D             Platypus  gattgtc--
  D          Rock pigeon  acctg----
  D  Collared flycatcher  gtgtg----
B D  Medium ground finch  gcctg----
B D           Budgerigar  atatg----
  D               Parrot  gtatg----
B D          Stickleback  aggc-----
B D            Zebrafish  gtgt-----
B D              Lamprey  acctg--ac
B D              Gorilla  ---------

Alignment block 15 of 629 in window, 65429649 - 65429649, 1 bps 
B D                Human  a
B D                Chimp  a
B D            Orangutan  a
B D             Platypus  a
  D          Rock pigeon  a
  D  Collared flycatcher  t
B D  Medium ground finch  g
B D           Budgerigar  g
  D               Parrot  t
B D              Chicken  a
B D          Stickleback  a
B D            Zebrafish  a
B D              Lamprey  g
B D              Gorilla  -

Inserts between block 15 and 16 in window
  D         Rock pigeon 2bp

Alignment block 16 of 629 in window, 65429650 - 65429650, 1 bps 
B D                Human  -g
B D                Chimp  -g
B D            Orangutan  -g
B D             Platypus  -g
  D         Saker falcon  -g
  D  Collared flycatcher  -c
B D  Medium ground finch  -t
B D           Budgerigar  -g
  D               Parrot  -g
B D              Chicken  -g
B D          Stickleback  -t
B D            Zebrafish  -g
B D              Lamprey  t-
  D          Rock pigeon  ==
B D              Gorilla  --

Alignment block 17 of 629 in window, 65429651 - 65429672, 22 bps 
B D                Human  gt-----gg-------cacagacgtgtc----acac--gt-----
B D                Chimp  gt-----gg-------cacagacgtgtc----acac--gt-----
B D            Orangutan  gt-----gg-------cacagatgtgtc----acac--gt-----
B D             Platypus  ctaagtggg-------cactgg-gggat----acac--gc-----
  D          Rock pigeon  ----------------cgcgcgcatgcg----acac--gt-----
  D         Saker falcon  tt-----ga-------cacgggagtgac----acgg--g------
  D     Peregrine falcon  gt-----ga-------cacgggattgac----acgg--g------
  D  Collared flycatcher  --------acagtgtgcacaggcgtgtc----acag--gt-----
B D  Medium ground finch  --------gtggggcgcacacgcgtgtc----acag--gg-----
B D           Budgerigar  --------a-------catggacaggac----acat--at-----
  D               Parrot  --------c-------tacatacatgcc----atct--at-----
B D              Chicken  -----------gtgt-cattgacgtgtcgttaacat---------
B D          Stickleback  -----gaga-------cacataagagac----acataa-------
B D            Zebrafish  -----ttgg-------tgtataattgac----gtat---------
B D              Lamprey  ---------------------gtgtgac----acct--ggtacgt
B D              Gorilla  ---------------------------------------------

Inserts between block 17 and 18 in window
  D        Saker falcon 3bp
  D    Peregrine falcon 3bp
B D          Budgerigar 22bp
  D              Parrot 2bp

Alignment block 18 of 629 in window, 65429673 - 65429679, 7 bps 
B D                Human  --gtcactc
B D                Chimp  --gtcac--
B D            Orangutan  --gtcactc
B D             Platypus  --ttagatc
  D          Rock pigeon  --gacgcgc
  D         Saker falcon  --gacacgg
  D     Peregrine falcon  --gacacgg
  D  Collared flycatcher  --cacacac
B D  Medium ground finch  --agcacgg
B D           Budgerigar  --gggacag
  D               Parrot  --gttacat
  D        Scarlet macaw  --gacacgc
B D              Chicken  --gtcacaa
B D          Stickleback  --gagacag
B D            Zebrafish  ------tga
B D              Lamprey  gtgagac--
B D              Gorilla  ---------

Alignment block 19 of 629 in window, 65429680 - 65429690, 11 bps 
B D                Human  -----acatg-tc------------ggtg
B D                Chimp  -------atg-tc------------ggtc
B D            Orangutan  -----acatg-tc------------ggtc
B D             Platypus  -----acgtgagc------------agca
  D          Rock pigeon  -----tcgtg-tgacgcgt----------
  D         Saker falcon  -----ggttg-a-----------------
  D     Peregrine falcon  -----ggttg-a-----------------
  D  Collared flycatcher  -----atgtg-tc----------------
B D  Medium ground finch  -----gtgtg-tc----------------
B D           Budgerigar  -----gtatg-gg----------------
  D               Parrot  -----gcatg-tt----------------
  D        Scarlet macaw  -----gtgtg-cg----------------
B D              Chicken  -----gcatg-tc------attggc----
B D        X. tropicalis  -----gggt--------------------
B D          Stickleback  -----gcatg-ag----------------
B D            Zebrafish  -----gcatg-ta----------------
B D              Lamprey  acctgacgt--------------------
B D              Gorilla  -----------------------------

Inserts between block 19 and 20 in window
B D            Platypus 15bp
  D         Rock pigeon 7bp
  D        Saker falcon 1bp
  D    Peregrine falcon 1bp
  D Collared flycatcher 20bp
B D Medium ground finch 20bp
B D          Budgerigar 2bp
  D              Parrot 2bp
  D       Scarlet macaw 2bp
B D             Chicken 22bp
B D         Stickleback 4bp
B D           Zebrafish 4bp

Alignment block 20 of 629 in window, 65429691 - 65429692, 2 bps 
B D                Human  aa
B D                Chimp  aa
B D            Orangutan  aa
B D              Opossum  ag
B D             Platypus  aa
B D        X. tropicalis  aa
B D          Stickleback  -g
B D            Zebrafish  -a
B D              Lamprey  --
B D  Medium ground finch  ==
B D              Chicken  ==
  D        Scarlet macaw  ==
  D               Parrot  ==
  D     Peregrine falcon  ==
  D         Saker falcon  ==
  D          Rock pigeon  ==
B D           Budgerigar  ==
  D  Collared flycatcher  ==
B D              Gorilla  --

Inserts between block 20 and 21 in window
B D       X. tropicalis 2bp
B D         Stickleback 1bp
B D           Zebrafish 1bp

Alignment block 21 of 629 in window, 65429693 - 65429703, 11 bps 
B D                   Human  gtgt------ctcacat
B D                   Chimp  gtgt------ctca--t
B D               Orangutan  gtgt------ctcacat
B D                 Opossum  gttt------cttatct
B D                Platypus  gggcacgtg-ctcatcc
  D             Rock pigeon  ac---------------
  D            Saker falcon  ac---------------
  D        Peregrine falcon  ac---------------
  D     Collared flycatcher  ac---------------
  D  White-throated sparrow  at---------------
B D     Medium ground finch  at---------------
B D              Budgerigar  at---------------
  D                  Parrot  at---------------
  D           Scarlet macaw  gt---------------
B D                 Chicken  at---------------
B D           X. tropicalis  g----------------
B D             Stickleback  ---------------ac
B D               Zebrafish  ---------------gt
B D                 Lamprey  ------gtgtgacacct
B D                 Gorilla  -----------------

Inserts between block 21 and 22 in window
  D            Rock pigeon 2bp
  D           Saker falcon 17bp
  D       Peregrine falcon 17bp
  D    Collared flycatcher 17bp
  D White-throated sparrow 3bp
B D    Medium ground finch 6bp
B D             Budgerigar 4bp
  D                 Parrot 4bp
  D          Scarlet macaw 8bp
B D            Stickleback 2bp
B D              Zebrafish 15bp

Alignment block 22 of 629 in window, 65429704 - 65429756, 53 bps 
B D                   Human  gtcacac-atgtgtcag-----------tcatat-----------------gtcacac--gtcagtca--
B D                   Chimp  gtcacac-----gtcag-----------tcacat-----------------gtcacac--gtcagtca--
B D               Orangutan  gtcatgc-atatgtcag-----------tcacgt-----------------gccacacatgtcagtca--
B D                 Opossum  accctat-ctgaactga-----------tgattt-----------------ctaaagc--ctttataa--
B D                Platypus  gccacga-tcacgtcgg-----------tggcactggctgagatcaggtaggcgacacaagatcatga--
  D             Rock pigeon  gacacgc-gtgtgcgac-------------acgt-----------------gtgtgac---------acc
  D            Saker falcon  gacacgg-gagtggcctgggacaa----acatgg-----------------gacaaac---------a--
  D        Peregrine falcon  gacacgg-gattgacacggggttg----acacgg-----------------gagtgac---------a--
  D     Collared flycatcher  cacacccagtgccacccagtgc------cacctc-----------------ctgtcac------------
  D  White-throated sparrow  -agacgt-gtgtgacag-------------gtgt-----------------gtgtgac---------a--
B D     Medium ground finch  cacacgt-gtgtcacagtgcgc------acacgc-----------------gtgtcac---------a--
B D             Zebra finch  cacacct-gtgtgacac-------------acct-----------------gtgacac---------a--
B D              Budgerigar  ggaacat-atatgggac-------------aggt-----------------atgggat---------a--
  D                  Parrot  gacacac-gtgtgatag-------------atgg-----------------gggttac---------a--
  D           Scarlet macaw  gacaccc-atg--------------------ggg-----------------gtgtcac---------a--
B D                 Chicken  gttctgg-atgtgtcatcgtggggtccccaaagt-----------------gtcccca---------a--
B D             Stickleback  gacacat-aagagacag---------------gc-----------------atgagac---------c--
B D               Zebrafish  ggcgtgt-aattgacat-----------------------------------tttgcc---------t--
B D                 Lamprey  ggtgcgt-gtgagacac----------ctgacgt-----------------gtgtgac--acctggta--
B D           X. tropicalis  ----------------------------------------------------------------------
B D                 Gorilla  ----------------------------------------------------------------------

                      Human  -------ct-------t-gttagtcacgtgt
                      Chimp  -------ct-------t-gttagtcacatgt
                  Orangutan  -------ct-------t-gttagtcacgtgt
                    Opossum  -------at-------t-gtttg---cgtgc
                   Platypus  -------ag-------c-ggcagtcatgtga
                Rock pigeon  tgacaagcg-------c-gtgtgacgcgtgt
               Saker falcon  -------cg-------g-gactgacacggga
           Peregrine falcon  -------cg-------g-gattgacacggga
        Collared flycatcher  ----------------c-tcctgtcacctgc
     White-throated sparrow  -------tg-------t-gtgtgacacgtgt
        Medium ground finch  -------ggctccacat-gtgtgtcacgggt
                Zebra finch  -------cc-------t-gtgatacacctgt
                 Budgerigar  -------tg-------t-atgagatatgtat
                     Parrot  -------ta-------c-gtgttacatgcat
              Scarlet macaw  -------ca-------cggggtcacacgcac
                    Chicken  -------ag-------g-gtctccaaagtgt
                Stickleback  -------gg-------t-acgagacacataa
                  Zebrafish  -------tg-------t-agttggcatgtaa
                    Lamprey  -------cg-------t-gtgagacacctga
              X. tropicalis  -------------------------------
                    Gorilla  -------------------------------

Inserts between block 22 and 23 in window
  D            Rock pigeon 2bp
  D    Collared flycatcher 11bp
  D White-throated sparrow 7bp
B D    Medium ground finch 11bp
B D            Zebra finch 11bp
B D             Budgerigar 11bp
  D          Scarlet macaw 4bp

Alignment block 23 of 629 in window, 65429757 - 65429773, 17 bps 
B D                   Human  catacatgcatcaccca-------
B D                   Chimp  catacatgcgtcaccca-------
B D               Orangutan  catacatgcgtcaccca-------
B D                 Opossum  caggaacg----acaca-------
B D                Platypus  tcagcacggcgtgagca-------
  D             Rock pigeon  --gacacctgacaagcg-------
  D            Saker falcon  --ttgacacggggttga-------
  D        Peregrine falcon  --ttgacacggggttga-------
  D     Collared flycatcher  --gtcac-------ccc-------
  D  White-throated sparrow  --tacag-------gga-------
B D     Medium ground finch  --tgcac-------gcg-------
B D             Zebra finch  --tacacctgtgataca-------
B D              Budgerigar  -----------gggata-------
  D                  Parrot  -----------catcca-------
  D           Scarlet macaw  --------------ccg-------
B D                 Chicken  --------------ccc-------
B D           X. tropicalis  ----------tgaatca-------
B D             Stickleback  --gagacaggcatgata-------
B D               Zebrafish  --ttgacgtatttggtg-------
B D                 Lamprey  ------cgtgtgtgacacctggtg
B D                 Gorilla  ------------------------

Inserts between block 23 and 24 in window
B D          X. tropicalis 4bp
B D            Stickleback 11bp
B D              Zebrafish 9bp

Alignment block 24 of 629 in window, 65429774 - 65429787, 14 bps 
B D                   Human  tgtattattcacgt--------------
B D                   Chimp  tgtattattc------------------
B D               Orangutan  cgtattattcacgt--------------
B D                 Opossum  catgcaattc------------------
B D                Platypus  catggatggcaagg--------------
  D             Rock pigeon  cgtgt-----------------------
  D            Saker falcon  cacgg-----------------------
  D        Peregrine falcon  cacgg-----------------------
  D     Collared flycatcher  catgt-----------------------
  D  White-throated sparrow  cctgg-----------------------
B D     Medium ground finch  cgtgt-----------------------
B D             Zebra finch  cctgt-----------------------
B D              Budgerigar  ggtat-----------------------
  D                  Parrot  tgcat-----------------------
  D           Scarlet macaw  ggtgt-----------------------
B D                 Chicken  catgg-----------------------
  D         Green seaturtle  tgtgt-----------------------
B D           X. tropicalis  tgtgt-----------------------
B D             Stickleback  cacat-----------------------
B D               Zebrafish  agtgt-----------------------
B D                 Lamprey  cgtgt---------gagacacctgacgt
B D                 Gorilla  ----------------------------

Inserts between block 24 and 25 in window
  D            Rock pigeon 5bp
  D           Saker falcon 11bp
  D       Peregrine falcon 11bp
  D    Collared flycatcher 3313bp
  D White-throated sparrow 11bp
B D    Medium ground finch 14bp
B D            Zebra finch 6bp
B D             Budgerigar 18bp
  D                 Parrot 13bp
  D          Scarlet macaw 14bp
B D                Chicken 23bp
  D        Green seaturtle 15bp
B D          X. tropicalis 5bp

Alignment block 25 of 629 in window, 65429788 - 65429794, 7 bps 
B D                   Human  gtctgtc
B D                   Chimp  gtgtgtc
B D               Orangutan  gtctgtc
B D                 Opossum  --ccaac
B D                Platypus  agctatg
  D             Rock pigeon  gtgtgtg
  D            Saker falcon  gactgac
  D        Peregrine falcon  gagtgac
  D  White-throated sparrow  agccggt
B D     Medium ground finch  gtgtgtc
B D             Zebra finch  ccctgtt
B D              Budgerigar  gtatgag
  D                  Parrot  -----cc
  D           Scarlet macaw  --acgtg
B D                 Chicken  gtcatta
  D         Green seaturtle  ttttggg
B D           X. tropicalis  gtgtgtg
B D             Stickleback  ---aaga
B D               Zebrafish  ---agtt
B D                 Lamprey  gtgtgac
  D     Collared flycatcher  =======
B D                 Gorilla  -------

Inserts between block 25 and 26 in window
B D            Stickleback 6bp

Alignment block 26 of 629 in window, 65429795 - 65429847, 53 bps 
B D                   Human  acatgtt---------ggtaatgcgtgttac---------acaa-------gactgtcatgtg--ac---
B D                   Chimp  acatgtt---------ggtaatgcgtgttac---------acaa-------gacagtcatgtg--ac---
B D               Orangutan  ac--gtt---------ggtaatgtgtgttac---------acaa-------gactgtcacgtg--ac---
B D                 Opossum  acatgt-----------gtcctttccgacac---------acat-------aacggggaaat---ac---
B D                Platypus  acgatgt---------gatcatgtgagtggc---------acag-------g------------------
  D             Rock pigeon  acacctg---------acgcgcgcgtgcgac---------acgt-------gtgtgacacctg--ac---
  D            Saker falcon  acgggag--tggcctgggacaaacatgggacaaac-----acgg-------gactg---------ac---
  D        Peregrine falcon  acggggt--tgacacgggggtgacacgggattgac-----acgg-------gattg---------ac---
  D  White-throated sparrow  acaaggt------gagagacacacgtgtgac---------acgt-------gtgtg---------ac---
B D     Medium ground finch  acaggtc---------acacacacctgtgcca-gcgtgt-acgg-------gtgtgtcgtggggcac---
B D             Zebra finch  acacctg---------tgtcacacctgtgatacacctgtcatac-------ctgtg---------at---
B D              Budgerigar  acatgta-------tgggaaacatgtggaac---------acat-------atggg---------at---
  D                  Parrot  acatgta-----------acccacatgtaac---------gcgt-------gtgta---------ac---
  D           Scarlet macaw  acatgtt-----------acacacgtgttac---------atgtgacatacgtgtg---------ac---
B D                 Chicken  acatgtc-----------attagcatgtcattagc-----gtgt-------ccttc---------ac---
  D         Green seaturtle  tcatttt------ttgtgcgtgacgtgcgac---------gtgc-------gcgtg---------ac---
B D           X. tropicalis  gcttgtt------------------tgtagc---------ctgt-------gtgta---------gc---
B D             Stickleback  -catgagaccagtaagagacacataagagac---------aggc-------atgag---------ac---
B D                 Lamprey  ---------------acctgacgtgtgtgac--acctg--acgt-------gcgag---------acacc
  D     Collared flycatcher  ======================================================================
B D                 Gorilla  ----------------------------------------------------------------------

                      Human  --tcgca------------tgt--gacat
                      Chimp  --ttgca------------tgt--gacat
                  Orangutan  ----aca------------cgt--gacat
                    Opossum  ----aca------------tgt--gacat
                   Platypus  ----gta------------tgt--gacat
                Rock pigeon  --acgcg------------cgt--g----
               Saker falcon  --acggg------------att--gacac
           Peregrine falcon  --acggg------------gtt--gacac
     White-throated sparrow  --acacg------------tgt--g--ac
        Medium ground finch  --acacg------------tgt--gtcac
                Zebra finch  --acacc------------tgt--gatac
                 Budgerigar  --atgta------------tgg--ggtaa
                     Parrot  --ctgtc------------tgt--aacgt
              Scarlet macaw  --atgttatgcatgtgctatgt--tacgt
                    Chicken  --atgtt------------cct--gatgt
            Green seaturtle  --acgtg------------cctccgtcgc
              X. tropicalis  --tcgtg------------tgt--gactt
                Stickleback  --cggta------------cga--gacac
                    Lamprey  tgacgtg------------tgt--gac--
        Collared flycatcher  =============================
                    Gorilla  -----------------------------

Inserts between block 26 and 27 in window
B D                Chicken 77bp
  D        Green seaturtle 2bp
B D            Stickleback 6bp

Alignment block 27 of 629 in window, 65429848 - 65429848, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D               Orangutan  g
B D                 Opossum  a
B D                Platypus  g
  D            Saker falcon  g
  D        Peregrine falcon  g
  D  White-throated sparrow  a
B D     Medium ground finch  a
B D             Zebra finch  a
B D              Budgerigar  g
  D                  Parrot  g
  D           Scarlet macaw  g
  D         Green seaturtle  g
B D           X. tropicalis  g
B D             Stickleback  g
B D                 Lamprey  a
B D                 Chicken  =
  D             Rock pigeon  -
  D     Collared flycatcher  =
B D                 Gorilla  -

Inserts between block 27 and 28 in window
  D           Saker falcon 2bp
  D       Peregrine falcon 2bp
B D    Medium ground finch 2bp
  D          Scarlet macaw 1bp

Alignment block 28 of 629 in window, 65429849 - 65429850, 2 bps 
B D                   Human  ac-
B D                   Chimp  ac-
B D               Orangutan  ac-
B D                 Opossum  ct-
B D                Platypus  tc-
  D            Saker falcon  gt-
  D        Peregrine falcon  gt-
B D     Medium ground finch  -c-
B D             Zebra finch  gc-
B D              Budgerigar  -t-
  D                  Parrot  -c-
  D           Scarlet macaw  -c-
  D         Green seaturtle  ac-
B D           X. tropicalis  -t-
B D             Stickleback  ac-
B D                 Lamprey  -cc
  D  White-throated sparrow  ---
B D                 Chicken  ===
  D             Rock pigeon  ---
  D     Collared flycatcher  ===
B D                 Gorilla  ---

Inserts between block 28 and 29 in window
B D    Medium ground finch 1bp
B D            Zebra finch 3bp
B D             Budgerigar 1bp
  D                 Parrot 1bp
  D          Scarlet macaw 1bp
  D        Green seaturtle 1bp
B D          X. tropicalis 1bp

Alignment block 29 of 629 in window, 65429851 - 65429852, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D               Orangutan  tg
B D                 Opossum  tg
B D                Platypus  ac
  D             Rock pigeon  tg
  D            Saker falcon  tg
  D        Peregrine falcon  tg
  D  White-throated sparrow  -t
B D     Medium ground finch  -g
B D             Zebra finch  -g
B D              Budgerigar  tg
  D                  Parrot  tg
  D           Scarlet macaw  tg
  D         Green seaturtle  t-
B D           X. tropicalis  tg
B D             Stickleback  ag
B D               Zebrafish  tg
B D                 Lamprey  tg
B D                 Chicken  ==
  D     Collared flycatcher  ==
B D                 Gorilla  --

Inserts between block 29 and 30 in window
  D White-throated sparrow 1bp
B D    Medium ground finch 1bp
B D            Zebra finch 1bp
  D                 Parrot 6bp
  D          Scarlet macaw 7bp
B D          X. tropicalis 2bp

Alignment block 30 of 629 in window, 65429853 - 65429861, 9 bps 
B D                   Human  acat---gtgtg-------
B D                   Chimp  ac-----gtgtg-------
B D               Orangutan  ac-----ttgtg-------
B D                 Opossum  acat---gtatg-------
B D                Platypus  atgt---tcata-------
  D             Rock pigeon  --ac---acgtg-------
  D            Saker falcon  --ac---acggg-------
  D        Peregrine falcon  --ac---atgag-------
  D  White-throated sparrow  acat---gtgag-------
B D     Medium ground finch  acac---gtgtg-------
B D             Zebra finch  ccat---ccctg-------
B D              Budgerigar  acat---atgtg-------
  D                  Parrot  --gt---atgta-------
  D           Scarlet macaw  --gt---acgtt-------
  D         Green seaturtle  gcat---gtgtg-------
B D           X. tropicalis  gcct---gtgtg-------
B D             Stickleback  gcatgagac----------
B D               Zebrafish  acat---at----------
B D                 Lamprey  acgt---gtgagacacctg
B D                 Chicken  ===================
  D     Collared flycatcher  ===================
B D                 Gorilla  -------------------

Inserts between block 30 and 31 in window
  D            Rock pigeon 2bp
  D       Peregrine falcon 6bp
  D        Green seaturtle 2bp
B D          X. tropicalis 4bp

Alignment block 31 of 629 in window, 65429862 - 65429870, 9 bps 
B D                   Human  atgt-g----cgtg
B D                   Chimp  atgt-g----cgtg
B D               Orangutan  atgt-g----tgtg
B D                 Opossum  cctt-t----cctg
B D                Platypus  atgc-t----gcga
  D             Rock pigeon  acgc-g----tgtg
  D            Saker falcon  atgg-g----attg
  D        Peregrine falcon  acgg-g----gttg
  D  White-throated sparrow  acgt-g----tgtg
B D     Medium ground finch  ttgcag----cgtg
B D             Zebra finch  atgc-a----cctg
B D              Budgerigar  atag-g----tacg
  D                  Parrot  acct-g----tata
  D           Scarlet macaw  catt-tcaactgtt
  D         Green seaturtle  acgt-g----ca--
B D           X. tropicalis  tcgt-g----tgtg
B D             Stickleback  cggt-a----cgag
B D               Zebrafish  atgt-t----tctg
B D                 Lamprey  acgt-g----tgtg
B D                 Chicken  ==============
  D     Collared flycatcher  ==============
B D                 Gorilla  --------------

Inserts between block 31 and 32 in window
  D            Rock pigeon 2bp
  D White-throated sparrow 2bp
B D             Budgerigar 2bp
  D                 Parrot 2bp
  D          Scarlet macaw 2bp

Alignment block 32 of 629 in window, 65429871 - 65429904, 34 bps 
B D                   Human  acacatg--------------ggtgatacgtgactgaca-----tatgtgtga--
B D                   Chimp  acacatg--------------ggtgatacgtgactgaca-----tatgtgtga--
B D               Orangutan  atacatg--------------ggtgatacgtgactaac-------atgtgtga--
B D                 Opossum  gcacgtg--------------tgcatgatggtccaggcg-----catgtgtca--
B D                Platypus  ctatgtg--------------ggcagccccctatgatc---------acgtga--
  D             Rock pigeon  acatgtgacatgcgtgacacctgacacgcgtatgcaaca-----cgtgtgtga--
  D            Saker falcon  acacggg--------------gttgacacgggagtgaca-----cgggattga--
  D        Peregrine falcon  acacggg--------------gttgacacgggataaaca-----tgggactga--
  D  White-throated sparrow  aggtgtg--------------tgtgacatgtg----------------tgtga--
B D     Medium ground finch  acatgtgg----------ggctgggacatgtgtgtgaca------ggctgtga--
B D             Zebra finch  ---agtg-----------atctctgacacacctgtgaca-----cacctgtga--
B D              Budgerigar  acatgta--------------tgtgataggtatgggata-----catatggga--
  D                  Parrot  acatgga--------------cgtcacatgtatgcagca-----cgcatgtaa--
  D           Scarlet macaw  gcatgg----------------gttacatacatgtagca-----tacatgtta--
  D         Green seaturtle  acatgcg--------------tccgacacgcgacatgca-----acgttgc----
B D           X. tropicalis  acttgtg--------------tgtagctcgtgtgtgact-----tgtgtgta---
B D             Stickleback  -------------------------acacataagagaca-----ggcat------
B D               Zebrafish  -------------------------acatatatgtg--------gacat------
B D                 Lamprey  ------------------acacctggtacgtgtgagacacctgacgtgtgtgaca
B D                 Chicken  =======================================================
  D     Collared flycatcher  =======================================================
B D                 Gorilla  -------------------------------------------------------

Inserts between block 32 and 33 in window
  D            Rock pigeon 1bp
  D           Saker falcon 1bp
  D       Peregrine falcon 1bp
  D White-throated sparrow 1bp
B D    Medium ground finch 1bp
B D            Zebra finch 1bp
B D             Budgerigar 1bp
  D                 Parrot 1bp
  D          Scarlet macaw 1bp

Alignment block 33 of 629 in window, 65429905 - 65429928, 24 bps 
B D                   Human  atg----------------ggcttgacaagt-----------gacagacac
B D                   Chimp  atgacacct--gtgtcacgggcttgacaagt-----------gacagacat
B D               Orangutan  atgacacct--gtgtcatgggcttgacaagt-----------gacagacat
B D                 Opossum  at-------------------cctggcatgttcacccttcccagcacgcat
B D                Platypus  gcgacacttgagtgtcatgtgctttgcacac-----------aactgtcat
  D             Rock pigeon  ----------------acc---------tga-----------cgcgcgtgt
  D            Saker falcon  ----------------acggggttgacacgg-----------gataaacat
  D        Peregrine falcon  ----------------acgggagtggcctgg-----------gacaaacat
  D  White-throated sparrow  ----------------acg-------tgtga--------------------
B D     Medium ground finch  ----------------acg-------tgtga-----------cacc----t
B D             Zebra finch  ----------------acc-------tgtga-----------tacacctgt
B D              Budgerigar  ----------------atg-------gacag-----------gacacatat
  D                  Parrot  ----------------acg-------tatgt-----------aacccgcat
  D           Scarlet macaw  ----------------atgcg--ttacatgt-----------tgcacacat
B D                  Turkey  ----------------atgggatctacatgg-----------gattaacat
  D         Green seaturtle  ----------------atgcattttgtgtga-----------agt------
B D           X. tropicalis  ---------------------cctcgtgtgt-----------gactcgtgt
B D             Stickleback  ------------------gagaccggtacga-----------gacacataa
B D               Zebrafish  ---------------------atttgtttct-----------ggcatatat
B D                 Lamprey  ---------------------cctggtgcgt-----------gtgagacac
B D                 Chicken  ===================================================
  D     Collared flycatcher  ===================================================
B D                 Gorilla  ---------------------------------------------------

Alignment block 34 of 629 in window, 65429929 - 65429975, 47 bps 
B D                   Human  gtgactggta---tgtgactgacgtg-tgt--gaatcgtg---------------ac-------------
B D                   Chimp  gtgactggta---tgtgactgacgtg-tgt--gaatcgtg---------------ac-------------
B D               Orangutan  gtgactggta---tgtgactgacgtg-tgt--gaatcgtg---------------ac-------------
B D                 Opossum  gccagtgcta---------gcatgtg-tgt--tgttcctg---------------ac-------------
B D                Platypus  atgctcggcaccctgcga-tgatgtg-tgt----atcatg---------------ct-------------
  D             Rock pigeon  --------------gcgacacgtgtgtga---cacctgac---------------ac-------------
  D            Saker falcon  --------------gggactgacacg-ggagtggcctggg---------------ac-------------
  D        Peregrine falcon  --------------gggactgacacg-ggactgacacggg---------------actgacatgggattg
  D  White-throated sparrow  -----------------ggggttaca-gg---gacctgga---------------gg-------------
B D     Medium ground finch  --------------gccacgcgtgta-gg---ggactggg---------------ac-------------
B D             Zebra finch  --------------gcccatctctga-ta---cacctgtg---------------tg-------------
B D              Budgerigar  --------------gggacatggat--gg---gatatgtatgggacaggtatgggat-------------
  D                  Parrot  --------------gtcacc------------cgtatgta---------------ac-------------
  D           Scarlet macaw  --------------gttacattcat--gg---catatgtt---------------ac-------------
B D                 Chicken  --------------gccattgacgtg-tgcttaacgtgtc---------------at-------------
B D                  Turkey  --------------gggatcaacatg-gggtggacatggg---------------at-------------
  D         Green seaturtle  --------------gtgttgtgtgtg-tg---atcttgtg---------------tg-------------
B D           X. tropicalis  --------------gtcactcgtgtg-tgacttgtgtgta---------------tc-------------
B D             Stickleback  --------------gagacaggcatg-ataccagtaagag---------------ac-------------
B D               Zebrafish  --------------gtgacatatatg-tttc-------ag---------------ac-------------
B D                 Lamprey  ------------------ctgacgtg-tgt--gacacctg---------------gt-------------
  D     Collared flycatcher  ======================================================================
B D                 Gorilla  ----------------------------------------------------------------------

                      Human  -----------agacg-------tgac----------------------aa-------------------
                      Chimp  ---------tgagacg-------tgac----------------------aa-------------------
                  Orangutan  ---------tgagatg-------tgac----------------------aa-------------------
                    Opossum  ---------atgggtgtcccttctggc----------------------ac-------------------
                   Platypus  ---------cagcacc-------ctgt----------------------ga-------------------
                Rock pigeon  ---------gcgtgtg-------tgac----------------------ac-------------------
               Saker falcon  ---------aaacatg-------ggac----------------------aa-------------------
           Peregrine falcon  acacgggataaacatg-------ggaccgacacaggagtgacacgggataa-------------------
     White-throated sparrow  ---------atctgt----------ac----------------------ag-------------------
        Medium ground finch  ---------atgtgcg-------tgac----------------------ag-------------------
                Zebra finch  ---------atctgtg-------atac----------------------ac-------------------
                 Budgerigar  ---------atgtatg-------gaac----------------------at-------------------
                     Parrot  ---------ccatatg-------taac----------------------ac-------------------
              Scarlet macaw  ---------acatata-------ttgc----------------------at-------------------
                    Chicken  ---------tggcgtg-------ttct----------------------tg-------------------
                     Turkey  ---------cgacatg-------ggat----------------------ta-------------------
            Green seaturtle  ---------agtcgtg-------tttt----------------------gt-------------------
              X. tropicalis  ---------tcgtgtg-------agac----------------------tt-------------------
                Stickleback  ---------acataag-------agac----------------------ag-------------------
                  Zebrafish  ---------atatatg-------tgac----------------------at-------------------
                    Lamprey  ---------acgtgtg-------agac----------------------acctgacgtgtgtgacacctg
        Collared flycatcher  ======================================================================
                    Gorilla  ----------------------------------------------------------------------

Inserts between block 34 and 35 in window
B D            Stickleback 22bp

Alignment block 35 of 629 in window, 65429976 - 65429990, 15 bps 
B D                   Human  --ac---------acgtga---c-------------tgacac
B D                   Chimp  --ac---------acgtga---c-------------tgacac
B D               Orangutan  --ac---------acttga---c-------------tgacac
B D                 Opossum  --ac---------atgtcattcc-------------tggcac
B D                Platypus  --tt---------atgtgc---a-------------tgccat
  D             Rock pigeon  --ctgacgcgcgtgtgcga---cacgtgtgtg----acacct
  D            Saker falcon  --ac---------acggga---c-------------tgacac
  D        Peregrine falcon  --ac---------atggga---c-------------tgacac
  D  White-throated sparrow  --cc-----------ggta---ca------------aggtga
B D     Medium ground finch  --cc----------tggaa---cacccgtgtgg---ggctgt
B D             Zebra finch  --ct---------gtgata---cacctgtacca---atccct
B D              Budgerigar  --at---------atggga---caggtatggga--tatgtat
  D                  Parrot  --ac---------acgtga---cccgaatgcaa--caggcat
  D           Scarlet macaw  --ac---------acgttt---c----atatta--cattcat
B D                 Chicken  --ac---------gtgttc---t-------------tgacat
B D                  Turkey  --ac---------atggga---t-------------tgacat
  D         Green seaturtle  --gt---------gtcttt---tttgtgtgtcaatttttttt
B D           X. tropicalis  --gt---------gtgaag---ctcgtgtg------tgactc
         Southern platyfish  --ac---------atgtga---a-------------tgacat
B D             Stickleback  --at---------aagaga---c-------------aggcat
B D               Zebrafish  --at---------atgttt---c-------------agacat
B D                 Lamprey  acgt---------gtgaga---cacc----------tgacgt
  D     Collared flycatcher  ==========================================
B D                 Gorilla  ------------------------------------------

Inserts between block 35 and 36 in window
B D               Platypus 3bp

Alignment block 36 of 629 in window, 65429991 - 65429997, 7 bps 
B D                   Human  gtgatag-----
B D                   Chimp  gtgatag-----
B D               Orangutan  atgatag-----
B D                 Opossum  gagatac-----
B D                Platypus  atga--------
  D             Rock pigeon  --gacac-----
  D            Saker falcon  --gggat-----
  D        Peregrine falcon  --gggat-----
  D  White-throated sparrow  --gagac-----
B D     Medium ground finch  --gacac-----
B D             Zebra finch  --gatac-----
B D              Budgerigar  --gagat-----
  D                  Parrot  --gtaac-----
  D           Scarlet macaw  --gtaat-----
B D                 Chicken  --gttct-----
B D                  Turkey  --ggggt-----
  D         Green seaturtle  --g---------
B D           X. tropicalis  gtgtagc-----
         Southern platyfish  --gtaaa-----
B D             Stickleback  --gagac-----
B D                 Lamprey  gtgagacacctg
B D               Zebrafish  ------------
  D     Collared flycatcher  ============
B D                 Gorilla  ------------

Inserts between block 36 and 37 in window
  D           Saker falcon 4bp
  D       Peregrine falcon 37bp
B D             Budgerigar 1bp
  D                 Parrot 1bp
  D          Scarlet macaw 1bp
B D                Chicken 2bp
B D                 Turkey 2bp
        Southern platyfish 2bp
B D            Stickleback 2bp

Alignment block 37 of 629 in window, 65429998 - 65429999, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                 Opossum  at
B D                Platypus  -t
  D             Rock pigeon  gc
  D            Saker falcon  ac
  D        Peregrine falcon  gt
  D     Collared flycatcher  ac
  D  White-throated sparrow  ac
B D     Medium ground finch  ac
B D             Zebra finch  ac
B D              Budgerigar  -t
  D                  Parrot  -c
B D           X. tropicalis  -c
         Southern platyfish  at
B D             Stickleback  gt
B D               Zebrafish  at
B D                 Lamprey  ac
B D                  Turkey  ==
B D                 Chicken  ==
  D           Scarlet macaw  ==
  D         Green seaturtle  --

Inserts between block 37 and 38 in window
B D                Gorilla 67bp
B D               Platypus 1bp
B D          X. tropicalis 1bp

Alignment block 38 of 629 in window, 65430000 - 65430048, 49 bps 
B D                   Human  gtgtgtg-----a---------------catgtg------actt---agacgtgt-------gacaca--
B D                   Chimp  gtgtgtg-----a---------------catgtg------actt---agacgtgt-------gacaca--
B D               Orangutan  gtgtgtg-----a---------------catgtg------actt---agacatgt-------gtcacg--
B D                 Opossum  gtctataattaca---------------cattgc------attt---acgcttgt-------tttata--
B D                Platypus  ------------a---------------tgtgcg------cttc---acatgctt-------agcata--
  D             Rock pigeon  gtgtgtg---------------------------------acac---gtgtgtga-------cacc----
  D            Saker falcon  ggggttg-----a---------------cacggg------ataa---acatggga-------c-------
  D        Peregrine falcon  gggaccg-----a---------------cacggg------ataa---acatggga-------c-------
  D     Collared flycatcher  gtgtgtc-----g---------------ca----------gtgt---gtatg----------ggtgtg--
  D  White-throated sparrow  acgtgtg-----a---------------cacgtgtgtgacacac---gtgtgaca-------ggtgtg--
B D     Medium ground finch  gcgtgtg-----a---------------cacctg------acac---gtgtgtga-------gccctg--
B D             Zebra finch  ctgtgtg-----a---------------tctctg------atac---acctgtgt-------gatctc--
B D              Budgerigar  gtatggg---------------------------------acag---gtatggga-------taggta--
  D                  Parrot  gtatgta---------------------------------acat---gtatgtaa-------gccata--
  D           Scarlet macaw  ---tatt---------------------------------acat---gcatgt-----------------
B D                 Chicken  --atgtg-----gcgc------------cattgg------atcc---ccattggg-------tctcca--
B D                  Turkey  --atgtg-----gggtt---------tacatggg------attg---acatggga-------ttaacatg
  D         Green seaturtle  ---tgtg-----gtgttttgtgtgtctttttttt------gtgt---acttgtgg-------tacctt--
B D           X. tropicalis  ----------------------------------------------------------------------
         Southern platyfish  -----------------------------gtgaa------tcac---atgtaaaagcacatgtataca--
B D             Stickleback  -----------------------------acgag------acac---ataagaga-------caggca--
B D               Zebrafish  -----------------------------atgtg------acat---atatgttt-------cagaca--
B D                 Lamprey  ---------------------------gtgtgtg------acacctgacgtgtga-------gacacc--
B D                 Gorilla  ======================================================================

                      Human  ----tg----ac-----------------------------------tgatacgtgact---g
                      Chimp  ----tg----ac-----------------------------------tgatacgtgact---g
                  Orangutan  ----tg----actgacaagtgattgacatgtgatggccaca--tgtgtgacacgtgact---g
                    Opossum  ----at----ac----------------------------------------tgtctct---a
                   Platypus  ----tt----ga-------------------gattgccaca------tgtcacatgccc---c
                Rock pigeon  ----tg----ac--------------------------acgcgcgtgtgacacctgacg---c
               Saker falcon  ----tg----ac--------------------------acg--ggagtggcctgggaca---a
           Peregrine falcon  ----tg----ac--------------------------acg--ggagtgacacgggatt---g
        Collared flycatcher  ----tc----ac--------------------------ggg-----------tcagaca---c
     White-throated sparrow  ----tg----at--------------------------gtg-----------tatgaca---c
        Medium ground finch  ----tg----ac--------------------------acgcctgtgcacactgcgaca---c
                Zebra finch  ----tg----at--------------------------acacctgagtgatctctgtca---c
                 Budgerigar  ----tgggacac--------------------------ata-----------tgggata---g
                     Parrot  ----tg---ca---------------------------acg-----------agcaaca---c
              Scarlet macaw  ----tg---cat--------------------------aca-----------tgtgaca---c
                    Chicken  -aattg----tc--------------------------------------------cct---t
                     Turkey  gaatgg----tc--------------------------atg--ggattgacatgggatt---t
            Green seaturtle  ----ag----ag--------------------------actaaccaatttatttgagca---t
              X. tropicalis  -------------------------------------------------ttgtgtgact---c
         Southern platyfish  ----tg----gg--------------------------at----------tttggaacatttc
                Stickleback  ----tg----ag--------------------------acc-------ggtacgagaca---c
                  Zebrafish  ----ta--------------------------------------------tatgtgaca---t
                    Lamprey  ----tg----gt--------------------------gcg-----------tgtgag-----
                    Gorilla  ===============================================================

Inserts between block 38 and 39 in window
        Southern platyfish 7bp
B D            Stickleback 7bp
B D              Zebrafish 11bp

Alignment block 39 of 629 in window, 65430049 - 65430094, 46 bps 
B D                   Human  a----cac-ct---------gtgagacaagtgact-----------------------------gaca-c
B D                   Chimp  a----cac-ct---------gtgagacaagtgact-----------------------------gaca-c
B D               Orangutan  a----cac-ct---------gtgagacacgtgact-----------------------------gaca-c
B D                 Opossum  g----cat-c--------------aacatgtgaat------------------------------aca-c
B D                Platypus  a----cgtgct---------gtg-atcatgtgtac-----------------------------atca-c
  D             Rock pigeon  a----cgt-gt---------gcgacacctgacgcg-----------------------------cacg-c
  D            Saker falcon  a----cat-gg---------gacaaacacgggact-----------------------------gaca-c
  D        Peregrine falcon  a----cat-gg---------gactgacacgggaca-----------------------------caca-c
  D     Collared flycatcher  a----cgt-gtcacgggctggacacgtgtgtcacg-----------------------------g----t
  D  White-throated sparrow  a----tgt-gt---------gacaagtgtgtgaca-----------------------------gatg-t
B D     Medium ground finch  g----cct-gtacagccccaaacaggcgtgtg-ca-----------------------------gcc--t
B D             Zebra finch  a----cct-gt---------gacacacctgtacca-----------------------------atctct
B D              Budgerigar  g----tat-ga---------gacatgtatgggaaa-----------------------------catg-t
  D                  Parrot  a----tat-gt---------aacacacatgtaacc-----------------------------cgta-t
  D           Scarlet macaw  a----cat-gc---------tacatacatgttgca-----------------------------caca-t
B D                 Chicken  g----cgt-gt---------cacagacacgtgact-----------------------------aaca-t
B D                  Turkey  a----cat-gg---------gatcggcatcagatc-----------------------------aaca-t
  D         Green seaturtle  aagctttt-gt---------gagctacagctcact-----------------------------tcat-c
B D           X. tropicalis  g----tg---------------------------------------------------------------
         Southern platyfish  ---------------------aaacctatgtgatccccatgttttcaagtgtatcacgttttcacatg-t
B D             Stickleback  ---------------------acaggcatgagacc-----------------------------ggta-c
B D            Atlantic cod  -----------------------atacctgagaca-----------------------------cagg-t
B D               Zebrafish  ---------------------acatatatgtgaca-----------------------------tata-t
B D                 Lamprey  ----------------acacctgacgtgtgtgaca--------------------------cctgacg-t
B D                 Gorilla  ======================================================================

                      Human  atgatcaacacataaatgat-----
                      Chimp  atgatcaacacataaatgat-----
                  Orangutan  atgatcaacac--aaatgat-----
                    Opossum  gtgttcggcat-caattaa------
                   Platypus  atgctcaggtccttgctatt-----
                Rock pigeon  gtgcgacac----------------
               Saker falcon  gggattgac----------------
           Peregrine falcon  gggattgac----------------
        Collared flycatcher  gtg-cacag----------------
     White-throated sparrow  gtgacacac----------------
        Medium ground finch  gggacacac----------------
                Zebra finch  gttacacct----------------
                 Budgerigar  ggaacacat----------------
                     Parrot  gtaacccac----------------
              Scarlet macaw  gctacagac----------------
                    Chicken  gtcacgagc----------------
                     Turkey  gggattaac----------------
            Green seaturtle  gg-----------------------
              X. tropicalis  -------------------------
         Southern platyfish  gatacaaat----------------
                Stickleback  gagacacat----------------
               Atlantic cod  gagccaggt----------------
                  Zebrafish  gtttcagac----------------
                    Lamprey  gtgagacac-----------ctgac
                    Gorilla  =========================

Inserts between block 39 and 40 in window
  D            Rock pigeon 11bp
  D           Saker falcon 2bp
  D       Peregrine falcon 2bp
  D    Collared flycatcher 11bp
  D White-throated sparrow 11bp
B D    Medium ground finch 11bp
B D            Zebra finch 11bp
B D             Budgerigar 35bp
  D                 Parrot 13bp
  D          Scarlet macaw 19bp
  D        Green seaturtle 2bp
        Southern platyfish 4bp
B D            Stickleback 9bp
B D           Atlantic cod 9bp
B D              Zebrafish 4bp

Alignment block 40 of 629 in window, 65430095 - 65430100, 6 bps 
B D                   Human  atgtga
B D                   Chimp  atgtga
B D               Orangutan  atgtga
B D                Platypus  atgtg-
  D             Rock pigeon  --gtgt
  D            Saker falcon  --gggg
  D        Peregrine falcon  --ggga
  D     Collared flycatcher  --gtca
  D  White-throated sparrow  --gtga
B D     Medium ground finch  --gtga
B D             Zebra finch  --ctga
         Tibetan ground jay  --gggc
B D              Budgerigar  --ggga
  D                  Parrot  --gtaa
  D           Scarlet macaw  --gtta
  D         Green seaturtle  --gcag
B D           X. tropicalis  -tgtag
         Southern platyfish  acgtga
B D             Stickleback  gcatga
B D            Atlantic cod  gtgaga
B D               Zebrafish  atgtga
B D                 Lamprey  gtgtga
B D                  Turkey  ------
B D                 Chicken  ------
B D                 Opossum  ------
B D                 Gorilla  ======

Inserts between block 40 and 41 in window
  D            Rock pigeon 2bp
  D           Saker falcon 1bp
  D       Peregrine falcon 2bp
  D    Collared flycatcher 2bp
  D White-throated sparrow 2bp
B D    Medium ground finch 2bp
B D            Zebra finch 2bp
        Tibetan ground jay 2bp
B D             Budgerigar 2bp
  D                 Parrot 2bp
  D          Scarlet macaw 2bp
  D        Green seaturtle 2bp

Alignment block 41 of 629 in window, 65430101 - 65430102, 2 bps 
B D                   Human  ca
B D                   Chimp  ca
B D                 Gorilla  ca
B D               Orangutan  ca
B D                 Opossum  ca
  D             Rock pigeon  ca
  D        Peregrine falcon  aa
  D     Collared flycatcher  ca
  D  White-throated sparrow  ca
B D     Medium ground finch  ca
B D             Zebra finch  ca
         Tibetan ground jay  ca
B D              Budgerigar  tg
  D                  Parrot  ca
  D           Scarlet macaw  ca
B D                 Chicken  -g
B D                  Turkey  -a
  D         Green seaturtle  ca
B D           X. tropicalis  ct
         Southern platyfish  aa
B D             Stickleback  ga
B D            Atlantic cod  ca
B D               Zebrafish  ca
B D                 Lamprey  ga
  D            Saker falcon  ==
B D                Platypus  --

Inserts between block 41 and 42 in window
        Southern platyfish 17bp
B D            Stickleback 13bp
B D           Atlantic cod 13bp
B D              Zebrafish 17bp

Alignment block 42 of 629 in window, 65430103 - 65430261, 159 bps 
B D                   Human  ---------catgac--tg--acacg---------tgactg---------agacctg-tg--tgaca---
B D                   Chimp  ---------catgac--tg--acacg---------tgactg---------agacctg-tg--tgaca---
B D               Orangutan  ---------catgac--tg--acaca---------tgactg---------agacctg-tg--tgaca---
B D                 Opossum  ---------tgtgaa--tg--tcatg---------agactg---------aaataca-ct--ggaca---
B D                Platypus  ---------cttggc--t----tgct---------gcaatc---------aggtgtg-ca--tcatg---
  D             Rock pigeon  ---------cgtgtg--cg--acacc---------tgac-----------gcgcgtg-tg--cgacgcgc
  D            Saker falcon  -----------------tg--acacg---------ggat-----------aaacatg-ggaccg------
  D        Peregrine falcon  ---------catgggactg--acacg---------ggattggaatgggacaaacatg-ggattgacc---
  D     Collared flycatcher  ---------catgtg--tc--acggg---------ctgt-----------acacatg-tg--ttaca---
  D  White-throated sparrow  ---------cgtgtg--ag--gggttacagggacctgga-----------ggatctg-ta--cagccggt
B D     Medium ground finch  ---------cgtgta--ca--gcctg---------tgac-----------acacatg-ta--cagcc---
B D             Zebra finch  ---------cctgag--tg--acctg---------tgat-----------acacctg-tg--tgatc---
         Tibetan ground jay  ---------cgtggg--gg--acacg---------tggg-----------acacctg-gg--agaccccc
B D              Budgerigar  ---------tatggg--at--acaga---------tgg-------------gacatg-ta--tgggacat
  D                  Parrot  ---------tacgta--ac--ccat--------------------------agcatg-ta--cgagcc--
  D           Scarlet macaw  ---------catgtc--ac--acacg---------ttat-----------gagcatgtta--tgaac---
B D                 Chicken  ---------tgtcct--tg--acgtg---------ttcc-----------taacgtg-tccttgccg---
B D                  Turkey  ---------tgggat--ca--atatg---------ggct-----------gaacatg-ggattaaca---
  D         Green seaturtle  ---------cgaaagc-tt--acgct---------caaa-----------taaattg-gt--tagtctct
B D           X. tropicalis  ---------cgtgtg--tg--acttg---------tgtgta---------gctcgtg-tg--tgactcg-
         Southern platyfish  ---------catatt--tt-cacatg---------tgta-----------ttccata-ta--aattatg-
B D             Stickleback  ---------cataag--ag--acagg---------catg-----------agacaca-ta--a-------
B D            Atlantic cod  ---------cagggg--ag--ccagg---------tggt-----------agacagg-tg--agacatgt
B D               Zebrafish  ---------tatgtg--acatatatg---------tttc-----------tgacata-ta--t-------
B D                 Lamprey  cacctggtacgtgtg--tg--acacc------------------------tgacgtg-tg--tgaca---
B D                 Gorilla  ======================================================================

                      Human  --------cg-----------tgacacttg-------------tgtgacacctga--------taggca-
                      Chimp  --------ca-----------tgacacttg-------------tgtgacacctga--------taggca-
                  Orangutan  --------cgtgtgtgacacatgacacttg-------------tgtgacacctga--------taggca-
                    Opossum  --------tg-----------caattgcca-------------tgtaatcagtaatctacatctagaca-
                   Platypus  --------tg-----------caagacatg-------------ctccacatgctg--------tgatca-
                Rock pigeon  -gtgcacgcg-----------tgtgacgcg-------------tgtgcgacacct--------gacacg-
               Saker falcon  ---------------------------aca-------------cgggagtgacac--------gggata-
           Peregrine falcon  --------tg-----------ggacaaacg-------------tgggaccgacac--------gggata-
        Collared flycatcher  --------gg-----------gtgcacggg-------------tgtgtcacgggc--------tgtaca-
     White-throated sparrow  -aca-aggtg-----------agagacacg-------------tgtgacatgtgt--------gtgaca-
        Medium ground finch  --------tg-----------ggacacacg-------------tgtgtgacccgt--------gacaca-
                Zebra finch  --------tt-----------tgacacacc-------------tgagtgatctct--------gacaca-
         Tibetan ground jay  --------tg-----------ggac-cacc-------------tgagaccccccc--------cg-----
                 Budgerigar  -gta----tg-----------ggataagca-------------tgggacaggcat--------gggaca-
                     Parrot  --ta----tg-----------catcacgtg-------------tgtaacatgcag--------gttaca-
              Scarlet macaw  ---a----tg-----------ctacagaca-------------tgtcacacacat--------gctgca-
                    Chicken  --------tg-----------tccctgccg-------------tgtccttgatgt--------gttcct-
                     Turkey  --------tg-----------gggtcaacg-------------tgggctttacat--------gggatt-
            Green seaturtle  aggg----tg-----------ccacaagtcctccttttctttttgcgaatacaga--------ctaaca-
              X. tropicalis  --------tg-----------tagcccttg-------------tgtgactcatgt--------gtagct-
         Southern platyfish  --------gg-----------atgcacatg-------------tg---catgtga--------tataca-
                Stickleback  ---------g-----------agacacat--------------------aagaga--------caggca-
               Atlantic cod  gtc-----ag-----------agacacagg-------------ggagccaggtgg--------tagacag
                  Zebrafish  ---------g-----------tgacatatg-------------tg---tttctga--------catata-
                    Lamprey  --------ca-----------tggtacgtg-------------tgagacacctga---------------
                    Gorilla  ======================================================================

                      Human  -c-------atgtg--tgaaacctgattgacgc--gt-------gtga--cacctgt---------g---
                      Chimp  -c-------acgtg--tgaaacctgattgacgcaagt-------gtga--cacctgt---------g---
                  Orangutan  -c---------gtg--tgaaacctgattgacatgagt-------gtga--ca--tgt---------g---
                    Opossum  -c-------acatggttgacacgcaataaagatgact-------atat--tatagaa---------a---
                   Platypus  -c-------gtgtg--catcacgtgctcggcatccag-------atgt--catggag---------t---
                Rock pigeon  -c-------gcgtg--tgacgcgtgtgcgacacct---------gaca--cgcgcgt---------g---
               Saker falcon  -a-------acatg--ggactgacacggga--------------gtga--cacggga---------t---
           Peregrine falcon  -a-------acatg--ggactgacacggga--------------gtga--cacggga---------t---
        Collared flycatcher  -c-------gtgtg--tcacagt---------------------gtgc---acgggt---------g---
     White-throated sparrow  -c-------gtgtg--tgacagg-----gacctg--gaggatctgtac--agccggtacaaggtgag---
        Medium ground finch  -c-------at---------------------------------gtac--agcctgt---------g---
                Zebra finch  -c-------ct---------------------------------gtgccacacctgt---------g---
         Tibetan ground jay  --------------------------------------------ggac--cacctga---------g---
                 Budgerigar  -g-------gtatg--ggacacggatggaacagg--t-------atgg--gacatgt---------a---
                     Parrot  -t-------gtatg--taatcca-----tacatag-c-------atct--ctcatgt---------a---
              Scarlet macaw  -t-------acatg--tcacaca--cgctacata--c-------gtgt--tacatgt---------t---
                    Chicken  -g-------tcatg--ttcctgacatgttc--------------ttgc--catgtcc---------t---
                     Turkey  -g-------acatg--ggattaacatggaa--------------tggt--catggga---------t---
            Green seaturtle  -c-------ggctg--ctactctgaaag----------------cttt--tttgtgt---------g---
              X. tropicalis  -c-------gtgtg--tgacttgtgtgtagctcgtgt-------gtga--cttgtgt---------g---
         Southern platyfish  -t-agat--gtgaa--atacatgtatgtgatacacat-------gcta--cacctat---------g---
                Stickleback  -tgagaccagtaag--agacacataagagacaggcat-------gaga--cagataa---------g---
               Atlantic cod  gtgagac--atgtg--gtagacaggtgagacatgtag-------taga--caggt-----------g---
                  Zebrafish  -t-------gtgac--atatgtgtttctgacatatat-------gtga--catatgt---------gttt
                    Lamprey  -c-------gtgtg--agacacctgac-----------------gtgt--gagacac---------c---
                    Gorilla  ======================================================================

                      Human  -tgacacgtga-----ctgaa-atg-----tgt------g----tgacacctgac----atgactta---
                      Chimp  -tgacacgtga-----ctgaa-atg-----cgt------g----tgacacctgactgacatgactta---
                  Orangutan  -tgacacgtga-----ctgaa-atg-----tgt------g----tgacacgtgactgacatgactta---
                    Opossum  -tggca-----------ttaa-gtt-----tgtggtttgg----tatcatgtggtttacatgatatt---
                   Platypus  -tggcgtgctg-----ctgtc-aca-----ggt------g----ggtcac---gctgtgatcacatg---
                Rock pigeon  -tgacgcgtg-------tgcg-aca-----cgt------g----acgcgcgagtgcgacacctgaca---
               Saker falcon  -tgacatggga-----ctgac-acg-----gga------g----tgacacgggattgacatgggata---
           Peregrine falcon  -tgacatggga-----ctgac-acg-----gga------c----acacacgggattgacatgggata---
        Collared flycatcher  -tgtcacagc-------acgc-aga-----ggt------g----tgtcacgggctgtacatgtgtgt---
     White-throated sparrow  -agacacgtg-------ggac-acg-----tgt------g----tgacacgtgtgtgacaggtgtgag--
        Medium ground finch  -acacacatg-------taca-gcc-----tat------g----acacacgtgtgtgaccagtgaca---
                Zebra finch  -tgatctctg-------acac-acc-----tgt------g----ccacacctgtgtgatctctgaca---
         Tibetan ground jay  -acccccctg-------tgac-acc-----tgt------g----ggacacgtgggtgacacctgtgatcc
                 Budgerigar  -tgggatatg-------t------a-----tgg------g----gcacatatgggacatggatggga---
                     Parrot  -tcacctatg-------taac-aca-----cgt------g----tcgcacatgcatcacgcatgtaa---
              Scarlet macaw  -ccacacatg-------ttac-ata-----cat------g----tcacacacgctgcatacgtggta---
                    Chicken  -tgatgtgttc-----ctagc-acg-----ttc------t----tgacatgttcctgacatgtccc----
                     Turkey  -tgacatggga-----gcaac-atg-----gga------t----ttacatgggatcggcatcagat----
            Green seaturtle  -tcatttttt-------tggcgaga-----cgt------a----cgacgtgtgagtgacgtgcgatg---
              X. tropicalis  -tagctcgtgt-----gtgac-ttg-----tgt------g----tagctcgtgtgtgacttgtgtg----
         Southern platyfish  -tagcatttga-----ctgat-ata-----cat------g----tgacacacatgtgatgtacatg----
                Stickleback  -agacacataa-----gagac-agg-----cat------g----agaccggtacgagacacataag----
               Atlantic cod  -agacatgtgg-----tagac-aggtgagacat------g----tggtagacaggtgagacatgtg----
                  Zebrafish  ctggcatatat-----gtgac-ata-----tat------gtttctgacatatatgtgacatatatg----
                    Lamprey  -tgacgtgtgagacacctggt-acg-----tgt------g----tgacac----ctgacgtgtgaga---
                    Gorilla  ======================================================================

                      Human  --------caggtg--------------------tgtgacacc------tctg
                      Chimp  --------caggtg--------------------tgtgacacc------tctg
                  Orangutan  --------caggtg--------------------tgtgacacc------tctg
                    Opossum  --------gaccta--------------------tgtggccat------tctg
                   Platypus  --------c---------------------------tcgccat------gctg
                Rock pigeon  --------cgcgcg--------------------tgtgacgcg------tgtg
               Saker falcon  --------aacatgggactgacacgggattggaatgggacaaa------catg
           Peregrine falcon  --------aacatgggactgacacgggattggaatgggacaaa------catg
        Collared flycatcher  --------cacagt--------------------gtgtacggc------tgtg
     White-throated sparrow  ----gggttacagggacc----------------tggaggacc------tgta
        Medium ground finch  --------cacatgtaca--------gcctg---tgacacaca------tgta
                Zebra finch  --------cacctg--------------------tgccacacc------tgtg
         Tibetan ground jay  cccccggacacctg--------------------agtgacacc------tggg
                 Budgerigar  --------tatgta--------------------tgagacacg------tatg
                     Parrot  --------catgta--------------------tgcaacacg------tgtg
              Scarlet macaw  --------catgtt--------------------acctaca------------
                    Chicken  -----------------------------------------------------
                     Turkey  -----------------------------------------------------
            Green seaturtle  -----cgccacgtgcc------------------tgcgacgccctattttttg
              X. tropicalis  -----------------------------------------------------
         Southern platyfish  -----------------------------------------------------
                Stickleback  -----------------------------------------------------
               Atlantic cod  -----------------------------------------------------
                  Zebrafish  -----------------------------------------------------
                    Lamprey  --------cacct----------------------------------------
                    Gorilla  =====================================================

Inserts between block 42 and 43 in window
  D            Rock pigeon 9bp
  D           Saker falcon 11bp
  D       Peregrine falcon 11bp
  D    Collared flycatcher 9bp
  D White-throated sparrow 18bp
B D    Medium ground finch 9bp
B D            Zebra finch 9bp
        Tibetan ground jay 9bp
B D             Budgerigar 11bp
  D                 Parrot 2bp

Alignment block 43 of 629 in window, 65430262 - 65430331, 70 bps 
B D                   Human  t-gacatgtgaccaa------------tatgtgtgtgacaca--tgatggac-----atgtgtgtga-ca
B D                   Chimp  t-gacatgtgaccaa------------tatgtgtgtgacaca--tgatggac-----acgtgtgtga-ca
B D               Orangutan  t-gacatgtgaccaa------------tacgtgtgtgacaca--tgatggac-----acgtgtgtga-ca
B D                 Opossum  c----------tcaa------------catgtgaaaaaccca--tgaagggc-----atatgaataa-ta
B D                Platypus  cagtcacatgatcat------------tgcttgcctcacacg--tgacaatc-----atgtgcgtgc-ca
  D             Rock pigeon  -acacgcgtgtgtga------------ca--cctgacacgcg--tgtgcga-------cacgtgaca-cg
  D            Saker falcon  -ggacaagcgtggga------------ccgacacgggataaa--catgggac-----tgacacagga-tt
  D        Peregrine falcon  -ggacaaacgtggca------------ccgacacgggataaa--catgggac-----tgacacagga-tt
  D     Collared flycatcher  -acacacacgtgt--------------ca--cgggctgtaca--cgtgtgc-------tccaggaca-ca
  D  White-throated sparrow  -agacaggtgtgtga------------caggtgtgtgacacg--tgtgtga-------caggtgtgagga
B D     Medium ground finch  -acacacgtgtacag------------cc--cgtgacacacg--tgtgtga-------ccagtgaca-ca
B D             Zebra finch  -acaca---------------------cc--tgtgtcacacc--tgtgtga-------tctctgaca-ca
         Tibetan ground jay  -ggacacgtgggtgacat-ctgt-gaccc--cctgggacact--tgtgggac------cccctggga-ca
B D              Budgerigar  -ggacatggatggga------------catgtacgggatatg--tatgggac-----acaagtgtga-tg
  D                  Parrot  -acccatacatag--------------catgtatgtatcaca--tatgcaac-----atgcatgtaa-ca
  D           Scarlet macaw  -acatgtgatctg--------------catgtgtgt----------------------tacatgtga-tt
B D                 Chicken  ---------------------------------------tga--catgtcct-----taatgtgttc-ct
B D                  Turkey  ---------------------------------------caa--catgggat-----taacatggga-tc
  D         Green seaturtle  ----------------------------------------------tgtgat----gttttgtgtgt-gt
B D           X. tropicalis  -tagctcgtgtgtga------------cttgtgtgtagctcg--tgtgtgac-----ttgtgtgtag-ct
         Southern platyfish  ------------------------tatatcacatgggataca--tatgtgac-----gtgta--tcc-ca
B D             Stickleback  ------------------------agacaggcatgagaccag--taagagac-----acataagaga-ca
B D            Atlantic cod  ------------------------gtagacaggtgaaacatggctcggagac-----acaggggaga-ca
B D               Zebrafish  ------------------------tttctgacata---------tatgtgac-----atata--------
B D                 Lamprey  --gacgtgtgagacacctggtgcgtgtgagacacctggtacg--tgtgagacacctgacgtgtgaga-ca
B D                 Gorilla  ======================================================================

                      Human  cgtgtttgactcgaccaaatt
                      Chimp  cgtgtttgactcgacaaaatt
                  Orangutan  cgtgtttgactcaaccaaatt
                    Opossum  c--------------------
                   Platypus  tgtgcttcactcattaaaat-
                Rock pigeon  cgcgcgtg--cga--------
               Saker falcon  gacatgtgaccga--------
           Peregrine falcon  gacatgtgaccga--------
        Collared flycatcher  cgtgtgtgtttca--------
     White-throated sparrow  cctggaggat-----------
        Medium ground finch  catgtacagc-----------
                Zebra finch  cctgtgtcacacc--------
         Tibetan ground jay  tgtgggtgacac---------
                 Budgerigar  tctatgtagcata--------
                     Parrot  cgtatgtaacccc--------
              Scarlet macaw  tacatatgatc----------
                    Chicken  ggcatgttcctga--------
                     Turkey  aatatgggattaa--------
            Green seaturtle  gttgtgttgtgtg--------
              X. tropicalis  cgtgtgtgactcg--------
         Southern platyfish  tgcatgtca------------
                Stickleback  ggcatgagaccgg--------
               Atlantic cod  tgtggtagacagg--------
                  Zebrafish  tgtttcagacata--------
                    Lamprey  cctgacgt-------------
                    Gorilla  =====================

Inserts between block 43 and 44 in window
B D              Orangutan 306bp

Alignment block 44 of 629 in window, 65430332 - 65430332, 1 bps 
B D                   Human  -t
B D                   Chimp  -t
B D                 Lamprey  g-
        Southern platyfish  --
B D            Atlantic cod  --
B D               Zebrafish  --
B D             Stickleback  --
        Tibetan ground jay  --
B D             Zebra finch  --
  D  White-throated sparrow  --
B D     Medium ground finch  --
B D                  Turkey  --
B D                 Chicken  --
  D           Scarlet macaw  --
  D                  Parrot  --
  D        Peregrine falcon  --
  D            Saker falcon  --
  D             Rock pigeon  --
B D              Budgerigar  --
B D                Platypus  --
  D     Collared flycatcher  --
B D                 Opossum  --
  D         Green seaturtle  --
B D           X. tropicalis  --
B D               Orangutan  ==
B D                 Gorilla  ==

Alignment block 45 of 629 in window, 65430333 - 65430419, 87 bps 
B D                   Human  tttcacacctggctg-a--cact-gtg-cgaaacctgacg-g---ac---atgaatgagacatgtgtgtg
B D                   Chimp  tttcacacctggttg-a--cacttgtg-tgaaacctgacg-g---ac---atgaatgagaca--------
B D               Orangutan  tttcacacctggctg-a--cacttgtg-tgaaacctgacg-g---ac---atgaatgagatacgtgtgtg
B D                 Opossum  -ttcaggcttcattgtg--catttcca-tgtaa----------------------------------ata
B D                Platypus  ---------------ca--catgtgtg-tcatgcgcacca-g---tc---gcga---aatcaggtgtgtg
  D             Rock pigeon  ---------cacctg-a--cacgcgcg-tgtg-------------ac---gcgtgtgtgacacctgacac
  D            Saker falcon  ---------catggg-a--cagacatg-ggaccaacacgg-accgac---acgggaccgacatgggactg
  D        Peregrine falcon  ---------catggg-a--cagacatg-ggaccaacacgg-accgac---acgggaccgacatgggactg
  D     Collared flycatcher  ----------ggctg-c-acacgcctgtttcggggtgt-------ac---acgtgtgtt-----------
  D  White-throated sparrow  ------------ctg-t-acagccg-g-tacaaggtgaga-----ac---atgtgtggg-----------
B D     Medium ground finch  ------------ctg-tgacacacgtg-tacagcctgtga-c---ac---acgtgtgtg-----------
B D             Zebra finch  -----------tctg-t--cacacctg-tgtgacttctga-c---ac---acctgtgtgatgtctgatac
         Tibetan ground jay  ------------ctg-g--gacccccg-ggatacctgagt-g---ac---acctgagtgacaccggggac
B D              Budgerigar  ---------catgga-a--cacacatc-tgacacgtatgg-a---at---acgtgtgtaatgtatatata
  D                  Parrot  ---------catcta-t--cacacgtg-tgtcatttatgc-a---ac---atgcatgtaacccatagatg
  D           Scarlet macaw  -----------------------ggcg-tgtgatttacat-a---gg---atttacatgaac-----att
B D                 Chicken  ---------catgtt-c--ttgacatg-tccttg-----------at---gtgttcctaacatgttcttg
B D                  Turkey  ---------catggg-a--ttgacatg-ggagca-----------ac---atgggctggacatgagactg
  D         Green seaturtle  ---------cg-ttg-t--cagctatg-tgcaacgcgcaata---tt---ttttgtgtgatgttgtttgt
B D           X. tropicalis  ----------------------------------------------------------------------
         Southern platyfish  -----------------------------------tgtga-t---gc---acatgtgtatcc--catgtg
B D             Stickleback  -----------------------------------tacga-g---ac---acataagagacaggcatgag
B D            Atlantic cod  -----------------------------------tgaga-c---at---gcattagagacacagatgag
B D               Zebrafish  -----------------------------------tatgt-g---ac---atatatgtttcagacat---
B D                 Lamprey  ------------------tgagacacc-tgacgtgtgaga-c---acctgacgtgtgagacacctggtgc
B D                 Gorilla  ======================================================================

                      Human  acatatg-------------------actg-acac----------gtgtgtga--catgtg
                      Chimp  ----------------------------------c----------gtgtgtga--catgtg
                  Orangutan  acatgtg-------------------actg-acac----------gtgtgtga--catgta
                    Opossum  acatgca-------------------aatg-tcac----------gtgaccaa--gatgtg
                   Platypus  tcacatg-------------------ttct-gtgc----------actgcgat--catgtg
                Rock pigeon  gcgtgtgacacgtgtgcgaca-----cctg-acac----------gcgtgtgc--gacacg
               Saker falcon  acatggggttgaca------------tggg-acac----------acacgggattgacatg
           Peregrine falcon  acatgggactgaca------------cggg-acac----------acacgggattgacatg
        Collared flycatcher  atgggga------------------------gcac----------agccgtgt--cacggg
     White-throated sparrow  acaggtg-------------------tgtg-acac----------acttgg----gacatg
        Medium ground finch  accagtgacacacatgcacag---cctgtg-acac----------acatgtac--agcctg
                Zebra finch  acctgtgacacacctgagtga---tctctg-atac----------acctgtgt--gatctc
         Tibetan ground jay  acctgtgggacatctgtgaaacctcctgtg-acacctgggggactccctggga--gacctc
                 Budgerigar  gcatgta-------------------tgta-acgc----------atgtgtaa--cacgca
                     Parrot  gcatgta-------------------tgta-gcac----------atacgtaa--cccata
              Scarlet macaw  gcatgtg-------------------tgtg-attc----------acatgtga--tctgca
                    Chicken  acatgtccttgctg------------tgtc-acta----------ccatgtccctggtgtg
                     Turkey  gcatagggtcaaca------------tggg-atta----------acatgagatcgacatg
            Green seaturtle  gtcggtgtcatgtgt-----------tgtgtgtgt----------ttttgtgt--ggtgtt
              X. tropicalis  ------------------------tgtgta-gctc----------gtgtgtga--cttgtg
         Southern platyfish  catgaca-------------------tggg-atac----------acatgtgc--tacaca
                Stickleback  accggta-------------------cgag-acac----------ataagaga--caggca
               Atlantic cod  ccaggtg-------------------gtag-agac----------acaggtca--gacagg
                  Zebrafish  ----ata-------------------tgtg-acat----------atatgttt--cagaca
                    Lamprey  gtgtgagaca----------------cctg-gtac----------gtgtgaga--cacctg
                    Gorilla  =============================================================

Inserts between block 45 and 46 in window
B D          X. tropicalis 7bp
        Southern platyfish 34bp
B D            Stickleback 11bp
B D           Atlantic cod 13bp
B D              Zebrafish 19bp

Alignment block 46 of 629 in window, 65430420 - 65430430, 11 bps 
B D                   Human  ac--------------caa----ca-cgtg
B D                   Chimp  ac--------------caa----ca-cgtg
B D               Orangutan  ac--------------cca----ca-cgtg
B D                 Opossum  aa--------------tgg----ca-tatg
B D                Platypus  cc--------------cca----ca-cact
  D             Rock pigeon  tg--------------aca----ca-cacg
  D            Saker falcon  gg--------------ata----aa-catg
  D        Peregrine falcon  gg--------------ata----aa-catg
  D     Collared flycatcher  ct--------------gta----ca-cgtg
  D  White-throated sparrow  tg--------------aca----ca-cgtg
B D     Medium ground finch  tg--------------aca----ca-cgtg
B D             Zebra finch  tg--------------ata----ca-cctg
         Tibetan ground jay  tg--------------gga----ca-cctg
B D              Budgerigar  tg--------------gaa----ca-catg
  D                  Parrot  cg--------------cag----ca-cgta
  D           Scarlet macaw  agtgatttcatgggatcta----ca-tgtg
B D                 Chicken  tc--------------act----aa-gatg
B D                  Turkey  gg--------------att----aa-catg
  D         Green seaturtle  tt--------------gta----tgtcgtg
         Southern platyfish  tc--------------acgttttca-cata
B D             Stickleback  cg--------------aga----ca-cata
B D            Atlantic cod  tt--------------aga----ga-caca
B D               Zebrafish  tc--------------tga----ca-tata
B D                 Lamprey  ------------------a----cg-tgtg
B D           X. tropicalis  ==============================
B D                 Gorilla  ==============================

Inserts between block 46 and 47 in window
  D            Rock pigeon 2bp
  D           Saker falcon 2bp
  D       Peregrine falcon 2bp
  D    Collared flycatcher 20bp
  D White-throated sparrow 38bp
B D    Medium ground finch 40bp
B D            Zebra finch 75bp
        Tibetan ground jay 24bp
B D                Chicken 2bp
B D                 Turkey 2bp
  D        Green seaturtle 2bp

Alignment block 47 of 629 in window, 65430431 - 65430447, 17 bps 
B D                   Human  -----ggtcacaagtaattgac
B D                   Chimp  -----ggtcacaagt----gat
B D               Orangutan  -----ggtcacaagtgattgac
B D                 Opossum  -----gttcacaagtaaatgac
B D                Platypus  -----gtgatcacgtgcttgtc
  D             Rock pigeon  -----tgcgac-----------
  D            Saker falcon  -----accgac-----------
  D        Peregrine falcon  -----actgac-----------
  D     Collared flycatcher  -----tgtcac-----------
  D  White-throated sparrow  -----tacaag-----------
B D     Medium ground finch  -----tacagc-----------
         Tibetan ground jay  -----gacacc-----------
B D              Budgerigar  -----tttaac-----------
  D                  Parrot  -----tgtaac-----------
  D           Scarlet macaw  -----agctgc-----------
B D                 Chicken  -----cttgac-----------
B D                  Turkey  -----gtcaac-----------
  D         Green seaturtle  -----tgc--------------
         Southern platyfish  -----tgtatc-----------
B D             Stickleback  -----agagac-----------
B D            Atlantic cod  -----ggggag-----------
B D               Zebrafish  -----tgtgac-----------
B D                 Lamprey  agacacctgac-----------
B D             Zebra finch  ======================
B D           X. tropicalis  ======================
B D                 Gorilla  ======================

Inserts between block 47 and 48 in window
B D              Orangutan 2bp
  D            Rock pigeon 11bp
  D           Saker falcon 13bp
  D       Peregrine falcon 13bp
  D          Scarlet macaw 13bp
B D                Chicken 13bp
B D                 Turkey 13bp
  D        Green seaturtle 1bp
        Southern platyfish 11bp
B D            Stickleback 13bp
B D           Atlantic cod 7bp
B D              Zebrafish 7bp

Alignment block 48 of 629 in window, 65430448 - 65430470, 23 bps 
B D                   Human  gtggtggaca-c-------g---tgtataacgt-------g
B D                   Chimp  gtggtggaca-c-------g---tgtataacgt-------g
B D               Orangutan  gtggtggaca-c-------a---tgtataacat-------g
B D                 Opossum  gtgtgaatga-t-------g---tgta-----t-------g
B D                Platypus  acgttccacatt-------t---tgtgttacattagtttca
  D             Rock pigeon  tcgtgtgaca-c-------g---tgtg-----c-------g
  D            Saker falcon  gggactgaca-c-------a---ggat-----t-------g
  D        Peregrine falcon  gggacaaaca-t-------g---ggat-----t-------g
  D     Collared flycatcher  gggtcacaca-c-------g---cgtg-----t--------
  D  White-throated sparrow  gtgagagaca-c-------g---cgtg-----t--------
B D     Medium ground finch  ctgtgacaca-catgtacag---cctg-----t--------
         Tibetan ground jay  cctggggaca-c-------c---cgag-----t--------
B D              Budgerigar  gtgtgtgaca-t-------g---tatg-----t-------g
  D                  Parrot  gtgttataca-t-------g---tcta-----t-------t
  D           Scarlet macaw  gtggtttaca-t-------g---tctgtgat-t-------c
B D                 Chicken  gtccttggcg-t-------g---tcct-----t-------a
B D                  Turkey  gggatcaaca-t-------g---ggat-----c-------a
  D         Green seaturtle  atgtgcaacg-t-------gcaatgcg-----c-------g
         Southern platyfish  acatggtgta-t-------a---tatg-----a-------t
B D             Stickleback  gtaagagaca-c-------a---taag-----a-------g
B D            Atlantic cod  -tgagagata-c-------a---ggtc-----a-------g
B D               Zebrafish  -tttcagaca-t-------a---tatg-----t-------g
B D                 Lamprey  gtgtgagaca-cctggtgcg---tgtg--------------
B D             Zebra finch  =========================================
B D           X. tropicalis  =========================================
B D                 Gorilla  =========================================

Inserts between block 48 and 49 in window
  D White-throated sparrow 2bp
B D    Medium ground finch 2bp
        Tibetan ground jay 2bp
B D            Stickleback 22bp
B D           Atlantic cod 16bp
B D              Zebrafish 4bp

Alignment block 49 of 629 in window, 65430471 - 65430480, 10 bps 
B D                   Human  --acatgt----gact
B D                   Chimp  --acatgt----gact
B D               Orangutan  --acatgt----gact
B D                 Opossum  --acattt----gg--
B D                Platypus  --atgggc----aatt
  D             Rock pigeon  --acacct--------
  D            Saker falcon  --acatgg----gatt
  D        Peregrine falcon  --acctgg----gaca
B D              Budgerigar  --acactg----a---
  D                  Parrot  --acaggg----gtgc
  D           Scarlet macaw  --acatgg----gatc
B D                 Chicken  --gcgtgt----tctt
B D                  Turkey  --acgtgg----gatc
  D         Green seaturtle  --acgtgc----aacg
B D             Stickleback  --acacat--------
B D            Atlantic cod  --aaatgtcccc----
B D               Zebrafish  --atatgt--------
B D                 Lamprey  agacacct--------
        Tibetan ground jay  ================
B D             Zebra finch  ================
  D  White-throated sparrow  ================
B D     Medium ground finch  ================
  D     Collared flycatcher  ----------------
B D           X. tropicalis  ================
B D                 Gorilla  ================

Inserts between block 49 and 50 in window
  D            Rock pigeon 22bp
B D             Budgerigar 11bp
  D                 Parrot 11bp
  D          Scarlet macaw 11bp
B D                Chicken 11bp
B D                 Turkey 11bp

Alignment block 50 of 629 in window, 65430481 - 65430488, 8 bps 
B D                   Human  gacaggtt
B D                   Chimp  gacaggtt
B D               Orangutan  gacaggtg
B D                 Opossum  -------t
B D                Platypus  aataggtt
  D         Green seaturtle  tgcatgc-
B D            Atlantic cod  ---tggt-
B D                 Lamprey  gacg----
B D               Zebrafish  --------
B D             Stickleback  --------
        Tibetan ground jay  ========
B D             Zebra finch  ========
  D  White-throated sparrow  ========
B D     Medium ground finch  ========
B D                  Turkey  ========
B D                 Chicken  ========
  D           Scarlet macaw  ========
  D                  Parrot  ========
  D        Peregrine falcon  --------
  D            Saker falcon  --------
  D             Rock pigeon  ========
B D              Budgerigar  ========
  D     Collared flycatcher  --------
B D           X. tropicalis  ========
B D                 Gorilla  ========

Alignment block 51 of 629 in window, 65430489 - 65430489, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                 Opossum  c
B D                Platypus  t
B D           X. tropicalis  t
B D            Atlantic cod  t
B D                 Lamprey  t
B D               Zebrafish  -
B D             Stickleback  -
        Tibetan ground jay  =
B D             Zebra finch  =
  D  White-throated sparrow  =
B D     Medium ground finch  =
B D                  Turkey  =
B D                 Chicken  =
  D           Scarlet macaw  =
  D                  Parrot  =
  D        Peregrine falcon  -
  D            Saker falcon  -
  D             Rock pigeon  =
B D              Budgerigar  =
  D     Collared flycatcher  -
  D         Green seaturtle  -
B D                 Gorilla  =

Inserts between block 51 and 52 in window
B D          X. tropicalis 2bp

Alignment block 52 of 629 in window, 65430490 - 65430580, 91 bps 
B D                   Human  ---------gtgatgtg--------accaacacgtgactgacatgt-----------g---tgaca---t
B D                   Chimp  ---------gtgatgtg--------accaacacgtgactgacatgt-----------g---tgaca---t
B D               Orangutan  ---------gtgatgtg--------accaacacgtgactgacatgt-----------g---tgaca---c
B D                 Opossum  ---------atcatatg--------agctatgcaagaacgctatgt-----------a---tcact---g
  D             Rock pigeon  ---------cgcgcgcg--------tgcgacacgtgacgcgctcgt-----------g---tgacg---c
  D            Saker falcon  ---------gacacggg--------actgacacgggacacacacgg-----------ga-ttgaca---t
  D        Peregrine falcon  ---------aacgtggc--------accgacacgggataaacatgg-----------ga-ctgaca---c
  D     Collared flycatcher  -----------cacggg--------ctggacacgcgtgtcacgggc-----------t---ggaca---c
  D  White-throated sparrow  ---------caggtgtg--------tgtgacacacctgggacatgt-----------g---tgaca---g
B D     Medium ground finch  ---------cacacgtg-tacagcctgtgacacacatgtacagcct-----------g---tgaca---c
B D             Zebra finch  ---------cacacctg--------tgtgacacacctgtgac---------------------aca---c
         Tibetan ground jay  ---------cacctgtgggaccccctgggacatgtgggtgacacctgggaccccccgg---ggaca---c
B D              Budgerigar  ---------tacatgta----------ttacatgctctacacacat-----------g---ataca---c
  D                  Parrot  ---------tacatgtg--------tcatacatttgtgttacatgg-----------g---tgata---c
  D           Scarlet macaw  ---------tacatgca--------atttgcatgtgatctgcatgt-----------g---atttg---t
B D                 Chicken  ------------gtgtc--------cttaaagtgtccttaacgtgt-----------cc-ttgacg---t
B D                  Turkey  ---------aatatggg--------atcaacatgggatggacatgg-----------ga-tcaaca---t
  D         Green seaturtle  ---------gacgcgtg-----atgtgcgacgcatgatttttgtgt-----------g---tgatgtttt
B D           X. tropicalis  ---------ggcatata--------gctggcatgtatctggcatat-----------ag-ctggca---t
B D             Stickleback  ------------aagag--------acaggcatgagaccggtacg----------------agaca---c
B D            Atlantic cod  ---------gcgatgac--------ccctccaggtgctccatgcgt---------------aggtg---g
B D               Zebrafish  ------------ttctg--------acatatatgtgacatatatgt-----------tt-ctgaca---t
B D                 Lamprey  gtgagacacctgacgtg--------tgagacacctgacgtgtgtga-----------cacctgacg---t
B D                 Gorilla  ======================================================================

                      Human  gtgatt-----------g----atgtg---ac---acgt-----------------ggc--------tg-
                      Chimp  gtgatt-----------g----atgtgtg-ac---acgt-----------------ggc--------tg-
                  Orangutan  gtgatt-----------g----aagtgtg-ac---acgt-----------------ggc--------tg-
                    Opossum  gtg--t-----------g----cagtc---aa---tcat-----------------gcc--------tgc
                Rock pigeon  gtgtgt-----------g-------------c---acgt-----------------gtg--------cg-
               Saker falcon  gggata-----------a------------ac---atgg-----------------gac--------tg-
           Peregrine falcon  aggatt-----------g------------ac---atgt-----------------gac--------cg-
        Collared flycatcher  gtgtgt-----------c---acagtgtgcac---gggc-----------------gtg--------tc-
     White-throated sparrow  gtgtgt-----------g------------ac---aggt-----------------gtg--------tg-
        Medium ground finch  acgtgt-----------gtgacccgtg-acac---acgt-----------------gta--------ca-
                Zebra finch  ctgagt-----------g------------ac---acct-----------------gag--------cg-
         Tibetan ground jay  cttagt-----------g------------ac---acct-----------------gag--------tg-
                 Budgerigar  acatgg-----------t------------ac---atgc-----------------aca--------tt-
                     Parrot  gtgtgg-----------g------------tt---acgg-----------------ggg--------tg-
              Scarlet macaw  gtgtgg-----------t------------tc---atgt-----------------agg--------at-
                    Chicken  gtcact-----------a------------ac---atgt-----------------ctt--------tg-
                     Turkey  gggactgggaagggatga------------ac---atgg-----------------agt--------gg-
            Green seaturtle  gtgtgt-----------g------------tt---gtgttgtgtgcattgtaagcggca--------tg-
              X. tropicalis  gaagct-----------g------------gc---atat-----------------agc--------tg-
                Stickleback  ataaga-----------g------------ac---aggc-----------------atg--------at-
               Atlantic cod  ccaaga-----------g------------ac---aggt-----------------gtt--------gg-
                  Zebrafish  atatgt-----------g------------ac---atat-----------------gtgtttctgacat-
                    Lamprey  gtgaga-----------c------------acctgacgt-----------------gtg--------ag-
                    Gorilla  ======================================================================

                      Human  -------aca----t-----gtgtgacacgtgac-t-------gacacatgactga
                      Chimp  -------aca----t-----gtgtgacacgtgac-t-------gacaaatgactga
                  Orangutan  -------aca----t-----gtgtgacacgtgac-t-------gacatgtgactga
                    Opossum  tgcacaaaca----tcatgggagcgtaacattac-t-------g-cacgcacctga
                Rock pigeon  -------aca----c-----ctgacgcgcgcgtg-t---------gacacgtgacg
               Saker falcon  -------aca----c-----gggattgacgtggg-a-----ccaacatgggacaaa
           Peregrine falcon  -------aca----t-----gggacagacatggg-a-----ccaacac-ggaccga
        Collared flycatcher  -------aca----g-----cacgcacaggtgtg-t---------cacgggctgta
     White-throated sparrow  -------acg----t-----gtatgacacgtgtg-t---------gacaggtgaga
        Medium ground finch  -------gcc----t-----gtgacacacgtgta-c---------agcccgtgaca
                Zebra finch  -------acc----g-----atgatacgcctatacc---------catccctgata
         Tibetan ground jay  -------acacctta-----gtgacacctgagtg-a---------cacctgagtga
                 Budgerigar  -------aca----c-----acattacatgcact-acacacataacacacatatta
                     Parrot  -------tca----c-----a-----tgtgtgat-c---------catggttatta
              Scarlet macaw  -------tta----c-----a---tgtgtgtgat-t-------gacatgcgatctg
                    Chicken  -------atg----t-----gtctttgacgtgtc-c-----tttacatgtccttaa
                     Turkey  -------aca----t-----gggatgggcatggg-a-----ttgccatggggtcaa
            Green seaturtle  -------acg----c-----acaacgtgacagtg-a---------tgtgcaagtga
              X. tropicalis  -------gca----t-----gaagctggcatata-g-----caggcatatagctgg
                Stickleback  -------acc----a-----gtaagagacacata-a-----gagacaggcatga--
               Atlantic cod  -------aca----g-----gt-------------------gagacaggtgtta--
                  Zebrafish  -------ata----t-----gtgacatatgtgtt-t-----ctgacatatatgt--
                    Lamprey  -------aca----c-----ctggtaggtgtgag-a---------cacctgg----
                    Gorilla  ========================================================

Inserts between block 52 and 53 in window
B D            Stickleback 23bp
B D           Atlantic cod 15bp
B D              Zebrafish 6bp

Alignment block 53 of 629 in window, 65430581 - 65430583, 3 bps 
B D                   Human  cgc
B D                   Chimp  cgc
B D               Orangutan  cgt
B D                 Opossum  tag
  D             Rock pigeon  cac
  D            Saker falcon  gac
  D        Peregrine falcon  cac
  D     Collared flycatcher  cat
  D  White-throated sparrow  cat
B D     Medium ground finch  cac
B D             Zebra finch  cac
         Tibetan ground jay  cac
B D              Budgerigar  cac
  D                  Parrot  cat
  D           Scarlet macaw  cat
B D                 Chicken  cgt
B D                  Turkey  cat
  D         Green seaturtle  cgt
B D           X. tropicalis  cat
         Southern platyfish  cgc
B D             Stickleback  cgc
B D               Zebrafish  tgt
B D                 Lamprey  tgc
B D            Atlantic cod  ===
B D                 Gorilla  ===

Inserts between block 53 and 54 in window
  D            Rock pigeon 2bp
  D           Saker falcon 6bp
  D       Peregrine falcon 6bp
  D    Collared flycatcher 2bp
  D White-throated sparrow 2bp
B D    Medium ground finch 2bp
B D            Zebra finch 2bp
B D             Budgerigar 2bp
  D                 Parrot 2bp
  D          Scarlet macaw 11bp
B D                Chicken 8bp
B D                 Turkey 8bp
  D        Green seaturtle 6bp
B D          X. tropicalis 7bp

Alignment block 54 of 629 in window, 65430584 - 65430591, 8 bps 
B D                   Human  gtctttta
B D                   Chimp  gtctttta
B D               Orangutan  gtctttta
B D                 Opossum  gtgacata
  D             Rock pigeon  g-------
  D            Saker falcon  g-------
  D        Peregrine falcon  g-------
  D     Collared flycatcher  g-------
  D  White-throated sparrow  g-------
B D     Medium ground finch  g-------
B D             Zebra finch  g-------
B D              Budgerigar  a-------
  D                  Parrot  g-------
  D           Scarlet macaw  g-------
  D         Green seaturtle  g-------
B D           X. tropicalis  g-------
         Southern platyfish  ---acctt
B D             Stickleback  ---tttta
B D               Zebrafish  ---gtttc
B D                 Lamprey  ---gtgt-
B D            Atlantic cod  ========
B D                  Turkey  ========
B D                 Chicken  ========
B D                 Gorilla  ========

Inserts between block 54 and 55 in window
  D            Rock pigeon 5bp
  D           Saker falcon 1bp
  D       Peregrine falcon 1bp
  D    Collared flycatcher 1bp
  D White-throated sparrow 1bp
B D    Medium ground finch 1bp
B D            Zebra finch 1bp
B D             Budgerigar 7bp
  D          Scarlet macaw 18bp
  D        Green seaturtle 1bp
        Southern platyfish 3bp
B D            Stickleback 3bp
B D              Zebrafish 3bp

Alignment block 55 of 629 in window, 65430592 - 65430601, 10 bps 
B D                   Human  aaagt--aactg
B D                   Chimp  aaagt--aactg
B D               Orangutan  aaagc--aactg
B D                 Opossum  caatc--atcaa
  D             Rock pigeon  cacgt--g----
  D            Saker falcon  catgg--gattg
  D        Peregrine falcon  catgg--gactg
  D     Collared flycatcher  ---gt--cacag
  D  White-throated sparrow  ---gt--gacag
B D     Medium ground finch  ---gt--gacca
B D             Zebra finch  ---gtcacacct
B D              Budgerigar  catgt--tacat
  D           Scarlet macaw  cgtgt--gattt
B D                 Chicken  catgt--ccttg
B D                  Turkey  catgt--gatta
  D         Green seaturtle  tgtgc--aagag
B D           X. tropicalis  catat--agctg
         Southern platyfish  cacgt--gtatc
B D             Stickleback  aaagc--gactt
B D            Atlantic cod  caggt--gctag
B D               Zebrafish  catat--atgtg
B D                 Lamprey  gagac--acctg
B D                 Gorilla  ============

Inserts between block 55 and 56 in window
  D    Collared flycatcher 16bp
  D White-throated sparrow 26bp
B D    Medium ground finch 16bp
B D            Zebra finch 16bp
  D          Scarlet macaw 15bp

Alignment block 56 of 629 in window, 65430602 - 65430610, 9 bps 
B D                   Human  acg-taatag
B D                   Chimp  atg-taatag
B D               Orangutan  atc-taatag
B D                 Opossum  atg-tgattg
  D             Rock pigeon  aca-tgcgtg
  D            Saker falcon  acg-tgggat
  D        Peregrine falcon  aca-tggggt
  D     Collared flycatcher  acg-gactgt
  D  White-throated sparrow  gcc-ggtaca
B D     Medium ground finch  gcc-tgggac
B D             Zebra finch  acc-tgtacc
B D              Budgerigar  gca-cactac
  D                  Parrot  cca-tggatc
  D           Scarlet macaw  gca-tgcgat
         Southern platyfish  ata-tatac-
B D             Stickleback  acattacac-
B D            Atlantic cod  aca-caaac-
B D               Zebrafish  aca-ta----
B D                 Lamprey  acg-tgtgag
B D                  Turkey  ----------
B D                 Chicken  ----------
  D         Green seaturtle  ----------
B D           X. tropicalis  ----------
B D                 Gorilla  ==========

Inserts between block 56 and 57 in window
        Southern platyfish 10bp
B D            Stickleback 14bp
B D           Atlantic cod 13bp
B D              Zebrafish 12bp

Alignment block 57 of 629 in window, 65430611 - 65430669, 59 bps 
B D                   Human  a------catatga-cttaca----ca-tgtg-----------acacgtgaaaaat---t---------a
B D                   Chimp  a------catatga-cttaca----ca-tgtg-----------acacgtgaaaaat---t---------a
B D               Orangutan  a------cacgtga-cttaca----ta-tgtg-----------acatgggaaaagttgct---------g
B D                 Opossum  a------catgcga-tgtgca----tgctatg-----------tcatgtgtaa--t---t---------g
  D             Rock pigeon  a------cacgtga-cacgcg----tg-tgcg-----------acacgtgtgtgac---acctgacacgc
  D            Saker falcon  a------aacatgg-gactga----ca-cggg-----------attggaatgggac---a---------a
  D        Peregrine falcon  t------gacatgg-gacaca----ca-cggg-----------attgacatgggat---a---------a
  D     Collared flycatcher  a------cacgtgt-gtcgca----gt-gtgt-----------atgggtgtgtcac---g---------g
  D  White-throated sparrow  a------ggtgagt-gacacg----cg-tggg-----------acacgtgtgtgac---a---------c
B D     Medium ground finch  a------catgtgt-gtgccc----cc-taac-----------aggcgtgtatg----------------
B D             Zebra finch  a-----------------ccc----cc-aggc-----------tcaggtga-------------------
B D              Budgerigar  a------cgtatgt-tacacg----ta-tgtc-----------acacgtatgttag---g---------t
  D                  Parrot  a------cacatgt-gacacc----cc-cgta-----------acccacacgtatc---a---------c
  D           Scarlet macaw  c------tgcatat-gattca----ca-tgtg-----------atttgtgcatggt---t---------t
B D                 Chicken  --------ac------atgcc----cc-tggc-----------atgtcc------t---t---------g
B D                  Turkey  --------acatgg-aatggt----ca-taga-----------atggtcacagaat---g---------g
  D         Green seaturtle  a------cgtgtgtggacacaagt-ca-tgcg-----------agcgaagtgcaat---g---------t
B D           X. tropicalis  --------gcatgt-agctgg----ca-tata-----------gctggcatgtagc---t---------g
B D                  Medaka  a------ggtacgt-gtgacaggtgta-tgtg-----------aca---tggtgac---a---------g
         Southern platyfish  a------cccatgt-gataca----ta-tgtg-----------aaa---acgtgat---a---------c
B D             Stickleback  -----------ttt-ttcaca----tt-tttgcctggggagcaatt---aggagtc---a---------g
B D            Atlantic cod  gaccccctccaggt-gctccatgagca-ggta-----------gcc---aggagac---a---------g
B D               Zebrafish  a------tatatgt-gacatatatgtt-tctg-----------acatatatgtgac---a---------t
B D                 Lamprey  -acacctgacgtgt-gagata----cc-tggt-----------gcgtgtgagacacctgg---------t
B D                 Gorilla  ======================================================================

                      Human  acac--g----actg--------acacgtttgcgacat
                      Chimp  acatatg----actg--------acacgtttgcgac--
                  Orangutan  acatgtg----actg--------acacgtttgtaacac
                    Opossum  acacata----agca--------ccac-----------
                Rock pigeon  gtgtgtg----acac--------gtgtgtgcgac----
               Saker falcon  acatgtg----accg--------acacgggacag----
           Peregrine falcon  acatgtg----accg--------acatgggacag----
        Collared flycatcher  gtcagac----acac--------gtgtcacgggc----
     White-throated sparrow  acctggg----acat--------gtgtgagaggt----
        Medium ground finch  gcctgtg----acac--------gcgtgtgtgcc----
                Zebra finch  gcct--------cca--------gcgccagcagc----
                 Budgerigar  gtacgtc----ccac--------gcaccaggtgc----
                     Parrot  ccatgta----acac--------aaatgtatgac----
              Scarlet macaw  ctatgtg----gctt--------gcatgtgattt----
                    Chicken  atgtgtc----acta--------acatgtccttt----
                     Turkey  tcatggg----atct--------acatgggatct----
            Green seaturtle  gcatgcg----acgt--------acgtgcgattt----
              X. tropicalis  gcatata----ggtg--------gcat-----------
                     Medaka  gtacatgtggcaggt--------acatgtgacgt----
         Southern platyfish  acatatg----aaac--------acatgatacac----
                Stickleback  gtgtcttgctcaggtacacttcgacatggaacat----
               Atlantic cod  gtttt------agac--------aggtgagacag----
                  Zebrafish  atatgtttctgacat--------atatgtgacat----
                    Lamprey  acgtgtg----agac--------acctggtacgt----
                    Gorilla  ======================================

Inserts between block 57 and 58 in window
  D            Rock pigeon 15bp
  D           Saker falcon 15bp
  D       Peregrine falcon 15bp
  D    Collared flycatcher 11bp
  D White-throated sparrow 22bp
B D    Medium ground finch 15bp
B D            Zebra finch 16bp
B D             Budgerigar 15bp
  D                 Parrot 15bp
  D          Scarlet macaw 15bp
B D                Chicken 15bp
B D                 Turkey 15bp
  D        Green seaturtle 9bp

Alignment block 58 of 629 in window, 65430670 - 65430723, 54 bps 
B D                   Human  -----gtgactgaa--------acgt--------------------------gatgga--------t---
B D                   Chimp  -----gtgactgaa--------acgt--------------------------gatgga--------t---
B D               Orangutan  -----gtgactgaa--------acgt--------------------------gatgaa--------t---
B D                 Opossum  ------tgaccatc--------atgt--------------------------gtt---------------
  D             Rock pigeon  -----gtgacacgt--------------------------------------gacgcg--------c---
  D            Saker falcon  -----ggaattgac--------atgt--------------------------gaccga--------c---
  D        Peregrine falcon  -----aggattgac--------atgg--------------------------gattga--------c---
  D     Collared flycatcher  -----gtcacggtg----------------------------------------tgca--------c---
  D  White-throated sparrow  -----acagctggt--------acaaggt-----------------------gagaca--------c---
B D     Medium ground finch  -----acagcccgt----------------------------------------gaca--------c---
B D             Zebra finch  -----ccacctgct--------ggggaca-----------------------gggaca--------c---
B D              Budgerigar  -----tcatacttc--------atgtact-tgaggcagaactcacagatccagagtta--------c---
  D                  Parrot  -----gcagcaccc--------ctgt--------------------------aataga--------c---
  D           Scarlet macaw  -----atggtttgt--------atgt--------------------------gactta--------c---
B D                 Chicken  -----gtcactaac--------atgt--------------------------ctttaa--------c---
B D                  Turkey  -----gagatcgac--------atgg--------------------------gttcta--------c---
B D      American alligator  -----gcgtgtgtgtgcagtggatgt--------------------------gatgca--------c---
  D         Green seaturtle  -----atgttttgt--------gtgtcttgtgttgtgtgcgttgt-------gagtga--------c---
B D           X. tropicalis  -----gtagctggc--------atgt--------------------------atctgg--------c---
B D                  Medaka  -----atggaaagt--------acgt--------------------------gtgaca--------g---
         Southern platyfish  -----at-aaaaac--------atgt--------------------------gtagca--------c---
B D             Stickleback  -----ggggcagcc--------agga--------------------------atcgaaccaccaacc---
B D            Atlantic cod  -----gtgttagac--------aggt--------------------------gagaca------------
B D               Zebrafish  -----at---------------atgt--------------------------ttctga--------c---
B D                 Lamprey  gtgagacacctgac--------gtgt--------------------------gagaca--------cctg
B D                 Gorilla  ======================================================================

                      Human  aca-------tgt-----------------------------------------gtgacccctgactgaa
                      Chimp  aca-------tgt-----------------------------------------gtgacccctgactgaa
                  Orangutan  aca-------tgt-----------------------------------------gtgacacctgactgac
                    Opossum  --a-------cat-----------------------------------------gttatctctgattg--
                Rock pigeon  gcg-------tgt-----------------------------------------gacacg----------
               Saker falcon  acggaattgacat-----------------------------------------gtgacc----------
           Peregrine falcon  acgggactgacac-----------------------------------------gggaca----------
        Collared flycatcher  agg-------cgt-----------------------------------------gtcacg----------
     White-throated sparrow  gtg-------tgt-----------------------------------------gtgaca----------
        Medium ground finch  acg-------tgt-----------------------------------------gtgacc----------
                Zebra finch  acc-------tgt-----------------------------------------gtgaca----------
                 Budgerigar  acg-------tat-----------------------------------------gttaca----------
                     Parrot  atg-------tat-----------------------------------------aacaca----------
              Scarlet macaw  atg-------tgt-----------------------------------------gggatt----------
                    Chicken  atgtccttaacgt-----------------------------------------gtctct----------
                     Turkey  atgggattgagat-----------------------------------------ggaata----------
         American alligator  aggagctgtgtgt-----------------------------------------atgcca----------
            Green seaturtle  gtg-------cga-----------------------------------------gcgacg----------
              X. tropicalis  atatagctggcat-----------------------------------------ttatct----------
                     Medaka  gtg-------tat-----------------------------------------gtgaca----------
         Southern platyfish  atg-------tgtatccc------------------------------------atgtca----------
                Stickleback  ttg-------tgcatcccagcacaccttctctaacctctgcaccacgacgacgacttact----------
               Atlantic cod  -tg-------tgagccag------------------------------------gtgtga----------
                  Zebrafish  ata-------tat-----------------------------------------gtgaca----------
                    Lamprey  acg-------tgt-----------------------------------------gagacacctggtgcgt
                    Gorilla  ======================================================================

                      Human  gtgacaca---------------catt
                      Chimp  gtgacaca---------------catt
                  Orangutan  atgacaca---------------catt
                    Opossum  ----catg---------------tgtg
                Rock pigeon  -tgacaca---------------cgtg
               Saker falcon  ----caca---------------tggg
           Peregrine falcon  ----caca---------------cggg
        Collared flycatcher  -------------------------gg
     White-throated sparrow  ----tg-----------------tgtg
        Medium ground finch  -------------------------ag
                Zebra finch  ----cacc---------------tgtg
                 Budgerigar  ----caca-------------------
                     Parrot  ----tgga-------------------
              Scarlet macaw  ----taga---------------tgcg
                    Chicken  ----aaca---------------tgtc
                     Turkey  ----aaca---------------tggg
         American alligator  ----tgaa---------------ggtg
            Green seaturtle  ----cacaacgtatgatgtgcgacgtg
              X. tropicalis  ----ggca---------------tata
                     Medaka  ----ggta---------------ta--
         Southern platyfish  ----tgca---------------ca--
                Stickleback  ----gaga---------------cc--
               Atlantic cod  ----gaca---------------ct--
                  Zebrafish  ----tata-------------------
                    Lamprey  gtgagaca---------------cct-
                    Gorilla  ===========================

Alignment block 59 of 629 in window, 65430724 - 65430730, 7 bps 
B D                   Human  tgtgaca
B D                   Chimp  tgtgaca
B D               Orangutan  tgtgaca
B D                 Opossum  ttttgcc
  D             Rock pigeon  agtgaca
  D            Saker falcon  agaaaga
  D        Peregrine falcon  attgaca
  D     Collared flycatcher  tcacaca
  D  White-throated sparrow  tgacacg
B D     Medium ground finch  tgacaca
B D             Zebra finch  tgacaca
B D              Budgerigar  cattaca
  D                  Parrot  acttaca
  D           Scarlet macaw  atttgtg
B D                 Chicken  cttgaca
B D                  Turkey  atagaca
B D      American alligator  atgtgtg
  D         Green seaturtle  tgacgca
B D           X. tropicalis  gctggca
B D               Zebrafish  tgtgaca
B D                 Lamprey  ---ggta
        Southern platyfish  -------
B D                  Medaka  -------
B D             Stickleback  -------
B D                 Gorilla  =======

Inserts between block 59 and 60 in window
B D              Zebrafish 4bp

Alignment block 60 of 629 in window, 65430731 - 65430765, 35 bps 
B D                   Human  ----------------cgtgactgatacgt---------gacatgagtg----acacttgtgtg
B D                   Chimp  ----------------cgtgactgatacgt---------gacatgagtgtgtgacacttgtgtg
B D               Orangutan  ----------------cgtgactgatatgt---------gacatgcgtgtgtgacacttgtgtg
B D                 Opossum  ----------------tagaatcaacatgt---------gacaaaaa------------gtgtg
  D             Rock pigeon  ----------------cgtgacgcgctcgt---------gtgacacgtgtgtg-----------
  D            Saker falcon  ----------------cgggaccgacgcgg---------gacccacatgggat-----------
  D        Peregrine falcon  ----------------tgggataaacatgg---------gactgacacgggat-----------
  D     Collared flycatcher  ----------------catgtgtcacgggc---------tgtacacatgtgtt-----------
  D  White-throated sparrow  ----------------tgtgtgtg------------------acaggtgtgtg-----------
B D     Medium ground finch  ----------------cctgtgcaagctgc---------aacacacgtgtgtg-----------
B D             Zebra finch  ----------------cctgtgtg----------------acacacctgtgtg-----------
B D              Budgerigar  ----------------catacgttacacac---------attacacgta---------------
  D                  Parrot  ----------------tgtaacccatatgt---------atcacacatg---------------
  D           Scarlet macaw  ----------------catggattgtatgt---------aatttgtatg---------------
B D                 Chicken  ----------------tgtccctaacatgt---------ccttg--------------------
B D                  Turkey  ----------------tgggatgaacacgg---------gatgg--------------------
B D      American alligator  ----------------tgagttgtgcatat---------gtt----------------------
  D         Green seaturtle  ----------------tgcgtgcgacaagc---------aacatgcgagcg-------------
B D           X. tropicalis  ----------------cgtgtgtgactcgt---------gtagcccttgtgtg-----------
B D                  Medaka  ----------------agtgacaggtacgt-----ataagaggcacatgtg-------------
         Southern platyfish  ----------------tgggatacacatgtgcatcacatgacatgcatggg-------------
B D             Stickleback  ----------------agtaagagacacat-----aagagacaagcttgag-------------
B D               Zebrafish  ----------------tgtgacatatatgt-----ttctggcatatatgtg-------------
B D                 Lamprey  cgtgtgtgacacctgacgtgtgagacacct---------gacgtgtgag---------------
B D                 Gorilla  ================================================================

Inserts between block 60 and 61 in window
  D            Rock pigeon 9bp
  D           Saker falcon 2bp
  D       Peregrine falcon 2bp
  D    Collared flycatcher 9bp
  D White-throated sparrow 32bp
B D    Medium ground finch 31bp
B D            Zebra finch 4bp
B D             Budgerigar 15bp
  D                 Parrot 28bp
  D          Scarlet macaw 11bp
  D        Green seaturtle 7bp
B D          X. tropicalis 2bp
B D                 Medaka 9bp
        Southern platyfish 9bp
B D            Stickleback 13bp
B D              Zebrafish 18bp

Alignment block 61 of 629 in window, 65430766 - 65430850, 85 bps 
B D                   Human  ---------acatgtga---------------------------------ccaacg-------tgtgtaa
B D                   Chimp  ---------acatgtga---------------------------------ccaacg-------tgtgtaa
B D               Orangutan  ---------acatgtga---------------------------------cc-atg-------tgtgtaa
B D                 Opossum  ---------gctta-----------------------------------------a-------tggttaa
  D             Rock pigeon  ---------acatgcgt---------------------------------gt--------------gcaa
  D            Saker falcon  ---------acacggga---------------------------------tcaaca-------c--agaa
  D        Peregrine falcon  ---------acgtggga---------------------------------ccaaca-------t--ggga
  D     Collared flycatcher  ---------acgggtgt---------------------------------gtcacg-------g--gctg
  D  White-throated sparrow  ---------a-aggtga---------------------------------g---------------aaca
B D     Medium ground finch  ---------acatgtgc---------------------------------gcccc-----------aaaa
B D             Zebra finch  ---------acctgtgt---------------------------------g------------------a
B D              Budgerigar  ---------acacgtat---------------------------------gttaca-------c--gca-
  D                  Parrot  ---------acacgtaa---------------------------------cccaca-------t--gtaa
B D                 Chicken  ---------acctgtcactaccatgtccttaacatgtccttaccatgcccttaaca-------t--gtca
B D                  Turkey  ---------acacgtga---------------------------------gtaaca-------c--gtga
B D      American alligator  -----------gtgtgt---------------------------------gcaatg-------t--gtgt
  D         Green seaturtle  ---------acaagcgt---------------------------------gcgacg-------c--gtaa
B D           X. tropicalis  ---------tcgtgtag---------------------------------cccttg-------t--gtga
B D                  Medaka  ---------aggtacgt---------------------------------gtgaca----gggt--gaca
         Southern platyfish  ---------acatatgt---------------------------------atccca-----tgt--gata
B D             Stickleback  ---------acataaga---------------------------------gacaca-------t--aaga
B D               Zebrafish  ---------atatatgt---------------------------------gacata---tatgt--ttct
B D                 Lamprey  acacctggtgcatgtga---------------------------------gacacctggtgcgt--gtga
  D           Scarlet macaw  ======================================================================
B D                 Gorilla  ======================================================================

                      Human  cac---aggatggac---------------atgtgtg------------at----ac---ac--------
                      Chimp  cac---aggatggac---------------atgtgtg------------at----ac---ac--------
                  Orangutan  cac---aggatggac---------------atgtgtg------------at----ac---at--------
                    Opossum  cac---acaatggcc--------------------tg------------at----gt---ct--------
                Rock pigeon  cat---gggtgtgcg---------------acacgtg------------cctggtat---gt--------
               Saker falcon  ttg---acctgggaccg-------------gcacggg------------accg--ac---ac--------
           Peregrine falcon  caa---agacgggaccg-------------acacggg------------accg--ac---ac--------
        Collared flycatcher  tac---acgtgtgc-----------------tccggg------------ac----ac---ac--------
     White-throated sparrow  cat---gtgtgtgac---------------atctgtg------------tg----ac---at--------
        Medium ground finch  cac---gcgtgtgca---------------gcctgtg------------ac----ac---ac--------
                Zebra finch  cac---acctgtgac---------------acctgtg------------at----ac---ac--------
                 Budgerigar  ------ccaggtgc-----------------------------------------at---gc--------
                     Parrot  cac---ccatgtacc---------------acccctg------------ta----ac---ac--------
                    Chicken  tta---acttgtcctta-------------gcatgtc------------cttactgt---gc--------
                     Turkey  tta---a------------------------------------------------gt---gc--------
         American alligator  gag---ctgtatgtatgctgtgtacgtgatgcgtgag------------ct----gt---gc--------
            Green seaturtle  cacgtgacgtgcaacat-------------gcatgcg------------ac----ac---gtgatttttt
              X. tropicalis  ctc---atgtgtagc---------------tcgtgtg------------ta----gc---tc--------
                     Medaka  ggt---acgtgtggc---------------aagtatg------tataacag----gc---ac--------
         Southern platyfish  tac---atgtacatc---------------acatgtg------tgtcacat----gt---at--------
                Stickleback  gac---aggcatgag---------------accggtggcccctcctcctcc----ac---ac--------
                  Zebrafish  ggc---atatatgtg---------------acatata------tgtttctg----gc---at--------
                    Lamprey  gat---acctggtgc---------------gtgtgag------------ac----acctgac--------
              Scarlet macaw  ======================================================================
                    Gorilla  ======================================================================

                      Human  ------------gtgtt---------tgactc---------------ttga-ccaaattgtgtcacacct
                      Chimp  ------------gtgtt---------tgactc---------------ttga-ccaaattgtgtcacacct
                  Orangutan  ------------gtgtt---------tgactc---------------ttga-ctgaaatgtgtcacacct
                    Opossum  ------------cgctc---------tgacc-------------------a-ccaccgtgggacttgcct
                Rock pigeon  ------------gtgtg---------tgacac---------------gtga-cgcgctcgtgcaacatgt
               Saker falcon  ------------gtgac---------ggacat---------------gtga-cggacacgtgacgga---
           Peregrine falcon  ------------gggat---------tgacgt---------------ggga-taaacatgggactga---
        Collared flycatcher  ------------gtgtg---------tgtttc--------------------aggctgcac---acgcct
     White-throated sparrow  ------------gtgtg---------aggacc----------------tgg-aggatctgt---acagcc
        Medium ground finch  ------------ccgtg---------tgcccc---------------ataa-caggtgtgt---acagcc
                Zebra finch  ------------ctgag---------tgatct---------------ctga-cacacctgtgtcacacct
                 Budgerigar  ------------ggaag---------gagcgc---------tcgtacttca-tgtacttgaggcagaact
                     Parrot  ------------ccaca---------taaccc---------acatgtataa-tacatgtaacgcacatgc
                    Chicken  ------------ccttaagatgcccttgacgt---------------gtca-ctat--------------
                     Turkey  --------------------------tgacat---------------ggaa-ccga--------------
         American alligator  ------------gtgtg---------ctgtgt---------------gtga-tgtatgtga---------
            Green seaturtle  gtgtagtgttttgtgtg---------tggtgt---------------tttg-tgtgt-------------
              X. tropicalis  ------------gtgtg---------tgacttgtgtgtagctcgtgtgtga-cttgtgtgt---------
                     Medaka  ------------atgtg---------acgtgt---------------gaca-ggtacgtg----------
         Southern platyfish  ------------atcag---------tcaaat---------------gcta-cataggtg----------
                Stickleback  ------------aggaa---------tagtac---------------gttatcatcatta----------
                  Zebrafish  ------------atatg---------tgacat---------------a----tatgtttc----------
                    Lamprey  ------------gtgtg---------agacac---------------ctga-cg----------------
              Scarlet macaw  ======================================================================
                    Gorilla  ======================================================================

                      Human  ga----ctga
                      Chimp  ga----c---
                  Orangutan  ga----c---
                    Opossum  at----aagt
                Rock pigeon  g---------
               Saker falcon  ----------
           Peregrine falcon  ----------
        Collared flycatcher  gt--------
     White-throated sparrow  gc--------
        Medium ground finch  g---------
                Zebra finch  ga--------
                 Budgerigar  cacaga----
                     Parrot  aacgca----
                    Chicken  ----------
                     Turkey  ----------
         American alligator  ----------
            Green seaturtle  ----------
              X. tropicalis  ----------
                     Medaka  ----------
         Southern platyfish  ----------
                Stickleback  ----------
                  Zebrafish  ----------
                    Lamprey  ----------
              Scarlet macaw  ==========
                    Gorilla  ==========

Inserts between block 61 and 62 in window
  D            Rock pigeon 8bp
  D           Saker falcon 1bp
  D       Peregrine falcon 1bp
  D    Collared flycatcher 12bp
  D White-throated sparrow 13bp
B D    Medium ground finch 9bp
B D            Zebra finch 16bp
  D                 Parrot 1bp
B D                Chicken 1bp
B D                 Turkey 1bp
B D     American alligator 14bp
  D        Green seaturtle 8bp

Alignment block 62 of 629 in window, 65430851 - 65430867, 17 bps 
B D                   Human  cacttgtgtgaaacctg
B D                   Chimp  -acttgtgtgaaacctg
B D               Orangutan  -acttgcgtgaaacctg
B D                 Opossum  ggcctgtgagcagcgtg
B D           X. tropicalis  agctcgtgtgcgacttg
B D                  Medaka  ---------------tg
         Southern platyfish  ---------------ta
B D             Stickleback  ---------------cg
B D               Zebrafish  ---------------tg
B D                 Lamprey  ----tgtgtgacacctg
B D             Zebra finch  =================
  D  White-throated sparrow  =================
B D     Medium ground finch  =================
B D      American alligator  =================
B D                  Turkey  =================
B D                 Chicken  =================
  D           Scarlet macaw  =================
  D                  Parrot  =================
  D        Peregrine falcon  =================
  D            Saker falcon  =================
  D             Rock pigeon  =================
  D     Collared flycatcher  =================
  D         Green seaturtle  =================
B D                 Gorilla  =================

Inserts between block 62 and 63 in window
B D                Opossum 4bp

Alignment block 63 of 629 in window, 65430868 - 65430887, 20 bps 
B D                   Human  acatg----------agtga-------gacacatgg--c
B D                   Chimp  acatg----------agtga-------gactcatga--c
B D               Orangutan  acatg----------agtga-------gacacatga--c
B D                 Opossum  ccaga----------agtga------------atga--c
  D             Rock pigeon  acgtgacacgag---catgt-------gacacctga--c
  D            Saker falcon  acgtgatggaca---cgtga-------ctgacatgt--g
  D        Peregrine falcon  acgggattggaa---tggga-------caaacatgg--g
  D     Collared flycatcher  acgtg----------tgttatggggagcacggctgt--g
  D  White-throated sparrow  acgtg----------tgtga-------cacacctgg--g
B D     Medium ground finch  acgta--cagc---ccatga-------cacacatgt--g
B D             Zebra finch  aggtg----------tgtct-------tgtacctgtcca
  D                  Parrot  acgtaaccgacat-ctatcacacacagcactcatgt--a
B D                 Chicken  atgtc----------cttga-----------catgt--c
B D                  Turkey  acgtc----------cgtga-----------ggtga--c
B D      American alligator  gcgtaggtgatgc-gtgtga-------accgcgtgt--g
  D         Green seaturtle  gtgtgttctgtgcgttgtgt-------gtcgtgtga--g
B D                  Medaka  aca-g----------ggtga-------aaggtac-----
         Southern platyfish  gcatg----------tgtat-------cacatac-----
B D             Stickleback  tcatg----------gatgg-------aggacag-----
B D               Zebrafish  acata----------tatgt-------gacatat-----
B D                 Lamprey  gtacg----------tgtga-------gacacctgg--t
  D           Scarlet macaw  =======================================
B D           X. tropicalis  ---------------------------------------
B D                 Gorilla  =======================================

Inserts between block 63 and 64 in window
  D       Peregrine falcon 11bp
B D                Chicken 15bp
B D                 Turkey 2bp
B D     American alligator 8bp

Alignment block 64 of 629 in window, 65430888 - 65430889, 2 bps 
B D                   Human  ac
B D                   Chimp  ac
B D               Orangutan  at
B D                 Opossum  ac
  D             Rock pigeon  ac
  D            Saker falcon  ac
  D     Collared flycatcher  tc
  D  White-throated sparrow  ac
B D     Medium ground finch  ca
B D             Zebra finch  aa
  D                  Parrot  ac
B D                 Chicken  gc
B D                  Turkey  gc
B D      American alligator  ac
  D         Green seaturtle  gt
B D                  Medaka  gt
         Southern platyfish  at
B D             Stickleback  at
B D               Zebrafish  at
B D                 Lamprey  ac
  D           Scarlet macaw  ==
  D        Peregrine falcon  ==
B D           X. tropicalis  --
B D                 Gorilla  ==

Alignment block 65 of 629 in window, 65430890 - 65430890, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D               Orangutan  g
B D                  Baboon  a
B D                 Opossum  a
  D             Rock pigeon  a
  D            Saker falcon  a
  D     Collared flycatcher  a
  D  White-throated sparrow  a
B D     Medium ground finch  g
B D             Zebra finch  g
  D                  Parrot  a
B D                 Chicken  g
B D                  Turkey  g
B D      American alligator  a
  D         Green seaturtle  g
B D                  Medaka  g
         Southern platyfish  g
B D             Stickleback  c
B D               Zebrafish  g
B D                 Lamprey  g
  D           Scarlet macaw  =
  D        Peregrine falcon  =
B D           X. tropicalis  -
B D                 Gorilla  =

Inserts between block 65 and 66 in window
  D            Rock pigeon 9bp
  D           Saker falcon 1bp
  D    Collared flycatcher 2bp
  D White-throated sparrow 2bp
B D    Medium ground finch 2bp
B D            Zebra finch 2bp
  D                 Parrot 15bp
B D                Chicken 13bp
B D                 Turkey 13bp
B D     American alligator 22bp
  D        Green seaturtle 11bp

Alignment block 66 of 629 in window, 65430891 - 65430891, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                  Baboon  t
  D             Rock pigeon  t
  D            Saker falcon  g
  D     Collared flycatcher  g
  D  White-throated sparrow  t
B D     Medium ground finch  c
B D             Zebra finch  t
  D                  Parrot  t
  D           Scarlet macaw  c
B D                 Chicken  t
B D                  Turkey  t
B D      American alligator  c
  D         Green seaturtle  t
B D                  Medaka  t
         Southern platyfish  t
B D             Stickleback  t
B D               Zebrafish  t
B D                 Lamprey  t
  D        Peregrine falcon  =
B D                 Opossum  -
B D           X. tropicalis  -
B D                 Gorilla  =

Inserts between block 66 and 67 in window
B D                 Baboon 43bp

Alignment block 67 of 629 in window, 65430892 - 65430909, 18 bps 
B D                   Human  gacttacaagtgtgtg-ca-------
B D                   Chimp  gacttacaagtgtgtg-ca-------
B D               Orangutan  gacttacacgtgtgtgaca-------
B D                 Opossum  -gttcataagagaaca-ac-------
  D             Rock pigeon  ----------gacacg-cg-------
  D            Saker falcon  ----------gaggaa-ca-------
  D        Peregrine falcon  -----------acaga-ca-------
  D     Collared flycatcher  ----------gctgga-ca-------
  D  White-throated sparrow  ----------gacaca-cg-------
B D     Medium ground finch  ----------gaaaca-cg-------
B D             Zebra finch  ----------gtctct-ca-------
  D                  Parrot  ----------atcacc-ca-------
  D           Scarlet macaw  ----------gatttg-ca-------
B D                 Chicken  ----------cactaa-ct-------
B D                  Turkey  -------------gaa-ca-------
B D      American alligator  ----------tgtgtg-ca-------
  D         Green seaturtle  ----------gtcggc-at-------
B D                  Medaka  ----------g----a-ca-------
         Southern platyfish  ----------atttca-ca-------
B D             Stickleback  ----------cgtccc-ct-------
B D               Zebrafish  ----------ttctga-ca-------
B D                 Lamprey  ----------gtgaga-cacctgacg
B D           X. tropicalis  --------------------------
B D                  Baboon  ==========================
B D                 Gorilla  ==========================

Inserts between block 67 and 68 in window
B D                 Medaka 10bp
        Southern platyfish 10bp
B D            Stickleback 5bp
B D              Zebrafish 8bp

Alignment block 68 of 629 in window, 65430910 - 65430925, 16 bps 
B D                   Human  tgt--------------------------g-------------atca--------acgtgta---a---
B D                   Chimp  cgt--------------------------g-------------atca--------acgtgta---a---
B D               Orangutan  cgt--------------------------g-------------atca--------acgtgca---a---
B D                 Opossum  tgc--------------------------g-------------tcca--------acatgca---a---
  D             Rock pigeon  tgt--------------------------g-------------tgac--------acctgat---a---
  D            Saker falcon  tgt--------------------------g-------------tgac--------gtgagta---a---
  D        Peregrine falcon  tgt--------------------------gaccgacacggaattgac--------atgtgac---c---
  D     Collared flycatcher  cgt---gtgtcacagt-------------g-------------tgcac-------aggcgtg---t---
  D  White-throated sparrow  tgtgaggggttacagggtctgcacagcagg-------------taca--------agatgag---a---
B D     Medium ground finch  cgt--------------------------g-------------tgca--------cgctgta---a---
B D             Zebra finch  cct--------------------------g-------------tccc--------aggtgtgtctg---
  D                  Parrot  tgt--------------------------a-------------tcgc--------acatgta---a---
  D           Scarlet macaw  tgt--------------------------g-------------attt--------gcatgca---a---
B D                 Chicken  tgt--------------------------c-------------cttg--------acgtgtc---a---
B D                  Turkey  tgg--------------------------g-------------atga--------acatggg---a---
B D      American alligator  ggt--------------------------g-------------agcg--------gtgtgtg---t---
  D         Green seaturtle  tgt--------------------------g-------------tttt--------gtgtgtg---t---
B D           X. tropicalis  tgt--------------------------g-------------actt--------gtgtgta---g---
B D                  Medaka  -----------------------------------------------acagtgtgacaggta---c---
         Southern platyfish  -----------------------------------------------tcacatgcacatgtg---c---
B D             Stickleback  ----------------------------------------------------------tgtg---a---
B D               Zebrafish  -------------------------------------------------------acatata---t---
B D                 Lamprey  --------------------------------------------------------tgtgag---acac
B D                  Baboon  =====================================================================
B D                 Gorilla  =====================================================================

Inserts between block 68 and 69 in window
B D                 Medaka 6bp
        Southern platyfish 18bp
B D              Zebrafish 6bp

Alignment block 69 of 629 in window, 65430926 - 65430931, 6 bps 
B D                   Human  ctg--------aca
B D                   Chimp  ctg--------aca
B D               Orangutan  ctg--------aca
B D                 Opossum  atg--------aca
  D             Rock pigeon  cgcgtgtgca-aca
  D            Saker falcon  gaa--------aca
  D        Peregrine falcon  gac--------acg
  D     Collared flycatcher  cacaggtc---aca
  D  White-throated sparrow  gacacacctggaca
B D     Medium ground finch  cac--------acg
B D             Zebra finch  tacctgtccaggtg
  D                  Parrot  ccc--------aca
  D           Scarlet macaw  ttt--------gca
B D                 Chicken  gta--------aca
B D                  Turkey  ggg--------tca
B D      American alligator  gct--------gca
  D         Green seaturtle  caatttt----ttg
B D           X. tropicalis  ctc--------g--
B D                  Medaka  --------caggca
         Southern platyfish  --------aataca
B D               Zebrafish  --------gacata
B D                 Lamprey  --------ctgacg
B D                  Baboon  ==============
B D                 Gorilla  ==============

Alignment block 70 of 629 in window, 65430932 - 65430932, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                  Baboon  t
B D                 Opossum  t
  D             Rock pigeon  t
  D            Saker falcon  c
  D        Peregrine falcon  g
  D     Collared flycatcher  c
  D  White-throated sparrow  t
B D     Medium ground finch  t
B D             Zebra finch  t
  D                  Parrot  t
  D           Scarlet macaw  t
B D                 Chicken  t
B D                  Turkey  c
B D      American alligator  t
  D         Green seaturtle  t
B D           X. tropicalis  t
B D                  Medaka  c
         Southern platyfish  c
B D               Zebrafish  t
B D                 Lamprey  t
B D                 Gorilla  =

Inserts between block 70 and 71 in window
B D                 Baboon 16bp

Alignment block 71 of 629 in window, 65430933 - 65430933, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D               Orangutan  g
B D                 Opossum  g
  D             Rock pigeon  g
  D            Saker falcon  a
  D        Peregrine falcon  a
  D     Collared flycatcher  a
  D  White-throated sparrow  g
B D     Medium ground finch  g
B D             Zebra finch  g
  D                  Parrot  g
  D           Scarlet macaw  g
B D                 Chicken  g
B D                  Turkey  g
B D      American alligator  a
  D         Green seaturtle  g
B D           X. tropicalis  g
B D                  Medaka  a
         Southern platyfish  a
B D               Zebrafish  a
B D                 Lamprey  g
B D                  Baboon  =
B D                 Gorilla  =

Inserts between block 71 and 72 in window
  D            Rock pigeon 6bp
  D           Saker falcon 11bp
  D       Peregrine falcon 9bp
  D    Collared flycatcher 4bp
  D White-throated sparrow 4bp
B D    Medium ground finch 7bp
B D            Zebra finch 8bp
B D     American alligator 2bp
  D        Green seaturtle 5bp

Alignment block 72 of 629 in window, 65430934 - 65430948, 15 bps 
B D                   Human  tg--tgacat---gtg-------atag
B D                   Chimp  tg--tgacat---gtg-------attg
B D               Orangutan  tg--tgacac---gtg-------attg
B D                 Opossum  tgatcgacat---gtg------aattg
  D             Rock pigeon  ----cgacac---gcgcctggt-----
  D            Saker falcon  ----ggacac---acatg---------
  D        Peregrine falcon  ----tgaccc---acatgggag-----
  D     Collared flycatcher  ----tgtcac---gggct---------
  D  White-throated sparrow  ----tgacac---gtgtg---------
B D     Medium ground finch  ----tgacac-----------------
B D             Zebra finch  ----tgtccc-----------------
  D                  Parrot  ----tatcac-----------------
B D      American alligator  ----tgatgt---gtgtgagcc-----
  D         Green seaturtle  ----tgtttt---gtgtgtgtc-----
B D           X. tropicalis  tg--tgactt---gtgtgta-------
B D                  Medaka  tg--tgacatgtgacag----------
         Southern platyfish  tg--tgaaa----atat----------
B D               Zebrafish  tg--tgacat---atat----------
B D                 Lamprey  tg--tgatac---ctggt---------
B D                  Turkey  ---------------------------
B D                 Chicken  ---------------------------
B D                  Baboon  ===========================
B D                 Gorilla  ===========================

Inserts between block 72 and 73 in window
  D       Peregrine falcon 2bp
B D     American alligator 2bp
  D        Green seaturtle 2bp
B D                 Medaka 2bp
        Southern platyfish 2bp
B D              Zebrafish 11bp

Alignment block 73 of 629 in window, 65430949 - 65430952, 4 bps 
B D                   Human  acaa
B D                   Chimp  acaa
B D               Orangutan  acaa
B D                  Baboon  acac
B D                 Opossum  -cag
  D             Rock pigeon  atgt
  D            Saker falcon  acac
  D        Peregrine falcon  agac
  D     Collared flycatcher  gtac
  D  White-throated sparrow  ggac
B D     Medium ground finch  gggc
B D             Zebra finch  aggt
B D      American alligator  atgt
  D         Green seaturtle  ttgt
B D           X. tropicalis  --gc
B D                  Medaka  ag--
         Southern platyfish  gt--
B D               Zebrafish  at--
B D                 Lamprey  --ac
B D                  Turkey  ----
B D                 Chicken  ----
  D                  Parrot  ----
B D                 Gorilla  ====

Inserts between block 73 and 74 in window
B D                 Baboon 107bp
B D                Opossum 1bp
B D          X. tropicalis 2bp

Alignment block 74 of 629 in window, 65430953 - 65430983, 31 bps 
B D                   Human  atgtgtgacat-------------gtgtct----gacttgtgtg----------ac--------------
B D                   Chimp  atgtgtgacat-------------gtgtct----gacttgtgtg----------ac--------------
B D               Orangutan  gtgtgtgacac-------------atgtct----gacttgtgtg----------ac--------------
B D                 Opossum  aagtctgatag-------------ttgagg----gactgttact----------accgtgttgttcatcg
  D             Rock pigeon  gtatgtgacac-------------gtgtcg----cgcgcgtgcg----------ac--------------
  D            Saker falcon  tggagggatga-------------gga-------cacatg------------tgac--------------
  D        Peregrine falcon  gggaccgacgc-------------gggacc----cacatgggat--------tgac--------------
  D     Collared flycatcher  acgtgtgttacagtgtgcacgggtgtgtca----caggcggtac----------ac--------------
  D  White-throated sparrow  atgtgtgacag-------------gtgtga----caggtgtgtg----------ac--------------
B D     Medium ground finch  acgtccagccc-------------gtgaca----cacccgtgcgccccc---taac--------------
B D             Zebra finch  gtgtctgtgcc----tgtcccagtgtgtct----cacctgt-------------cc--------------
  D                  Parrot  acatgtaacac---------tcatatataa----cacacgtaatcccca-tgtacc--------------
B D                 Chicken  -tccttaacat-------------gtcact----accatgtcct--------taac--------------
B D                  Turkey  -tgaccgtcag-------------gcagcc----aacacggtgt--------taac--------------
B D      American alligator  gtgctacgtac-------------atgatg----cgtgtgagct--------------------------
  D         Green seaturtle  gtgttttttct------------tttgttc----tgtgtgtcgttttttgtgtgtc--------------
B D           X. tropicalis  gtgtgtgactt-------------gtgtgt----agctcgtgt---------------------------
B D                  Medaka  --gtgtgacag-------gtacatgtgaca----gatacgtgtg----------ac--------------
         Southern platyfish  --atccaacat-------acccgtttcacgtttttatttgtatc----------ac--------------
B D               Zebrafish  --atgtgacat-------atatgtttctga----catatatgtg----------ac--------------
B D                 Lamprey  gtgtgagacac-----------------ct----gacgtgtgtg----------ac--------------
B D                  Baboon  ======================================================================
B D                 Gorilla  ======================================================================

                      Human  -ac
                      Chimp  -ac
                  Orangutan  -ac
                    Opossum  tac
                Rock pigeon  -ac
               Saker falcon  -at
           Peregrine falcon  -ac
        Collared flycatcher  -at
     White-throated sparrow  -ag
        Medium ground finch  -ag
                Zebra finch  -ag
                     Parrot  -ac
                    Chicken  -at
                     Turkey  -at
         American alligator  ---
            Green seaturtle  -at
              X. tropicalis  ---
                     Medaka  -ag
         Southern platyfish  -at
                  Zebrafish  -a-
                    Lamprey  -ac
                     Baboon  ===
                    Gorilla  ===

Inserts between block 74 and 75 in window
B D                Chicken 20bp
B D                 Turkey 20bp

Alignment block 75 of 629 in window, 65430984 - 65430984, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D               Orangutan  g
B D                 Opossum  a
  D             Rock pigeon  g
  D            Saker falcon  g
  D        Peregrine falcon  g
B D                 Chicken  a
B D                  Turkey  a
B D                  Medaka  g
         Southern platyfish  g
B D                 Lamprey  -
B D               Zebrafish  -
B D             Zebra finch  -
  D  White-throated sparrow  -
B D     Medium ground finch  -
B D      American alligator  -
  D     Collared flycatcher  -
  D         Green seaturtle  -
B D           X. tropicalis  -
B D                  Baboon  =
B D                 Gorilla  =

Alignment block 76 of 629 in window, 65430985 - 65431053, 69 bps 
B D                   Human  tgacca-------------------------------acgttactg-acacatgtttg------------
B D                   Chimp  tgacca-------------------------------acgttactg-acacatgtttg------------
B D               Orangutan  tgacca-------------------------------atgttactg-atgcatgtttg------------
B D                 Opossum  caatac-------------------------------atgcaaaca-acacgtggcag------------
  D             Rock pigeon  tgacac-------------------------------gcgtgtgcg-acacc----tg------------
  D            Saker falcon  agacat-------------------------------gtgccaaga-acaca----cg------------
  D        Peregrine falcon  ggatc----------------------------------------a-acacagaattg------------
  D     Collared flycatcher  -------------------------------------gtgtttcag-gac--------------------
  D  White-throated sparrow  -------------------------------------gtgtgacag-gtgtg----tg------------
B D     Medium ground finch  -------------------------------------gcgtgtacg-gcctg----tg------------
B D             Zebra finch  -------------------------------------gtgtgtctgtacctg----t-------------
B D                 Chicken  tgaccttagcatgtttt-----------------aatgtgtcagta-acatgtcctta------------
B D                  Turkey  gggaattaacatg------------------------gggt---ta-acatgggatta------------
B D      American alligator  -------------------------------------gtgtgtgtt-gcgtg----tg------------
  D         Green seaturtle  ------------------------------------gttgtgtgcg-acgca----ca------------
B D           X. tropicalis  ---------------------------------------gtgactt-gtgtg----ta------------
         Southern platyfish  tgaaaacgtgatacacttgaaaacatggggatcacataggttttta-ccatg----aaatgttccaaaat
B D               Zebrafish  ----------------------------------tatatgtttctg-acata----ta------------
B D                 Lamprey  --------------------------------ctggtacgtgtgag-acacc----tg------------
B D                  Baboon  ======================================================================
B D                 Gorilla  ======================================================================

                      Human  ---------acat-------------------gtgactt------ga---------gatgtgactg----
                      Chimp  ---------acat-------------------gtgactt------ga---------gatgtgactg----
                  Orangutan  ---------acat-------------------gtgactt------ga---------gacgtgactg----
                    Opossum  ---------gcatagcgttgaatcacactaggacggtat------gc---------aaggagaatgcata
                Rock pigeon  ---------acac-------------------gtg-tgc------aa-------tgcgtgtgtatg----
               Saker falcon  ---------acat-------------------gag-taa------gg---------gacacgcatg----
           Peregrine falcon  ---------acct-------------------ggg-acc------gg---------cacgggaccg----
        Collared flycatcher  ---------acac-------------------gtg-tgt------gt-------ttcaggctgcac----
     White-throated sparrow  ---------acat-------------------gtg-tgt------ga---------caggtgtgtg----
        Medium ground finch  ---------acac-------------------gtg-tgt------gt---------gacgtgtgac----
                Zebra finch  ---------ccag-------------------gtg-tgt------ctgtacctgtccaggtgtgtc----
                    Chicken  ---------gcgt-------------------gtc-cgt------aa---------catgtccttg----
                     Turkey  ---------acac-------------------ggg-atc------ta---------catgggatta----
         American alligator  ---------atgc-------------------gtg-cga------gc-------tgcatgtgcact----
            Green seaturtle  ---------atgt-------------------gcg-agt------ga---------catgcgaagc----
              X. tropicalis  ---------gctc-------------------gtg-tgt------ga---------cttgtgtgta----
         Southern platyfish  cccatgtatacat-------------------gtg-cttt-----ta---------catgtgattc----
                  Zebrafish  --tgtggacatat-------------------atg-tttctgacata---------tatgtgacat----
                    Lamprey  ---------acgt-------------------gtg-tga------ca------cctgacgtgtgtg----
                     Baboon  ======================================================================
                    Gorilla  ======================================================================

                      Human  ---atgtgt------gtgacatgtg-----actt
                      Chimp  -atatgtgt------gtgacatgtg-----actt
                  Orangutan  -atacatgt------gtgacatgtg-----actt
                    Opossum  tacacgtgg------atgccatgag-----acct
                Rock pigeon  -acacgtaa----cacgtgcacgtg-----ta--
               Saker falcon  -acacaggaggaatgaggacacgtg-----tg--
           Peregrine falcon  -acacggga------cggacacgtg---acgg--
        Collared flycatcher  -acgcctgt-----ttcggggtgt----------
     White-throated sparrow  -atgcgtgt--------gacatgtg-----gg--
        Medium ground finch  -acgcctgt------acagcccgtg-----ac--
                Zebra finch  tgtgcctgt------cccaggtgtg-----tc--
                    Chicken  -acctgtca------ctgacatgtccatagcg--
                     Turkey  -acacggga------tggaggcaggaacggtg--
         American alligator  -atgtacat--------gatgtgtg-----tg--
            Green seaturtle  -gtgtgtgc---aacacgcgacgtg-----ca--
              X. tropicalis  -gctcgtgt------gtgacttgtg-----tg--
         Southern platyfish  -acatcatt------t--acatgtc-----at--
                  Zebrafish  -atatgttt------ctgacatata-----tg--
                    Lamprey  -acacctga------------cgt----------
                     Baboon  ==================================
                    Gorilla  ==================================

Inserts between block 76 and 77 in window
B D          X. tropicalis 2bp
        Southern platyfish 2bp
B D              Zebrafish 2bp
B D                Lamprey 7bp

Alignment block 77 of 629 in window, 65431054 - 65431055, 2 bps 
B D                   Human  ac
B D                   Chimp  ac
B D               Orangutan  ac
B D                  Baboon  ac
B D                 Opossum  gt
  D             Rock pigeon  tc
  D            Saker falcon  ac
  D        Peregrine falcon  ac
  D     Collared flycatcher  ac
  D  White-throated sparrow  ac
B D     Medium ground finch  ac
B D             Zebra finch  tc
B D                 Chicken  tt
B D                  Turkey  gt
B D      American alligator  aa
  D         Green seaturtle  at
B D           X. tropicalis  gc
         Southern platyfish  ac
B D               Zebrafish  ac
B D                 Lamprey  ac
B D                 Gorilla  ==

Inserts between block 77 and 78 in window
B D                 Baboon 54bp
        Southern platyfish 6bp
B D              Zebrafish 4bp

Alignment block 78 of 629 in window, 65431056 - 65431088, 33 bps 
B D                   Human  -----acctga----------------ctg----acacgtgtgtgac-------acatgac-------tg
B D                   Chimp  -----acctga----------------ctg----acacgtgtgtgac-------acatgac-------tg
B D               Orangutan  -----acctga----------------ctg----acacatgtgtgac-------acatgactgagaagtg
B D                 Opossum  -----acttca----------------ttg----gcatgtgattggt-------gtg-----------tg
  D             Rock pigeon  -----acatgacacacacttggcatgtgtg----tgcgacacgtgac----ac-gcg-----------tg
  D            Saker falcon  -----atgcga-------------------------acacaaatgacatggag-acg-----------tg
  D        Peregrine falcon  -----acgtga------------------------cggacacgtgac----gg-aca-----------cg
  D     Collared flycatcher  -----acgtgt---------gttatgggga----gcacagccgtgtc----acgggc-----------tg
  D  White-throated sparrow  -----atgtgt----------------ggg----acacgtgtgtgag----ac-gtg-----------tg
B D     Medium ground finch  -----acccgt----------------gtg----ccc----tgtgac----ac-gcc-----------tg
B D             Zebra finch  -----acctgt------------------------cccaggtgt----------gtc-----------tg
B D                 Chicken  -----tcct-------------------------------------------------------------
B D                  Turkey  -----aaat-------------------------------------------------------------
B D      American alligator  -----ctgtgt--------------gtgtg----ttgtgtatgtgat-------aca-----------tg
  D         Green seaturtle  -----gtgtgt----------------gtg----acacacgattttt-----------------------
B D           X. tropicalis  -----tcgtgt----------------gtg----actcgtgtgtagc-------tcg-----------tg
         Southern platyfish  -----acgttt----------------ctgtgaaccacatatg---------------------------
B D               Zebrafish  -----atgttt----------------ctg----acatatatg---------------------------
B D                 Lamprey  acctgacgtgt-----------gacacctg----gtacgtgtgtgac-------acc-----------tg
B D                  Baboon  ======================================================================
B D                 Gorilla  ======================================================================

                      Human  tg---
                      Chimp  tg---
                  Orangutan  tg---
                    Opossum  ag---
                Rock pigeon  tg---
               Saker falcon  tg---
           Peregrine falcon  tg---
        Collared flycatcher  ta---
     White-throated sparrow  tg---
        Medium ground finch  tg---
                Zebra finch  ta---
                    Chicken  -----
                     Turkey  -----
         American alligator  tg---
            Green seaturtle  -----
              X. tropicalis  tg---
         Southern platyfish  -----
                  Zebrafish  -----
                    Lamprey  gtggg
                     Baboon  =====
                    Gorilla  =====

Inserts between block 78 and 79 in window
  D            Rock pigeon 7bp
  D           Saker falcon 23bp
  D    Collared flycatcher 8bp
  D White-throated sparrow 9bp
B D    Medium ground finch 7bp
B D            Zebra finch 16bp

Alignment block 79 of 629 in window, 65431089 - 65431089, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                 Opossum  t
  D             Rock pigeon  t
  D            Saker falcon  g
  D     Collared flycatcher  t
  D  White-throated sparrow  t
B D     Medium ground finch  c
B D             Zebra finch  t
B D                 Chicken  t
B D                  Turkey  c
B D      American alligator  a
  D         Green seaturtle  t
B D           X. tropicalis  t
         Southern platyfish  t
B D               Zebrafish  t
B D                 Lamprey  t
B D                  Baboon  =
B D                 Gorilla  =

Alignment block 80 of 629 in window, 65431090 - 65431108, 19 bps 
B D                   Human  ---------gacactcaactgac---atgg-g
B D                   Chimp  ---------gacactcgactgac---atgg-g
B D               Orangutan  ---------gacactcgactgac---atgg-g
B D                 Opossum  ---------gacatgccattggc---gcgt-g
  D             Rock pigeon  ---------gacgcgtgtgt------gtgacg
  D            Saker falcon  ---------gacacatatgacacgggacac-g
  D     Collared flycatcher  ---------caca-gtgtgc------acag-g
  D  White-throated sparrow  ---------gacatgtgtg-------acag-g
B D     Medium ground finch  ---------aacacacgtgt------acagcc
B D             Zebra finch  ---------gtcacctgtc-------ccag-g
B D                 Chicken  ---------aacatgtcactaac---atgt-g
B D                  Turkey  ---------aacatgggatgaac---atgg-g
B D      American alligator  ---------gccgtatgtgtgct---atgc-a
B D           X. tropicalis  ---------gacttgtgtgtagc---tcgt-g
         Southern platyfish  ---------gac-------tt-----------
B D               Zebrafish  ---------gacatatatgtt-----------
B D                 Lamprey  gaaatacctgacacctggag------------
B D                  Baboon  ================================
B D                 Gorilla  ================================

Alignment block 81 of 629 in window, 65431109 - 65431114, 6 bps 
B D                   Human  tgtgac
B D                   Chimp  tgtgac
B D               Orangutan  tgtgac
  D             Rock pigeon  cctgac
  D            Saker falcon  cgtgac
  D     Collared flycatcher  cgtgtc
  D  White-throated sparrow  tgtgac
B D     Medium ground finch  tgtgac
B D             Zebra finch  tgtgtc
B D                 Chicken  cttaac
B D                  Turkey  aagaac
B D      American alligator  tgtgat
B D           X. tropicalis  tgtgac
         Southern platyfish  tctcgt
B D               Zebrafish  tctgac
B D                 Lamprey  tgtgag
B D                  Baboon  ======
B D                 Gorilla  ======

Inserts between block 81 and 82 in window
  D    Collared flycatcher 11bp

Alignment block 82 of 629 in window, 65431115 - 65431116, 2 bps 
B D                   Human  ac
B D                   Chimp  ac
B D               Orangutan  ac
  D             Rock pigeon  at
  D            Saker falcon  ac
  D     Collared flycatcher  ac
  D  White-throated sparrow  ag
B D     Medium ground finch  ac
B D                 Chicken  gt
B D                  Turkey  ac
B D      American alligator  gc
B D           X. tropicalis  tc
         Southern platyfish  ga
B D               Zebrafish  at
B D                 Lamprey  ac
B D                  Baboon  ==
B D                 Gorilla  ==

Alignment block 83 of 629 in window, 65431117 - 65431117, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D               Orangutan  a
B D                  Baboon  g
  D             Rock pigeon  g
  D            Saker falcon  a
  D     Collared flycatcher  a
  D  White-throated sparrow  g
B D     Medium ground finch  a
B D                 Chicken  g
B D                  Turkey  g
B D      American alligator  a
B D           X. tropicalis  g
         Southern platyfish  a
B D               Zebrafish  a
B D                 Lamprey  g
B D                 Gorilla  =

Alignment block 84 of 629 in window, 65431118 - 65431118, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                  Baboon  t
B D           X. tropicalis  t
         Southern platyfish  t
B D               Zebrafish  t
B D                 Lamprey  c
  D  White-throated sparrow  -
B D     Medium ground finch  -
B D      American alligator  -
B D                  Turkey  -
B D                 Chicken  -
  D             Rock pigeon  -
  D     Collared flycatcher  -
B D                 Gorilla  =

Inserts between block 84 and 85 in window
B D                 Baboon 18563bp
        Southern platyfish 4bp
B D              Zebrafish 1bp

Alignment block 85 of 629 in window, 65431119 - 65431121, 3 bps 
B D                   Human  -tag
B D                   Chimp  -tag
B D               Orangutan  -tag
  D             Rock pigeon  -tg-
  D     Collared flycatcher  -tg-
  D  White-throated sparrow  -tg-
B D     Medium ground finch  -cg-
B D                 Chicken  --t-
B D                  Turkey  --g-
B D      American alligator  -tg-
         Southern platyfish  -tg-
B D               Zebrafish  -tg-
B D                 Lamprey  ttg-
B D                  Baboon  ====
B D                 Gorilla  ====

Alignment block 86 of 629 in window, 65431122 - 65431123, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D               Orangutan  tg
  D             Rock pigeon  cg
  D     Collared flycatcher  tg
  D  White-throated sparrow  tg
B D     Medium ground finch  tg
B D                 Chicken  ca
B D                  Turkey  ga
         Southern platyfish  gg
B D               Zebrafish  tg
B D                  Baboon  ==
B D                 Gorilla  ==

Inserts between block 86 and 87 in window
  D            Rock pigeon 2bp
  D    Collared flycatcher 2bp
  D White-throated sparrow 2bp
B D                Chicken 1bp
B D                 Turkey 1bp

Alignment block 87 of 629 in window, 65431124 - 65431126, 3 bps 
B D                   Human  ac------a
B D                   Chimp  ac------a
B D               Orangutan  ac------a
B D                  Gibbon  ac------a
B D     Crab-eating macaque  ac------a
B D         Squirrel monkey  ac------a
  D             Rock pigeon  ac------a
  D     Collared flycatcher  ac------g
  D  White-throated sparrow  ac------a
         Southern platyfish  attttttaa
B D               Zebrafish  ac------a
B D                  Turkey  =========
B D                 Chicken  =========
B D                  Baboon  =========
B D                 Gorilla  =========

Inserts between block 87 and 88 in window
  D    Collared flycatcher 8bp

Alignment block 88 of 629 in window, 65431127 - 65431133, 7 bps 
B D                Human  -accagtt
B D                Chimp  -accagtt
B D            Orangutan  -actggtt
B D               Gibbon  -actagta
B D  Crab-eating macaque  -accagta
B D      Squirrel monkey  -accagta
  D  Collared flycatcher  -acgtgtg
      Southern platyfish  tagagct-
B D            Zebrafish  tatatgt-
B D               Turkey  ========
B D              Chicken  ========
B D               Baboon  ========
B D              Gorilla  ========

Inserts between block 88 and 89 in window
B D           Orangutan 4bp
B D              Gibbon 4bp
B D Crab-eating macaque 4bp
B D     Squirrel monkey 4bp

Alignment block 89 of 629 in window, 65431134 - 65431150, 17 bps 
B D                Human  tttaagtttacatgtga
B D                Chimp  tttaggtttacatgtga
B D            Orangutan  tttaagtttacatgtga
B D               Gibbon  tttaggtttacatgtga
B D               Rhesus  tttatgtttacatgtga
B D  Crab-eating macaque  tttaggtttacatgtga
B D         Green monkey  tttaggtttacatgtga
B D      Squirrel monkey  tttaggtttacatctga
  D  Collared flycatcher  ttacagtgtgcacgggt
B D              Chicken  -------taacatgtcc
B D               Turkey  -------ctacatggga
      Southern platyfish  tttagttata---atga
B D            Zebrafish  ttctgacatatatgtga
B D               Baboon  =================
B D              Gorilla  =================

Inserts between block 89 and 90 in window
     Southern platyfish 5bp

Alignment block 90 of 629 in window, 65431151 - 65431156, 6 bps 
B D                Human  ----ttgcca
B D                Chimp  ----ttgcca
B D            Orangutan  ----ttgcca
B D               Gibbon  ----ttgcca
B D               Rhesus  ----ttgcca
B D  Crab-eating macaque  ----ttgcca
B D         Green monkey  ----ttgcca
B D      Squirrel monkey  ----ttgcca
  D  Collared flycatcher  ----gtgtca
B D              Chicken  ----ttacca
B D               Turkey  ----ttgaca
      Southern platyfish  ttaatt----
B D               Baboon  ==========
B D              Gorilla  ==========

Alignment block 91 of 629 in window, 65431157 - 65431157, 1 bps 
B D                Human  -t
B D                Chimp  -t
B D            Orangutan  -t
B D               Gibbon  -t
B D               Rhesus  -t
B D  Crab-eating macaque  -t
B D         Green monkey  -t
B D      Squirrel monkey  -t
B D              Chicken  -t
B D               Turkey  -t
      Southern platyfish  a-
B D               Baboon  ==
B D              Gorilla  ==

Inserts between block 91 and 92 in window
B D             Chicken 11bp

Alignment block 92 of 629 in window, 65431158 - 65431171, 14 bps 
B D                Human  tttatatactcacc
B D                Chimp  tttatatactcacc
B D            Orangutan  tttatatactcacc
B D               Gibbon  tttatatactcacc
B D               Rhesus  tttatatacttatc
B D  Crab-eating macaque  tttatatacttatc
B D         Green monkey  tttatatacttatc
B D      Squirrel monkey  tttatatactcacc
B D              Chicken  ------------gt
      Southern platyfish  ttaataaatttacc
B D               Baboon  ==============
B D              Gorilla  ==============

Alignment block 93 of 629 in window, 65431172 - 65431179, 8 bps 
B D                Human  acttcttg
B D                Chimp  acttcttg
B D            Orangutan  acttcttg
B D               Gibbon  acttcttg
B D               Rhesus  acttcttg
B D  Crab-eating macaque  acttcttg
B D         Green monkey  acttcttg
B D      Squirrel monkey  atttcttg
B D              Chicken  ccttaatg
B D               Baboon  ========
B D              Gorilla  ========

Alignment block 94 of 629 in window, 65431180 - 65431282, 103 bps 
B D                Human  catcttagaaagaccattaaagcatatattctaa---gtttttatttagttagttatttttatagag-ac
B D                Chimp  cacctcagaaagaccatcaa-gcacctattctaataagtttttatttagttatttatttttgtagag-ac
B D            Orangutan  catctcagaaagaccattaaagcatatattccact--gtttttatttagttagttatttttgtagag-ac
B D               Gibbon  cacctcagaaagaccatcaaggcacctattctaacaagtttttatttagttatttatttttgtagag-gc
B D               Rhesus  catctcagaaagaccattaaagcacctattctaataagtttttatttagttatttatttttgtagag-ac
B D  Crab-eating macaque  catctcagaaagaccattaaagcacctattctaataagtttttatttagttatttatttttgtagag-ac
B D         Green monkey  catctcagaaagaccatcaaagcacctattctaataagtttttatttagttatttatttttgtagag-ac
B D      Squirrel monkey  catctcagaaagaccatcagagcaaatattctact--gtttttatttagttatttatttttgtagag-gc
B D              Chicken  tgtccttgacgtgaccttagcgt--------------gttt-------gtagcatatcctta------ac
B D              Lamprey  cctctaactcggcccccaataacacgagttttgt---gtccgtgtttagtttgttgcccttccaccgctc
B D               Baboon  ======================================================================
B D              Gorilla  ======================================================================

                   Human  agggcctctctatgttgcccaggctggtgtcgaactc
                   Chimp  aggctctctctatgttgcccaggctggtgtcgaactc
               Orangutan  agggcctctctatgttgcccaggctggtgtcaaactc
                  Gibbon  aggatctctctatgttgcccaggctggtgtcgaactc
                  Rhesus  agggtctctctatgttgcccaggctggtgtcgaa-tc
     Crab-eating macaque  agggtctctctatgttgcccaggctggtgtcgaa-tc
            Green monkey  agggtctctctatgttgcccaggctggtgtcgaa-tc
         Squirrel monkey  agggtctctctatgttgcccaggctggtgtaaaattc
                 Chicken  atgtccttaacatgtcgc---------tagcata-gc
                 Lamprey  accgcacctctccgatgggcagcgtggcggtgtgttc
                  Baboon  =====================================
                 Gorilla  =====================================

Alignment block 95 of 629 in window, 65431283 - 65431313, 31 bps 
B D                Human  ctga-tt-------------ttgtttttaaatttaactttcattt
B D                Chimp  ctgagtt-------------tttttttttaatttagttttgattt
B D            Orangutan  ttga----------------tttttttttaatttagctttcattt
B D               Gibbon  ctgagtt-------------tttttttttaatttagttttgattt
B D               Rhesus  ctgagtt----ttgtgtgtgtttttttaaaatttagctttcattt
B D  Crab-eating macaque  ctgagtt----ttgtgtgtgtttttttaaaatttagctttcattt
B D         Green monkey  ctgagtt----ttgtgtgtgttttttttaaatttagctttcattt
B D      Squirrel monkey  ctgagttttttttttttttttttttttttaatttagttttcattt
B D              Chicken  cttagta-------------tgttcttatcatgtccttaacatgt
B D               Baboon  =============================================
B D              Gorilla  =============================================

Inserts between block 95 and 96 in window
B D           Orangutan 271bp

Alignment block 96 of 629 in window, 65431314 - 65431381, 68 bps 
B D                Human  taagaaattctatttttccaaaatctacct-gtttattcctaatagtaccttactgcttcttcagctta
B D                Chimp  taagaaattctatttttccaaaatctacct-gtttattcctaatagtaccttattgcttgttcagctt-
B D               Gibbon  taagaaattctacttttccaaaatctacct-gtttattcctaatagtaccttattgcttgttcagcttt
B D               Rhesus  taagaaattctatttttccaaaatctacct-gtttattcctagtagcaccttattgcttgttcagcttc
B D  Crab-eating macaque  taagaaattctatttttccaaaatctacct-gtttattcctagtagcaccttattgcttgttcagcttc
B D         Green monkey  taagaaattctatttttcaaaaatctacct-gtttattcctagtagcaccttattgcttgttcagcttc
B D      Squirrel monkey  taagaaattctatttttccaaaatcgacct-gtttattcctaatagtgccttattgcttattcagcttt
B D              Chicken  ---cactatctactcctt-aacatgtccttagcatgtccttaatgtgcccttaccgtgtccttaac---
B D            Orangutan  =====================================================================
B D               Baboon  =====================================================================
B D              Gorilla  =====================================================================

Inserts between block 96 and 97 in window
B D              Rhesus 1bp
B D Crab-eating macaque 1bp
B D        Green monkey 1bp

Alignment block 97 of 629 in window, 65431382 - 65431382, 1 bps 
B D                Human  g
B D                Chimp  t
B D               Gibbon  g
B D      Squirrel monkey  g
B D              Chicken  g
B D         Green monkey  =
B D  Crab-eating macaque  =
B D               Rhesus  =
B D            Orangutan  =
B D               Baboon  =
B D              Gorilla  =

Alignment block 98 of 629 in window, 65431383 - 65431391, 9 bps 
B D                Human  ttattatct----
B D                Chimp  ttattatcc----
B D               Gibbon  ttattatcc----
B D               Rhesus  ttatcatcc----
B D  Crab-eating macaque  ttatcatcc----
B D         Green monkey  ttatcatcc----
B D      Squirrel monkey  ttattgtcc----
B D              Chicken  ----tctccttgc
B D            Orangutan  =============
B D               Baboon  =============
B D              Gorilla  =============

Alignment block 99 of 629 in window, 65431392 - 65431436, 45 bps 
B D                Human  tttgttctataatctgtatctaacaattgcaatatctttttcctt-
B D                Chimp  tttgttctataatctgtatctaacaatttcagtatcttttttctt-
B D            Orangutan  tttgttctat-atctgtatctaacaattgcaatatc-ttttcctt-
B D               Gibbon  tttgttctataatctgtatctaacaatttcagtatcttttttctt-
B D               Rhesus  tttgttctataatctgtatctaacaatttcagtatcttttttctt-
B D  Crab-eating macaque  tttgttctataatctgtatctaacaatttcagtatcttttttctt-
B D         Green monkey  tttgttctataatctgtatctaacaatttcaatatcttttttctt-
B D      Squirrel monkey  tttgttctataatctgcatctgacaatttcaatatctttttcctt-
B D              Chicken  cgtgtcct-tgacatgtccttaac-gtgccagcaac-atgtcctta
B D               Baboon  ==============================================
B D              Gorilla  ==============================================

Alignment block 100 of 629 in window, 65431437 - 65431499, 63 bps 
B D                Human  aggtagctagaac---tcttttgtatttcctggttcctagttgaccctttcttataatgtc-ttacc---
B D                Chimp  aggtagctagaac---tcttttgtatttccttgttcctagttgaccctctcttataatgtc-ttacc---
B D            Orangutan  aggtagctagaac---tcttttgtatttccttgttcctagttgaccctttcttataatgtc-tta-c---
B D               Gibbon  aggtagctagaac---tcttttgtatttccttgttcctagttgtccctcccttataatgtc-ttacc---
B D               Rhesus  aggtagctagaac---tcttttgtatttccttgttcctagttgaccctcccttataatgtc-ttacc---
B D  Crab-eating macaque  aggtagctagaac---tcttttgtatttccttgttcctagttgaccctcccttataatgtc-ttacc---
B D         Green monkey  aggtagctagaac---tcttttgtatttccttgttcctagttgaccctcccttataatgtc-ttacc---
B D             Marmoset  aggtagccagaat---tcttttgtatttatttgtccctagttgaccctcccttataatgtt-ttatt---
B D      Squirrel monkey  aggtagctagaat---tcttttgtatttctttgtccctagttgacactcccttataatgat-ttatt---
B D              Chicken  gcgtgtccttaacatgtccttaccctttacttgtcc----ttaacatgtccttagcatgtcactaacatg
B D               Baboon  ======================================================================
B D              Gorilla  ======================================================================

                   Human  ---
                   Chimp  ---
               Orangutan  ---
                  Gibbon  ---
                  Rhesus  ---
     Crab-eating macaque  ---
            Green monkey  ---
                Marmoset  ---
         Squirrel monkey  ---
                 Chicken  ccc
                  Baboon  ===
                 Gorilla  ===

Alignment block 101 of 629 in window, 65431500 - 65431556, 57 bps 
B D                Human  ttcttgtgtaa--------ttttaattgtgagctcatt-a----ttgatcttaaac-tgtgggggtccca
B D                Chimp  ttcttgtgtaa--------ttttaattgtgagctcattga----ttgatattaaac-tgtgggggtccca
B D            Orangutan  ttcttgtgtaa--------ttttaattgtgagctcattaa----ctgatcttaaac-tgtgggggtgcca
B D               Gibbon  ttcttgtgtaa--------ttttaattgtgagctcattga----ctgatattaaac-tgtgggggtccca
B D               Rhesus  ttcttgtgtaa--------ttttaattgtgagctcattga----ttgatcttaaac-tgtgggggtccaa
B D  Crab-eating macaque  ttcttgtgtaa--------ttttaattgtgagctcattga----ttgatcttaaac-tgtgggggtccaa
B D         Green monkey  ttcttgtgtaa--------ttttaattgtgagctcattga----ttgatcttaaac-tgtgggggtccaa
B D             Marmoset  ttcttgtgtaa--------ttttaattgtgagctcactga----ttgatcttaaac-tataggggttcca
B D      Squirrel monkey  ttcttgtgtaa--------ttttaattgtgagctcattta----ctgatcttaaac-tatagggattcca
B D             Squirrel  tttctacatca--------ttttaattgtaagctcattgactgcttgcccttaaac-tgtggaagtccca
        Brush-tailed rat  ttcctatgtaa--------ttttaattgaaaactctctga----ttaatcttaagc-tctgatgatccca
B D              Chicken  ttagcgtgtcactaacatgtccttagcgtg---tcactaa----cacatccttaacatatccctccccca
B D               Baboon  ======================================================================
B D              Gorilla  ======================================================================

                   Human  t
                   Chimp  t
               Orangutan  t
                  Gibbon  t
                  Rhesus  t
     Crab-eating macaque  t
            Green monkey  t
                Marmoset  t
         Squirrel monkey  t
                Squirrel  t
        Brush-tailed rat  t
                 Chicken  t
                  Baboon  =
                 Gorilla  =

Inserts between block 101 and 102 in window
B D             Chicken 14bp

Alignment block 102 of 629 in window, 65431557 - 65431578, 22 bps 
B D                Human  ggatctaaatttgggaaacttt
B D                Chimp  ggttctaaatttgggaaacttt
B D            Orangutan  ggatctaaatttgggaaacttt
B D               Gibbon  ggatctaaatttgggaaacttt
B D               Rhesus  ggatttaaatttggaaaagttt
B D  Crab-eating macaque  gaatttaaatttggaaaagttt
B D         Green monkey  ggatctaaatttggaaaacttt
B D             Marmoset  ggatctaaatttgggaaacttt
B D      Squirrel monkey  ggatctaaattagggaaacttt
B D             Squirrel  aggcataaatttgggaaacttt
        Brush-tailed rat  ggatctaaatggggggaacttt
B D              Chicken  ======================
B D               Baboon  ======================
B D              Gorilla  ======================

Alignment block 103 of 629 in window, 65431579 - 65431583, 5 bps 
B D                Human  tctct
B D            Orangutan  tctat
B D               Rhesus  tctct
B D  Crab-eating macaque  tctct
B D               Baboon  tctct
B D         Green monkey  tctct
B D             Marmoset  tctct
B D      Squirrel monkey  tctct
B D             Squirrel  tctcc
        Brush-tailed rat  tctcc
B D              Chicken  =====
B D               Gibbon  -----
B D              Gorilla  =====
B D                Chimp  -----

Inserts between block 103 and 104 in window
B D              Baboon 662bp

Alignment block 104 of 629 in window, 65431584 - 65431591, 8 bps 
B D                Human  ggagtgga
B D                Chimp  ggagtaga
B D            Orangutan  ggagtgga
B D               Gibbon  ggagtaga
B D               Rhesus  ggagtgga
B D  Crab-eating macaque  ggagtgga
B D         Green monkey  ggagtgga
B D             Marmoset  ggagtgga
B D      Squirrel monkey  ggagtgga
B D             Squirrel  tgagaaga
        Brush-tailed rat  taagacgg
B D              Chicken  ========
B D               Baboon  ========
B D              Gorilla  ========

Alignment block 105 of 629 in window, 65431592 - 65431654, 63 bps 
B D                Human  tatgattatccttctgcatgtggtcattggacactattctctcagaacaattcagccca------ttgg
B D                Chimp  tatgattatccttctgcatgtggtcattgggcactattctcccagaacaattcagccca------ttgg
B D            Orangutan  tatgattatccttctgcatgtggtcattggacactattctctcagaacaattcagccca------ttgg
B D               Gibbon  tatgattatccttctgcatgtggtcattgggcactattctcccagaacaattcagccca------ttgg
B D               Rhesus  tatgattatccttctgcatgtggtcattgggcactattctcccagaacaattcagccca------ttgg
B D  Crab-eating macaque  tatgattatccttctgcatgtggtcattgggcactattctcccagaacaattcagccca------ttgg
B D         Green monkey  tatgattatccttctgcatgtggtcattgggcactattctcccagaacaattcagccca------ttgg
B D             Marmoset  tattattatccttctgcatatggtcattgggcactattttcccagaacaattcagccca------ttgg
B D      Squirrel monkey  tatgattatccttctgcatatggtcactgggcactattttcccagaacaattcagccca------ctgg
B D             Squirrel  tatgattcttcttgtacatgtagttataaggcaccaaagccccagaaca---------a------ttgg
        Brush-tailed rat  tgtgtatctccttgt-tatatagtcatgggaccttattctcttagaacaagacagccca------ttgg
B D              Chicken  tataaggaccc-----cctgcgacctttagggaccctttt--gggggcagttcaccccgtgacctttg-
B D               Baboon  =====================================================================
B D              Gorilla  =====================================================================

Inserts between block 105 and 106 in window
B D            Squirrel 5bp
       Brush-tailed rat 115bp

Alignment block 106 of 629 in window, 65431655 - 65431899, 245 bps 
B D                Human  atctcag----gtgaaagaatgccaggctcaaacttttctacttgcactggcc-aaggcttagtatcccg
B D                Chimp  atctcagctcagttaaagaattccaggctcaaacttttctacttgcactggcc-aaggcttagtatcctg
B D            Orangutan  atctcagctcagttaaagaatgccaggctcaaacttttctacttgcactggcc-aaggcttagtatcccg
B D               Gibbon  atctcagctcagttaaagaattccaggctcaaacttttctgcttgcactggcc-aaggcttagtatcctg
B D               Rhesus  atctcagctcagttaaagaatttcaggctcaaacttttctacttgcgctggcc-aaggcttagtatccta
B D  Crab-eating macaque  atctcagctcagttaaagaatttcaggctcaaacttttctacttgcgctggcc-aaggcttagtatcctg
B D         Green monkey  atctcagctcagttaaagaatttcaggctcaaacttttctacttgc-ctggcc-aaggcttagtatcctg
B D             Marmoset  atctcagctcacttaaag-attccaggctcaaacttttctacttgcactggcc-aaggcttaatatcctg
B D      Squirrel monkey  atctcagctcacttaaaa-attccaggctcaaacttttctacttgcactggcc-aagacttaatatcctg
B D             Squirrel  -----aactgagctgaagtgattcaggctcaaatgtctctacttgccttgaccgaagacttagtatcctg
        Brush-tailed rat  -----attttagttgaaaaattccaggctcaaacatctccccttgctcttgcccaaagtttagcagggag
B D              Chicken  -----acctttggcgacgccacccctccccctccccccccccctcctccaccc-a---------------
B D               Baboon  ======================================================================
B D              Gorilla  ======================================================================

                   Human  atcacagt-gctgctgcagctatcttctctagtggggat------------------gctataaatcctg
                   Chimp  atcacagt-gctgctgtagctatcttctctaccggaaat------------------gccataaatcctg
               Orangutan  atcacagt-gctgctgcagctatcttctctagtggggat------------------gctataaatcctg
                  Gibbon  atcacagt-gctgctgtagctatcttctctgccggaaat------------------gccataaatcctg
                  Rhesus  atcacagt-tctgctgtagctatcttctctaccaggaat------------------gccataaatcctg
     Crab-eating macaque  atcacagt-tctgctgtagctatcttctctaccaggaat------------------gccataaatcctg
            Green monkey  atcacagt-gctgctgtagctatcttctctaccaggaat------------------gccataaatcctg
                Marmoset  atcgcagt-gctgctgtagctatcttctctactgaaaat------------------gccataaatcctg
         Squirrel monkey  atcacagt-gctgctgtagctatcttctctactggaaat------------------gccataaatcctg
                Squirrel  atagccagtgctgcttcagtcagcttctctaaggacaat------------------gtctctcatcctg
        Brush-tailed rat  aaagcaaa-gctgatttgactgccttccctcagaaagca------------------gccacccatcatg
                 Chicken  --cgcagt-tttgggg------tcttttttgggggaggtgggggggcaaaaagggccgatttggggccgg
                  Baboon  ======================================================================
                 Gorilla  ======================================================================

                   Human  gatgtc---catcgctcaggcccacgttcccagttcctttgtataatctattggctaatctaccaa-cat
                   Chimp  gatgtc---catcactcaggcccaagttcccagttcctttgaataatctattggctaatctaccaattat
               Orangutan  gatgtc---catcgctcaggcccaagttcccagttcctttgtataatgtattggctaatctaccaa-cat
                  Gibbon  gatgtc---catcactcaggcccaagttcccagttcctctgaataatctattggctaatctaccaattat
                  Rhesus  gatgtc---catcactcaggtccaagttcccagttcctttgaataatctattggctaatctaccaattat
     Crab-eating macaque  gatgtc---catcactcaggtccaagttcccagttcctttgaataatctattggctaatctaccaattat
            Green monkey  gatgtc---catcactcaggtccaagttcccagttcctttgaataatctattggctaatctaccaattat
                Marmoset  gatgtcattcatcactcaggcccaagttaccagttcctttgtgtaatctattggttaatctagcaattat
         Squirrel monkey  gatgtcattcattactcaggctcaagttcccagttcctttgtgtaatctattggttaatctagcaattat
                Squirrel  ggttct---catcactcaggccccagatcctaattcatc--tgtaatctgttgacaaattcaccaattgt
        Brush-tailed rat  ggcatg---caacacacagg-tccagtgcttgtctcttttgtgtattctgtgggctaatctaccaaccca
                 Chicken  gatttc---cttttctt---------tttccttttctttttccttttctttttccttttcc----ttttt
                  Baboon  ======================================================================
                 Gorilla  ======================================================================

                   Human  g-ttttggtttttattcta-----ttgtgtttttcatttc----tgtatgctctatgtgcttctttttca
                   Chimp  g-ttttagttttgattcta-----ttgtgtttttcatttc----tatatgctctatgtgcttctttttca
               Orangutan  g-ttttagcttttattcta-----atgtgtttttcatttc----tgtatgctctatgtgcttctttttca
                  Gibbon  c-ttttagttttgattcta-----ttgtgtttttcatttc----tatatgctctatgtgcttctttttca
                  Rhesus  g--tttagttttgattcta-----ttgtgtttttcatt-------------tctatgtgcttctttttca
     Crab-eating macaque  g--tttagttttgattcta-----ttgtgtttttcatt-------------tctatgtgcttctttttca
            Green monkey  g--tttagttttgattcta-----ttgtgtttttcatt-------------tctatgtgcttctttttca
                Marmoset  g-ttttagtttttattcta-----ttgtgtttttcatttc----tatatgctctatgtgca--tttttca
         Squirrel monkey  g-ttttagtttttattcta-----ttgtgtttttcatttc----tatatgctctatgtgct--tttttca
                Squirrel  gattttagttttgattcta-----ttatctttttcatgcc----tctatagtatacatgattctttttca
        Brush-tailed rat  aggtttagttttgattctgctggttttattttttcatatc-tgttatatgttctatgtgattctttttga
                 Chicken  c-cttttccttttttcctt-----ttctttttcccttttcctttttccttttccttttccttttttcct-
                  Baboon  ======================================================================
                 Gorilla  ======================================================================

                   Human  aat
                   Chimp  aat
               Orangutan  aat
                  Gibbon  aat
                  Rhesus  aat
     Crab-eating macaque  aat
            Green monkey  aat
                Marmoset  aat
         Squirrel monkey  aa-
                Squirrel  aat
        Brush-tailed rat  aat
                 Chicken  ---
                  Baboon  ===
                 Gorilla  ===

Inserts between block 106 and 107 in window
B D Crab-eating macaque 331bp

Alignment block 107 of 629 in window, 65431900 - 65431912, 13 bps 
B D                Human  ct-gtttatttcct
B D                Chimp  ct-gtttatttcct
B D            Orangutan  ct-gtttatttcct
B D               Gibbon  ct-gtttatttcct
B D               Rhesus  ct-gtttatttcct
B D  Crab-eating macaque  ct-gtttatttcct
B D         Green monkey  ct-gtttatttcct
B D             Marmoset  ct-gtttatttcct
B D      Squirrel monkey  -t-gtttatttcct
B D             Squirrel  -tactttacactcc
        Brush-tailed rat  -c-tgttatgtcct
B D              Chicken  tt-tcctttttcct
B D               Baboon  ==============
B D              Gorilla  ==============

Inserts between block 107 and 108 in window
B D        Green monkey 3878bp

Alignment block 108 of 629 in window, 65431913 - 65431913, 1 bps 
B D                Human  t
B D                Chimp  t
B D            Orangutan  t
B D               Gibbon  t
B D               Rhesus  t
B D  Crab-eating macaque  t
B D         Green monkey  t
B D             Marmoset  t
B D      Squirrel monkey  t
B D             Squirrel  t
        Brush-tailed rat  t
B D              Chicken  t
B D               Baboon  =
B D              Gorilla  =

Inserts between block 108 and 109 in window
B D     Squirrel monkey 152bp

Alignment block 109 of 629 in window, 65431914 - 65431914, 1 bps 
B D                Human  t
B D                Chimp  t
B D            Orangutan  t
B D               Gibbon  t
B D               Rhesus  t
B D  Crab-eating macaque  t
B D         Green monkey  t
B D             Marmoset  t
B D      Squirrel monkey  t
B D             Squirrel  t
        Brush-tailed rat  t
B D              Chicken  t
B D               Baboon  =
B D              Gorilla  =

Inserts between block 109 and 110 in window
B D              Rhesus 322bp

Alignment block 110 of 629 in window, 65431915 - 65431930, 16 bps 
B D                Human  caaacttttcttttta----
B D                Chimp  caaacttcttttttaa----
B D            Orangutan  -----ttatcttttta----
B D               Gibbon  caaacttctcttttta----
B D               Rhesus  caaacttctcttttta----
B D  Crab-eating macaque  caaacttctcttttta----
B D         Green monkey  caaaattctcttttta----
B D             Marmoset  caaacttctctttttt----
B D      Squirrel monkey  caaacttctctttttt----
B D             Squirrel  ---atctcttt---------
        Brush-tailed rat  caaacttcttt---------
B D              Chicken  -----tccttttttcctttt
B D               Baboon  ====================
B D              Gorilla  ====================

Alignment block 111 of 629 in window, 65431931 - 65431933, 3 bps 
B D                Human  aag
B D                Chimp  aaa
B D            Orangutan  aag
B D               Gibbon  aaa
B D               Rhesus  aaa
B D  Crab-eating macaque  aaa
B D               Baboon  aaa
B D         Green monkey  aaa
B D             Marmoset  aaa
B D      Squirrel monkey  aaa
B D             Squirrel  -a-
        Brush-tailed rat  ga-
B D              Chicken  ---
B D              Gorilla  ===

Inserts between block 111 and 112 in window
B D              Baboon 87bp

Alignment block 112 of 629 in window, 65431934 - 65431937, 4 bps 
B D                Human  ataa
B D                Chimp  ataa
B D            Orangutan  ataa
B D               Gibbon  ataa
B D               Rhesus  ataa
B D  Crab-eating macaque  ataa
B D         Green monkey  ataa
B D             Marmoset  ataa
B D      Squirrel monkey  ataa
B D             Squirrel  -taa
        Brush-tailed rat  -aaa
B D              Chicken  ----
B D               Baboon  ====
B D              Gorilla  ====

Inserts between block 112 and 113 in window
B D            Marmoset 829bp
B D            Squirrel 1bp
       Brush-tailed rat 1bp

Alignment block 113 of 629 in window, 65431938 - 65431993, 56 bps 
B D                Human  ataaaacattttcaattgttcccctttccctttctttccccaggcccctgacattt
B D                Chimp  ataaaacattttcaactgtcccccttttcctttctttccccaggcccctgacattt
B D            Orangutan  ataaaacattttcaatggttcccctttccctttctttccccaggcccctgacattt
B D               Gibbon  ataaaacattttcaattatccccctttgcctttctttccccaggcccctgacattt
B D               Rhesus  ataaaacattttcaattgtcccccttttcctttctttccccaggtccctcacattt
B D  Crab-eating macaque  ataaaacattttcaattgtcccccttttcctttctttccccaggtccctcacattt
B D         Green monkey  ataaaacattttcaa-tgtcccccttttcctttctttccccaggtccctgacattt
B D             Marmoset  ataaaatattttcaactgttcccctttccctttctttccccaggtccctgacattt
B D      Squirrel monkey  ataaaatattttcaactgtccccctttcccttcctttccccaggtccctgacattt
B D             Squirrel  ttaaaataatttcaagtgtgttctctttcatttctgtaactaggcccccaacatct
        Brush-tailed rat  ataaaatattctcaagtgtgttgtcttctctctctttcccttggcctccaacatct
B D              Chicken  ------ccttttcctttttctttttctttttcccttttccttttcccttttccttt
B D               Baboon  ========================================================
B D              Gorilla  ========================================================

Alignment block 114 of 629 in window, 65431994 - 65432008, 15 bps 
B D                Human  attacggcagctttt
B D                Chimp  attatgacagctttt
B D            Orangutan  attatggcagctttt
B D               Gibbon  attatgacagctttt
B D               Rhesus  attatgacagttttt
B D  Crab-eating macaque  attatgacagttttt
B D         Green monkey  attatgacagttttt
B D             Marmoset  attatggcagctttt
B D      Squirrel monkey  attatggcagctttt
B D             Squirrel  gttacaatagttttc
        Brush-tailed rat  attacagtagtttt-
B D               Baboon  ===============
B D              Gorilla  ===============

Inserts between block 114 and 115 in window
B D              Rhesus 2bp
B D Crab-eating macaque 2bp
B D        Green monkey 1bp

Alignment block 115 of 629 in window, 65432009 - 65432009, 1 bps 
B D                Human  t
B D                Chimp  t
B D            Orangutan  t
B D               Gibbon  t
B D         Green monkey  t
B D             Marmoset  t
B D      Squirrel monkey  t
B D             Squirrel  t
        Brush-tailed rat  t
B D  Crab-eating macaque  =
B D               Rhesus  =
B D               Baboon  =
B D              Gorilla  =

Alignment block 116 of 629 in window, 65432010 - 65432019, 10 bps 
B D                Human  aaccagtctc
B D                Chimp  aaccagtct-
B D            Orangutan  aactgatctc
B D               Gibbon  aaccagtctc
B D               Rhesus  aaccagtctc
B D  Crab-eating macaque  aaccagtctc
B D         Green monkey  aaccagtctc
B D             Marmoset  aaccagtctc
B D      Squirrel monkey  aaccagtctc
B D             Squirrel  aactggtctc
        Brush-tailed rat  agtgtgtctc
B D               Baboon  ==========
B D              Gorilla  ==========

Alignment block 117 of 629 in window, 65432020 - 65432020, 1 bps 
B D                Human  c
B D                Chimp  c
B D            Orangutan  c
B D               Gibbon  c
B D               Rhesus  c
B D  Crab-eating macaque  c
B D               Baboon  t
B D         Green monkey  c
B D             Marmoset  c
B D      Squirrel monkey  c
B D             Squirrel  c
        Brush-tailed rat  c
B D              Gorilla  =

Inserts between block 117 and 118 in window
B D              Baboon 67bp

Alignment block 118 of 629 in window, 65432021 - 65432021, 1 bps 
B D                Human  c
B D                Chimp  c
B D              Gorilla  c
B D            Orangutan  c
B D               Gibbon  c
B D               Rhesus  c
B D  Crab-eating macaque  c
B D         Green monkey  c
B D             Marmoset  t
B D      Squirrel monkey  c
B D             Squirrel  c
        Brush-tailed rat  c
B D               Baboon  =

Inserts between block 118 and 119 in window
B D             Gorilla 37764bp

Alignment block 119 of 629 in window, 65432022 - 65432083, 62 bps 
B D                Human  tatttatatgttcaaggaatgaccagtggaaaataaga---------------taggtaagataggttgt
B D                Chimp  tatttatatgttcaaggaatgactagtggaaaataaga---------------caggtaagataggttgt
B D            Orangutan  tatttatatgttcaaggaatggccagtggaaaataaga---------------taggtaagataggttgt
B D               Gibbon  tatttatatgttcaaggaatgactagtggaaaataaga---------------caggtaagataggttgt
B D               Rhesus  tatttatatgttcaaggaatgactaatggaaaataagt---------------taggtaagataagttgt