Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 760 in window, 150716668 - 150716754, 87 bps 
B D                     Human  ttcagagc----ctgtcac--------caggaaaggtga-------gcctgagcctgg-----g------
B D                     Chimp  ttcagagc----ctgtcac--------caggaaaggtga-------gcctgagcctgg-----g------
B D                   Gorilla  ttcagagc----ctgtcac--------caggaaaggtga-------gcctgagcctgg-----g------
B D                 Orangutan  ttcagagc----ctgtcac--------caggaaaggtga-------gcctgagcctgg-----g------
B D                    Gibbon  ttcagagc----ctgtcac--------caggaaaggtga-------gcctgagcctgg-----g------
B D                    Rhesus  ttcagagc----ctgtcac--------caggaaaggtga-------gccagagcctgg-----g------
B D       Crab-eating macaque  ttcagagc----ctgtcac--------caggaaaggtga-------gccagagcctgg-----g------
B D                    Baboon  ttcagagc----ctgtcac--------caggaaaggtga-------gccagagcctgg-----g------
B D              Green monkey  ttcagagc----ctgtcac--------caggaaaggtga-------gcctgagcctgg-----g------
B D                  Marmoset  ttcagagc----ctgtcac--------caggaaaggtgagtggtgggcctgagcctgg-----g------
B D           Squirrel monkey  ttcagagc----ctgtcac--------cgggaaaggtgagcggtgagtctgagcctgg-----g------
B D                  Bushbaby  ttcagagc----ctgtcac--------caggaagggtga-------gtctgagcctgg-----a------
           Chinese tree shrew  gtcagaac----ctgtcac--------cacgaaaggtga-------gcctgagcctgg-----g------
B D                  Squirrel  tccagagc----ctgtcac--------caggaaaggtga-------gcctaagtcta------g------
                 Prairie vole  tttaaagt----ctgtcac--------caagaaaggtga-------gcttgagcctgt-----g------
B D           Chinese hamster  ttcagagt----ctgtcac--------caagaaaggtga-------gcctgagcctgt-----g------
B D                     Mouse  ttcaggga----ctgtcag--------caagaaaggtga-------gcctgaggctgt-----g------
B D                       Rat  atcagaga----ctttcag--------caagaaaggtga-------gcctgaggcatt-----g------
B D            Naked mole-rat  ttcacagc----ctgtcaa--------caggaaaggtga-------gcgggagccagg-----g------
B D                Guinea pig  ttcagagc----atgtcac--------cagaaaaggtga-------gtgggagcctgg-----gagccgg
                   Chinchilla  ttcagagc----ctgtcac--------caggaaaggtga-------gcgggagcctgg-----g------
             Brush-tailed rat  ttcagaac----ctgtcac--------caggaaaggtga-------gcggaagcctgg-----g------
B D                    Rabbit  tccaggac----tcgtctc--------cgggaaaggtga-------gcctgatccagg-----g------
B D                      Pika  tccagagc----ctgtcac--------cagggaaggtga-------gcctgttccagg-----g------
B D                    Alpaca  attagagc----ctgtcac--------caggaa------------------------------a------
               Bactrian camel  gttagagc----ctgtcac--------caggaa------------------------------a------
B D                   Dolphin  gttagagc----ctgtcgccaatcctgcaggaacggtga-------gcacaaa---ggaaaagg------
                 Killer whale  gttagagc----ctgttgccaatcctgcaggaacggtga-------gcccaag---ggaaaagg------
             Tibetan antelope  gttagagc----ctgtcaccaattctgcaggaaaggtga-------gtgtaag---gggaaggg------
B D                       Cow  gtgagagc----ctgtcac--------caggaaaggt--------------------------g------
B D                     Sheep  gtgagagc----ctgtcac--------caggaaaggc--------------------------g------
B D                     Horse  atctgagc----ctgtcac--------caggaaaggtga-------gcccaaa--ctgggaggg------
B D          White rhinoceros  ctcagagc----ccgtcaccaactctgcagcaaaggtga-------gcccaag---ggaaaggg------
B D                       Dog  atcacagc----ctgttactgctgctgcagaaaaggaga-------gcctgta--ggggaaggg------
                 Weddell seal  a--------------------ctgctgtgggaaaggtga-------gcccaca--ggggaaggg------
             Black flying-fox  gtcacagcccgtctgtcacccgctctgcaggaaaggtga-------gctcaggcatggggaggg------
B D                   Megabat  gtcacagcccgtctgtcacccgctctgcaggaaaggtga-------gctcaggcatggggaggg------
                Big brown bat  ctcagagc----ctgtcactgattctgcaggaaaggtga-------gtaccagcagggaaaggg------
B D                  Microbat  ctcagagc----ctgtcactgattctgtaggaaaggtga-------gggccagcaggggaaggg------
              Star-nosed mole  ------------ctgtccc---------aggaaaggtga-------tcccagg--gggcgaggg------
               Domestic goat  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                   Ferret   ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
    Mexican tetra (cavefish)  ======================================================================

                        Human  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
                        Chimp  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
                      Gorilla  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
                    Orangutan  -a---------g-tg-gt-------g---ggggctg----------------gg----------------
                       Gibbon  -a---------g-tg-gc-------g---gggactg----------------gg----------------
                       Rhesus  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
          Crab-eating macaque  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
                       Baboon  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
                 Green monkey  -a---------g-tg-gc-------g---ggggctg----------------gg----------------
                     Marmoset  -t---------gctg-gc-------g---ggagctg----------------gg----------------
              Squirrel monkey  -a---------gctg-gt-------g---ggagctg----------------gg----------------
                     Bushbaby  -a---------gctg-gctggggatg---ggagctg----------------ag----------------
           Chinese tree shrew  -a---------gctg-ga-------ggt-ggggccg----------------ggcagtaggtagtgggga
                     Squirrel  -a---------gctg-ga-------g---ggag--g----------------aa----------------
                 Prairie vole  -a---------gc-a-gg-------g---tgga--g----------------ag----------------
              Chinese hamster  -a---------gctg-gg-------g---ttaa--g----------------ag----------------
                        Mouse  -a---------gctg-gg-------g---tgga--g----------------ag----------------
                          Rat  -a---------gttt-gg-------g---tgga--g----------------ag----------------
               Naked mole-rat  -a---------gctg-gg------ag---ccgg--g----------------tg----------------
                   Guinea pig  ca---------gctg-gg------ag---ctgg--g----------------tg----------------
                   Chinchilla  -a---------tctg-gg------ag---ctgg--g----------------tg----------------
             Brush-tailed rat  -a---------gctg-gg------ag---ctgg--g----------------tg----------------
                       Rabbit  -aagggaggtggctg-gg-------ggcttggg--gctggaactagtacagcag----------------
                         Pika  -aagggagcacacca-gg-------g---tggg--g--------------gtag----------------
                       Alpaca  -a---------gcca-gc------ct---gagc--a----------------ga----------------
               Bactrian camel  -a---------gcca-gc------ct---gagc--a----------------ga----------------
                      Dolphin  -a---------acca--g------cc---cgga--g----------------ca----------------
                 Killer whale  -a---------acca--g------cc---cgga--g----------------ca----------------
             Tibetan antelope  -a---------gtca-gt------ct---ggga--g----------------ta----------------
                          Cow  -a---------gccc-cg------ca---ggga--g----------------ca----------------
                        Sheep  -a---------gccc-cg------ca---ggga--g----------------ca----------------
                        Horse  -a---------gctg-gc------tg---gtga--g----------------tg----------------
             White rhinoceros  -a---------ccca-gc------cg---ggga--g----------------ta----------------
                          Dog  -g---------gtctccc------cg---agca--g----------------tg----------------
                 Weddell seal  -g---------gccg-cc------gg---agct--g----------------tg----------------
             Black flying-fox  -a---------gccg-gc------cg---ggga--a----------------gc----------------
                      Megabat  -a---------gccg-gc------cg---ggga--a----------------gc----------------
                Big brown bat  -a---------gcca-gc------ag---caaa--g----------------ta----------------
                     Microbat  -a---------gcca-gc------cg---caaa--g----------------ta----------------
              Star-nosed mole  -a---------gctg-------------------------------------------------------
                Domestic goat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
     Mexican tetra (cavefish)  ======================================================================

                        Human  g---gtgct--------ctgag-aaccagaaa------gaacatgat-t-c
                        Chimp  g---gtgct--------ctgag-aaccagaaa------gaacatgat-t-c
                      Gorilla  g---gtgct--------ctgag-aaccagaaa------gaacatgat-t-c
                    Orangutan  g---gtgct--------ctgag-aaccagaaa------gaacatgat-t-c
                       Gibbon  g---gcgct--------ctgag-aaccagaaa------gaacatgat-t-c
                       Rhesus  g---gtgct--------ctgag-aaccagaaa------gaacgtgat-t-c
          Crab-eating macaque  g---gtgct--------ctgag-aaccagaaa------gaacgtgat-t-c
                       Baboon  g---gtgct--------ctgag-aaccagaaa------gaacgtgat-t-c
                 Green monkey  g---gtcct--------ctgag-aaccagaaa------gaacgtgat-t-c
                     Marmoset  t---gtgct--------ctgaa-aaccagaaa------gaatgtgat-t-c
              Squirrel monkey  g---atgct--------ctgaa-aaccagaaa------gaatgtgat-t-c
                     Bushbaby  g---gcagtgggaaagactcag-tacctgaag------g--tgttgt-c-c
           Chinese tree shrew  g---tctct--------gtgag-aaccagagg------gaacgaggt-t-t
                     Squirrel  ggaaggact----------------------g------atccctggg-g--
                 Prairie vole  g---gggct----------------------g------ggttgtgag-a--
              Chinese hamster  g---gggct----------------------t------ggctgtgag-a--
                        Mouse  g---aagct----------------------g------ggctgtgag-a--
                          Rat  g---aggtt----------------------g------gactgtgag-a--
               Naked mole-rat  g---g-gcc--------ctgag--accagaaa------ggctgtgct-tc-
                   Guinea pig  g---gggca--------ctgag--accagaaa------ggttgtagt-tc-
                   Chinchilla  g---gcgcc--------ccaag--accagaaa------ggctgtggt-tc-
             Brush-tailed rat  g---gcgcc--------ccgag--accagaaa------ggctgtggt-cc-
                       Rabbit  g---aagcc--------gtcag--tgtctgaa------ggtgttgct-c--
                         Pika  g---aagca--------gtcag--tgcctgaa------ggtgtggtt-c--
                       Alpaca  g---gagct--------gcaaccaaccagagg------gagcataat-t-c
               Bactrian camel  g---gagct--------gcaaccaaccagagg------gagcataat-t-c
                      Dolphin  g---gacct--------gtggggaacaggaagagctctgcctgtg------
                 Killer whale  g---gacct--------gtggggaacaggaagagctctgcctgtg------
             Tibetan antelope  g---gacct--------gtgggcaacaggaaga-----gcccatg------
                          Cow  a---gagct--------acaactaaccagaag------gaacatggt-t-c
                        Sheep  g---gagct--------acaaccaaccagaag------gaacatggt-t-c
                        Horse  g---gagct--------gtgaccacccagcag------gaaagtggt-t-c
             White rhinoceros  g---gacct--------gtg----------ag------gaatttggtgc-c
                          Dog  g---gagct--------gtgaccaaccagcag------gaacatggt-t-c
                 Weddell seal  g---gagct--------gtgacccaccagcag------gaacatggt-t-c
             Black flying-fox  g---gagct--------acgaggagcctgaag------gaatgtcat-t-c
                      Megabat  g---gagct--------acgaggagcctgaag------gaatgtcat-t-c
                Big brown bat  g---gagct--------gtgaggaccaggaag------a------at-t-c
                     Microbat  g---gagct--------gtgaagagtggaaag------a------at-t-c
              Star-nosed mole  -------------------------ccgggag------g------gg-g-c
                Domestic goat  ===================================================
                  Zebra mbuna  ===================================================
        Burton's mouthbreeder  ===================================================
                 Nile tilapia  ===================================================
           Southern platyfish  ===================================================
          Princess of Burundi  ===================================================
                 Atlantic cod  ---------------------------------------------------
                       Lizard  ===================================================
                         Fugu  ===================================================
                       Medaka  ===================================================
                  Spotted gar  ===================================================
                    Zebrafish  ===================================================
                  Stickleback  ===================================================
                      Ferret   ===================================================
                 Mallard duck  ---------------------------------------------------
           American alligator  ===================================================
                       Turkey  ===================================================
       Spiny softshell turtle  ---------------------------------------------------
     Chinese softshell turtle  ---------------------------------------------------
               Painted turtle  ===================================================
                      Wallaby  ---------------------------------------------------
                      Opossum  ---------------------------------------------------
              Tasmanian devil  ===================================================
              Green seaturtle  ===================================================
     Mexican tetra (cavefish)  ===================================================

Inserts between block 1 and 2 in window
B D           Naked mole-rat 1bp
B D               Guinea pig 53bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 2 of 760 in window, 150716755 - 150716836, 82 bps 
B D                     Human  ctagagt-------gttta-ctgcctgaacactt----gcattctac---aaggcatcatgc--------
B D                     Chimp  ctagagt-------gtttt-ctgcctgaacactt----gcattctac---aaggcatcatgc--------
B D                   Gorilla  ctagagt-------gttta-ctgcctgaacactt----gcattctac---aagacatcatgc--------
B D                 Orangutan  ctagagt-------gttta-ctgcctgaacactt----gcatcatgc----aggcatcatgc--------
B D                    Gibbon  ctagagt-------gttta-ctgcctgaacactt----gcattctac---aaggcatcatgc--------
B D                    Rhesus  ctagagt-------gttta-ctgcctgagcactt----gcattctac---aaggcatcatgc--------
B D       Crab-eating macaque  ctagagt-------gttta-ctgcctgagcactt----gcattctac---aaggcatcatgc--------
B D                    Baboon  ctagagt-------gttta-ctgcctgagcactt----gcattctac---aaggcatcatgc--------
B D              Green monkey  ctagagt-------gttta-ctgcctgagcactt----gcattctac---aaggcatcacgc--------
B D                  Marmoset  ctagagt-------gttta-ctgcctgagcactc----gtat----------------------------
B D           Squirrel monkey  ctagggt-------gttta-ctgccggtgcactt----gcattccac---aaggcatcatgt--------
B D                  Bushbaby  taacaaa-------gctct-ctgagcaaccacct----gtgttctgctcagaggca--------------
           Chinese tree shrew  ctagagt-------gtttg-ctgcctgagcacct----gcattccac----aggcaccttgt--------
B D                  Squirrel  --agggt-------tcctg-----ctgtgctcct----g-actctac---taagcactgtgcagcccaca
                 Prairie vole  ccaaagt-------gtctg-ctgcctacacacag----gcaatttac---aaagcactatgc--------
B D           Chinese hamster  ccaaagt-------gtctg-ctgcctacacacct----gc--ttttg---caagcaccgtgc--------
B D                     Mouse  ccaaagt-------gtctg-gtacctatacacct----gcattgtac---aaagcactatgc--------
B D                       Rat  ccaaaat-------gtctgtgccctcacacactt----gtgctgtac---aaagcagtattt--------
B D            Naked mole-rat  tggagag-------ggg---------------ct----gcattctac---acagagccttgt--------
                   Chinchilla  tgcagag-------gggca-gctgcagggcacct----gcattctac---aaagtgccctgt--------
             Brush-tailed rat  tggaggg-------ggctg-ccgcctgggcactt----gcattctac---tgagtgccttgc--------
B D                    Rabbit  -aaatgg-------aactggttgagtgagcacct----ccaatctag-------------ag--------
B D                      Pika  -caatga-------ggttgactgagtgagctcct----gacaattag-------------gc--------
B D                    Alpaca  tgagagc-------attta-ctgtctgagcatct----gtattctgc---caggcaccttac--------
               Bactrian camel  tgagagc-------atttg-ctgtctgagcatct----gtgttctgc---caggcaccatac--------
B D                   Dolphin  tgaa----------gctgg-ctgagtgagcagct----gcgttctag---taagtatgtgaa--------
                 Killer whale  tgaa----------gctgg-ctgagtgagcagct----gcgttctag---taagtttgtgaa--------
             Tibetan antelope  tgaa----------actga-ctagc-gagcatgt----gcattctag---taaatatgagaa--------
B D                       Cow  tgagagc-------attta-ctgtctgagcaccc----aggctccac---caggcacctttc--------
B D                     Sheep  tgagagc-------attta-ctgtctgagcaccc----aggctccac---caggcacctttc--------
B D                     Horse  tgagagc-------gttta-ctgcctgagctcct----gcatcccac---caggcaccatgc--------
B D          White rhinoceros  tgtatga-------gctcg-ctgagggagcacct----acattgtcc---taggtacgaggc--------
B D                       Dog  tgagagt-------gttta-ttgcctgagcacct----acattccac---tgaacaccatgt--------
                 Weddell seal  t--gagt-------gttta-ctgcctgaacacct----acattccac---ccaacaccatgc--------
             Black flying-fox  tgagcgt-------gtcta-ctgcctgagcccctggtggcgctcttc---ctggcctcag----------
B D                   Megabat  tgagcgt-------gtcta-ctgcctgagcccctggtggcgctcttc---ctggcctcag----------
                Big brown bat  agtgcctgcaagaagctag-ctgagagagcacct----ccgttctac---taggtactagga--------
B D                  Microbat  agtgcctgcgagaagctca-ctgagtgaaca-ct----ccattctag---taggtaccagga--------
              Star-nosed mole  tggg------------------------------------------------------------------
               Domestic goat  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                   Ferret   ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  aggcgagcaa----gat------c----tgga----acaatcaagga---c---------atact
                        Chimp  aggcgagcaa----gat------c----tgga----acagtcaagga---c---------atact
                      Gorilla  aggcgagcaa----gat------c----tgga----acaatcaggga---c---------atgct
                    Orangutan  aggcaagcaa----gat------c----tgga----acaatcaagga---c---------atgct
                       Gibbon  aggcgagcaa----gat------c----tgga----gcaatcaagga---c---------atgct
                       Rhesus  aggtgagcaa----ttt------c----tgga----acaatcaaaga---c---------atgct
          Crab-eating macaque  aggtgagcaa----ttt------c----tgga----acaatcaaaga---c---------atgct
                       Baboon  aggtgagcaa----ttt------c----tgga----acaatcaaaga---c---------atgct
                 Green monkey  aggtgagcaa----ttt------c----tgga----acaatcaaaga---c---------atgct
                     Marmoset  --gta---aa----gat------c----tgga----acaatcaaggt---c---------atgct
              Squirrel monkey  -ggcaagcaa----gat------c----tgga----acaatcaaggt---c---------atgct
                     Bushbaby  ------------------------------ga----ataacca-------c---------ccact
           Chinese tree shrew  -ggtaagcaa----gat------t----caga----gcaatcaggat---c---------ctgct
                     Squirrel  agggccatgt----ttt------gtcactgtgcagagcagccaaggc---c---------gtgct
                 Prairie vole  aggagcatac----catgcaagcg----cacgcggtgcaggca----------------------
              Chinese hamster  agt-gcttgc----cct------g----tgtgcggcacaggcaagag---c---------aggct
                        Mouse  aggagcactccgagcga------g----cgtgcatcacaggcaaggg-------------gggct
                          Rat  aggtgcatac----tgt------g----catgcggcacaggcaaggg---a---------aggct
               Naked mole-rat  gggtgagcag----ggt------g----catg----acagtcaaggt---t---------atgct
                   Chinchilla  gggtggacag----gat------g----tgcg----acagtcaagat---c---------ctgct
             Brush-tailed rat  gggtggttag----gac------g----tgtg------agtcaagat---c---------ctgct
                       Rabbit  aggggagaag----gga------g----tgtgatctagaaggaataactgc---------atgct
                         Pika  ggaagcaagg----gga------a----tgtgatctggaaggagtaa---c---------atgct
                       Alpaca  cggtaagtga----gag------c----caga----gccgtgaagat---c---------agact
               Bactrian camel  cggtaagtga----gag------c----caga----gccgtgaaggt---c---------agact
                      Dolphin  aggggggcag----gat------c----taga----aacggtaactt---c---------atgtg
                 Killer whale  aagggggcag----gat------c----taga----aacggtaactt---c---------atgtg
             Tibetan antelope  agggaagcaa----gac------c----taga----gacagtaactt---c---------gcatg
                          Cow  gggtgagtaa----cag------c----tgga----ctcattaagat---g---------gggca
                        Sheep  aggtgagtaa----cag------c----cggc----cccagtaagat---g---------gggtg
                        Horse  gggtgagtaa----gag------c----ctga----gcacccaggat---g---------atgct
             White rhinoceros  ggg-----------gag------c-------a----gcacctagaaa---gagtaacttcacact
                          Dog  gggtgagtaa----gag------g----caga----gcaatcaagat---c---------atgct
                 Weddell seal  aggtgaacaa----gag------g----caga----gcagtcaagat---c---------tcgcc
             Black flying-fox  ---------c----ggt------c----aaga--------------t---c---------acgct
                      Megabat  ---------c----ggt------c----aaga--------------t---c---------acgct
                Big brown bat  aggagagtgg----gat------c----taga----aagactaactt---c---------atact
                     Microbat  aggggagcag----gat------c----taga----aggagtaactc---c---------acact
              Star-nosed mole  --------------------------------------------------c---------ctgct
                Domestic goat  =================================================================
                  Zebra mbuna  =================================================================
        Burton's mouthbreeder  =================================================================
                 Nile tilapia  =================================================================
           Southern platyfish  =================================================================
          Princess of Burundi  =================================================================
                 Atlantic cod  -----------------------------------------------------------------
                       Lizard  =================================================================
                         Fugu  =================================================================
                       Medaka  =================================================================
                  Spotted gar  =================================================================
                    Zebrafish  =================================================================
                  Stickleback  =================================================================
                      Ferret   =================================================================
                 Mallard duck  -----------------------------------------------------------------
           American alligator  =================================================================
                       Turkey  =================================================================
       Spiny softshell turtle  -----------------------------------------------------------------
     Chinese softshell turtle  -----------------------------------------------------------------
               Painted turtle  =================================================================
                      Wallaby  -----------------------------------------------------------------
                      Opossum  -----------------------------------------------------------------
              Tasmanian devil  =================================================================
              Green seaturtle  =================================================================
     Mexican tetra (cavefish)  =================================================================
                   Guinea pig  =================================================================

Inserts between block 2 and 3 in window
B D                 Squirrel 19bp
                Prairie vole 17bp
B D          Chinese hamster 20bp
B D                    Mouse 19bp
B D                      Rat 18bp
B D           Naked mole-rat 23bp
                  Chinchilla 23bp
            Brush-tailed rat 23bp
B D                  Dolphin 2bp
                Killer whale 2bp

Alignment block 3 of 760 in window, 150716837 - 150716916, 80 bps 
B D                     Human  ------------------t------------------ccaggtttttaagtaggc---------------
B D                     Chimp  ------------------t------------------ccaggtttttaagtaggc---------------
B D                   Gorilla  ------------------t------------------ccaggtttttaagtaggc---------------
B D                 Orangutan  ------------------t------------------ccaggtttttaagtaggc---------------
B D                    Gibbon  ------------------t------------------ccaggtttttaagtaggc---------------
B D                    Rhesus  ------------------t------------------ccaggtttttaagtaggc---------------
B D       Crab-eating macaque  ------------------t------------------ccaggtttttaagtaggc---------------
B D                    Baboon  ------------------t------------------ccaggtttttaagtaggc---------------
B D              Green monkey  ------------------t------------------ccaggtttttaagtaggc---------------
B D                  Marmoset  ------------------t------------------ccaggtttttaagttgac---------------
B D           Squirrel monkey  ------------------t------------------ccaggtttttaagttggc---------------
B D                  Bushbaby  ------------------t------------------ccaggattttaag--gac---------------
           Chinese tree shrew  ------------------t------------------ccaggctgttagggaggttccgagtttcaaaca
B D                  Squirrel  -------------------------------------tccgaattccaaatagag---------------
                 Prairie vole  -------------------------------------tctgggtttcaacctgag---------------
B D           Chinese hamster  -------------------------------------tctggatttcaacttgag---------------
B D                     Mouse  -------------------------------------cctgggcttcgaatcga----------------
B D                       Rat  -------------------------------------cctgggtttcaacctga----------------
B D            Naked mole-rat  -------------------------------------tctgagtttcaaacagag---------------
B D                Guinea pig  -------------------------------------tcccggttt------------------------
                   Chinchilla  -------------------------------------tccgagtttcaaatagag---------------
             Brush-tailed rat  -------------------------------------ttcaagcttccaac--ag---------------
B D                    Rabbit  ------------------tccaggatgacaaagatgctcgggctttcaaacggac---------------
B D                      Pika  ------------------tccaggatgataagggtgatccaatttccaaatggac---------------
B D                    Alpaca  tccaggcttgtagagatct------------------tgtaagttttcaataaag---------------
               Bactrian camel  tccaggcttgtagagatct------------------tataagttttcaataaag---------------
B D                   Dolphin  tctaggtttgtaaggttgt------------------tctgagtgtcaaacacag---------------
                 Killer whale  tctaggtttgtaaggttgt------------------tctgagtgtcaaacacag---------------
             Tibetan antelope  tttaggttagtaaggatgt------------------tttgagtgtcaaatagag---------------
B D                       Cow  tctggatttgtaaagatgt------------------tcaaagtttccaatacag---------------
B D                     Sheep  tccggatttgtaaagatgt------------------cccaagttt-caatagag---------------
B D                     Horse  tccagg--tttaaagatgt------------------cccgagttt-tgagagag---------------
B D          White rhinoceros  tccaggtttttaaggatgt------------------tctgagtttccaatagag---------------
B D                       Dog  tccaggtttttaaagatgt------------------tctgagtttcaaatagtg---------------
                 Weddell seal  tccaggcgtttaaagatgt------------------gctgagtttcaaattgag---------------
             Black flying-fox  -ccaggtttttaaagatgt------------------tctgagttttgaatagag---------------
B D                   Megabat  -ccaggtttttaaacatgt------------------tctgagttttgaatagag---------------
                Big brown bat  cccaggtgtgtaaggatg-------------------cctgagtttcacacacag---------------
B D                  Microbat  cccgggtgcatcaggatg-------------------cctgagtttcacacacag---------------
              Star-nosed mole  tccaggtcctca--gaagg------------------tccggggtccaaggagag---------------
               Domestic goat  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
B D                   Ferret   ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
    Mexican tetra (cavefish)  ======================================================================

                        Human  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacacgttcttgg---
                        Chimp  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacacgttcttgg---
                      Gorilla  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcatacacattcttgg---
                    Orangutan  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacatgttcttgg---
                       Gibbon  ---aaagttcagaggaaa-tttta--ggatcat-cttccccagct-ctggagcacacacgttgttgg---
                       Rhesus  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacatgttcttgg---
          Crab-eating macaque  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacacgttcttgg---
                       Baboon  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacacgttcttgg---
                 Green monkey  ---aaagttcagaggaaa-tttta--ggatcat-cttctccagct-ctggagcacacacgttcttgg---
                     Marmoset  ---aaagttcagaggaaa-tttta--gcagcat-cttctccagct-ctggagcacgcaggttcttga---
              Squirrel monkey  ---aaagtccagaggaaa-tttta--gtagcgc-cttctccagct-ctggagaacatacgttcttgg---
                     Bushbaby  ---attat------gagt-ttctaatggagcaa-gtttgccagct-ccagagcacacacattcttac---
           Chinese tree shrew  gagcaagctcaagggaag-ttttaa-ggagtgt-cttcttcaggt-ctggagcacaca----cttgt---
                     Squirrel  ---caagttcagagaagg-ttggg--g-agcat-cttcccc--------aagcacacacattatgggaat
                 Prairie vole  ---caagttcagaggaag-tctta--g----------------------gagtacacagatttt------
              Chinese hamster  ---catgttcagaggaag-tttta--g----------------------gagtacacacattct------
                        Mouse  ---caagtttggaggaag-tctta--g----------------------gagttcacacatctt------
                          Rat  ---caagtttggaggaag-tctta--g----------------------gagtacatacatcct------
               Naked mole-rat  ---caagttcagaggaag-tgttg--ggagcat-cttccct--------gagcacacacattcatgt---
                   Guinea pig  ---caagttcagaggaag-tctta--ggagcat-cttccct--------gaacacacgtgttctggg---
                   Chinchilla  ---caagttcagaggaag-tttta--ggagcat-cttccct--------gagcacacatgttctcca---
             Brush-tailed rat  ---caagttcagaggaag-tctta--ggagcat-cttccct--------gagcacacgcattcttga---
                       Rabbit  ---tagatttggaagaag-tggta--a--gcat-tttcaccggct-ctggaatgcacacatccttact--
                         Pika  ---tagatttggaaggaa-tggta--a--acat-tttcacctact-ctggaaaggacac-tccttatt--
                       Alpaca  ---gaagttcagaagaag-tttta--tgagcat-attctccag-t-ctggaggggatccgttc-------
               Bactrian camel  ---gaagttc---agaag-tttta--tgagcat-cttctccag-t-ctggaggggatccgttc-------
                      Dolphin  ---taagttcagaagaac--------aggtaat-cttctcgagct-ctgcagcgcacatgctcttct---
                 Killer whale  ---taagttcagaagaac--------aggtaat-cttctcgagct-ctgcagcgcacatgctcttct---
             Tibetan antelope  ---taagttcagaagtgg--------gaagcatcactctccag-c-tcttgttgcacatgctcctgt---
                          Cow  ---gaagttcaaaaaagg--ttta--tgagcat-ggtccccag-t-ctggagggcatacat---------
                        Sheep  ---gaagttcaaaaaagg--ttta--tgagcat-ggtccccag-t-ctggagggcacacat---------
                        Horse  ---gaagtttatg---------------agtat-cttctccag-c-ctggaggatgcacattcttgt---
             White rhinoceros  ---taagttctggagaag---tgg--gaagcat-cttctccag-ctctggagggcacacagtctt-----
                          Dog  ---gaagttcaga-gaag-tctga--caagcat-cttctcccg-c-atggagggtacgcacaactgt---
                 Weddell seal  ---taagctcagaggaag-tttta--caagcat-catctcctg-c-tgggaaggcacacacacctgg---
             Black flying-fox  ---taggttctgaaaaagcttttt--tgagcac-cttctttag-c-ctggagggcatacggtctcac---
                      Megabat  ---taggttctgaaaaagcttttt--tgagcac-cttctttag-c-ctggagggcatacggtctcat---
                Big brown bat  ---cagcttcagaagcag---tgg--caagcat-ctcctccag-c-ctggatgcc---caacttctt---
                     Microbat  ---cagcttcaggatcag---tgg--taagcat-ctcctccag-c-ctagatgcc---caggctctt---
              Star-nosed mole  ---gaggtacaggggaag-cctga--ggcccct-gttctccag-c-ctgcaggcctcgcaggcctgg---
                Domestic goat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
     Mexican tetra (cavefish)  ======================================================================

                        Human  --tg
                        Chimp  --tg
                      Gorilla  --tg
                    Orangutan  --tg
                       Gibbon  --tg
                       Rhesus  --tg
          Crab-eating macaque  --tg
                       Baboon  --tg
                 Green monkey  --tg
                     Marmoset  --ta
              Squirrel monkey  --tg
                     Bushbaby  --tt
           Chinese tree shrew  --tg
                     Squirrel  tatg
                 Prairie vole  --tg
              Chinese hamster  --tg
                        Mouse  --tg
                          Rat  --tg
               Naked mole-rat  --ca
                   Guinea pig  --ca
                   Chinchilla  --ca
             Brush-tailed rat  --tg
                       Rabbit  --tt
                         Pika  --tt
                       Alpaca  ----
               Bactrian camel  ----
                      Dolphin  --tt
                 Killer whale  --tt
             Tibetan antelope  --tg
                          Cow  ----
                        Sheep  ----
                        Horse  --tt
             White rhinoceros  ----
                          Dog  --tt
                 Weddell seal  --tt
             Black flying-fox  --tt
                      Megabat  --tt
                Big brown bat  --gc
                     Microbat  --gc
              Star-nosed mole  --tg
                Domestic goat  ====
                  Zebra mbuna  ====
        Burton's mouthbreeder  ====
                 Nile tilapia  ====
           Southern platyfish  ====
          Princess of Burundi  ====
                 Atlantic cod  ----
                       Lizard  ====
                         Fugu  ====
                       Medaka  ====
                  Spotted gar  ====
                    Zebrafish  ====
                  Stickleback  ====
                      Ferret   ====
                 Mallard duck  ----
           American alligator  ====
                       Turkey  ====
       Spiny softshell turtle  ----
     Chinese softshell turtle  ----
               Painted turtle  ====
                      Wallaby  ----
                      Opossum  ----
              Tasmanian devil  ====
              Green seaturtle  ====
     Mexican tetra (cavefish)  ====

Inserts between block 3 and 4 in window
            Tibetan antelope 359bp

Alignment block 4 of 760 in window, 150716917 - 150716922, 6 bps 
B D                     Human  gggagt
B D                     Chimp  gggagt
B D                   Gorilla  gggagt
B D                 Orangutan  agaagt
B D                    Gibbon  gggagt
B D                    Rhesus  gggagt
B D       Crab-eating macaque  gggagt
B D                    Baboon  gggagt
B D              Green monkey  gggagt
B D                  Marmoset  gggagt
B D           Squirrel monkey  gggagt
B D                  Bushbaby  gagatg
           Chinese tree shrew  ggaagt
B D                  Squirrel  ggaact
                 Prairie vole  atgggc
B D           Chinese hamster  attaac
B D                     Mouse  atgaac
B D                       Rat  atgaac
B D            Naked mole-rat  gggagt
B D                Guinea pig  gggagt
                   Chinchilla  aggagg
             Brush-tailed rat  ggagtg
B D                    Rabbit  tggact
B D                      Pika  gggact
B D                   Dolphin  -gggac
                 Killer whale  -gggac
B D                     Horse  aggaac
B D          White rhinoceros  ---acc
B D                       Dog  aggggc
                 Weddell seal  agtggc
             Black flying-fox  acaagc
B D                   Megabat  acaagc
                Big brown bat  tcagat
B D                  Microbat  ttgggc
              Star-nosed mole  --gggc
               Domestic goat  ======
B D                       Cow  ------
B D                     Sheep  ------
            Tibetan antelope  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D              Nile tilapia  ======
          Southern platyfish  ======
         Princess of Burundi  ======
B D              Atlantic cod  ------
B D                    Lizard  ======
B D                      Fugu  ======
B D                    Medaka  ======
                 Spotted gar  ======
B D                 Zebrafish  ======
B D                    Alpaca  ------
B D               Stickleback  ======
B D                   Ferret   ======
              Bactrian camel  ------
  D              Mallard duck  ------
B D        American alligator  ======
B D                    Turkey  ======
  D    Spiny softshell turtle  ------
  D  Chinese softshell turtle  ------
  D            Painted turtle  ======
B D                   Wallaby  ------
B D                   Opossum  ------
B D           Tasmanian devil  ======
  D           Green seaturtle  ======
    Mexican tetra (cavefish)  ======

Inserts between block 4 and 5 in window
B D                  Dolphin 1bp
                Killer whale 1bp
             Star-nosed mole 1bp

Alignment block 5 of 760 in window, 150716923 - 150716941, 19 bps 
B D                     Human  gaaatctgtctcctcccac
B D                     Chimp  gaaacctgtctcctcccac
B D                   Gorilla  gaaacctgtctcctcccac
B D                 Orangutan  gaaacctgtctcctcccac
B D                    Gibbon  gaaacctgtctcctcccac
B D                    Rhesus  gaaacctgtctcctcccac
B D       Crab-eating macaque  gaaacctgtctcctcccac
B D                    Baboon  gaaacctgtctcctcccac
B D              Green monkey  gaaacctgtctcctcccac
B D                  Marmoset  gaaatctgtctcctcccac
B D           Squirrel monkey  gaaatctgtctcctcccat
B D                  Bushbaby  aaaccctttctcttt----
           Chinese tree shrew  gaaacctgtgtcctcccac
B D                  Squirrel  aaaacctgtctcttcccc-
                 Prairie vole  agatcttgtctcttcccaa
B D           Chinese hamster  aaaactcgtctcttcccac
B D                     Mouse  aaagcttatctcttccctc
B D                       Rat  aaaacttatctcttcccac
B D            Naked mole-rat  aagaccttcctcttctcat
B D                Guinea pig  aagaccttcctcttctcac
                   Chinchilla  aagaccttcctcttctcac
             Brush-tailed rat  aagaacttcctcttctcac
B D                    Rabbit  aaatcctttctccttccc-
B D                      Pika  aaatcctttcccttctgc-
B D                    Alpaca  -----ctgtctccttccac
               Bactrian camel  -----ctgtctccttccac
B D                   Dolphin  aaattctctctccttccct
                 Killer whale  aaattctctctccttccct
             Tibetan antelope  gaagcccctctccttccct
B D                       Cow  ---gtctgtctccttccac
B D                     Sheep  ---gtctgtctccttccac
B D                     Horse  aaacctgtcgcccctcttt
B D          White rhinoceros  aaatcctctctccttccct
B D                       Dog  aaagcctgtctccttctac
                 Weddell seal  aaaacctgt-tccttccac
             Black flying-fox  aagatctgtctccttccac
B D                   Megabat  aaaatctgtctccttccac
                Big brown bat  taagccc-tctcctaatgt
B D                  Microbat  taagccc-tctcctaacct
              Star-nosed mole  gagccctgtgttcgtcc--
               Domestic goat  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
B D              Nile tilapia  ===================
          Southern platyfish  ===================
         Princess of Burundi  ===================
B D              Atlantic cod  -------------------
B D                    Lizard  ===================
B D                      Fugu  ===================
B D                    Medaka  ===================
                 Spotted gar  ===================
B D                 Zebrafish  ===================
B D               Stickleback  ===================
B D                   Ferret   ===================
  D              Mallard duck  -------------------
B D        American alligator  ===================
B D                    Turkey  ===================
  D    Spiny softshell turtle  -------------------
  D  Chinese softshell turtle  -------------------
  D            Painted turtle  ===================
B D                   Wallaby  -------------------
B D                   Opossum  -------------------
B D           Tasmanian devil  ===================
  D           Green seaturtle  ===================
    Mexican tetra (cavefish)  ===================

Inserts between block 5 and 6 in window
B D                   Rabbit 1bp
B D                     Pika 4827bp

Alignment block 6 of 760 in window, 150716942 - 150716947, 6 bps 
B D                     Human  attccc
B D                     Chimp  attccc
B D                   Gorilla  attccc
B D                 Orangutan  attccc
B D                    Gibbon  attccc
B D                    Rhesus  -ttccc
B D       Crab-eating macaque  -ttccc
B D                    Baboon  -ttccc
B D              Green monkey  -ttccc
B D                  Marmoset  attccc
B D           Squirrel monkey  attccc
B D                  Bushbaby  -ctccc
           Chinese tree shrew  -aactc
                 Prairie vole  acttct
B D           Chinese hamster  actact
B D                     Mouse  actctt
B D                       Rat  acttct
B D            Naked mole-rat  acttcc
B D                Guinea pig  acttcc
                   Chinchilla  gctgcc
             Brush-tailed rat  acttcc
B D                    Rabbit  tctccc
B D                    Alpaca  actctc
               Bactrian camel  actctc
B D                   Dolphin  a-ctcc
                 Killer whale  a-ctcc
             Tibetan antelope  a-gtcc
B D                       Cow  acctcc
B D                     Sheep  atttcc
B D                     Horse  actccc
B D          White rhinoceros  actccc
B D                       Dog  attctc
                 Weddell seal  attctc
             Black flying-fox  aatccc
B D                   Megabat  aatccc
                Big brown bat  acttcc
B D                  Microbat  actccc
              Star-nosed mole  --tccc
B D                      Pika  ======
               Domestic goat  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D              Nile tilapia  ======
          Southern platyfish  ======
         Princess of Burundi  ======
B D              Atlantic cod  ------
B D                    Lizard  ======
B D                      Fugu  ======
B D                    Medaka  ======
                 Spotted gar  ======
B D                 Zebrafish  ======
B D               Stickleback  ======
B D                   Ferret   ======
B D                  Squirrel  ------
  D              Mallard duck  ------
B D        American alligator  ======
B D                    Turkey  ======
  D    Spiny softshell turtle  ------
  D  Chinese softshell turtle  ------
  D            Painted turtle  ======
B D                   Wallaby  ------
B D                   Opossum  ------
B D           Tasmanian devil  ======
  D           Green seaturtle  ======
    Mexican tetra (cavefish)  ======

Inserts between block 6 and 7 in window
B D                   Rabbit 4bp

Alignment block 7 of 760 in window, 150716948 - 150717001, 54 bps 
B D                     Human  ttaacaaagtaagaaaagagtgtgctggaac-cacctccaggaat----aaaatacagt
B D                     Chimp  ttaacaaagtaagaaaagagtgtgctggaac-cacctccaggaat----aaaatacagt
B D                   Gorilla  ttaacaaagtaagaaaagagtgtgctggaac-cacctccaggaat----aaaat--agt
B D                 Orangutan  ttaacaaagtaagaaaagagtgtgctggaac-cacctccagtaat----aaaatacagt
B D                    Gibbon  ttaacaaagtaagaaaaaagtgtgctggaac-cacctccaggaat----aaaatacagt
B D                    Rhesus  ttaataaagtaagagaagagtgtgctggaac-cacctccaggaat----aaaatacagt
B D       Crab-eating macaque  ttaataaagtaagagaagagtgtgctggaac-cacctccaggaat----aaaatacagt
B D                    Baboon  ttaataaagtaagagaagagtgtgctggaac-cacctccaggaat----aaaatacagt
B D              Green monkey  ttaataaagtaagagaagagtgtgctggaac-cacctccaggaat----aaaatacagt
B D                  Marmoset  ttaacaaagtaagagaagagtgtgctggagc-cacctctgggaat----aaaatatagt
B D           Squirrel monkey  ttaacaaagtaagagaagagtgtgctggaac-cacctctgggaat----aaaatacagt
B D                  Bushbaby  tgaa-----tcagagaaa----tgctagaac-tattgaagggaac---aaaaatacacc
           Chinese tree shrew  ttaatacagtaagagaagtgagcactagaca-tacttccaggaac----aaaa--cagt
B D                  Squirrel  ------cggtgagtg---------ctggatc-tgcttccaagaac----aaagcacaat
                 Prairie vole  ttcatacggtaagagaaacctattctagatc-ccattccaggagc----aaagcgcatt
B D           Chinese hamster  ttcatacggtaagagaaatctattctagatc-ctcttccaggaac----aaagcacagt
B D                     Mouse  ttcgtacagtaagggaaatgtactctagatc-tcctcccaggagc----aaagcacagt
B D                       Rat  ctcacgaggtaagggaaagg---tctagatc-tcttcccaggagc----aaagcacagc
B D            Naked mole-rat  taagtacagtaagagaagtgt-tgctgggcc-cacttccaggaac----aacaaatagt
B D                Guinea pig  tacacggaggaagaaaaatgtgtgctgggca-cactgccaagaac----aacagatagt
                   Chinchilla  taaatacagt-agagaagtgtgtgctgggcaccacttccatcacttttaaacacctagt
             Brush-tailed rat  taaacatagt-agtgaagcgcgtgccaggta-cactcccagaact-------actgtgt
B D                    Alpaca  ttcattcagtaagagaagtgcaagctggaag-cacttc---tagg----aatatacatt
               Bactrian camel  ttcattcagtaagagaagtgcaagctggaac-cacttc---tagg----aatatacatt
B D                   Dolphin  cttagtc-----------cttctgctggaac-taccgc---------------------
                 Killer whale  cttagtc-----------cttctgctagaac-taccgc---------------------
             Tibetan antelope  cctagtcaataagaaaggcgattgctaggac-tactgcagacacc----aaaacgcatt
B D                       Cow  cccatacagtaaaaaaagtctgtactggaac-catgtccaggagt----aaaatgcatt
B D                     Sheep  cccatacagtaagaaaagtctgtact------catgtctaggagt----aaaatgcatt
B D                     Horse  ttaacacagtgagtgaagtgtgtgctggaac-cacttccaggaac----aggttacatt
B D          White rhinoceros  ctaata-aataaggaaggtgtttgctagaac-tactgcagggaac----aaaacatatt
B D                       Dog  ataatacagtaagagaagtgggtg--------------caggaac----aaaatacatt
                 Weddell seal  ttaatacagtaagagcagtgggtgctagaag-cccttccaggaac----agaatacagt
             Black flying-fox  tcagtacagtaagagaagcgtgtgccagaac-cacttccaggatc----aaagtaca--
B D                   Megabat  tcagtacagtaagagaagcgtgtgccagaac-cacttccaggatc----aaagtaca--
                Big brown bat  ctaaca-aggaagaaaggagtctgctcactc-tcctccaggggcc-----aaacaggct
B D                  Microbat  ctaaca-aggaaggaaggggtctgctcactc-tcctgcagggacc----aaaacacact
              Star-nosed mole  ttaccacagtctgagag-------------t-cactccccgggac----atggcccatt
B D                    Rabbit  ===========================================================
B D                      Pika  ===========================================================
               Domestic goat  ===========================================================
                 Zebra mbuna  ===========================================================
       Burton's mouthbreeder  ===========================================================
B D              Nile tilapia  ===========================================================
          Southern platyfish  ===========================================================
         Princess of Burundi  ===========================================================
B D              Atlantic cod  -----------------------------------------------------------
B D                    Lizard  ===========================================================
B D                      Fugu  ===========================================================
B D                    Medaka  ===========================================================
                 Spotted gar  ===========================================================
B D                 Zebrafish  ===========================================================
B D               Stickleback  ===========================================================
B D                   Ferret   ===========================================================
  D              Mallard duck  -----------------------------------------------------------
B D        American alligator  ===========================================================
B D                    Turkey  ===========================================================
  D    Spiny softshell turtle  -----------------------------------------------------------
  D  Chinese softshell turtle  -----------------------------------------------------------
  D            Painted turtle  ===========================================================
B D                   Wallaby  -----------------------------------------------------------
B D                   Opossum  -----------------------------------------------------------
B D           Tasmanian devil  ===========================================================
  D           Green seaturtle  ===========================================================
    Mexican tetra (cavefish)  ===========================================================

Inserts between block 7 and 8 in window
B D                    Mouse 183bp

Alignment block 8 of 760 in window, 150717002 - 150717040, 39 bps 
B D                     Human  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D                     Chimp  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D                   Gorilla  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D                 Orangutan  ttgaaaggcattaa-------acat--gcctc---------aagctccctattgagc
B D                    Gibbon  ttgaaaggcattaa-------acat--tcctc---------aagctccctgttgagc
B D                    Rhesus  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D       Crab-eating macaque  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D                    Baboon  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D              Green monkey  ttgaaaggcattaa-------acat--tcctc---------aagctccctattgagc
B D                  Marmoset  ttgaaaggcattaa-------a------gctc---------aagctccctattgagc
B D           Squirrel monkey  ttgaaaggcattaa-------a------gctc---------aagctccctattgagc
B D                  Bushbaby  atataagatagtaa-------acag--tcccc---------aaa-tgtaaatccagc
           Chinese tree shrew  ctcaaaggcattaa-------acat--tcccc---------aagctgcgtattcagc
B D                  Squirrel  ttaaaagacatga--------aacg--tcccc---------aggttgtatattcagc
                 Prairie vole  ttagaaggta-----------ccat--tcctc---------aaactgcacatacaac
B D           Chinese hamster  ttagaagaca-----------ccat--tcttc---------aaa-tgaacattcagc
B D                     Mouse  ttgaaagaaatttcattaaatgttt--ctttctatagaaaaaaaaagcacattcagc
B D                       Rat  ttagaagaca-----------gcct--tcctc---------aaaatgcacactccgc
B D            Naked mole-rat  ttgaaggacattaa-------acat--tcccc---------aagttgtatatctg-c
B D                Guinea pig  ttaaaaggcattaa-------acgt--tccct---------gagtttcatatcca-t
                   Chinchilla  ttaaaagacattga-------acat--tcccc---------aagtcgcagctcca-c
             Brush-tailed rat  ttaaaggacactga-------acat--tcccc---------aagttgcatattca-c
B D                    Alpaca  ttaaaagacattaa-------acat--tgccc---------aatt-gcattttcagc
               Bactrian camel  ttaaaagacattaa-------acat--taccc---------aatt-gcattttcagc
B D                   Dolphin  --agaaggcaatga-------acac--tcccc---------aaat-gcgtgtgcagc
                 Killer whale  --agaaggcaatga-------acac--tcccc---------aaat-gcatgtgcagc
             Tibetan antelope  ttcaaagtcaacaa-------acac--ccccc---------aaaa-gcatgttcagc
B D                       Cow  ttaaaaggcattca-------acgt--tgctc---------aaactgcacgttcagc
B D                     Sheep  ttaaaaggcattca-------acat--tgctc---------agattgaacattcagc
B D                     Horse  ttgaaagcat-gca-------acat--tgccc---------agactgcatactcagc
B D          White rhinoceros  ttagaaggca-gaa-------atac--tcccc---------aga-tgcatattcagc
B D                       Dog  tgggaaggcactaa-------agat--tgccc---------aaattgcatattcagc
                 Weddell seal  ttaaaaggcattaa-------agat--agtcc---------aaatgacatactcagc
             Black flying-fox  -----aggcattcg-------acat--tcccc---------aaatcgcacattcagc
B D                   Megabat  -----aggcattcg-------acat--tcccc---------aagtcgcacattcagc
                Big brown bat  ttag---------a-------acac--tcctc---------acct-gcatatctggc
B D                  Microbat  ttagaaggcagcaa-------agac--tcccc---------acct-gcatatccggc
              Star-nosed mole  tcaa-aggcattga-------ccatgacgccc---------aagtgacaaatcccga
B D                    Rabbit  =========================================================
B D                      Pika  =========================================================
               Domestic goat  =========================================================
                 Zebra mbuna  =========================================================
       Burton's mouthbreeder  =========================================================
B D              Nile tilapia  =========================================================
          Southern platyfish  =========================================================
         Princess of Burundi  =========================================================
B D              Atlantic cod  ---------------------------------------------------------
B D                    Lizard  =========================================================
B D                      Fugu  =========================================================
B D                    Medaka  =========================================================
                 Spotted gar  =========================================================
B D                 Zebrafish  =========================================================
B D               Stickleback  =========================================================
B D                   Ferret   =========================================================
  D              Mallard duck  ---------------------------------------------------------
B D        American alligator  =========================================================
B D                    Turkey  =========================================================
  D    Spiny softshell turtle  ---------------------------------------------------------
  D  Chinese softshell turtle  ---------------------------------------------------------
  D            Painted turtle  =========================================================
B D                   Wallaby  ---------------------------------------------------------
B D                   Opossum  ---------------------------------------------------------
B D           Tasmanian devil  =========================================================
  D           Green seaturtle  =========================================================
    Mexican tetra (cavefish)  =========================================================

Alignment block 9 of 760 in window, 150717041 - 150717059, 19 bps 
B D                     Human  aaaggcaaaagatatttct
B D                     Chimp  aaaggcaaaagatatttct
B D                   Gorilla  aaaggcaaaagatatttct
B D                 Orangutan  aaaggcaaaagatatttct
B D                    Gibbon  aaaggcaaaagatatttct
B D                    Rhesus  aaaggcaaaagatacttct
B D       Crab-eating macaque  aaaggcaaaagatacttct
B D                    Baboon  aaaggcaaaagatacttct
B D              Green monkey  aaaggcaaaagatacttct
B D                  Marmoset  aaaggcaaaagatatttct
B D           Squirrel monkey  aaaggcaaaaggtatttct
B D                  Bushbaby  agaggtgaaagatacatct
B D                  Squirrel  aaaggcaaagcatatttct
                 Prairie vole  aaatacagaagatgcttct
B D           Chinese hamster  aaacacaaaagatacttct
B D                     Mouse  aaaggcaaacgatccttct
B D                       Rat  aaaggcagaagatacttct
B D            Naked mole-rat  aaaggcaa--gatgtttct
B D                Guinea pig  aaaggcaa--ggtatttct
                   Chinchilla  aaagggga--gatatttct
             Brush-tailed rat  aaaagcaa--gatgtttct
B D                    Alpaca  aaaggcaaaagatatttct
               Bactrian camel  aaaggcaaaagatatttct
B D                   Dolphin  aaatgcaaaagatattcct
                 Killer whale  aaatgcaaaagatattcct
             Tibetan antelope  aaaggcaaaaggtaatcct
B D                       Cow  acaggcaaaagatctttcc
B D                     Sheep  acaggcaaaatatctttct
B D                     Horse  aaaggcgaaagatgcttct
B D          White rhinoceros  gaatacaaaaagtattttt
B D                       Dog  aaaggcaaaag--attgct
                 Weddell seal  aaaagcaaaagatatttct
             Black flying-fox  aaaggcaaaagatacttct
B D                   Megabat  aaaggcaaaagatacttct
                Big brown bat  aaag--caaagagatttct
B D                  Microbat  aagg--caaagagatttct
              Star-nosed mole  gacgac-aaagccacctct
B D                    Rabbit  ===================
B D                      Pika  ===================
               Domestic goat  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
B D              Nile tilapia  ===================
          Southern platyfish  ===================
         Princess of Burundi  ===================
B D              Atlantic cod  -------------------
B D                    Lizard  ===================
B D                      Fugu  ===================
B D                    Medaka  ===================
                 Spotted gar  ===================
B D                 Zebrafish  ===================
B D               Stickleback  ===================
B D                   Ferret   ===================
  D              Mallard duck  -------------------
B D        American alligator  ===================
B D                    Turkey  ===================
  D    Spiny softshell turtle  -------------------
  D  Chinese softshell turtle  -------------------
  D            Painted turtle  ===================
B D                   Wallaby  -------------------
B D                   Opossum  -------------------
B D           Tasmanian devil  ===================
  D           Green seaturtle  ===================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===================

Inserts between block 9 and 10 in window
               Big brown bat 6255bp
B D                 Microbat 1bp

Alignment block 10 of 760 in window, 150717060 - 150717076, 17 bps 
B D                     Human  -atgg-ccccataagc-c-a-t
B D                     Chimp  -atgg-ccccataagc-c-a-t
B D                   Gorilla  -atgg-ccccataagc-c-a-t
B D                 Orangutan  -gtgg-ccccataagc-c-a-t
B D                    Gibbon  -gtgg-cctcataagc-c-a-t
B D                    Rhesus  -gtgg-ccctgtaagc-c-a-t
B D       Crab-eating macaque  -gtgg-ccctgtaagc-c-a-t
B D                    Baboon  -gtgg-ccctgtaagc-c-a-t
B D              Green monkey  -gtgg-ccccgtaagc-c-a-t
B D                  Marmoset  -gtgg-ccccataagc-c-a-t
B D           Squirrel monkey  -gtgg-ccccaggcgc-c-a-t
B D                  Bushbaby  -gagg-atgtagaaac-a-att
B D                  Squirrel  -gtgg-ccc-atgagc-a-a-t
                 Prairie vole  -atgt-ctctataaac-c-a--
B D           Chinese hamster  -gtgt-ttct-------c-a--
B D                     Mouse  -gtgt-ccttataaac-c-a-t
B D                       Rat  -atgc-ccctataaac-c-a-t
B D            Naked mole-rat  -gtgt-ccccataagc-a-a-t
B D                Guinea pig  -gtgt-ccctgtaagc-a-a-t
                   Chinchilla  -gtgt-ccccataagc-g-a-t
             Brush-tailed rat  -gtgt-ccccataagc-a-a-t
B D                    Alpaca  atagg-ctc-agaagc-a-a-t
               Bactrian camel  atagg-ctc-agaagc-a-a-t
B D                   Dolphin  gggga-cttataaggg-a-a-g
                 Killer whale  gggga-cttataaggg-a-a-g
             Tibetan antelope  ggaga-cttataagga-a-a-g
B D                       Cow  tgtgg-ccc-caaagc-a-a-t
B D                     Sheep  tgtga-ccc-caaagc-a-a-t
B D                     Horse  -ctgg-acc-atgagc-a-a-t
B D          White rhinoceros  -gaggaaat-ataaac-gca-c
B D                       Dog  -gtgg-gcc-ataact-a-a-t
                 Weddell seal  -atgg-acc-ataaat-a-a-t
             Black flying-fox  -gtaa-cca-gtaagt-a-t-t
B D                   Megabat  -gtaa-cca-gtaagt-a-t-t
B D                  Microbat  -agga-cat-ataagtga-g-t
              Star-nosed mole  -gtga-ccc--actgc-a-g-c
B D                    Rabbit  ======================
B D                      Pika  ======================
               Domestic goat  ======================
               Big brown bat  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
B D              Nile tilapia  ======================
          Southern platyfish  ======================
         Princess of Burundi  ======================
B D              Atlantic cod  ----------------------
B D                    Lizard  ======================
B D                      Fugu  ======================
B D                    Medaka  ======================
                 Spotted gar  ======================
B D                 Zebrafish  ======================
B D               Stickleback  ======================
B D                   Ferret   ======================
  D              Mallard duck  ----------------------
B D        American alligator  ======================
B D                    Turkey  ======================
  D    Spiny softshell turtle  ----------------------
  D  Chinese softshell turtle  ----------------------
  D            Painted turtle  ======================
B D                   Wallaby  ----------------------
B D                   Opossum  ----------------------
B D           Tasmanian devil  ======================
  D           Green seaturtle  ======================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================

Inserts between block 10 and 11 in window
B D                    Mouse 45bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 11 of 760 in window, 150717077 - 150717123, 47 bps 
B D                     Human  ctaacctcggagtgagttacgacgtgacaagac------tgggta-catttgaa
B D                     Chimp  ctaacctcggagtgagttacgacatgacaagac------tgggta-catttgaa
B D                   Gorilla  ctaacctcggagtgagttacgacgtgacaagac------tgggta-catttgaa
B D                 Orangutan  ctaaccttggagtgagttacaacgtgacaagac------tgggta-catttgaa
B D                    Gibbon  ctaacctcggagtgagttacaacatgacaagac------tggtta-catttgaa
B D                    Rhesus  ctaacctcggagtgagtcacaacgtggcaagac------tgggta-catttgaa
B D       Crab-eating macaque  ctaacctcggagtgagtcacaacgtgacaagac------tgggta-catttgaa
B D                    Baboon  ctaacctcggagtgagtcacaatgtgacaagac------tgggta-catttgaa
B D              Green monkey  ctaacctcagagtgagtcacaacgtgacaagac------tgggta-catttgaa
B D                  Marmoset  ctaaccctggagtgagttacaatgtgacaagac------tgggta-catctgaa
B D           Squirrel monkey  ctaaccttggagtaagttacaatgtgacaagac------tgggta-catctgaa
B D                  Bushbaby  ctaaccttagaacaagttaaaaagtaaaaattctgtatatgtgta-tatctgag
B D                  Squirrel  ctaaccttggggcagcgagttatgtggaa-acc------tgggta-cacctgaa
                 Prairie vole  -tgccttcaaggccagtcttgatgtgcca-gtc------tgcgcc-cctctgaa
B D           Chinese hamster  -caccttca---------------------------------------------
B D                       Rat  --gctttcaaggccactctgaatgtgccatgtc------tg-------------
B D            Naked mole-rat  taaccttgag-gcaaattccaatgtgacaagtg------tgggta-caagtgaa
B D                Guinea pig  caaccttggggggcaattccaatgtgacaagta------tgggta-caagtaaa
                   Chinchilla  taaccctggggggaaattccagtgtgacaagtg------caggta-cgggcgaa
             Brush-tailed rat  taatcttgagagaaaatgccagtgtgacaagtg------cgggcc-caagtcca
B D                    Alpaca  ctaacttcagactagtttacaatgtgacgagtc------aggaccccacccgaa
               Bactrian camel  ctaacttcagactaggttataatgtgacgagtc------aggaccccatctgaa
B D                   Dolphin  ctaacctcagaacaagttacaaagtgaaaattc------tgtata-tatctgag
                 Killer whale  ctaacctcagaacaagttacaaagtgaaaattc------tgtata-tatctgag
             Tibetan antelope  ctaacctcagaacaagttacaaagtg------------------------agaa
B D                       Cow  ctaactt-agagcaagttacagtgtgttgagtc------aggaaaccatcagaa
B D                     Sheep  ctaacttcagagcaagttacagtgtgctgagtc------aggaaaccatcagaa
B D                     Horse  ccaacctcagagcgagtgacaatgtggcagatc------cgggtg-catctgaa
B D          White rhinoceros  ctaaactca-aacaagttacaaagtga-aattc------tgtata-catctgaa
B D                       Dog  ctaacctcagagcaagtcacaatgtgggaaatc------tagata-caaattaa
                 Weddell seal  ctaacctcagagcaagttacaatgtggcaaatc------tagata-catatgaa
             Black flying-fox  gtagcctcagagccagtgacagt---------c------tgcata-gattcagg
B D                   Megabat  ctagcctcagagccagtgacagt---------c------tgcata-gattcagg
B D                  Microbat  ctaaactcagaacacgttaaagtgaa--aatcc------tgtgtg-tatctggg
              Star-nosed mole  tgaccccaagggcgagctaaaaggtggcagagg------tgcagg--ttctgag
B D                    Rabbit  ======================================================
B D                      Pika  ======================================================
B D                     Mouse  ======================================================
               Domestic goat  ======================================================
               Big brown bat  ======================================================
                 Zebra mbuna  ======================================================
       Burton's mouthbreeder  ======================================================
B D              Nile tilapia  ======================================================
          Southern platyfish  ======================================================
         Princess of Burundi  ======================================================
B D              Atlantic cod  ------------------------------------------------------
B D                    Lizard  ======================================================
B D                      Fugu  ======================================================
B D                    Medaka  ======================================================
                 Spotted gar  ======================================================
B D                 Zebrafish  ======================================================
B D               Stickleback  ======================================================
B D                   Ferret   ======================================================
  D              Mallard duck  ------------------------------------------------------
B D        American alligator  ======================================================
B D                    Turkey  ======================================================
  D    Spiny softshell turtle  ------------------------------------------------------
  D  Chinese softshell turtle  ------------------------------------------------------
  D            Painted turtle  ======================================================
B D                   Wallaby  ------------------------------------------------------
B D                   Opossum  ------------------------------------------------------
B D           Tasmanian devil  ======================================================
  D           Green seaturtle  ======================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================

Inserts between block 11 and 12 in window
                Prairie vole 2bp
B D          Chinese hamster 1bp

Alignment block 12 of 760 in window, 150717124 - 150717132, 9 bps 
B D                     Human  ct-------------------ctcctcc-----
B D                     Chimp  ct-------------------ctcctcc-----
B D                   Gorilla  ct-------------------ctcctcc-----
B D                 Orangutan  ct-------------------ctcctcc-----
B D                    Gibbon  ct-------------------ctcctcc-----
B D                    Rhesus  ct-------------------ctcctcc-----
B D       Crab-eating macaque  ct-------------------ctcctcc-----
B D                    Baboon  ct-------------------ctcctcc-----
B D              Green monkey  ct-------------------ctcctcc-----
B D                  Marmoset  ctctcttct------------ctcctcc-----
B D           Squirrel monkey  ctctcttcg------------ctcctcc-----
B D                  Bushbaby  ctgaatcctccaatcctccacctcccca-----
B D                  Squirrel  ---------------------ctcttca-----
                 Prairie vole  ---------------------ctcttaa-----
B D           Chinese hamster  ---------------------ttcatga-----
B D                     Mouse  ---------------------ctcttct-----
B D                       Rat  ---------------------cccctct-----
B D            Naked mole-rat  ------------ctctcctg--tcctcc-----
B D                Guinea pig  ------------tgatctcagttccttc-----
                   Chinchilla  ------------ctatctcagctcctcc-----
             Brush-tailed rat  ------------ccgtcccagcgcctcc-----
B D                    Alpaca  ---------------------ttactca----c
               Bactrian camel  ---------------------ttactcg----c
B D                   Dolphin  ---------------------ctgaacc---ct
                 Killer whale  ---------------------ctgaacc---ct
             Tibetan antelope  ---------------------ttctgtaattct
B D                       Cow  ---------------------ttcaaccccgcc
B D                     Sheep  ---------------------ttcaaccctgcc
B D                     Horse  ---------------------tgga----cgcc
B D          White rhinoceros  ---------------------ctgaatc-ctcc
B D                       Dog  ---------------------tttgttc-cc--
                 Weddell seal  ---------------------tttactc-ccac
             Black flying-fox  ---------------------ac--------cc
B D                   Megabat  ---------------------ac--------cc
B D                  Microbat  ---------------------ctga-ac-cgcc
              Star-nosed mole  ---------------------cccgccc---cc
B D                    Rabbit  =================================
B D                      Pika  =================================
               Domestic goat  =================================
               Big brown bat  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
B D              Nile tilapia  =================================
          Southern platyfish  =================================
         Princess of Burundi  =================================
B D              Atlantic cod  ---------------------------------
B D                    Lizard  =================================
B D                      Fugu  =================================
B D                    Medaka  =================================
                 Spotted gar  =================================
B D                 Zebrafish  =================================
B D               Stickleback  =================================
B D                   Ferret   =================================
  D              Mallard duck  ---------------------------------
B D        American alligator  =================================
B D                    Turkey  =================================
  D    Spiny softshell turtle  ---------------------------------
  D  Chinese softshell turtle  ---------------------------------
  D            Painted turtle  =================================
B D                   Wallaby  ---------------------------------
B D                   Opossum  ---------------------------------
B D           Tasmanian devil  =================================
  D           Green seaturtle  =================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =================================

Inserts between block 12 and 13 in window
B D                   Alpaca 17bp
              Bactrian camel 17bp
B D                  Dolphin 17bp
                Killer whale 17bp
            Tibetan antelope 17bp
B D                      Cow 17bp
B D                    Sheep 17bp
B D                    Horse 17bp
B D         White rhinoceros 20bp
B D                      Dog 10bp
                Weddell seal 17bp
            Black flying-fox 13bp
B D                  Megabat 13bp
B D                 Microbat 18bp
             Star-nosed mole 45bp

Alignment block 13 of 760 in window, 150717133 - 150717175, 43 bps 
B D                     Human  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ta
B D                     Chimp  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagatat-ctgagat--ta
B D                   Gorilla  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ta
B D                 Orangutan  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ta
B D                    Gibbon  t-aa-----c-------------tgt-cacagaa-gggg-ccctgaggagacat-ctgagat--ta
B D                    Rhesus  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ta
B D       Crab-eating macaque  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ta
B D                    Baboon  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ta
B D              Green monkey  t-ca-----c-------------tgtccacaaaa-ggggcccctgaggagatat-ctgagat--ta
B D                  Marmoset  t-ca-----c-------------tgtccacagaa-ggggcccctgaggagacat-ctgagat--ga
B D           Squirrel monkey  t-ca-----c-------------tgtccacagaa-ggggcccccgaggagacat-ctgagat--ga
B D                  Bushbaby  g-ca-----c-------------tgtctata-aa-gggatctttcaggagatgt-ctaaggt--ca
B D                  Squirrel  c-ct-----c-------------atgaccacagc-aggggccttcaggagacat-ctaaatc--a-
                 Prairie vole  t-ct-----cacacctgtatgcgtgtgcatgggg-aaggggctctaacacacct-cagagga--at
B D           Chinese hamster  t-tt-----c--------------------------------------------------------
B D                     Mouse  t-ct-----c-------------cttgccagtcg-gaggggctctagcaaactt-gagagga--at
B D                       Rat  t-ct---------------------------------ggggctctagcagacct-cagagga--at
B D            Naked mole-rat  t-cc-----c-------------cacccacagta-gagggccctctggagaaat-ctcaagt--tt
B D                Guinea pig  t-cc-----c-------------cacctgcagca-gaggaccctcaggagacac-ctcaagt--ta
                   Chinchilla  t-cc-----c-------------catgtgcagga-gagggccctcaggagacac-ctcaagt--ga
             Brush-tailed rat  t-cc-----c-------------cgtctacagta-gagggacttcaggagacac-ttcagac--ca
B D                    Alpaca  t-ct-----c-------------tgtccatagta-ggaggccccccggagacct-aagaggt--ta
               Bactrian camel  t-ct-----c-------------tgtccacagta-ggaggccccccggagacct-aagaggt--ta
B D                   Dolphin  c-cttagcgc-------------tatccacaata-gtg------caagagacag-ctaaggt--tg
                 Killer whale  c-cttagcgc-------------tatccacaata-gtg------caagagacag-ctaaggt--tg
             Tibetan antelope  c-cttagcac-------------tatccacaata-gtg------caggaaacaa-ctaaggt--ta
B D                       Cow  c-ct-----c-------------tgtccacagaa-agggaccctcaagagacta-aagaggt--ta
B D                     Sheep  c-ct-----c-------------tgtccacaata-agggaccctcaagagacta-aagaggt--ta
B D                     Horse  a-ta-----c-------------tgcccacagca-ggg-gccctcgggagacat-ctgaggt--ta
B D          White rhinoceros  agca-----c-------------tgtccagaacc-ggg-tctcataggagacat-ctaaggt--ta
B D                       Dog  t-ca-----c-------------tgcccactcta---g-gcccttaggagacat-ctgaggt--ta
                 Weddell seal  t-ca-----c-------------tgcccacagtagggg-gatctctggagacat-ctgagct--ta
             Black flying-fox  t-ca-----c-------------cgttctcggag-gtg-gggaggcgcaggcaatctgaggt--ta
B D                   Megabat  t-ca-----c-------------cgttctcggag-gtg-gggaggcgcaggcaatctgaggt--ta
B D                  Microbat  c-ca-----a-------------gtgtccagaaa-gca-acttgccagagacgg-caaaggtcatg
B D                    Rabbit  ==================================================================
B D                      Pika  ==================================================================
               Domestic goat  ==================================================================
               Big brown bat  ==================================================================
                 Zebra mbuna  ==================================================================
       Burton's mouthbreeder  ==================================================================
B D              Nile tilapia  ==================================================================
          Southern platyfish  ==================================================================
         Princess of Burundi  ==================================================================
B D              Atlantic cod  ------------------------------------------------------------------
B D                    Lizard  ==================================================================
B D                      Fugu  ==================================================================
B D                    Medaka  ==================================================================
                 Spotted gar  ==================================================================
B D                 Zebrafish  ==================================================================
B D               Stickleback  ==================================================================
             Star-nosed mole  ==================================================================
B D                   Ferret   ==================================================================
  D              Mallard duck  ------------------------------------------------------------------
B D        American alligator  ==================================================================
B D                    Turkey  ==================================================================
  D    Spiny softshell turtle  ------------------------------------------------------------------
  D  Chinese softshell turtle  ------------------------------------------------------------------
  D            Painted turtle  ==================================================================
B D                   Wallaby  ------------------------------------------------------------------
B D                   Opossum  ------------------------------------------------------------------
B D           Tasmanian devil  ==================================================================
  D           Green seaturtle  ==================================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ==================================================================

Alignment block 14 of 760 in window, 150717176 - 150717199, 24 bps 
B D                     Human  atatcttgg-tcttcaacccctttc
B D                     Chimp  atatcttgg-tcttcaacccctttc
B D                   Gorilla  atatcttgg-tcttcaacccctttc
B D                 Orangutan  atatcttgg-tcttcaacccctttc
B D                    Gibbon  atatcttgg-tcttcaa-cccgtcc
B D                    Rhesus  atatcttga-tcttcatcccctttc
B D       Crab-eating macaque  atatcttgg-tcttcatcccctttc
B D                    Baboon  atattttga-tcttcatcccctttc
B D              Green monkey  atatcttgg-tcttcatcctctttc
B D                  Marmoset  atcgctcgg-tcttcaacccctttt
B D           Squirrel monkey  atcacttgg-tcttcaacccctttc
B D                  Bushbaby  tgaacatgg-tcttcaaattcttgt
B D                  Squirrel  ggaccttgg-tctcctacccctcac
                 Prairie vole  gggacttgg-tcatcaagccctgtc
B D                     Mouse  ggaatt---------------agtc
B D                       Rat  ggaatt---------------agcc
B D            Naked mole-rat  cctaactttgtcttcaaaccctccc
B D                Guinea pig  gaaaagggt-tcttcaaaccctgtc
                   Chinchilla  ggaaggggt-tctcccagccctttc
             Brush-tailed rat  ggaa---gt-tcttcaagccattaa
B D                    Alpaca  ggaattagg-tcttcaacctct--c
               Bactrian camel  ggaattagg-tcttcaacctct--c
B D                   Dolphin  cgaacttgg-tcctcaacccttg-c
                 Killer whale  tgaacttgg-tcctcaacccttg-c
             Tibetan antelope  tgaacttgg-ccctcactccttg-c
B D                       Cow  ggaaccagg-tcttcaacccctc-g
B D                     Sheep  ggaaccagg-tcttcaacccctc-a
B D                     Horse  --agcttgc-tctccaacccctt--
B D          White rhinoceros  tgaagctgg-tcttcagacacttgc
B D                       Dog  ggaactggg-tcttcaacccctctc
                 Weddell seal  ggaacttgg-tctccagccccttt-
             Black flying-fox  gccaatcag-tcttcaattcctctc
B D                   Megabat  gccaatcag-tcttcaatccctctc
B D                  Microbat  acca--tag-tactcaaacacttgc
              Star-nosed mole  agaactcgg-tcttcagcccctttc
B D                    Rabbit  =========================
B D                      Pika  =========================
B D           Chinese hamster  -------------------------
               Domestic goat  =========================
               Big brown bat  =========================
                 Zebra mbuna  =========================
       Burton's mouthbreeder  =========================
B D              Nile tilapia  =========================
          Southern platyfish  =========================
         Princess of Burundi  =========================
B D              Atlantic cod  -------------------------
B D                    Lizard  =========================
B D                      Fugu  =========================
B D                    Medaka  =========================
                 Spotted gar  =========================
B D                 Zebrafish  =========================
B D               Stickleback  =========================
B D                   Ferret   =========================
  D              Mallard duck  -------------------------
B D        American alligator  =========================
B D                    Turkey  =========================
  D    Spiny softshell turtle  -------------------------
  D  Chinese softshell turtle  -------------------------
  D            Painted turtle  =========================
B D                   Wallaby  -------------------------
B D                   Opossum  -------------------------
B D           Tasmanian devil  =========================
  D           Green seaturtle  =========================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =========================

Inserts between block 14 and 15 in window
             Star-nosed mole 403bp

Alignment block 15 of 760 in window, 150717200 - 150717228, 29 bps 
B D                     Human  cctgcatggccccttaaa------catctgctccc
B D                     Chimp  cctgcatggccccttaaa------catctgccccc
B D                   Gorilla  cctgcgtggccccttaaa------catctgctccc
B D                 Orangutan  cctgcatggtcccttaaa------catctgctccc
B D                    Gibbon  cctgcatggt-ccttaaa------catctgctccc
B D                    Rhesus  cctgcatggtccctttaa------catctgctccc
B D       Crab-eating macaque  cctgcatggtccctttaa------catctgctccc
B D                    Baboon  cctgcatggtccctttaa------catctgctccc
B D              Green monkey  cctggatggtccctttaa------catctgctccc
B D                  Marmoset  tctgcatagttccttaaa------catctgctccc
B D           Squirrel monkey  cctgcatggtcccttaaa------catctgctccc
B D                  Bushbaby  cctacataaa------------------ggcctcc
B D                  Squirrel  cctcaatg-tcccttaat------catctgttccc
                 Prairie vole  cccacctg-tcatttaaa------cctttgcttcc
B D                     Mouse  ctcacttg---------------------tcttcc
B D                       Rat  cccacttg-gcaggtaaa------cctttgcttcc
B D            Naked mole-rat  cctgcatg-tctcttaaa------tgtctgctccc
B D                Guinea pig  cctgtagg-tcccttaaa------tgcctgctccc
                   Chinchilla  cctgaatg-tcccttgag------cgtctgctccc
             Brush-tailed rat  cctgcagg-ccccttaaa------tatctgtgccc
B D                    Alpaca  cctgcatgatctcttaaa------catctgctc--
               Bactrian camel  cctgcatgatctcttaaa------catctgctc--
B D                   Dolphin  cctacatgatcacttgaa------catctgctccc
                 Killer whale  cctacatgatcacttgaa------catctgctccc
             Tibetan antelope  cctacagggactcttgaa------tatcttctccc
B D                       Cow  tcctcatgagccctgaca------cgttggctccc
B D                     Sheep  tcctcatgacccctgaca------cgctggctccc
B D                     Horse  ----------cccatgca----------ggacccc
B D          White rhinoceros  cctccgtgtgcccacaca--------tctgctccc
B D                       Dog  tctgcatg--accttaaaaggggtcatccgctctt
                 Weddell seal  ----------------aaaggggtcttctgctccc
             Black flying-fox  cctgcatgagcccttaca------catctgctccc
B D                   Megabat  cctgcatgagcccttaca------catctgctccc
B D                  Microbat  cctacctgtgcttttaaa------cacctgctccc
B D                    Rabbit  ===================================
B D                      Pika  ===================================
B D           Chinese hamster  -----------------------------------
               Domestic goat  ===================================
               Big brown bat  ===================================
                 Zebra mbuna  ===================================
       Burton's mouthbreeder  ===================================
B D              Nile tilapia  ===================================
          Southern platyfish  ===================================
         Princess of Burundi  ===================================
B D              Atlantic cod  -----------------------------------
B D                    Lizard  ===================================
B D                      Fugu  ===================================
B D                    Medaka  ===================================
                 Spotted gar  ===================================
B D                 Zebrafish  ===================================
B D               Stickleback  ===================================
             Star-nosed mole  ===================================
B D                   Ferret   ===================================
  D              Mallard duck  -----------------------------------
B D        American alligator  ===================================
B D                    Turkey  ===================================
  D    Spiny softshell turtle  -----------------------------------
  D  Chinese softshell turtle  -----------------------------------
  D            Painted turtle  ===================================
B D                   Wallaby  -----------------------------------
B D                   Opossum  -----------------------------------
B D           Tasmanian devil  ===================================
  D           Green seaturtle  ===================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===================================

Inserts between block 15 and 16 in window
                Killer whale 23bp

Alignment block 16 of 760 in window, 150717229 - 150717229, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
B D                   Dolphin  c
B D                    Rabbit  =
B D                      Pika  =
B D          White rhinoceros  -
                Prairie vole  -
B D                       Rat  -
B D                     Mouse  -
B D           Chinese hamster  -
               Domestic goat  =
B D                       Cow  -
B D                     Sheep  -
            Tibetan antelope  -
               Big brown bat  =
                Killer whale  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  -
B D                    Lizard  =
B D                      Fugu  =
B D                    Medaka  =
                 Spotted gar  =
B D                 Zebrafish  =
B D                    Alpaca  -
B D               Stickleback  =
             Star-nosed mole  =
B D                  Microbat  -
B D                   Ferret   =
B D                     Horse  -
B D                  Squirrel  -
            Black flying-fox  -
              Bactrian camel  -
  D              Mallard duck  -
B D        American alligator  =
B D                    Turkey  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  =
B D                   Wallaby  -
B D                   Opossum  -
B D           Tasmanian devil  =
  D           Green seaturtle  =
B D                       Dog  -
            Brush-tailed rat  -
          Chinese tree shrew  N
                  Chinchilla  -
    Mexican tetra (cavefish)  =
                Weddell seal  -
B D                   Megabat  -
B D                Guinea pig  -
B D            Naked mole-rat  -

Alignment block 17 of 760 in window, 150717230 - 150717230, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
B D                  Squirrel  t
                 Prairie vole  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  c
             Brush-tailed rat  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  c
B D                       Cow  t
B D                     Sheep  t
B D                     Horse  t
B D          White rhinoceros  c
B D                       Dog  t
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
B D                  Microbat  c
B D                    Rabbit  =
B D                      Pika  =
B D           Chinese hamster  -
               Domestic goat  =
               Big brown bat  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  -
B D                    Lizard  =
B D                      Fugu  =
B D                    Medaka  =
                 Spotted gar  =
B D                 Zebrafish  =
B D               Stickleback  =
             Star-nosed mole  =
B D                   Ferret   =
  D              Mallard duck  -
B D        American alligator  =
B D                    Turkey  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  =
B D                   Wallaby  -
B D                   Opossum  -
B D           Tasmanian devil  =
  D           Green seaturtle  =
          Chinese tree shrew  N
    Mexican tetra (cavefish)  =

Inserts between block 17 and 18 in window
B D                  Dolphin 21bp

Alignment block 18 of 760 in window, 150717231 - 150717468, 238 bps 
B D                     Human  aattcaa----gcttctcctgctcca----gcca----cgggg----acacctcaa------attcc---
B D                     Chimp  aattcaa----gcttctcctgctcca----gcca----cgggg----acacctcaa------attcc---
B D                   Gorilla  aattcaa----gcttctcctgctcca----gcca----cgggg----acacctcaa------attcc---
B D                 Orangutan  aattcaa----gcttctcctgctcca----gcca----caggg----acacctcaa------attcc---
B D                    Gibbon  aattcaa----gcttct-ctgctcca----gcca----caggg----acacctcga------attcc---
B D                    Rhesus  aattcaa----gcttctcctgctcca----gcca----cgggg----acaccttaa------attcc---
B D       Crab-eating macaque  aattcaa----gcttctcctgctcca----gcca----cgggg----acaccttaa------attcc---
B D                    Baboon  aattcaa----gcttctcctgctcca----gtca----cgggg----acaccttaa------attcc---
B D              Green monkey  aattcaa----gcttctcctgctcca----gtaa----cgggg----acaccttaa------attcc---
B D                  Marmoset  aattcaa----gtttctcctgctcca----gcca----tgggg----acacctgaa------gttcct--
B D           Squirrel monkey  aattcaa----gtttctcctgctcca----gcca----tgggg----acacctgaa------gttcct--
B D                  Bushbaby  agtccta----gcagcccaggacccatcttggtg----ctgac----tcatctgaa------tttct---
B D                  Squirrel  aattcaa----gcttttcccactcca----gctg----cagag----acacctcaa------tttcct--
                 Prairie vole  gaatgaa----gtttgtcccgctcca----acta----taggg----acctcatag------tttttt--
B D           Chinese hamster  -----aa----gtttg------tcca----acta----cagg------cctcgcag------tttctt--
B D                     Mouse  g----ga----gtttgtcccactcca----actg----caggg----atacctctg------tttctc--
B D                       Rat  g----g-----ttttgtcccactcca----actg----cagga----atgcctctg------tttctt--
B D            Naked mole-rat  aattcaa----gcttctcccacttca----tctg----caggg----atacctcaa------ttgcct--
B D                Guinea pig  aatttga----gcttttcctgctcca----tctg----cagag----gtacctcag------ttgcct--
                   Chinchilla  aattcaa----gcttctccagttcca----cctg----cagag----gcatctcaa------tggcct--
             Brush-tailed rat  gagtcaa----gcttctcctgcccca----tctg----tggag----atacctcac------t-gcct--
B D                    Alpaca  aattgaa----gtttctcccacccca----gttg----ccaga----acacctcag------tttcct--
               Bactrian camel  aattgaa----gtttctcccacccca----gttg----ccaga----acacctcag------tttcct--
B D                   Dolphin  aattcag----gtctctcccacgcca----gctg----caggg----acacctcaa------tttcat--
                 Killer whale  aattcag----gtctctcccacgcca----gctg----caggg----acacctcaa------tttcat--
             Tibetan antelope  aagtcaaggtgggctttgtgg---------gttg----ctgta----ccatgttaa------tttcct--
B D                       Cow  aattcaa----gtctctcccacccct----gctg----tagga----acacctcag------tttcct--
B D                     Sheep  aattcaa----gcctctcccacccct----gctg----tagga----acacctcag------tttcct--
B D                     Horse  aatccaa----gcttctcccacccca----gcgt----caggg----acacctcaa------tttctc--
B D          White rhinoceros  aatctaa----gcctcccagggctct----gtgtgctgctgag----ccacctcaa------tgtctcat
B D                       Dog  cattcca----gcctccccc-tccca----gctg----caagc----atacttcaa------tttcct--
                 Weddell seal  aagtcaa----gcttccccc-tccca----gctg----caagg----aaacctcaa------tttcct--
             Black flying-fox  aattcaa----gcttctcccacccca----ggtt----cgagg----acaccccaa------tttcct--
B D                   Megabat  aattcaa----gcttctcccacccca----ggtt----cgagg----acaccccaa------tttcct--
B D                  Microbat  aatagaa----gctgc-ccaggactg----tgtt----ggtggctgtgcattctgagcttcctccctt--
B D                    Rabbit  ======================================================================
B D                      Pika  ======================================================================
               Domestic goat  ======================================================================
               Big brown bat  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                   Ferret   ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================

                        Human  -------cat-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                        Chimp  -------cat-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                      Gorilla  -------cat-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                    Orangutan  -------cat-----ctgtacaata-a-ag---gggggtgc-aaa-aatgactgatgtccaag------t
                       Gibbon  -------cat-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                       Rhesus  -------cac-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
          Crab-eating macaque  -------cac-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                       Baboon  -------cac-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                 Green monkey  -------cac-----ctgtacaata-a-ag---ggggttgc-aaa-aatgactgatgtccaag------t
                     Marmoset  -------cat-----ctgtacaata-a-ag---ggggttac-aaa-aatgactgatgtccaag------t
              Squirrel monkey  -------cat-----ctgtacaata-aggg---ggggttac-aaa-aatgactgatgtccaag------t
                     Bushbaby  ---------t-----ctgtatgttg-a-ag---ggagaggc-taa-ggaaaccagttcccagggcagatc
                     Squirrel  -------cat-----ctatacaatgaa-a-----ggatttg-aaa-gataactgatttccaac------t
                 Prairie vole  -------cat-----gtctacagtg-a-a-----gagttgg-aga-aatagctcattttcaaa------t
              Chinese hamster  -------cac-----gtctacaatg-a-a-----gagtttg-aga-agtagctcattttcaaa------t
                        Mouse  -------cgc-----gtctacaagg-a-a-----gggttta-aga-aataatg-ttcttcaaa------t
                          Rat  -------cat-----gtctacacag-a-a-----ggattta-aca-aacagcg-actttcaaa------t
               Naked mole-rat  -------cat-----ctgtatattg---------gagttcagaaa-aataactaatttccaaa------c
                   Guinea pig  -------cat-----ctgtacattg---------gaattta-aaa-aacaactgacttccaaa------c
                   Chinchilla  -------cat-----ctgtatattg---------gagtttg-gaa-aataactgattgccaaa------c
             Brush-tailed rat  -------cct-----gtgtacgtgg---------gaattta-aaa-aataccagagt-------------
                       Alpaca  -------cat-----ctgtatgatg-a-ag---agctctga-ata-aatagctgatattcaga------c
               Bactrian camel  -------cat-----ctgtatgatg-a-ag---aggtctga-ata-aatagctgatattcaga------c
                      Dolphin  -------cat-----ctgtacagtg-a-ag---gggtctga-ata-aatagctcatttccaaa------c
                 Killer whale  -------cat-----ctgtacagcg-a-ag---gggtctga-ata-aatagctcatttccaaa------c
             Tibetan antelope  -------catcccaactgtgtactg-a-ag---gggtggga-ctaggataactgattcaaaaa------c
                          Cow  -------cat-----ctgtacaatg-a-ag---gggtctga-ata-aacggctcatttcttaa------t
                        Sheep  -------cat-----ctgtacaatg-a-ac---gggtctga-ata-aacggctcatttccaaa------c
                        Horse  -------cat-----ctgcacaatg-a-ag---acgtttga-ata-aataac-agtttccagt------c
             White rhinoceros  ctcatctcat-----ctgtataatg-a-cggatgagctagg-ata-gggga----ttcacaaa------c
                          Dog  -------cat-----ctgtacaatg-c-aa---gagtttga-ata-aataactggtttccaaa------t
                 Weddell seal  -------cgt-----ctgtgcaatg-c-aa---gagtttga-ata-aataactggtttccaca------c
             Black flying-fox  -------cag-----ctgtacaatt-c-ag---gagtttaa-ata-aatacctgatttccaaa------c
                      Megabat  -------cag-----ctgtacaatt-c-aa---gagttgaa-ata-aatacctgatttccaaa------c
                     Microbat  -------cct-----ctgcatgaca-a-ag---gggttggt-cta-ggacagtgatggcgaac------c
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  tctgag-------------------ctgtg----------ga----------------------------
                        Chimp  tctgag-------------------ctgtg----------ga----------------------------
                      Gorilla  tctgag-------------------ctgtg----------ga----------------------------
                    Orangutan  tctgag-------------------ctgtg----------ga----------------------------
                       Gibbon  tctgag-------------------c--tg----------ga----------------------------
                       Rhesus  tctgag-------------------ctgtc----------ga----------------------------
          Crab-eating macaque  tctgag-------------------ctgtg----------ga----------------------------
                       Baboon  tctgag-------------------ctgtg----------ga----------------------------
                 Green monkey  tctgag-------------------ctgtg----------ga----------------------------
                     Marmoset  tctgaa-------------------ctgtg----------ga----------------------------
              Squirrel monkey  tctgaa-------------------ctgtg----------ga----------------------------
                     Bushbaby  cctgaaaaggctgcactgggagcccctggg----------gaaggga-----------------gat---
                     Squirrel  ctgagt--------------------tatg----------ga----c-----------------taa---
                 Prairie vole  gctggg--------------------tgtg----------ga----t-----------------taa---
              Chinese hamster  gctgac--------------------tgt-----------ga----t-----------------tag---
                        Mouse  tctgga--------------------tgca----------ga----t-----------------taa---
                          Rat  tctgga--------------------tgtg----------ga----t-----------------taa---
               Naked mole-rat  tctgag-------------------ttgtg----------ga----c-----------------taa---
                   Guinea pig  atggag-------------------ttgtg----------ga----c-----------------aga---
                   Chinchilla  tcagag--------------------cgtg----------ga----c-----------------aga---
             Brush-tailed rat  --------------------------tgtg----------gg----c-----------------aga---
                       Alpaca  tctgat-------------------ttgtg----------gg----t-----------------tga---
               Bactrian camel  tctgat-------------------ttgtg----------gg----t-----------------tga---
                      Dolphin  tctgat-------------------ttgtg----------ga----c-----------------tga---
                 Killer whale  tctgat-------------------ttgtg----------ga----c-----------------tga---
             Tibetan antelope  ---aag-------------------tcatg----------gg----c-----------------tgaatg
                          Cow  tctgat-------------------gtgtg----------ga----c-----------------tga---
                        Sheep  tctgat-------------------gtgtg----------ga----c-----------------tga---
                        Horse  tctgat-------------------ttgtg----------ga----c-----------------tga---
             White rhinoceros  tcaga--------------------tcatg----------ga----c-----------------tga---
                          Dog  tctgat-------------------tggtg----------ga----c-----------------tga---
                 Weddell seal  tctggt-------------------tggt-----------ga----g-----------------tga---
             Black flying-fox  tctgat-------------------tcgtg----------ga----c-----------------tgg---
                      Megabat  tctgat-------------------ttgtg----------ga----c-----------------tgg---
                     Microbat  tatgac-------------------acgtgtgtcagaggtga----catgcgaactcatttttttgg---
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ---------------------------------------------cat----------------------
                        Chimp  ---------------------------------------------cat----------------------
                      Gorilla  ---------------------------------------------cat----------------------
                    Orangutan  ---------------------------------------------cat----------------------
                       Gibbon  ---------------------------------------------cat----------------------
                       Rhesus  ---------------------------------------------cat----------------------
          Crab-eating macaque  ---------------------------------------------cat----------------------
                       Baboon  ---------------------------------------------cat----------------------
                 Green monkey  ---------------------------------------------cat----------------------
                     Marmoset  ---------------------------------------------cat----------------------
              Squirrel monkey  ---------------------------------------------cat----------------------
                     Bushbaby  --gcc----------------------------------------tat----------------------
                     Squirrel  --cta----------------------------------------cat----------------------
                 Prairie vole  --cct----------------------------------------cat----------------------
              Chinese hamster  --cct----------------------------------------cat----------------------
                        Mouse  --gct----------------------------------------tgt----------------------
                          Rat  --gct----------------------------------------tgt----------------------
               Naked mole-rat  --ctg----------------------------------------tat----------------------
                   Guinea pig  --ctg------------------------------------------t----------------------
                   Chinchilla  --ctg----------------------------------------tct----------------------
             Brush-tailed rat  --ttg----------------------------------------tat----------------------
                       Alpaca  --ttc----------------------------------------cat----------------------
               Bactrian camel  --ttc----------------------------------------cat----------------------
                      Dolphin  --tta----------------------------------------cat----------------------
                 Killer whale  --tta----------------------------------------cat----------------------
             Tibetan antelope  attgg----------------------------------------catggaggggaacttactattttta
                          Cow  --tga----------------------------------------tat----------------------
                        Sheep  --tga----------------------------------------tat----------------------
                        Horse  --tta----------------------------------------cat----------------------
             White rhinoceros  --atg----------------------------------------cat----------------------
                          Dog  --tta----------------------------------------cat----------------------
                 Weddell seal  --tta----------------------------------------cat----------------------
             Black flying-fox  --ttg----------------------------------------cat----------------------
                      Megabat  --ttg----------------------------------------cat----------------------
                     Microbat  --ttgatttttctttgttaaatggcatttaaatatataaaataaatat----------------------
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                        Chimp  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                      Gorilla  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                    Orangutan  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                       Gibbon  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                       Rhesus  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
          Crab-eating macaque  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                       Baboon  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                 Green monkey  ----cagaaaca---t----------------------------ttaattca-tgaatc--aga------
                     Marmoset  ----cagaaac---------------------------------ttgatttg-tgaatc--aga------
              Squirrel monkey  ----cagaaac---------------------------------ttgacttg-tgaatc--aga------
                     Bushbaby  ----caaaa-----------------------------------caaagatg-caaatc--aca------
                     Squirrel  ----cagaagga---t----------------------------cacattctttgaatc--aga------
                 Prairie vole  ----gaggaacg---a----------------------------tccacttgttctagc--aga------
              Chinese hamster  ----gagaaatg---t----------------------------cccacttg---tgtc--aga------
                        Mouse  ----gagaaaga---t----------------------------actacttgttgtatc--aga------
                          Rat  ----gagaaaca---t----------------------------cccatttgttgtatc--aga------
               Naked mole-rat  ----ctgaaacatcct----------------------------cctggtcactgaatc--taa------
                   Guinea pig  ----cagaaaca---t----------------------------cccagtcattgaatc--tga------
                   Chinchilla  ----cagaaaca---t----------------------------cccagcctttttatc--tgg------
             Brush-tailed rat  ----cagaaaca---t----------------------------cccagtcattgaatc--tga------
                       Alpaca  ----cagataca---a----------------------------ctgatccg-taaatc--aga------
               Bactrian camel  ----cagataca---t----------------------------ctgatccg-taaatc--aga------
                      Dolphin  ----cagataca---t----------------------------caggttca-taaatc--gga------
                 Killer whale  ----cagataca---t----------------------------caggttca-taaatc--gga------
             Tibetan antelope  agtacagatata---------------------------------ggaat-a-taaatc--taagaaata
                          Cow  ----cagataca---c----------------------------tggattca-taaatc--aga------
                        Sheep  ----cagataca---c----------------------------tggattca-taaatc--aga------
                        Horse  ----cacaaaca---c----------------------------ctgattca-tgaatc--aga------
             White rhinoceros  ----tagaatca---ctggaggggggtacttatttctaaaagtacagatatg-ggaatc--aaa------
                          Dog  ----cagaaaca---t----------------------------cggat-ca-agaacc--aga------
                 Weddell seal  ----caaccaca---t----------------------------cagat-ca-agaatc--aga------
             Black flying-fox  ----cagaaaca---t----------------------------ttgaatca-tgaatc--aga------
                      Megabat  ----cagaaaca---t----------------------------ttgaatca-tgaatc--aga------
                     Microbat  ----caaaaata---t-----------aaatctttgttttactatggtatca-aatatcaaaaa------
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ---atctc--------------------------------------------------------------
                        Chimp  ---atctctg------------------------------------------------------------
                      Gorilla  ---atctctg------------------------------------------------------------
                    Orangutan  ---atctctg------------------------------------------------------------
                       Gibbon  ---atctctg------------------------------------------------------------
                       Rhesus  ---atctctg------------------------------------------------------------
          Crab-eating macaque  ---atctctg------------------------------------------------------------
                       Baboon  ---atctctg------------------------------------------------------------
                 Green monkey  ---atctctg------------------------------------------------------------
                     Marmoset  ---atctctg------------------------------------------------------------
              Squirrel monkey  ---atttctg------------------------------------------------------------
                     Bushbaby  ---aactgtg------------------------------------------------------------
                     Squirrel  ---atctcta------------------------------------------------------------
                 Prairie vole  ---accacca------------------------------------------------------------
              Chinese hamster  ---accatc-------------------------------------------------------------
                        Mouse  ---acaactg------------------------------------------------------------
                          Rat  ---actacta------------------------------------------------------------
               Naked mole-rat  ---a-ctctg------------------------------------------------------------
                   Guinea pig  ---atctcca------------------------------------------------------------
                   Chinchilla  ---gtctctg------------------------------------------------------------
             Brush-tailed rat  ---atctctg------------------------------------------------------------
                       Alpaca  ---gcctttg------------------------------------------------------------
               Bactrian camel  ---gcctttg------------------------------------------------------------
                      Dolphin  ---atttctg------------------------------------------------------------
                 Killer whale  ---atttctg------------------------------------------------------------
             Tibetan antelope  cacattttta------------------------------------------------------------
                          Cow  ---atttctg------------------------------------------------------------
                        Sheep  ---atttctg------------------------------------------------------------
                        Horse  ---ctctctg------------------------------------------------------------
             White rhinoceros  ---atctcta------------------------------------------------------------
                          Dog  -----ctctg------------------------------------------------------------
                 Weddell seal  ---atctctg------------------------------------------------------------
             Black flying-fox  ---atttctg------------------------------------------------------------
                      Megabat  ---atttctg------------------------------------------------------------
                     Microbat  ---atttctatatgtgacacggcaccagagttaagttagggtttttcaaaatgctgacacgccgaggtca
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ----------------------agga----------------tgga--tcc-aagagatg----------
                        Chimp  ----------------------agga----------------tgga--tcc-aagagatg----------
                      Gorilla  ----------------------agga----------------tgga--tcc-aagagatg----------
                    Orangutan  ----------------------agga----------------tgga--tcc-aagagatg----------
                       Gibbon  ----------------------agga----------------tgga--tcc-aagagatg----------
                       Rhesus  ----------------------agga----------------tgga--tcc-aagagctg----------
          Crab-eating macaque  ----------------------agga----------------tgga--tcc-aagagctg----------
                       Baboon  ----------------------agga----------------tgga--tcc-aagagctg----------
                 Green monkey  ----------------------agga----------------tgga--tcc-aagagctg----------
                     Marmoset  ----------------------agga----------------tgga--tcc-aagaaatg----------
              Squirrel monkey  ----------------------agga----------------tgga--tcc-aagaaatg----------
                     Bushbaby  ----------------------aaaa--------------------------atttgctt----------
                     Squirrel  ----------------------atgg----------------tggg--tgg-gagaaatg----------
                 Prairie vole  ----------------------agga----------------tggg--tcc-aagagatg----------
              Chinese hamster  --------------------------------------------gg--tct-aagaaatg----------
                        Mouse  ----------------------agga----------------taga--tcc-aagaagtg----------
                          Rat  ----------------------agga----------------tggc--tcc-aagaaacg----------
               Naked mole-rat  ----------------------aaaa----------------tggg--tcc-aagaaatg----------
                   Guinea pig  ----------------------aaaa----------------tggg--ccc-aagaaatg----------
                   Chinchilla  ----------------------aaaa----------------tggg--ccc-aagaaatg----------
             Brush-tailed rat  ----------------------aaaa----------------tggg--ttc-aagaaatg----------
                       Alpaca  ----------------------agaa----------------tggt--gcccaca-aatg----------
               Bactrian camel  ----------------------agaa----------------tggt--gcccaca-aatg----------
                      Dolphin  ----------------------agca----------------tggt--ccccccagaatg----------
                 Killer whale  ----------------------agca----------------tggt--ccccccagaatg----------
             Tibetan antelope  ----------------------tata----------------ttgtgaatcaccacaat-----------
                          Cow  ----------------------agca----------------tggt--ccccccagaatt----------
                        Sheep  ----------------------agca----------------cggt--ccccccagaatc----------
                        Horse  ----------------------agga----------------tggt--cc--ccaaaatg----------
             White rhinoceros  ----------------------ag-------------------------------aaaca----------
                          Dog  ----------------------agga----------------tggc--cca-caaaactg----------
                 Weddell seal  ----------------------aaga----------------tggt--ccc-ccaaaatg----------
             Black flying-fox  ----------------------agga----------------taat--c---aaaaaacg----------
                      Megabat  ----------------------agga----------------taat--c---aaaaaatg----------
                     Microbat  aaaggttcgccatcactggtctaggaaatctgatccagacactgat--c---aggaactgagtgcatcac
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ---------------------------tacatttttaaa----g----------aacattcaag------
                        Chimp  ---------------------------tacatttttaaa----g----------aacattcaag------
                      Gorilla  ---------------------------tacatttttaaa----g----------aacattcaag------
                    Orangutan  ---------------------------tacatttttaaa----g----------agcattcaag------
                       Gibbon  ---------------------------tacatttttaaa----g----------aacattcaag------
                       Rhesus  ---------------------------tacatttttaaa----g----------aacattcacg------
          Crab-eating macaque  ---------------------------tacatttttaaa----g----------aacattcacg------
                       Baboon  ---------------------------tacatttttaaa----g----------aacattcacg------
                 Green monkey  ---------------------------tacatttttaaa----g----------aacattcacg------
                     Marmoset  ---------------------------tacatttttaaa----g----------agcattcaag------
              Squirrel monkey  ---------------------------tacatttttaaa----g----------agcattcaag------
                     Bushbaby  ---------------------------tttattttaaag----a----------atcccctaaa------
                     Squirrel  ---------------------------tgtattttgaca----g----------aacactaagg------
                 Prairie vole  ---------------------------caatgtccaggg----g----------aacacctaaa------
              Chinese hamster  ---------------------------agatgttgaggg----g----------aacact----------
                        Mouse  ---------------------------tgatgttgaggg----g----------aacacctaaa------
                          Rat  ---------------------------tgatgttgaagg----g----------aacacctaaa------
               Naked mole-rat  ---------------------------tgaattttgaaa----g----------aacactcaaa------
                   Guinea pig  ---------------------------tgaatttggaca----g----------aacactcaag------
                   Chinchilla  ---------------------------tgaattctgaca----g----------aacacttatg------
             Brush-tailed rat  ---------------------------tgaattttgaca----g----------aacactcatg------
                       Alpaca  ---------------------------gacattttaaaa----g----------aatactcaag------
               Bactrian camel  ---------------------------gacattttaaaa----g----------aatactcatg------
                      Dolphin  ---------------------------gacatttttaaa----g----------aacactcaag------
                 Killer whale  ---------------------------gacatttttaaa----g----------aacactcaag------
             Tibetan antelope  ---------------------------ggcatttctgca----gccataaaataaagattggagcaatat
                          Cow  ---------------------------gacatttttaaa----g----------aacattcaag------
                        Sheep  ---------------------------gacatttttaaa----g----------aacattccag------
                        Horse  ---------------------------tacatttttaaa----g----------aacactcaag------
             White rhinoceros  ---------------------------ttgattttaaag----a----------atcccctgga------
                          Dog  ---------------------------tttatttttaat----g----------aacactcaag------
                 Weddell seal  ---------------------------tgtacttttaa-----a----------aacagtcaag------
             Black flying-fox  ---------------------------tacatttttaaa----a----------agcacttgga------
                      Megabat  ---------------------------tacatttttaaa----a----------agcacttgga------
                     Microbat  aatcattggccagggtgtggggatgcttatattctgaaagtaca----------ggtatgtgaa------
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ------------t-aa----ttctgagaa-----------------------------------------
                        Chimp  ------------t-aa----ttctgagaa-----------------------------------------
                      Gorilla  ------------t-aa----ttctgagaa-----------------------------------------
                    Orangutan  ------------t-aa----ttctgagaa-----------------------------------------
                       Gibbon  ------------t-aa----ttctgagaa-----------------------------------------
                       Rhesus  ------------t-aa----ttctgagaa-----------------------------------------
          Crab-eating macaque  ------------t-aa----ttctgagaa-----------------------------------------
                       Baboon  ------------t-aa----ttctgagaa-----------------------------------------
                 Green monkey  ------------t-aa----ttctgagaa-----------------------------------------
                     Marmoset  ------------t-aa----ttctgagaa-----------------------------------------
              Squirrel monkey  ------------t-aa----ttctgagaa-----------------------------------------
                     Bushbaby  ------------t-aa----tttcaaaaa-----------------------------------------
                     Squirrel  ------------tcat----tt-----ga-----------------------------------------
                 Prairie vole  ------------t-at----ttccgagaa-----------------------------------------
              Chinese hamster  ---------------------------aa-----------------------------------------
                        Mouse  ------------t-ac----ttcaaaaaa-----------------------------------------
                          Rat  ------------t-at----tt------------------------------------------------
               Naked mole-rat  ------------t-aa----ct--agaaa-----------------------------------------
                   Guinea pig  ------------t-gg----ta--agaaa-----------------------------------------
                   Chinchilla  ------------t-aa----tt--acaaa-----------------------------------------
             Brush-tailed rat  ------------t-ca----tt--agaaa-----------------------------------------
                       Alpaca  ------------t-aa----ttctgaaaa-----------------------------------------
               Bactrian camel  ------------t-aa----ttctgaaaa-----------------------------------------
                      Dolphin  ------------t-aa----ttctgaaaa-----------------------------------------
                 Killer whale  ------------t-aa----ttctgaaaa-----------------------------------------
             Tibetan antelope  ggcaggggtgtat-aa----tattaagaa-----------------------------------------
                          Cow  ------------t-ag----ttctgaaaa-----------------------------------------
                        Sheep  ------------t-ag----ttctgaaaa-----------------------------------------
                        Horse  ------------c-ag----ttctgaaaa-----------------------------------------
             White rhinoceros  ------------t-aa----ttccaaaag-----------------------------------------
                          Dog  ------------t-aa----ttctgaaaa-----------------------------------------
                 Weddell seal  ------------t-ga----ttctgaaaa-----------------------------------------
             Black flying-fox  ------------t-aa----ttctgaaaa-----------------------------------------
                      Megabat  ------------t-aa----ttctgaaaa-----------------------------------------
                     Microbat  ------------c-caaaatctctgagaaatgccacattttaccgaatctcgaatcccctagataattcc
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  -----g----------------------------------------------------------------
                        Chimp  -----g----------------------------------------------------------------
                      Gorilla  -----g----------------------------------------------------------------
                    Orangutan  -----g----------------------------------------------------------------
                       Gibbon  -----g----------------------------------------------------------------
                       Rhesus  -----a----------------------------------------------------------------
          Crab-eating macaque  -----a----------------------------------------------------------------
                       Baboon  -----a----------------------------------------------------------------
                 Green monkey  -----a----------------------------------------------------------------
                     Marmoset  -----a----------------------------------------------------------------
              Squirrel monkey  -----a----------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Squirrel  -----a----------------------------------------------------------------
                 Prairie vole  -----a----------------------------------------------------------------
              Chinese hamster  -----c----------------------------------------------------------------
                        Mouse  -----acaaaacaaacaaacaaaaaaaccaaaaaccaaaaccaaccaaccaaccaaacaaaaaccaaacc
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  -----a----------------------------------------------------------------
                   Guinea pig  -----a----------------------------------------------------------------
                   Chinchilla  -----a----------------------------------------------------------------
             Brush-tailed rat  -----a----------------------------------------------------------------
                       Alpaca  -----c----------------------------------------------------------------
               Bactrian camel  -----c----------------------------------------------------------------
                      Dolphin  -----a----------------------------------------------------------------
                 Killer whale  -----a----------------------------------------------------------------
             Tibetan antelope  -----a----------------------------------------------------------------
                          Cow  -----a----------------------------------------------------------------
                        Sheep  -----a----------------------------------------------------------------
                        Horse  -----a----------------------------------------------------------------
             White rhinoceros  -----a----------------------------------------------------------------
                          Dog  -----g----------------------------------------------------------------
                 Weddell seal  -----g----------------------------------------------------------------
             Black flying-fox  -----g----------------------------------------------------------------
                      Megabat  -----g----------------------------------------------------------------
                     Microbat  cagaga----------------------------------------------------------------
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  -----------------------------------------------------cagca------------
                        Chimp  -----------------------------------------------------cagca------------
                      Gorilla  -----------------------------------------------------cagca------------
                    Orangutan  -----------------------------------------------------cagca------------
                       Gibbon  -----------------------------------------------------cagca------------
                       Rhesus  -----------------------------------------------------cagca------------
          Crab-eating macaque  -----------------------------------------------------cagca------------
                       Baboon  -----------------------------------------------------cagca------------
                 Green monkey  -----------------------------------------------------cagca------------
                     Marmoset  -----------------------------------------------------cagca------------
              Squirrel monkey  -----------------------------------------------------cagca------------
                     Bushbaby  ------------------------------------------------------agta------------
                     Squirrel  -----------------------------------------------------aaaca------------
                 Prairie vole  -----------------------------------------------------catca------------
              Chinese hamster  -----------------------------------------------------catca------------
                        Mouse  aaaccaaccaaacaaacaaacaaaaaagccccaaaaaacaaaaaccaaaaccccatca------------
                          Rat  -----------------------------------------------------cttca------------
               Naked mole-rat  -----------------------------------------------------cagtg------------
                   Guinea pig  -----------------------------------------------------cagtg------------
                   Chinchilla  -----------------------------------------------------caaag------------
             Brush-tailed rat  -----------------------------------------------------caata------------
                       Alpaca  -----------------------------------------------------cagaa------------
               Bactrian camel  -----------------------------------------------------cagaa------------
                      Dolphin  -----------------------------------------------------cagca------------
                 Killer whale  -----------------------------------------------------cagca------------
             Tibetan antelope  -----------------------------------------------------aaacacagactgtgaat
                          Cow  -----------------------------------------------------caaca------------
                        Sheep  -----------------------------------------------------caata------------
                        Horse  -----------------------------------------------------cagta------------
             White rhinoceros  -----------------------------------------------------tagca------------
                          Dog  -----------------------------------------------------cagca------------
                 Weddell seal  -----------------------------------------------------cagca------------
             Black flying-fox  -----------------------------------------------------cagct------------
                      Megabat  -----------------------------------------------------cagct------------
                     Microbat  -----------------------------------------------------cagga------------
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  ----cat-ttgagcggt---gaag-aactcaat------------------------------------a
                        Chimp  ----cat-ttgagcggt---gaag-aactcaat------------------------------------a
                      Gorilla  ----cat-ttgagcggt---gaag-aactcaat------------------------------------a
                    Orangutan  ----ctt-ttgagcggt---gaag-aactcaat------------------------------------a
                       Gibbon  ----cat-ttgagtggt---gaag-aactcaat------------------------------------g
                       Rhesus  ----cat-ttgagtggc---aaag-aactcaat------------------------------------a
          Crab-eating macaque  ----cat-ttgagtggc---aaag-aactcaat------------------------------------a
                       Baboon  ----cat-ttgagtggc---aaag-aactcaat------------------------------------a
                 Green monkey  ----cat-ttgagtggc---aaag-aactcaat------------------------------------a
                     Marmoset  ----cat-ttgagtggt---aaag-aactcaat------------------------------------a
              Squirrel monkey  ----cat-ttgagtggt---aaag-aactcaat------------------------------------a
                     Bushbaby  ----agtatggggaggc---attg-gaccaaat------------------------------------a
                     Squirrel  ----agt-ttggg-agg---aaag-aaaataat------------------------------------g
                 Prairie vole  ----aga-caaga------------aactagat------------------------------------a
              Chinese hamster  ----gcc-ctgga-ggc----tgg-agccagat------------------------------------g
                        Mouse  ----agc-ttgta-ggc---aagg-acctggac------------------------------------t
                          Rat  ----agc-ttgta-ggc---gggg-aactggac------------------------------------t
               Naked mole-rat  ----att-ttgggaggc---aagg-aactg----------------------------------------
                   Guinea pig  ----ggt-ttggaaggc---aagg-aactggat------------------------------------g
                   Chinchilla  ----agt-ttgaaaggc---aagg-agctggat------------------------------------g
             Brush-tailed rat  ----ggt-ttacagggc---aagg-aactggat------------------------------------g
                       Alpaca  ----------------------tg-aactacat------------------------------------g
               Bactrian camel  ----------------------tg-aactacat------------------------------------g
                      Dolphin  ----aat-ctgagaggc---acta-aactacat------------------------------------g
                 Killer whale  ----aat-ctgagaggc---acta-aactacat------------------------------------g
             Tibetan antelope  agtgtat-gtgata-gc---attgcagctacataaaaatgtgcattgcacacggacaataagatcaaagg
                          Cow  ----tat-ttgagaggc---actg-agatacat------------------------------------g
                        Sheep  ----tat-ttgagaggc---actg-agttacgt------------------------------------g
                        Horse  ----agt-ttgggaggt---gctg-aactagat------------------------------------g
             White rhinoceros  ----agt-tcaagaaacaagactg-gactagataaac--------------------------------a
                          Dog  ----att-ttgggagac---actg-aaccagat------------------------------------g
                 Weddell seal  ----agt-ttgggagac---actc-aactagat------------------------------------g
             Black flying-fox  ----agt-ttgggaggc---aacg-aactagat------------------------------------g
                      Megabat  ----agt-ttgggaggc---aacg-aactagat------------------------------------g
                     Microbat  ----ggt-tcagcaagt---ccgg-gactaggt------------------------------------g
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  aa-----------ctttg----------------------------------------------cggtct
                        Chimp  aa-----------ctttg----------------------------------------------cggtct
                      Gorilla  aa-----------ctttg----------------------------------------------cggtct
                    Orangutan  aa-----------ctttg----------------------------------------------tggtct
                       Gibbon  aa-----------ctttg----------------------------------------------cagtct
                       Rhesus  aa-----------ctttg----------------------------------------------aggtct
          Crab-eating macaque  aa-----------ctttg----------------------------------------------aggtct
                       Baboon  aa-----------c-ttg----------------------------------------------aggtct
                 Green monkey  aa-----------ctttg----------------------------------------------aggtct
                     Marmoset  aa-----------ttttg----------------------------------------------aggtct
              Squirrel monkey  aa-----------ctttg----------------------------------------------acgtct
                     Bushbaby  ga-----------catgg----------------------------------------------agaccc
                     Squirrel  aa-----------ttttg----------------------------------------------acgtct
                 Prairie vole  ac-----------tcctg----------------------------------------------agctct
              Chinese hamster  ac-----------tgctg----------------------------------------------agctct
                        Mouse  a------------tcccg----------------------------------------------ggctct
                          Rat  at-----------tcttg----------------------------------------------ggctct
               Naked mole-rat  -----------------t----------------------------------------------ggatct
                   Guinea pig  aa-----------ctttg----------------------------------------------agatct
                   Chinchilla  aa-----------ctttg----------------------------------------------aggtct
             Brush-tailed rat  aa-----------cttgg----------------------------------------------atgttt
                       Alpaca  aa-----------c--tg----------------------------------------------aatttt
               Bactrian camel  aa-----------c--tg----------------------------------------------aatttt
                      Dolphin  aa-----------ctttg----------------------------------------------agtttt
                 Killer whale  aa-----------ctttg----------------------------------------------agtttt
             Tibetan antelope  aa-----------ctatagaaaataaaaagtatcgcaaaagataaaaatacatacatgtttaacaatctc
                          Cow  aa-----------ctttg----------------------------------------------aatttt
                        Sheep  aa-----------ctttg----------------------------------------------aatttt
                        Horse  aa-----------ctttg----------------------------------------------aagtct
             White rhinoceros  aa-----------ctcca----------------------------------------------atctct
                          Dog  aa-----------ctttg----------------------------------------------aagact
                 Weddell seal  aa-----------ctttg----------------------------------------------aggact
             Black flying-fox  ga-----------ctttg----------------------------------------------aagcaa
                      Megabat  ga-----------ctttg----------------------------------------------aagcaa
                     Microbat  aatagactcagtcccttg----------------------------------------------gag---
                       Rabbit  ======================================================================
                         Pika  ======================================================================
                Domestic goat  ======================================================================
                Big brown bat  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                 Nile tilapia  ======================================================================
           Southern platyfish  ======================================================================
          Princess of Burundi  ======================================================================
                 Atlantic cod  ----------------------------------------------------------------------
                       Lizard  ======================================================================
                         Fugu  ======================================================================
                       Medaka  ======================================================================
                  Spotted gar  ======================================================================
                    Zebrafish  ======================================================================
                  Stickleback  ======================================================================
              Star-nosed mole  ======================================================================
                      Ferret   ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
           American alligator  ======================================================================
                       Turkey  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ======================================================================
                      Wallaby  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ======================================================================

                        Human  c----tt
                        Chimp  c----tt
                      Gorilla  c----tt
                    Orangutan  c----tt
                       Gibbon  c----tt
                       Rhesus  c----tt
          Crab-eating macaque  c----tt
                       Baboon  c----tt
                 Green monkey  c----tt
                     Marmoset  c----tt
              Squirrel monkey  c----tt
                     Bushbaby  c----tt
                     Squirrel  cct----
                 Prairie vole  c------
              Chinese hamster  c------
                        Mouse  c------
                          Rat  c------
               Naked mole-rat  c------
                   Guinea pig  c------
                   Chinchilla  c--tc--
             Brush-tailed rat  c--ct--
                       Alpaca  c------
               Bactrian camel  c------
                      Dolphin  c------
                 Killer whale  c------
             Tibetan antelope  c------
                          Cow  c------
                        Sheep  c------
                        Horse  c------
             White rhinoceros  t------
                          Dog  c------
                 Weddell seal  a------
             Black flying-fox  c------
                      Megabat  c------
                     Microbat  -------
                       Rabbit  =======
                         Pika  =======
                Domestic goat  =======
                Big brown bat  =======
                  Zebra mbuna  =======
        Burton's mouthbreeder  =======
                 Nile tilapia  =======
           Southern platyfish  =======
          Princess of Burundi  =======
                 Atlantic cod  -------
                       Lizard  =======
                         Fugu  =======
                       Medaka  =======
                  Spotted gar  =======
                    Zebrafish  =======
                  Stickleback  =======
              Star-nosed mole  =======
                      Ferret   =======
                 Mallard duck  -------
           American alligator  =======
                       Turkey  =======
       Spiny softshell turtle  -------
     Chinese softshell turtle  -------
               Painted turtle  =======
                      Wallaby  -------
                      Opossum  -------
              Tasmanian devil  =======
              Green seaturtle  =======
           Chinese tree shrew  NNNNNNN
     Mexican tetra (cavefish)  =======

Inserts between block 18 and 19 in window
                  Chinchilla 170bp
            Brush-tailed rat 1bp

Alignment block 19 of 760 in window, 150717469 - 150717498, 30 bps 
B D                     Human  aaagt------------------gttag--gaatacaggatt------ctataagt
B D                     Chimp  aaagt------------------gttag--gaatataggatt------ctataagt
B D                   Gorilla  aaagt------------------gttag--gaatacaggatt------ctataagt
B D                 Orangutan  aaagt------------------gttag--taatataggatt------ctgtaagt
B D                    Gibbon  aaagt------------------gttag--gaatataggatt------ctataagt
B D                    Rhesus  aaagt------------------attag--gaatataggatc------ctacaagt
B D       Crab-eating macaque  aaagt------------------attag--gaatataggatc------ctacaagt
B D                    Baboon  aaagt------------------attag--gaatataggatc------ctacaagt
B D              Green monkey  aaagt------------------attag--gaatataggatc------ctacaagt
B D                  Marmoset  aaagt------------------attag--gaatataggatt------ccacaagt
B D           Squirrel monkey  aaagt------------------attag--gaatacaggatt------ccacgagt
B D                  Bushbaby  ggaga------------------tttga--gattataggaat------ttacaggt
B D                  Squirrel  caagt------------------attaa--gaatatagattt------g--cacgt
                 Prairie vole  ------------------------ttaa--acatgtagaact------gttcttgc
B D           Chinese hamster  ------------------------ttaa--gcatatagaatt------g-ccatgc
B D                     Mouse  ------------------------ttga--gcatatagaact------gcatgtgc
B D                       Rat  ------------------------ttga--gcatatagaatt------gcacctgt
B D            Naked mole-rat  -aaac------------------catta--agaattagaatt------ctatctct
B D                Guinea pig  -aagt------------------tatta--tcagttacagtt------ctacctat
                   Chinchilla  -aaat------------------tatca--tcaactagaatt------ctacctgt
             Brush-tailed rat  -a---------------------tatta--ttaattagaatt------ctacctgt
B D                    Alpaca  agagt------------------attta---------ggatt------ctacatgt
               Bactrian camel  agagt------------------attta---------ggatt------ctacatgt
B D                   Dolphin  agacg------------------attcc--gaatacaggatt------ctacacgt
                 Killer whale  agagg------------------attcc--gaatacaggatt------ctacatgt
             Tibetan antelope  taaataattccaaaagatgccaggttcaatgagtactggactagctaaataaatct
B D                       Cow  agagt------------------attca--aaatacaggaat-------------t
B D                     Sheep  agagt------------------gttca--gaatataggaat-------------t
B D                     Horse  agagg------------------attac--gaatacaggact------c-acaggg
B D          White rhinoceros  ggagt------------------tttaa--gatgataggatt------ctacatgt
B D                       Dog  agagt------------------attaa--gaatatgggctt------ctacatgt
                 Weddell seal  ggagt------------------gttat--gaatatgaa-tt------ctatatgt
             Black flying-fox  agagt------------------attaa--gaatacaggatt------ctacatgt
B D                   Megabat  agagt------------------attaa--aaatacaggatt------ctacatgt
B D                  Microbat  ---gt------------------gt--a--gcatataagatc------ccacatgt
B D                    Rabbit  ========================================================
B D                      Pika  ========================================================
               Domestic goat  ========================================================
               Big brown bat  ========================================================
                 Zebra mbuna  ========================================================
       Burton's mouthbreeder  ========================================================
B D              Nile tilapia  ========================================================
          Southern platyfish  ========================================================
         Princess of Burundi  ========================================================
B D              Atlantic cod  --------------------------------------------------------
B D                    Lizard  ========================================================
B D                      Fugu  ========================================================
B D                    Medaka  ========================================================
                 Spotted gar  ========================================================
B D                 Zebrafish  ========================================================
B D               Stickleback  ========================================================
             Star-nosed mole  ========================================================
B D                   Ferret   ========================================================
  D              Mallard duck  --------------------------------------------------------
B D        American alligator  ========================================================
B D                    Turkey  ========================================================
  D    Spiny softshell turtle  --------------------------------------------------------
  D  Chinese softshell turtle  --------------------------------------------------------
  D            Painted turtle  ========================================================
B D                   Wallaby  --------------------------------------------------------
B D                   Opossum  --------------------------------------------------------
B D           Tasmanian devil  ========================================================
  D           Green seaturtle  ========================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ========================================================

Inserts between block 19 and 20 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
                Killer whale 235bp
            Tibetan antelope 9bp
B D                      Cow 3bp
B D                    Sheep 4bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Dog 1bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
B D                 Microbat 2bp

Alignment block 20 of 760 in window, 150717499 - 150717499, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
B D                  Squirrel  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  =
B D                      Pika  =
B D          White rhinoceros  =
               Domestic goat  =
B D                       Cow  =
B D                     Sheep  =
            Tibetan antelope  =
               Big brown bat  =
                Killer whale  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  -
B D                    Lizard  =
B D                      Fugu  =
B D                    Medaka  =
                 Spotted gar  =
B D                 Zebrafish  =
B D                    Alpaca  =
B D               Stickleback  =
             Star-nosed mole  =
B D                  Microbat  =
B D                   Ferret   =
B D                     Horse  =
            Black flying-fox  =
              Bactrian camel  =
  D              Mallard duck  -
B D        American alligator  =
B D                    Turkey  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  =
B D                   Wallaby  -
B D                   Opossum  -
B D           Tasmanian devil  =
  D           Green seaturtle  =
B D                       Dog  =
          Chinese tree shrew  N
    Mexican tetra (cavefish)  =
                Weddell seal  =
B D                   Dolphin  =
B D                   Megabat  =

Inserts between block 20 and 21 in window
B D                 Bushbaby 1bp
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 21 of 760 in window, 150717500 - 150717563, 64 bps 
B D                     Human  tacattcctcaatga--------ttaagggcca----------------------tttgtcacctcagag
B D                     Chimp  tacattcctcaatga--------ttaagggcca----------------------tttgtcacctcagag
B D                   Gorilla  tacattcctcaatga--------ttaagggcca----------------------tttgtcacctcagag
B D                 Orangutan  tacattcctcaatga--------ttaagggcca----------------------tttgtcacctcagag
B D                    Gibbon  tacattcctcaatga--------ttaagggcca----------------------tttgtcacctcagag
B D                    Rhesus  ----ttcctcaatga--------ttacaggcca----------------------tttgtcacctcagag
B D       Crab-eating macaque  ----ttcctcaatga--------ttacgggcca----------------------tttgtcacctcagag
B D                    Baboon  ----ttcctcaatga--------ttacgggcca----------------------tttgtcacctcagag
B D              Green monkey  tacattcctcaatga--------ttaagggcca----------------------tttgtcacctcagag
B D                  Marmoset  tacattcctcaatga--------ttaagagtca----------------------tttgccacctcagag
B D           Squirrel monkey  tacattcctcaatga--------ttaagagtca----------------------tttgtcacctcagag
B D                  Bushbaby  tattttctctaataa--------ctatatgacc----------------------attttaacctcagat
B D                  Squirrel  tatatttgtgaataa--------ttaagaa-cc----------------------actttcacctcagat
                 Prairie vole  tatattcccagataa--------taaaagc-ca----------------------tttgtcacccaagat
B D           Chinese hamster  tatattcccagataa--------taaaaac-ca----------------------tttgtcacccaagat
B D                     Mouse  tatgttcccagataa--------tagaaa--ca----------------------tttatcgcccgagat
B D                       Rat  taagtttccgggtaa--------taaaaa--ca----------------------tttatcacctgag--
B D            Naked mole-rat  tgtactcctaaataa--------ttaagaaact----------------------tttatcaccccagat
B D                Guinea pig  tatactcctaaacaa--------ttaagaagtt----------------------tttatcaccccaaat
                   Chinchilla  tatacttctaaatta--------ttaagaaatt----------------------cttaccaccccagat
             Brush-tailed rat  tatactcctaaataa--------ttaagatact----------------------tttatcaccccagat
B D                    Alpaca  tacataccccagtaa--------ttaagaatca----------------------tttgtcagcccagat
               Bactrian camel  tacataccccagtaa--------ttaagaatca----------------------tttgtcagcccagat
                 Killer whale  tacgtagctcaataa--------ctaagaacca----------------------tttgtcgtcccagat
             Tibetan antelope  gaagttttaaaagaaaggattgtacaagttttactttttccaataactgcatacctttgtaaccccagat
B D                       Cow  -atgctttacaataa--------aaaagagcta----------------------tttatcaccccaaat
B D                     Sheep  -atgctttacaataaag------aaaagagcta----------------------tttatcaccccagag
B D                     Horse  tacgcccctcaacga--------gttggagcca----------------------tttgt-cacccaaac
B D          White rhinoceros  tacattcttcaataa--------caatacgccc----------------------tttgcacccccatat
B D                       Dog  ta-aagtctcaacaa---------ttga--------------------------------gagcccagat
                 Weddell seal  tatacaccttaacag---------ttgatgcca----------------------tttgttaccccagat
             Black flying-fox  tacagatctcaataa--------ttaagaacga----------------------cttgtcacgc-----
B D                   Megabat  tacagatctcaataa--------ttaagagcca----------------------cttgtcacgc-----
B D                  Microbat  c-ctttcctctatga--------cagtgtgtg-----------------------tttgtaaccccagat
B D                    Rabbit  ======================================================================
B D                      Pika  ======================================================================
               Domestic goat  ======================================================================
               Big brown bat  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                   Ferret   ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
B D                   Dolphin  ======================================================================

                        Human  ttc--------ag----ctgggt-cttactttccttt
                        Chimp  ttc--------ag----ctgggt-cttactttccttt
                      Gorilla  ttc--------aa----ctgggt-cttactttccttt
                    Orangutan  ttc--------ag----ctgggt-cttactttccttt
                       Gibbon  ttc--------ag----ctgggt-cttactttccttt
                       Rhesus  ttc--------ag----ctgggt-cttactttcctct
          Crab-eating macaque  ttc--------ag----ctgggt-cttactttcctct
                       Baboon  ttc--------ag----ctgggt-cttactttcctct
                 Green monkey  ttc--------ag----ctgggt-cttactttcctct
                     Marmoset  ttc--------ag----ctggat-cttactgtactct
              Squirrel monkey  ttc--------ag----ctgggt-attactgtactct
                     Bushbaby  ttc--------gg----c----t-cttatgaaccttg
                     Squirrel  gtc--------ag----tgggg--cttatctctctct
                 Prairie vole  ttc--------at----tcattgttttttttttttct
              Chinese hamster  ttt--------ac----tcaagattttatttttctct
                        Mouse  ttc--------ac----tcggtg-tttgcctttctct
                          Rat  --c--------gt----tcagtg-cttacttttctct
               Naked mole-rat  ttc--------at----ctggg--cttctctctt---
                   Guinea pig  ttc--------ag----ctagg--cttacttctgtct
                   Chinchilla  ttc--------ag----caggg--cttacttttctct
             Brush-tailed rat  ttt--------ag----ctgag--tttgcttctttct
                       Alpaca  ttc--------ag----ctggag-cttacctcctt-t
               Bactrian camel  ttc--------ag----ctggag-cttacctcctt-t
                 Killer whale  tgc--------ag----tgggag-ctcacctccttct
             Tibetan antelope  ttt--------ag--------------------ctgt
                          Cow  ttc--------ag----gaagag-cttatcaccttct
                        Sheep  ttc--------ag----gaagag-cgtatcgccttct
                        Horse  ttc--------aa----------------------ct
             White rhinoceros  ttc--------ag----ct----------------ct
                          Dog  tta--------ag----ctgggg-cttacttctctct
                 Weddell seal  ttgtaagccccag----ctgggg-cttagttcccact
             Black flying-fox  ttc--------ag----ctgggg-ctaccctccctct
                      Megabat  ttc--------ag----ctgggg-ctaccctccctct
                     Microbat  ttc--------agctctctgggc-ctgtcc-------
                       Rabbit  =====================================
                         Pika  =====================================
                Domestic goat  =====================================
                Big brown bat  =====================================
                  Zebra mbuna  =====================================
        Burton's mouthbreeder  =====================================
                 Nile tilapia  =====================================
           Southern platyfish  =====================================
          Princess of Burundi  =====================================
                 Atlantic cod  -------------------------------------
                       Lizard  =====================================
                         Fugu  =====================================
                       Medaka  =====================================
                  Spotted gar  =====================================
                    Zebrafish  =====================================
                  Stickleback  =====================================
              Star-nosed mole  =====================================
                      Ferret   =====================================
                 Mallard duck  -------------------------------------
           American alligator  =====================================
                       Turkey  =====================================
       Spiny softshell turtle  -------------------------------------
     Chinese softshell turtle  -------------------------------------
               Painted turtle  =====================================
                      Wallaby  -------------------------------------
                      Opossum  -------------------------------------
              Tasmanian devil  =====================================
              Green seaturtle  =====================================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  =====================================
                      Dolphin  =====================================

Inserts between block 21 and 22 in window
B D          Squirrel monkey 11bp
B D                 Squirrel 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 117bp

Alignment block 22 of 760 in window, 150717564 - 150717569, 6 bps 
B D                     Human  -aaaaaa
B D                     Chimp  -aaaaaa
B D                   Gorilla  -aaaaaa
B D                 Orangutan  -aaaaaa
B D                    Gibbon  -aaaaaa
B D                    Rhesus  --aaaaa
B D       Crab-eating macaque  -aaaaaa
B D                    Baboon  --aaaaa
B D              Green monkey  --aaaaa
B D                  Marmoset  -aaaaaa
B D           Squirrel monkey  -aaaaaa
B D                  Bushbaby  ---gatt
B D                Guinea pig  ---aaaa
                   Chinchilla  ---aaga
B D                    Alpaca  t------
               Bactrian camel  t------
                 Killer whale  t------
             Tibetan antelope  t------
B D                       Cow  t------
B D                     Sheep  t------
B D                     Horse  t------
B D          White rhinoceros  t------
B D                       Dog  t------
                 Weddell seal  t------
             Black flying-fox  t------
B D                   Megabat  t------
B D                    Rabbit  =======
B D                      Pika  =======
                Prairie vole  -------
B D                       Rat  =======
B D                     Mouse  =======
B D           Chinese hamster  =======
               Domestic goat  =======
               Big brown bat  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
B D              Nile tilapia  =======
          Southern platyfish  =======
         Princess of Burundi  =======
B D              Atlantic cod  -------
B D                    Lizard  =======
B D                      Fugu  =======
B D                    Medaka  =======
                 Spotted gar  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
             Star-nosed mole  =======
B D                  Microbat  -------
B D                   Ferret   =======
B D                  Squirrel  =======
  D              Mallard duck  -------
B D        American alligator  =======
B D                    Turkey  =======
  D    Spiny softshell turtle  -------
  D  Chinese softshell turtle  -------
  D            Painted turtle  =======
B D                   Wallaby  -------
B D                   Opossum  -------
B D           Tasmanian devil  =======
  D           Green seaturtle  =======
            Brush-tailed rat  =======
          Chinese tree shrew  NNNNNNN
    Mexican tetra (cavefish)  =======
B D                   Dolphin  =======
B D            Naked mole-rat  -------

Inserts between block 22 and 23 in window
B D               Guinea pig 1bp
                  Chinchilla 1bp

Alignment block 23 of 760 in window, 150717570 - 150717605, 36 bps 
B D                     Human  aaa---aactatttaaaatca---tttcaacc-c-ctcttctaa
B D                     Chimp  aaa-----ctatttaaaatca---tttcaacc-c-ctcttccaa
B D                   Gorilla  aaa-----ctatttaaaatca---tttcaacc-c-ctcttccaa
B D                 Orangutan  aaaa-aaactatttaaaatca---tttcaacc-c-ctcttccaa
B D                    Gibbon  aaa----actatttaaaatca---tttcaacc-c-ctcttccaa
B D                    Rhesus  aat-----ctatttaaaatca---tttcaacc-c-ctgttccaa
B D       Crab-eating macaque  aat-----ctatttaaaatca---tttcaacc-c-ctgttccaa
B D                    Baboon  aat-----ctatttaaaatca---tttcaacc-c-ctgttccaa
B D              Green monkey  aat-----ctatttaaaatca---tttcaacc-c-ctgttccaa
B D                  Marmoset  aaa-----ctatttaaagtca---tttcaacc-c-ctgttccaa
B D           Squirrel monkey  aaa-----ctatttaaagtca---tttcaacc-c-ctgttccaa
B D                  Bushbaby  aac---------------------tttcaacc-c-acattccaa
B D                  Squirrel  ---aaaaactatttaaaataa---tatcaacc---ccatttgaa
                 Prairie vole  ------------------------ctttggct-t-ccactctga
B D           Chinese hamster  ---aaaaaccattgaatataa---tgtcagct-t-ccactctga
B D                     Mouse  ---agaaactatc-aaaggaa---gcccagcc-t-ccactctga
B D                       Rat  ---agaaacgattgaaaggaa---actcagccag-ccactctga
B D            Naked mole-rat  ---aaaaactgtttaaaatca---tttcagca-c-ctttcacag
B D                Guinea pig  --------ttgtttaaaa--------tctaca-t-ccattgcaa
                   Chinchilla  --------ctgtttaaaa--------tcaaca-c-ccactgcaa
             Brush-tailed rat  ---aagcactgcttcaaa--------tcaaca-c-ccactgcag
B D                    Alpaca  ---aaaaattattttaaaaga---ttttaacc-a-ttatttcaa
               Bactrian camel  ---aaaaattattttaaaaga---ttttaacc-c-ttatttcaa
                 Killer whale  ---gaaaattattttaaatga---ttttaacc-c-ccatttcaa
             Tibetan antelope  ---aaga---acctcagaagaactttccaaat-t-ccattccaa
B D                       Cow  ---aaaatttattttaaatga---ttttaacc-c-acatttcaa
B D                     Sheep  ---aaaatgtattttaaatgg---ttttaacc-c-acatttcaa
B D                     Horse  ---aaaaactgtttaaaatca---cttc-aac-c-cccatccaa
B D          White rhinoceros  ---aagaactctggaaaaact---tttcaaat-c-ccaatccaa
B D                       Dog  ---aaaaactaggttaaatca---tttcaaca-c-cctttctaa
                 Weddell seal  ---aaaaactgggtaaaaaca---tatcaaca-c-cctttttaa
             Black flying-fox  ---aaaaactacttaaaatca---tttcaacc-c-ccactccaa
B D                   Megabat  ---aaaaactacttaaaatca---tttcaacc-c-ccactccaa
B D                  Microbat  ---aggaactttctaa----a---tcccagct-taccagctca-
B D                    Rabbit  ============================================
B D                      Pika  ============================================
               Domestic goat  ============================================
               Big brown bat  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
B D              Nile tilapia  ============================================
          Southern platyfish  ============================================
         Princess of Burundi  ============================================
B D              Atlantic cod  --------------------------------------------
B D                    Lizard  ============================================
B D                      Fugu  ============================================
B D                    Medaka  ============================================
                 Spotted gar  ============================================
B D                 Zebrafish  ============================================
B D               Stickleback  ============================================
             Star-nosed mole  ============================================
B D                   Ferret   ============================================
  D              Mallard duck  --------------------------------------------
B D        American alligator  ============================================
B D                    Turkey  ============================================
  D    Spiny softshell turtle  --------------------------------------------
  D  Chinese softshell turtle  --------------------------------------------
  D            Painted turtle  ============================================
B D                   Wallaby  --------------------------------------------
B D                   Opossum  --------------------------------------------
B D           Tasmanian devil  ============================================
  D           Green seaturtle  ============================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ============================================
B D                   Dolphin  ============================================

Inserts between block 23 and 24 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Dog 2bp
                Weddell seal 2bp
            Black flying-fox 206bp
B D                  Megabat 380bp
B D                 Microbat 2bp

Alignment block 24 of 760 in window, 150717606 - 150717639, 34 bps 
B D                     Human  actatg-g--aaaa--ttccaaa-ggccta-----tcc-agaattc
B D                     Chimp  actatg-g--aaaa--ttccaaa-ggccta-----tcc-agaattc
B D                   Gorilla  actatg-g--aaaa--ttccaaa-ggccta-----tcc-agaattc
B D                 Orangutan  actatg-g--aaaa--ttccagt-ggccta-----tcc-agaattc
B D                    Gibbon  actatg-g--aaaa--ttccaat-ggccta-----tcc-agaattc
B D                    Rhesus  actatg-g--aaaa--ttccagt-ggacta-----tcc-agagttc
B D       Crab-eating macaque  actatg-g--aaaa--ttccagt-ggacta-----tcc-agagttc
B D                    Baboon  actatg-g--aaaa--ttccagt-ggacta-----tcc-agagttc
B D              Green monkey  actatg-g--aaaa--ttccagc-gggcta-----tcc-agagttc
B D                  Marmoset  accatg-g--aaaa--ttccaat-agtcta-----tct-agagttc
B D           Squirrel monkey  actagg-g--aaaagtttggaac-aaacta-----cct-ggagttg
B D                  Bushbaby  actata-tacaaag--ttccagt-ggcctg-----ccc-agaattc
B D                  Squirrel  actctgtg--aaag--tcccact-ggcctgggtcccct-ccaacat
                 Prairie vole  gctcca-g--ggag--tcctggg-ggcctg-----ccc-tggcctc
B D           Chinese hamster  actctg-g--ggag--tcctag------------------------
B D                     Mouse  actctg-g--aa-g--ccccagc-gtcctg-----ccc-tgggctt
B D                       Rat  actctg-g--gacg--tcctggt-gtcctg-----ccc-tggattt
B D            Naked mole-rat  actgtg-g--aaag--ctctgt---ggcca-----a----gaggtc
B D                Guinea pig  actgtg-g--aaag--ctcttt---gagcg-----acc-tgagttc
                   Chinchilla  actgtg-g--aaag--cg-------------------c-tgagctc
             Brush-tailed rat  actgtg-g--gaag--ctccag---gccca-----ccc-cgagttc
B D                    Alpaca  tttatg-a--aaa---ttccaat-gactta-----cccaagagttc
               Bactrian camel  tttatg-a--aaa---ttccaat-gactta-----cccgagagttc
                 Killer whale  gatatg-g--aaa---gtccagt-caccta-----ttcgagagttc
             Tibetan antelope  tttgca-g--gaag-ttccaaag-ggcaca-----cccaagagttt
B D                       Cow  tatctg-g--aaa---tcccaat-gaccta-----ctcgagagttt
B D                     Sheep  tatctg-g--aaa---tcccagt-gaccta-----ctcgagagttc
B D                     Horse  tatatg-g--aaaa--gcccaca-gaccta-----ccccagggtac
B D          White rhinoceros  tccgtg-g--gaag--ttctaaatgcccta-----cccaagggttc
B D                       Dog  aataca-g--aaaa--ttccagg-gaccta-----ctggaaagttc
                 Weddell seal  taaacg-g--aaaa--ttctaat-gaccta-----ctcaggagttc
             Black flying-fox  tctgtg-a--gaag--ttctaaa-gggcca-----tccgagggccc
B D                   Megabat  tctgtg-a--gaag--ttctaaa-gggcca-----tccgagggccc
B D                  Microbat  actgtc-a--g------------------------ttcccggaccc
B D                    Rabbit  ==============================================
B D                      Pika  ==============================================
               Domestic goat  ==============================================
               Big brown bat  ==============================================
                 Zebra mbuna  ==============================================
       Burton's mouthbreeder  ==============================================
B D              Nile tilapia  ==============================================
          Southern platyfish  ==============================================
         Princess of Burundi  ==============================================
B D              Atlantic cod  ----------------------------------------------
B D                    Lizard  ==============================================
B D                      Fugu  ==============================================
B D                    Medaka  ==============================================
                 Spotted gar  ==============================================
B D                 Zebrafish  ==============================================
B D               Stickleback  ==============================================
             Star-nosed mole  ==============================================
B D                   Ferret   ==============================================
  D              Mallard duck  ----------------------------------------------
B D        American alligator  ==============================================
B D                    Turkey  ==============================================
  D    Spiny softshell turtle  ----------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------
  D            Painted turtle  ==============================================
B D                   Wallaby  ----------------------------------------------
B D                   Opossum  ----------------------------------------------
B D           Tasmanian devil  ==============================================
  D           Green seaturtle  ==============================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ==============================================
B D                   Dolphin  ==============================================

Inserts between block 24 and 25 in window
B D                 Squirrel 2bp
                Prairie vole 11bp
B D                    Mouse 93bp
B D                      Rat 13bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp

Alignment block 25 of 760 in window, 150717640 - 150717644, 5 bps 
B D                     Human  tgcag
B D                     Chimp  tgcag
B D                   Gorilla  tgcag
B D                 Orangutan  tgcag
B D                    Gibbon  tgcag
B D                    Rhesus  tgtgg
B D       Crab-eating macaque  tgtgg
B D                    Baboon  tgtgg
B D              Green monkey  tgtgg
B D                  Marmoset  tgcag
B D           Squirrel monkey  tgcag
B D                  Bushbaby  tccag
                 Prairie vole  tgcac
B D           Chinese hamster  tgccc
B D                       Rat  tgtac
B D            Naked mole-rat  tccac
B D                Guinea pig  tccag
                   Chinchilla  tccag
             Brush-tailed rat  gccag
B D                    Alpaca  tgtgg
               Bactrian camel  tgtgg
                 Killer whale  tgtgg
             Tibetan antelope  tgtgg
B D                       Cow  tgtgg
B D                     Sheep  tgtgg
B D                     Horse  tgtga
B D          White rhinoceros  tgtga
B D                       Dog  agtga
                 Weddell seal  cgtga
             Black flying-fox  tgcgt
B D                   Megabat  tgcgt
B D                  Microbat  t----
B D                    Rabbit  =====
B D                      Pika  =====
B D                     Mouse  =====
               Domestic goat  =====
               Big brown bat  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
B D              Nile tilapia  =====
          Southern platyfish  =====
         Princess of Burundi  =====
B D              Atlantic cod  -----
B D                    Lizard  =====
B D                      Fugu  =====
B D                    Medaka  =====
                 Spotted gar  =====
B D                 Zebrafish  =====
B D               Stickleback  =====
             Star-nosed mole  =====
B D                   Ferret   =====
B D                  Squirrel  =====
  D              Mallard duck  -----
B D        American alligator  =====
B D                    Turkey  =====
  D    Spiny softshell turtle  -----
  D  Chinese softshell turtle  -----
  D            Painted turtle  =====
B D                   Wallaby  -----
B D                   Opossum  -----
B D           Tasmanian devil  =====
  D           Green seaturtle  =====
          Chinese tree shrew  NNNNN
    Mexican tetra (cavefish)  =====
B D                   Dolphin  =====

Inserts between block 25 and 26 in window
B D                   Rhesus 13bp
B D      Crab-eating macaque 11bp
B D                   Baboon 11bp
B D             Green monkey 13bp
B D                 Marmoset 3bp
B D          Squirrel monkey 3bp
B D                 Bushbaby 3bp

Alignment block 26 of 760 in window, 150717645 - 150717655, 11 bps 
B D                     Human  cactggaaaaa----------
B D                     Chimp  cactggaaaaa----------
B D                   Gorilla  cactggaaaaa----------
B D                 Orangutan  cac------------------
B D                    Gibbon  cac------------------
B D       Crab-eating macaque  cac------------------
B D                    Baboon  cac------------------
B D                  Marmoset  ccctgcagtg-----------
B D           Squirrel monkey  ccctgcagta-----------
B D                  Bushbaby  cccggtag-------------
                 Prairie vole  aca------------------
B D           Chinese hamster  aca------------------
B D                       Rat  atg------------------
B D            Naked mole-rat  ccc------------------
B D                Guinea pig  ccc------------------
                   Chinchilla  tg-------------------
             Brush-tailed rat  cat------------------
B D                    Alpaca  ----------attttcagtag
               Bactrian camel  ----------attttcagtag
                 Killer whale  ----------attccc-ataa
             Tibetan antelope  ----------attctctgtag
B D                       Cow  ----------attccctgtag
B D                     Sheep  ----------attccctgtag
B D                     Horse  ----------at---------
B D          White rhinoceros  ----------at---------
B D                       Dog  ----------at---------
                 Weddell seal  ----------at---------
             Black flying-fox  ----------gt---------
B D                   Megabat  ----------gt---------
B D                    Rabbit  =====================
B D                      Pika  =====================
B D                     Mouse  =====================
               Domestic goat  =====================
               Big brown bat  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
B D              Nile tilapia  =====================
          Southern platyfish  =====================
         Princess of Burundi  =====================
B D              Atlantic cod  ---------------------
B D                    Lizard  =====================
B D                      Fugu  =====================
B D                    Medaka  =====================
                 Spotted gar  =====================
B D                 Zebrafish  =====================
B D               Stickleback  =====================
             Star-nosed mole  =====================
B D                  Microbat  ---------------------
B D                   Ferret   =====================
B D                  Squirrel  =====================
  D              Mallard duck  ---------------------
B D        American alligator  =====================
B D                    Turkey  =====================
  D    Spiny softshell turtle  ---------------------
  D  Chinese softshell turtle  ---------------------
  D            Painted turtle  =====================
B D                   Wallaby  ---------------------
B D                   Opossum  ---------------------
B D           Tasmanian devil  =====================
  D           Green seaturtle  =====================
B D              Green monkey  =====================
B D                    Rhesus  =====================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =====================
B D                   Dolphin  =====================

Inserts between block 26 and 27 in window
B D                    Horse 15bp
B D         White rhinoceros 13bp
B D                      Dog 15bp
                Weddell seal 15bp
            Black flying-fox 10bp
B D                  Megabat 10bp

Alignment block 27 of 760 in window, 150717656 - 150717659, 4 bps 
B D                     Human  gaaa
B D                     Chimp  gaaa
B D                   Gorilla  gaaa
B D                 Orangutan  -aca
B D                    Gibbon  -aca
B D                    Rhesus  caca
B D       Crab-eating macaque  -aca
B D                    Baboon  -aca
B D              Green monkey  caca
B D                  Marmoset  cact
B D           Squirrel monkey  cact
B D                  Bushbaby  caca
B D                  Squirrel  ---t
                 Prairie vole  --ga
B D           Chinese hamster  --ca
B D                       Rat  --at
B D            Naked mole-rat  --gc
B D                Guinea pig  --cc
                   Chinchilla  --cc
             Brush-tailed rat  --cc
B D                    Alpaca  caca
               Bactrian camel  caca
                 Killer whale  ccca
             Tibetan antelope  taca
B D                       Cow  caca
B D                     Sheep  caca
B D                    Rabbit  ====
B D                      Pika  ====
B D          White rhinoceros  ====
B D                     Mouse  ====
               Domestic goat  ====
               Big brown bat  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
B D              Nile tilapia  ====
          Southern platyfish  ====
         Princess of Burundi  ====
B D              Atlantic cod  ----
B D                    Lizard  ====
B D                      Fugu  ====
B D                    Medaka  ====
                 Spotted gar  ====
B D                 Zebrafish  ====
B D               Stickleback  ====
             Star-nosed mole  ====
B D                  Microbat  ----
B D                   Ferret   ====
B D                     Horse  ====
            Black flying-fox  ====
  D              Mallard duck  ----
B D        American alligator  ====
B D                    Turkey  ====
  D    Spiny softshell turtle  ----
  D  Chinese softshell turtle  ----
  D            Painted turtle  ====
B D                   Wallaby  ----
B D                   Opossum  ----
B D           Tasmanian devil  ====
  D           Green seaturtle  ====
B D                       Dog  ====
          Chinese tree shrew  NNNN
    Mexican tetra (cavefish)  ====
                Weddell seal  ====
B D                   Dolphin  ====
B D                   Megabat  ====

Inserts between block 27 and 28 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp

Alignment block 28 of 760 in window, 150717660 - 150717667, 8 bps 
B D                     Human  ttctcatt
B D                     Chimp  ttctcatt
B D                   Gorilla  ttctcatt
B D                 Orangutan  ttctcatt
B D                    Gibbon  ttctcatt
B D                    Rhesus  ttctcatt
B D       Crab-eating macaque  ttctcatt
B D                    Baboon  ttctcatt
B D              Green monkey  ttctcatt
B D                  Marmoset  ttcccact
B D           Squirrel monkey  ttatcatt
B D                  Bushbaby  ctcgtatt
B D                  Squirrel  ctaccact
                 Prairie vole  tca----t
B D           Chinese hamster  tcctcgtt
B D                       Rat  tcctcatt
B D            Naked mole-rat  ttctcatt
B D                Guinea pig  ttctcatt
                   Chinchilla  ttctgatt
             Brush-tailed rat  ttcctgtt
B D                    Alpaca  tcctcttt
               Bactrian camel  tcctcttt
B D                   Dolphin  tcctcatt
                 Killer whale  tcctcatt
             Tibetan antelope  ttctcatt
B D                       Cow  tcctcatt
B D                     Sheep  ttctcatt
B D                     Horse  ttctcatc
B D          White rhinoceros  ttctcatt
B D                       Dog  ttctcatt
                 Weddell seal  ctctcatt
             Black flying-fox  tcctcagc
B D                   Megabat  tcctcagc
                Big brown bat  ttctcatc
B D                  Microbat  -tctcatc
B D                    Rabbit  ========
B D                      Pika  ========
B D                     Mouse  ========
               Domestic goat  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
B D              Nile tilapia  ========
          Southern platyfish  ========
         Princess of Burundi  ========
B D              Atlantic cod  --------
B D                    Lizard  ========
B D                      Fugu  ========
B D                    Medaka  ========
                 Spotted gar  ========
B D                 Zebrafish  ========
B D               Stickleback  ========
             Star-nosed mole  ========
B D                   Ferret   ========
  D              Mallard duck  --------
B D        American alligator  ========
B D                    Turkey  ========
  D    Spiny softshell turtle  --------
  D  Chinese softshell turtle  --------
  D            Painted turtle  ========
B D                   Wallaby  --------
B D                   Opossum  --------
B D           Tasmanian devil  ========
  D           Green seaturtle  ========
          Chinese tree shrew  NNNNNNNN
    Mexican tetra (cavefish)  ========

Alignment block 29 of 760 in window, 150717668 - 150717701, 34 bps 
B D                     Human  ttcttggttgacaaggacattttgctt---catctaa
B D                     Chimp  ttcttggttgacaaggacattttgctt---catctaa
B D                   Gorilla  ttcttggttgacaaggacattttgctt---catctaa
B D                 Orangutan  ttcttggttgacaaggacattttgctt---catctca
B D                    Gibbon  ttcttagttgacaaggacattttgctt---catctaa
B D                    Rhesus  ttcttggttgacaaggacattttgctt---catctaa
B D       Crab-eating macaque  ttcttggttgacaaggacattttgctt---catctaa
B D                    Baboon  ttcttggttgacaaggacattttgctt---catctaa
B D              Green monkey  ttcttggttgacaaggacattttgctt---catctaa
B D                  Marmoset  ttcttagttaacaagggctttttgctt---catctaa
B D           Squirrel monkey  ttcttagttaacaaggactttttgctt---catctaa
B D                  Bushbaby  ttcatctttgacaaggacttcttgctt---tggttaa
B D                  Squirrel  ttcagctttatcagagacttc-atcat---cagctaa
                 Prairie vole  ttcccccaggacaaggtcttcaagctc---ctgcaga
B D           Chinese hamster  ttcctgcaggacaaggtcttcaagttc---ctgcaga
B D                       Rat  tctctctgggacaag--cttctggccc---cttcgga
B D            Naked mole-rat  tccatcttcaacagga-ctttgtgctt---cagctgc
B D                Guinea pig  tccatcttcatcagga-ctttgtcctt---gagctgc
                   Chinchilla  tccacctccgacagga-tttcacgcttcaacagcaat
             Brush-tailed rat  tccacttccaacagga-ctttgtgctc---cagcagg
B D                    Rabbit  ttcatcattgacaagggcttcttgctt---cagctaa
B D                    Alpaca  tccatctttgacaacaacttcttgctt---tagctaa
               Bactrian camel  tccatctttg---acaacttcttgctt---tagctaa
B D                   Dolphin  tccagctttgacaaggacatcttgctt---cagctaa
                 Killer whale  tccagctttgacaaggacatcttgctt---tagctaa
             Tibetan antelope  tccacctttgaccgggacatcttgctt---caggtaa
B D                       Cow  tccacctttggtgaggacctcttgctt---tagctac
B D                     Sheep  tccatctttggcgaggacctcttgctt---tagctac
B D                     Horse  tccacctttgacaaggacttcttgctt---tggctaa
B D          White rhinoceros  tccgttcttgacaaggacatcttgctt---tagctaa
B D                       Dog  tccagcattgacaaggacttcatgctg---tagctac
                 Weddell seal  tccagcatggacaaggacttctggctt---tagctaa
             Black flying-fox  tccatcc-tggacacggcctcttgctt---tagctaa
B D                   Megabat  tccatcc-tggacacggcctcttgctt---tagctaa
                Big brown bat  t---cctatggccagaactcattgcat---tagctat
B D                  Microbat  tccacctttggccaggactccttgcat---tagcaca
B D                      Pika  =====================================
B D                     Mouse  =====================================
               Domestic goat  =====================================
                 Zebra mbuna  =====================================
       Burton's mouthbreeder  =====================================
B D              Nile tilapia  =====================================
          Southern platyfish  =====================================
         Princess of Burundi  =====================================
B D              Atlantic cod  -------------------------------------
B D                    Lizard  =====================================
B D                      Fugu  =====================================
B D                    Medaka  =====================================
                 Spotted gar  =====================================
B D                 Zebrafish  =====================================
B D               Stickleback  =====================================
             Star-nosed mole  =====================================
B D                   Ferret   =====================================
  D              Mallard duck  -------------------------------------
B D        American alligator  =====================================
B D                    Turkey  =====================================
  D    Spiny softshell turtle  -------------------------------------
  D  Chinese softshell turtle  -------------------------------------
  D            Painted turtle  =====================================
B D                   Wallaby  -------------------------------------
B D                   Opossum  -------------------------------------
B D           Tasmanian devil  =====================================
  D           Green seaturtle  =====================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =====================================

Inserts between block 29 and 30 in window
B D                 Squirrel 3bp
                Prairie vole 6bp
B D          Chinese hamster 6bp
B D                      Rat 6bp
B D           Naked mole-rat 6bp
B D               Guinea pig 6bp
                  Chinchilla 6bp
            Brush-tailed rat 6bp
B D                      Cow 5bp
B D                    Sheep 5bp

Alignment block 30 of 760 in window, 150717702 - 150717702, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  c
                 Prairie vole  g
B D           Chinese hamster  c
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Dog  t
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
B D                  Microbat  a
B D                    Rabbit  -
B D                      Pika  =
               Domestic goat  =
B D                       Cow  =
B D                     Sheep  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  -
B D                    Lizard  =
B D                      Fugu  =
B D                    Medaka  =
                 Spotted gar  =
B D                 Zebrafish  =
B D               Stickleback  =
             Star-nosed mole  =
B D                   Ferret   =
  D              Mallard duck  -
B D        American alligator  =
B D                    Turkey  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  =
B D                   Wallaby  -
B D                   Opossum  -
B D           Tasmanian devil  =
  D           Green seaturtle  =
          Chinese tree shrew  N
    Mexican tetra (cavefish)  =

Inserts between block 30 and 31 in window
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                    Horse 6bp
B D         White rhinoceros 5bp
B D                      Dog 6bp
                Weddell seal 6bp
            Black flying-fox 6bp
B D                  Megabat 6bp
               Big brown bat 4bp
B D                 Microbat 6bp

Alignment block 31 of 760 in window, 150717703 - 150717738, 36 bps 
B D                     Human  t------tcttttctctg---aatcttgcaa-ctgtttc-----ttcattt
B D                     Chimp  t------tcttttctctg---aatcttgcaa-ctgtttc-----ttcattt
B D                   Gorilla  t------tcttttctctg---aatcttgcaa-ctgtttc-----ttcattt
B D                 Orangutan  t------tcttttctctg---aatcttgcaa-ctgtttc-----ttcgttt
B D                    Gibbon  t------tcttttctctg---aatcttgcaa-ctgtttc-----ttcattt
B D                    Rhesus  t------tattttctccg---aatcttgcag-ctgtttc-----ttcattt
B D       Crab-eating macaque  t------tattttctccg---aatcttgcag-ctgtttc-----ttcattt
B D                    Baboon  t------tattttctccg---aatcttgcag-ctgtttc-----ttcattt
B D              Green monkey  t------tattttctccg---aatcttgcag-ctgtttc-----ttcattt
B D                  Marmoset  ttcttactctttgctccg---aatctcacag-ctgtttc-----ttccttt
B D           Squirrel monkey  ttcttattctttgctctg---aatctcatag-ctgtttc-----ttcattt
B D                  Bushbaby  cccttgttctctgctctg---aatcttggag-ctgtctt-----ttcattt
B D                  Squirrel  t------tcatcttgttctataatcttgtgg-ctgtttc-----ttcattt
                 Prairie vole  t------tcgctgctctc---agtcttgtgg-ctgcttc-----ttcattt
B D           Chinese hamster  t------tcgttgctctc---agtcttatgg-ctgtttc-----ttcattt
B D                     Mouse  c------tcattgccccc---gctcttacgg-ctgtttc-----ttcagtt
B D                       Rat  t------tcattctcttg---ggtcttatgg-ccgtttc-----ttca-tt
B D            Naked mole-rat  t------tcttagctctg---catctcgtgg-ctattgc-----ttcattt
B D                Guinea pig  c------tcttggctctg---tattttgtga-ctacagc-----ttcactt
                   Chinchilla  t------tcct-gctctg---aatcctgtga-ctgctgc-----ttcgttt
             Brush-tailed rat  t------tcttagctctc---taccccgtgg-ctaccgc-----tgcactt
B D                    Rabbit  a------ttcttgctcta---actagcacaa-atataccagctgttttgtt
B D                       Pig  t------tatttgctttg---agtctcgttggttgtttc-----ctcattt
B D                    Alpaca  t------tctttgctctg---aattttgtgg-ctgtttc-----tccattt
               Bactrian camel  t------tctctgctctg---aattttgtgg-ctgtttc-----tccattt
B D                   Dolphin  t------tcttggctctg---aaccttgtggcctctttc-----ttcattt
                 Killer whale  t------tcttggctctg---aaccttgtgggctctttc-----ttcattt
             Tibetan antelope  c------tcttggttgtg---aatcttgtag-ctctttc-----ttcatgt
B D                       Cow  t------tctagggtttg---aatcttatgg-ctctttc-----ttcattt
B D                     Sheep  t------tctagggtttg---aatcttgtgg-ctctttc-----ttcattt
B D                     Horse  t------tctttgctct----aatcttgtgg-ctgtttc-----ttcattt
B D          White rhinoceros  t------tctttgctct----aatcttgtgg-ctgtttc-----ttcattt
B D                       Dog  t------tctgtgcactg---aatcttctgg-ctgtttc-----ttcactt
                 Weddell seal  t------tctttgcactg---aatcttccag-ctgtttc-----ttcactt
             Black flying-fox  t------tctttgctctg---agtc-tgtgg-ctgtctg-----tcca-tt
B D                   Megabat  t------cctttgctctg---agtc-tgtgg-ctgtctg-----tcca-tt
                Big brown bat  g------cccttgcactg---tatc-tgtgg-ctctttt-----tctattt
B D                  Microbat  g------cctttgc--------atc-tgtgg-ctctttc-----tccattt
B D                      Pika  ===================================================
               Domestic goat  ===================================================
                 Zebra mbuna  ===================================================
       Burton's mouthbreeder  ===================================================
B D              Nile tilapia  ===================================================
          Southern platyfish  ===================================================
         Princess of Burundi  ===================================================
B D              Atlantic cod  ---------------------------------------------------
B D                    Lizard  ===================================================
B D                      Fugu  ===================================================
B D                    Medaka  ===================================================
                 Spotted gar  ===================================================
B D                 Zebrafish  ===================================================
B D               Stickleback  ===================================================
             Star-nosed mole  ===================================================
B D                   Ferret   ===================================================
  D              Mallard duck  ---------------------------------------------------
B D        American alligator  ===================================================
B D                    Turkey  ===================================================
  D    Spiny softshell turtle  ---------------------------------------------------
  D  Chinese softshell turtle  ---------------------------------------------------
  D            Painted turtle  ===================================================
B D                   Wallaby  ---------------------------------------------------
B D                   Opossum  ---------------------------------------------------
B D           Tasmanian devil  ===================================================
  D           Green seaturtle  ===================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===================================================

Alignment block 32 of 760 in window, 150717739 - 150717764, 26 bps 
B D                     Human  ctgctttgatgtcatttatgatcatc
B D                     Chimp  ctgctttgatgtcatttatgatcatc
B D                   Gorilla  ctgctttgatgtcatttatgatcatc
B D                 Orangutan  ctgctctgatgtcatttatgatcgtc
B D                    Gibbon  ctgctctgatgtcatttatgatcgtc
B D                    Rhesus  ctgctctgatatcattgatgatcgtc
B D       Crab-eating macaque  ctgctctgatatcattgatgatcgtc
B D                    Baboon  ctgctctgatgtcattgatgatcgtc
B D              Green monkey  ctgctctgatgtcattgatgatcgtc
B D                  Marmoset  ctgctctgatgtcaattatgatcccc
B D           Squirrel monkey  ctgctctgatgtcaattatgatcctc
B D                  Bushbaby  ctgctcttgcgtttgttatgg-agtc
B D                  Squirrel  cc-------tgttcatcacaggagtt
                 Prairie vole  ctg---------catttgtgga-att
B D           Chinese hamster  ct------------------------
B D                     Mouse  ctgatct-gtgtcatttgtgggcatt
B D                       Rat  ttgatct-gtgtcatttatgggcatt
B D            Naked mole-rat  ctgctcttgtattcgttacaggagtt
B D                Guinea pig  ctgctctcctataggttataggagtt
                   Chinchilla  ctgctctcgtatcagttagaggagtc
             Brush-tailed rat  ctgctctcctaccagttatgggagtc
B D                    Rabbit  ttgttctggtgtaaattatgagagtc
B D                       Pig  cttctc-ggggtcagttaagggagtt
B D                    Alpaca  ctactttggtgtcaattaagggagtt
               Bactrian camel  ctactttggtgtcagttaagggagtt
B D                   Dolphin  ctgctctggtgtcaattaagggagtt
                 Killer whale  ctgctctggtgtcaattaagggagtt
             Tibetan antelope  cacctctggtgtcaattaagggagcc
B D                       Cow  ctgctctgatgtcaattatgggactt
B D                     Sheep  ctgctctgatgtcaattatgggagtt
B D                     Horse  ctg--ctgttgtcaattatggcagct
B D          White rhinoceros  ctgctctgctgtcaattatgggagct
B D                       Dog  ctgctcaggggtcagttataggactt
                 Weddell seal  ctgccccggggtcagttatgggagtt
             Black flying-fox  cggctctgctgtcagtcacgggagtg
B D                   Megabat  cggctctgctgtcagtcacgggagtg
                Big brown bat  ctgctctggtgtcagtcatgggattg
B D                  Microbat  ctgctcttgtgtcagtcatgggagtg
B D                      Pika  ==========================
               Domestic goat  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
B D              Nile tilapia  ==========================
          Southern platyfish  ==========================
         Princess of Burundi  ==========================
B D              Atlantic cod  --------------------------
B D                    Lizard  ==========================
B D                      Fugu  ==========================
B D                    Medaka  ==========================
                 Spotted gar  ==========================
B D                 Zebrafish  ==========================
B D               Stickleback  ==========================
             Star-nosed mole  ==========================
B D                   Ferret   ==========================
  D              Mallard duck  --------------------------
B D        American alligator  ==========================
B D                    Turkey  ==========================
  D    Spiny softshell turtle  --------------------------
  D  Chinese softshell turtle  --------------------------
  D            Painted turtle  ==========================
B D                   Wallaby  --------------------------
B D                   Opossum  --------------------------
B D           Tasmanian devil  ==========================
  D           Green seaturtle  ==========================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ==========================

Alignment block 33 of 760 in window, 150717765 - 150717771, 7 bps 
B D                     Human  tgttcat
B D                     Chimp  tgttcat
B D                   Gorilla  tgttcat
B D                 Orangutan  tgttcat
B D                    Gibbon  tgttcat
B D                    Rhesus  tgttcat
B D       Crab-eating macaque  tgttcat
B D                    Baboon  tgttcat
B D              Green monkey  tgttcat
B D                  Marmoset  tgtttgt
B D           Squirrel monkey  tgcttgt
B D                  Bushbaby  tgctgat
B D                  Squirrel  ---t---
                 Prairie vole  ---t---
B D                     Mouse  ---t---
B D                       Rat  ---t---
B D            Naked mole-rat  ---t---
B D                Guinea pig  ---g---
                   Chinchilla  ---g---
             Brush-tailed rat  ---a---
B D                    Rabbit  ---t---
B D                      Pika  tatt---
B D                       Pig  tgttggt
B D                    Alpaca  ggttggt
               Bactrian camel  ggttggt
B D                   Dolphin  tgttgat
                 Killer whale  tgttgat
             Tibetan antelope  tgctgat
B D                       Cow  tgttgat
B D                     Sheep  tgttgat
B D                     Horse  tggtgat
B D          White rhinoceros  tgttgat
B D                       Dog  tgctgat
                 Weddell seal  tgctgat
             Black flying-fox  tgggggc
B D                   Megabat  tgctggc
                Big brown bat  tgtttat
B D                  Microbat  tattgat
B D           Chinese hamster  -------
               Domestic goat  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
B D              Nile tilapia  =======
          Southern platyfish  =======
         Princess of Burundi  =======
B D              Atlantic cod  -------
B D                    Lizard  =======
B D                      Fugu  =======
B D                    Medaka  =======
                 Spotted gar  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
             Star-nosed mole  =======
B D                   Ferret   =======
  D              Mallard duck  -------
B D        American alligator  =======
B D                    Turkey  =======
  D    Spiny softshell turtle  -------
  D  Chinese softshell turtle  -------
  D            Painted turtle  =======
B D                   Wallaby  -------
B D                   Opossum  -------
B D           Tasmanian devil  =======
  D           Green seaturtle  =======
          Chinese tree shrew  NNNNNNN
    Mexican tetra (cavefish)  =======

Inserts between block 33 and 34 in window
B D                 Squirrel 6bp
                Prairie vole 6bp
B D                    Mouse 6bp
B D                      Rat 10bp
B D           Naked mole-rat 3bp
B D               Guinea pig 3bp
                  Chinchilla 2bp
            Brush-tailed rat 3bp
B D                   Rabbit 1981bp
B D                     Pika 3bp

Alignment block 34 of 760 in window, 150717772 - 150717817, 46 bps 
B D                     Human  tcctacatgcaaaataattaatcacataagg-------cccatgga------gtgaatt
B D                     Chimp  tcctacacgcaaaataattaatcacataagg-------cccatgga------gtgaatt
B D                   Gorilla  tcctacacgcaaaataattaatcacataagg-------cccatgga------gtgaatt
B D                 Orangutan  tcctacacgcaaaataatt-atcacataagg-------cccatgga------gtgaatt
B D                    Gibbon  tcctacacgcaaaataattaatcacataagg-------cccatgga------gtgaatt
B D                    Rhesus  tcctacacgcaaaataaataatcacataagg-------cccatgca------gtgaatc
B D       Crab-eating macaque  tcctacacgcaaaataattaatcacataagg-------cccatgca------gtgaatc
B D                    Baboon  tcctacacgcaaaataattaatcacataagg-------cccatgga------gtgaatc
B D              Green monkey  tcctacacgcaaaataattaatcacataagg-------cccatgca------gtgaatc
B D                  Marmoset  ttctacatgcaaaataattaatcacataatg-------tccatgga------gtcaact
B D           Squirrel monkey  tcctacatgcaaaataattaatcatataagg-------cccatgga------gtgaact
B D                  Bushbaby  ttctacatgcaaaataattaatcatgtaagg-------ccagtggt------aagaact
B D                  Squirrel  ttctatatgcaatacaat--------cag----------ccacacaaatcctgtgggct
                 Prairie vole  tcccgcacccagaacaga--gacacagaa----------ccacaca------gtgagtt
B D           Chinese hamster  ----gtacccagaacagt--gacacagaa----------ccacaca------gtgagtt
B D                     Mouse  ttctgcacacaggacaga--gacatggaa----------tcccaca------gagtgtt
B D                       Rat  ttctgcctacagatcagt--ggcatggag----------tcacata------gtgagtt
B D            Naked mole-rat  ----------------------------------------------------gtgagct
B D                Guinea pig  ----------------------------------------------------gtgaact
                   Chinchilla  ----------------------------------------------------gtgaact
             Brush-tailed rat  ----------------------------------------------------ggggact
B D                    Rabbit  ttctacatgcaaagtatttgatcacatag---------tccaaaca------gtgaatt
B D                      Pika  ttcaagatgcaaaataatttatcacatag---------cttgttgg------tttaatt
B D                       Pig  tgctatttacaaaataacgcctcacacgatgtgatttgcccctggg------gtgaact
B D                    Alpaca  tttcacacacaaaataactaatcacattatgttattttcccacggg------gtgaact
               Bactrian camel  tttcacacacaaaataactaatcacattatgttattttcccatggg------gtgaact
B D                   Dolphin  ttctagacacaaaataaggaatcacattatgtgatttagccctggg------gtaaact
                 Killer whale  ttctagacacaaaataaggaatcacattatgtgatttagccctggg------gtaaact
             Tibetan antelope  ttctagacacaaaataactaatcacatcaagggatttgcccctggg------acaaact
B D                       Cow  gcctagacacaaaataactaatcatatcatgtgatttgcccc-ggg------gtaaact
B D                     Sheep  gcttagacacaaaataactaatcatatcatgtgatttgtcct-ggg------gtaaact
B D                     Horse  ttctacacacaaactaatcaatcacagtagg-------cccgtggg------ttgcact
B D          White rhinoceros  ttctacaga-aaatt-----atcacatgagg-------cccgtggg------gtgaact
B D                       Dog  ttggatgcataagataactaatcacctaagg-------cctgtgga------gtgaact
                 Weddell seal  ttgtatgcacaagatcactcatcacctaagg-------cctgtggg------gtgacct
             Black flying-fox  ttctacgcacaacgt----catcaca-aagg-------cccg-ggg------gtgcacc
B D                   Megabat  ttctacacgcaacgt----catcaca-aagg-------cccg-ggg------gtgcacc
                Big brown bat  ttccg-gtggggcgg------------------------cgg-gag------ggggaca
B D                  Microbat  ttcca-----------------------------------tg-ggg------gtgaaca
               Domestic goat  ===========================================================
                 Zebra mbuna  ===========================================================
       Burton's mouthbreeder  ===========================================================
B D              Nile tilapia  ===========================================================
          Southern platyfish  ===========================================================
         Princess of Burundi  ===========================================================
B D              Atlantic cod  -----------------------------------------------------------
B D                    Lizard  ===========================================================
B D                      Fugu  ===========================================================
B D                    Medaka  ===========================================================
                 Spotted gar  ===========================================================
B D                 Zebrafish  ===========================================================
B D               Stickleback  ===========================================================
             Star-nosed mole  ===========================================================
B D                   Ferret   ===========================================================
  D              Mallard duck  -----------------------------------------------------------
B D        American alligator  ===========================================================
B D                    Turkey  ===========================================================
  D    Spiny softshell turtle  -----------------------------------------------------------
  D  Chinese softshell turtle  -----------------------------------------------------------
  D            Painted turtle  ===========================================================
B D                   Wallaby  -----------------------------------------------------------
B D                   Opossum  -----------------------------------------------------------
B D           Tasmanian devil  ===========================================================
  D           Green seaturtle  ===========================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===========================================================

Alignment block 35 of 760 in window, 150717818 - 150717863, 46 bps 
B D                     Human  ttattgaagg------cttt-g---------------------------------------ggga-----
B D                     Chimp  ttattgaagg------cttt-g---------------------------------------ggga-----
B D                   Gorilla  ttcttcaagg------cttt-g---------------------------------------ggga-----
B D                 Orangutan  ttattgaagg------cttt-g---------------------------------------ggga-----
B D                    Gibbon  tgattgaagg------cttt-g---------------------------------------ggga-----
B D                    Rhesus  ttattgaagg------tttt-g---------------------------------------ggga-----
B D       Crab-eating macaque  ttattgaagg------tttt-g---------------------------------------ggga-----
B D                    Baboon  ttatcaaagg------tttt-g---------------------------------------agga-----
B D              Green monkey  ttattgaagg------tttt-g---------------------------------------ggca-----
B D                  Marmoset  ttattggagg------cttt-g---------------------------------------ggaa-----
B D           Squirrel monkey  ttattgaagg------cttt-g---------------------------------------agga-----
B D                  Bushbaby  ttactgaagg------cttt-a---------------------------------------ggga-----
B D                  Squirrel  gaacttcaggggagaacttg-g---------------------------------------g-ga-----
                 Prairie vole  ctactaaagg------cttt-g---------------------------------------ggga-----
B D           Chinese hamster  ctactaaaag------cttt-g---------------------------------------gaga-----
B D                     Mouse  tgactaaagg------cttt-g---------------------------------------g-ga-----
B D                       Rat  ctattaaagg------cttg-g---------------------------------------g-ga-----
B D            Naked mole-rat  ttactgaagg------attt-a---------------------------------------ggga-----
B D                Guinea pig  tcaatgaaag------ctgt-g---------------------------------------ggga-----
                   Chinchilla  ttactgacag------cttt-g---------------------------------------ggga-----
             Brush-tailed rat  ttactgcagg------cttt-g---------------------------------------ggga-----
B D                       Pig  tcgctgaaga------cttg-g---------------------------------------tggg-----
B D                    Alpaca  ttactgaaga------cttt-gg--------------------------------------cgaa-----
               Bactrian camel  ttactgaagg------cttt-gg--------------------------------------cgag-----
B D                   Dolphin  ttacag-aag------cttt-gggggggtggggtgatgggggtggggtgggtaacggagtgggggggggc
                 Killer whale  ttacag-aag------cttt-gggggggtggggtgatgggggtggggtgggtaacggagt-ggggggggc
             Tibetan antelope  ttactgaaag------cttt-ggggg--------------------------------gt-gggg-----
B D                       Cow  ttactgaaag------cttt-gca-------------------------------------tggg-----
B D                     Sheep  ttactgaaag------cttt-gcg-------------------------------------tggg-----
B D                     Horse  ttcctcaagg------cttg-g---------------------------------------ggag-----
B D          White rhinoceros  ttgctgaagg------cttgtg---------------------------------------gggg-----
B D                       Dog  ttactgagga------ctttgg---------------------------------------ggac-----
                 Weddell seal  ttactgaggg------ttttgg---------------------------------------gggg-----
             Black flying-fox  ttacggaagg------cgtg-a---------------------------------------gggg-----
B D                   Megabat  ttacggaagg------cgtg-a---------------------------------------gggg-----
                Big brown bat  ttacttaagt------cttt-g---------------------------------------gga------
B D                  Microbat  tta-tgaagg------cttt-g---------------------------------------gg-------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
               Domestic goat  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ----------------------------------------------------------------------
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                   Ferret   ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
          Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================

                        Human  -gg-gccagtag-ag-ttcctgcagaaacag
                        Chimp  -gg-gccagtag-ag-ttcctgcagaaacag
                      Gorilla  -gg-gccagtag-ag-ttcctgcagaaacag
                    Orangutan  -gg-gccagtag-ag-ttcctgcagaaacag
                       Gibbon  -gg-gccagtag-ag-tgcctgcagaaacag
                       Rhesus  -gg-gccaggag-ag-ttcctgcagaaacag
          Crab-eating macaque  -gg-gccaggag-ag-ttcctgcagaaacag
                       Baboon  -gg-gccaggag-ag-ttcctgcagaaacag
                 Green monkey  -gg-gccaggag-ag-ttcctgcagaaacag
                     Marmoset  -cg-gccagcgg-ac-ttcctgcagaaacag
              Squirrel monkey  -gg-gccagtgg-ac-ttcctgcagaaacag
                     Bushbaby  -gg-ggtagaggaag-ttcctacagaaacag
                     Squirrel  -ggtggccacgg-ag-ctcctgcagcctag-
                 Prairie vole  -gaggg--aaga-gg-tgttaac--------
              Chinese hamster  -gaggg--atgg-ga-ggtttac--------
                        Mouse  -gatgg--aagg-gg-tattagc--------
                          Rat  -gatgg--gagg-gg-caccagc--------
               Naked mole-rat  -ggtgcctgggg-ag-tgactgcaaaatag-
                   Guinea pig  -gatggctcggg-gg-tgactgcacaattt-
                   Chinchilla  -ggtgactgggg-at-tgactgggcaatag-
             Brush-tailed rat  -ggtggctgggg-gg-cagctgcacagcag-
                          Pig  -at-ga-agggg-gg-ttactgcagaaacag
                       Alpaca  -gt-gacaggag-ag-ttactgcaaaaacat
               Bactrian camel  -gt-gacaggag-ag-ttactgcaaaaacat
                      Dolphin  agc-ggcaggag-cg-ttactgcagagacac
                 Killer whale  agc-ggcaggag-cg-ttactgcagagacac
             Tibetan antelope  -gt-tgcaggag-agaaaactgcagaaatgc
                          Cow  -gc-agcaggag-ag-tgactgcagaaacac
                        Sheep  -gc-agcaggag-ag-cgacagcagaaacac
                        Horse  -gt-agcagggc-ac-ttactgcaggaacac
             White rhinoceros  -tt-ggcagggg-ac-ctactggagaaacac
                          Dog  -gt-ggcaaggg-tg-ttactgcagaaacac
                 Weddell seal  -ct-ggcagggg-tg-ttcctgcagaaacac
             Black flying-fox  -at-ggcagggg-gg-cccctgcagaaacac
                      Megabat  -at-ggcagggg-gg-cccctgcagaaacac
                Big brown bat  ----gtgtgggg-ag-ttcctgaggatacac
                     Microbat  ----gtgggggg-ag-ttcctgcagaaatat
                       Rabbit  -------------------------------
                         Pika  -------------------------------
                Domestic goat  ===============================
                  Zebra mbuna  ===============================
        Burton's mouthbreeder  ===============================
                 Nile tilapia  ===============================
           Southern platyfish  ===============================
          Princess of Burundi  ===============================
                 Atlantic cod  -------------------------------
                       Lizard  ===============================
                         Fugu  ===============================
                       Medaka  ===============================
                  Spotted gar  ===============================
                    Zebrafish  ===============================
                  Stickleback  ===============================
              Star-nosed mole  ===============================
                      Ferret   ===============================
                 Mallard duck  -------------------------------
           American alligator  ===============================
                       Turkey  ===============================
       Spiny softshell turtle  -------------------------------
     Chinese softshell turtle  -------------------------------
               Painted turtle  ===============================
                      Wallaby  -------------------------------
                      Opossum  -------------------------------
              Tasmanian devil  ===============================
              Green seaturtle  ===============================
           Chinese tree shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ===============================

Inserts between block 35 and 36 in window
B D                 Bushbaby 15009bp

Alignment block 36 of 760 in window, 150717864 - 150717903, 40 bps 
B D                     Human  aaacagctctagatttaat-----atgaggcaaatctgttctcca
B D                     Chimp  aaacagctctagatttaat-----atgaggcaaatctgttctcca
B D                   Gorilla  aaacagctctagatttaat-----acgaggcaaatctgttctcca
B D                 Orangutan  aaacagctctagatctaat-----atgaggcaaatctgttctcca
B D                    Gibbon  aaacagctctagatttaat-----atgaggcaaatctgttctcca
B D                    Rhesus  aaacagctctagatttaatagaggatgaggcaaacctgttctcca
B D       Crab-eating macaque  aaacagctctagatttaatagaggatgaggcaaacctgttctcca
B D                    Baboon  aaacagctctagatttaatagaggatgaggcaaacctgttctcca
B D              Green monkey  aaacagctctagatttaatagaggatgaggcaaacctgttctcca
B D                  Marmoset  aaacagctctagctttaat-----acaaggcaaacctgttctcca
B D           Squirrel monkey  aaacagctctagctttcac-----acgaggcaaacctgttctcca
B D                  Bushbaby  aagcagccttggcttgagt-----acaaggcaaacctgctctcag
B D                  Squirrel  -aacaccttagggttgaac-----gc--agcaaatccattctcag
                 Prairie vole  ------------------------------ccaacctattcccaa
B D           Chinese hamster  ------------------------------ccaacatgtttccaa
B D                     Mouse  ------------------------------ccatctggtttgcaa
B D                       Rat  ------------------------------ccaacctgtttccaa
B D            Naked mole-rat  aaacagctgcggattgaac-----actaggtaaatctgtgcccaa
B D                Guinea pig  ---tcgctttgggttgaac-----actttgtaaacttgtccccaa
                   Chinchilla  aaacagctttgggttcaac---taactaggtaaacttgaacccaa
             Brush-tailed rat  agatggctttgggctgagc---tagctgggtgagcttgtgcctgg
B D                       Pig  gaagaccttcggattgagt-----tctaggcacacctgtcactag
B D                    Alpaca  gaatagctttggactgagt-----tctaggcaaacctgtcatctg
               Bactrian camel  gaatagctttggactgagt-----tctaggcaaacctgtcatctg
B D                   Dolphin  ccacagctttggcttgagc-----tctaggcaaacctaccatctg
                 Killer whale  ccacagctttggcttgagc-----tctaggcaaacctaccatctg
             Tibetan antelope  aaacagttttagcttgagt-----tctggacaaaactgccctctg
B D                       Cow  aaacagcttcggcttgagt-----tctggacaaatttgccctctg
B D                     Sheep  aaacagcttcagcttgagt-----tctggacaaacttggccgccg
B D                     Horse  -gagcaatttggactgagg-----accaggcaaacctgtcctctt
B D          White rhinoceros  -gagcactttggtttgggg-----acctggcaaacctgtcatcta
B D                       Dog  aaaaagctttggactgagt-----atcaggcaatcca--------
                 Weddell seal  aaaacactttggactgagg-----accaggcaaacctgtcacctg
             Black flying-fox  ggacacctttggactgagg-----accagg-aagcccgtcgtcta
B D                   Megabat  ggacacctttggactgagg-----accagg-aagcccgtcgtcta
                Big brown bat  gaacacctttgaattgagg-----accagcccagcccatcatcta
B D                  Microbat  gaacgcctttggattgagg-----accaggccagcccatcatcta
B D                    Rabbit  ---------------------------------------------
B D                      Pika  ---------------------------------------------
               Domestic goat  =============================================
                 Zebra mbuna  =============================================
       Burton's mouthbreeder  =============================================
B