Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 456 in window, 45000923 - 45000924, 2 bps 
B D                     Human  ac--
B D                     Chimp  ac--
B D                   Gorilla  ac--
B D                 Orangutan  ac--
B D                    Gibbon  ac--
B D       Crab-eating macaque  ac--
B D                    Baboon  ac--
B D              Green monkey  ac--
B D                  Marmoset  ac--
B D           Squirrel monkey  ac--
B D                  Bushbaby  ac--
           Chinese tree shrew  gc--
B D                  Squirrel  ac--
                 Prairie vole  ac--
               Golden hamster  ac--
B D                     Mouse  ac--
B D                       Rat  ac--
B D            Naked mole-rat  ac--
B D                Guinea pig  ac--
                   Chinchilla  ac--
             Brush-tailed rat  ac--
B D                      Pika  ac--
B D                       Pig  ac--
               Bactrian camel  ac--
B D                   Dolphin  ac--
                 Killer whale  ac--
             Tibetan antelope  ac--
B D                       Cow  ac--
B D                     Sheep  ac--
                Domestic goat  ac--
B D                     Horse  ac--
B D          White rhinoceros  ac--
B D                       Dog  ac--
B D                   Ferret   ac--
               Pacific walrus  ac--
                 Weddell seal  ac--
             Black flying-fox  ac--
B D                   Megabat  ac--
                Big brown bat  ac--
B D                  Microbat  ac--
B D                  Hedgehog  ac--
B D                     Shrew  ac--
              Star-nosed mole  ac--
B D                  Elephant  ac--
          Cape elephant shrew  ac--
B D                   Manatee  ac--
             Cape golden mole  ac--
                     Aardvark  ac--
B D                 Armadillo  gc--
B D                   Opossum  ----
B D           Tasmanian devil  ----
B D                  Platypus  cg--
B D               Zebra finch  cg--
B D                   Chicken  cc--
B D        American alligator  gg--
  D           Green seaturtle  ac--
  D            Painted turtle  ac--
B D                 Tetraodon  -cgg
        Burton's mouthbreeder  -ttt
                  Zebra mbuna  -ttt
                  Spotted gar  -cct
        David's myotis (bat)  ====
B D                    Alpaca  ----
B D                     Panda  ====
B D           Chinese hamster  ====
B D                       Cat  NNNN
B D                    Rabbit  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
B D                 Zebrafish  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
  D    Spiny softshell turtle  ====
B D                    Turkey  ====
B D                    Rhesus  NNNN

Inserts between block 1 and 2 in window
B D                    Horse 1bp
B D                 Microbat 1bp
B D                  Opossum 8bp
B D          Tasmanian devil 14bp
B D                 Platypus 2bp

Alignment block 2 of 456 in window, 45000925 - 45000928, 4 bps 
B D                     Human  ttc---c--
B D                     Chimp  ttc---c--
B D                   Gorilla  ttc---c--
B D                 Orangutan  ttc---c--
B D                    Gibbon  ttc---c--
B D       Crab-eating macaque  ttc---c--
B D                    Baboon  ttc---c--
B D              Green monkey  ttc---c--
B D                  Marmoset  ttc---c--
B D           Squirrel monkey  ttc---c--
B D                  Bushbaby  ttc---c--
           Chinese tree shrew  ttc---c--
B D                  Squirrel  ttccggc--
                 Prairie vole  ttc---c--
               Golden hamster  ttc---c--
B D                     Mouse  ttc---c--
B D                       Rat  ttc---c--
B D            Naked mole-rat  ttc---c--
B D                Guinea pig  ttc---c--
                   Chinchilla  ttc---c--
             Brush-tailed rat  ttc---c--
B D                      Pika  ttc---c--
B D                       Pig  ttc---c--
B D                    Alpaca  ------c--
B D                   Dolphin  ttc---c--
                 Killer whale  ttc---c--
             Tibetan antelope  ttc---c--
B D                       Cow  ttc---c--
B D                     Sheep  ttc---c--
                Domestic goat  ttc---c--
B D                     Horse  ttc---c--
B D          White rhinoceros  ttc---c--
B D                       Dog  ttc---c--
B D                   Ferret   ttc---c--
               Pacific walrus  ttc---c--
                 Weddell seal  ttc---c--
             Black flying-fox  ttc---c--
B D                   Megabat  ttc---c--
                Big brown bat  ttc---c--
B D                  Microbat  ttc---c--
B D                  Hedgehog  ttc---c--
B D                     Shrew  ttc---c--
              Star-nosed mole  ttc---c--
B D                  Elephant  ttc---c--
          Cape elephant shrew  ttc---c--
B D                   Manatee  ttc---c--
             Cape golden mole  ttc---c--
                     Aardvark  ttc---c--
B D                 Armadillo  cct---c--
B D                   Opossum  ctc---t--
B D           Tasmanian devil  cgc---t--
B D                  Platypus  atc------
B D               Zebra finch  tgc---a--
B D                   Chicken  tcc---c--
B D        American alligator  ttc---c--
  D           Green seaturtle  ccc---c--
  D            Painted turtle  ccc---t--
B D                 Tetraodon  --c---tca
        Burton's mouthbreeder  --t---tgc
                  Zebra mbuna  --t---tgc
                  Spotted gar  --c---t--
        David's myotis (bat)  =========
              Bactrian camel  NNNNNNNNN
B D                     Panda  =========
B D           Chinese hamster  =========
B D                       Cat  NNNNNNNNN
B D                    Rabbit  =========
      Lesser Egyptian jerboa  =========
B D                    Tenrec  =========
B D                 Zebrafish  =========
B D               Stickleback  =========
    Mexican tetra (cavefish)  =========
  D    Spiny softshell turtle  =========
B D                    Turkey  =========
B D                    Rhesus  NNNNNNNNN

Inserts between block 2 and 3 in window
B D          Tasmanian devil 5bp
B D                 Platypus 209bp

Alignment block 3 of 456 in window, 45000929 - 45000932, 4 bps 
B D                     Human  -ggcg
B D                     Chimp  -ggcg
B D                   Gorilla  -ggcg
B D                 Orangutan  -ggcg
B D                    Gibbon  -ggcg
B D       Crab-eating macaque  -ggcg
B D                    Baboon  -ggcg
B D              Green monkey  -ggcg
B D                  Marmoset  -ggcg
B D           Squirrel monkey  -ggcg
B D                  Bushbaby  -ggcg
           Chinese tree shrew  -ggca
B D                  Squirrel  -ggcg
                 Prairie vole  -ggcg
               Golden hamster  -ggcg
B D                     Mouse  -ggcg
B D                       Rat  -ggcg
B D            Naked mole-rat  -ggcg
B D                Guinea pig  -ggcg
                   Chinchilla  -ggcg
             Brush-tailed rat  -ggcg
B D                      Pika  -ggca
B D                       Pig  -ggtg
B D                    Alpaca  -agcg
B D                   Dolphin  -ggtg
                 Killer whale  -ggtg
             Tibetan antelope  -ggc-
B D                       Cow  -ggca
B D                     Sheep  -ggca
                Domestic goat  -ggca
B D                     Horse  -ggca
B D          White rhinoceros  -ggcg
B D                       Dog  -ggcg
B D                   Ferret   -ggcg
               Pacific walrus  -ggcg
                 Weddell seal  -ggcg
             Black flying-fox  -ggcg
B D                   Megabat  -ggcg
                Big brown bat  -ggtg
B D                  Microbat  -ggtg
B D                  Hedgehog  -ggtg
B D                     Shrew  -ggcg
              Star-nosed mole  -ggtg
B D                  Elephant  -ggcg
          Cape elephant shrew  -ggtg
B D                   Manatee  -ggcg
             Cape golden mole  -ggtg
                     Aardvark  -ggtg
B D                 Armadillo  -ggcg
B D                   Opossum  --gcg
B D           Tasmanian devil  -ggcg
B D                  Platypus  -ggag
B D               Zebra finch  -ggtg
B D                   Chicken  -ggct
B D        American alligator  -cgcg
  D           Green seaturtle  -ggtg
  D            Painted turtle  -ggtg
B D                 Tetraodon  aagc-
        Burton's mouthbreeder  ggat-
                  Zebra mbuna  ggat-
                  Spotted gar  ---c-
        David's myotis (bat)  =====
              Bactrian camel  NNNNN
B D                     Panda  =====
B D           Chinese hamster  =====
B D                       Cat  NNNNN
B D                    Rabbit  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
B D                 Zebrafish  =====
B D               Stickleback  =====
    Mexican tetra (cavefish)  =====
  D    Spiny softshell turtle  =====
B D                    Turkey  =====
B D                    Rhesus  NNNNN

Alignment block 4 of 456 in window, 45000933 - 45000933, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
                 Prairie vole  a
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D                       Dog  g
B D                   Ferret   g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  t
B D                  Microbat  t
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                 Armadillo  c
B D                   Opossum  g
B D           Tasmanian devil  g
B D                  Platypus  a
B D               Zebra finch  g
B D                   Chicken  a
B D        American alligator  g
  D           Green seaturtle  a
  D            Painted turtle  a
B D                 Tetraodon  g
        Burton's mouthbreeder  g
                  Zebra mbuna  g
                  Spotted gar  a
            Tibetan antelope  -
        David's myotis (bat)  =
              Bactrian camel  N
B D                     Panda  =
B D           Chinese hamster  =
B D                       Cat  N
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D          White rhinoceros  N
B D                 Zebrafish  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
  D    Spiny softshell turtle  =
B D                    Turkey  =
B D                    Rhesus  N

Inserts between block 4 and 5 in window
B D                     Pika 758bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp

Alignment block 5 of 456 in window, 45000934 - 45000935, 2 bps 
B D                     Human  cg
B D                     Chimp  cg
B D                   Gorilla  cg
B D                 Orangutan  cg
B D                    Gibbon  cg
B D       Crab-eating macaque  cg
B D                    Baboon  cg
B D              Green monkey  cg
B D                  Marmoset  cg
B D           Squirrel monkey  cg
B D                  Bushbaby  cg
           Chinese tree shrew  cg
B D                       Pig  cg
B D                    Alpaca  cg
B D                   Dolphin  cg
                 Killer whale  cg
B D                       Cow  cg
B D                     Sheep  cg
                Domestic goat  cg
B D                     Horse  gg
B D                       Dog  cg
B D                   Ferret   cg
               Pacific walrus  cg
                 Weddell seal  cg
             Black flying-fox  cg
B D                   Megabat  cg
                Big brown bat  ct
B D                  Microbat  ct
B D                  Hedgehog  cg
B D                     Shrew  cg
              Star-nosed mole  cg
B D                  Elephant  -a
          Cape elephant shrew  -g
B D                   Manatee  -g
             Cape golden mole  -g
                     Aardvark  -g
B D                 Armadillo  -g
B D                   Opossum  cc
B D           Tasmanian devil  ca
B D                  Platypus  ag
B D               Zebra finch  ca
B D                   Chicken  cg
B D        American alligator  gg
  D           Green seaturtle  ag
  D            Painted turtle  ag
B D                 Tetraodon  ca
        Burton's mouthbreeder  tg
                  Zebra mbuna  tg
                  Spotted gar  ca
            Tibetan antelope  --
        David's myotis (bat)  ==
              Bactrian camel  NN
B D                     Mouse  --
B D                     Panda  ==
B D                       Rat  --
                Prairie vole  --
B D           Chinese hamster  ==
              Golden hamster  --
B D                  Squirrel  --
B D                       Cat  NN
B D                      Pika  ==
B D            Naked mole-rat  --
B D                    Rabbit  ==
                  Chinchilla  --
B D                Guinea pig  --
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  --
B D                    Tenrec  ==
B D          White rhinoceros  NN
B D                 Zebrafish  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
  D    Spiny softshell turtle  ==
B D                    Turkey  ==
B D                    Rhesus  NN

Inserts between block 5 and 6 in window
  D          Green seaturtle 21bp
  D           Painted turtle 21bp

Alignment block 6 of 456 in window, 45000936 - 45000938, 3 bps 
B D                     Human  cgg
B D                     Chimp  cgg
B D                   Gorilla  cgg
B D                 Orangutan  cgg
B D                    Gibbon  cgg
B D       Crab-eating macaque  cgg
B D                    Baboon  cgg
B D              Green monkey  cgt
B D                  Marmoset  cgg
B D           Squirrel monkey  cgg
B D                  Bushbaby  cgg
           Chinese tree shrew  cga
B D                  Squirrel  -ga
                 Prairie vole  -gc
               Golden hamster  -gc
B D                     Mouse  -gc
B D                       Rat  -gc
B D                       Pig  cga
B D                    Alpaca  ctg
B D                   Dolphin  cga
                 Killer whale  cga
             Tibetan antelope  --g
B D                       Cow  cga
B D                     Sheep  cga
                Domestic goat  cga
B D                     Horse  cca
B D                       Dog  cga
B D                   Ferret   cga
               Pacific walrus  cga
                 Weddell seal  cga
             Black flying-fox  cga
B D                   Megabat  cga
                Big brown bat  gga
B D                  Microbat  gga
B D                  Hedgehog  cga
B D                     Shrew  cga
              Star-nosed mole  cga
B D                  Elephant  ccg
          Cape elephant shrew  tgg
B D                   Manatee  ccg
             Cape golden mole  tcg
                     Aardvark  ctg
B D                 Armadillo  c-g
B D                   Opossum  cgg
B D           Tasmanian devil  cgg
B D                  Platypus  cgg
B D                 Tetraodon  cgg
        Burton's mouthbreeder  agg
                  Zebra mbuna  agg
                  Spotted gar  tgg
        David's myotis (bat)  ===
              Bactrian camel  NNN
B D                     Panda  ===
B D           Chinese hamster  ===
B D                       Cat  NNN
B D                      Pika  ===
B D            Naked mole-rat  ---
B D                    Rabbit  ===
                  Chinchilla  ---
B D                Guinea pig  ---
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ---
B D                    Tenrec  ===
B D          White rhinoceros  NNN
B D                 Zebrafish  ===
B D               Stickleback  ===
    Mexican tetra (cavefish)  ===
  D    Spiny softshell turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ---
B D               Zebra finch  ---
  D            Painted turtle  ===
B D                    Rhesus  NNN
B D        American alligator  ---

Inserts between block 6 and 7 in window
B D                 Elephant 1bp
         Cape elephant shrew 3bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 7 of 456 in window, 45000939 - 45000943, 5 bps 
B D                     Human  ga-----ggc---
B D                     Chimp  ga-----ggc---
B D                   Gorilla  ga-----ggc---
B D                 Orangutan  ga-----ggc---
B D                    Gibbon  ga-----ggc---
B D       Crab-eating macaque  ga-----ggc---
B D                    Baboon  ga-----ggc---
B D              Green monkey  ga-----ggc---
B D                  Marmoset  ga-----ggc---
B D           Squirrel monkey  ga-----ggc---
B D                  Bushbaby  gc-----ggc---
           Chinese tree shrew  ga-----ggc---
B D                  Squirrel  ga-----ggc---
                 Prairie vole  ga-----ggc---
               Golden hamster  ga-----gga---
B D                     Mouse  ga-----ggc---
B D                       Rat  ga-----ggc---
B D            Naked mole-rat  -------ggg---
B D                Guinea pig  -------ggc---
                   Chinchilla  -------ggc---
             Brush-tailed rat  -------ggt---
B D                       Pig  gg-----gac---
B D                   Dolphin  ag-----ggc---
                 Killer whale  ag-----ggc---
             Tibetan antelope  ag-----ggc---
B D                       Cow  ag-----ggc---
B D                     Sheep  ag-----ggc---
                Domestic goat  ag-----ggc---
B D                     Horse  -g-----ggc---
B D                       Dog  gg-----ggc---
B D                   Ferret   gg-----ggc---
               Pacific walrus  gg-----ggc---
                 Weddell seal  gg-----ggt---
             Black flying-fox  gg-----cac---
B D                   Megabat  gg-----cac---
                Big brown bat  gg------gc---
B D                  Microbat  gg------gc---
B D                  Hedgehog  gg-----gga---
B D                     Shrew  ggagcgaggg---
              Star-nosed mole  gg-----gga---
B D                  Elephant  gc-----ggc---
          Cape elephant shrew  gc-----gtt---
B D                   Manatee  gt-----ggc---
             Cape golden mole  gt-----ggc---
                     Aardvark  gt-----ggc---
B D                 Armadillo  gg-----ggc---
B D                   Opossum  ga-----ctc---
B D           Tasmanian devil  ga-----gat---
B D                  Platypus  -------ggc---
B D               Zebra finch  -g-----ggc---
B D                   Chicken  -a-----agc---
B D        American alligator  -a-----ggg---
  D           Green seaturtle  -a-----tgc---
  D            Painted turtle  -a-----tgc---
  D  Chinese softshell turtle  -c-----ggt---
B D                 Tetraodon  --------gcgcg
        Burton's mouthbreeder  --------aaggg
                  Zebra mbuna  --------aaggg
                  Spotted gar  --------acg--
        David's myotis (bat)  =============
              Bactrian camel  NNNNNNNNNNNNN
B D                    Alpaca  -------------
B D                     Panda  =============
B D           Chinese hamster  =============
B D                       Cat  NNNNNNNNNNNNN
B D                      Pika  =============
B D                    Rabbit  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
B D          White rhinoceros  NNNNNNNNNNNNN
B D                 Zebrafish  =============
B D               Stickleback  =============
    Mexican tetra (cavefish)  =============
  D    Spiny softshell turtle  =============
B D                    Turkey  =============
B D                    Rhesus  NNNNNNNNNNNNN

Inserts between block 7 and 8 in window
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 7bp
B D                      Cow 4bp
B D                    Sheep 4bp
               Domestic goat 123bp
B D                 Platypus 2bp
B D              Zebra finch 8bp
B D                  Chicken 6bp
B D       American alligator 4bp
  D          Green seaturtle 4bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 4bp

Alignment block 8 of 456 in window, 45000944 - 45000951, 8 bps 
B D                     Human  gccc-------------ag--cg
B D                     Chimp  gccc-------------ag--cg
B D                   Gorilla  gccc-------------ag--cg
B D                 Orangutan  gccc-------------ag--cg
B D                    Gibbon  gtcc-------------ag--cg
B D       Crab-eating macaque  gccc-------------ag--cg
B D                    Baboon  gccc-------------ag--cg
B D              Green monkey  gccc-------------ag--cg
B D                  Marmoset  gcct-------------ag--tg
B D           Squirrel monkey  gcct-------------ag--tg
B D                  Bushbaby  gagc-------------ag---g
           Chinese tree shrew  gcgc-------------gg--tg
B D                  Squirrel  gcgg-------------gg--cg
                 Prairie vole  gcga-------------gg--cg
               Golden hamster  gcaa-------------ag--cg
B D                     Mouse  gcga-------------gg--cg
B D                       Rat  ggga-------------gg--cg
B D            Naked mole-rat  gcga-------------ggcccg
B D                Guinea pig  gcta-------------ggcccg
                   Chinchilla  gc-a-------------ggcccg
             Brush-tailed rat  gcaa-------------ggtccg
B D                       Pig  gccg-------------gg--cg
B D                   Dolphin  ggcg-------------ag--cg
                 Killer whale  ggcg-------------ag--cg
             Tibetan antelope  tccc-------------gg--tg
B D                       Cow  ggca-------------ag--cg
B D                     Sheep  ggcg-------------ag--cg
B D                     Horse  accg-------------ag--cg
B D                       Dog  gcccagcagcg------ag--cg
B D                   Ferret   gccc-------------ag--cg
               Pacific walrus  gccc-------------ag--cg
                 Weddell seal  gccc-------------ag--cc
             Black flying-fox  cccg-------------ag--cg
B D                   Megabat  cccg-------------ag--cg
                Big brown bat  gccg-------------cg--ct
B D                  Microbat  gccg-------------ag--cg
B D                  Hedgehog  gcgg-------------ag--cg
B D                     Shrew  agcg-------------ag--cg
              Star-nosed mole  tccg-------------tg--tg
B D                  Elephant  gccg-------------ag--gc
          Cape elephant shrew  gctg-------------ag--gc
B D                   Manatee  accc-------------ag--gc
             Cape golden mole  gcgg-------------ag--ac
                     Aardvark  gcgg-------------ag--gc
B D                 Armadillo  gtcg-------------gg--ag
B D                   Opossum  ---------catttcccag--ca
B D           Tasmanian devil  ---------gg------gg--cg
B D                  Platypus  ----------------------g
  D               Rock pigeon  gcct-------------tg--tg
B D               Zebra finch  gccc-------------cg--gg
B D                   Chicken  gacg-------------ag--cg
B D        American alligator  gctt-------------cg--tg
  D           Green seaturtle  gccc-------------aa----
  D            Painted turtle  gccc-------------ag----
  D  Chinese softshell turtle  gcgt-------------gg----
B D                 Tetraodon  tcca-------------gg--cg
        Burton's mouthbreeder  accc-------------ag--cg
                  Zebra mbuna  accc-------------ag--cg
                  Spotted gar  -ccc-------------tg--ct
               Domestic goat  =======================
        David's myotis (bat)  =======================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  -----------------------
B D                     Panda  =======================
B D           Chinese hamster  =======================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNN
B D                      Pika  =======================
B D                    Rabbit  =======================
      Lesser Egyptian jerboa  =======================
B D                    Tenrec  =======================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  =======================
B D               Stickleback  =======================
    Mexican tetra (cavefish)  =======================
  D    Spiny softshell turtle  =======================
B D                    Turkey  =======================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 8 and 9 in window
B D                Tetraodon 4bp

Alignment block 9 of 456 in window, 45000952 - 45000954, 3 bps 
B D                     Human  agc
B D                     Chimp  agc
B D                   Gorilla  agc
B D                 Orangutan  agc
B D                    Gibbon  agc
B D       Crab-eating macaque  agc
B D                    Baboon  agc
B D              Green monkey  agc
B D                  Marmoset  agc
B D           Squirrel monkey  agc
B D                  Bushbaby  agc
           Chinese tree shrew  ggc
B D                  Squirrel  agc
                 Prairie vole  agt
               Golden hamster  agc
B D                     Mouse  ggc
B D                       Rat  agc
B D            Naked mole-rat  gct
B D                Guinea pig  gag
                   Chinchilla  gca
             Brush-tailed rat  gct
B D                       Pig  ggc
B D                   Dolphin  agc
                 Killer whale  agc
             Tibetan antelope  ggc
B D                       Cow  agc
B D                     Sheep  ggc
B D                     Horse  gga
B D                       Dog  agc
B D                   Ferret   agc
               Pacific walrus  agc
                 Weddell seal  agc
             Black flying-fox  agg
B D                   Megabat  agg
                Big brown bat  ggg
B D                  Microbat  ggg
B D                  Hedgehog  atc
B D                     Shrew  agc
              Star-nosed mole  gg-
B D                  Elephant  agc
          Cape elephant shrew  agc
B D                   Manatee  agc
             Cape golden mole  tgc
                     Aardvark  agc
B D                 Armadillo  agc
B D                   Opossum  ttc
B D           Tasmanian devil  tac
B D                  Platypus  gac
  D               Rock pigeon  tct
B D               Zebra finch  gtc
B D                   Chicken  ggc
B D        American alligator  --c
  D           Green seaturtle  --c
  D            Painted turtle  --c
                  Spotted gar  -gt
               Domestic goat  ===
        David's myotis (bat)  ===
              Bactrian camel  NNN
B D                    Alpaca  ---
B D                     Panda  ===
B D           Chinese hamster  ===
B D                       Cat  NNN
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D          White rhinoceros  NNN
B D                 Tetraodon  ===
B D                 Zebrafish  ===
B D               Stickleback  ===
    Mexican tetra (cavefish)  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ---
B D                    Turkey  ===
B D                    Rhesus  NNN

Inserts between block 9 and 10 in window
B D                  Ferret  131bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
B D                 Microbat 4bp
B D                 Hedgehog 4bp
B D                    Shrew 4bp
             Star-nosed mole 4bp
B D                  Opossum 4bp
B D          Tasmanian devil 12bp
B D                 Platypus 7bp

Alignment block 10 of 456 in window, 45000955 - 45000957, 3 bps 
B D                     Human  cag-
B D                     Chimp  cag-
B D                   Gorilla  cag-
B D                 Orangutan  cgg-
B D                    Gibbon  cag-
B D       Crab-eating macaque  cag-
B D                    Baboon  cag-
B D              Green monkey  caa-
B D                  Marmoset  cag-
B D           Squirrel monkey  cag-
B D                  Bushbaby  gag-
           Chinese tree shrew  gag-
B D                  Squirrel  gag-
                 Prairie vole  -ac-
               Golden hamster  -tc-
B D                     Mouse  -ac-
B D                       Rat  -ac-
B D            Naked mole-rat  -ag-
B D                Guinea pig  -ag-
                   Chinchilla  -ag-
             Brush-tailed rat  -ag-
B D                       Pig  gag-
B D                   Dolphin  gag-
                 Killer whale  gag-
             Tibetan antelope  ccg-
B D                       Cow  gag-
B D                     Sheep  gag-
B D                     Horse  gag-
B D                       Dog  cag-
               Pacific walrus  gag-
                 Weddell seal  gag-
             Black flying-fox  gag-
B D                   Megabat  gag-
                Big brown bat  cgg-
B D                  Microbat  tgg-
B D                  Hedgehog  tga-
B D                     Shrew  gcg-
              Star-nosed mole  tag-
B D                  Elephant  gag-
          Cape elephant shrew  -ag-
B D                   Manatee  cag-
             Cape golden mole  aag-
                     Aardvark  gag-
B D                 Armadillo  gcg-
B D                   Opossum  g---
B D           Tasmanian devil  g---
B D                  Platypus  cgg-
  D               Rock pigeon  cag-
B D               Zebra finch  cgc-
B D                   Chicken  cga-
B D        American alligator  tgg-
  D           Green seaturtle  caa-
  D            Painted turtle  cga-
  D  Chinese softshell turtle  cgt-
                  Spotted gar  -aga
               Domestic goat  ====
        David's myotis (bat)  ====
              Bactrian camel  NNNN
B D                    Alpaca  ----
B D                     Panda  ====
B D           Chinese hamster  ====
B D                   Ferret   ====
B D                       Cat  NNNN
B D                      Pika  ====
B D                    Rabbit  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
B D          White rhinoceros  NNNN
B D                 Tetraodon  ====
B D                 Zebrafish  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
  D    Spiny softshell turtle  ====
B D                    Turkey  ====
B D                    Rhesus  NNNN

Inserts between block 10 and 11 in window
B D                      Pig 6bp
B D                    Horse 4bp
B D                      Dog 9bp
              Pacific walrus 8bp
                Weddell seal 1181bp

Alignment block 11 of 456 in window, 45000958 - 45000959, 2 bps 
B D                     Human  ag-
B D                     Chimp  gg-
B D                   Gorilla  gg-
B D                 Orangutan  gg-
B D                    Gibbon  gg-
B D       Crab-eating macaque  gg-
B D                    Baboon  gg-
B D              Green monkey  gg-
B D                  Marmoset  gg-
B D           Squirrel monkey  gg-
B D                  Bushbaby  gg-
           Chinese tree shrew  gg-
B D                  Squirrel  gg-
                 Prairie vole  cg-
               Golden hamster  cg-
B D                     Mouse  cg-
B D                       Rat  cg-
B D            Naked mole-rat  gg-
B D                Guinea pig  gg-
                   Chinchilla  gg-
             Brush-tailed rat  gg-
B D                   Dolphin  -g-
                 Killer whale  -g-
             Tibetan antelope  -g-
B D                       Cow  -g-
B D                     Sheep  -g-
B D                     Horse  -g-
B D                       Dog  -g-
               Pacific walrus  -g-
             Black flying-fox  -g-
B D                   Megabat  -g-
                Big brown bat  -g-
B D                  Microbat  -g-
B D                  Hedgehog  gg-
B D                     Shrew  gg-
              Star-nosed mole  gg-
B D                  Elephant  gg-
          Cape elephant shrew  gg-
B D                   Manatee  gg-
             Cape golden mole  gg-
                     Aardvark  gg-
B D                 Armadillo  gg-
B D                   Opossum  cg-
B D           Tasmanian devil  gg-
B D                  Platypus  ag-
  D               Rock pigeon  tg-
B D               Zebra finch  ag-
B D                   Chicken  ga-
B D        American alligator  gg-
  D           Green seaturtle  ga-
  D            Painted turtle  ga-
  D  Chinese softshell turtle  ga-
                  Spotted gar  -ga
               Domestic goat  ===
        David's myotis (bat)  ===
              Bactrian camel  NNN
B D                    Alpaca  ---
B D                     Panda  ===
B D           Chinese hamster  ===
B D                   Ferret   ===
B D                       Cat  NNN
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D          White rhinoceros  NNN
B D                 Tetraodon  ===
B D                 Zebrafish  ===
B D               Stickleback  ===
    Mexican tetra (cavefish)  ===
  D    Spiny softshell turtle  ===
B D                    Turkey  ===
                Weddell seal  ===
B D                       Pig  ===
B D                    Rhesus  NNN

Inserts between block 11 and 12 in window
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 530bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D                    Horse 1bp
B D                      Dog 1bp
              Pacific walrus 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 4bp
B D                  Opossum 7bp
B D          Tasmanian devil 7bp
  D              Rock pigeon 2bp
B D                  Chicken 1bp
B D       American alligator 8bp
  D          Green seaturtle 7bp
  D           Painted turtle 7bp
  D Chinese softshell turtle 5bp

Alignment block 12 of 456 in window, 45000960 - 45000960, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -c
           Chinese tree shrew  -c
B D                  Squirrel  -c
                 Prairie vole  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                       Pig  -c
B D                   Dolphin  -c
                 Killer whale  -c
B D                       Cow  -c
B D                     Sheep  -c
B D                     Horse  -c
B D                       Dog  -c
               Pacific walrus  -c
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -c
B D                  Microbat  -c
B D                  Hedgehog  -c
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  -c
          Cape elephant shrew  -t
B D                   Manatee  -c
             Cape golden mole  -a
                     Aardvark  -c
B D                 Armadillo  -c
B D                   Opossum  -g
B D           Tasmanian devil  -g
B D                  Platypus  -t
  D           Green seaturtle  -c
  D            Painted turtle  -c
  D  Chinese softshell turtle  -t
                  Spotted gar  g-
               Domestic goat  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
              Bactrian camel  NN
B D                    Alpaca  --
B D                     Panda  ==
B D           Chinese hamster  ==
B D                   Ferret   ==
B D                       Cat  NN
B D                      Pika  ==
B D                    Rabbit  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
B D          White rhinoceros  NN
B D                 Tetraodon  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
  D    Spiny softshell turtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D               Rock pigeon  ==
                Weddell seal  ==
B D                    Rhesus  NN
B D        American alligator  ==

Inserts between block 12 and 13 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp

Alignment block 13 of 456 in window, 45000961 - 45000962, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D       Crab-eating macaque  cg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  gg
B D                  Squirrel  gg
                 Prairie vole  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                       Pig  cg
B D                   Dolphin  gg
                 Killer whale  gg
B D                       Cow  gg
B D                     Sheep  gg
B D                     Horse  gg
B D                       Dog  gg
               Pacific walrus  gg
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  gg
B D                  Microbat  ga
B D                  Hedgehog  gg
B D                     Shrew  ag
              Star-nosed mole  gg
B D                  Elephant  gg
          Cape elephant shrew  gt
B D                   Manatee  gg
             Cape golden mole  gg
                     Aardvark  gg
B D                 Armadillo  gg
B D                   Opossum  gg
B D           Tasmanian devil  gg
B D                  Platypus  gg
  D               Rock pigeon  -g
B D               Zebra finch  -g
B D                   Chicken  -g
B D        American alligator  -g
  D           Green seaturtle  -g
  D            Painted turtle  -g
  D  Chinese softshell turtle  -g
B D                 Tetraodon  ag
                  Spotted gar  gg
               Domestic goat  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
              Bactrian camel  NN
B D                    Alpaca  --
B D                     Panda  ==
B D           Chinese hamster  ==
B D                   Ferret   ==
B D                       Cat  NN
B D                      Pika  ==
B D                    Rabbit  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
B D          White rhinoceros  NN
B D                 Zebrafish  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
  D    Spiny softshell turtle  ==
B D                    Turkey  ==
                Weddell seal  ==
B D                    Rhesus  NN

Inserts between block 13 and 14 in window
B D              Zebra finch 1bp
B D                  Chicken 4bp
B D       American alligator 11bp
  D          Green seaturtle 10bp
  D           Painted turtle 10bp
  D Chinese softshell turtle 6bp

Alignment block 14 of 456 in window, 45000963 - 45000970, 8 bps 
B D                     Human  tg------gc-tggt------
B D                     Chimp  tg------gc-tggt------
B D                   Gorilla  tg------gc-tggt------
B D                 Orangutan  tg------gc-tggt------
B D                    Gibbon  tg------gc-tggt------
B D       Crab-eating macaque  tg------gc-tgat------
B D                    Baboon  cg------gc-tgat------
B D              Green monkey  tg------gc-tgat------
B D                  Marmoset  tg------gc-tgat------
B D           Squirrel monkey  tg------gcttggt------
B D                  Bushbaby  tg------gt-cggc------
           Chinese tree shrew  cg------gg-----------
B D                  Squirrel  cg------gc-cggc------
                 Prairie vole  cg------gc-ct--------
               Golden hamster  cg------gc-ct--------
B D                     Mouse  cg------gc-ct--------
B D                       Rat  cg------gc-ct--------
B D            Naked mole-rat  tg------gc-gg--------
B D                Guinea pig  ta------gc-gg--------
                   Chinchilla  tg------gc-gg--------
             Brush-tailed rat  tg------gc-gg--------
B D                       Pig  cg--gacggc-----------
B D                   Dolphin  cg-----ggc-----------
                 Killer whale  cg-----ggc-----------
B D                       Cow  cg-------------------
B D                     Sheep  cg-------------------
B D                     Horse  cg--gccggc-----------
B D                       Dog  cggcggcggc-----------
               Pacific walrus  cg--ggcggc-----------
             Black flying-fox  ca------gc-----------
B D                   Megabat  ca------gc-----------
                Big brown bat  tg-------------------
B D                  Microbat  ca-------------------
B D                  Hedgehog  cg--gctg-------------
B D                     Shrew  cg--gccggt-----------
              Star-nosed mole  cg--gccggc-----------
B D                  Elephant  cg------gc-cgcg------
          Cape elephant shrew  cg------gc-cgac------
B D                   Manatee  tg------gc-cgca------
             Cape golden mole  ca------tc-tgcg------
                     Aardvark  tg------gc-cgca------
B D                 Armadillo  cg------gc-cgcg------
B D                   Opossum  c--------------------
B D           Tasmanian devil  c--------------------
B D                  Platypus  cg------gc-----------
  D               Rock pigeon  --tgcctggt-----------
B D       Medium ground finch  --tggggggt-----------
B D               Zebra finch  --atgcgagt-----------
B D                   Chicken  --ctgtcgcc-----------
B D        American alligator  --atggcggt-----------
  D           Green seaturtle  --ctataaat-----------
  D            Painted turtle  --ctataaat-----------
  D  Chinese softshell turtle  ---cagcagc-----------
B D                 Tetraodon  -------------cagccctt
                  Spotted gar  -------------gagacc--
               Domestic goat  =====================
            Tibetan antelope  =====================
        David's myotis (bat)  =====================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  ---------------------
B D                     Panda  =====================
B D           Chinese hamster  =====================
B D                   Ferret   =====================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNN
B D                      Pika  =====================
B D                    Rabbit  =====================
      Lesser Egyptian jerboa  =====================
B D                    Tenrec  =====================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  =====================
B D               Stickleback  =====================
    Mexican tetra (cavefish)  =====================
  D    Spiny softshell turtle  =====================
B D                    Turkey  =====================
                Weddell seal  =====================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNN

Inserts between block 14 and 15 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                 Platypus 3bp

Alignment block 15 of 456 in window, 45000971 - 45000987, 17 bps 
B D                     Human  cc-----------cgcgc-------ggt---------gagtggg
B D                     Chimp  cc-----------cgcgc-------ggt---------gagtggg
B D                   Gorilla  cc-----------cgtgc-------ggt---------gagtggg
B D                 Orangutan  cc-----------ttcgc-------ggt---------gagtggg
B D                    Gibbon  ct-----------cgcgc-------ggt---------gagtggg
B D       Crab-eating macaque  cc-----------cgcgc-------ggt---------gagtggg
B D                    Baboon  cc-----------cgcgc-------ggt---------gagtggg
B D              Green monkey  ct-----------cgcgc-------ggt---------gagtggg
B D                  Marmoset  cc-----------cgcac-------ggt---------gagtggg
B D           Squirrel monkey  cc-----------cgcgc-------ggt---------gagtggg
B D                  Bushbaby  cc-----------cgcgc-------ggt---------gagtggg
           Chinese tree shrew  ---------------cgc-------ggt---------gagtggg
B D                  Squirrel  gc-----------ggcgc-------ggt---------gagtggg
                 Prairie vole  --------------gcgc-------ggt---------gagtgcg
               Golden hamster  ----------------gc-------ggt---------gagtgcg
B D                     Mouse  --------------gcgc-------ggt---------gagtacg
B D                       Rat  --------------gcac-------ggt---------gagtgcg
B D            Naked mole-rat  --------------taga-------ggt---------gagtggg
B D                Guinea pig  --------------gaga-------ggt---------gagttgg
                   Chinchilla  --------------gaga-------ggt---------gagtggg
             Brush-tailed rat  --------------gaga-------ggt---------gagtggg
B D                       Pig  -a-----------ggcgc-------ggt---------gagtgg-
B D                   Dolphin  -t-----------ggcgc-------ggt---------gagtgg-
                 Killer whale  -t-----------ggcgc-------ggt---------gagtgg-
B D                       Cow  ----------------gc-------ggt---------gagtgg-
B D                     Sheep  ----------------gc-------ggt---------gagtgg-
B D                     Horse  -cc------------cgc-------ggt---------gagtggc
B D                       Dog  -cc--------gcggcgc-------ggt---------gagtggg
               Pacific walrus  -cc--------gctgcgc-------ggt---------gagtggg
             Black flying-fox  -cc--------gtggcgc-------ggt---------gagtagt
B D                   Megabat  -cc--------gtggcgc-------ggt---------aagtagt
                Big brown bat  -------------ggctt-------ggt---------gagcggg
B D                  Microbat  -------------ggggtccgaagaggc---------gcgtgag
B D                  Hedgehog  ------------cagcgt-------ggt---------gagtggg
B D                     Shrew  ------------cggcgc-------ggt---------gagtggg
B D                  Elephant  -----------cccgcgt-------ggt---------gagtggg
          Cape elephant shrew  -----------ccagcgt-------ggt---------gagtggg
B D                   Manatee  -----------cgggagt-------ggt---------gagtagc
             Cape golden mole  -----------ctcgcgt-------ggt---------gagtggg
                     Aardvark  -----------cccgcgt-------ggt---------gagtagg
B D                 Armadillo  -----------cggccta-------ggt---------gagaggg
B D                   Opossum  ------------------accgct-ggc---------ttgcaag
B D           Tasmanian devil  ------------------ccc-----gg---------atgcagg
B D                  Platypus  -----------ccctcgt-------ggg---------agacggg
  D               Rock pigeon  -------------cctgctga----gtg---------atctggc
B D       Medium ground finch  -------------cccgc-------gtgccc-tgtccctgcggg
B D               Zebra finch  -------------ccccc-------gcg---------gtgcggg
B D                   Chicken  -------------cccgc-------act---------gtgagga
B D        American alligator  -------------cccgc-------gcacaagtggctccccggg
  D           Green seaturtle  -------------gcagt-------gag----------tgtggg
  D            Painted turtle  -------------gtagt-------gaa----------tgtggg
  D  Chinese softshell turtle  -------------gccgt-------ggg----------tgtgtt
B D                 Tetraodon  --cctctgtcctcagtgc-------g------------------
                  Spotted gar  -----------------c-------g------------------
               Domestic goat  ============================================
            Tibetan antelope  ============================================
        David's myotis (bat)  ============================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  --------------------------------------------
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Panda  ============================================
B D           Chinese hamster  ============================================
B D                   Ferret   ============================================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                      Pika  ============================================
B D                    Rabbit  ============================================
      Lesser Egyptian jerboa  ============================================
B D                    Tenrec  ============================================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ============================================
B D               Stickleback  ============================================
    Mexican tetra (cavefish)  ============================================
  D    Spiny softshell turtle  ============================================
B D                    Turkey  ============================================
                Weddell seal  ============================================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 15 and 16 in window
                Prairie vole 1bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 1078bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 4bp
B D          Tasmanian devil 6bp
  D              Rock pigeon 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
B D       American alligator 2bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp

Alignment block 16 of 456 in window, 45000988 - 45000990, 3 bps 
B D                     Human  -at---------t
B D                     Chimp  -at---------t
B D                   Gorilla  -at---------t
B D                 Orangutan  -tt---------t
B D                    Gibbon  -ct---------t
B D       Crab-eating macaque  -cc---------t
B D                    Baboon  -cc---------t
B D              Green monkey  -cc---------t
B D                  Marmoset  -cc---------t
B D           Squirrel monkey  -cctggggtgcgt
B D                  Bushbaby  -cc---------c
           Chinese tree shrew  -cc---------t
B D                  Squirrel  -ct----------
                 Prairie vole  -cc----------
               Golden hamster  -cc----------
B D                     Mouse  -cg----------
B D                       Rat  -cc----------
B D            Naked mole-rat  -cg---------c
B D                Guinea pig  -tg---------c
                   Chinchilla  -cg---------c
             Brush-tailed rat  -cg---------c
B D                  Microbat  ------------c
B D                  Elephant  -ct---------c
          Cape elephant shrew  -ct---------t
B D                   Manatee  -ct---------c
             Cape golden mole  -ct---------c
                     Aardvark  -ct---------c
B D                 Armadillo  -ct----------
B D                   Opossum  -tt---------c
B D           Tasmanian devil  -cc---------c
B D                  Platypus  ----------cat
B D                 Tetraodon  gcc----------
                  Spotted gar  gcg----------
B D                  Hedgehog  -------------
B D                     Shrew  -------------
               Domestic goat  =============
B D                     Sheep  -------------
B D                       Cow  -------------
            Tibetan antelope  =============
               Big brown bat  =============
        David's myotis (bat)  =============
              Bactrian camel  NNNNNNNNNNNNN
B D                    Alpaca  -------------
             Star-nosed mole  NNNNNNNNNNNNN
B D                     Panda  =============
B D                       Dog  -------------
B D           Chinese hamster  =============
                Killer whale  -------------
B D                   Ferret   =============
B D                       Cat  NNNNNNNNNNNNN
B D                      Pika  =============
              Pacific walrus  -------------
B D                    Rabbit  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
B D                     Horse  -------------
            Black flying-fox  =============
B D          White rhinoceros  NNNNNNNNNNNNN
B D                 Zebrafish  =============
B D               Stickleback  =============
    Mexican tetra (cavefish)  =============
  D    Spiny softshell turtle  =============
  D  Chinese softshell turtle  =============
  D           Green seaturtle  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
B D               Zebra finch  =============
  D            Painted turtle  =============
  D               Rock pigeon  =============
                Weddell seal  =============
B D                   Dolphin  -------------
B D                       Pig  -------------
B D                    Rhesus  NNNNNNNNNNNNN
B D                   Megabat  =============
B D        American alligator  =============

Alignment block 17 of 456 in window, 45000991 - 45000993, 3 bps 
B D                     Human  ggg
B D                     Chimp  ggg
B D                   Gorilla  ggg
B D                 Orangutan  ggg
B D                    Gibbon  ggg
B D       Crab-eating macaque  gtg
B D                    Baboon  gtg
B D              Green monkey  gtg
B D                  Marmoset  agg
B D           Squirrel monkey  ggg
B D                  Bushbaby  ggg
           Chinese tree shrew  ggg
B D            Naked mole-rat  ggc
B D                Guinea pig  ggg
                   Chinchilla  gcc
             Brush-tailed rat  ggc
B D                  Microbat  ggg
B D                  Elephant  ag-
          Cape elephant shrew  gc-
B D                   Manatee  ag-
             Cape golden mole  gg-
                     Aardvark  ag-
B D                   Opossum  aga
B D           Tasmanian devil  gga
B D                  Platypus  ggg
  D               Rock pigeon  gtg
B D       Medium ground finch  gag
B D               Zebra finch  ggg
B D                   Chicken  gag
B D                 Tetraodon  gca
                  Spotted gar  ggg
B D                  Hedgehog  ---
B D                     Shrew  ---
               Domestic goat  ===
B D                     Sheep  ---
B D                       Cow  ---
            Tibetan antelope  ===
               Big brown bat  ===
        David's myotis (bat)  ===
              Bactrian camel  NNN
B D                    Alpaca  ---
             Star-nosed mole  NNN
B D                     Mouse  ---
B D                     Panda  ===
B D                       Dog  ---
B D                       Rat  ---
                Prairie vole  ---
B D           Chinese hamster  ===
              Golden hamster  ---
                Killer whale  ---
B D                   Ferret   ===
B D                  Squirrel  ---
B D                       Cat  NNN
B D                      Pika  ===
              Pacific walrus  ---
B D                    Rabbit  ===
B D                 Armadillo  ---
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                     Horse  ---
            Black flying-fox  ===
B D          White rhinoceros  NNN
B D                 Zebrafish  ===
B D               Stickleback  ===
    Mexican tetra (cavefish)  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
  D            Painted turtle  ===
                Weddell seal  ===
B D                   Dolphin  ---
B D                       Pig  ---
B D                    Rhesus  NNN
B D                   Megabat  ===
B D        American alligator  ===

Inserts between block 17 and 18 in window
          Chinese tree shrew 199bp

Alignment block 18 of 456 in window, 45000994 - 45001035, 42 bps 
B D                     Human  gcacttggg-----gcg-------ctcg----------------------gggcctgcgtcggata----
B D                     Chimp  gcacttggg-----gcg-------ctca----------------------gggcctgcgtcggata----
B D                   Gorilla  gcacttggg-----gcg-------ctcg----------------------gggcctgcgtcggata----
B D                 Orangutan  gcacttggg-----gcg-------ctcg----------------------gtgcccgcgtcggata----
B D                    Gibbon  gcacttggg-----gcg-------cgcg----------------------gggcccgcgtcggata----
B D       Crab-eating macaque  gcgagtgcg-----gcg-------cgtg----------------------gggcccgcgtcggata----
B D                    Baboon  gcgagtgcg-----gcg-------cgtg----------------------gggcccgcgtcggata----
B D              Green monkey  gcgagtgcg-----gcg-------cgtc----------------------gggcccgcgtcggata----
B D                  Marmoset  gtgcctggg-----gcg-------cgcg----------------------ggacccgcgtcgggta----
B D           Squirrel monkey  gtgcgtggg-----gcg-------cgcg----------------------gggcccgcgtgggcta----
B D                  Bushbaby  ctgcgtggg-----ggc-------cgcg------------------------------gccgggcg----
B D                  Squirrel  --------------------------------------------------gagggcgcg-----------
                 Prairie vole  --------------------------------------------------cgggctgcg-----------
               Golden hamster  --------------------------------------------------tgggctgag-----------
B D                     Mouse  --------------------------------------------------gggcctgcg-----------
B D                       Rat  --------------------------------------------------aggcctgcg-----------
B D            Naked mole-rat  -gtgtggcg-----ggc-------ttt-----------------------ggggttgtg-----------
B D                Guinea pig  -ttgccgcg-----gga-------ttcc----------------------gagctcgcg-----------
                   Chinchilla  -ttcccgcg-----ggc-------tct-----------------------ggggccgcg-----------
             Brush-tailed rat  -gtgccgcg-----gta-------cctg----------------------ggggctgcg-----------
B D                       Pig  --------------------------------------------------------------ccctgggg
B D                   Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
B D                     Horse  -----------------------------------------------------ccgcccgggcgcg----
B D                       Dog  -----------------------------------------------------ccgggggcgcgcg----
               Pacific walrus  -----------------------------------------------------ccgggggtgcgcg----
             Black flying-fox  ----------------------------------------------------gccgggg-tgttgg----
B D                   Megabat  ----------------------------------------------------gccgggg-tgttgg----
B D                  Microbat  --------------------------------------------------gcgccgggg--gatcg----
B D                  Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                   Opossum  --------t-----cag-------ctcg----------------------agctacccgctgggaa----
B D           Tasmanian devil  ------------------------cccg----------------------aggccccatctcggta----
B D                  Platypus  ----ttggaaatctgct-------cttg----------------------ggccctgcctctgccc----
  D               Rock pigeon  ----------------g-------cacg----------------------gggtgaggaa----------
B D       Medium ground finch  ----------------aggcgat-ctcg----------------------gggttgggggt---------
B D               Zebra finch  ------------------------ctcc----------------------cggccgagccc---------
B D                   Chicken  ----------------g-------caca----------------------cggggaacga----------
B D        American alligator  ------------------gcggtgctgg----------------------ggggcgggggca--------
  D           Green seaturtle  --------------------------------------------------------agggc---------
  D            Painted turtle  --------------------------------------------------------agggc---------
  D  Chinese softshell turtle  --------------------------------------------------------gggg----------
B D                 Tetraodon  -------------------------gcttctccttcaaacgctcgctggagaggcaccagctgacg----
                  Spotted gar  -------------------------gct----------------------gggccgagacccggat----
B D                  Hedgehog  ----------------------------------------------------------------------
B D                     Shrew  ----------------------------------------------------------------------
               Domestic goat  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  ----------------------------------------------------------------------
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Panda  ======================================================================
B D           Chinese hamster  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Chinese tree shrew  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                    Turkey  ======================================================================
                Weddell seal  ======================================================================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ---------------ctcgggtccg
                        Chimp  ---------------ctcgggtccg
                      Gorilla  ---------------ctcgggtccg
                    Orangutan  ---------------ctcgggtccg
                       Gibbon  ---------------ctcgggtccg
          Crab-eating macaque  ---------------ctcaggtccg
                       Baboon  ---------------ctcaggtccg
                 Green monkey  ---------------ctcaggtcag
                     Marmoset  ---------------ctcggatctt
              Squirrel monkey  ---------------ctcgggtctt
                     Bushbaby  ---------------ctcgggggct
                     Squirrel  -------------------ggg-ag
                 Prairie vole  -------------------gctcga
               Golden hamster  -------------------ggtcgg
                        Mouse  -------------------ggtctg
                          Rat  -------------------ggtcgg
               Naked mole-rat  -------------------gccccg
                   Guinea pig  -------------------gct-ta
                   Chinchilla  -------------------gctctg
             Brush-tailed rat  -------------------gctgcg
                          Pig  tgcgcgggcaggtgctccgagg--c
                      Dolphin  ---------------gtcgggg--c
                 Killer whale  ---------------gccaggg--c
                          Cow  ---------------gccgagc--c
                        Sheep  ---------------gccgagc--c
                        Horse  -------------------------
                          Dog  ---------------gcgcggt--g
               Pacific walrus  ---------------gcccggt--g
             Black flying-fox  ---------------gccaggt--g
                      Megabat  ---------------gccaggt--g
                     Microbat  ---------------gctgggt---
                     Elephant  -----------------cggggcgg
          Cape elephant shrew  -----------------cgtggctg
                      Manatee  -----------------cgtgggtg
             Cape golden mole  -----------------cttggctg
                     Aardvark  -----------------cgtgcaaa
                    Armadillo  -----------------cgcgcggg
                      Opossum  -----------------gggtagtt
              Tasmanian devil  ---------------ctcggggcta
                     Platypus  ---------------catcgtgtgg
                  Rock pigeon  ----------------cagggcaca
          Medium ground finch  ---------------cccagggaga
                  Zebra finch  ---------------tccgagctct
                      Chicken  ----------------atggcctcg
           American alligator  ---------------cacgtgggga
              Green seaturtle  ---------------ttcagccaga
               Painted turtle  ---------------tttagccaga
     Chinese softshell turtle  -----------------------ga
                    Tetraodon  ---------------caccgcaccc
                  Spotted gar  ---------------ctccgatctc
                     Hedgehog  -------------------------
                        Shrew  -------------------------
                Domestic goat  =========================
             Tibetan antelope  =========================
                Big brown bat  =========================
         David's myotis (bat)  =========================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNN
                       Alpaca  -------------------------
              Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNN
                        Panda  =========================
              Chinese hamster  =========================
                      Ferret   =========================
                          Cat  NNNNNNNNNNNNNNNNNNNNNNNNN
           Chinese tree shrew  =========================
                         Pika  =========================
                       Rabbit  =========================
       Lesser Egyptian jerboa  =========================
                       Tenrec  =========================
             White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNN
                    Zebrafish  =========================
                  Stickleback  =========================
     Mexican tetra (cavefish)  =========================
       Spiny softshell turtle  =========================
                       Turkey  =========================
                 Weddell seal  =========================
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 18 and 19 in window
B D                Tetraodon 27bp

Alignment block 19 of 456 in window, 45001036 - 45001044, 9 bps 
B D                     Human  ct-cgggagc---
B D                     Chimp  ct-cgggagc---
B D                   Gorilla  ct-cgggagc---
B D                 Orangutan  ct-cgggagc---
B D                    Gibbon  ct-cgggagc---
B D       Crab-eating macaque  ct-cgggagc---
B D                    Baboon  ct-cgagagc---
B D              Green monkey  ct-cgggagc---
B D                  Marmoset  ct-cgggagc---
B D           Squirrel monkey  ct-cgggagc---
B D                  Bushbaby  ctgcggccgc---
B D                  Squirrel  cc-gcggcgg---
                 Prairie vole  cc-tgggcgg---
               Golden hamster  cc-tggccgg---
B D                     Mouse  cc-tgggccg---
B D                       Rat  cc-tggaccg---
B D            Naked mole-rat  gc-cgggcga---
B D                Guinea pig  gt-cgggcgg---
                   Chinchilla  ga-ggagggg---
             Brush-tailed rat  gc-agagcgg---
B D                       Pig  ac-cagagg----
B D                   Dolphin  ct-caggag----
                 Killer whale  ct-caggag----
B D                       Cow  cg-cagggg----
B D                     Sheep  cg-cagggg----
B D                     Horse  ----agtggc---
B D                       Dog  gt--ggaggc---
               Pacific walrus  ct-cggaggc---
             Black flying-fox  ct-caggagc---
B D                   Megabat  ct-caggagc---
B D                  Microbat  -c-cgggagc---
B D                  Hedgehog  cg-cgtg-gc---
B D                     Shrew  cc-cgggcgc---
              Star-nosed mole  cc-cgggagc---
B D                  Elephant  cc-cagcggt---
          Cape elephant shrew  cc-tcgtggg---
B D                   Manatee  cc-ccgcggc---
             Cape golden mole  cc-ct-cggc---
                     Aardvark  tc-cgactac---
B D                 Armadillo  gc-cagcggc---
B D                   Opossum  cc-aggccga---
B D           Tasmanian devil  cc-cgcccga---
B D                  Platypus  ga-caggagc---
  D               Rock pigeon  gt-cccggtt---
B D       Medium ground finch  gc-cggg------
B D               Zebra finch  gc-cggggct---
B D                   Chicken  gc-ctgaccc---
B D        American alligator  gc-cccggtc---
  D           Green seaturtle  gc-tctgacc---
  D            Painted turtle  gc-tctgacc---
  D  Chinese softshell turtle  gc-ccgg------
B D                 Tetraodon  tt-ccgaaggagc
                  Spotted gar  ct-ggggagagct
               Domestic goat  =============
            Tibetan antelope  =============
               Big brown bat  =============
        David's myotis (bat)  =============
              Bactrian camel  NNNNNNNNNNNNN
B D                    Alpaca  -------------
B D                     Panda  =============
B D           Chinese hamster  =============
B D                   Ferret   =============
B D                       Cat  NNNNNNNNNNNNN
          Chinese tree shrew  =============
B D                      Pika  =============
B D                    Rabbit  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
B D          White rhinoceros  NNNNNNNNNNNNN
B D                 Zebrafish  =============
B D               Stickleback  =============
    Mexican tetra (cavefish)  =============
  D    Spiny softshell turtle  =============
B D                    Turkey  =============
                Weddell seal  =============
B D                    Rhesus  NNNNNNNNNNNNN

Inserts between block 19 and 20 in window
B D                      Pig 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
B D                    Horse 3bp
B D                      Dog 5bp
              Pacific walrus 5bp
            Black flying-fox 10bp
B D                  Megabat 10bp
B D                 Microbat 10bp
B D                 Hedgehog 11bp
B D                    Shrew 13bp
             Star-nosed mole 5bp
B D                 Elephant 18bp
         Cape elephant shrew 12bp
B D                  Manatee 27bp
            Cape golden mole 27bp
                    Aardvark 28bp
B D                Armadillo 25bp
B D                  Opossum 7bp
B D          Tasmanian devil 6bp
B D                 Platypus 6bp
  D              Rock pigeon 6bp
B D      Medium ground finch 4bp
B D              Zebra finch 8bp
B D                  Chicken 13bp
B D       American alligator 20bp
  D          Green seaturtle 11bp
  D           Painted turtle 11bp
  D Chinese softshell turtle 11bp

Alignment block 20 of 456 in window, 45001045 - 45001056, 12 bps 
B D                     Human  gcg-ctgg---------------------------c-cgca-------
B D                     Chimp  gcg-ctgg---------------------------c-cgca-------
B D                   Gorilla  gcg-ctgg---------------------------c-cgca-------
B D                 Orangutan  gcg-ctgg---------------------------c-cgca-------
B D                    Gibbon  gct-gcgg---------------------------t-cgca-------
B D       Crab-eating macaque  gcg-ctgg---------------------------c-cgta-------
B D                    Baboon  gcg-ctgg---------------------------c-cgta-------
B D              Green monkey  gcg-ctgg---------------------------c-cgta-------
B D                  Marmoset  gcg-ctgg---------------------------c-cgca-------
B D                  Bushbaby  gaa-ctgg---------------------------c-ctca-------
B D                  Squirrel  --g-tgcctaggagcccttgggcgctggctggctgc-cgca-------
                 Prairie vole  --g-tgtc----------------------------------------
               Golden hamster  --g-tgtc----------------------------------------
B D                     Mouse  --g-tgtt----------------------------------------
B D                       Rat  --g-tgtg----------------------------------------
B D            Naked mole-rat  --g-aagg---------------------------g-ttcg-------
B D                Guinea pig  --g-aagg---------------------------c-tgag-------
                   Chinchilla  --g-aagg---------------------------c-cgag-------
             Brush-tailed rat  --g-aagg---------------------------c-tgag-------
B D                       Pig  gag-ctgg---------------------------g-cgcg-------
B D                   Dolphin  gag-ctgg---------------------------c-cgct-------
                 Killer whale  gag-ctgg---------------------------c-cgca-------
B D                       Cow  gag-ctgg---------------------------c-cgcg-------
B D                     Sheep  ggg-ctgg---------------------------c-cgcg-------
B D                     Horse  aag-cgcg----------------------------------------
B D                       Dog  ggg-cgcc----------------------------------------
               Pacific walrus  ggg-cgcc---------------------ggttggc-cgtc-------
             Black flying-fox  gag-ctgg---------------------------c-ggta-------
B D                   Megabat  gag-ctgg---------------------------c-ggta-------
B D                  Microbat  ggg-cccg---------------------------c-gaga-------
B D                  Hedgehog  ggg-cccc---------------------------g-tggg-------
B D                     Shrew  tgg-ccgg---------------------------a-cggg-------
              Star-nosed mole  gcg-cggg---------------------------a-cggg-------
B D                  Elephant  gag-ctgg---------------------------c-cgcc-------
          Cape elephant shrew  agg-caga---------------------------t-ggca-------
B D                   Manatee  aag-ccgg---------------------------c-cgct-------
             Cape golden mole  taa-cctg---------------------------c-cgcc-------
                     Aardvark  gag-ccag---------------------------c-cgca-------
B D                 Armadillo  ggatctgg---------------------------c-cagc-------
B D                   Opossum  gcg-cagg---------------------------cgcaga-------
B D           Tasmanian devil  tgg-gagg---------------------------c-catg-------
B D                  Platypus  gaa-cca-----------------------------------------
  D               Rock pigeon  --------------------------------------gcg-------
B D       Medium ground finch  ------------------------------------acgcg-------
B D               Zebra finch  ------------------------------------ccgcg-------
B D                   Chicken  ------------------------------------acgca-------
B D        American alligator  ------------------------------------ccgcc-------
  D           Green seaturtle  ------------------------------------ctgcg-------
  D            Painted turtle  ------------------------------------ctgcg-------
  D  Chinese softshell turtle  ------------------------------------ctggc-------
B D                 Tetraodon  ------------------------------------acccgtgctcgg
                  Spotted gar  ------------------------------------gcgaatgccgca
               Domestic goat  ================================================
            Tibetan antelope  ================================================
               Big brown bat  ================================================
        David's myotis (bat)  ================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  ------------------------------------------------
B D                     Panda  ================================================
B D           Chinese hamster  ================================================
B D                   Ferret   ================================================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Chinese tree shrew  ================================================
B D                      Pika  ================================================
B D                    Rabbit  ================================================
      Lesser Egyptian jerboa  ================================================
B D                    Tenrec  ================================================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ================================================
B D               Stickleback  ================================================
    Mexican tetra (cavefish)  ================================================
  D    Spiny softshell turtle  ================================================
B D                    Turkey  ================================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ================================================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 20 and 21 in window
B D                      Dog 10bp
B D                 Hedgehog 15bp
B D                    Shrew 11bp
             Star-nosed mole 8bp
  D              Rock pigeon 7bp
B D      Medium ground finch 7bp
B D              Zebra finch 2bp
B D                  Chicken 3bp
B D       American alligator 7bp
  D          Green seaturtle 7bp
  D           Painted turtle 7bp
  D Chinese softshell turtle 3bp

Alignment block 21 of 456 in window, 45001057 - 45001063, 7 bps 
B D                     Human  acgaggg
B D                     Chimp  acgaggg
B D                   Gorilla  acgaggg
B D                 Orangutan  acgaagg
B D                    Gibbon  acgaggt
B D       Crab-eating macaque  acgaggg
B D                    Baboon  acgaggg
B D              Green monkey  acgaggg
B D                  Marmoset  acgaggg
B D                  Bushbaby  tc-aggg
B D                  Squirrel  a--ggga
B D            Naked mole-rat  c---ggg
B D                Guinea pig  c--agga
                   Chinchilla  c--ggta
             Brush-tailed rat  ctggggg
B D                  Elephant  -gtgggg
          Cape elephant shrew  -ggagtg
B D                   Manatee  -gtgggg
             Cape golden mole  -gtgagg
                     Aardvark  -gtgggg
B D                 Armadillo  -gcgggg
B D                   Opossum  ------g
B D           Tasmanian devil  ------g
B D                  Platypus  --gaagg
  D               Rock pigeon  ctaatct
B D       Medium ground finch  cgaagag
B D               Zebra finch  -ggagcg
B D                   Chicken  cccatcg
B D        American alligator  acgagcg
  D           Green seaturtle  accggcg
  D            Painted turtle  accggcg
  D  Chinese softshell turtle  -cctggg
B D                 Tetraodon  ------a
                  Spotted gar  ------g
B D                  Hedgehog  =======
B D                     Shrew  =======
               Domestic goat  =======
B D                     Sheep  -------
B D                       Cow  -------
            Tibetan antelope  =======
               Big brown bat  =======
B D                  Microbat  -------
        David's myotis (bat)  =======
              Bactrian camel  NNNNNNN
B D                    Alpaca  -------
             Star-nosed mole  =======
B D                     Mouse  -------
B D                     Panda  =======
B D                       Dog  =======
B D                       Rat  -------
                Prairie vole  -------
B D           Chinese hamster  =======
              Golden hamster  -------
                Killer whale  -------
B D                   Ferret   =======
B D                       Cat  NNNNNNN
          Chinese tree shrew  =======
B D                      Pika  =======
              Pacific walrus  -------
B D                    Rabbit  =======
      Lesser Egyptian jerboa  =======
B D                    Tenrec  =======
B D                     Horse  -------
            Black flying-fox  -------
B D          White rhinoceros  NNNNNNN
B D                 Zebrafish  =======
B D               Stickleback  =======
    Mexican tetra (cavefish)  =======
  D    Spiny softshell turtle  =======
B D                    Turkey  =======
B D           Squirrel monkey  NNNNNNN
                Weddell seal  =======
B D                   Dolphin  -------
B D                       Pig  -------
B D                    Rhesus  NNNNNNN
B D                   Megabat  -------

Inserts between block 21 and 22 in window
B D      Medium ground finch 6bp
B D              Zebra finch 19bp
B D                  Chicken 7bp
B D       American alligator 6bp
  D          Green seaturtle 10bp
  D           Painted turtle 10bp
  D Chinese softshell turtle 18bp

Alignment block 22 of 456 in window, 45001064 - 45001066, 3 bps 
B D                     Human  cgg
B D                     Chimp  cgg
B D                   Gorilla  cgg
B D                 Orangutan  cgg
B D                    Gibbon  cgg
B D       Crab-eating macaque  cgg
B D                    Baboon  cgg
B D              Green monkey  cgg
B D                  Marmoset  cgg
B D                  Bushbaby  cgg
B D            Naked mole-rat  cgg
B D                Guinea pig  gcg
                   Chinchilla  ggg
             Brush-tailed rat  ggg
B D                  Elephant  cgg
          Cape elephant shrew  tgg
B D                   Manatee  cgg
             Cape golden mole  cgg
                     Aardvark  cgg
B D                 Armadillo  tgg
B D                   Opossum  cgc
B D           Tasmanian devil  ccc
B D                  Platypus  gga
B D                  Hedgehog  ===
B D                     Shrew  ===
               Domestic goat  ===
B D                     Sheep  ---
B D                       Cow  ---
            Tibetan antelope  ===
               Big brown bat  ===
B D                  Microbat  ---
        David's myotis (bat)  ===
              Bactrian camel  NNN
B D                    Alpaca  ---
             Star-nosed mole  ===
B D                     Mouse  ---
B D                     Panda  ===
B D                       Dog  ===
B D                       Rat  ---
                Prairie vole  ---
B D           Chinese hamster  ===
              Golden hamster  ---
                Killer whale  ---
B D                   Ferret   ===
B D                  Squirrel  ---
B D                       Cat  NNN
          Chinese tree shrew  ===
B D                      Pika  ===
              Pacific walrus  ---
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                     Horse  ---
            Black flying-fox  ---
B D          White rhinoceros  NNN
B D                 Tetraodon  ---
B D                 Zebrafish  ===
                 Spotted gar  ---
B D               Stickleback  ===
    Mexican tetra (cavefish)  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D                   Chicken  ===
B D               Zebra finch  ===
B D           Squirrel monkey  NNN
  D            Painted turtle  ===
                Weddell seal  ===
B D                   Dolphin  ---
B D                       Pig  ---
B D                    Rhesus  NNN
B D                   Megabat  ---
B D        American alligator  ===

Alignment block 23 of 456 in window, 45001067 - 45001067, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  g
B D                    Gibbon  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D                  Bushbaby  c
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                  Elephant  g
          Cape elephant shrew  c
B D                   Manatee  g
             Cape golden mole  g
                     Aardvark  g
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                  Platypus  a
B D                   Chicken  c
B D        American alligator  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
B D                  Hedgehog  =
B D                     Shrew  =
               Domestic goat  =
B D                     Sheep  -
B D                       Cow  -
            Tibetan antelope  =
               Big brown bat  =
B D                  Microbat  -
        David's myotis (bat)  =
              Bactrian camel  N
B D                    Alpaca  -
             Star-nosed mole  =
B D                     Mouse  -
B D                     Panda  =
B D                       Dog  =
B D                       Rat  -
                Prairie vole  -
B D           Chinese hamster  =
              Golden hamster  -
                Killer whale  -
B D                   Ferret   =
B D                  Squirrel  -
B D                       Cat  N
          Chinese tree shrew  =
B D                      Pika  =
              Pacific walrus  -
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                     Horse  -
            Black flying-fox  -
B D          White rhinoceros  N
B D                 Tetraodon  -
B D                 Zebrafish  =
                 Spotted gar  -
B D               Stickleback  =
    Mexican tetra (cavefish)  =
  D    Spiny softshell turtle  =
B D       Medium ground finch  =
B D                    Turkey  =
B D               Zebra finch  =
B D           Squirrel monkey  N
                Weddell seal  =
B D                   Dolphin  -
B D                       Pig  -
B D                    Rhesus  N
B D                   Megabat  -

Inserts between block 23 and 24 in window
B D                  Chicken 4bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp

Alignment block 24 of 456 in window, 45001068 - 45001074, 7 bps 
B D                     Human  gcgg------------------gcc--
B D                     Chimp  gcgg------------------gcc--
B D                   Gorilla  gcgg------------------gcc--
B D                 Orangutan  gcgg------------------gcc--
B D                    Gibbon  gcgt------------------gcc--
B D       Crab-eating macaque  gcgg------------------gcc--
B D                    Baboon  gcgg------------------gcc--
B D              Green monkey  gcgg------------------gcc--
B D                  Marmoset  gcgg------------------gcc--
B D                  Bushbaby  acgg------------------agc--
B D                  Squirrel  ---g------------------gcg--
B D                     Mouse  ---g------------------ggt--
B D            Naked mole-rat  tccg------------------ctg--
B D                Guinea pig  cctg------------------ccg--
                   Chinchilla  ccgg------------------ccg--
             Brush-tailed rat  cctg------------------tcg--
B D                       Pig  ----------------------gca--
B D                   Dolphin  ----------------------gtg--
                 Killer whale  ----------------------gtg--
B D                       Cow  ----------------------gct--
B D                     Sheep  ----------------------gcg--
B D                     Horse  ----------------------gtg--
               Pacific walrus  ----------------------gcg--
             Black flying-fox  ----------------------aag--
B D                   Megabat  ----------------------aag--
B D                  Microbat  ----------------------aga--
B D                  Hedgehog  ---ccgtgtagcgtggatccggaga--
B D                     Shrew  -------------tggagtgaggcg--
              Star-nosed mole  ---------------------gggg--
B D                  Elephant  gtgg------------------ggc--
          Cape elephant shrew  gtgg------------------gac--
B D                   Manatee  gcgg------------------act--
             Cape golden mole  gcgg------------------a----
                     Aardvark  gcag------------------acc--
B D                 Armadillo  gcgg------------------ccg--
B D                   Opossum  gcgg------------------gcc--
B D           Tasmanian devil  gggg------------------gcg--
B D                  Platypus  gcgg------------------acg--
  D       Collared flycatcher  gca------------------------
B D       Medium ground finch  gcg------------------------
B D                   Chicken  gcc------------------------
B D        American alligator  gcg------------------------
  D           Green seaturtle  gtg------------------------
  D            Painted turtle  gtg------------------------
  D  Chinese softshell turtle  ggc------------------------
B D                 Tetraodon  --------------------atgcggc
                  Spotted gar  --------------------atggctc
               Domestic goat  ===========================
            Tibetan antelope  ===========================
               Big brown bat  ===========================
        David's myotis (bat)  ===========================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  ---------------------------
B D                     Panda  ===========================
B D                       Dog  ===========================
B D                       Rat  ---------------------------
                Prairie vole  ---------------------------
B D           Chinese hamster  ===========================
              Golden hamster  ---------------------------
B D                   Ferret   ===========================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNN
          Chinese tree shrew  ===========================
B D                      Pika  ===========================
B D                    Rabbit  ===========================
      Lesser Egyptian jerboa  ===========================
B D                    Tenrec  ===========================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ===========================
B D               Stickleback  ===========================
    Mexican tetra (cavefish)  ===========================
  D    Spiny softshell turtle  ===========================
B D                    Turkey  ===========================
B D               Zebra finch  ===========================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ===========================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
  D      Collared flycatcher 39bp
B D      Medium ground finch 30bp
B D                  Chicken 31bp
B D       American alligator 28bp
  D          Green seaturtle 4bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 4bp

Alignment block 25 of 456 in window, 45001075 - 45001077, 3 bps 
B D                     Human  -cgg
B D                     Chimp  -cgg
B D                   Gorilla  -cgg
B D                 Orangutan  -cgg
B D                    Gibbon  -cgg
B D       Crab-eating macaque  -ggg
B D                    Baboon  -ggg
B D              Green monkey  -ggg
B D                  Marmoset  -cgg
B D                  Bushbaby  -ggg
B D                  Squirrel  -ccg
                 Prairie vole  --gg
               Golden hamster  --cg
B D                     Mouse  -cgg
B D                       Rat  --gg
B D            Naked mole-rat  -tgg
B D                Guinea pig  -cgg
                   Chinchilla  -cgg
             Brush-tailed rat  -cgg
B D                       Pig  -ggg
B D                    Alpaca  ---a
B D                   Dolphin  -ggg
                 Killer whale  -ggg
B D                       Cow  -ggg
B D                     Sheep  -ggg
B D                     Horse  -ggg
               Pacific walrus  -ggg
             Black flying-fox  -agg
B D                   Megabat  -agg
B D                  Microbat  -ggg
B D                  Hedgehog  -gta
B D                     Shrew  -gcg
              Star-nosed mole  -gcg
B D                  Elephant  -gg-
          Cape elephant shrew  -ag-
B D                   Manatee  -gg-
                     Aardvark  -gg-
B D                 Armadillo  -gg-
B D                   Opossum  -agt
B D           Tasmanian devil  -cct
B D                  Platypus  -tgt
  D       Collared flycatcher  -gg-
  D    White-throated sparrow  -gg-
B D       Medium ground finch  -gg-
B D               Zebra finch  -cc-
B D                   Chicken  -cg-
B D                    Turkey  -cg-
B D        American alligator  -gt-
  D           Green seaturtle  -ga-
  D            Painted turtle  -ga-
  D  Chinese softshell turtle  -ca-
B D                 Tetraodon  cgg-
                  Spotted gar  cgg-
               Domestic goat  ====
            Tibetan antelope  ====
               Big brown bat  ====
        David's myotis (bat)  ====
              Bactrian camel  NNNN
B D                     Panda  ====
B D                       Dog  ====
B D           Chinese hamster  ====
B D                   Ferret   ====
B D                       Cat  NNNN
          Chinese tree shrew  ====
B D                      Pika  ====
B D                    Rabbit  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
B D          White rhinoceros  NNNN
B D                 Zebrafish  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
  D    Spiny softshell turtle  ====
B D           Squirrel monkey  NNNN
                Weddell seal  ====
            Cape golden mole  ----
B D                    Rhesus  NNNN

Inserts between block 25 and 26 in window
B D                      Pig 17bp
B D                   Alpaca 4bp
B D                  Dolphin 13bp
                Killer whale 13bp
B D                      Cow 17bp
B D                    Sheep 250bp
B D                    Horse 15bp
              Pacific walrus 14bp
            Black flying-fox 14bp
B D                  Megabat 14bp
B D                 Microbat 4bp
B D                 Hedgehog 3bp
B D                    Shrew 3bp
             Star-nosed mole 4bp
B D                  Opossum 3bp
B D          Tasmanian devil 6bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D              Zebra finch 3bp
B D                  Chicken 3bp
B D                   Turkey 3bp
B D       American alligator 3bp
  D          Green seaturtle 3bp
  D           Painted turtle 3bp
  D Chinese softshell turtle 3bp

Alignment block 26 of 456 in window, 45001078 - 45001078, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D                  Bushbaby  a
B D                  Squirrel  g
                 Prairie vole  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  g
B D                       Dog  g
               Pacific walrus  g
             Black flying-fox  g
B D                   Megabat  g
B D                  Microbat  g
B D                  Hedgehog  t
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  a
B D                   Manatee  g
                     Aardvark  g
B D                 Armadillo  g
B D           Tasmanian devil  g
B D                  Platypus  g
B D                 Tetraodon  g
                  Spotted gar  g
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
               Big brown bat  =
        David's myotis (bat)  =
              Bactrian camel  N
B D                    Alpaca  =
B D                     Panda  =
B D           Chinese hamster  =
B D                   Ferret   =
B D                       Cat  N
          Chinese tree shrew  =
B D                      Pika  =
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D          White rhinoceros  N
B D                 Zebrafish  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                   Chicken  =
B D               Zebra finch  =
B D           Squirrel monkey  N
  D            Painted turtle  =
B D                   Opossum  =
                Weddell seal  =
            Cape golden mole  -
B D                       Pig  =
B D                    Rhesus  N
B D        American alligator  =

Inserts between block 26 and 27 in window
B D                  Dolphin 3bp
                Killer whale 3bp
B D                    Horse 10bp
B D                      Dog 8bp
              Pacific walrus 11bp
            Black flying-fox 3bp
B D                  Megabat 3bp
B D                 Microbat 742bp
B D                 Hedgehog 3bp
B D                    Shrew 2bp
             Star-nosed mole 2bp

Alignment block 27 of 456 in window, 45001079 - 45001081, 3 bps 
B D                     Human  cga
B D                     Chimp  cga
B D                   Gorilla  cga
B D                 Orangutan  cga
B D                    Gibbon  cga
B D       Crab-eating macaque  cga
B D                    Baboon  cga
B D              Green monkey  cga
B D                  Marmoset  cga
B D                  Bushbaby  cca
B D                  Squirrel  ccg
                 Prairie vole  tgg
               Golden hamster  cga
B D                     Mouse  tcg
B D                       Rat  tcg
B D            Naked mole-rat  cgg
B D                Guinea pig  cgg
                   Chinchilla  cgg
             Brush-tailed rat  cgg
B D                       Pig  cgg
B D                    Alpaca  c--
B D                   Dolphin  cgg
                 Killer whale  cgg
B D                       Cow  cgg
B D                     Horse  cgc
B D                       Dog  cgg
               Pacific walrus  cga
             Black flying-fox  cga
B D                   Megabat  cga
B D                  Hedgehog  ctg
B D                     Shrew  cgg
              Star-nosed mole  cgg
B D                  Elephant  gcg
          Cape elephant shrew  ctg
B D                   Manatee  cgg
                     Aardvark  agg
B D                 Armadillo  gcg
B D           Tasmanian devil  taa
B D                  Platypus  tgt
  D       Collared flycatcher  c--
  D    White-throated sparrow  c--
B D       Medium ground finch  c--
B D               Zebra finch  a--
B D                   Chicken  c--
B D                    Turkey  c--
B D        American alligator  g--
  D           Green seaturtle  c--
  D            Painted turtle  c--
  D  Chinese softshell turtle  c--
B D                 Tetraodon  cgt
                  Spotted gar  cgc
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
              Bactrian camel  NNN
B D                     Panda  ===
B D           Chinese hamster  ===
B D                   Ferret   ===
B D                       Cat  NNN
          Chinese tree shrew  ===
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D          White rhinoceros  NNN
B D                 Zebrafish  ===
B D               Stickleback  ===
    Mexican tetra (cavefish)  ===
  D    Spiny softshell turtle  ===
B D           Squirrel monkey  NNN
B D                   Opossum  ===
                Weddell seal  ===
            Cape golden mole  ---
B D                    Rhesus  NNN

Inserts between block 27 and 28 in window
B D                 Squirrel 6bp
                Prairie vole 3bp
              Golden hamster 3bp
B D                    Mouse 5bp
B D                      Rat 5bp
B D           Naked mole-rat 235bp
B D                      Pig 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
B D                      Cow 6bp
B D                    Horse 6bp
B D                      Dog 1bp
              Pacific walrus 6bp
            Black flying-fox 6bp
B D                  Megabat 6bp
B D                 Hedgehog 6bp
B D                    Shrew 6bp
             Star-nosed mole 6bp
B D                 Platypus 1bp

Alignment block 28 of 456 in window, 45001082 - 45001086, 5 bps 
B D                     Human  tgg-----------------cg
B D                     Chimp  tgg-----------------cg
B D                   Gorilla  tgg-----------------cg
B D                 Orangutan  tgg-----------------cg
B D                    Gibbon  tgg-----------------cg
B D       Crab-eating macaque  tgg-----------------cg
B D                    Baboon  tgg-----------------cg
B D              Green monkey  tgg-----------------cg
B D                  Marmoset  tgg-----------------cg
B D                  Bushbaby  cgg-----------------cg
B D                  Squirrel  cgg-----------------cg
B D                     Mouse  cgg-----------------cg
B D                       Rat  cgg-----------------cg
B D                Guinea pig  tgg-----------------gg
                   Chinchilla  cgg-----------------gg
             Brush-tailed rat  cca-----------------gg
B D                       Pig  gag-----------------cg
B D                    Alpaca  -gg-----------------cg
B D                   Dolphin  ggg-----------------cg
                 Killer whale  ggg-----------------cg
B D                       Cow  ggg-----------------cg
B D                     Horse  ggg-----------------ag
               Pacific walrus  agg-----------------aa
             Black flying-fox  ggg-----------------cg
B D                   Megabat  ggg-----------------cg
B D                  Hedgehog  ctg-----------------cg
B D                     Shrew  tcg-----------------cg
              Star-nosed mole  ccg-----------------cg
B D                  Elephant  gag-----------------cg
          Cape elephant shrew  gag-----------------tc
B D                   Manatee  cgg-----------------cg
                     Aardvark  tgg-----------------tg
B D                 Armadillo  gag-----------------gc
B D                   Opossum  ---------------------g
B D           Tasmanian devil  --g-----------------ag
B D                  Platypus  ggg-----------------cg
  D       Collared flycatcher  cgg-----------------ca
  D    White-throated sparrow  tgg-----------------ca
B D       Medium ground finch  ctg-----------------ga
B D               Zebra finch  ttg-----------------gg
B D                   Chicken  tcggcgctgg----------gg
B D                    Turkey  tccccctcagcccctcaccagg
B D        American alligator  tgg-----------------cg
  D           Green seaturtle  ggc-----------------ag
  D            Painted turtle  ggc-----------------ag
  D  Chinese softshell turtle  agg-----------------gg
B D                 Tetraodon  tcg-----------------cg
                  Spotted gar  cga-----------------cc
               Domestic goat  ======================
B D                     Sheep  ======================
            Tibetan antelope  ======================
               Big brown bat  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNN
B D                     Panda  ======================
B D                       Dog  ======================
                Prairie vole  ======================
B D           Chinese hamster  ======================
              Golden hamster  ======================
B D                   Ferret   ======================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNN
          Chinese tree shrew  ======================
B D                      Pika  ======================
B D            Naked mole-rat  ======================
B D                    Rabbit  ======================
      Lesser Egyptian jerboa  ======================
B D                    Tenrec  ======================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ======================
B D               Stickleback  ======================
    Mexican tetra (cavefish)  ======================
  D    Spiny softshell turtle  ======================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ======================
            Cape golden mole  ----------------------
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNN

Inserts between block 28 and 29 in window
B D               Guinea pig 347bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
  D      Collared flycatcher 9bp
  D   White-throated sparrow 9bp
B D      Medium ground finch 9bp
B D              Zebra finch 9bp
B D                  Chicken 9bp
B D                   Turkey 17bp
B D       American alligator 9bp
  D          Green seaturtle 22bp
  D           Painted turtle 22bp
  D Chinese softshell turtle 27bp

Alignment block 29 of 456 in window, 45001087 - 45001121, 35 bps 
B D                     Human  tggcttgcgtctcccgcctccg-------------ggcagggcctggc----------------------
B D                     Chimp  tggcttgcgtctcccgcctccg-------------ggcagggcctggc----------------------
B D                   Gorilla  tggcttgcgtcttccgcctccg-------------ggcagggcctggc----------------------
B D                 Orangutan  tggctggcgtctcccgtcttcg-------------ggcagggcctggc----------------------
B D                    Gibbon  tggctgacgtctcccgcctccg-------------ggcagggcctggc----------------------
B D       Crab-eating macaque  tggctggcgtctccggcctccg-------------ggctgtgcctggc----------------------
B D                    Baboon  tggctggcgtctccggcctccg-------------ggctgtgcctggc----------------------
B D              Green monkey  tggctggcgtctccggcctccg-------------ggctgtgcctggc----------------------
B D                  Marmoset  tggccggcgcctcccgcctcag-------------ggcagggcctggc----------------------
B D                  Bushbaby  cggcgggcgccg-aggcctcca-------------ggccgggccgggg----------------------
B D                  Squirrel  -----------------tggcg-------------ggtgcctcgtgcc----------------------
B D                     Mouse  -----------------ctgca------------------------------------------------
B D                       Rat  -----------------cttca------------------------------------------------
                   Chinchilla  -------------aggcctgcg------tggctctggcgaattggggc----------------------
             Brush-tailed rat  -------------aggccttag------------tggcgaactggggc----------------------
B D                       Pig  --------------------------------------------cggc----------------------
B D                    Alpaca  --------------------------------------------cgg-----------------------
B D                   Dolphin  --------------------------------------------cggc----------------------
                 Killer whale  --------------------------------------------cggc----------------------
B D                       Cow  --------------------------------------------cggc----------------------
B D                     Horse  --------------------------------------------gg------------------------
               Pacific walrus  --------------------------------------------gg------------------------
             Black flying-fox  --------------------------------------------tggc----------------------
B D                   Megabat  --------------------------------------------tggc----------------------
B D                  Hedgehog  --------------------------------------------gcgt----------------------
B D                     Shrew  --------------------------------------------gagc----------------------
              Star-nosed mole  --------------------------------------------gggc----------------------
B D                  Elephant  --------------------------------------------gggc----------------------
          Cape elephant shrew  --------------------------------------------aggc----------------------
B D                   Manatee  --------------------------------------------gggc----------------------
             Cape golden mole  ----------------------------------------------gc----------------------
                     Aardvark  --------------------------------------------gtgc----------------------
B D                 Armadillo  --------------------------------------------g-gc----------------------
B D                   Opossum  -------ctgtttcgttgcggg-----cgggcgagcgggcagagcggc----------------------
B D           Tasmanian devil  -------cggcctccccccgggac--ccaggcctccaggaagctgggc----------------------
B D                  Platypus  -----------------------tggccagttacccactgggtctgac----------------------
  D       Collared flycatcher  cgg-------------------------------------------------------------------
  D    White-throated sparrow  gggtcccggt------------------------------------------------------------
B D       Medium ground finch  gaggccagag------------------------------------------------------------
B D               Zebra finch  gagagccgcg------------------------------------------------------------
B D                   Chicken  gtggcc----------------------------------------------------------------
B D                    Turkey  gcggcctgag------------------------------------------------------------
B D        American alligator  gggggcgggg------------------------------------------------------------
  D           Green seaturtle  ctgctcaagc------------------------------------------------------------
  D            Painted turtle  ctgctcaagc------------------------------------------------------------
  D  Chinese softshell turtle  ctgttccaac------------------------------------------------------------
B D                 Tetraodon  -------------------------------------tggaagtcggcgctg-----------------g
                  Spotted gar  -------------------------------------cggagtcctacatcacggtcttcgagcacaccg
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Chinese tree shrew  ======================================================================
B D                      Pika  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                    Rabbit  ======================================================================
B D                Guinea pig  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D          White rhinoceros  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Weddell seal  ======================================================================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --------
                        Chimp  --------
                      Gorilla  --------
                    Orangutan  --------
                       Gibbon  --------
          Crab-eating macaque  --------
                       Baboon  --------
                 Green monkey  --------
                     Marmoset  --------
                     Bushbaby  --------
                     Squirrel  --------
                        Mouse  --------
                          Rat  --------
                   Chinchilla  --------
             Brush-tailed rat  --------
                          Pig  --------
                       Alpaca  --------
                      Dolphin  --------
                 Killer whale  --------
                          Cow  --------
                        Horse  --------
               Pacific walrus  --------
             Black flying-fox  --------
                      Megabat  --------
                     Hedgehog  --------
                        Shrew  --------
              Star-nosed mole  --------
                     Elephant  --------
          Cape elephant shrew  --------
                      Manatee  --------
             Cape golden mole  --------
                     Aardvark  --------
                    Armadillo  --------
                      Opossum  --------
              Tasmanian devil  --------
                     Platypus  --------
          Collared flycatcher  --------
       White-throated sparrow  --------
          Medium ground finch  --------
                  Zebra finch  --------
                      Chicken  --------
                       Turkey  --------
           American alligator  --------
              Green seaturtle  --------
               Painted turtle  --------
     Chinese softshell turtle  --------
                    Tetraodon  cca--ggc
                  Spotted gar  ccaccagc
                Domestic goat  ========
                        Sheep  ========
             Tibetan antelope  ========
                Big brown bat  ========
                     Microbat  ========
         David's myotis (bat)  ========
               Bactrian camel  NNNNNNNN
                        Panda  ========
                          Dog  ========
                 Prairie vole  ========
              Chinese hamster  ========
               Golden hamster  ========
                      Ferret   ========
                          Cat  NNNNNNNN
           Chinese tree shrew  ========
                         Pika  ========
               Naked mole-rat  ========
                       Rabbit  ========
                   Guinea pig  ========
       Lesser Egyptian jerboa  ========
                       Tenrec  ========
             White rhinoceros  NNNNNNNN
                    Zebrafish  ========
                  Stickleback  ========
     Mexican tetra (cavefish)  ========
       Spiny softshell turtle  ========
              Squirrel monkey  NNNNNNNN
                 Weddell seal  ========
                       Rhesus  NNNNNNNN

Inserts between block 29 and 30 in window
B D                      Pig 20bp
B D                   Alpaca 149bp
B D                  Dolphin 20bp
                Killer whale 20bp
B D                      Cow 29bp
B D                    Horse 6bp
              Pacific walrus 5bp
            Black flying-fox 21bp
B D                  Megabat 22bp
B D                 Hedgehog 10bp
B D                    Shrew 7bp
             Star-nosed mole 1bp
B D                 Elephant 23bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp
            Cape golden mole 3bp
                    Aardvark 24bp
B D                Armadillo 3bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 7bp
B D                   Turkey 3bp
B D       American alligator 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp

Alignment block 30 of 456 in window, 45001122 - 45001125, 4 bps 
B D                     Human  cgcc-
B D                     Chimp  cgcc-
B D                   Gorilla  cgcc-
B D                 Orangutan  cgcc-
B D                    Gibbon  cacc-
B D       Crab-eating macaque  cgcc-
B D                    Baboon  cgcc-
B D              Green monkey  cgcc-
B D                  Marmoset  cgcc-
B D                  Bushbaby  agga-
B D                  Squirrel  tccc-
                   Chinchilla  ccga-
             Brush-tailed rat  caga-
B D                       Pig  tgcc-
B D                   Dolphin  tgcc-
                 Killer whale  tgcc-
B D                     Horse  -gcc-
B D                   Ferret   cgcc-
               Pacific walrus  cgcc-
             Black flying-fox  cgcc-
B D                   Megabat  cgcc-
B D                  Elephant  cggc-
          Cape elephant shrew  cggc-
B D                   Manatee  cgcc-
             Cape golden mole  cgcc-
                     Aardvark  ctcc-
B D                 Armadillo  cc---
B D                  Platypus  ggcc-
  D       Collared flycatcher  t----
  D    White-throated sparrow  t----
B D       Medium ground finch  t----
B D               Zebra finch  t----
B D                   Chicken  c----
B D                    Turkey  c----
B D        American alligator  t----
  D           Green seaturtle  c----
  D            Painted turtle  c----
  D  Chinese softshell turtle  t----
B D                 Tetraodon  -acct
                  Spotted gar  -agcc
B D                  Hedgehog  =====
B D                     Shrew  =====
               Domestic goat  =====
B D                     Sheep  =====
B D                       Cow  =====
            Tibetan antelope  =====
               Big brown bat  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
              Bactrian camel  NNNNN
B D                    Alpaca  =====
             Star-nosed mole  =====
B D                     Mouse  -----
B D                     Panda  =====
B D                       Dog  =====
B D                       Rat  -----
                Prairie vole  =====
B D           Chinese hamster  =====
              Golden hamster  =====
B D                       Cat  NNNNN
          Chinese tree shrew  =====
B D                      Pika  =====
B D            Naked mole-rat  =====
B D                    Rabbit  =====
B D                Guinea pig  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
B D          White rhinoceros  NNNNN
B D                 Zebrafish  =====
B D               Stickleback  =====
    Mexican tetra (cavefish)  =====
  D    Spiny softshell turtle  =====
B D           Squirrel monkey  NNNNN
B D           Tasmanian devil  -----
B D                   Opossum  -----
                Weddell seal  =====
B D                    Rhesus  NNNNN

Inserts between block 30 and 31 in window
B D                      Pig 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Black flying-fox 4bp
B D                  Megabat 4bp
B D                 Elephant 9bp
         Cape elephant shrew 4bp
                    Aardvark 9bp
B D                 Platypus 4134bp

Alignment block 31 of 456 in window, 45001126 - 45001129, 4 bps 
B D                     Human  ---gggc--------
B D                     Chimp  ---gggc--------
B D                   Gorilla  ---gggc--------
B D                 Orangutan  ---gggc--------
B D                    Gibbon  ---gggc--------
B D       Crab-eating macaque  ---gggc--------
B D                    Baboon  ---gggc--------
B D              Green monkey  ---gggc--------
B D                  Marmoset  ---ggtc--------
B D                  Bushbaby  ---ggga--------
B D                  Squirrel  ---ggcc--------
B D                     Mouse  ------c--------
B D                       Rat  ------c--------
                   Chinchilla  ---gg-c--------
             Brush-tailed rat  ---gg-c--------
B D                   Dolphin  ---gggc--------
                 Killer whale  ---gggc--------
B D                     Horse  ---gggc--------
B D                   Ferret   ---gggc--------
               Pacific walrus  ---gggc--------
             Black flying-fox  ---gggc--------
B D                   Megabat  ---gggc--------
B D                  Hedgehog  ---ccgc--------
B D                     Shrew  ---gggc--------
              Star-nosed mole  ---gagg--------
B D                   Opossum  ---gggt--------
B D           Tasmanian devil  ---cggt--------
B D                  Platypus  ---gg----------
  D       Collared flycatcher  ---gggc--------
  D    White-throated sparrow  ---gggt--------
B D       Medium ground finch  ---gagc--------
B D               Zebra finch  ---gggc--------
B D                   Chicken  ---cgcc--------
B D                    Turkey  ---cgcc--------
B D        American alligator  ---tgca--------
  D           Green seaturtle  ---catc--------
  D            Painted turtle  ---catc--------
  D  Chinese softshell turtle  ---ggcc--------
B D                 Tetraodon  gaagacccacg--gc
                  Spotted gar  ggctgcccagggagc
         Cape elephant shrew  ===============
               Domestic goat  ===============
B D                     Sheep  ===============
B D                       Cow  ===============
            Tibetan antelope  ===============
               Big brown bat  ===============
B D                  Microbat  ===============
        David's myotis (bat)  ===============
              Bactrian camel  NNNNNNNNNNNNNNN
B D                    Alpaca  ===============
B D                     Panda  ===============
B D                       Dog  ===============
                Prairie vole  ===============
B D           Chinese hamster  ===============
              Golden hamster  ===============
B D                       Cat  NNNNNNNNNNNNNNN
          Chinese tree shrew  ===============
B D                      Pika  ===============
B D            Naked mole-rat  ===============
B D                    Rabbit  ===============
B D                Guinea pig  ===============
B D                   Manatee  ---------------
B D                  Elephant  ===============
B D                 Armadillo  ---------------
      Lesser Egyptian jerboa  ===============
B D                    Tenrec  ===============
B D          White rhinoceros  NNNNNNNNNNNNNNN
B D                 Zebrafish  ===============
B D               Stickleback  ===============
    Mexican tetra (cavefish)  ===============
  D    Spiny softshell turtle  ===============
B D           Squirrel monkey  NNNNNNNNNNNNNNN
                    Aardvark  ===============
                Weddell seal  ===============
            Cape golden mole  ---------------
B D                       Pig  ===============
B D                    Rhesus  NNNNNNNNNNNNNNN

Inserts between block 31 and 32 in window
B D                  Opossum 4bp

Alignment block 32 of 456 in window, 45001130 - 45001134, 5 bps 
B D                     Human  g-gggg
B D                     Chimp  g-gggg
B D                   Gorilla  g-gggg
B D                 Orangutan  g-gggg
B D                    Gibbon  g-gtgg
B D       Crab-eating macaque  g-gggg
B D                    Baboon  g-gggg
B D              Green monkey  g-gggg
B D                  Marmoset  t-gggg
B D                  Bushbaby  gcgggg
B D                  Squirrel  g-ggcc
B D                     Mouse  g-gagc
B D                       Rat  g-gagc
                   Chinchilla  g-gagg
             Brush-tailed rat  g-gagg
B D                   Dolphin  t-ctgc
                 Killer whale  t-ctgc
B D                     Horse  c-gggg
B D                   Ferret   g-gggg
               Pacific walrus  g-gggg
             Black flying-fox  g-atgg
B D                   Megabat  g-atgg
B D                  Hedgehog  g-gcgg
B D                     Shrew  g-gcgg
              Star-nosed mole  a-gagg
B D                   Opossum  g-acga
B D           Tasmanian devil  g-gtga
B D                  Platypus  g-gaac
  D       Collared flycatcher  g-ggga
  D    White-throated sparrow  g-gggg
B D       Medium ground finch  g-ggct
B D               Zebra finch  g-ggag
B D                   Chicken  g-gctg
B D                    Turkey  a-gcag
B D        American alligator  g-tccg
  D           Green seaturtle  g-cgtg
  D            Painted turtle  g-cgtg
  D  Chinese softshell turtle  a-ggga
B D                 Tetraodon  g-ggga
                  Spotted gar  a-gtgg
         Cape elephant shrew  ======
               Domestic goat  ======
B D                     Sheep  ======
B D                       Cow  ======
            Tibetan antelope  ======
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
              Bactrian camel  NNNNNN
B D                    Alpaca  ======
B D                     Panda  ======
B D                       Dog  ======
                Prairie vole  ======
B D           Chinese hamster  ======
              Golden hamster  ======
B D                       Cat  NNNNNN
          Chinese tree shrew  ======
B D                      Pika  ======
B D            Naked mole-rat  ======
B D                    Rabbit  ======
B D                Guinea pig  ======
B D                   Manatee  ------
B D                  Elephant  ======
B D                 Armadillo  ------
      Lesser Egyptian jerboa  ======
B D                    Tenrec  ======
B D          White rhinoceros  NNNNNN
B D                 Zebrafish  ======
B D               Stickleback  ======
    Mexican tetra (cavefish)  ======
  D    Spiny softshell turtle  ======
B D           Squirrel monkey  NNNNNN
                    Aardvark  ======
                Weddell seal  ======
            Cape golden mole  ------
B D                       Pig  ======
B D                    Rhesus  NNNNNN

Inserts between block 32 and 33 in window
B D                 Squirrel 15bp
B D                    Horse 8bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 33 of 456 in window, 45001135 - 45001144, 10 bps 
B D                     Human  cgggagggcc--
B D                     Chimp  cgggagggcc--
B D                   Gorilla  cgggagggcc--
B D                 Orangutan  cggaagggcc--
B D                    Gibbon  cgggagggcc--
B D       Crab-eating macaque  cgggagggcc--
B D                    Baboon  cgggagggcc--
B D              Green monkey  cgggagggcc--
B D                  Marmoset  caggagggcc--
B D                  Bushbaby  cgggagggct--
B D                  Squirrel  ---------c--
B D           Chinese hamster  ---------c--
                   Chinchilla  -aaatgggcc--
             Brush-tailed rat  -aaacgggcg--
B D                   Dolphin  --------cg--
                 Killer whale  --------cg--
B D                   Ferret   --------cg--
               Pacific walrus  --------cg--
             Black flying-fox  --------cg--
B D                   Megabat  --------cg--
B D                  Hedgehog  --------cc--
B D                     Shrew  --------cc--
              Star-nosed mole  --------tc--
B D                  Elephant  -gcctgggcc--
B D                   Manatee  --tttaggcc--
             Cape golden mole  ---ttgggct--
                     Aardvark  -gtctaggcc--
B D                   Opossum  cggagggac---
B D           Tasmanian devil  gggacgtgc---
B D                  Platypus  tgagggggc---
  D       Collared flycatcher  ---------a--
  D    White-throated sparrow  ---------c--
B D       Medium ground finch  ---------c--
B D               Zebra finch  ---------c--
B D                   Chicken  ---------c--
B D                    Turkey  ---------c--
B D        American alligator  ---------g--
  D           Green seaturtle  ---------c--
  D            Painted turtle  ---------c--
  D  Chinese softshell turtle  ---------t--
B D                 Tetraodon  --ggcgagcgcg
                  Spotted gar  --gctgggcggc
         Cape elephant shrew  ============
               Domestic goat  ============
B D                     Sheep  ============
B D                       Cow  ============
            Tibetan antelope  ============
               Big brown bat  ============
B D                  Microbat  ============
        David's myotis (bat)  ============
              Bactrian camel  NNNNNNNNNNNN
B D                    Alpaca  ============
B D                     Mouse  ------------
B D                     Panda  ============
B D                       Dog  ============
B D                       Rat  ------------
                Prairie vole  ============
              Golden hamster  ============
B D                       Cat  NNNNNNNNNNNN
          Chinese tree shrew  ============
B D                      Pika  ============
B D            Naked mole-rat  ============
B D                    Rabbit  ============
B D                Guinea pig  ============
B D                 Armadillo  ------------
      Lesser Egyptian jerboa  ============
B D                    Tenrec  ============
B D                     Horse  ============
B D          White rhinoceros  NNNNNNNNNNNN
B D                 Zebrafish  ============
B D               Stickleback  ============
    Mexican tetra (cavefish)  ============
  D    Spiny softshell turtle  ============
B D           Squirrel monkey  NNNNNNNNNNNN
                Weddell seal  ============
B D                       Pig  ============
B D                    Rhesus  NNNNNNNNNNNN

Inserts between block 33 and 34 in window
B D                 Elephant 10bp
B D                  Manatee 10bp
            Cape golden mole 10bp
                    Aardvark 246bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 6bp
B D      Medium ground finch 6bp
B D              Zebra finch 17bp
B D                  Chicken 6bp
B D                   Turkey 6bp
B D       American alligator 6bp
  D          Green seaturtle 6bp
  D           Painted turtle 6bp
  D Chinese softshell turtle 6bp

Alignment block 34 of 456 in window, 45001145 - 45001148, 4 bps 
B D                     Human  a---cgc
B D                     Chimp  a---cgc
B D                   Gorilla  a---cgc
B D                 Orangutan  a---cgc
B D                    Gibbon  t---ttc
B D       Crab-eating macaque  a---cgc
B D                    Baboon  a---cgc
B D              Green monkey  a---cgc
B D                  Marmoset  t---cgc
B D                  Bushbaby  g---agc
B D                  Squirrel  a---ggg
B D           Chinese hamster  g---gga
                   Chinchilla  g---gag
             Brush-tailed rat  g---tgg
B D                   Dolphin  t---ggc
                 Killer whale  t---ggc
B D                   Ferret   a---ggg
               Pacific walrus  g---ggg
             Black flying-fox  g---tgg
B D                   Megabat  g---tgg
B D                  Hedgehog  c---tgt
B D                     Shrew  g---agg
              Star-nosed mole  g---tcg
B D                 Armadillo  a---ggc
B D                   Opossum  g---gga
B D           Tasmanian devil  ----tgc
B D                  Platypus  ----tga
  D       Collared flycatcher  ----cgg
  D    White-throated sparrow  ctggcgc
B D       Medium ground finch  c---ccc
B D               Zebra finch  c---cag
B D                   Chicken  c---cgc
B D                    Turkey  g---cgc
B D        American alligator  c---cgg
  D           Green seaturtle  g---cga
  D            Painted turtle  g---cga
  D  Chinese softshell turtle  c---tgg
B D                 Tetraodon  ---ccgg
                  Spotted gar  ---tcag
         Cape elephant shrew  =======
               Domestic goat  =======
B D                     Sheep  =======
B D                       Cow  =======
            Tibetan antelope  =======
               Big brown bat  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
              Bactrian camel  NNNNNNN
B D                    Alpaca  =======
B D                     Mouse  -------
B D                     Panda  =======
B D                       Dog  =======
B D                       Rat  -------
                Prairie vole  =======
              Golden hamster  =======
B D                       Cat  NNNNNNN
          Chinese tree shrew  =======
B D                      Pika  =======
B D            Naked mole-rat  =======
B D                    Rabbit  =======
B D                Guinea pig  =======
B D                   Manatee  =======
B D                  Elephant  =======
      Lesser Egyptian jerboa  =======
B D                    Tenrec  =======
B D                     Horse  =======
B D          White rhinoceros  NNNNNNN
B D                 Zebrafish  =======
B D               Stickleback  =======
    Mexican tetra (cavefish)  =======
  D    Spiny softshell turtle  =======
B D           Squirrel monkey  NNNNNNN
                    Aardvark  =======
                Weddell seal  =======
            Cape golden mole  =======
B D                       Pig  =======
B D                    Rhesus  NNNNNNN

Inserts between block 34 and 35 in window
B D                  Dolphin 9bp
                Killer whale 9bp
B D                  Ferret  1bp
              Pacific walrus 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 35 of 456 in window, 45001149 - 45001149, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D                  Bushbaby  a
B D                  Squirrel  a
B D           Chinese hamster  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                       Pig  g
B D                    Alpaca  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                  Platypus  g
  D       Collared flycatcher  g
  D    White-throated sparrow  t
B D       Medium ground finch  g
B D               Zebra finch  g
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  t
B D                 Tetraodon  c
                  Spotted gar  g
         Cape elephant shrew  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
              Bactrian camel  N
B D                     Mouse  -
B D                     Panda  =
B D                       Dog  =
B D                       Rat  -
                Prairie vole  =
              Golden hamster  =
B D                   Ferret   =
B D                       Cat  N
          Chinese tree shrew  =
B D                      Pika  =
              Pacific walrus  =
B D            Naked mole-rat  =
B D                    Rabbit  =
B D                Guinea pig  =
B D                   Manatee  =
B D                  Elephant  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                     Horse  =
            Black flying-fox  =
B D          White rhinoceros  N
B D                 Zebrafish  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
  D    Spiny softshell turtle  =
B D           Squirrel monkey  N
                    Aardvark  =
                Weddell seal  =
            Cape golden mole  =
B D                    Rhesus  N
B D                   Megabat  =

Inserts between block 35 and 36 in window
  D      Collared flycatcher 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
B D                  Chicken 2bp
B D       American alligator 2bp
  D          Green seaturtle 12bp
  D           Painted turtle 12bp

Alignment block 36 of 456 in window, 45001150 - 45001150, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D                  Bushbaby  g
B D                  Squirrel  g
B D           Chinese hamster  a
                   Chinchilla  g
             Brush-tailed rat  a
B D                       Pig  g
B D                    Alpaca  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  g
B D                  Platypus  g
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  g
B D                 Tetraodon  g
                  Spotted gar  g
         Cape elephant shrew  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
              Bactrian camel  N
B D                     Mouse  -
B D                     Panda  =
B D                       Dog  =
B D                       Rat  -
                Prairie vole  =
              Golden hamster  =
B D                   Ferret   =
B D                       Cat  N
          Chinese tree shrew  =
B D                      Pika  =
              Pacific walrus  =
B D            Naked mole-rat  =
B D                    Rabbit  =
B D                Guinea pig  =
B D                   Manatee  =
B D                  Elephant  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                     Horse  =
            Black flying-fox  =
B D          White rhinoceros  N
B D                 Zebrafish  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
  D    Spiny softshell turtle  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                    Turkey  -
B D                   Chicken  =
B D               Zebra finch  =
B D           Squirrel monkey  N
                    Aardvark  =
                Weddell seal  =
            Cape golden mole  =
B D                    Rhesus  N
B D                   Megabat  =
B D        American alligator  =

Inserts between block 36 and 37 in window
B D                      Pig 19bp
B D                      Cow 17bp
B D                Armadillo 13bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp

Alignment block 37 of 456 in window, 45001151 - 45001155, 5 bps 
B D                     Human  gccca
B D                     Chimp  gccca
B D                   Gorilla  gccca
B D                 Orangutan  g-cca
B D                    Gibbon  c-cct
B D       Crab-eating macaque  gctca
B D                    Baboon  gctca
B D              Green monkey  gctca
B D                  Marmoset  gccca
B D                  Bushbaby  gcccc
B D                  Squirrel  gcc--
B D           Chinese hamster  gcc--
                   Chinchilla  gtct-
             Brush-tailed rat  tcct-
B D                       Pig  ----g
B D                    Alpaca  ----g
B D                   Dolphin  ----g
                 Killer whale  ----g
B D                       Cow  ----g
B D                  Hedgehog  ----g
B D                     Shrew  ----g
              Star-nosed mole  ----g
B D                   Opossum  ----g
B D           Tasmanian devil  ----g
B D                  Platypus  gccc-
  D       Collared flycatcher  tcc--
  D    White-throated sparrow  gcc--
B D       Medium ground finch  gct--
B D               Zebra finch  ccc--
B D                   Chicken  gcc--
B D                    Turkey  --c--
B D        American alligator  gga--
  D           Green seaturtle  act--
  D            Painted turtle  acg--
  D  Chinese softshell turtle  aca--
B D                 Tetraodon  gccgg
                  Spotted gar  gcctg
         Cape elephant shrew  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
               Big brown bat  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
              Bactrian camel  NNNNN
B D                     Mouse  -----
B D                     Panda  =====
B D                       Dog  =====
B D                       Rat  -----
                Prairie vole  =====
              Golden hamster  =====
B D                   Ferret   =====
B D                       Cat  NNNNN
          Chinese tree shrew  =====
B D                      Pika  =====
              Pacific walrus  =====
B D            Naked mole-rat  =====
B D                    Rabbit  =====
B D                Guinea pig  =====
B D                   Manatee  =====
B D                  Elephant  =====
B D                 Armadillo  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
B D                     Horse  =====
            Black flying-fox  =====
B D          White rhinoceros  NNNNN
B D                 Zebrafish  =====
B D               Stickleback  =====
    Mexican tetra (cavefish)  =====
  D    Spiny softshell turtle  =====
B D           Squirrel monkey  NNNNN
                    Aardvark  =====
                Weddell seal  =====
            Cape golden mole  =====
B D                    Rhesus  NNNNN
B D                   Megabat  =====

Inserts between block 37 and 38 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
B D                      Cow 4bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                  Opossum 5bp
B D          Tasmanian devil 5bp
B D                 Platypus 5bp

Alignment block 38 of 456 in window, 45001156 - 45001156, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -t
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D                  Bushbaby  -g
B D                  Elephant  -g
          Cape elephant shrew  -g
B D                   Manatee  -g
             Cape golden mole  -g
B D                 Armadillo  -g
B D                   Opossum  -g
B D           Tasmanian devil  -a
B D                  Platypus  -c
  D       Collared flycatcher  -g
  D    White-throated sparrow  -g
B D       Medium ground finch  -g
B D               Zebra finch  -c
B D                   Chicken  -c
B D                    Turkey  -t
B D        American alligator  -g
  D           Green seaturtle  -g
  D            Painted turtle  -g
  D  Chinese softshell turtle  -g
B D                 Tetraodon  c-
                  Spotted gar  t-
B D                  Hedgehog  ==
B D                     Shrew  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
              Bactrian camel  NN
B D                    Alpaca  ==
             Star-nosed mole  ==
B D                     Mouse  --
B D                     Panda  ==
B D                       Dog  ==
B D                       Rat  --
                Prairie vole  ==
B D           Chinese hamster  --
              Golden hamster  ==
                Killer whale  ==
B D                   Ferret   ==
B D                  Squirrel  --
B D                       Cat  NN
          Chinese tree shrew  ==
B D                      Pika  ==
              Pacific walrus  ==
B D            Naked mole-rat  ==
B D                    Rabbit  ==
                  Chinchilla  --
B D                Guinea pig  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  --
B D                    Tenrec  ==
B D                     Horse  ==
            Black flying-fox  ==
B D          White rhinoceros  NN
B D                 Zebrafish  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
  D    Spiny softshell turtle  ==
B D           Squirrel monkey  NN
                    Aardvark  ==
                Weddell seal  ==
B D                   Dolphin  ==
B D                       Pig  ==