Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1689 in window, 63792529 - 63792532, 4 bps 
B D                     Human  tgat
B D                     Chimp  tgat
B D                   Gorilla  tgat
B D                 Orangutan  tgat
B D                    Gibbon  tgat
B D                    Rhesus  tgat
B D       Crab-eating macaque  tgat
B D                    Baboon  tgat
B D              Green monkey  tgat
B D                  Marmoset  tgat
B D           Squirrel monkey  tgat
B D                  Bushbaby  tgat
           Chinese tree shrew  tgat
B D                  Squirrel  tgat
       Lesser Egyptian jerboa  tgat
                 Prairie vole  tgat
B D           Chinese hamster  tgat
B D                     Mouse  tgac
B D                       Rat  cgac
B D            Naked mole-rat  tgat
B D                Guinea pig  tgat
                   Chinchilla  tgat
             Brush-tailed rat  tgac
B D                    Rabbit  tgat
B D                      Pika  tgac
B D                       Pig  tgat
B D                    Alpaca  tgat
               Bactrian camel  tgat
B D                   Dolphin  tgat
                 Killer whale  tgat
             Tibetan antelope  tgat
B D                       Cow  tgat
B D                     Sheep  tgat
                Domestic goat  tgat
B D                     Horse  tgat
B D          White rhinoceros  tgat
B D                       Cat  tgat
B D                       Dog  cgat
B D                   Ferret   tgat
B D                     Panda  tgat
               Pacific walrus  cgat
                 Weddell seal  cgat
             Black flying-fox  tgat
B D                   Megabat  tgat
                Big brown bat  tgat
         David's myotis (bat)  tgat
B D                  Microbat  tgat
B D                  Hedgehog  cgac
B D                     Shrew  tgat
              Star-nosed mole  tgat
B D                  Elephant  tgac
          Cape elephant shrew  tgac
B D                   Manatee  tgac
             Cape golden mole  tgac
B D                    Tenrec  tgac
                     Aardvark  tgac
B D                 Armadillo  tgat
B D                   Opossum  tgat
B D           Tasmanian devil  tgat
B D                   Wallaby  tgat
  D               Rock pigeon  cgat
  D              Saker falcon  tgat
  D          Peregrine falcon  tgat
  D       Collared flycatcher  tgat
  D    White-throated sparrow  tgat
B D       Medium ground finch  tgat
B D               Zebra finch  tgat
           Tibetan ground jay  tgat
B D                Budgerigar  tgat
  D                    Parrot  tgat
  D             Scarlet macaw  tgat
  D              Mallard duck  tgat
B D                   Chicken  tgat
B D                    Turkey  tgat
B D        American alligator  tgat
  D           Green seaturtle  tgat
  D            Painted turtle  tgat
  D  Chinese softshell turtle  tgat
  D    Spiny softshell turtle  tgat
B D                    Lizard  tgac
B D             X. tropicalis  ggat
B D                Coelacanth  tgat
B D                 Tetraodon  tgac
B D                      Fugu  cgac
       Yellowbelly pufferfish  cgac
B D              Nile tilapia  tgac
          Princess of Burundi  tgac
        Burton's mouthbreeder  tgac
                  Zebra mbuna  tgac
          Pundamilia nyererei  tgac
B D                    Medaka  tgac
           Southern platyfish  cgac
B D               Stickleback  tgac
B D              Atlantic cod  cgac
B D                 Zebrafish  tgac
     Mexican tetra (cavefish)  cgat
                  Spotted gar  ggac
B D                   Lamprey  tgac
              Golden hamster  ====
B D                  Platypus  ====

Alignment block 2 of 1689 in window, 63792533 - 63792567, 35 bps 
B D                     Human  cccttggaggcattcatggctgaagtggaggc----------aag
B D                     Chimp  cccttggaggcattcatggctgaagtggaggc----------aag
B D                   Gorilla  cccttggaggcattcatggctgaagtggaggc----------aag
B D                 Orangutan  cccttggaggcattcatggctgaagtggaggc----------aag
B D                    Gibbon  cccttggaggcattcatggctgaagtggaggc----------aag
B D                    Rhesus  cccttggaggcattcatggctgaagtggaggc----------aag
B D       Crab-eating macaque  cccttggaggcattcatggctgaagtggaggc----------aag
B D                    Baboon  cccttggaggcattcatggctgaagtggaggc----------aag
B D              Green monkey  cccttggaggcattcatggctgaagtggaggc----------aag
B D                  Marmoset  cccttggaggcattcatggctgaagtggaggc----------aag
B D           Squirrel monkey  cccttggaggcattcatggctgaagtcgaggc----------acg
B D                  Bushbaby  cccttggaggcattcatggctgaagttgaggc----------aag
           Chinese tree shrew  cccttggaggcattcatggctgaagtggaggc----------aag
B D                  Squirrel  cccttggaagcatttatggctgaagtggaggc----------aag
       Lesser Egyptian jerboa  cccttggaggcattcatggctgaagtggaggc----------atg
                 Prairie vole  cccttggaggcatttatggctgaagtagaggc----------aag
B D           Chinese hamster  cccttggaggccttcatggctgaagtggaggc----------aag
B D                     Mouse  cccttagaggcattcatggctgaagtggaggc----------aag
B D                       Rat  cccttagaggcattcatggctgaagtagaggc----------aag
B D            Naked mole-rat  cccttggaggcatttatggctgaagtagaggc----------aag
B D                Guinea pig  cccttggaggcatttatggctgaagtagaggc----------aag
                   Chinchilla  cccttggaggcatttatggctgaagtagaggc----------aag
             Brush-tailed rat  cccttggaggcattcatggctgaagtagaggt----------ggg
B D                    Rabbit  cccttggaggcattcatggctgaagtggaggc----------atg
B D                      Pika  ccactggaggcgttcatggctgaagtggaggc----------atg
B D                       Pig  ccattagaggcattcatggctgaagtggaggc----------aag
B D                    Alpaca  cccttagaggcattcatggctgaagtggaggc----------aag
               Bactrian camel  cccttagaggcattcatggctgaagtggaggc----------aag
B D                   Dolphin  cccttagaggcattcatggctgaagtggaggc----------aag
                 Killer whale  cccttagaggcattcatggctgaagtggaggc----------aag
             Tibetan antelope  cccttagaggcattcatggctgaagtggaggc----------aag
B D                       Cow  cccttagaggcattcatggctgaagtggaggc----------aag
B D                     Sheep  cccttagaggcattcatggctgaagtggaggc----------aag
                Domestic goat  cccttagaggcattcatggctgaagtggaggc----------aag
B D                     Horse  cccctggaggcattcatggctgaagtggaggc----------aag
B D          White rhinoceros  cccttggaggcattcatggctgaagtggaggc----------aag
B D                       Cat  cccttggaggcattcatggctgaagtggaggc----------aag
B D                       Dog  cccttggaggcattcatggctgaagtggaggc----------aag
B D                   Ferret   cccttggaggcgttcatggctgaagtggaggc----------aag
B D                     Panda  cccttggaggcattcatggccgaagtggaggc----------aag
               Pacific walrus  cccttggaggcattcatggctgaagtggaggc----------aag
                 Weddell seal  cccttggaggcattcatggccgaagtggaggc----------aag
             Black flying-fox  cccttggaggcattcatggctgaagtggaggc----------aag
B D                   Megabat  cccttggaggcattcatggctgaagtggaggc----------aag
                Big brown bat  cccttggaggcattcatggctgaagtggaagc----------aag
         David's myotis (bat)  cccttggaggcattcatggctgaagtggaagc----------aag
B D                  Microbat  cccttggaggcattcatggctgaagtggaagc----------aag
B D                  Hedgehog  cctctggaggcattcatggctgaagtggaggc----------acg
B D                     Shrew  cccttggaggcattcatggctgaagtggaggc----------atg
              Star-nosed mole  cccttggaagctttcatggctgaggtggaggc----------atg
B D                  Elephant  cccttggaggcattcatggctgaagtggaggc----------aag
          Cape elephant shrew  cccttggaggcattcatggctgaagtggaggt----------tag
B D                   Manatee  ccgttggaggcattcatggctgaagtggaggc----------aag
             Cape golden mole  cctttggaggcattcatggctgaagtggaggc----------aag
B D                    Tenrec  cccttggaggctttcatggctgaagtggaggc----------aag
                     Aardvark  cccttggaggcattcatggctgaggtggaggc----------aag
B D                 Armadillo  cccttggaggcattcatggctgaagtggaggc----------aag
B D                   Opossum  cccctggaagcattcatggctgaagtagaggcaagactctttata
B D           Tasmanian devil  cccctggaagcattcatggctgaagtagaggcaaggctctttaaa
B D                   Wallaby  cccctggaagagttcatggctaaagtagagga--------tcaag
B D                  Platypus  cccctggaagcgttcatggccgaagtggaggc----------aag
  D               Rock pigeon  cctctggaggcgttcatggctgaagtggaggc----------aag
  D              Saker falcon  cctctggaggcattcatggctgaagtggaggc----------aag
  D          Peregrine falcon  cctctggaggcattcatggctgaagtggaggc----------aag
  D       Collared flycatcher  cctctggaggcattcatggctgaagtggaggc----------aag
  D    White-throated sparrow  cctctggaggcattcatggctgaagtggaggc----------aag
B D       Medium ground finch  cctctggaggcattcatggctgaagtggaggc----------aag
B D               Zebra finch  cctctggaggcattcatggctgaagtggaggc----------aag
           Tibetan ground jay  cctctggaggcattcatggctgaagtggaggc----------aag
B D                Budgerigar  cctctggaggcattcatggctgaagtggaggc----------aag
  D                    Parrot  cctctggaggcattcatggctgaagtggaggc----------aag
  D             Scarlet macaw  cctctggaggcattcatggctgaagtggaggc----------aag
  D              Mallard duck  cctctggaggcattcatggctgaagtggaggc----------aag
B D                   Chicken  cctctggaggcgttcatggctgaagtggaggc----------aag
B D                    Turkey  cctctggaggcattcatggctgaagtggaggc----------aag
B D        American alligator  cctctggaagcattcatggctgaagtggaggt----------aag
  D           Green seaturtle  cccttggaagcattcatggctgaagtggaggc----------aag
  D            Painted turtle  cccttggaagcattcatggctgaagtggaggc----------aag
  D  Chinese softshell turtle  cccttggaagcattcatggctgaagtggaggc----------aag
  D    Spiny softshell turtle  cccttggaagcattcatggctgaagtggaggc----------aag
B D                    Lizard  ccattggaggcattcatggcagaagtggaggt----------gag
B D             X. tropicalis  cctctggaggctttcatggcagaagttgaggt----------tag
B D                Coelacanth  ccactggatgaatttatggctgaagtagaggt----------agg
B D                 Tetraodon  ccgttggacgctttcatgacagaagttgaggt----------gag
B D                      Fugu  ccgttggacgctttcatggcagaggttgaggt----------ggg
       Yellowbelly pufferfish  ccgttggacgctttcatggcagaggttgaggt----------ggg
B D              Nile tilapia  cctttggatgctttcatggctgaagttgaggt----------tag
          Princess of Burundi  cctttggatgctttcatggccgaagttgaggt----------gag
        Burton's mouthbreeder  cctttggatgctttcatggccgaagttgaggt----------gag
                  Zebra mbuna  cctttggatgctttcatggccgaagttgaggt----------gag
          Pundamilia nyererei  cctttggatgctttcatggccgaagttgaggt----------gag
B D                    Medaka  ccgttggatgcctttatggcagaggttgaggt----------gag
           Southern platyfish  ccgttggatgccttcatggcagaggtggaggt-------------
B D               Stickleback  ccactggacgccttcatggccgaggttgaggt----------gag
B D              Atlantic cod  cccctggatgctttcatggcagaggttgaggt----------gag
B D                 Zebrafish  cctcttgatgcctttatggctgaagtggaggt----------gag
     Mexican tetra (cavefish)  ccactggatgcctttatggctgaggtggaggt----------gag
                  Spotted gar  cctttggatgcctttatggccgaggtcgaggt----------gag
B D                   Lamprey  ccactggatgcattcatggcccaagtggagg--------------
              Golden hamster  =============================================

Inserts between block 2 and 3 in window
B D                 Platypus 2860bp
  D      Collared flycatcher 253bp
          Tibetan ground jay 524bp
B D               Budgerigar 446bp
B D                   Lizard 2bp
B D            X. tropicalis 6bp
B D               Coelacanth 3bp
B D                Tetraodon 5bp
B D                   Medaka 8bp
          Southern platyfish 8bp
B D             Atlantic cod 637bp
B D                Zebrafish 1509bp

Alignment block 3 of 1689 in window, 63792568 - 63792569, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
           Chinese tree shrew  ta
B D                  Squirrel  ta
       Lesser Egyptian jerboa  ta
                 Prairie vole  ta
B D           Chinese hamster  ta
B D                     Mouse  tg
B D                       Rat  tg
B D            Naked mole-rat  ta
B D                Guinea pig  ta
                   Chinchilla  ta
             Brush-tailed rat  ta
B D                    Rabbit  tg
B D                      Pika  tg
B D                       Pig  tg
B D                    Alpaca  t-
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  ta
B D                   Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                  Hedgehog  ta
B D                     Shrew  tg
              Star-nosed mole  ta
B D                  Elephant  tg
          Cape elephant shrew  tg
B D                   Manatee  tg
             Cape golden mole  tg
B D                    Tenrec  tg
                     Aardvark  tg
B D                 Armadillo  tg
B D                   Opossum  ta
B D           Tasmanian devil  ta
B D                   Wallaby  ca
  D               Rock pigeon  ac
  D              Saker falcon  ac
  D          Peregrine falcon  ac
  D    White-throated sparrow  ag
B D       Medium ground finch  ag
B D               Zebra finch  ag
  D              Mallard duck  ac
B D                   Chicken  ac
B D                    Turkey  ac
B D        American alligator  tc
  D           Green seaturtle  cc
  D            Painted turtle  cc
  D  Chinese softshell turtle  cc
  D    Spiny softshell turtle  cc
B D             X. tropicalis  ta
B D                Coelacanth  ta
B D                      Fugu  ga
       Yellowbelly pufferfish  ga
B D              Nile tilapia  ta
          Princess of Burundi  ta
        Burton's mouthbreeder  ta
                  Zebra mbuna  ta
          Pundamilia nyererei  ta
B D                    Medaka  t-
           Southern platyfish  t-
B D               Stickleback  -a
                  Spotted gar  ca
B D                   Lamprey  ta
              Golden hamster  ==
  D             Scarlet macaw  --
  D                    Parrot  --
B D                Budgerigar  ==
B D                    Lizard  ==
    Mexican tetra (cavefish)  --
B D                 Zebrafish  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
          Tibetan ground jay  ==

Inserts between block 3 and 4 in window
B D                     Fugu 753bp
      Yellowbelly pufferfish 753bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D              Stickleback 33bp
                 Spotted gar 1bp

Alignment block 4 of 1689 in window, 63792570 - 63792577, 8 bps 
B D                     Human  tcaa--c---at-g
B D                     Chimp  tcaa--c---at-g
B D                   Gorilla  tcaa--c---at-g
B D                 Orangutan  tcaa--c---at-g
B D                    Gibbon  tcaa--c---at-g
B D                    Rhesus  tcag--c---at-g
B D       Crab-eating macaque  tcag--c---at-g
B D                    Baboon  tcag--c---at-g
B D              Green monkey  tcag--c---at-g
B D                  Marmoset  ttaa--c---at-g
B D           Squirrel monkey  tcaa--c---at-g
B D                  Bushbaby  tcaattc---tt-g
           Chinese tree shrew  tcaa--c---tt-g
B D                  Squirrel  tcag--t---tt-a
       Lesser Egyptian jerboa  ttag--c---tctt
                 Prairie vole  tcag--ctcttc-t
B D           Chinese hamster  ttag--c---tc-t
B D                     Mouse  ttgg--c---tc-t
B D                       Rat  ctgg--t---tc-t
B D            Naked mole-rat  ttaa--t--ggt-t
B D                Guinea pig  gtag--c--agt-t
                   Chinchilla  ttag--c--agt-t
             Brush-tailed rat  ttag--c--agt-c
B D                    Rabbit  ccaa--a--tct-t
B D                      Pika  gcaa------ct-c
B D                       Pig  tcaa--c--tct-g
B D                    Alpaca  --at--c--tct-g
               Bactrian camel  tcat--c--tct-g
B D                   Dolphin  tcaa--c--tct-g
                 Killer whale  tcaa--c--tct-g
             Tibetan antelope  tcaa--c--tct-g
B D                       Cow  tcaa--c--tct-g
B D                     Sheep  tcaa--c--tct-g
                Domestic goat  tcaa--c--tct-g
B D                     Horse  tcaa--c--tct-a
B D          White rhinoceros  tcaa--c--tct-a
B D                       Cat  tcga--g--gct-g
B D                       Dog  ttaa--g--gct-g
B D                   Ferret   tcta--g--gct-g
B D                     Panda  tcaa--g--gct-g
               Pacific walrus  tcaa--g--gct-g
                 Weddell seal  tcaa--g--gct-g
             Black flying-fox  tcaa--c--cct-g
B D                   Megabat  tcaa--c--cct-g
                Big brown bat  tcaa--c--tct-g
         David's myotis (bat)  tcaa--c--tct-g
B D                  Microbat  tcaa--c--tct-g
B D                  Hedgehog  tcgt----------
B D                     Shrew  tcaa------tt-g
              Star-nosed mole  tcaactt--ttt-g
B D                  Elephant  tcag--c--tct-t
          Cape elephant shrew  ttaa--c--tct-t
B D                   Manatee  tcaa--c--tct-t
             Cape golden mole  tcaa--c--ttt-t
B D                    Tenrec  acag--c--tct-t
                     Aardvark  tcaa--c--tct-t
B D                 Armadillo  tcaa--c--tct-t
B D                   Opossum  tct-----------
B D           Tasmanian devil  tct-----------
B D                   Wallaby  gct-----------
  D               Rock pigeon  ccga--c--ttg--
  D              Saker falcon  ccgg--c--tcg--
  D          Peregrine falcon  ccgg--c--tcg--
  D    White-throated sparrow  ccag--c--ttg--
B D       Medium ground finch  ccag--c--ttg--
B D               Zebra finch  ccag--t--ttg--
  D                    Parrot  ---a--c--ctg--
  D             Scarlet macaw  ---a--c--ctg--
  D              Mallard duck  ccgg--c--ttg--
B D                   Chicken  ccag--c--tca--
B D                    Turkey  ccag--c--tca--
B D        American alligator  ccaa--t--gca--
  D           Green seaturtle  ccaa--c-------
  D            Painted turtle  ccaa--c-------
  D  Chinese softshell turtle  ccaa--c-------
  D    Spiny softshell turtle  ccaa--c-------
B D                    Lizard  ----------ta--
B D             X. tropicalis  tc------------
B D                Coelacanth  acaa--a--a----
B D                    Medaka  ------g-------
           Southern platyfish  ------a-------
     Mexican tetra (cavefish)  ---g--t-------
                  Spotted gar  tcaa--a-------
B D                   Lamprey  -caa--t--tat-g
              Golden hamster  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D               Stickleback  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D                Budgerigar  ==============
B D                 Zebrafish  ==============
B D              Nile tilapia  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D                  Platypus  ==============
  D       Collared flycatcher  ==============
          Tibetan ground jay  ==============

Inserts between block 4 and 5 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 3bp
  D   White-throated sparrow 464bp
B D      Medium ground finch 506bp
B D              Zebra finch 335bp
B D                   Lizard 9bp
B D                   Medaka 41bp
          Southern platyfish 30bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 6bp

Alignment block 5 of 1689 in window, 63792578 - 63792578, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  c
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  c
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D             X. tropicalis  t
B D                Coelacanth  t
B D                   Lamprey  t
B D                  Hedgehog  -
              Golden hamster  =
B D                   Ferret   -
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                    Turkey  -
                 Spotted gar  =
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  -
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  -
B D                 Zebrafish  =
  D               Rock pigeon  -
B D              Nile tilapia  =
  D            Painted turtle  -
B D                 Tetraodon  =
B D                   Chicken  -
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  -
B D               Zebra finch  =
  D              Saker falcon  -
  D           Green seaturtle  -
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 5 and 6 in window
          Chinese tree shrew 380bp
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 2bp
B D               Guinea pig 1bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                 Elephant 6bp
         Cape elephant shrew 6bp
B D                  Manatee 6bp
            Cape golden mole 6bp
B D                   Tenrec 6bp
                    Aardvark 6bp
B D                Armadillo 2bp

Alignment block 6 of 1689 in window, 63792579 - 63792579, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  a
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  g
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D             X. tropicalis  t
B D                Coelacanth  c
B D                   Lamprey  c
B D                  Hedgehog  -
              Golden hamster  =
          Chinese tree shrew  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                    Turkey  -
                 Spotted gar  =
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  =
B D                   Wallaby  =
  D    Spiny softshell turtle  -
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  -
B D                 Zebrafish  =
  D               Rock pigeon  -
B D              Nile tilapia  =
  D            Painted turtle  -
B D                 Tetraodon  =
B D                   Chicken  -
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  -
B D               Zebra finch  =
  D              Saker falcon  -
  D           Green seaturtle  -
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 6 and 7 in window
B D                      Pig 1bp
B D            X. tropicalis 583bp

Alignment block 7 of 1689 in window, 63792580 - 63792593, 14 bps 
B D                     Human  tcat--------t--aaaa---tat----tt
B D                     Chimp  tcat--------t--aaaa---tat----tt
B D                   Gorilla  tcat--------t--aaaa---tat----tt
B D                 Orangutan  tcat--------t--aaaa---tat----tt
B D                    Gibbon  tcat--------t--aaaa---tat----tt
B D                    Rhesus  tcat--------t--aaaa---tat----tt
B D       Crab-eating macaque  tcat--------t--aaaa---tat----tt
B D                    Baboon  tcat--------t--aaaa---tat----tt
B D              Green monkey  tcat--------t--aaaa---tat----tt
B D                  Marmoset  tcat--------t--aaaa---tat----tt
B D           Squirrel monkey  tcat--------t--aaaa---tat----tt
B D                  Bushbaby  ttat--------t--ggaa---tat----tc
B D                  Squirrel  tcat--------t--aaaa---tat----gt
       Lesser Egyptian jerboa  tcat--------t--aaag---tct----tt
                 Prairie vole  ttct--------t--aaaa---tac----tg
B D           Chinese hamster  tcat--------t--aaaa---tat----tg
B D                     Mouse  tcct--------t--aaaa---tat----tg
B D                       Rat  tcct--------t--aaaa---tat----cg
B D            Naked mole-rat  tcat--------t--aaag---tat----tt
B D                Guinea pig  tcat--------t--aaag---tat----tt
                   Chinchilla  tcac--------t--aaag---tat----tt
             Brush-tailed rat  tcat--------t--caac---tgc----tt
B D                    Rabbit  tcct--------t--aaaa---tat----gt
B D                      Pika  tcct--------t--aaa-------------
B D                       Pig  atgt--------t--aaaa---tct--tt--
B D                    Alpaca  atgt--------t--aaaa---ttc--tc--
               Bactrian camel  acgt--------t--aaaa---ttt--tc--
B D                   Dolphin  atgt--------t--aaca---ttt--tc--
                 Killer whale  atgt--------t--aaca---ttt--tc--
             Tibetan antelope  acgt--------t--aaca---ttt--tt--
B D                       Cow  acgt--------t--aaca---tct--tt--
B D                     Sheep  acgt--------t--aaca---ttt--tt--
                Domestic goat  acgt--------t--aaca---ttt--tt--
B D                     Horse  ttgt--------taaaaat---ttt------
B D          White rhinoceros  ttgt--------gaaaaat---ttt------
B D                       Cat  ttgt--------tggaagt---tgc------
B D                       Dog  ttgt--------t--aaat---ttc------
B D                   Ferret   ttgt--------t--aagc---tgc------
B D                     Panda  ttgt--------t--aagt---tgc------
               Pacific walrus  ttgt--------t--aagt---tac------
                 Weddell seal  ttgt--------t--aagt---tac------
             Black flying-fox  ttat--------t--aaaa---ttcta----
B D                   Megabat  ttat--------t--aaaa---ttcta----
                Big brown bat  ttgt--------t--aaaa---tgctc----
         David's myotis (bat)  ttgt--------t--aaaa---ttctc----
B D                  Microbat  ttgt--------a--aaaa---tgctc----
B D                  Hedgehog  ----------------------ctc------
B D                     Shrew  ttat--------t--taaa---tat------
              Star-nosed mole  tcat--------t--aaca---ttt------
B D                  Elephant  tatt--------t--aaag---tat----tc
          Cape elephant shrew  tctt--------t--gaaa---tat----tc
B D                   Manatee  tctt--------t--aaaa---tat----tc
             Cape golden mole  tctt--------a--agaa---tat----tt
B D                    Tenrec  tctt--------g--aaag---tat----tc
                     Aardvark  --ct--------t--aaaa---tat----tc
B D                 Armadillo  tcat--------t--aaaa---tat----tc
B D                   Opossum  tcat--------t--agaa---tatgc----
B D           Tasmanian devil  tcat--------t--agaa---tatgc----
B D                   Wallaby  acat--------t--aaga---gac------
  D               Rock pigeon  ------------t--gaaa---tgt----cg
  D              Saker falcon  ------------t--gaaa---tgt----tt
  D          Peregrine falcon  ------------t--gaaa---tgt----tt
  D                    Parrot  --gct-----cct--gaaa---tgt----tt
  D             Scarlet macaw  --gct-----cct--gaaa---tgt----tt
  D              Mallard duck  ------------t--gaaa---tgt----tt
B D                   Chicken  ------------t--gaga---tgt----tt
B D                    Turkey  ------------t--gaaa---tgt----tt
B D        American alligator  ------------t--gaaa---tgt----tt
  D           Green seaturtle  ----t-----cat--taag---tgt----tt
  D            Painted turtle  ----t-----cat--taag---tct----tt
  D  Chinese softshell turtle  ----t-----cat--taag---tgt----tt
  D    Spiny softshell turtle  ----t-----cat--taag---cgt----tt
B D                    Lizard  ttgat-----cat--aaga---att----a-
B D                Coelacanth  tgat--------c--aaac---tac----t-
B D              Nile tilapia  -----------------aa---ttt------
          Princess of Burundi  -----------------aa---ttt------
        Burton's mouthbreeder  -----------------aa---ttt------
                  Zebra mbuna  ------------------a---ttt------
          Pundamilia nyererei  -----------------aa---ttt------
B D                    Medaka  -----------------agtctaca------
           Southern platyfish  -----------------aa---gca------
     Mexican tetra (cavefish)  -------------------atgcat------
                  Spotted gar  ----------------------cct------
B D                   Lamprey  ----ttgcaatgt--aaaa---tgc----ca
              Golden hamster  ===============================
          Chinese tree shrew  ===============================
      Yellowbelly pufferfish  ===============================
B D                      Fugu  ===============================
B D               Stickleback  ===============================
B D                Budgerigar  ===============================
B D                 Zebrafish  ===============================
B D                 Tetraodon  ===============================
B D              Atlantic cod  ===============================
B D                  Platypus  ===============================
  D       Collared flycatcher  ===============================
B D               Zebra finch  ===============================
B D             X. tropicalis  ===============================
B D       Medium ground finch  ===============================
  D    White-throated sparrow  ===============================
          Tibetan ground jay  ===============================

Inserts between block 7 and 8 in window
B D                    Horse 279bp
B D         White rhinoceros 1bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 1bp
          Southern platyfish 1bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 1bp

Alignment block 8 of 1689 in window, 63792594 - 63792594, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  t
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  c
                     Aardvark  a
B D                 Armadillo  a
B D                   Opossum  t
B D           Tasmanian devil  t
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  g
B D                   Chicken  a
B D                    Turkey  a
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D                   Lamprey  g
              Golden hamster  =
B D                      Pika  -
          Chinese tree shrew  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  -
                 Spotted gar  =
B D                Budgerigar  =
B D                   Wallaby  -
B D                    Lizard  -
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
B D               Zebra finch  =
B D             X. tropicalis  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
          Tibetan ground jay  =

Inserts between block 8 and 9 in window
  D              Rock pigeon 25bp
  D             Saker falcon 25bp
  D         Peregrine falcon 25bp
  D                   Parrot 424bp
  D            Scarlet macaw 181bp
  D             Mallard duck 12bp
B D                  Chicken 12bp
B D                   Turkey 12bp
B D       American alligator 9bp
  D          Green seaturtle 8bp
  D           Painted turtle 8bp
  D Chinese softshell turtle 8bp
  D   Spiny softshell turtle 8bp

Alignment block 9 of 1689 in window, 63792595 - 63792598, 4 bps 
B D                     Human  gcag----
B D                     Chimp  gcag----
B D                   Gorilla  gcag----
B D                 Orangutan  gcag----
B D                    Gibbon  gcag----
B D                    Rhesus  gcag----
B D       Crab-eating macaque  gcag----
B D                    Baboon  gcag----
B D              Green monkey  gcag----
B D                  Marmoset  gcag----
B D           Squirrel monkey  gcag----
B D                  Bushbaby  gcaa----
B D                  Squirrel  acaa----
       Lesser Egyptian jerboa  gcag----
                 Prairie vole  gcaa----
B D           Chinese hamster  ga------
B D                     Mouse  gcat----
B D                       Rat  acag----
B D            Naked mole-rat  ggaa----
B D                Guinea pig  gcaa----
                   Chinchilla  gcaa----
             Brush-tailed rat  gcaa----
B D                    Rabbit  gcaa----
B D                       Pig  gcga----
B D                    Alpaca  gcaa----
               Bactrian camel  gcaa----
B D                   Dolphin  gtga----
                 Killer whale  gtga----
             Tibetan antelope  gcaa----
B D                       Cow  gcaa----
B D                     Sheep  gcaa----
                Domestic goat  gcaa----
B D                     Horse  gcac----
B D          White rhinoceros  gcag----
B D                       Cat  gcag----
B D                       Dog  gcaa----
B D                   Ferret   ggag----
B D                     Panda  gcaa----
               Pacific walrus  gcaa----
                 Weddell seal  gcaa----
             Black flying-fox  gtaa----
B D                   Megabat  gcaa----
                Big brown bat  gcaa----
         David's myotis (bat)  gtaa----
B D                  Microbat  gtaa----
B D                  Hedgehog  gcaa----
B D                     Shrew  acag----
              Star-nosed mole  gcaa----
B D                  Elephant  gcaa----
          Cape elephant shrew  gcat----
B D                   Manatee  gcag----
             Cape golden mole  ccaa----
B D                    Tenrec  acaa----
                     Aardvark  gcca----
B D                 Armadillo  gcaa----
B D                   Opossum  atta----
B D           Tasmanian devil  gtta----
  D               Rock pigeon  ccag----
  D              Saker falcon  ccag----
  D          Peregrine falcon  ccag----
  D              Mallard duck  gcag----
B D                   Chicken  gcag----
B D                    Turkey  gcag----
B D        American alligator  gtgg----
  D           Green seaturtle  ggtg----
  D            Painted turtle  ggtg----
  D  Chinese softshell turtle  gatg----
  D    Spiny softshell turtle  gctg----
B D                    Lizard  --ag----
B D                Coelacanth  ataa----
B D              Nile tilapia  acag----
          Princess of Burundi  acag----
        Burton's mouthbreeder  acag----
                  Zebra mbuna  acag----
          Pundamilia nyererei  acag----
B D                    Medaka  taaa----
           Southern platyfish  aaaa----
     Mexican tetra (cavefish)  agag----
                  Spotted gar  acca----
B D                   Lamprey  gcagggtg
              Golden hamster  ========
B D                      Pika  --------
          Chinese tree shrew  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D               Stickleback  ========
  D             Scarlet macaw  ========
  D                    Parrot  ========
B D                Budgerigar  ========
B D                   Wallaby  --------
B D                 Zebrafish  ========
B D                 Tetraodon  ========
B D              Atlantic cod  ========
B D                  Platypus  ========
  D       Collared flycatcher  ========
B D               Zebra finch  ========
B D             X. tropicalis  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
          Tibetan ground jay  ========

Inserts between block 9 and 10 in window
B D                   Lizard 462bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 1bp
          Southern platyfish 1bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 1bp

Alignment block 10 of 1689 in window, 63792599 - 63792599, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  c
B D                    Rabbit  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  c
B D           Tasmanian devil  t
B D                   Wallaby  t
  D               Rock pigeon  t
  D              Saker falcon  t
  D          Peregrine falcon  t
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                Coelacanth  t
B D                   Lamprey  t
              Golden hamster  =
B D           Chinese hamster  -
B D                      Pika  -
          Chinese tree shrew  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
                 Spotted gar  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
B D               Zebra finch  =
B D             X. tropicalis  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
          Tibetan ground jay  =

Inserts between block 10 and 11 in window
  D             Mallard duck 465bp
B D                  Chicken 486bp
B D                   Turkey 485bp
B D       American alligator 16bp

Alignment block 11 of 1689 in window, 63792600 - 63792602, 3 bps 
B D                     Human  ta-------g
B D                     Chimp  ta-------g
B D                   Gorilla  ta-------g
B D                 Orangutan  ta-------g
B D                    Gibbon  ta-------g
B D                    Rhesus  ta-------g
B D       Crab-eating macaque  ta-------g
B D                    Baboon  ta-------g
B D              Green monkey  ta-------g
B D                  Marmoset  ta-------g
B D           Squirrel monkey  ta-------g
B D                  Bushbaby  tg-------g
B D                  Squirrel  ta-------g
       Lesser Egyptian jerboa  tt-------g
                 Prairie vole  tt-------g
B D                     Mouse  tt-------g
B D                       Rat  ct-------g
B D            Naked mole-rat  ta-------t
B D                Guinea pig  ta-------g
                   Chinchilla  ta-------g
             Brush-tailed rat  ca-------g
B D                    Rabbit  ta-------g
B D                       Pig  ta-------g
B D                    Alpaca  ta-------g
               Bactrian camel  ta-------g
B D                   Dolphin  ta-------g
                 Killer whale  ta-------g
             Tibetan antelope  ta-------a
B D                       Cow  ta-------g
B D                     Sheep  ta-------g
                Domestic goat  ta-------g
B D                     Horse  ta-------g
B D          White rhinoceros  ta-------t
B D                       Cat  ta-------g
B D                       Dog  ta-------g
B D                   Ferret   ta-------g
B D                     Panda  ta-------g
               Pacific walrus  ta-------g
                 Weddell seal  ta-------g
             Black flying-fox  ta-------g
B D                   Megabat  ta-------g
                Big brown bat  ta-------g
         David's myotis (bat)  ta-------g
B D                  Microbat  ta-------g
B D                  Hedgehog  cg-------g
B D                     Shrew  ca-------g
              Star-nosed mole  ca-------a
B D                  Elephant  ca-------g
          Cape elephant shrew  ta-------g
B D                   Manatee  ta-------g
             Cape golden mole  ta-------g
B D                    Tenrec  ta-------a
                     Aardvark  ca-------g
B D                 Armadillo  ta-------g
B D                   Opossum  tg-------g
B D           Tasmanian devil  tg-------g
B D                   Wallaby  tg-------a
  D               Rock pigeon  ca-------g
  D              Saker falcon  ca-------g
  D          Peregrine falcon  ca-------g
B D        American alligator  ca-------g
  D           Green seaturtle  ta-------a
  D            Painted turtle  ta-------a
  D  Chinese softshell turtle  ta-------a
  D    Spiny softshell turtle  ta-------a
B D                Coelacanth  ta-------t
B D              Nile tilapia  ta-------a
          Princess of Burundi  ta-------a
        Burton's mouthbreeder  ta-------a
                  Zebra mbuna  ta-------a
          Pundamilia nyererei  ta-------a
B D                    Medaka  tg-------c
           Southern platyfish  tacaccactc
     Mexican tetra (cavefish)  tac------a
                  Spotted gar  tc-------t
B D                   Lamprey  tt-------g
              Golden hamster  ==========
B D           Chinese hamster  ----------
B D                      Pika  ----------
          Chinese tree shrew  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Stickleback  ==========
B D                    Turkey  ==========
  D              Mallard duck  ==========
  D             Scarlet macaw  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
B D                    Lizard  ==========
B D                 Zebrafish  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
B D                  Platypus  ==========
  D       Collared flycatcher  ==========
B D               Zebra finch  ==========
B D             X. tropicalis  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========

Inserts between block 11 and 12 in window
B D                 Squirrel 1663bp
            Brush-tailed rat 18bp
B D                 Microbat 1bp

Alignment block 12 of 1689 in window, 63792603 - 63792608, 6 bps 
B D                     Human  ----------aaat---ag--
B D                     Chimp  ----------aaat---ag--
B D                   Gorilla  ----------aaat---ag--
B D                 Orangutan  ----------aaat---ag--
B D                    Gibbon  ----------aaat---ag--
B D                    Rhesus  ----------aaat---ag--
B D       Crab-eating macaque  ----------aaat---ag--
B D                    Baboon  ----------aaat---ag--
B D              Green monkey  ----------aaat---ag--
B D                  Marmoset  ----------aaat---ag--
B D           Squirrel monkey  ----------aaat---ag--
B D                  Bushbaby  ----------aaat---aa--
       Lesser Egyptian jerboa  -----------------aa--
                 Prairie vole  -----------------aa--
B D                     Mouse  -----------------aa--
B D                       Rat  -----------------aa--
B D            Naked mole-rat  -----------------aa--
B D                Guinea pig  -----------------aa--
                   Chinchilla  -----------------aa--
             Brush-tailed rat  -----------------ag--
B D                    Rabbit  ----------aaat---ag--
B D                      Pika  -----------------ag--
B D                       Pig  ----------aaat---ag--
B D                    Alpaca  ----------aagt---ag--
               Bactrian camel  ----------aagt---ag--
B D                   Dolphin  ----------aaat---ag--
                 Killer whale  ----------aaat---ag--
             Tibetan antelope  ----------aaac---ag--
B D                       Cow  ----------aaac---ag--
B D                     Sheep  ----------aaac---ag--
                Domestic goat  ----------aaac---ag--
B D                     Horse  ----------aaat---ag--
B D          White rhinoceros  ----------aaat---ag--
B D                       Cat  ----------aaag---at--
B D                       Dog  ----------aaat---ag--
B D                   Ferret   -----------aat---ag--
B D                     Panda  ----------aaat---ag--
               Pacific walrus  ----------aaat---ag--
                 Weddell seal  ----------aaat---ag--
             Black flying-fox  ----------taat---ag--
B D                   Megabat  ----------gaat---ag--
                Big brown bat  ----------aaat---aa--
         David's myotis (bat)  ----------aaat---ag--
B D                  Microbat  ----------aaat---ag--
B D                  Hedgehog  ----------aagt---ac--
B D                     Shrew  ----------ggtt---ag--
              Star-nosed mole  ----------aaat---at--
B D                  Elephant  ----------taat-------
          Cape elephant shrew  ----------aaac-------
B D                   Manatee  ----------aaat-------
             Cape golden mole  ----------aaat-------
B D                    Tenrec  ----------aatt-------
                     Aardvark  ----------aaat-------
B D                 Armadillo  ----------aaataga----
B D                   Opossum  ----------aaac---aa--
B D           Tasmanian devil  ----------aaat---aa--
B D                   Wallaby  ----------agaa---aa--
  D               Rock pigeon  ----------gagc---ag--
  D              Saker falcon  ----------gagc---ag--
  D          Peregrine falcon  ----------gagc---ag--
B D        American alligator  ----------gaac---ag--
  D           Green seaturtle  ----------actc---ct--
  D            Painted turtle  ----------actc---ct--
  D  Chinese softshell turtle  ----------aatc---tt--
  D    Spiny softshell turtle  ----------aatc---tt--
B D                Coelacanth  ------------------g--
B D              Nile tilapia  ------------gc---ag--
          Princess of Burundi  ------------gc---ag--
        Burton's mouthbreeder  ------------gc---ag--
                  Zebra mbuna  ------------gc---ag--
          Pundamilia nyererei  ------------gc---ag--
B D                    Medaka  ------------ct---aa--
           Southern platyfish  ------------ac---aa--
     Mexican tetra (cavefish)  ------------gc---ac--
                  Spotted gar  ------------ac---ag--
B D                   Lamprey  aatttgcccttaat---aaag
              Golden hamster  =====================
B D           Chinese hamster  ---------------------
B D                  Squirrel  =====================
          Chinese tree shrew  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D               Stickleback  =====================
B D                    Turkey  =====================
  D              Mallard duck  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
B D                    Lizard  =====================
B D                 Zebrafish  =====================
B D                 Tetraodon  =====================
B D                   Chicken  =====================
B D              Atlantic cod  =====================
B D                  Platypus  =====================
  D       Collared flycatcher  =====================
B D               Zebra finch  =====================
B D             X. tropicalis  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
          Tibetan ground jay  =====================

Inserts between block 12 and 13 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1830bp
  D   Spiny softshell turtle 1bp
B D               Coelacanth 5bp
B D             Nile tilapia 2bp
         Princess of Burundi 2bp
       Burton's mouthbreeder 2bp
                 Zebra mbuna 2bp
         Pundamilia nyererei 2bp
B D                   Medaka 2bp
          Southern platyfish 2bp
    Mexican tetra (cavefish) 2bp
                 Spotted gar 2bp

Alignment block 13 of 1689 in window, 63792609 - 63792609, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -c
B D                    Rabbit  -a
B D                      Pika  -a
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -g
B D                       Cow  -g
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -g
B D                   Megabat  -g
                Big brown bat  -c
         David's myotis (bat)  -c
B D                  Microbat  -c
B D                  Hedgehog  -t
B D                     Shrew  -a
              Star-nosed mole  -a
B D                   Opossum  -a
B D           Tasmanian devil  -a
B D                   Wallaby  -a
B D                Coelacanth  -a
B D              Nile tilapia  -a
          Princess of Burundi  -a
        Burton's mouthbreeder  -a
                  Zebra mbuna  -a
          Pundamilia nyererei  -a
B D                    Medaka  -c
           Southern platyfish  -a
     Mexican tetra (cavefish)  -a
                  Spotted gar  -g
B D                   Lamprey  t-
B D                    Tenrec  --
              Golden hamster  ==
B D           Chinese hamster  --
B D                  Elephant  --
         Cape elephant shrew  --
B D                  Squirrel  ==
B D                 Armadillo  --
B D                   Manatee  --
          Chinese tree shrew  ==
            Cape golden mole  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  --
B D               Stickleback  ==
B D                    Turkey  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D    Spiny softshell turtle  ==
B D                    Lizard  ==
  D          Peregrine falcon  --
B D                 Zebrafish  ==
  D               Rock pigeon  --
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  --
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D        American alligator  --
  D    White-throated sparrow  ==
          Tibetan ground jay  ==

Inserts between block 13 and 14 in window
B D                    Shrew 532bp
B D                  Opossum 9bp
B D          Tasmanian devil 8bp
B D                  Wallaby 21bp
B D               Coelacanth 2bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 1bp
          Southern platyfish 1bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 11bp

Alignment block 14 of 1689 in window, 63792610 - 63792610, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D                     Mouse  t
B D                       Rat  c
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  c
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  t
B D                 Armadillo  c
  D           Green seaturtle  t
  D            Painted turtle  t
  D    Spiny softshell turtle  t
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  t
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D                    Medaka  t
           Southern platyfish  t
     Mexican tetra (cavefish)  t
                  Spotted gar  a
B D                   Lamprey  t
B D                    Tenrec  -
              Golden hamster  =
B D           Chinese hamster  -
B D                  Elephant  -
         Cape elephant shrew  -
B D                     Shrew  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                   Manatee  -
          Chinese tree shrew  =
            Cape golden mole  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  -
B D               Stickleback  =
B D                Coelacanth  =
B D                    Turkey  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
  D          Peregrine falcon  -
B D                 Zebrafish  =
  D               Rock pigeon  -
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  -
B D             X. tropicalis  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 14 and 15 in window
      Lesser Egyptian jerboa 2bp
B D                    Mouse 24bp
B D                      Rat 2bp
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp

Alignment block 15 of 1689 in window, 63792611 - 63792617, 7 bps 
B D                     Human  c-----aagtt----------a
B D                     Chimp  c-----aagtt----------a
B D                   Gorilla  c-----aagtt----------a
B D                 Orangutan  c-----gagtt----------a
B D                    Gibbon  ------aagtt----------a
B D                    Rhesus  c-----aagct----------a
B D       Crab-eating macaque  c-----aagct----------a
B D                    Baboon  c-----aagct----------a
B D              Green monkey  c-----aagct----------a
B D                  Marmoset  c-----aggtt----------a
B D           Squirrel monkey  c-----gtgtt----------a
B D                  Bushbaby  c-----aagtt----------a
       Lesser Egyptian jerboa  ---------tt----------a
                 Prairie vole  -------agtt----------a
B D                       Rat  ---------tt----------a
B D                    Rabbit  c-----aagtt----------a
B D                      Pika  c-----aagtt----------a
B D                       Pig  c-----aaatt----------a
B D                    Alpaca  c-----aaatt----------a
               Bactrian camel  c-----aaatt----------a
B D                   Dolphin  c-----agatt----------a
                 Killer whale  c-----agatt----------a
             Tibetan antelope  c-----aaatt----------a
B D                       Cow  c-----agatt----------a
B D                     Sheep  c-----aaatt----------a
                Domestic goat  c-----aaatt----------a
B D                     Horse  c-----aaatt----------a
B D          White rhinoceros  c-----aaatt----------a
B D                       Cat  c-----aaatt----------a
B D                       Dog  c-----aaatt----------a
B D                   Ferret   c-----aaatt----------a
B D                     Panda  c-----aaatt----------a
               Pacific walrus  c-----agatt----------g
                 Weddell seal  c-----agatt----------g
             Black flying-fox  c-----aaatt----------a
B D                   Megabat  c-----aaatt----------a
                Big brown bat  c-----aaagt----------a
         David's myotis (bat)  c-----aaagt----------a
B D                  Microbat  c-----aaagt----------a
B D                  Hedgehog  c-----agact----------a
              Star-nosed mole  -------tatt----------a
B D                  Elephant  c-----a---------------
          Cape elephant shrew  c-----aagtt----------g
B D                   Manatee  t-----aagtt----------a
             Cape golden mole  c-----aagtt----------a
B D                    Tenrec  c-----aagtt----------a
                     Aardvark  c-----aagtt----------a
B D                 Armadillo  c-----aaatt----------g
  D               Rock pigeon  ------caaat----------g
  D              Saker falcon  ------caaat----------g
  D          Peregrine falcon  ------caaat----------g
B D        American alligator  ------aaaac----------a
  D           Green seaturtle  c-----cggtt----------a
  D            Painted turtle  c-----tggtc----------a
  D    Spiny softshell turtle  c-----cagtc----------a
B D                Coelacanth  a-----tggtt----------g
B D              Nile tilapia  c-----aaact----------a
          Princess of Burundi  c-----aaact----------a
        Burton's mouthbreeder  c-----aaact----------a
                  Zebra mbuna  c-----aaact----------a
          Pundamilia nyererei  c-----aaact----------a
B D                    Medaka  tccttaatgta----------g
           Southern platyfish  g--gaaaggtg----------a
     Mexican tetra (cavefish)  c-----atgctcacttgttaga
                  Spotted gar  c-----aggct----------a
B D                   Lamprey  -----gaagac----------a
B D                Guinea pig  ======================
B D                     Mouse  ======================
              Golden hamster  ======================
B D           Chinese hamster  ----------------------
B D                     Shrew  ======================
B D                  Squirrel  ======================
                  Chinchilla  ======================
            Brush-tailed rat  ======================
          Chinese tree shrew  ======================
B D            Naked mole-rat  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D               Stickleback  ======================
B D                    Turkey  ======================
  D              Mallard duck  ======================
  D             Scarlet macaw  ======================
  D                    Parrot  ======================
B D                Budgerigar  ======================
B D                   Wallaby  ======================
B D                    Lizard  ======================
B D                 Zebrafish  ======================
B D                 Tetraodon  ======================
B D                   Chicken  ======================
B D              Atlantic cod  ======================
B D                  Platypus  ======================
  D       Collared flycatcher  ======================
  D  Chinese softshell turtle  ======================
B D               Zebra finch  ======================
B D             X. tropicalis  ======================
B D       Medium ground finch  ======================
B D                   Opossum  ======================
  D    White-throated sparrow  ======================
          Tibetan ground jay  ======================
B D           Tasmanian devil  ======================

Inserts between block 15 and 16 in window
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
B D       American alligator 2bp
B D               Coelacanth 2bp
                 Spotted gar 10bp

Alignment block 16 of 1689 in window, 63792618 - 63792618, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  a
B D                  Bushbaby  a
       Lesser Egyptian jerboa  g
                 Prairie vole  a
B D                       Rat  g
B D                    Rabbit  g
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
B D                Coelacanth  g
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D                    Medaka  a
           Southern platyfish  a
     Mexican tetra (cavefish)  a
                  Spotted gar  c
B D                   Lamprey  a
B D                Guinea pig  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  -
B D                     Shrew  =
B D                  Squirrel  =
                  Chinchilla  =
            Brush-tailed rat  =
          Chinese tree shrew  =
B D            Naked mole-rat  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
B D                    Turkey  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
B D                 Zebrafish  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
B D             X. tropicalis  =
B D       Medium ground finch  =
B D                   Opossum  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 16 and 17 in window
  D              Rock pigeon 7bp
  D             Saker falcon 7bp
  D         Peregrine falcon 7bp
B D       American alligator 11bp
  D          Green seaturtle 2879bp
  D           Painted turtle 10bp

Alignment block 17 of 1689 in window, 63792619 - 63792628, 10 bps 
B D                     Human  ctta-----------------------------------------------------------gtact--
B D                     Chimp  ctta-----------------------------------------------------------gtact--
B D                   Gorilla  ctta-----------------------------------------------------------gtact--
B D                 Orangutan  ctta-----------------------------------------------------------gtaat--
B D                    Gibbon  ctta-----------------------------------------------------------gtact--
B D                    Rhesus  ctta-----------------------------------------------------------gtact--
B D       Crab-eating macaque  ctta-----------------------------------------------------------gtact--
B D                    Baboon  ctta-----------------------------------------------------------gtact--
B D              Green monkey  cgta-----------------------------------------------------------gtact--
B D                  Marmoset  cata-----------------------------------------------------------gtact--
B D           Squirrel monkey  tata-----------------------------------------------------------gtact--
B D                  Bushbaby  ctt---------------------------------------------------------------ct--
       Lesser Egyptian jerboa  tagg------------------------------------------------------------------
                 Prairie vole  catg------------------------------------------------------------------
B D                       Rat  caaa------------------------------------------------------------------
B D            Naked mole-rat  --aa------taaaccttgctcacatttgcctgttggcattttttgttgttgttctt-------------
B D                Guinea pig  --aa------------------------------------------------------------------
                   Chinchilla  --aa------------------------------------------------------------------
             Brush-tailed rat  --gagtgcct------------------------------------------------------------
B D                    Rabbit  ctta-----------------------------------------------------gtactt-------
B D                      Pika  cctt-----------------------------------------------------gttcac-------
B D                       Pig  ccta-----------------------------------------------------------gtgca--
B D                    Alpaca  cctc-----------------------------------------------------------gtgct--
               Bactrian camel  cctc-----------------------------------------------------------gtgct--
B D                   Dolphin  ccta-----------------------------------------------------------gtgct--
                 Killer whale  ccta-----------------------------------------------------------gtgct--
             Tibetan antelope  ccta-----------------------------------------------------------gtgct--
B D                       Cow  ccta-----------------------------------------------------------gtgct--
B D                     Sheep  tcta-----------------------------------------------------------gtgct--
                Domestic goat  tcta-----------------------------------------------------------gtgct--
B D                     Horse  cctc-----------------------------------------------------------atgct--
B D          White rhinoceros  cctt-----------------------------------------------------------gtgct--
B D                       Cat  ccta-----------------------------------------------------------gttat--
B D                       Dog  ccta-----------------------------------------------------------gc--t--
B D                   Ferret   tgt----------------------------------------------------------------t--
B D                     Panda  cct-------------------------------------------------------------------
               Pacific walrus  cct-------------------------------------------------------------------
                 Weddell seal  cct-------------------------------------------------------------------
             Black flying-fox  cctc-----------------------------------------------------------ttgtt--
B D                   Megabat  cctc-----------------------------------------------------------ttgtt--
                Big brown bat  tcta-----------------------------------------------------------atgct--
         David's myotis (bat)  ccta-----------------------------------------------------------gtgct--
B D                  Microbat  ccta-----------------------------------------------------------gtgct--
B D                  Hedgehog  -cca-----------------------------------------------------------gtatt--
              Star-nosed mole  ccca-----------------------------------------------------------gtgct--
B D                  Elephant  ccta-----------------------------------------------------------gtact--
          Cape elephant shrew  ccta-----------------------------------------------------------atatt--
B D                   Manatee  ccta-----------------------------------------------------------gtatt--
             Cape golden mole  tcta-----------------------------------------------------------g------
B D                    Tenrec  ctta-----------------------------------------------------------gtatt--
                     Aardvark  ccta-----------------------------------------------------------gcact--
B D                 Armadillo  ccta-----------------------------------------------------------gtatc--
B D                   Opossum  --------------------------------------------------------------tacttt--
B D           Tasmanian devil  --------------------------------------------------------------tgtgtt--
  D               Rock pigeon  ctt-------------------------------------------------------------------
  D              Saker falcon  ctt-------------------------------------------------------------------
  D          Peregrine falcon  ctt-------------------------------------------------------------------
B D        American alligator  cct-------------------------------------------------------------------
  D            Painted turtle  cat-------------------------------------------------------------------
B D                Coelacanth  -----------------------------------------------------------tttgacgtt--
B D              Nile tilapia  -----------------------------------------------------------------act--
          Princess of Burundi  -----------------------------------------------------------------act--
        Burton's mouthbreeder  -----------------------------------------------------------------act--
                  Zebra mbuna  -----------------------------------------------------------------act--
          Pundamilia nyererei  -----------------------------------------------------------------act--
B D                    Medaka  -----------------------------------------------------------------gcc--
           Southern platyfish  -----------------------------------------------------------------actg-
     Mexican tetra (cavefish)  -----------------------------------------------------------------accat
                  Spotted gar  -----------------------------------------------------------------acttg
B D                   Lamprey  ---------------------------------------------------------------------g
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
B D                  Squirrel  ======================================================================
          Chinese tree shrew  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
B D                    Turkey  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
B D                 Zebrafish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  -t----
                        Chimp  -t----
                      Gorilla  -t----
                    Orangutan  -t----
                       Gibbon  -t----
                       Rhesus  -t----
          Crab-eating macaque  -t----
                       Baboon  -t----
                 Green monkey  -t----
                     Marmoset  -t----
              Squirrel monkey  -t----
                     Bushbaby  -t----
       Lesser Egyptian jerboa  ------
                 Prairie vole  ------
                          Rat  ------
               Naked mole-rat  ------
                   Guinea pig  ------
                   Chinchilla  ------
             Brush-tailed rat  ------
                       Rabbit  ------
                         Pika  ------
                          Pig  -t----
                       Alpaca  -t----
               Bactrian camel  -t----
                      Dolphin  -t----
                 Killer whale  -t----
             Tibetan antelope  -t----
                          Cow  -t----
                        Sheep  -t----
                Domestic goat  -t----
                        Horse  -a----
             White rhinoceros  -t----
                          Cat  -t----
                          Dog  -t----
                      Ferret   -t----
                        Panda  ------
               Pacific walrus  ------
                 Weddell seal  ------
             Black flying-fox  -t----
                      Megabat  -t----
                Big brown bat  -t----
         David's myotis (bat)  -t----
                     Microbat  -t----
                     Hedgehog  -t----
              Star-nosed mole  -t----
                     Elephant  -t----
          Cape elephant shrew  -t----
                      Manatee  -t----
             Cape golden mole  ------
                       Tenrec  -t----
                     Aardvark  -t----
                    Armadillo  -t----
                      Opossum  -t----
              Tasmanian devil  -t----
                  Rock pigeon  ------
                 Saker falcon  ------
             Peregrine falcon  ------
           American alligator  ------
               Painted turtle  ------
                   Coelacanth  -t----
                 Nile tilapia  ------
          Princess of Burundi  ------
        Burton's mouthbreeder  ------
                  Zebra mbuna  ------
          Pundamilia nyererei  ------
                       Medaka  ------
           Southern platyfish  ------
     Mexican tetra (cavefish)  ------
                  Spotted gar  ------
                      Lamprey  ttaaaa
                        Mouse  ======
               Golden hamster  ======
              Chinese hamster  ------
                        Shrew  ======
                     Squirrel  ======
           Chinese tree shrew  ======
       Yellowbelly pufferfish  ======
                         Fugu  ======
                  Stickleback  ======
                       Turkey  ======
                 Mallard duck  ======
                Scarlet macaw  ======
                       Parrot  ======
                   Budgerigar  ======
                      Wallaby  ======
                       Lizard  ======
                    Zebrafish  ======
                    Tetraodon  ======
                      Chicken  ======
                 Atlantic cod  ======
                     Platypus  ======
          Collared flycatcher  ======
     Chinese softshell turtle  ======
                  Zebra finch  ======
                X. tropicalis  ======
              Green seaturtle  ======
          Medium ground finch  ======
       White-throated sparrow  ======
           Tibetan ground jay  ======

Inserts between block 17 and 18 in window
B D           Naked mole-rat 37bp
            Brush-tailed rat 274bp
B D                  Opossum 9bp
B D          Tasmanian devil 11bp
  D              Rock pigeon 3bp
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
B D       American alligator 1bp
  D           Painted turtle 3bp

Alignment block 18 of 1689 in window, 63792629 - 63792636, 8 bps 
B D                     Human  -ca-------aa-tctt
B D                     Chimp  -ca-------aa-tctt
B D                   Gorilla  -ca-------aa-tctt
B D                 Orangutan  -ca-------aa-tctt
B D                    Gibbon  -ca-------aa-tctt
B D                    Rhesus  -ca-------aa-tctt
B D       Crab-eating macaque  -ca-------aa-tctt
B D                    Baboon  -ca-------aa-tctt
B D              Green monkey  -ca-------aa-tctt
B D                  Marmoset  -ca-------aa-cctt
B D           Squirrel monkey  -ca-------aa-cctt
B D                  Bushbaby  -ca-------aa-cttt
       Lesser Egyptian jerboa  ----------------t
                 Prairie vole  ----------------t
B D                       Rat  -------------tgct
B D            Naked mole-rat  -ta-------ac-cctt
B D                Guinea pig  -ca-------tg-cctt
                   Chinchilla  -ta-------aa-cctt
B D                    Rabbit  -ca-------ga-cctt
B D                      Pika  -ca-------tt-cctt
B D                       Pig  -ta-------gt-cttc
B D                    Alpaca  -ta-------gt-cctc
               Bactrian camel  -ta-------gt-cctc
B D                   Dolphin  -ta-------gt-cctc
                 Killer whale  -ta-------gt-cctc
             Tibetan antelope  -ta-------gt-cctc
B D                       Cow  -ca-------gt-cct-
B D                     Sheep  -ta-------gt-cctc
                Domestic goat  -ta-------gt-cctc
B D                     Horse  -ta-------gc-cctt
B D          White rhinoceros  -ca-------gt-cctt
B D                       Cat  -ca-------gt-ca--
B D                       Dog  -cg-------gt-ca--
B D                   Ferret   -ca-------gt-ca--
B D                     Panda  --a-------gt-tc--
               Pacific walrus  --a-------gt-tc--
                 Weddell seal  --a-------gt-tc--
             Black flying-fox  -ca-------gt-tctc
B D                   Megabat  -ca-------gt-tctc
                Big brown bat  -ca-------gt-cctc
         David's myotis (bat)  -ca-------gt-cctc
B D                  Microbat  -ca-------gt-cctc
B D                  Hedgehog  -ca-------gt-cttc
              Star-nosed mole  -ca-------gt-cttc
B D                  Elephant  -ga-------gt-ccta
          Cape elephant shrew  -ta-------gtcccta
B D                   Manatee  -ca-------at-ccta
             Cape golden mole  --------------cta
B D                    Tenrec  -ca-------gt-ccta
                     Aardvark  -ca-------tt-tcta
B D                 Armadillo  -ca-------at-ccta
B D                   Opossum  ----------at-cct-
B D           Tasmanian devil  -gatagaagcat-ctt-
  D               Rock pigeon  -ca-------gc-cgt-
  D              Saker falcon  -ca-------ac-tgt-
  D          Peregrine falcon  -ca-------ac-tgt-
B D        American alligator  -ct-------ac-tag-
  D            Painted turtle  -ta-------ga-tat-
B D                Coelacanth  -aa-------aa-tatt
B D                   Lamprey  gaa-------gt-ctt-
B D                     Mouse  =================
              Golden hamster  =================
B D           Chinese hamster  -----------------
B D                     Shrew  =================
B D                  Squirrel  =================
            Brush-tailed rat  =================
          Chinese tree shrew  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D               Stickleback  =================
         Pundamilia nyererei  -----------------
                 Zebra mbuna  -----------------
       Burton's mouthbreeder  -----------------
         Princess of Burundi  -----------------
B D                    Medaka  -----------------
B D                    Turkey  =================
                 Spotted gar  -----------------
  D              Mallard duck  =================
  D             Scarlet macaw  =================
  D                    Parrot  =================
B D                Budgerigar  =================
B D                   Wallaby  =================
B D                    Lizard  =================
          Southern platyfish  -----------------
    Mexican tetra (cavefish)  -----------------
B D                 Zebrafish  =================
B D              Nile tilapia  -----------------
B D                 Tetraodon  =================
B D                   Chicken  =================
B D              Atlantic cod  =================
B D                  Platypus  =================
  D       Collared flycatcher  =================
  D  Chinese softshell turtle  =================
B D               Zebra finch  =================
B D             X. tropicalis  =================
  D           Green seaturtle  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
          Tibetan ground jay  =================

Inserts between block 18 and 19 in window
B D                     Pika 886bp

Alignment block 19 of 1689 in window, 63792637 - 63792655, 19 bps 
B D                     Human  at-------------tcaaaat----ttgtt-ttcta
B D                     Chimp  at-------------tcaaaat----ttgtt-ttcta
B D                   Gorilla  at-------------tcaaaat----ttgtt-ttcta
B D                 Orangutan  at-------------tcaaaat----ttgtt-ttcta
B D                    Gibbon  at-------------tcaaaat----ttgtt-ttcta
B D                    Rhesus  ac-------------tcaaaat----ttgtt-ttctg
B D       Crab-eating macaque  ac-------------tcaaaat----ttgtt-ttctg
B D                    Baboon  ac-------------tcaaaat----ttgtt-ttctg
B D              Green monkey  ac-------------tcaaaat----ttgtt-ttctt
B D                  Marmoset  tt-------------tcaaaat----ttgtt-ttcta
B D           Squirrel monkey  tt-------------tcaaaat----ttgtt-ttcta
B D                  Bushbaby  gt-------------tcaaa--------ttt-ttcta
       Lesser Egyptian jerboa  gt-------------tca--------gactt-ttctg
                 Prairie vole  ct-------------ata--------atttt-tttta
B D           Chinese hamster  ----------------------------ttc-ttttg
B D                       Rat  ct-------------ttt--------gtttg-cttgg
B D            Naked mole-rat  ga-------------aca--------cagt------a
B D                Guinea pig  gt-------------tca--------ttatt-tgtca
                   Chinchilla  gc-------------tca---------aatt-tgtct
B D                    Rabbit  gt-------------tcagaatttgggtttt-tttta
B D                       Pig  ct-------------gcagaat----ttgtt-tctta
B D                    Alpaca  at-------------tcagtat----ttggt-ttttg
               Bactrian camel  at-------------tcagtat----ttggt-ttttg
B D                   Dolphin  ag-------------tcag--t----ttgtt-tcttg
                 Killer whale  ag-------------tcag--t----ttgtt-tcttg
             Tibetan antelope  ag-------------acagagt----gtgtt-cattg
B D                       Cow  ----------------cagaat----ttgtt-tattg
B D                     Sheep  ag-------------acagagt----gtgtt-cattg
                Domestic goat  ag-------------acagagt----gtgtt-cattg
B D                     Horse  gt-------------tcagaat----ttgtt-ttctg
B D          White rhinoceros  gt-------------tcagaat----ttgtt-ttctc
B D                       Cat  -t-------------tcagaat----ttgct-ttctg
B D                       Dog  -t-------------tcagaat----ttgtt-tcttg
B D                   Ferret   -t-------------tcagaat----ttggt-ttttg
B D                     Panda  -t-------------tcagtct----ttgtt-ttctg
               Pacific walrus  -t-------------tc-------------t-ttctg
                 Weddell seal  -t-------------tc-------------t-ttctg
             Black flying-fox  at-------------tcagaat-------tt-ttctg
B D                   Megabat  at-------------tcagaat-------tt-ttctg
                Big brown bat  at-------------tcagaat----ttgtt-ttctg
         David's myotis (bat)  at-------------tcagaat----ttgtt-ttctg
B D                  Microbat  at-------------tcagaat----ttgtt-ttctg
B D                  Hedgehog  at-------------tcagaat----aagct-ttcta
              Star-nosed mole  at-------------tgtgaat----ttgct-ttttg
B D                  Elephant  gt-------------tctgaac----gagtt-ttcta
          Cape elephant shrew  ga-------------tcccatt----ttgttatttta
B D                   Manatee  gt-------------tctcaat----ttgtt-ctcta
             Cape golden mole  gt-------------atgtaa----------------
B D                    Tenrec  cc-------------tttgaat----ttgtc-ttcta
                     Aardvark  at-------------tacgagt----ttgtt-ttcta
B D                 Armadillo  gt-------------ccagaat----ttgtt-ttcta
B D                   Opossum  ag-------------tcataat----tgacc-ttaga
B D           Tasmanian devil  gc-------------tcaaa-------gaac-ttaaa
  D               Rock pigeon  at-------------tcagaat----gtcac-tta--
  D              Saker falcon  at-------------tcagaat----gtcac-tta--
  D          Peregrine falcon  at-------------tcagaat----gtcac-tta--
B D        American alligator  ac-------------tagtatt----atcac-tgt--
  D            Painted turtle  acaaaaggttaagggttatatt----agtac-t----
B D                Coelacanth  gt-------------ttgctgt----tagta-tctta
B D              Nile tilapia  ------------------aaat----tctgc-cttta
          Princess of Burundi  ------------------aaat----tctgc-cttta
        Burton's mouthbreeder  ------------------aaat----tctgc-cttta
                  Zebra mbuna  ------------------aaat----tctgc-cttca
          Pundamilia nyererei  ------------------aaat----tctgc-cttta
B D                    Medaka  ----------------acaaaa----tctac------
           Southern platyfish  ---------------aagataa----tctcc------
     Mexican tetra (cavefish)  ---------------taagtac----ttgtt-cttta
                  Spotted gar  ---------------gtgcagt----ttttt-tttt-
B D                   Lamprey  ----------------actgat----ttaca-tttta
B D                     Mouse  =====================================
              Golden hamster  =====================================
B D                     Shrew  =====================================
B D                  Squirrel  =====================================
B D                      Pika  =====================================
            Brush-tailed rat  =====================================
          Chinese tree shrew  =====================================
      Yellowbelly pufferfish  =====================================
B D                      Fugu  =====================================
B D               Stickleback  =====================================
B D                    Turkey  =====================================
  D              Mallard duck  =====================================
  D             Scarlet macaw  =====================================
  D                    Parrot  =====================================
B D                Budgerigar  =====================================
B D                   Wallaby  =====================================
B D                    Lizard  =====================================
B D                 Zebrafish  =====================================
B D                 Tetraodon  =====================================
B D                   Chicken  =====================================
B D              Atlantic cod  =====================================
B D                  Platypus  =====================================
  D       Collared flycatcher  =====================================
  D  Chinese softshell turtle  =====================================
B D               Zebra finch  =====================================
B D             X. tropicalis  =====================================
  D           Green seaturtle  =====================================
B D       Medium ground finch  =====================================
  D    White-throated sparrow  =====================================
          Tibetan ground jay  =====================================

Inserts between block 19 and 20 in window
            Cape golden mole 1bp
  D              Rock pigeon 7bp
  D             Saker falcon 8bp
  D         Peregrine falcon 8bp
B D       American alligator 8bp
  D           Painted turtle 8bp
B D               Coelacanth 1339bp
B D             Nile tilapia 8bp
         Princess of Burundi 8bp
       Burton's mouthbreeder 8bp
                 Zebra mbuna 8bp
         Pundamilia nyererei 8bp
B D                   Medaka 5bp
          Southern platyfish 4bp
    Mexican tetra (cavefish) 1219bp
                 Spotted gar 4bp

Alignment block 20 of 1689 in window, 63792656 - 63792661, 6 bps 
B D                     Human  g-----tc----t-----ta-
B D                     Chimp  g-----tc----t-----ta-
B D                   Gorilla  g-----tc----t-----ta-
B D                 Orangutan  g-----tc----t-----tt-
B D                    Gibbon  t-----tt-------------
B D                    Rhesus  g-----tc----t-----tt-
B D       Crab-eating macaque  g-----tc----t-----tt-
B D                    Baboon  g-----tc----c-----tt-
B D              Green monkey  g-----tc----t-----tt-
B D                  Marmoset  g-----tc----t-----tt-
B D           Squirrel monkey  g-----tc----t-----tt-
B D                  Bushbaby  g-----cc-------------
       Lesser Egyptian jerboa  g-----tt----t-----tg-
                 Prairie vole  g-----tc----t-----tt-
B D           Chinese hamster  g-----tc----t-----tt-
B D                       Rat  g-----tttg-gt-----tt-
B D            Naked mole-rat  g-----ctcaaga-----tt-
B D                Guinea pig  g-----ctggtgt-----tt-
                   Chinchilla  g-----ctggtgt-----tt-
B D                    Rabbit  g-----cc----t-----ta-
B D                       Pig  g-----gc----t--------
B D                    Alpaca  g-----cc----c--------
               Bactrian camel  g-----cc----c--------
B D                   Dolphin  g-----cc----c--------
                 Killer whale  g-----cc----c--------
             Tibetan antelope  g-----cc----c--------
B D                       Cow  g-----cc----c--------
B D                     Sheep  g-----cc----c--------
                Domestic goat  g-----cc----c--------
B D                     Horse  g-----cc----c--------
B D          White rhinoceros  g-----cc----cccgc----
B D                       Cat  a-----cc----c--------
B D                       Dog  g-----cc----c--------
B D                   Ferret   ------cc----c--------
B D                     Panda  t-----cc----c--------
               Pacific walrus  g-----cc--ctc--------
                 Weddell seal  g-----cc----c--------
             Black flying-fox  g-----cc----c--------
B D                   Megabat  g-----cc----c--------
                Big brown bat  g-----ct----t--------
         David's myotis (bat)  g-----cc----t--------
B D                  Microbat  g-----cc----t--------
B D                  Hedgehog  gctccccc----c--------
              Star-nosed mole  ------cc----a--------
B D                  Elephant  g-----ca-------------
          Cape elephant shrew  g-----ct-------------
B D                   Manatee  g-----cc-------------
B D                    Tenrec  g-----ct-------------
                     Aardvark  g-----cc-------------
B D                 Armadillo  g-----tc-------------
B D                   Opossum  g--------------------
B D           Tasmanian devil  g--------------------
B D              Nile tilapia  a--------------------
          Princess of Burundi  a--------------------
        Burton's mouthbreeder  a--------------------
                  Zebra mbuna  a--------------------
          Pundamilia nyererei  a--------------------
B D                    Medaka  t--------------------
           Southern platyfish  t--------------------
                  Spotted gar  a--------------------
B D                   Lamprey  ---------------gtataa
B D                     Mouse  =====================
              Golden hamster  =====================
B D                     Shrew  =====================
B D                  Squirrel  =====================
B D                      Pika  =====================
            Brush-tailed rat  =====================
          Chinese tree shrew  =====================
            Cape golden mole  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D               Stickleback  =====================
B D                Coelacanth  =====================
B D                    Turkey  =====================
  D              Mallard duck  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
B D                   Wallaby  =====================
B D                    Lizard  =====================
    Mexican tetra (cavefish)  =====================
  D          Peregrine falcon  =====================
B D                 Zebrafish  =====================
  D               Rock pigeon  =====================
  D            Painted turtle  =====================
B D                 Tetraodon  =====================
B D                   Chicken  =====================
B D              Atlantic cod  =====================
B D                  Platypus  =====================
  D       Collared flycatcher  =====================
  D  Chinese softshell turtle  =====================
B D               Zebra finch  =====================
  D              Saker falcon  =====================
B D             X. tropicalis  =====================
  D           Green seaturtle  =====================
B D       Medium ground finch  =====================
B D        American alligator  =====================
  D    White-throated sparrow  =====================
          Tibetan ground jay  =====================

Inserts between block 20 and 21 in window
      Lesser Egyptian jerboa 2bp
B D                      Rat 5bp
B D           Naked mole-rat 62bp
B D               Guinea pig 6bp
                  Chinchilla 84bp
B D         White rhinoceros 8bp
            Black flying-fox 4bp
B D                  Megabat 5bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D             Nile tilapia 11bp
         Princess of Burundi 11bp
       Burton's mouthbreeder 11bp
                 Zebra mbuna 11bp
         Pundamilia nyererei 11bp
B D                   Medaka 13bp
          Southern platyfish 11bp
                 Spotted gar 11bp

Alignment block 21 of 1689 in window, 63792662 - 63792675, 14 bps 
B D                     Human  ---------ttattttt--ttt--ttt
B D                     Chimp  ---------ttattattatttt--ttt
B D                   Gorilla  ---------ttatttt---ttt--ttt
B D                 Orangutan  ---------ttttttttt-ttt--ttt
B D                    Gibbon  -------------------ttt--ttt
B D                    Rhesus  ---------ttttttgt--tgtagttt
B D       Crab-eating macaque  ---------ttttttgt--tgtagttt
B D                    Baboon  ---------ttttttgt--tgtagttt
B D              Green monkey  ---------tttttttt--ttt--ttt
B D                  Marmoset  ---------ttttttt---ttt--ttt
B D           Squirrel monkey  ---------ttttttt---ttt--ttt
B D                  Bushbaby  ------------------------ttt
       Lesser Egyptian jerboa  ---------ttatttc---tct----t
                 Prairie vole  ---------ttgtttt---ggc-----
B D           Chinese hamster  ---------ttgtttt---gcc-----
B D                     Mouse  ---------tgttttt---ggt--gtt
B D                       Rat  ---------tggtttt---ggt--gtt
B D            Naked mole-rat  ---------tttttta-----------
B D                Guinea pig  ---------ttgttat-----------
                   Chinchilla  ---------ttttttt-----------
B D                    Rabbit  -----------atttt-----t--gat
B D                       Pig  ---------tttatt------------
B D                    Alpaca  ---------tt--ct------------
               Bactrian camel  ---------tt--ct------------
B D                   Dolphin  ---------tttatt------------
                 Killer whale  ---------tttatt------------
             Tibetan antelope  ---------tgtgtt------------
B D                       Cow  ---------tttgtt------------
B D                     Sheep  ---------tgtgtt------------
                Domestic goat  ---------tgtgtt------------
B D                     Horse  ---------tttttt------------
B D          White rhinoceros  ---------tttttt------------
B D                       Cat  ---------tttttg------------
B D                       Dog  ---------tcttt-------------
B D                   Ferret   ---------tctctt------------
B D                     Panda  ---------tctctt------------
               Pacific walrus  ---------tctctt------------
                 Weddell seal  ---------tctctt------------
             Black flying-fox  ---------tttttt------------
B D                   Megabat  ---------tttttt------------
                Big brown bat  ---------ttttgg------------
         David's myotis (bat)  ---------tttggg------------
B D                  Microbat  ---------ttttgg------------
B D                  Hedgehog  ---------ctttt-------------
              Star-nosed mole  ---------ttttt-------------
B D                  Elephant  ---------ttttat------------
          Cape elephant shrew  ---------tttcat------------
B D                   Manatee  ---------ttttat------------
             Cape golden mole  ---------tcttat------------
B D                    Tenrec  ---------ttttat------------
                     Aardvark  ---------ttttat------------
B D                 Armadillo  ---------ttttat------------
B D                   Opossum  ---------ttc---------------
B D           Tasmanian devil  ---------ttt---------------
  D               Rock pigeon  ---------tttttt------------
  D              Saker falcon  ---------tttttt------------
  D          Peregrine falcon  ---------tttttt------------
  D            Painted turtle  ---------tgcttt------------
B D              Nile tilapia  ---------ttt---------------
          Princess of Burundi  ---------ttt---------------
        Burton's mouthbreeder  ---------ttt---------------
                  Zebra mbuna  ---------ttt---------------
          Pundamilia nyererei  ---------ttt---------------
B D                    Medaka  ---------ttt---------------
           Southern platyfish  ---------ttt---------------
                  Spotted gar  ---------tat---------------
B D                   Lamprey  aatgatttgttgta-------------
              Golden hamster  ===========================
B D                     Shrew  ===========================
B D                  Squirrel  ===========================
B D                      Pika  ===========================
            Brush-tailed rat  ===========================
          Chinese tree shrew  ===========================
      Yellowbelly pufferfish  ===========================
B D                      Fugu  ===========================
B D               Stickleback  ===========================
B D                Coelacanth  ===========================
B D                    Turkey  ===========================
  D              Mallard duck  ===========================
  D             Scarlet macaw  ===========================
  D                    Parrot  ===========================
B D                Budgerigar  ===========================
B D                   Wallaby  ===========================
B D                    Lizard  ===========================
    Mexican tetra (cavefish)  ===========================
B D                 Zebrafish  ===========================
B D                 Tetraodon  ===========================
B D                   Chicken  ===========================
B D              Atlantic cod  ===========================
B D                  Platypus  ===========================
  D       Collared flycatcher  ===========================
  D  Chinese softshell turtle  ===========================
B D               Zebra finch  ===========================
B D             X. tropicalis  ===========================
  D           Green seaturtle  ===========================
B D       Medium ground finch  ===========================
B D        American alligator  ===========================
  D    White-throated sparrow  ===========================
          Tibetan ground jay  ===========================

Inserts between block 21 and 22 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
              Pacific walrus 186bp
                Weddell seal 39bp

Alignment block 22 of 1689 in window, 63792676 - 63792681, 6 bps 
B D                     Human  --ttgaga
B D                     Chimp  --ttgaga
B D                   Gorilla  --ttgaga
B D                 Orangutan  --ttgaga
B D                    Gibbon  --ttgaga
B D                    Rhesus  --ttgaga
B D       Crab-eating macaque  --ttgaga
B D                    Baboon  --ttgaga
B D              Green monkey  --ttgaga
B D                  Marmoset  --ttgaga
B D           Squirrel monkey  --tttaga
B D                  Bushbaby  --ttgaga
       Lesser Egyptian jerboa  --tttaga
B D                     Mouse  --tttaga
B D                       Rat  --tttaga
B D                    Rabbit  --tggaga
B D                       Pig  --gggaga
B D                    Alpaca  --ggggca
               Bactrian camel  --ggggca
B D                   Dolphin  --gggaga
                 Killer whale  --gggaga
             Tibetan antelope  --gagaga
B D                       Cow  --gagaga
B D                     Sheep  --gagaga
                Domestic goat  --gagaga
B D                     Horse  --tg-agc
B D          White rhinoceros  --tgcaga
B D                       Cat  --gggagg
B D                       Dog  --tggaga
B D                   Ferret   --tggaga
B D                     Panda  --gggaga
               Pacific walrus  ---ttaac
                 Weddell seal  ----taag
             Black flying-fox  --tggaga
B D                   Megabat  --tggaga
                Big brown bat  --gaaaga
         David's myotis (bat)  --gggata
B D                  Microbat  --gggaga
B D                  Hedgehog  --ttgaga
              Star-nosed mole  --ttgaga
B D                  Elephant  --ttgaga
          Cape elephant shrew  --gtggga
B D                   Manatee  --ttgaga
             Cape golden mole  --ttgaga
B D                    Tenrec  --ttgaga
                     Aardvark  --ttgaga
B D                 Armadillo  --ttgcga
B D                   Opossum  --ttgggt
B D           Tasmanian devil  --ttgggt
  D               Rock pigeon  --atgcaa
  D              Saker falcon  --gtgtga
  D          Peregrine falcon  --ctgtga
  D            Painted turtle  --ttacaa
B D              Nile tilapia  --ttcaga
          Princess of Burundi  --ttcaga
        Burton's mouthbreeder  --ttcaga
                  Zebra mbuna  --ttcaga
          Pundamilia nyererei  --ttcaga
B D                    Medaka  --ttttta
           Southern platyfish  --tttgag
                  Spotted gar  --tagatg
B D                   Lamprey  cctgta--
B D                Guinea pig  --------
              Golden hamster  ========
B D           Chinese hamster  --------
                Prairie vole  --------
B D                     Shrew  ========
B D                  Squirrel  ========
B D                      Pika  ========
                  Chinchilla  --------
            Brush-tailed rat  ========
          Chinese tree shrew  ========
B D            Naked mole-rat  --------
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D               Stickleback  ========
B D                Coelacanth  ========
B D                    Turkey  ========
  D              Mallard duck  ========
  D             Scarlet macaw  ========
  D                    Parrot  ========
B D                Budgerigar  ========
B D                   Wallaby  ========
B D                    Lizard  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
B D              Atlantic cod  ========
B D                  Platypus  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
B D               Zebra finch  ========
B D             X. tropicalis  ========
  D           Green seaturtle  ========
B D       Medium ground finch  ========
B D        American alligator  ========
  D    White-throated sparrow  ========
          Tibetan ground jay  ========

Inserts between block 22 and 23 in window
  D              Rock pigeon 1bp
  D             Saker falcon 156bp
  D         Peregrine falcon 156bp
  D           Painted turtle 2bp

Alignment block 23 of 1689 in window, 63792682 - 63792682, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
       Lesser Egyptian jerboa  -a
B D                     Mouse  -a
B D                       Rat  -a
B D                    Rabbit  -a
B D                       Pig  -a
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -g
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Hedgehog  -c
              Star-nosed mole  -a
B D                  Elephant  -a
          Cape elephant shrew  -g
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -a
                     Aardvark  -a
B D                 Armadillo  -a
B D                   Opossum  -g
B D           Tasmanian devil  -a
  D               Rock pigeon  -a
  D            Painted turtle  -a
B D              Nile tilapia  -a
          Princess of Burundi  -a
        Burton's mouthbreeder  -a
                  Zebra mbuna  -a
          Pundamilia nyererei  -a
B D                    Medaka  -a
           Southern platyfish  -g
                  Spotted gar  -a
B D                   Lamprey  t-
B D                Guinea pig  --
              Golden hamster  ==
B D           Chinese hamster  --
                Prairie vole  --
B D                     Shrew  ==
B D                  Squirrel  ==
B D                      Pika  ==
                  Chinchilla  --
            Brush-tailed rat  ==
          Chinese tree shrew  ==
B D                  Bushbaby  --
B D            Naked mole-rat  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
B D                Coelacanth  ==
B D                    Turkey  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==

Inserts between block 23 and 24 in window
B D                      Rat 1bp
B D             Nile tilapia 366bp
         Princess of Burundi 726bp
       Burton's mouthbreeder 723bp
                 Zebra mbuna 728bp
         Pundamilia nyererei 732bp
B D                   Medaka 5bp
          Southern platyfish 5bp

Alignment block 24 of 1689 in window, 63792683 - 63792687, 5 bps 
B D                     Human  tt-------------t--------tg
B D                     Chimp  tt-------------t--------tg
B D                   Gorilla  tt-------------t--------tg
B D                 Orangutan  tt-------------t--------tg
B D                    Gibbon  tt-------------t--------tg
B D                    Rhesus  tt-------------t--------tg
B D       Crab-eating macaque  tt-------------t--------tg
B D                    Baboon  tt-------------t--------tg
B D              Green monkey  tt-------------t--------tg
B D                  Marmoset  tt-------------t--------tg
B D           Squirrel monkey  tt-------------t--------tg
B D                  Bushbaby  ------------------------ta
       Lesser Egyptian jerboa  tt-------------t--------tg
                 Prairie vole  tt-------------t--------tg
B D           Chinese hamster  tt-------------t--------tg
B D                     Mouse  tt-------------t--------tg
B D                       Rat  tt-------------t--------tg
B D            Naked mole-rat  tt-------------t--------tg
B D                Guinea pig  tt------------------------
                   Chinchilla  ttgaggtactacggat--------tg
B D                    Rabbit  tt-------------t--------tg
B D                       Pig  tc-------------t--------tg
B D                    Alpaca  ag-------------t--------tg
               Bactrian camel  ag-------------t--------tg
B D                   Dolphin  tt-------------t--------tg
                 Killer whale  tt-------------t--------tg
             Tibetan antelope  tt-------------t--------tg
B D                       Cow  tt-------------t--------tg
B D                     Sheep  tt-------------t--------tg
                Domestic goat  tt-------------t--------tg
B D                     Horse  tt-------------t--------tg
B D          White rhinoceros  tt-------------t--------tg
B D                       Cat  tt-------------t--------tg
B D                       Dog  tt-------------t--------tg
B D                   Ferret   tt-------------t--------tg
B D                     Panda  tt-------------t--------tg
               Pacific walrus  ac-------------t--------ga
                 Weddell seal  tt-------------t--------ta
             Black flying-fox  tt-------------t--------tg
B D                   Megabat  tt-------------t--------tg
                Big brown bat  tt-------------t--------tg
         David's myotis (bat)  tt-------------t--------tg
B D                  Microbat  tt-------------t--------tg
B D                  Hedgehog  ta-------------t--------ta
              Star-nosed mole  tt-------------t--------tg
B D                  Elephant  tt-------------t--------ta
          Cape elephant shrew  tt-------------t--------tc
B D                   Manatee  tt-------------t--------tc
             Cape golden mole  tt-------------t--------tc
B D                    Tenrec  tg-------------t--------tc
                     Aardvark  tt-------------t--------tc
B D                 Armadillo  tt-------------t--------tg
B D                   Opossum  cc-------------t--------tg
B D           Tasmanian devil  cc-------------t--------t-
  D               Rock pigeon  tg-------------c--------tg
B D        American alligator  ct-------------c--------tg
  D            Painted turtle  ta-------------t--------tg
B D                    Medaka  tt-------------tttaagctatt
           Southern platyfish  tt-------------t--------tg
                  Spotted gar  tt-------------t--------tg
B D                   Lamprey  ct-------------t--------ta
              Golden hamster  ==========================
B D                     Shrew  ==========================
B D                  Squirrel  ==========================
B D                      Pika  ==========================
            Brush-tailed rat  ==========================
          Chinese tree shrew  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D               Stickleback  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
         Princess of Burundi  ==========================
B D                Coelacanth  ==========================
B D                    Turkey  ==========================
  D              Mallard duck  ==========================
  D             Scarlet macaw  ==========================
  D                    Parrot  ==========================
B D                Budgerigar  ==========================
B D                   Wallaby  ==========================
B D                    Lizard  ==========================
    Mexican tetra (cavefish)  ==========================
  D          Peregrine falcon  ==========================
B D                 Zebrafish  ==========================
B D              Nile tilapia  ==========================
B D                 Tetraodon  ==========================
B D                   Chicken  ==========================
B D              Atlantic cod  ==========================
B D                  Platypus  ==========================
  D       Collared flycatcher  ==========================
  D  Chinese softshell turtle  ==========================
B D               Zebra finch  ==========================
  D              Saker falcon  ==========================
B D             X. tropicalis  ==========================
  D           Green seaturtle  ==========================
B D       Medium ground finch  ==========================
  D    White-throated sparrow  ==========================
          Tibetan ground jay  ==========================

Inserts between block 24 and 25 in window
              Pacific walrus 15bp
                Weddell seal 134bp
  D              Rock pigeon 153bp
B D       American alligator 1bp
                 Spotted gar 217bp

Alignment block 25 of 1689 in window, 63792688 - 63792688, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  t
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  a
                   Chinchilla  a
B D                    Rabbit  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  t
B D                  Hedgehog  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                    Medaka  t
           Southern platyfish  t
B D                   Lamprey  c
B D                Guinea pig  -
              Golden hamster  =
B D                     Shrew  =
B D                  Squirrel  =
B D                      Pika  =
            Brush-tailed rat  =
          Chinese tree shrew  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  -
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  -
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  -

Inserts between block 25 and 26 in window
      Lesser Egyptian jerboa 342bp
B D           Naked mole-rat 2bp
                  Chinchilla 2bp
B D                   Medaka 1bp
          Southern platyfish 1bp

Alignment block 26 of 1689 in window, 63792689 - 63792690, 2 bps 
B D                     Human  --tc
B D                     Chimp  --tc
B D                   Gorilla  --tc
B D                 Orangutan  --tc
B D                    Gibbon  --tc
B D                    Rhesus  --tc
B D       Crab-eating macaque  --tc
B D                    Baboon  --tc
B D              Green monkey  --tc
B D                  Marmoset  --tc
B D           Squirrel monkey  --tc
B D                  Bushbaby  --tc
                 Prairie vole  --tt
B D           Chinese hamster  --tt
B D                     Mouse  --ta
B D                       Rat  --tc
B D            Naked mole-rat  --ta
                   Chinchilla  --tc
B D                    Rabbit  --tc
B D                       Pig  --tt
B D                    Alpaca  --tc
               Bactrian camel  --tc
B D                   Dolphin  --tt
                 Killer whale  --tt
             Tibetan antelope  --tc
B D                       Cow  --tc
B D                     Sheep  --tc
                Domestic goat  --tc
B D                     Horse  --tc
B D          White rhinoceros  --tg
B D                       Cat  --tc
B D                       Dog  --tc
B D                   Ferret   --tt
B D                     Panda  --tc
               Pacific walrus  --tc
                 Weddell seal  --tc
             Black flying-fox  --tc
B D                   Megabat  --tc
                Big brown bat  --tc
         David's myotis (bat)  --tc
B D                  Microbat  --tc
B D                  Hedgehog  --tc
              Star-nosed mole  --tc
B D                  Elephant  --tc
          Cape elephant shrew  --tg
B D                   Manatee  --tc
             Cape golden mole  --tc
B D                    Tenrec  --tc
                     Aardvark  --cc
B D                 Armadillo  --tc
B D                    Medaka  --tc
           Southern platyfish  --ta
B D                   Lamprey  ag--
B D                Guinea pig  ----
              Golden hamster  ====
B D                     Shrew  ====
B D                  Squirrel  ====
B D                      Pika  ====
      Lesser Egyptian jerboa  ====
            Brush-tailed rat  ====
          Chinese tree shrew  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
B D                Budgerigar  ====
B D                   Wallaby  ====
B D                    Lizard  ====
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D              Nile tilapia  ====
  D            Painted turtle  ----
B D                 Tetraodon  ====
B D                   Chicken  ====
B D              Atlantic cod  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D                   Opossum  ----
B D        American alligator  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D           Tasmanian devil  ----

Inserts between block 26 and 27 in window
B D                   Rabbit 4161bp
B D                   Medaka 1bp
          Southern platyfish 1bp

Alignment block 27 of 1689 in window, 63792691 - 63792695, 5 bps 
B D                     Human  cagta--
B D                     Chimp  cagta--
B D                   Gorilla  cagta--
B D                 Orangutan  cagta--
B D                    Gibbon  cagta--
B D                    Rhesus  cagta--
B D       Crab-eating macaque  cagta--
B D                    Baboon  cagta--
B D              Green monkey  cagta--
B D                  Marmoset  tagta--
B D           Squirrel monkey  tagta--
B D                  Bushbaby  tcata--
B D            Naked mole-rat  aggtc--
                   Chinchilla  aggga--
B D                       Pig  ttgta--
B D                    Alpaca  ttgta--
               Bactrian camel  ttgta--
B D                   Dolphin  ttgta--
                 Killer whale  ttgta--
             Tibetan antelope  ttgta--
B D                       Cow  ttgta--
B D                     Sheep  ttgta--
                Domestic goat  ttgta--
B D                     Horse  ttgta--
B D          White rhinoceros  ttgta--
B D                       Cat  tccta--
B D                       Dog  tcata--
B D                   Ferret   tcata--
B D                     Panda  ttata--
               Pacific walrus  tcata--
                 Weddell seal  tcgta--
             Black flying-fox  ttgta--
B D                   Megabat  ttgta--
                Big brown bat  ttata--
         David's myotis (bat)  ttata--
B D                  Microbat  ttata--
B D                  Hedgehog  atgta--
              Star-nosed mole  ttgta--
B D                  Elephant  aagta--
          Cape elephant shrew  ttgta--
B D                   Manatee  tagta--
             Cape golden mole  tagtc--
B D                    Tenrec  tacta--
                     Aardvark  tacta--
B D                 Armadillo  cagta--
B D                   Opossum  agata--
B D           Tasmanian devil  acata--
B D        American alligator  cc-----
B D                    Medaka  caaca--
           Southern platyfish  aaaga--
B D                   Lamprey  --acatt
B D                Guinea pig  -------
B D                       Rat  -------
B D                     Mouse  -------
              Golden hamster  =======
B D           Chinese hamster  -------
                Prairie vole  -------
B D                     Shrew  =======
B D                  Squirrel  =======
B D                      Pika  =======
B D                    Rabbit  =======
      Lesser Egyptian jerboa  =======
            Brush-tailed rat  =======
          Chinese tree shrew  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D               Stickleback  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                Coelacanth  =======
B D                    Turkey  =======
                 Spotted gar  =======
  D              Mallard duck  =======
  D             Scarlet macaw  =======
  D                    Parrot  =======
B D                Budgerigar  =======
B D                   Wallaby  =======
B D                    Lizard  =======
    Mexican tetra (cavefish)  =======
  D          Peregrine falcon  =======
B D                 Zebrafish  =======
  D               Rock pigeon  =======
B D              Nile tilapia  =======
  D            Painted turtle  -------
B D                 Tetraodon  =======
B D                   Chicken  =======
B D              Atlantic cod  =======
B D                  Platypus  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
B D               Zebra finch  =======
  D              Saker falcon  =======
B D             X. tropicalis  =======
  D           Green seaturtle  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
          Tibetan ground jay  =======

Inserts between block 27 and 28 in window
B D                      Pig 255bp

Alignment block 28 of 1689 in window, 63792696 - 63792699, 4 bps 
B D                     Human  gtct
B D                     Chimp  gtct
B D                   Gorilla  gtct
B D                 Orangutan  gtct
B D                    Gibbon  gtct
B D                    Rhesus  gtcg
B D       Crab-eating macaque  gtcg
B D                    Baboon  gtca
B D              Green monkey  gtcg
B D                  Marmoset  ctct
B D           Squirrel monkey  ctct
B D                  Bushbaby  tttt
B D            Naked mole-rat  ttaa
                   Chinchilla  acac
B D                       Pig  gcct
B D                    Alpaca  tttt
               Bactrian camel  tttt
B D                   Dolphin  ttct
                 Killer whale  ttct
             Tibetan antelope  ttct
B D                       Cow  ttcc
B D                     Sheep  ttcc
                Domestic goat  ttcc
B D                     Horse  ttct
B D          White rhinoceros  ctcc
B D                       Cat  ctct
B D                       Dog  ctct
B D                   Ferret   ctct
B D                     Panda  ctgt
               Pacific walrus  ctct
                 Weddell seal  ctct
             Black flying-fox  ctgt
B D                   Megabat  ctgt
                Big brown bat  ctct
         David's myotis (bat)  ctct
B D                  Microbat  ctcc
              Star-nosed mole  ctct
B D                  Elephant  ctct
          Cape elephant shrew  cgtt
B D                   Manatee  ctct
             Cape golden mole  atct
B D                    Tenrec  ttct
                     Aardvark  tgct
B D                 Armadillo  ttgt
B D                   Opossum  attt
B D           Tasmanian devil  tatt
B D        American alligator  --tt
  D            Painted turtle  --tt
B D                    Medaka  acct
           Southern platyfish  cact
B D                   Lamprey  gtat
B D                  Hedgehog  ----
B D                Guinea pig  ----
B D                       Rat  ----
B D                     Mouse  ----
              Golden hamster  ====
B D           Chinese hamster  ----
                Prairie vole  ----
B D                     Shrew  ====
B D                  Squirrel  ====
B D                      Pika  ====
B D                    Rabbit  ====
      Lesser Egyptian jerboa  ====
            Brush-tailed rat  ====
          Chinese tree shrew  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
B D                Budgerigar  ====
B D                   Wallaby  ====
B D                    Lizard  ====
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D              Nile tilapia  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
B D              Atlantic cod  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====

Inserts between block 28 and 29 in window
  D           Painted turtle 2bp

Alignment block 29 of 1689 in window, 63792700 - 63792712, 13 bps 
B D                     Human  atagttgcatata
B D                     Chimp  atagttgcatata
B D                   Gorilla  atagttgcatata
B D                 Orangutan  atagttgcatata
B D                    Gibbon  atagttgcatatg
B D                    Rhesus  atagttgcatata
B D       Crab-eating macaque  atagttgcatata
B D                    Baboon  atagttgcatata
B D              Green monkey  atagttgcatata
B D                  Marmoset  atagtttcatatg
B D           Squirrel monkey  atagtttcatatg
B D                  Bushbaby  gtagtttcataga
B D            Naked mole-rat  taagttgcccagg
                   Chinchilla  caaactgcatctt
B D                       Pig  ataatttcttaaa
B D                    Alpaca  gtagtttcttaaa
               Bactrian camel  gtagttttttaaa
B D                   Dolphin  atagtttcttaaa
                 Killer whale  atagtttcttaaa
             Tibetan antelope  gtagtttcttaaa
B D                       Cow  atagtttcttaaa
B D                     Sheep  gtagtttcttaaa
                Domestic goat  gtagtttgttaaa
B D                     Horse  acagtttcttaaa
B D          White rhinoceros  gcagtttcttaaa
B D                       Cat  atagtttcttaaa
B D                       Dog  acagtttcttaga
B D                   Ferret   atagtttcctaat
B D                     Panda  atagtatcttaaa
               Pacific walrus  gtattttcttaaa
                 Weddell seal  gtagtttcttaaa
             Black flying-fox  --ggtttcttaaa
B D                   Megabat  --ggtttcttaaa
                Big brown bat  --agtttcttaaa
         David's myotis (bat)  --agtttcttaaa
B D                  Microbat  --agtttcttaaa
B D                  Hedgehog  -----tgcctaaa
B D                     Shrew  acaatttcttaaa
              Star-nosed mole  acagtccatcgcc
B D                  Elephant  acgattctcc---
          Cape elephant shrew  gtagtttgtt---
B D                   Manatee  acaatttaataaa
             Cape golden mole  ctagtttcttgta
B D                    Tenrec  attgtttcttaaa
                     Aardvark  acaatttcgtaag
B D                 Armadillo  acagttt------
B D                   Opossum  -----ttattagc
B D           Tasmanian devil  -----ttttcagg
B D        American alligator  ---------tgaa
  D            Painted turtle  atgttgacatgga
B D                    Medaka  acaaataactgtg
           Southern platyfish  ataatgcatttta
B D                   Lamprey  tttatatcaaata
B D                Guinea pig  -------------
B D                       Rat  -------------
B D                     Mouse  -------------
              Golden hamster  =============
B D           Chinese hamster  -------------
                Prairie vole  -------------
B D                  Squirrel  =============
B D                      Pika  =============
B D                    Rabbit  =============
      Lesser Egyptian jerboa  =============
            Brush-tailed rat  =============
          Chinese tree shrew  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D               Stickleback  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D             Scarlet macaw  =============
  D                    Parrot  =============
B D                Budgerigar  =============
B D                   Wallaby  =============
B D                    Lizard  =============
    Mexican tetra (cavefish)  =============
  D          Peregrine falcon  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
B D              Nile tilapia  =============
B D                 Tetraodon  =============
B D                   Chicken  =============
B D              Atlantic cod  =============
B D                  Platypus  =============
  D       Collared flycatcher  =============
  D  Chinese softshell turtle  =============
B D               Zebra finch  =============
  D              Saker falcon  =============
B D             X. tropicalis  =============
  D           Green seaturtle  =============
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
          Tibetan ground jay  =============

Inserts between block 29 and 30 in window
B D           Naked mole-rat 12bp
                  Chinchilla 63bp
B D                  Opossum 5bp
B D          Tasmanian devil 5bp
B D                   Medaka 1bp
          Southern platyfish 1bp

Alignment block 30 of 1689 in window, 63792713 - 63792714, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  tg
                 Prairie vole  tt
B D           Chinese hamster  tt
B D                     Mouse  tt
B D                       Rat  tt
B D            Naked mole-rat  tt
B D                Guinea pig  tt
                   Chinchilla  tt
             Brush-tailed rat  tc
B D                       Pig  ta
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ca
B D                       Dog  tc
B D                   Ferret   tt
B D                     Panda  ca
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  ta
B D                   Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                  Hedgehog  tt
B D                     Shrew  tt
              Star-nosed mole  tt
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
             Cape golden mole  tt
B D                    Tenrec  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                   Opossum  tg
B D           Tasmanian devil  tg
B D        American alligator  tt
  D            Painted turtle  ta
B D                    Medaka  c-
           Southern platyfish  t-
B D                   Lamprey  tt
              Golden hamster  ==
B D                  Squirrel  ==
B D                      Pika  ==
B D                    Rabbit  ==
      Lesser Egyptian jerboa  ==
          Chinese tree shrew  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D              Nile tilapia  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D               Zebra finch  ==
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==

Inserts between block 30 and 31 in window
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                  Ferret  188bp
B D                 Elephant 5bp
B D                  Opossum 2bp
B D          Tasmanian devil 3bp
B D       American alligator 1bp
  D           Painted turtle 1bp

Alignment block 31 of 1689 in window, 63792715 - 63792715, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  c
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  a
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D        American alligator  a
  D            Painted turtle  g
B D                    Medaka  t
           Southern platyfish  t
B