Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1240 in window, 40287894 - 40287932, 39 bps 
B D                     Human  gagc------g-cggctggagt-tt-gctg-ctgccgc-tgt-----gc--------agt-ttg------
B D                     Chimp  gagc------g-cggctggagt-tt-gctg-ctgccgc-tgt-----gc--------agt-ttg------
B D                   Gorilla  gagc------g-cggctggagt-tt-gctg-ctgccgc-tgt-----gc--------agt-ttg------
B D                 Orangutan  gagc------g-cggctggagt-tt-gctg-ctgcagc-tgt-----gc--------agt-ttg------
B D                    Gibbon  gagc------a-cggctggagt-tt-gctg-ctgcagg-tgt-----gc--------agt-ttg------
B D                    Rhesus  gagc------g-cggctgtatt-tt-gctg-ctgccgg-tgt-----gc--------agt-ttg------
B D       Crab-eating macaque  gagc------g-cggctgtatt-tt-gctg-ctgcctg-tgt-----gc--------agt-ttg------
B D                    Baboon  gagc------g-cggttgtgtt-tt-gctg-ctgccgg-tgt-----gc--------agt-ttg------
B D              Green monkey  gagc------g-cggctgtatt-tt-gctg-ctgctgg-tgt-----gc--------agt-ttg------
B D                  Marmoset  gagc------g-cggctgggtt-tt-gctg-ctgctgg-tgt-----gc--------agt-ttg------
B D           Squirrel monkey  gagc------g-cggctgggtt-tt-gctg-ctgctgg-tgt-----gc--------agt-ttg------
B D                  Bushbaby  gagc------c-cggttgggtt-ta-gttg-ctgctgg-tgt-----gt--------ggt-tt-------
           Chinese tree shrew  gagt------t-tggctggagc-cg-gctg-ctgcgga-tgt-----g---------agt-ttg------
B D                  Squirrel  gagc------t-------gact-tt-tcta-ctgctgg-tgt-----gt--------aat-ttg------
       Lesser Egyptian jerboa  gagc------tgcgggtcgggt-tt--------gctgg-tgt-----gg--------agt-ttg------
                 Prairie vole  gagc------t-------gact-tt-gct----gcagc-tgt-----gc--------atc-tcg------
B D           Chinese hamster  gagc------g-------gact-tc-actg-cggccgc-tgt-----gc--------atc-tag------
               Golden hamster  gagc------t-------gact-tc-act----gccgc-tgt-----gc--------gtc-ttg------
B D                     Mouse  gagt------t-------gact-tt-gca----gctgc-tgt-----ag--------aat-ttg------
B D                       Rat  gagc------t-------gact-tt-gca----gcagc-tgt-----gg--------acc-ttg------
B D            Naked mole-rat  gagc------c-------gagc-tg-ggtg-ctgccgg-tgt-----gg--------agt-ctg------
B D                Guinea pig  gagc------c-------gcgc-tt-ggtg-ccgcagg-tgt-----ag--------agt-cc-------
                   Chinchilla  gagc------c-------gagc-tt-agtg-gttccgc-tgt-----ga---------gt-cgg------
             Brush-tailed rat  gagc------a-------gagc-tt-agtg-cttccac-tgt-----gg--------tgt-ccg------
B D                    Rabbit  gagc------g-cgtctgtatt-tt-gctgcctgctgg-tgt-----tc--------ggt-ttg------
B D                      Pika  gaga------g-cgtttgggtc-tt-gctgcctgctgg-tgt-----tc--------gtt----------
B D                       Pig  gagc------g-cagcttggct-ct-cctg-ctgcagg-tgt-----gg--------ggt-ttg------
B D                    Alpaca  gagc------g-cggctgggct-tt-ccgg-ctgcagg-tgt-----gg--------agt-gtg------
               Bactrian camel  gagt------g-cggctgggct-tt-ccgg-ctgcagg-tgt-----gg--------agt-gtg------
B D                   Dolphin  gagc------g-cgtctgggct-tt-ccgg-ctgacgg-tgt-----gg--------tgt-ttg------
                 Killer whale  gagc------g-cgtctgggct-tt-ccgg-ctgacgg-tgt-----gg--------tgt-ttg------
             Tibetan antelope  gagc------g-tggctgggct-tt-gctg-ctgtttg-tgt-----gg--------ggt-tta------
B D                       Cow  gagc------g-tggctgggct-tt-gctg-ctgtcgg-tgt-----gg--------ggt-tta------
B D                     Sheep  gagc------g-tggctgggct-tt-actg-ctgtctg-tgt-----gg--------gct-tta------
                Domestic goat  gagc------g-tggctgggct-tt-actg-ctgtctg-tgt-----gg--------gct-tta------
B D                     Horse  gagc------g-cgtctgggct-tt-gccg-ctgcggg-tgt-----gt--------ggt-ttg------
B D          White rhinoceros  gagc------g-cggctgggct-tt-gctg-ctgccgg-tgt-----gt--------ggt-tca------
B D                       Cat  gagt------g-cggctgggct-tt-actg-cagctgg-tgt-----gt--------agt-tta------
B D                       Dog  gagc------g-cgactgggccatt-tctg-ctgctgg-tgt-----gt--------agt-tca------
B D                   Ferret   gagc------g-cggtttggct-tt-actg-ctgctgg-tgt-----gt--------agt-tta------
B D                     Panda  gagc------g-cggctgggct-tt-actg-ctgctgg-tgt-----gt--------agt-ttg------
               Pacific walrus  gagt------g-cggctgggct-tt-actg-acgctgg-tgt-----gt--------ggt-tta------
                 Weddell seal  gagc------g-cggctgggct-tt-actg-acgctgg-tgt-----gt--------agt-tta------
             Black flying-fox  gagt------g-tggctgcgct-tt-tctg-ctgcctg-tgt-----at---------------------
B D                   Megabat  gagt------g-tggctgcgct-tt-tctg-ctgcctg-tgt-----at---------------------
                Big brown bat  gaat------g-tgtctggact-tc-gctg-ccgccgg-ttt-----gt---------------------
         David's myotis (bat)  gaat------g-tgtctggact-cg-gctg-ctgccgg-ttt-----gt---------------------
B D                  Microbat  gaat------g-tgtctggact-tg-gctg-ctgccgg-ttt-----gt---------------------
B D                  Hedgehog  gagc------g-cgcctatgct-gt-gcag-ctgtcgc-tga-----tt--------agt-ttg------
B D                     Shrew  gagc------c-gtcctgggtt-ct-gctg-ttgctgc-tgc-----tgctgctgctgctgctg------
              Star-nosed mole  gagc------g-cgctggggct-ct-cctg-ccaccg--------------------agtgtag------
B D                  Elephant  gagc------g-cggaagggct-tt-gctg-ctgccgg-tat-----ca--------g------------
          Cape elephant shrew  gagc------a-cgggaggtcc-ttggctc-gtgacggttgt-----ca--------c------------
B D                   Manatee  gagc------g-cggaaggggt-ta-gctg-ctgccga-tat-----ct--------g------------
             Cape golden mole  gaga------g-ttgaatgtct-ct-gcta-ctccctg-tgc-----ct--------g------------
B D                    Tenrec  cagc------g-cgg--tggga-cg-gctg-ctgtcgg-cgt-----cg--------g------------
                     Aardvark  gagt------g-cggtggtgct-gt-gctg-ctgctga-agt-----ct--------g------------
B D                 Armadillo  gagc------g-cggctgggct-tt-cctg-ctgctgg-tgtgtcgctt--------t------------
B D                   Opossum  gagctgagttg-cagcgagaac-tt-ctga------gc-tgt-----gt--------ggc-agc------
B D           Tasmanian devil  gagc-----tg-cggaaagagc-cg-gcga------gc-tgt-----gt--------ggc-ggg------
B D                   Wallaby  gagc-----tg-cgggaggacc-ct-ccga------tc-tgt-----gt--------ggc-ggg------
  D               Rock pigeon  gaag------g-tg---gggaa-gg-gtt------tgg-ggt-----cg--------ggg-gagga----
B D        American alligator  acgg------g-ca--cgggca-ct-gctg---accgg-ggt-----cc--------cgg-ccccactca
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  --
                        Chimp  --
                      Gorilla  --
                    Orangutan  --
                       Gibbon  --
                       Rhesus  --
          Crab-eating macaque  --
                       Baboon  --
                 Green monkey  --
                     Marmoset  --
              Squirrel monkey  --
                     Bushbaby  --
           Chinese tree shrew  --
                     Squirrel  --
       Lesser Egyptian jerboa  --
                 Prairie vole  --
              Chinese hamster  --
               Golden hamster  --
                        Mouse  --
                          Rat  --
               Naked mole-rat  --
                   Guinea pig  --
                   Chinchilla  --
             Brush-tailed rat  --
                       Rabbit  --
                         Pika  --
                          Pig  --
                       Alpaca  --
               Bactrian camel  --
                      Dolphin  --
                 Killer whale  --
             Tibetan antelope  --
                          Cow  --
                        Sheep  --
                Domestic goat  --
                        Horse  --
             White rhinoceros  --
                          Cat  --
                          Dog  --
                      Ferret   --
                        Panda  --
               Pacific walrus  --
                 Weddell seal  --
             Black flying-fox  --
                      Megabat  --
                Big brown bat  --
         David's myotis (bat)  --
                     Microbat  --
                     Hedgehog  --
                        Shrew  --
              Star-nosed mole  --
                     Elephant  --
          Cape elephant shrew  --
                      Manatee  --
             Cape golden mole  --
                       Tenrec  --
                     Aardvark  --
                    Armadillo  --
                      Opossum  --
              Tasmanian devil  --
                      Wallaby  --
                  Rock pigeon  --
           American alligator  cc
       Yellowbelly pufferfish  ==
                         Fugu  ==
          Pundamilia nyererei  ==
                  Zebra mbuna  ==
        Burton's mouthbreeder  ==
                   Coelacanth  ==
                  Spotted gar  ==
                       Lizard  ==
           Southern platyfish  --
     Mexican tetra (cavefish)  ==
             Peregrine falcon  ==
                    Zebrafish  ==
                 Nile tilapia  ==
               Painted turtle  ==
                    Tetraodon  ==
                      Chicken  ==
                     Platypus  ==
          Collared flycatcher  ==
     Chinese softshell turtle  ==
                  Zebra finch  ==
                 Saker falcon  ==
                X. tropicalis  ==
              Green seaturtle  ==
          Medium ground finch  ==
       White-throated sparrow  ==
           Tibetan ground jay  ==

Inserts between block 1 and 2 in window
B D           Naked mole-rat 565bp
B D                  Opossum 16bp
B D          Tasmanian devil 12bp
B D                  Wallaby 24bp

Alignment block 2 of 1240 in window, 40287933 - 40287974, 42 bps 
B D                     Human  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D                     Chimp  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D                   Gorilla  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D                 Orangutan  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D                    Gibbon  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D                    Rhesus  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D       Crab-eating macaque  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D                    Baboon  ttca----------------------------ggggcttg-tggtg---------------gt--gag--
B D              Green monkey  ttca----------------------------ggggctag-tggtg---------------gt--gag--
B D                  Marmoset  ttc-----------------------------ggggcttt-tggtg---------------gt--gag--
B D           Squirrel monkey  ttc-----------------------------ggggcttg-tggtg---------------gt--gag--
B D                  Bushbaby  ttca----------------------------ggaacttt-tggtg---------------ga--aag--
           Chinese tree shrew  ctct----------------------------ggagcctg-tggcg---------------ga--gag--
B D                  Squirrel  -----------------------------------------ggggagcttgtggta-----ga--gag--
       Lesser Egyptian jerboa  -----------------------------------------acgtg-------------------gag--
                 Prairie vole  -----------------------------------------tggcgg--------------ga--ga---
B D           Chinese hamster  -----------------------------------------tggcgg--------------ga--gag--
               Golden hamster  -----------------------------------------tggcgg--------------ga--gag--
B D                     Mouse  -----------------------------------------tggcgg--------------ga--gag--
B D                       Rat  -----------------------------------------tggccg--------------ga--gag--
B D                Guinea pig  -------------------------------------------------------------ga--gag--
                   Chinchilla  -------------------------------------------------------t-----ga--gag--
             Brush-tailed rat  -------------------------------------------------------t-----gg--gag--
B D                    Rabbit  --------------------------------gccgggaa-cggtgg--------------tg--gag--
B D                      Pika  -----------------------------------------cggtgt--------------gt--ga---
B D                       Pig  ttca----------------------------ggaacttgcccgtg---------------ga-------
B D                    Alpaca  tccg----------------------------ggagtttg-tggtg---------------ga--gac--
               Bactrian camel  tccg----------------------------ggagtttg-tggtg---------------ga--gac--
B D                   Dolphin  tcca----------------------------ggatcctg-tcgtg---------------ga--cag--
                 Killer whale  tcca----------------------------ggatcctg-tcgtg---------------ga--cag--
             Tibetan antelope  tcca----------------------------gcagcttg-tcgtg---------------ga--cag--
B D                       Cow  tcca----------------------------gcagcttg-tcgtg---------------ga--cag--
B D                     Sheep  tcca----------------------------gcagcttg-tcgtg---------------ga--cag--
                Domestic goat  tcct----------------------------gcagcttg-tcgtg---------------ga--cag--
B D                     Horse  ctta----------------------------ggagcttg-tcgtg---------------ga--gaa--
B D          White rhinoceros  ctca----------------------------ggagctt----gtg---------------ga--gaa--
B D                       Cat  ttcc----------------------------ggaacttg-ccctg---------------aa--gaa--
B D                       Dog  ttcg----------------------------gaagcttg-acctg---------------aa--gaa--
B D                   Ferret   ttcg----------------------------ggagcttg-a-ctg---------------aa--gaa--
B D                     Panda  ttcg----------------------------ggagcttg-acctg---------------aa--gaa--
               Pacific walrus  ttcg----------------------------gtagcttg-acctg---------------aa--gaa--
                 Weddell seal  ttcg----------------------------gtagcttg-gcctg---------------aa--gac--
             Black flying-fox  -tct----------------------------gtaactta----tg---------------aa--gaa--
B D                   Megabat  -tct----------------------------gtaacttg----tg---------------aa--gaa--
                Big brown bat  -tca----------------------------ggagcttg----tg---------------aa--gaa--
         David's myotis (bat)  -cca----------------------------ggagcttg----tg---------------aa--gaa--
B D                  Microbat  -cct----------------------------ggagcttg-----a---------------aa--gaa--
B D                  Hedgehog  cccc----------------------------ggagcttg-cgttc---------------ga--gcg--
B D                     Shrew  tttctgctgtttctgctgtttctgctgctgcggctgcttc-tgctgcggctcagtgcgcacgg--ggact
              Star-nosed mole  ttcc----------------------------gaagcttg-tggtg---------------aa--gga--
B D                  Elephant  tgca----------------------------ggagcttc-tggtg---------------aa--gaa--
          Cape elephant shrew  tctg----------------------------ggcgctt----gtg---------------ga--gaa--
B D                   Manatee  tgct----------------------------gaagcttg-tcgtg---------------ga--gaa--
             Cape golden mole  ccag----------------------------aa---ttg-ctctt---------------gg--gaa--
B D                    Tenrec  t----------------------------------------------------------------gta--
                     Aardvark  tgct----------------------------ggagctt----gtg---------------ga--gaa--
B D                 Armadillo  tgca----------------------------ggcgctt----gtt---------------ga--gaa--
B D                   Opossum  tgac----------------------------ttgagccg-aggtg---------------agatgaa--
B D           Tasmanian devil  ttcc----------------------------gtgaggag-aggtg---------------ag--gag--
B D                   Wallaby  tgac----------------------------cttacgtg-aggtg---------------ag-------
  D               Rock pigeon  -------------------------------------------------------------gg--ggc--
B D        American alligator  ---------------------------------------------------------ttcccg--tcc--
B D            Naked mole-rat  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================

                        Human  tcc-------------gagagg-----ctgc-gtg----tgag
                        Chimp  tcc-------------gagagg-----ctgc-gtg----tgag
                      Gorilla  tcc-------------gtgagg-----ctgt-gtg----tgag
                    Orangutan  tcc-------------gtgaga-----ctgc-gtg----tgag
                       Gibbon  tcc-------------gtgagg-----ctgc-gtg----tgag
                       Rhesus  tcc-------------ctgagc-----ctgc-gtg----tgag
          Crab-eating macaque  tcc-------------ctgagc-----ctgc-gtg----tgag
                       Baboon  tcc-------------ctgagc-----ctgc-gtg----tgag
                 Green monkey  tcc-------------ctgagc-----ctgc-gtg----tgag
                     Marmoset  tcc-------------ctgagg-----ctgc-gtg----tgag
              Squirrel monkey  tcc-------------ccgagg-----ctgc-gtg----tgag
                     Bushbaby  tct-------------gtgaga-----ctgt-gtt----t--g
           Chinese tree shrew  tcc-------------ctgagg-----ccct-gtg----tgag
                     Squirrel  tcc-------------ctgagg-----ccgt-g------tgag
       Lesser Egyptian jerboa  tcg-------------tcgcgg-----tcgt-gcg----cggg
                 Prairie vole  tcc-------------ttgcgg-----ttgt-gac----cgac
              Chinese hamster  tcc-------------ttgcga-----ttgt-gat----cgaa
               Golden hamster  tcc-------------ttgcgg-----ttgt-gat----cgaa
                        Mouse  ttt-------------ttacgg-----tggt-gat----cgag
                          Rat  tcc-------------ttgcgg-----ttct-gat----cgag
                   Guinea pig  cccgttgtggacagtgctgagg-----ctgt-acg----ccaa
                   Chinchilla  accgcggtggacagtgctgagg-----ctgg-gcg----ccac
             Brush-tailed rat  cgcgtggtggacagcactgagg-----ccgc-gcg----ccac
                       Rabbit  tct-------------gaggcg-----gtgt-gtg----aggg
                         Pika  ----------------gggaag-----gtgt-gtg----aggg
                          Pig  --------------------ag-----ttgt-ctg----cggg
                       Alpaca  tcc-------------ctgaag-----ctgt-ttg----cggg
               Bactrian camel  tcc-------------ctgaag-----ctgt-ctg----cggg
                      Dolphin  tcc-------------ctttag-----tttt-ctg----tggg
                 Killer whale  tcc-------------ctttag-----tttt-ctg----tggg
             Tibetan antelope  tcc-------------ctaaag-----ttgt-ctg----ccgg
                          Cow  tcc-------------ctgaag-----ttgt-ctg----ccgg
                        Sheep  tcc-------------ctaaag-----ttgt-ctg----ccgg
                Domestic goat  tcc-------------ctaaag-----ttgt-ctg----ccgg
                        Horse  tcc-------------ctgaag-----ccgt-gtg----cgag
             White rhinoceros  tcc-------------ctgaag-----ccgt-gtg----cgag
                          Cat  tcc-------------cagaag-----ccgt-gtg----cgag
                          Dog  tcc-------------ttgaaa-----ccgt-gtg----cgag
                      Ferret   tcc-------------ctgaag-----ccct-gtg----cgag
                        Panda  tcc-------------ctgaag-----ccgt-gtg----cgag
               Pacific walrus  tcc-------------ctgaag-----ccgt-gtg----cgag
                 Weddell seal  tcc-------------ctgaag-----ccgt-gtg----cgag
             Black flying-fox  tcc-------------ctgaag-----ccgt-gtg----cgag
                      Megabat  tcc-------------ctgaag-----ccgt-gtg----cgag
                Big brown bat  tcc-------------ctggag-----cctt-gtg----cgag
         David's myotis (bat)  tcc-------------ctgaag-----cctt-gcg----cgag
                     Microbat  tcc-------------ctgaag-----cctt-gcg----cgag
                     Hedgehog  tcg-------------ctgggg-----ccgt-gga----cgcg
                        Shrew  tgt-------------ctggagaagctctgt-gtg----ctag
              Star-nosed mole  tcc-------------ctgaag-----ccgt-gtg----cgag
                     Elephant  tcc-------------ctgagg-----ccgt-ctg----tgtg
          Cape elephant shrew  ttt-------------ttgagg-----ctgtgttg----tgta
                      Manatee  tct-------------ctgagg-----ccgt-ttg----tgtg
             Cape golden mole  gtc-------------cctaag-----ccgt-ttg----tatt
                       Tenrec  gc------------------ag-----ctgc-gtg----tgcg
                     Aardvark  tct-------------ttatag-----ttgt-gtg----tgtg
                    Armadillo  ttc-------------ccgagg-----ccgt-gtg----tgtg
                      Opossum  gcg-------------agcagg-----ctga-gga----actg
              Tasmanian devil  gct-------------agcgaa-----gaga-gga----cccg
                      Wallaby  -----------------gtgag-----gagg-ctg----cc--
                  Rock pigeon  tgg-------------tgaaga-----tggg-aagggtttggg
           American alligator  tct-------------cgcagg-----taag-gag----cgag
               Naked mole-rat  ===========================================
       Yellowbelly pufferfish  ===========================================
                         Fugu  ===========================================
          Pundamilia nyererei  ===========================================
                  Zebra mbuna  ===========================================
        Burton's mouthbreeder  ===========================================
                   Coelacanth  ===========================================
                  Spotted gar  ===========================================
                       Lizard  ===========================================
           Southern platyfish  -------------------------------------------
     Mexican tetra (cavefish)  ===========================================
             Peregrine falcon  ===========================================
                    Zebrafish  ===========================================
                 Nile tilapia  ===========================================
               Painted turtle  ===========================================
                    Tetraodon  ===========================================
                      Chicken  ===========================================
                     Platypus  ===========================================
          Collared flycatcher  ===========================================
     Chinese softshell turtle  ===========================================
                  Zebra finch  ===========================================
                 Saker falcon  ===========================================
                X. tropicalis  ===========================================
              Green seaturtle  ===========================================
          Medium ground finch  ===========================================
       White-throated sparrow  ===========================================
           Tibetan ground jay  ===========================================

Inserts between block 2 and 3 in window
B D                     Pika 1bp
  D              Rock pigeon 2bp

Alignment block 3 of 1240 in window, 40287975 - 40287996, 22 bps 
B D                     Human  agacgtgag-------aaggatcctgcac
B D                     Chimp  agacgtgag-------aaggatcctgcac
B D                   Gorilla  agacgtgag-------aaggatcctgcac
B D                 Orangutan  agacgtgag-------aaggatcctgcac
B D                    Gibbon  agacgtgag-------aaggatcctgcac
B D                    Rhesus  agacttgag-------aaggatcctgcac
B D       Crab-eating macaque  agacgtgag-------aaggatcctgcac
B D                    Baboon  agacgtgag-------aaggatcctgcac
B D              Green monkey  agacgtgag-------aaggatcctgcac
B D                  Marmoset  agacctgag-------aaggagcctgcac
B D           Squirrel monkey  agacctgag-------aaggagcctgcac
B D                  Bushbaby  agacgtgag-------aaagaaccagcac
           Chinese tree shrew  agccgtgag-------aggggacctgcgc
B D                  Squirrel  acgcga--a-------aaggaacctgcac
       Lesser Egyptian jerboa  acgc-------------------------
                 Prairie vole  acac-------------cggaacgtgcgc
B D           Chinese hamster  acac-------------agaaacgtgcgc
               Golden hamster  acac-------------aggaacgtgcgc
B D                     Mouse  acgcg------------aggagtgtgcac
B D                       Rat  atcag------------gggagcgtgcac
B D                Guinea pig  acgcga-----------gggaccctgccg
                   Chinchilla  acgcga-----------gggagcctgcca
             Brush-tailed rat  acgcaa-----------ggcagcctgc--
B D                    Rabbit  acgtg------------aggaacctgcac
B D                      Pika  aagcg------------aggagcctgcgc
B D                       Pig  agacgtgag-------agagagccggctc
B D                    Alpaca  agac--ggg-------aaagatctggcac
               Bactrian camel  agac--ggg-------aaagatctagcac
B D                   Dolphin  agacgtgag-------aaggcgccggcac
                 Killer whale  agacgtgag-------aaggcgccggcac
             Tibetan antelope  agacgtgag-------gaagagccggcac
B D                       Cow  agacgtgag-------gaagagccggcac
B D                     Sheep  agacgtgag-------gaagagccggcac
                Domestic goat  agacgtgag-------gaagagccggcac
B D                     Horse  agac--agg-------aagcagcc--cgc
B D          White rhinoceros  agacgtgag-------aggcagccggcac
B D                       Cat  agacgtgag-------aaagagccagcac
B D                       Dog  agacgtgag-------gaagagccggcac
B D                   Ferret   agacgtgag-------gaagagcaggcac
B D                     Panda  agacgtgag-------gaagagtcggcac
               Pacific walrus  agacgtgag-------gaagagccggtac
                 Weddell seal  agacgtgag-------gaagagccggtac
             Black flying-fox  agacgttag-------aaggagccggcac
B D                   Megabat  agacgttag-------aaggagccggcac
                Big brown bat  agaggagag-------aaggatccggcat
         David's myotis (bat)  agaggagag-------aaggatccggtac
B D                  Microbat  agaggagag-------aaggatccggtac
B D                  Hedgehog  -caggtgag-------gaagagctagcac
B D                     Shrew  agacccga-----------------gcat
              Star-nosed mole  acacgcgag-------aaggagacggcac
B D                  Elephant  agacgtgag-------aaaaaacctgcgc
          Cape elephant shrew  agacgtgga-------agaaaagctgcac
B D                   Manatee  agacgtgag-------aaaaagcctgcgc
             Cape golden mole  agacgtgaa-------gaaaagcttggac
B D                    Tenrec  agac--gga-------aaaccgcctgcac
                     Aardvark  agacgtgag-------aacacgcctgcac
B D                 Armadillo  atacgtgag-------aaagagcctgcac
B D                   Opossum  gggcgggagcgggcggagggcagccacag
B D           Tasmanian devil  gagcgggcg------gagggcgaccacag
B D                   Wallaby  ----------------aaggcaacga-gc
  D               Rock pigeon  caaggtgag-------gaagggtttgggt
B D            Naked mole-rat  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
B D                Coelacanth  =============================
                 Spotted gar  =============================
B D                    Lizard  =============================
          Southern platyfish  -----------------------------
    Mexican tetra (cavefish)  =============================
  D          Peregrine falcon  =============================
B D                 Zebrafish  =============================
B D              Nile tilapia  =============================
  D            Painted turtle  =============================
B D                 Tetraodon  =============================
B D                   Chicken  =============================
B D                  Platypus  =============================
  D       Collared flycatcher  =============================
  D  Chinese softshell turtle  =============================
B D               Zebra finch  =============================
  D              Saker falcon  =============================
B D             X. tropicalis  =============================
  D           Green seaturtle  =============================
B D       Medium ground finch  =============================
B D        American alligator  -----------------------------
  D    White-throated sparrow  =============================
          Tibetan ground jay  =============================

Inserts between block 3 and 4 in window
B D                 Squirrel 16bp
      Lesser Egyptian jerboa 5bp
                Prairie vole 16bp
B D          Chinese hamster 16bp
              Golden hamster 18bp
B D                    Mouse 15bp
B D                      Rat 15bp
B D               Guinea pig 25bp
                  Chinchilla 25bp
            Brush-tailed rat 374bp
B D                      Pig 16bp
B D                   Alpaca 16bp
              Bactrian camel 16bp
B D                  Dolphin 16bp
                Killer whale 16bp
            Tibetan antelope 16bp
B D                      Cow 16bp
B D                    Sheep 16bp
               Domestic goat 16bp
B D                    Horse 16bp
B D         White rhinoceros 16bp
B D                      Cat 15bp
B D                      Dog 16bp
B D                  Ferret  16bp
B D                    Panda 16bp
              Pacific walrus 16bp
                Weddell seal 16bp
            Black flying-fox 16bp
B D                  Megabat 16bp
               Big brown bat 16bp
        David's myotis (bat) 16bp
B D                 Microbat 16bp
B D                 Hedgehog 20bp
B D                    Shrew 15bp
             Star-nosed mole 14bp
B D                 Elephant 16bp
         Cape elephant shrew 16bp
B D                  Manatee 16bp
            Cape golden mole 16bp
B D                   Tenrec 16bp
                    Aardvark 16bp
B D                Armadillo 16bp
B D                  Opossum 18bp
B D          Tasmanian devil 20bp
B D                  Wallaby 27bp

Alignment block 4 of 1240 in window, 40287997 - 40288021, 25 bps 
B D                     Human  t----gagg-------------agg--------tgg-aaaga--agaggattg
B D                     Chimp  t-------g-------------agg--------tgg-aaaga--agaggattg
B D                   Gorilla  t----gagg-------------agg--------tgg-aaaga--agaggattg
B D                 Orangutan  t----gagg-------------agg--------tgg-aaagg--agaggattg
B D                    Gibbon  t----gagg-------------agg--------tgg-aaagg--agaggattg
B D                    Rhesus  t----gagg-------------agg--------tgg-gaagg--agaggattg
B D       Crab-eating macaque  t----gagg-------------agg--------tgg-gaagg--agaggattg
B D                    Baboon  t----gagg-------------agg--------tgg-gaagg--ggaggattg
B D              Green monkey  t----gagg-------------agg--------tgg-gaagg--agaggattg
B D                  Marmoset  t----gagg-------------agg--------tgg-aaagg--agaggattg
B D           Squirrel monkey  t----gagg-------------agg--------tgg-aaagg--aggggattg
B D                  Bushbaby  tcggtgagg---cagccctgtaagg--------tgg-aaacg--agagggtta
           Chinese tree shrew  t----gaggtgacagccctatgagg--------gtg-aaaag--agaggattg
B D                  Squirrel  t----gagg-------------gg---------tgg-aaagg--agaggattt
       Lesser Egyptian jerboa  -----ggag-------------cc---------tgt-g--------------g
                 Prairie vole  t----gaag-------------ag---------tgt-gaagg--ggcagattg
B D           Chinese hamster  t----gaag-------------ag---------tgt-aaagg--aacaggttg
               Golden hamster  c----gaag-------------ag---------tg---aggg--aacacattg
B D                     Mouse  t----gaag-------------ag---------tgc-aaa------------g
B D                       Rat  t----gaag-------------ag---------tgc-aaa------------g
B D                Guinea pig  g----aagg-------------ag---------cag-aaac-----------t
                   Chinchilla  g----gagg-------------ag---------cgg-aaac-----------c
B D                    Rabbit  t----gagg-------------tgacgcagccctga-gagag--gagaagatt
B D                      Pika  c----gagg-------------agacgcggccctga-ggaag--gagaggctt
B D                       Pig  t----gaga-------------gt---------tgg-aaagg--aga------
B D                    Alpaca  t----gtga-------------gg---------tgg-aaagg--aga------
               Bactrian camel  t----gtga-------------gg---------tgg-aaagg--aga------
B D                   Dolphin  t----gtga-------------gg---------tgg-aaagg--aga------
                 Killer whale  t----gtga-------------gg---------tgg-aaagg--aga------
             Tibetan antelope  t----gtat-------------gg---------tgg-aaagg--aga------
B D                       Cow  t----gtat-------------gg---------tgg-aaagg--aga------
B D                     Sheep  t----gtat-------------gg---------tgg-aaagg--aga------
                Domestic goat  t----gtat-------------gg---------tgg-aaagg--aga------
B D                     Horse  g----ggga-------------gg---------tgg-agagg--agagcattg
B D          White rhinoceros  t----ggga-------------ga---------tgg-agagg--agaggattg
B D                       Cat  t----gtga-------------gg---------tgg-agagg--agaggattg
B D                       Dog  t----gtca-------------gg---------tgg-agagg--agaggattc
B D                   Ferret   t----gtgg-------------gg---------tgg-agagc--agatgattg
B D                     Panda  t----gtaa-------------gg---------tgg-aaagc--agaggattg
               Pacific walrus  t----gtga-------------gg---------tgg-agagc--agaggattg
                 Weddell seal  t----gtga-------------gg---------tgg-agagc--agaggattg
             Black flying-fox  t----gtgg-------------gg---------tgg-agagg--agaagattg
B D                   Megabat  t----gtgg-------------gg---------tgg-agagg--agaagattg
                Big brown bat  t----gcgg-------------gg---------tgg-agagg--agaggattg
         David's myotis (bat)  t----gtgg-------------gg---------tgg-agagg--agaggatgg
B D                  Microbat  t----gtgg-------------gg---------tgg-agagg--agaggatgg
B D                  Hedgehog  a----gcgg-------------gg---------tgc-g------agacgattg
B D                     Shrew  c----gtga-------------gt---------tgt-a------agaggattg
              Star-nosed mole  g----gcga-------------gg---------agt-agagcaggagagattg
B D                  Elephant  c----gtga-------------gg---------tgg-aaagg--agaagattg
          Cape elephant shrew  t----gtaa-------------gg---------tgg-gaag------------
B D                   Manatee  c----gtga-------------ag---------tgg-aaagg--agaggattg
             Cape golden mole  c----gtga-------------ag---------tgg-gaagg--agaggattt
B D                    Tenrec  c----gtga-------------gg---------tgg-gaagg--tgaggactg
                     Aardvark  c----gcga-------------gg---------tga-gaagg--agaggactg
B D                 Armadillo  t----tcga-------------gg---------tgg--aagg--agagggtaa
B D                   Opossum  t----cagg-------------gc---------ggc-gggga--ggagaggtg
B D           Tasmanian devil  t----gggg-------------ct---------ggg-ggtga--cgaaaatag
B D                   Wallaby  c----gggt-------------cc--------------------------ctg
  D               Rock pigeon  t----gagg-------------ggc--------tggtggagg--tgaggaagg
            Brush-tailed rat  =====================================================
B D            Naked mole-rat  =====================================================
      Yellowbelly pufferfish  =====================================================
B D                      Fugu  =====================================================
         Pundamilia nyererei  =====================================================
                 Zebra mbuna  =====================================================
       Burton's mouthbreeder  =====================================================
B D                Coelacanth  =====================================================
                 Spotted gar  =====================================================
B D                    Lizard  =====================================================
          Southern platyfish  -----------------------------------------------------
    Mexican tetra (cavefish)  =====================================================
  D          Peregrine falcon  =====================================================
B D                 Zebrafish  =====================================================
B D              Nile tilapia  =====================================================
  D            Painted turtle  =====================================================
B D                 Tetraodon  =====================================================
B D                   Chicken  =====================================================
B D                  Platypus  =====================================================
  D       Collared flycatcher  =====================================================
  D  Chinese softshell turtle  =====================================================
B D               Zebra finch  =====================================================
  D              Saker falcon  =====================================================
B D             X. tropicalis  =====================================================
  D           Green seaturtle  =====================================================
B D       Medium ground finch  =====================================================
B D        American alligator  -----------------------------------------------------
  D    White-throated sparrow  =====================================================
          Tibetan ground jay  =====================================================

Inserts between block 4 and 5 in window
B D                 Elephant 15bp
         Cape elephant shrew 6bp
B D                  Manatee 15bp
            Cape golden mole 15bp
B D                   Tenrec 15bp
                    Aardvark 220bp
B D                Armadillo 15bp

Alignment block 5 of 1240 in window, 40288022 - 40288032, 11 bps 
B D                     Human  ctcgaggaggc
B D                     Chimp  ctcgaggaggc
B D                   Gorilla  ctcgaggaggc
B D                 Orangutan  ctcgaggaggc
B D                    Gibbon  ctcgaggaggc
B D                    Rhesus  ctcgaggaggc
B D       Crab-eating macaque  ctcgaggaggc
B D                    Baboon  ctcgaggaggc
B D              Green monkey  ctcgaggaggg
B D                  Marmoset  ctctaggaggc
B D           Squirrel monkey  ctggaggaggc
B D                  Bushbaby  ct-aagggggg
           Chinese tree shrew  ttcagggaggc
B D                  Squirrel  cccggtgatgc
       Lesser Egyptian jerboa  ctctcaggtga
                 Prairie vole  ctccgtgaggc
B D           Chinese hamster  ctccgggaggc
               Golden hamster  cgcccggaggc
B D                     Mouse  ctccgcgaggt
B D                       Rat  ctccgtgaggt
B D                Guinea pig  cgcgaggagac
                   Chinchilla  ctcgaggagac
B D                    Rabbit  gctcgggaga-
B D                      Pika  ccttgcgagac
B D                       Pig  -----ggaggc
B D                    Alpaca  -----gggggc
               Bactrian camel  -----gggggc
B D                   Dolphin  -----ggaggc
                 Killer whale  -----ggaggc
             Tibetan antelope  -----ggaggc
B D                       Cow  -----ggaggc
B D                     Sheep  -----ggaggc
                Domestic goat  -----ggaggc
B D                     Horse  ctcggggaggc
B D          White rhinoceros  ctcggggaggc
B D                       Cat  ctcggggaggc
B D                       Dog  ctcggggaggc
B D                   Ferret   ctta-------
B D                     Panda  cctggggaggc
               Pacific walrus  ctcggggaggc
                 Weddell seal  ctcggggaggc
             Black flying-fox  ct-tgggaggc
B D                   Megabat  ct-tgggaggc
                Big brown bat  ctccgggaggc
         David's myotis (bat)  ccccggggcgc
B D                  Microbat  ccccggggcgc
B D                  Hedgehog  ttcagggaggc
B D                     Shrew  ctccgggaggc
              Star-nosed mole  ctccgggagtt
B D                  Elephant  ctcgggaaggc
          Cape elephant shrew  ctcggggaagt
B D                   Manatee  ctcggggaggc
             Cape golden mole  ttcggggaagc
B D                    Tenrec  ctctgggaggc
                     Aardvark  ctcaggaagac
B D                 Armadillo  ctcgaggaccc
B D                   Opossum  c------gggc
B D           Tasmanian devil  ctct-gggggc
B D                   Wallaby  ctc----aggc
  D               Rock pigeon  gttggggagat
            Brush-tailed rat  ===========
B D            Naked mole-rat  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
B D                Coelacanth  ===========
                 Spotted gar  ===========
B D                    Lizard  ===========
          Southern platyfish  -----------
    Mexican tetra (cavefish)  ===========
  D          Peregrine falcon  ===========
B D                 Zebrafish  ===========
B D              Nile tilapia  ===========
  D            Painted turtle  ===========
B D                 Tetraodon  ===========
B D                   Chicken  ===========
B D                  Platypus  ===========
  D       Collared flycatcher  ===========
  D  Chinese softshell turtle  ===========
B D               Zebra finch  ===========
  D              Saker falcon  ===========
B D             X. tropicalis  ===========
  D           Green seaturtle  ===========
B D       Medium ground finch  ===========
B D        American alligator  -----------
  D    White-throated sparrow  ===========
          Tibetan ground jay  ===========

Inserts between block 5 and 6 in window
B D                 Squirrel 8bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 12bp
B D          Chinese hamster 12bp
              Golden hamster 12bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D               Guinea pig 350bp
                  Chinchilla 4bp

Alignment block 6 of 1240 in window, 40288033 - 40288037, 5 bps 
B D                     Human  ct-ggg
B D                     Chimp  ct-ggg
B D                   Gorilla  ct-ggg
B D                 Orangutan  ct-ggg
B D                    Gibbon  ct-ggg
B D                    Rhesus  ct-ggg
B D       Crab-eating macaque  ct-ggg
B D                    Baboon  ct-ggg
B D              Green monkey  ct-ggg
B D                  Marmoset  ct-gcg
B D           Squirrel monkey  ct-gcg
B D                  Bushbaby  ct-tgg
           Chinese tree shrew  ct-ggg
B D                  Squirrel  -t-ggg
                 Prairie vole  -c-ggg
B D           Chinese hamster  cc-ggg
               Golden hamster  cc-ggg
B D                     Mouse  -t-ggt
B D                       Rat  -t-ggt
                   Chinchilla  cc-ggt
B D                    Rabbit  ct-gag
B D                      Pika  ct-tgg
B D                       Pig  cc-agg
B D                    Alpaca  cc-ggg
               Bactrian camel  cc-ggg
B D                   Dolphin  cc-gag
                 Killer whale  cc-gag
             Tibetan antelope  cc-ggg
B D                       Cow  cc-ggg
B D                     Sheep  cc-ggg
                Domestic goat  cc-ggg
B D                     Horse  ct-ggg
B D          White rhinoceros  ct-ggg
B D                       Cat  ct-agg
B D                       Dog  ct-agg
B D                   Ferret   ----gg
B D                     Panda  ct-agg
               Pacific walrus  cc-tgg
                 Weddell seal  cc-tgg
             Black flying-fox  ct-ggg
B D                   Megabat  ct-ggg
                Big brown bat  ct-ggg
         David's myotis (bat)  ct-ggg
B D                  Microbat  ct-ggg
B D                  Hedgehog  gc-ggg
B D                     Shrew  gt-gag
              Star-nosed mole  ggagga
B D                  Elephant  ct-ggg
          Cape elephant shrew  ct-ggg
B D                   Manatee  ct-ggg
             Cape golden mole  ct-ggg
B D                    Tenrec  cg-cgg
                     Aardvark  ct-ggg
B D                 Armadillo  tt-ggg
B D                   Opossum  ga-agg
B D           Tasmanian devil  gc-ggg
B D                   Wallaby  ct-ggg
  D               Rock pigeon  gt-ggg
B D                Guinea pig  ======
      Lesser Egyptian jerboa  ======
            Brush-tailed rat  ======
B D            Naked mole-rat  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D                Coelacanth  ======
                 Spotted gar  ======
B D                    Lizard  ======
          Southern platyfish  ------
    Mexican tetra (cavefish)  ======
  D          Peregrine falcon  ======
B D                 Zebrafish  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D                   Chicken  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
B D               Zebra finch  ======
  D              Saker falcon  ======
B D             X. tropicalis  ======
  D           Green seaturtle  ======
B D       Medium ground finch  ======
B D        American alligator  ------
  D    White-throated sparrow  ======
          Tibetan ground jay  ======

Inserts between block 6 and 7 in window
            Tibetan antelope 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                  Opossum 6bp
B D          Tasmanian devil 428bp
  D              Rock pigeon 6bp

Alignment block 7 of 1240 in window, 40288038 - 40288086, 49 bps 
B D                     Human  gtct-gt----------g-aggcagcg--------gagctgggtgaagg---------------------
B D                     Chimp  gtct-gt----------g-aggcagcg--------gagctgggtgaagg---------------------
B D                   Gorilla  gtct-gt----------g-aggcagca--------gagctgggtgaagg---------------------
B D                 Orangutan  gtct-gt----------g-aggcagcg--------gagctgggtgaagg---------------------
B D                    Gibbon  gtct-gt----------g-aggcagcg--------gagctgggtgaagg---------------------
B D                    Rhesus  gttt-gt----------g-aggcagcg--------gagttgcgtgaagg---------------------
B D       Crab-eating macaque  gttt-gt----------g-aggcagcg--------gagttgcgtgaagg---------------------
B D                    Baboon  gttt-gt----------g-aggcagcg--------gagttgcgtgaagg---------------------
B D              Green monkey  gttt-gt----------g-aggcagcg--------gagttgcgtgaagg---------------------
B D                  Marmoset  atct-gt----------g-aggcagcg--------gcgttgggtgaagg---------------------
B D           Squirrel monkey  atct-gt----------g-aggcagcg--------gagttgggggaagg---------------------
B D                  Bushbaby  gcct-gg----------g-aggcagtg--------ctgttgggtgaggg-----------ctggggccag
           Chinese tree shrew  gtgg-ac----------g-aggtagcc--------gagccgggcgaggt---------------------
B D                  Squirrel  agcc-ag-------------------c--------gggttgggagaggg---------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  accc-ag-------------------t--------tc-ctgga---------------------------
B D           Chinese hamster  accc-ag-------------------a--------gagttggg---------------------------
               Golden hamster  gctc-ag-------------------a--------gagtcggg---------------------------
B D                     Mouse  gtcc-ag-------------------a--------gaggtgag---------------------------
B D                       Rat  gccc-ac-------------------a--------gaattgag---------------------------
                   Chinchilla  gccg-gg-------------------a--------gcggaaggaag------------------------
B D                    Rabbit  gtct-gg-------------------g--------gagctgcgcgaagg---------------------
B D                      Pika  gttt-ggacgg------g-aggcagcg--------ggactcggtgaggg---------------------
B D                       Pig  tcct-gg----------g-gg---gcg--------gagttgggtgg----------------gggatgca
B D                    Alpaca  gctc-cg----------g-gggcagca--------gagctgggcgaaggg----------atgtggcgag
               Bactrian camel  gctc-cg----------g-ggtcagca--------gagctgggctaaggg----------ctgtggcgag
B D                   Dolphin  tcct-gg----------g-gggcggcg--------gagttgggtgagggg----------ctagggcgag
                 Killer whale  tcctggg----------g-gggcggcg--------gagttgggtgagggg----------ctagggcgag
             Tibetan antelope  ttct-tg----------g-gggcggcg--------gagtt-tgtgagagc----------ctggggcaag
B D                       Cow  tcct-tg----------g-ggacggcg--------gagtt-tgtgagagc----------ctggggcaag
B D                     Sheep  tcct-tg----------g-gggcggcg--------gagtt-tgtgagagc----------ctggggcaag
                Domestic goat  tcct-tg----------g-gggcggcg--------gagtt-tgtgagagc----------ctggggcaag
B D                     Horse  gtct-gg----------g-aggcagcg--------gagtggggtgagggc----------ctgcggcgag
B D          White rhinoceros  gtct-gg----------g-aggcagcg--------gagtagggtgagggg----------ctgtggcgag
B D                       Cat  gccc-ag----------g-aggcagcg--------gagttgggagagcgg----------ctacggcgag
B D                       Dog  gtct-gg----------g-aggcagcg--------gaattgggagagggg----------ctatggcgag
B D                   Ferret   gtct-gg----------a-aggcagcg--------gagttgggagagggg----------cgatggctag
B D                     Panda  gtct-gg----------g-aggcagca--------gagttgggagagggg----------ctgaggcgag
               Pacific walrus  gtct-gg----------g-aggctgcg--------gagttgggagaaagg----------ctatggcaag
                 Weddell seal  gtct-gg----------g-aggctgcg--------gagttgggagaaggg----------ctatggcaag
             Black flying-fox  gtct-gg----------t-aggcagca--------gagttggg--------------------tggcaag
B D                   Megabat  gtct-gg----------t-aggcagca--------gagttggg--------------------tggcaag
                Big brown bat  ggca-gg----------g-aactaggg--------gcgttgag--------------------tgacaag
         David's myotis (bat)  gtca-ga----------g-aagtaggg--------gcgctgag--------------------tgacaag
B D                  Microbat  gtca-ga----------g-aagtaggg--------gcgctgag--------------------tgacaag
B D                  Hedgehog  gtcg-gg----------g-----cgcc--------gac--------------------------------
B D                     Shrew  gtct-gg----------ggtggccgca--------gag-tgggtga----------------------gg
              Star-nosed mole  gttg-gg----------ggcggctgtg--------gcg------------------------------ag
B D                  Elephant  gttt-gg----------g-aggcggcg--------gagcgcggtaaggg-----------ctggggagag
          Cape elephant shrew  gtct-gg----------g-aggcagcg--------gagttcggtgaagg-----------ctgggaccag
B D                   Manatee  gtct-gg----------g-aagccgcg--------gagttccgtgaggg-----------ttagggagag
             Cape golden mole  gtct-gg----------g-agggagtg--------gaat-------------------------------
B D                    Tenrec  agtt-gg----------a-ggcgaggg--------gagc-------------------------------
                     Aardvark  gtct-tg----------g-aaaaagcg--------gagttcggtgaggg-----------c---------
B D                 Armadillo  gtca-gg----------g-aggcagtg--------gagttcggtgaggg-----------cttgggcgag
B D                   Opossum  -----------------g-aagaaccagatgcgcctagctgtgggggtga----------ataagatc--
B D                   Wallaby  ---------ggcggcagg-gaggacga--------cagttctggaggggc----------agg-------
  D               Rock pigeon  --------------------------g--------aaggtgaggaagggctgagatgcttttgggtgaag
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  --ctgcgggtt-ccggcgaggcc
                        Chimp  --ctgcgggtt-ccggcgaggcc
                      Gorilla  --ctgcgggtt-ccggcgaggcc
                    Orangutan  --ctgcgggtt-ccggcgaggcc
                       Gibbon  --ctgcgggtt-ccggcgaggcc
                       Rhesus  --ctgcgggtt-ccggcgaggcc
          Crab-eating macaque  --ctgcgggtt-ccggcgaggcc
                       Baboon  --ctgcgggtt-ccggcgaggcc
                 Green monkey  --ctgcgggtt-ccggcgaggcc
                     Marmoset  --ctgcgggtt-ccggcgaggcc
              Squirrel monkey  --ctgcgggtt-ccggcgaggcg
                     Bushbaby  gtctgcgggtt-cc-gctagacc
           Chinese tree shrew  --cggcgggtt-ccggcgagtct
                     Squirrel  --ctgcgggct-cccacgcggcc
       Lesser Egyptian jerboa  --------------------gcc
                 Prairie vole  ----gctggtt-cgagcgtggcc
              Chinese hamster  ----gctggtt-cgagcgcggcc
               Golden hamster  ----gctggtt-cgagcgtgacc
                        Mouse  ----gctggtc-cgagcaaggcc
                          Rat  ----gctggtc-tgagcaaggcc
                   Chinchilla  ----ccaaggt-ccggcagggtc
                       Rabbit  --t-tgaggtt-tccgcgagacc
                         Pika  --t-cgtggtt-cctgcgaga-c
                          Pig  gcccgag----------------
                       Alpaca  ggccacggatt-ccgatacagct
               Bactrian camel  ggccacggatt-ccgatgcagct
                      Dolphin  gaccgcgggtt-cc---------
                 Killer whale  gaccgcgggtt-cc---------
             Tibetan antelope  gaccgtg----------------
                          Cow  gaccgcg----------------
                        Sheep  gaccgcg----------------
                Domestic goat  gaccgcg----------------
                        Horse  gaccgcgggtt-ccgacgaggcc
             White rhinoceros  gaccgcggctt-cccagcaggcc
                          Cat  ggccgctgcttccccctgaggct
                          Dog  ggccgctgcct-tccttgaggcc
                      Ferret   ggccgcagcct-cccttgaggtt
                        Panda  ggccggggcct-cccttgaggcc
               Pacific walrus  ggccgctgcct-cctttgaggcc
                 Weddell seal  ggccgctgcct-cccttgaggcc
             Black flying-fox  acccgcgggtt-ccgatgaggcc
                      Megabat  acccgcgggtt-ccgatgaggcc
                Big brown bat  gcccgagggtg-cagg-------
         David's myotis (bat)  gcccgagggtg-ccggtgctgcc
                     Microbat  gcccgagggcg-ccggtgatgcc
                     Hedgehog  ----gcgggtt-ctggcgaggct
                        Shrew  ggcagcgcgtc-ccggtggcgcc
              Star-nosed mole  gaccgcgggct-tccttgcggcc
                     Elephant  ggttgcgggat-cccatgaggcc
          Cape elephant shrew  gactgtcgggt-ctgatgaagtc
                      Manatee  ggttgtgggat-cctgtgaggct
             Cape golden mole  ----------t-cggaagaagca
                       Tenrec  ------ggggt-ccgagctagcc
                     Aardvark  ------cgggt-tcgatgaggcc
                    Armadillo  ggccacgcgtt-gcgatgaggcc
                      Opossum  --cctccagct-tgggc------
                      Wallaby  -------ggcg-cgggc------
                  Rock pigeon  gaattatggga-ctggagagg--
                   Guinea pig  =======================
             Brush-tailed rat  =======================
               Naked mole-rat  =======================
       Yellowbelly pufferfish  =======================
                         Fugu  =======================
          Pundamilia nyererei  =======================
                  Zebra mbuna  =======================
        Burton's mouthbreeder  =======================
                   Coelacanth  =======================
                  Spotted gar  =======================
                       Lizard  =======================
           Southern platyfish  -----------------------
     Mexican tetra (cavefish)  =======================
             Peregrine falcon  =======================
                    Zebrafish  =======================
                 Nile tilapia  =======================
               Painted turtle  =======================
                    Tetraodon  =======================
                      Chicken  =======================
                     Platypus  =======================
          Collared flycatcher  =======================
     Chinese softshell turtle  =======================
                  Zebra finch  =======================
                 Saker falcon  =======================
                X. tropicalis  =======================
              Green seaturtle  =======================
          Medium ground finch  =======================
           American alligator  -----------------------
       White-throated sparrow  =======================
           Tibetan ground jay  =======================
              Tasmanian devil  =======================

Inserts between block 7 and 8 in window
B D                 Squirrel 8bp
                  Chinchilla 456bp

Alignment block 8 of 1240 in window, 40288087 - 40288091, 5 bps 
B D                     Human  tgagg
B D                     Chimp  tgagg
B D                   Gorilla  tgag-
B D                 Orangutan  cgagg
B D                    Gibbon  cgagg
B D                    Rhesus  cgagg
B D       Crab-eating macaque  cgagg
B D                    Baboon  cgagg
B D              Green monkey  cgagg
B D                  Marmoset  ggagg
B D           Squirrel monkey  cgagg
B D                  Bushbaby  cgag-
           Chinese tree shrew  tgaga
B D                    Rabbit  cgaga
B D                      Pika  cgagg
B D                       Pig  ----g
B D                    Alpaca  ccagg
               Bactrian camel  ccagg
B D                     Horse  cgagg
B D          White rhinoceros  cgagg
B D                       Cat  cgagg
B D                       Dog  cgagg
B D                   Ferret   cgagg
B D                     Panda  cgagg
               Pacific walrus  cgagg
                 Weddell seal  cgagg
             Black flying-fox  cgaag
B D                   Megabat  cgaag
         David's myotis (bat)  cgagg
B D                  Microbat  cgagg
B D                  Hedgehog  gaag-
B D                     Shrew  ggagg
              Star-nosed mole  ggagc
B D                  Elephant  gga-g
          Cape elephant shrew  gg---
B D                   Manatee  aga-g
             Cape golden mole  cga-g
B D                    Tenrec  cga-g
                     Aardvark  tga-g
B D                 Armadillo  gcagg
B D                   Opossum  ggggg
B D                   Wallaby  ggagg
  D               Rock pigeon  tgaga
B D                Guinea pig  =====
B D                       Rat  -----
B D                     Mouse  -----
              Golden hamster  -----
B D           Chinese hamster  -----
                Prairie vole  -----
            Tibetan antelope  -----
               Domestic goat  -----
B D                     Sheep  -----
B D                       Cow  -----
B D                  Squirrel  =====
                  Chinchilla  =====
      Lesser Egyptian jerboa  -----
            Brush-tailed rat  =====
               Big brown bat  -----
B D            Naked mole-rat  =====
                Killer whale  -----
B D                   Dolphin  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
B D                Coelacanth  =====
                 Spotted gar  =====
B D                    Lizard  =====
          Southern platyfish  -----
    Mexican tetra (cavefish)  =====
  D          Peregrine falcon  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
B D                  Platypus  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
B D               Zebra finch  =====
  D              Saker falcon  =====
B D             X. tropicalis  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D        American alligator  -----
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D           Tasmanian devil  =====

Inserts between block 8 and 9 in window
B D                  Wallaby 495bp

Alignment block 9 of 1240 in window, 40288092 - 40288121, 30 bps 
B D                     Human  tgaagtgaagggaa--aagagc-tgagctc-gct
B D                     Chimp  tgaagtgaagggaa--aagagc-tgagctc-gct
B D                   Gorilla  ----gtgaagggaa--aactgc-tgagctc-gct
B D                 Orangutan  tgaagtgaagggaa--aagagc-tgagctc-gct
B D                    Gibbon  tgaagtgaagggaa--aagagc-tgaactc-gct
B D                    Rhesus  taaagtgaaggtaa--aagagc-tgagctc-gct
B D       Crab-eating macaque  taaagtgaaggtaa--aagagc-tgagctc-gct
B D                    Baboon  taaagtgaaggtaa--aagagc-tgagctc-gct
B D              Green monkey  taaagtgaaggtaa--aagagc-tgagctc-gct
B D                  Marmoset  tgaagtgaggggaa--gagagc-tgagctc-gct
B D           Squirrel monkey  tgaagtgaggggaa--aagagc-tgagctc-gcc
B D                  Bushbaby  --aagggcggagaa--gagagc-tgagaat-gct
           Chinese tree shrew  ggaagtgagggga----agagg-cgagatc-gc-
B D                  Squirrel  ----------agtt--gagatc-tgagatc-gca
       Lesser Egyptian jerboa  ----------gccg--ggaagg-gtggatg-gcc
                 Prairie vole  ----------ggtg--gagagc-ggagatc-gcc
B D           Chinese hamster  ----------tgtg--gagagc-ggagatc-gcc
               Golden hamster  ----------tgtg--gagagc-ggagatc-gcc
B D                     Mouse  ----------ggtg--gagagcgggaaatc-gcc
B D                       Rat  ----------ggtg--gagagc-ggaaatc-gcc
B D                    Rabbit  aacagtgaggggaa--gggaag-ggagatc-gcg
B D                      Pika  agc----tgggcaa--gagaag-ggagatc----
B D                       Pig  tgaaacgagaggaa--gatagc-tcagatc-gcg
B D                    Alpaca  tggagtgagaggag--gacagc-tcagatc-gcg
               Bactrian camel  tggagtgagaggag--gacagc-tcagatc-gcg
B D                   Dolphin  ----gtaagaggag--gagagc-tcagatc-gcg
                 Killer whale  ----gtaagaggag--gagagc-tcagatc-gcg
             Tibetan antelope  ----------ggag--gagagc-tcagatc-gcc
B D                       Cow  ----------ggag--gagagc-tcagatc-gcc
B D                     Sheep  ----------ggag--gagagc-tcagatc-tca
                Domestic goat  ----------ggag--gagagc-tcagatc-gca
B D                     Horse  tgaagcgaggggag--gagagc-tca--tc-gcg
B D          White rhinoceros  tgaagcgaggggag--gagagc-tca--cc-gcg
B D                       Cat  tgaagtgaggggag--aagagc-tcagatc-gtc
B D                       Dog  tgaaatgaggggaa--aagagc-tcaggtc-gcc
B D                   Ferret   ggaagtgagg---g--aagagc-tcagatc-gcg
B D                     Panda  tgaagtgaggggag--aagagc-tcagatc-gcc
               Pacific walrus  tgaagtgaggggag--aagagc-tcagatc-gcc
                 Weddell seal  tgaagtgaggggag--aagagc-tcagatc-gcc
                Big brown bat  ------gagcggag--cggagc-ccagatc-gcg
         David's myotis (bat)  tgaagtgagcggag--cagagc-ccaggtc-gcg
B D                  Microbat  tgaagtgagcggag--cagagc-ccagatc-gcg
B D                  Hedgehog  --------aggaag--gaggag-gtagatc-gcg
B D                     Shrew  cggagggaagggagacgatcga-tcagatctgcg
              Star-nosed mole  tggagggcggggag--gacagg-tcagatc-gtg
B D                  Elephant  tgtaatgagaggag--gagagc-cgagatc-agg
          Cape elephant shrew  ---aataaatcgag--gagagc-tgaaatc-agg
B D                   Manatee  tgaagtgaggggag--gagagc-tgagatt-agg
             Cape golden mole  tgaagtgaagggag--cagtac-cgagacc-cca
B D                    Tenrec  gcgagggaggggag--gcgagc-cgatcct-ccg
                     Aardvark  t---------------gagagc-agatatc-aga
B D                 Armadillo  tgaagtgaggggag--gagagc-tgagata-ctg
B D                   Opossum  cgctgtgaaggaga--gagccc-ttagctg-gct
  D               Rock pigeon  --aaaagggaggag--gagctt-tgggtta-agg
B D                Guinea pig  ==================================
                  Chinchilla  ==================================
            Brush-tailed rat  ==================================
B D            Naked mole-rat  ==================================
            Black flying-fox  ----------------------------------
      Yellowbelly pufferfish  ==================================
B D                      Fugu  ==================================
         Pundamilia nyererei  ==================================
                 Zebra mbuna  ==================================
       Burton's mouthbreeder  ==================================
B D                Coelacanth  ==================================
                 Spotted gar  ==================================
B D                   Wallaby  ==================================
B D                    Lizard  ==================================
          Southern platyfish  ----------------------------------
    Mexican tetra (cavefish)  ==================================
  D          Peregrine falcon  ==================================
B D                 Zebrafish  ==================================
B D              Nile tilapia  ==================================
  D            Painted turtle  ==================================
B D                 Tetraodon  ==================================
B D                   Chicken  ==================================
B D                  Platypus  ==================================
  D       Collared flycatcher  ==================================
  D  Chinese softshell turtle  ==================================
B D               Zebra finch  ==================================
  D              Saker falcon  ==================================
B D             X. tropicalis  ==================================
  D           Green seaturtle  ==================================
B D       Medium ground finch  ==================================
B D        American alligator  ----------------------------------
  D    White-throated sparrow  ==================================
          Tibetan ground jay  ==================================
B D                   Megabat  ----------------------------------
B D           Tasmanian devil  ==================================

Inserts between block 9 and 10 in window
B D                  Opossum 365bp

Alignment block 10 of 1240 in window, 40288122 - 40288126, 5 bps 
B D                     Human  ggagg
B D                     Chimp  ggagg
B D                   Gorilla  ggagg
B D                 Orangutan  ggagg
B D                    Gibbon  ggagg
B D                    Rhesus  ggcgg
B D       Crab-eating macaque  ggcgg
B D                    Baboon  ggcgg
B D              Green monkey  ggcgg
B D                  Marmoset  ggagg
B D           Squirrel monkey  ggagg
B D                  Bushbaby  ggagg
B D                  Squirrel  gcaag
       Lesser Egyptian jerboa  gcggg
                 Prairie vole  tgagg
B D           Chinese hamster  tgagg
               Golden hamster  tgagg
B D                     Mouse  tgggg
B D                       Rat  tgggg
B D                    Rabbit  ggaga
B D                       Pig  ggaag
B D                    Alpaca  ggagg
               Bactrian camel  ggagg
B D                   Dolphin  ggagg
                 Killer whale  ggagg
             Tibetan antelope  ggaag
B D                       Cow  agaag
B D                     Sheep  ggaag
                Domestic goat  ggaag
B D                     Horse  ggagg
B D          White rhinoceros  ggagg
B D                       Cat  ggagg
B D                       Dog  ggagg
B D                   Ferret   ggagg
B D                     Panda  ggagg
               Pacific walrus  ggagg
                 Weddell seal  ggagg
                Big brown bat  ggaga
         David's myotis (bat)  ggaga
B D                  Microbat  ggaga
B D                  Hedgehog  ggagg
B D                     Shrew  ga-cc
              Star-nosed mole  gg-gg
B D                  Elephant  ggagg
          Cape elephant shrew  ggaga
B D                   Manatee  tgagg
             Cape golden mole  agg--
B D                    Tenrec  ccggg
                     Aardvark  ggagg
B D                 Armadillo  ggagg
  D               Rock pigeon  ggtgt
B D                Guinea pig  =====
B D                      Pika  -----
                  Chinchilla  =====
            Brush-tailed rat  =====
          Chinese tree shrew  -----
B D            Naked mole-rat  =====
            Black flying-fox  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
B D                Coelacanth  =====
                 Spotted gar  =====
B D                   Wallaby  =====
B D                    Lizard  =====
          Southern platyfish  -----
    Mexican tetra (cavefish)  =====
  D          Peregrine falcon  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
B D                  Platypus  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
B D               Zebra finch  =====
  D              Saker falcon  =====
B D             X. tropicalis  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D                   Opossum  =====
B D        American alligator  -----
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D                   Megabat  -----
B D           Tasmanian devil  =====

Inserts between block 10 and 11 in window
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                   Tenrec 1125bp

Alignment block 11 of 1240 in window, 40288127 - 40288224, 98 bps 
B D                     Human  tc--tgaggtc------ggg-atc---agggaaa------------------------------------
B D                     Chimp  tc--tgaggtc------ggg-atc---agggaaa------------------------------------
B D                   Gorilla  tc--tgaggtc------ggg-atc---agggaaa------------------------------------
B D                 Orangutan  tc--tgagggc------ggg-atc---agggaaa------------------------------------
B D                    Gibbon  tc--tgagatc------ggg-atc---agggaaa------------------------------------
B D                    Rhesus  tc--tgaggtc------agg-atc---agggaaa------------------------------------
B D       Crab-eating macaque  tc--tgaggtc------agg-atc---agggaaa------------------------------------
B D                    Baboon  tc--tgaggtc------agg-atc---agggaaa------------------------------------
B D              Green monkey  tc--tgaggtc------agg-atc---agggaaa------------------------------------
B D                  Marmoset  tc--tgaggtc------gggaatc---agggaaa------------------------------------
B D           Squirrel monkey  tc--tgaggtc------ggg-atc---agggaaa------------------------------------
B D                  Bushbaby  tc--tgagatc------tgg-gtc---agggaag------------------------------------
           Chinese tree shrew  -c--tgaggtt------gga-gtc---tgagaag------------------------------------
B D                  Squirrel  tc--tgaggtc------ggc-gtccctaggaaga------------------------------------
       Lesser Egyptian jerboa  tc--tga-----------g--gtt---aggcaag------------------------------------
                 Prairie vole  tc--tgaggct------gg--gtc---agggagg------------------------------------
B D           Chinese hamster  tc--tgaggca------gg--gtc---agggagg------------------------------------
               Golden hamster  tc--tgagcct------gg--gtc---agggagg------------------------------------
B D                     Mouse  tc--tgaggct------gg--gtc---agggagg------------------------------------
B D                       Rat  tc--tgaggct------gg--gtc---agggagg------------------------------------
B D                    Rabbit  tc--cgaagtc------gg--ggc---cggggcg------------------------------------
B D                      Pika  -----------------------------gggcg------------------------------------
B D                       Pig  gtgaggaggtc------gcg-ata---gggccag------------------------------------
B D                    Alpaca  gagaggaggcc------ggg-gta---gggaagg------------------------------------
               Bactrian camel  gagaggaggcc------ggg-gta---gggaagg------------------------------------
B D                   Dolphin  gtgagaaggtc------ggg-gta---gggaagg------------------------------------
                 Killer whale  gtgagaaggtc------ggg-gta---gggaagg------------------------------------
             Tibetan antelope  gtgatgaggtc------ggg-gtc---gggtagc------------------------------------
B D                       Cow  gtgatgaggtc------ggg-gtc---gggtagg------------------------------------
B D                     Sheep  gtgatgaggtc------ggg-gtc---gggtagc------------------------------------
                Domestic goat  gtgatgaggtc------ggg-gtc---gggtagc------------------------------------
B D                     Horse  tc--tggggtc------gcg-gca---agggcaggg----------------------------------
B D          White rhinoceros  tc--tgaggtc------ggg-gcg---agggcaggg----------------------------------
B D                       Cat  tc--tggggtc------gga-gta---agagaag------------------------------------
B D                       Dog  tt--ggagatctgatgtcgg-gtg---agggaag------------------------------------
B D                   Ferret   tc--tgaggtc------ggg-gta---agggaaa------------------------------------
B D                     Panda  tc--cgaggtc------cgg-gta---aggg-aa------------------------------------
               Pacific walrus  tc--tgaggtc------ggg-gta---agggaaa------------------------------------
                 Weddell seal  tc--tgaggtc------ggg-gta---agggaaa------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
                Big brown bat  t-----aggtc------ggg-ga-----------------------------------------------
         David's myotis (bat)  g-----aggtt------ggg-gaa---gggaagggaagggaagggaagggaagaggagggagggggaggg
B D                  Microbat  t-----aggtc------ggg-gaa---gggaagggaaggg------------------------------
B D                  Hedgehog  gc--tgaggt-------tgg-gta---aggaagg------------------------------------
B D                     Shrew  ga--ggagatc------cgg-gcc---aggggca------------------------------------
              Star-nosed mole  gc--tgaggtc------cgg-gtg---agggacg------------------------------------
B D                  Elephant  tc--tgaggtc------ggg-gtc---agacagg------------------------------------
          Cape elephant shrew  tc--tgagtcc------agg-gtt---agagagg------------------------------------
B D                   Manatee  tc--tgaggtc------agg-gtc---agaggag------------------------------------
             Cape golden mole  gc--tgaggtc------gga-gtc---agaaagg------------------------------------
                     Aardvark  tc--cgaggtt------ggg-atc---cgagagg------------------------------------
B D                 Armadillo  tc--tggggtc------ggc-gtc---tgggtgg------------------------------------
  D               Rock pigeon  --gcagagctg------taa-aga---tggggag------------------------------------
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
                  Chinchilla  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ---gggc--a--g-gtgccctcggggtagtt---ctagcag-ttatgcgtggtgtg------aaggaggt
                        Chimp  ---gggc--a--g-gtgccctcggggtagtt---ctagcag-ttatgcctggtgtg------aaggaggt
                      Gorilla  ---gggc--a--g-gtgccctcggggtagtt---ctagcag-ttgtgcgtggtgtg------aaggaggt
                    Orangutan  ---gggc--a--g-gtgccctcggggtagtt---ctagcag-ttgtgcgtggtgtg------aaggatct
                       Gibbon  ---gggc--a--g-gtgccctcggggtagtt---ctagcag-ttgtgcgtggtgtg------aaggagct
                       Rhesus  ---gggc--a--g-gtgccctcagggtagtt---atagcag-ttgtgcgtggtatg------aaggagct
          Crab-eating macaque  ---gggc--a--g-gtgccctcagggtagtt---atagcag-ttgtgcgtggtatg------aaggagct
                       Baboon  ---gggc--a--g-gtgccctcagggtagtt---atagcag-ttgtgcgtggtgtg------aaggagct
                 Green monkey  ---gggc--a--g-gtgccctcagggtagtt---atagcag-ttgtgcgtggtgtg------aaggagct
                     Marmoset  ---gggc--a--g-gcgccctcggggtagtt---ccagc-------------tgtg------aaggagct
              Squirrel monkey  ---gggc--a--g-gcgccctcggggtagtt---ccagcag-ttgtgcgtggtgtg------aagaagct
                     Bushbaby  ---ggtccta--t-gcgacctcagagtagtt---tgcgcaa-ttgtgcatggtgtg------aaggagct
           Chinese tree shrew  ---gggg--a----------------tcgtt---ctgacag-ttgtccgtggtaca------gaggagct
                     Squirrel  ---ggga--t--gtgggccctcggaatggtg---gaaaggttctggcagtgctgcgtgatgtaaggaact
       Lesser Egyptian jerboa  ---ggca--t--gtgcactctggaaacggac---cgag----cagtggtcagggtg------aaggagct
                 Prairie vole  ---gggt--t--gtgcgc-ctgcaaggcgtt---cgag----ccggcaatggtggg------aaggagct
              Chinese hamster  ---gggt--t--gcgcgc-ctgcaaggagag---cgag----cctggaatggtggg------aaggagct
               Golden hamster  ---gggt--t--gtgcgc-ctgcaaggcgtg---cgag----cctggaatggtggg------aaggagct
                        Mouse  ---gggt--t--gtgagctctagaagcggtt---cgag----cacgccgcgttggg------aagg---a
                          Rat  ---gcgt--t--gtgagctctagaagcggtc---cgag----catggagtgttggg------aaggagca
                       Rabbit  ---gggc--g--gtgcaccctcgaagtggct---ctagcag-ttgtgcgtggtgtg------agggagct
                         Pika  ---cggc--g--a-------------------------------------ggtggg------caagggct
                          Pig  ---gaga--c--gagcgccctcggagtagt----tcggcag-ttctgc---------------------t
                       Alpaca  ---gaga--g--gtgcatcctcggagtcgc----ctggcag-ttgtgc---------------------t
               Bactrian camel  ---gaga--g--gtgcgtcctcggagtcgc----ctggcag-ctgtgc---------------------t
                      Dolphin  ---gaga--c--gtgcgccctcggagtgct----ctggcag-ttgtgt---------------------t
                 Killer whale  ---gaga--c--gtgcgccctcggagtgct----ctggcag-ttgtgc---------------------t
             Tibetan antelope  ---gagg--a--atgcaccctcggaatggt----ctgacag-ttgtgc---------------------t
                          Cow  ---gagg--a--atgcaccctcggaatggt----ctgacag-ttgtgc---------------------t
                        Sheep  ---gagg--a--atgcaccctcggaatggt----ctgacag-ttgtgc---------------------t
                Domestic goat  ---gagg--a--atgcaccctcggaatggt----ctgacag-ttgtgc---------------------t
                        Horse  ----ggc--t--gcgcgccctcggagtagt----ctggcag-t-gtgcgtggggta------aaggagct
             White rhinoceros  ----gga--t--gtgcgccctcggagtagt----ctggcag-t-gtgcgtggggta------aagaagct
                          Cat  ----------------------ggagtagc----ctggcag-tcgtgcgtggaata------aagggtct
                          Dog  ----------------------ggagtcgg----ctggcag-tcgtgcgtggagta------aaggggct
                      Ferret   ----------------------ggaatagg----ctggcag-tcgtgcgtggaata------aaggggct
                        Panda  ----------------------ggagtagg----ctggcag-tcgtgcgtggaata------aaggggct
               Pacific walrus  ----------------------ggagtagg----ctggcag-tcgtgcgtggaata------aaggggct
                 Weddell seal  ----------------------ggagtagg----ctggcag-tcgtgcgtggaata------aaggggct
             Black flying-fox  -----------------------gagtagt----ctggcag-ttgtgcatgga-aa------agg-agct
                      Megabat  -----------------------gagtagt----ctggcag-ttgtgcatgga-aa------agg-agct
                Big brown bat  ---------t--aggcgctgtccgagcagt----ctggcag-ttgtgcgtaga-tg------aggtagga
         David's myotis (bat)  aggtagg--t--gtgcgctttccgagcagcctggctggcag-ttgtgcgtagg-tg------atgcaggg
                     Microbat  ----agg--t--gtgcgctgtcggagcagcctggctggcag-ctgtgcgtagg-tg------atgcaggg
                     Hedgehog  ---gacg--t--ttgcgccc-gggagcagt----ctggccg-cagtgcatggagta------aagttgct
                        Shrew  ---gcaa--taggtgcgcctcggggccagt----ctggcct-ttgggcatggggca------gagttgct
              Star-nosed mole  ---ggag--c-tgtgcacccgcggagtagc----ctggcgg-gtgtgcgtgagggg------aagttgtt
                     Elephant  ---ggaa--t--gtgcaggttcggaggagtt---ctggcag-ctgggcgtggtgta------aaggagct
          Cape elephant shrew  --cagat--t--gtttgtgctcagaggcgtt---cttgcag-ttgtgtgtggtgta------aa--agct
                      Manatee  ---ggaa--t--gtggacgctcagaggagtt---ctggcag-ctgggcgtggtgta------aagaagct
             Cape golden mole  --gagaa--t--gtgcctgctcagaggagtt---ctggc---ctctgtgcgggcta------aaggagtg
                     Aardvark  --gagaa--t--gtgcacgctcagaggagtt---ctggcag-ctgtgc-ccatgta------aag-agct
                    Armadillo  --gggtc--c--gaacgcactcgga-gaatt---cgggcag-ttgtgtat-gtgta------aagaagcc
                  Rock pigeon  ---gggc--t--gaggagctttagg---------gtgaggg-atgtgtgaggctgc------agagggga
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
                   Chinchilla  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
                   Coelacanth  ======================================================================
                  Spotted gar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
           Southern platyfish  ----------------------------------------------------------------------
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
                      Opossum  ======================================================================
           American alligator  ----------------------------------------------------------------------
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  gaaagttgt--aggaa----ggaaata-----ttc
                        Chimp  gaaagttgt--aggaa----ggaaata-----ttc
                      Gorilla  gaaagttgt--aggaa----ggaaata-----ttc
                    Orangutan  gcaagttgt--aggaa----ggaaata-----ttc
                       Gibbon  gaaagttgt--aggaa----ggaaata-----ttc
                       Rhesus  gaaagttgt--aggaa----ggaaata-----ttc
          Crab-eating macaque  gaaagttgt--aggaa----ggaaata-----ttc
                       Baboon  gaaagttgt--aggaa----ggaaata-----ttc
                 Green monkey  gaaagttgt--aggaa----ggaaata-----ttc
                     Marmoset  gaaagctgt--aggaa----ggaaatg-----ttc
              Squirrel monkey  cgaagttgg--aggaa----ggaaatg-----ttc
                     Bushbaby  gaaagttgt--aggaa----gg-aatg-----ccc
           Chinese tree shrew  -agatttgt--aggaa----ggaaatg-----ttc
                     Squirrel  gaaaactgt--aggaa----ggaaatg-----ttc
       Lesser Egyptian jerboa  gggagctgt--aagaa----gggactg-----ttc
                 Prairie vole  gagagctgc--tggga----ggaaacg-----gtg
              Chinese hamster  gagaactgc--tagga----ggaagcg-----gcg
               Golden hamster  gagaactgc--tagga----ggaaacg-----gcg
                        Mouse  gagagctgc--tggga----ggaaacg-----gtg
                          Rat  gagagctgc--tggga----ggaaatg-----gtg
                       Rabbit  gaa-gctgc--ggaca----ggaaaag-----ttc
                         Pika  gag-gctgt--gggaa----ggaagtg-----tgc
                          Pig  tactgctg-----gag----ggagatg-----ttc
                       Alpaca  gagtgctgc--gggag----agagatg-----tgg
               Bactrian camel  gagtgctgc--gggag----ggagatg-----tgg
                      Dolphin  gagtgcggc--aggag----ggagacg-----ttc
                 Killer whale  gagtgcggc--aggag----ggagacg-----ttc
             Tibetan antelope  gagtgcgat--atgag----ggcgatg-----ttc
                          Cow  gagtgcgat--aggag----ggcgatg-----ttc
                        Sheep  gagtgcgat--atgag----ggcgatg-----ttc
                Domestic goat  gagtgcgat--atgag----ggcgatg-----ttc
                        Horse  caatgtggt--aggaa----ggcggtg-----ttc
             White rhinoceros  gaatgtggtagaggag----ggcgatg-----ttc
                          Cat  gaatgtcga--aggag----ggagatg-----ttt
                          Dog  gactgttgt--aggag----ggagacg-----tcc
                      Ferret   gaatgttat--aggag----ggagatg-----ttc
                        Panda  gaatgttgt--aggag----ggagatg-----ttc
               Pacific walrus  gaatgtttt--aggag----ggagatg-----ttc
                 Weddell seal  gaatgttgt--aggag----ggagatg-----ttc
             Black flying-fox  gaatgttgt--aggag-------------------
                      Megabat  gaatgttgt--aggag-------------------
                Big brown bat  gg---------------------------------
         David's myotis (bat)  ggagatgtt--ccggg-------------------
                     Microbat  ggagatgtt--ccggg-------------------
                     Hedgehog  gcacgttgt--aggaa----ggagatgggattttg
                        Shrew  gaacatct----ggag----gcagatg-----ttc
              Star-nosed mole  ggacgctgt--aggag----ggagacg-----ttc
                     Elephant  gattgctgt--aggag----gaagatg-----ttc
          Cape elephant shrew  ---------------g----gagagtg-----ggt
                      Manatee  gaatgctgt--aggag----ggagatg-----ttc
             Cape golden mole  gaagactgt--aggag----gaaatt---------
                     Aardvark  gaatgctgt--aggta----ggagatg-----ttc
                    Armadillo  tattgctgt--ggaag----gaagatg-----ttc
                  Rock pigeon  gagagggat--cagaaattaggaggc---------
                       Tenrec  ===================================
                   Guinea pig  ===================================
                   Chinchilla  ===================================
             Brush-tailed rat  ===================================
               Naked mole-rat  ===================================
       Yellowbelly pufferfish  ===================================
                         Fugu  ===================================
          Pundamilia nyererei  ===================================
                  Zebra mbuna  ===================================
        Burton's mouthbreeder  ===================================
                   Coelacanth  ===================================
                  Spotted gar  ===================================
                      Wallaby  ===================================
                       Lizard  ===================================
           Southern platyfish  -----------------------------------
     Mexican tetra (cavefish)  ===================================
             Peregrine falcon  ===================================
                    Zebrafish  ===================================
                 Nile tilapia  ===================================
               Painted turtle  ===================================
                    Tetraodon  ===================================
                      Chicken  ===================================
                     Platypus  ===================================
          Collared flycatcher  ===================================
     Chinese softshell turtle  ===================================
                  Zebra finch  ===================================
                 Saker falcon  ===================================
                X. tropicalis  ===================================
              Green seaturtle  ===================================
          Medium ground finch  ===================================
                      Opossum  ===================================
           American alligator  -----------------------------------
       White-throated sparrow  ===================================
           Tibetan ground jay  ===================================
              Tasmanian devil  ===================================

Inserts between block 11 and 12 in window
B D                      Pig 5bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 20bp
                Killer whale 20bp
            Tibetan antelope 22bp
B D                      Cow 22bp
B D                    Sheep 20bp
               Domestic goat 20bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
                Weddell seal 5bp

Alignment block 12 of 1240 in window, 40288225 - 40288275, 51 bps 
B D                     Human  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D                     Chimp  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D                   Gorilla  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D                 Orangutan  tggggt--ga------g---ttgagag------ct---------gcctaaaatgaggactg---ag----
B D                    Gibbon  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D                    Rhesus  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D       Crab-eating macaque  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D                    Baboon  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D              Green monkey  tggggt--gc------g---ttgagag------ct---------gcctagaatgaggactg---ag----
B D                  Marmoset  tggggt--gc------c---ttgagag------cc---------gcttagaatgaggcctg---tg----
B D           Squirrel monkey  tggggt--gc------g---ttgagag------ct---------gcttcgaatgaggactg---gg----
B D                  Bushbaby  cggggtg-gg------g---ttgagag------cc---------gcaaagaggggacccta---ag----
           Chinese tree shrew  cgagtg--gg------g---ttgagag------ct---------gtgtgga-------------------
B D                  Squirrel  cagaa---------------ttgagga------ct---------gtgtggagttaggactaccgag----
       Lesser Egyptian jerboa  cagggt--gg------gtgctggagag------ct---------gggtggggtg-----t----ag----
                 Prairie vole  cagggt--gg------gg--tt--gag------ct---------gtatggcgagcaggct----ag----
B D           Chinese hamster  gagggt--gg------gg--ttgagag------ct---------gtgtggagtgcaggct----ag----
               Golden hamster  tagggt--gg------gg--ttgagag------ct---------atgtggagagcaggct----ag----
B D                     Mouse  tagggt--gg------gg--tcgggag------tt---------tggtggagtgctggct----ag----
B D                       Rat  tagggt--gg------gg--ttgagag------ct---------ttgtggagtgctggct----ag----
B D                    Rabbit  ccggct--gc------gg--ctgagag------ca---------gggtgag-------------ag----
B D                      Pika  t-------------------ctgagcg------ca---------gggtgcg-------------ag----
B D                       Pig  ------cggg------g---ctgag-g------tt---------gagtagcgtggggactg---aa----
B D                    Alpaca  ------tggg------g---ctgagag------tc---------aggtagagcggggactg---ag----
               Bactrian camel  ------tggg------g---ctgagag------tc---------gggtagagcggggactg---ag----
B D                   Dolphin  ------tggg------g---ccgagag------tt---------gggtagagcggggattg---ag----
                 Killer whale  ------tggg------g---ccgagag------tt---------gggtagagcggggattg---ag----
B D                     Sheep  ------tggg------g---ccgag-g------tt---------ggacggagtagggac-----------
                Domestic goat  ------tggg------g---ccgag-g------tt---------ggacggagtagggac-----------
B D                     Horse  ------gggg------g---ccgaaag------gt---------gtgtggagtgggcactc---cg----
B D          White rhinoceros  ------gggg------g---cttaaag------tt---------gtgtggagtggggaccc---cg----
B D                       Cat  ------tggg------g---ttgagaa------g----------gtgtggcgtgaggactg---ag----
B D                       Dog  ------tggg------a---ttgctag------g----------gtgtggagtggggaccg---ag----
B D                   Ferret   ------tggg------g---ttgagag------g----------gtgtggggtggggaccg---ag----
B D                     Panda  ------tggg------g---ttgggag------g----------gtgtggggtggggaccg---ag----
               Pacific walrus  ------tggg------g---ttgagag------g----------gtgtggggtggggaccg---ag----
                 Weddell seal  ------tggg------g---ttgagag------g----------gtgtggggtggggaccg---ag----
             Black flying-fox  ------tggg------g---ttgagagtt----ct---------gtatagtggggggactc---ag----
B D                   Megabat  ------tggg------g---ttgagagtt----ct---------gtatagtggggggactc---ag----
                Big brown bat  ------------------------gag------at---------gtgccgggtggagactg---gg----
         David's myotis (bat)  ------tggg------g---ttgcgag------ct---------gtgcggagtggagac-----ag----
B D                  Microbat  ------tggg------g---ttgcgag------ct---------gtgcggcgtggagactg---ag----
B D                  Hedgehog  ---------g------g---gtgagag------tt---------gcgcaga----gggtgc---ag----
B D                     Shrew  ---------g------g---gt-gtgg------gt---------ctgcagt-tgagggcgc---cg----
              Star-nosed mole  ---------gctttgag---gtggggg------gt---------gcgtggcatggggactc---cgaacg
B D                  Elephant  --------------------cggggtg------gg---------gggttgagtgaagactg---ag----
          Cape elephant shrew  --------------------gggtgtt------ga---------aagtgaaatgagggctg---aa----
B D                   Manatee  --------------------cggggt-------gg---------gggttgagtgaggactg---ag----
             Cape golden mole  ---------------------------------ga---------gcgtgaagtgaggacgg---ag----
                     Aardvark  --------------------cggagtgagggttga---------gtatggagtgaggactg---ag----
B D                 Armadillo  --------------------cgggtcg------gagttagagttgtgtagagtgaaaactg---ag----
  D               Rock pigeon  -----------------------tgag------gt---------gaggagagatagggctgc--ag----
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
            Tibetan antelope  ======================================================================
B D                       Cow  ======================================================================
                  Chinchilla  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ---------tgcaggggcggaa-a
                        Chimp  ---------tgcaggggcggaa-a
                      Gorilla  ---------tgcaggggcggaa-a
                    Orangutan  ---------tgcaggggcggaa-a
                       Gibbon  ---------tgcaggggcggaa-a
                       Rhesus  ---------tgcagaggcggag-a
          Crab-eating macaque  ---------tgcagaggcggag-a
                       Baboon  ---------tgcagaggcggag-a
                 Green monkey  ---------tgcagaggcggag-a
                     Marmoset  ---------tgcaggggcggag-a
              Squirrel monkey  ---------tgcaggggcggag-a
                     Bushbaby  ---------ggcataggcagag-g
           Chinese tree shrew  ----------gcgggggcagcg-g
                     Squirrel  ---------tctaagagcggagtg
       Lesser Egyptian jerboa  ---------tac-ggggcgggg-g
                 Prairie vole  ---------tcc-tgggcagag-g
              Chinese hamster  ---------acc-tggacggag--
               Golden hamster  ---------acc-tgggcagag-g
                        Mouse  ---------ttt-tgagca----g
                          Rat  ---------ttc-tgtgcaggg-g
                       Rabbit  ---------ggg----gctgaa-g
                         Pika  ---------cgg-agagctgag-g
                          Pig  ---------tg-------------
                       Alpaca  ---------tgc-aga--------
               Bactrian camel  ---------tgc-aga--------
                      Dolphin  ---------tgc-gga--------
                 Killer whale  ---------tgc-gga--------
                        Sheep  ------------------------
                Domestic goat  ------------------------
                        Horse  ---------tgc-agagtgag---
             White rhinoceros  ---------tgc-aaagtgag---
                          Cat  ---------tgc-agggtgg----
                          Dog  ---------tgc-cgggcgg----
                      Ferret   ---------tgc-caggcgg----
                        Panda  ---------tg--cgggcgg----
               Pacific walrus  ---------tgc-cgggcgg----
                 Weddell seal  ---------tgc-cgggcgg----
             Black flying-fox  ---------ggc-agagtgag---
                      Megabat  ---------ggc-agagtgag---
                Big brown bat  ---------tgc-tgagtggg---
         David's myotis (bat)  ---------tgc-tgagtgag---
                     Microbat  ---------tgc-tgagtgag---
                     Hedgehog  ------------------------
                        Shrew  ------------------------
              Star-nosed mole  gggcggagg---------------
                     Elephant  ---------tgcagaggcgagggg
          Cape elephant shrew  ---------tgccgagttgtaggg
                      Manatee  ---------tgcagaggcaaaggg
             Cape golden mole  ---------tgcaggggcgtaggg
                     Aardvark  ---------ttcagagacgaaggg
                    Armadillo  ---------tgctgggacagagga
                  Rock pigeon  ---------tga-tggaaa-----
                       Tenrec  ========================
                   Guinea pig  ========================
             Tibetan antelope  ========================
                          Cow  ========================
                   Chinchilla  ========================
             Brush-tailed rat  ========================
               Naked mole-rat  ========================
       Yellowbelly pufferfish  ========================
                         Fugu  ========================
          Pundamilia nyererei  ========================
                  Zebra mbuna  ========================
        Burton's mouthbreeder  ========================
                   Coelacanth  ========================
                  Spotted gar  ========================
                      Wallaby  ========================
                       Lizard  ========================
           Southern platyfish  ------------------------
     Mexican tetra (cavefish)  ========================
             Peregrine falcon  ========================
                    Zebrafish  ========================
                 Nile tilapia  ========================
               Painted turtle  ========================
                    Tetraodon  ========================
                      Chicken  ========================
                     Platypus  ========================
          Collared flycatcher  ========================
     Chinese softshell turtle  ========================
                  Zebra finch  ========================
                 Saker falcon  ========================
                X. tropicalis  ========================
              Green seaturtle  ========================
          Medium ground finch  ========================
                      Opossum  ========================
           American alligator  ------------------------
       White-throated sparrow  ========================
           Tibetan ground jay  ========================
              Tasmanian devil  ========================

Inserts between block 12 and 13 in window
B D                      Pig 4bp
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 13 of 1240 in window, 40288276 - 40288315, 40 bps 
B D                     Human  g-a---actgagggaagact---gagctgcagtg---------------tgagggc--------t--tgg
B D                     Chimp  g-a---cctgagggaagact---gagctgcagtg---------------tgagggc--------t--tgg
B D                   Gorilla  g-a---actgagggaagact---gagcttcagtg---------------tgagggc--------t--tgg
B D                 Orangutan  g-a---actgaaggaagact---gagctgcagtg---------------tgagggc--------t--tgg
B D                    Gibbon  g-a---actgagggaagact---gagctgcagtg---------------tgagggc--------t--tgg
B D                    Rhesus  g-a---actgagggaagact---gaactgtagtg---------------tgaggac--------t--tgg
B D       Crab-eating macaque  g-a---actgagggaagact---gaactgtagtg---------------tgaggac--------t--tgg
B D                    Baboon  g-a---actgagggaagacg---gaactgtagtg---------------tgaggac--------t--tgg
B D              Green monkey  g-a---actgagggaagact---gaactgtagtg---------------tgaggac--------t--tgg
B D                  Marmoset  g-a----ctgagagaagacg---gacctgcagtg---------------tgagggc--------t--tgg
B D           Squirrel monkey  g-a----ctgagagaagatt---gacccgcagtg---------------tgagggc--------t--tgg
B D                  Bushbaby  g-aggaactgagggacgacc---gaactgcagtg---------------ggagggc--------t--tgg
           Chinese tree shrew  a-a-------------------------------------------------gggc--------t--tgg
B D                  Squirrel  a-a-------------gacc---gagctgtgctg---------------tcagggc--------a--cag
       Lesser Egyptian jerboa  a-a-------------gccc---gagctgcagtg---------------tcagggc--------t--tgg
                 Prairie vole  a-g-------------gacg---gagctgccctg---------------cctgctt--------t--tgg
B D           Chinese hamster  -----------------------gagctgcactg---------------cccggcc--------c--tga
               Golden hamster  a-g-------------gaca---gagctgcactg---------------cctggct--------c--tga
B D                     Mouse  a-g-------------gacg---cagctgcccttgc-------------ccaggac--------t--tgg
B D                       Rat  a-g-------------gacg---gagctgcactg---------------cctggac--------t--tgg
B D                    Rabbit  gcg-------------gacggacgagcggcggtg---------------cgagggc--------t--ccg
B D                      Pika  g-a-------------gacg---gggcggctgtg---------------tgagggc--------t--ttg
B D                       Pig  -----------------------g-------------------------tgagggc--------t--tgg
B D                    Alpaca  -----------------------g-------------------------tgaggac--------t--tgg
               Bactrian camel  -----------------------g-------------------------tgaggac--------t--tgg
B D                   Dolphin  -----------------------g-------------------------tgagggc--------t--tga
                 Killer whale  -----------------------g-------------------------tgagggc--------t--tga
             Tibetan antelope  -----------------------gggccgaggttggacggagtagggactgagggc--------t--tgg
B D                       Cow  -----------------------gggccgaggttgggcggagtagggactgagggc--------t--tgg
B D                     Sheep  -------------------------------------------------tgagggc--------t--tgg
                Domestic goat  -------------------------------------------------tgagggc--------t--tgg
B D                     Horse  -----------------------------------------------------gac--------t--tgg
B D          White rhinoceros  -----------------------------------------------------ggc--------t--tgg
B D                       Cat  --------------------------------------------------------------------ag
B D                       Dog  --------------------------------------------------------------------ag
B D                   Ferret   --------------------------------------------------------------------ag
B D                     Panda  --------------------------------------------------------------------ag
               Pacific walrus  --------------------------------------------------------------------ag
                 Weddell seal  --------------------------------------------------------------------ag
             Black flying-fox  -----------------------------------------------------act--------t--tag
B D                   Megabat  -----------------------------------------------------act--------t--tag
                Big brown bat  -------------------------gtctggg-----------------ggtgggg--------t--agg
         David's myotis (bat)  -------------------------gcctggg-----------------ggt-gcg--------t--ggg
B D                  Microbat  -------------------------gcctggg-----------------ggtggcg--------t--ggg
B D                  Hedgehog  ---------------------------------------------agtgcgggg--------------gg
B D                     Shrew  ---------------------------------------------agagcagggtc--------t--cgg
              Star-nosed mole  -------------------------------------------acagaccgagggc--------t--tgg
B D                  Elephant  ----------------------------gaactg---------------ggggaga--------c--taa
          Cape elephant shrew  -----------------------------aactg---------------gcggagagacagctgc--caa
B D                   Manatee  ----------------------------gaactg---------------ggggaga--------c--taa
             Cape golden mole  ----------------------------gaactg---------------ggggaca--------c--tga
                     Aardvark  ----------------------------gaactg---------------gaggaaa--------c--caa
B D                 Armadillo  ----------------------------gaactga--------------ggggagg--------ctgtaa
  D               Rock pigeon  --------ttggaaaggctt---gagctccatgg---------------tgagggc--------t--tgg
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
                  Chinchilla  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  g---------------------a
                        Chimp  g---------------------a
                      Gorilla  g---------------------a
                    Orangutan  g---------------------a
                       Gibbon  g---------------------a
                       Rhesus  g---------------------a
          Crab-eating macaque  g---------------------a
                       Baboon  g---------------------a
                 Green monkey  g---------------------a
                     Marmoset  g---------------------a
              Squirrel monkey  g---------------------a
                     Bushbaby  g---------------------a
           Chinese tree shrew  g---------------------a
                     Squirrel  g----------------------
       Lesser Egyptian jerboa  g----------------------
                 Prairie vole  g----------------------
              Chinese hamster  g----------------------
               Golden hamster  g----------------------
                        Mouse  g----------------------
                          Rat  g----------------------
                       Rabbit  g--------------------a-
                         Pika  g--------------------a-
                          Pig  g---------------------g
                       Alpaca  g---------------------g
               Bactrian camel  g---------------------g
                      Dolphin  g---------------------g
                 Killer whale  g---------------------g
             Tibetan antelope  g---------------------g
                          Cow  g---------------------g
                        Sheep  g---------------------g
                Domestic goat  g---------------------g
                        Horse  g---------------------g
             White rhinoceros  g---------------------g
                          Cat  g---------------------g
                          Dog  g---------------------g
                      Ferret   g---------------------g
                        Panda  g---------------------g
               Pacific walrus  g---------------------g
                 Weddell seal  g---------------------g
             Black flying-fox  g---------------------c
                      Megabat  g---------------------c
                Big brown bat  g---------------------c
         David's myotis (bat)  g---------------------c
                     Microbat  g---------------------c
                     Hedgehog  g---------------------g
                        Shrew  a---------------------g
              Star-nosed mole  g---------------------g
                     Elephant  a----------------------
          Cape elephant shrew  g------------aact------
                      Manatee  a----------------------
             Cape golden mole  g------------ggcttgga--
                     Aardvark  gctgcagagagagggcttggg--
                    Armadillo  a----------------------
                  Rock pigeon  g---------------------c
                       Tenrec  =======================
                   Guinea pig  =======================
                   Chinchilla  =======================
             Brush-tailed rat  =======================
               Naked mole-rat  =======================
       Yellowbelly pufferfish  =======================
                         Fugu  =======================
          Pundamilia nyererei  =======================
                  Zebra mbuna  =======================
        Burton's mouthbreeder  =======================
                   Coelacanth  =======================
                  Spotted gar  =======================
                      Wallaby  =======================
                       Lizard  =======================
           Southern platyfish  -----------------------
     Mexican tetra (cavefish)  =======================
             Peregrine falcon  =======================
                    Zebrafish  =======================
                 Nile tilapia  =======================
               Painted turtle  =======================
                    Tetraodon  =======================
                      Chicken  =======================
                     Platypus  =======================
          Collared flycatcher  =======================
     Chinese softshell turtle  =======================
                  Zebra finch  =======================
                 Saker falcon  =======================
                X. tropicalis  =======================
              Green seaturtle  =======================
          Medium ground finch  =======================
                      Opossum  =======================
           American alligator  -----------------------
       White-throated sparrow  =======================
           Tibetan ground jay  =======================
              Tasmanian devil  =======================

Inserts between block 13 and 14 in window
B D                   Rabbit 27bp

Alignment block 14 of 1240 in window, 40288316 - 40288318, 3 bps 
B D                     Human  tag
B D                     Chimp  tag
B D                   Gorilla  tag
B D                 Orangutan  gag
B D                    Gibbon  gag
B D                    Rhesus  gag
B D       Crab-eating macaque  gag
B D                    Baboon  gag
B D              Green monkey  gag
B D                  Marmoset  gag
B D           Squirrel monkey  gag
B D                  Bushbaby  gag
           Chinese tree shrew  cag
B D                      Pika  gag
  D               Rock pigeon  taa
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ---
B D                     Mouse  ---
              Golden hamster  ---
B D           Chinese hamster  ---
                Prairie vole  ---
B D                  Elephant  ---
            Tibetan antelope  ---
         Cape elephant shrew  ---
B D                     Shrew  ---
        David's myotis (bat)  ---
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ---
B D                    Alpaca  ---
             Star-nosed mole  ---
B D                  Squirrel  ---
B D                    Rabbit  ===
B D                 Armadillo  ---
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ---
B D          White rhinoceros  ---
            Brush-tailed rat  ===
              Pacific walrus  ---
B D                       Dog  ---
B D                       Cat  ---
B D                  Microbat  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
                Killer whale  ---
              Bactrian camel  ---
B D                     Panda  ---
            Black flying-fox  ---
B D                   Ferret   ---
            Cape golden mole  ---
B D                   Dolphin  ---
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D                Coelacanth  ===
                 Spotted gar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ---
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ---
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ---
B D           Tasmanian devil  ===

Inserts between block 14 and 15 in window
B D                     Pika 22bp

Alignment block 15 of 1240 in window, 40288319 - 40288326, 8 bps 
B D                     Human  aag--agact
B D                     Chimp  aag--agact
B D                   Gorilla  aag--tgact
B D                 Orangutan  aag--agact
B D                    Gibbon  aag--agact
B D                    Rhesus  aag--agact
B D       Crab-eating macaque  aag--agact
B D                    Baboon  aag--agact
B D              Green monkey  aag--agact
B D                  Marmoset  aag--a---g
B D           Squirrel monkey  gag--a--tt
B D                  Bushbaby  acc--g---t
           Chinese tree shrew  acg--c----
B D                  Squirrel  -ac--tgtc-
       Lesser Egyptian jerboa  -ggacactct
                 Prairie vole  -ag--agcct
B D           Chinese hamster  -gg--agcct
               Golden hamster  -gg--agcct
B D                     Mouse  -ag--agcct
B D                       Rat  -ag--agcct
B D                       Pig  --a--agact
B D                    Alpaca  --a--agacg
               Bactrian camel  --a--agacg
B D                   Dolphin  --a--agcct
                 Killer whale  --a--agcct
             Tibetan antelope  --a--agcct
B D                       Cow  --a--agcct
B D                     Sheep  --a--agcct
                Domestic goat  --a--agcct
B D                     Horse  --c--agact
B D          White rhinoceros  --a--agac-
B D                       Cat  --a--agacc
B D                       Dog  --a--ggact
B D                   Ferret   --a--agact
B D                     Panda  --c--agacc
               Pacific walrus  --a--agac-
                 Weddell seal  --a--agac-
             Black flying-fox  --a--agact
B D                   Megabat  --a--agact
                Big brown bat  --g--agact
         David's myotis (bat)  --g--aggct
B D                  Microbat  --g--aggct
B D                     Shrew  ------ggct
              Star-nosed mole  --a--aggct
             Cape golden mole  -----ggagt
                     Aardvark  -----ggagt
  D               Rock pigeon  agg--agatg
B D                    Tenrec  ==========
B D                  Hedgehog  ----------
B D                Guinea pig  ==========
B D                  Elephant  ----------
         Cape elephant shrew  ----------
B D                      Pika  ==========
B D                    Rabbit  ==========
B D                 Armadillo  ----------
B D                   Manatee  ----------
                  Chinchilla  ==========
            Brush-tailed rat  ==========
B D            Naked mole-rat  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
B D                Coelacanth  ==========
                 Spotted gar  ==========
B D                   Wallaby  ==========
B D                    Lizard  ==========
          Southern platyfish  ----------
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
B D              Nile tilapia  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D                  Platypus  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D               Zebra finch  ==========
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
B D        American alligator  ----------
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========

Inserts between block 15 and 16 in window
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 1bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 1bp
                Weddell seal 1bp
               Big brown bat 37bp
        David's myotis (bat) 54bp
B D                 Microbat 24bp
            Cape golden mole 2bp
                    Aardvark 2bp

Alignment block 16 of 1240 in window, 40288327 - 40288333, 7 bps 
B D                     Human  -aaatgtg
B D                     Chimp  -aaatgtg
B D                   Gorilla  -aaatgtg
B D                 Orangutan  -aaatgtg
B D                    Gibbon  -aaatgtg
B D                    Rhesus  -aaatgtg
B D       Crab-eating macaque  -aaatgtg
B D                    Baboon  -aaatgtg
B D              Green monkey  -aaatgtg
B D                  Marmoset  -aaatgtg
B D           Squirrel monkey  -aaatgtg
B D                  Bushbaby  -aaatgtg
           Chinese tree shrew  --agtgtg
B D                  Squirrel  --agggtg
       Lesser Egyptian jerboa  -aaacata
                 Prairie vole  -acatgtt
B D           Chinese hamster  -aaatgtt
               Golden hamster  -aaatgtt
B D                     Mouse  -aaaggtg
B D                       Rat  -aaa----
B D                       Pig  -acatgtg
B D                    Alpaca  -taaagtg
               Bactrian camel  -taaagtg
B D                   Dolphin  -aaatgtg
                 Killer whale  -aaatgtg
             Tibetan antelope  -aagtat-
B D                       Cow  -aagtatg
B D                     Sheep  -aagtat-
                Domestic goat  -aagtat-
B D                     Horse  -gaatgtg
B D          White rhinoceros  -gaatgtg
B D                       Cat  -atatatg
B D                       Dog  -aaatgtg
B D                   Ferret   -aaatgtg
B D                     Panda  -aaatgtg
               Pacific walrus  -aaacgtg
                 Weddell seal  -aaacgtg
             Black flying-fox  -aaatgtg
B D                   Megabat  -aaatgtg
                Big brown bat  -agaagtg
B D                  Microbat  -aggagtg
              Star-nosed mole  -gactgtc
B D                  Elephant  ----tgtg
          Cape elephant shrew  ----tgcg
B D                   Manatee  ----tgtg
             Cape golden mole  -cagtgtg
                     Aardvark  -gaaagtg
B D                 Armadillo  ----tgtg
  D               Rock pigeon  tgaagct-
B D                    Tenrec  ========
B D                  Hedgehog  --------
B D                Guinea pig  ========
B D                     Shrew  --------
        David's myotis (bat)  ========
B D                      Pika  ========
B D                    Rabbit  ========
                  Chinchilla  ========
            Brush-tailed rat  ========
B D            Naked mole-rat  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
B D                Coelacanth  ========
                 Spotted gar  ========
B D                   Wallaby  ========
B D                    Lizard  ========
          Southern platyfish  --------
    Mexican tetra (cavefish)  ========
  D          Peregrine falcon  ========
B D                 Zebrafish  ========
B D              Nile tilapia  ========
  D            Painted turtle  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
B D                  Platypus  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
B D               Zebra finch  ========
  D              Saker falcon  ========
B D             X. tropicalis  ========
  D           Green seaturtle  ========
B D       Medium ground finch  ========
B D                   Opossum  ========
B D        American alligator  --------
  D    White-throated sparrow  ========
          Tibetan ground jay  ========
B D           Tasmanian devil  ========

Inserts between block 16 and 17 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 27bp
B D                 Microbat 23bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 17 of 1240 in window, 40288334 - 40288354, 21 bps 
B D                     Human  gcgggtgctgggctg--------aactgg
B D                     Chimp  gcgggtgctgggctg--------aactgg
B D                   Gorilla  gcgggtgctgggctg--------aactgg
B D                 Orangutan  gcgggtgctgggctg--------aactgg
B D                    Gibbon  gcgggcgctgggctg--------aactgg
B D                    Rhesus  gcggatgctgggctg--------aactgg
B D       Crab-eating macaque  gcggatgctgggctg--------aactgg
B D                    Baboon  gcggatgctgggctg--------aactgg
B D              Green monkey  gcggatgctgggctg--------aactgg
B D                  Marmoset  gcggctggtgggctg--------agctgg
B D           Squirrel monkey  gcggctgctgggctg--------acctgg
B D                  Bushbaby  gcggttgctggccta--------aactag
           Chinese tree shrew  g-----------------------ac--g
B D                  Squirrel  gc-ggttatgggctc--------a-----
       Lesser Egyptian jerboa  a--agcctggggctg--------aaccgg
                 Prairie vole  ac-gatctggaattaattaaactagttag
B D           Chinese hamster  at-ggtctggaatta--------aattag
               Golden hamster  gt-ggtctggaacta--------aattag
B D                     Mouse  ac-ggtctggaacca--------aaccag
B D                       Rat  ---tgtctggaacta--------aactag
B D                       Pig  gaggttgctgggcta--------agc-gg
B D                    Alpaca  gaggctgctgggcta--------agctga
               Bactrian camel  gaggttgctgggcta--------agctga
B D                   Dolphin  gaggctgctgggcta--------agctgg
                 Killer whale  gaggctgctgggcta--------agctgg
             Tibetan antelope  gaggctgctgcgcta--------aaatgg
B D                       Cow  gaggctgctgcgcta--------aggtgg
B D                     Sheep  gaggctgctgcgcta--------aaatgg
                Domestic goat  gaggctgctgcgcta--------aaatgg
B D                     Horse  aaggttgctgggcta--------agctgg
B D          White rhinoceros  aaggttgctgggcta--------agctgg
B D                       Cat  cagggtgctgggcca--------acctgg
B D                       Dog  cagggtgctggacta--------agctgg
B D                   Ferret   tcgggtcctgggcta--------agctgg
B D                     Panda  cagggtgctgggcta--------aactgg
               Pacific walrus  caggctgctgggcca--------agctag
                 Weddell seal  caggatgctgggcta--------agctag
             Black flying-fox  aaggttgctgggcga--------agctgg
B D                   Megabat  aaggttgctgggcga--------agctgg
B D                  Hedgehog  ggggtcgctggcgtg--------agctgg
B D                     Shrew  ggaaacgcgggaccg--------tgttgg
              Star-nosed mole  gaggttgctggactg--------cgctgg
B D                  Elephant  aaggttgctagacta--------agctgg
          Cape elephant shrew  gaggccgctggccca--------a---aa
B D                   Manatee  aaggttgctgggcta--------agctgg
             Cape golden mole  aaggttgctgggtta--------agtcga
                     Aardvark  aaggtttatgagcta--------a---gt
B D                 Armadillo  aaaattgttgggctc--------aggtgg
  D               Rock pigeon  gcagaggctgggaag--------ggg---
B D                    Tenrec  =============================
B D                Guinea pig  =============================
        David's myotis (bat)  =============================
B D                      Pika  =============================
B D                    Rabbit  =============================
                  Chinchilla  =============================
            Brush-tailed rat  =============================
B D                  Microbat  =============================
               Big brown bat  =============================
B D            Naked mole-rat  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
B D                Coelacanth  =============================
                 Spotted gar  =============================
B D                   Wallaby  =============================
B D                    Lizard  =============================
          Southern platyfish  -----------------------------
    Mexican tetra (cavefish)  =============================
  D          Peregrine falcon  =============================
B D                 Zebrafish  =============================
B D              Nile tilapia  =============================
  D            Painted turtle  =============================
B D                 Tetraodon  =============================
B D                   Chicken  =============================
B D                  Platypus  =============================
  D       Collared flycatcher  =============================
  D  Chinese softshell turtle  =============================
B D               Zebra finch  =============================
  D              Saker falcon  =============================
B D             X. tropicalis  =============================
  D           Green seaturtle  =============================
B D       Medium ground finch  =============================
B D                   Opossum  =============================
B D        American alligator  -----------------------------
  D    White-throated sparrow  =============================
          Tibetan ground jay  =============================
B D           Tasmanian devil  =============================

Inserts between block 17 and 18 in window
B D                    Shrew 10bp
             Star-nosed mole 227bp

Alignment block 18 of 1240 in window, 40288355 - 40288361, 7 bps 
B D                     Human  tgataaa
B D                     Chimp  tgataaa
B D                   Gorilla  tgataaa
B D                 Orangutan  tgataaa
B D                    Gibbon  tgataaa
B D                    Rhesus  tgataaa
B D       Crab-eating macaque  tgataaa
B D                    Baboon  tgataaa
B D              Green monkey  tgataaa
B D                  Marmoset  tgataaa
B D           Squirrel monkey  tgatcaa
B D                  Bushbaby  tgataag
           Chinese tree shrew  tgataaa
B D                  Squirrel  -gatgaa
       Lesser Egyptian jerboa  tgctgaa
                 Prairie vole  tgctaag
B D           Chinese hamster  tgctaaa
               Golden hamster  tgctaaa
B D                     Mouse  tgctaaa
B D                       Rat  tgctaaa
B D                       Pig  ggtttat
B D                    Alpaca  ggataat
               Bactrian camel  ggataat
B D                   Dolphin  tgttaac
                 Killer whale  tgttaac
             Tibetan antelope  tgataat
B D                       Cow  tgataat
B D                     Sheep  tgataat
                Domestic goat  tgataat
B D                     Horse  tgataaa
B D          White rhinoceros  tgataaa
B D                       Cat  tgataaa
B D                       Dog  tgataac
B D                   Ferret   tgataaa
B D                     Panda  tgataaa
               Pacific walrus  tgataaa
                 Weddell seal  tgataaa
             Black flying-fox  tgataaa
B D                   Megabat  tgataaa
B D                  Hedgehog  tggtaaa
B D                     Shrew  tgctgaa
B D                  Elephant  tgataaa
          Cape elephant shrew  tgataaa
B D                   Manatee  tgataaa
             Cape golden mole  tgctaaa
                     Aardvark  tgatcaa
B D                 Armadillo  agataaa
  D               Rock pigeon  tgaggaa
B D                    Tenrec  =======
B D                Guinea pig  =======
        David's myotis (bat)  =======
             Star-nosed mole  =======
B D                      Pika  =======
B D                    Rabbit  =======
                  Chinchilla  =======
            Brush-tailed rat  =======
B D                  Microbat  =======
               Big brown bat  =======
B D            Naked mole-rat  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
B D                Coelacanth  =======
                 Spotted gar  =======
B D                   Wallaby  =======
B D                    Lizard  =======
          Southern platyfish  -------
    Mexican tetra (cavefish)  =======
  D          Peregrine falcon  =======
B D                 Zebrafish  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D                   Chicken  =======
B D                  Platypus  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
B D               Zebra finch  =======
  D              Saker falcon  =======
B D             X. tropicalis  =======
  D           Green seaturtle  =======
B D       Medium ground finch  =======
B D                   Opossum  =======
B D        American alligator  -------
  D    White-throated sparrow  =======
          Tibetan ground jay  =======
B D           Tasmanian devil  =======

Inserts between block 18 and 19 in window
  D              Rock pigeon 949bp

Alignment block 19 of 1240 in window, 40288362 - 40288409, 48 bps 
B D                     Human  gacaccccgcg-tgcctggaggg-aggaaacta-------------gaa-----gttct----atataaa
B D                     Chimp  gacaccccgcg-tgcctggaggg-aggaaacta-------------gaa-----gttct----atataaa
B D                   Gorilla  gacaccccgcg-tgcctggaggg-aggaaacta-------------gaa-----gttct----atataaa
B D                 Orangutan  gacaccccgcg-tgtctggaggg-aggaaacta-------------gaa-----gttct--aaatataaa
B D                    Gibbon  gacaccccgcg-tgcctggaggg-aggaaacta-------------gaa-----gttct----atataaa
B D                    Rhesus  gacaccccgcg-ttcctggagag-agggaatta-------------gaa-----gttct----atataaa
B D       Crab-eating macaque  gacaccccgcg-ttcctggagag-agggaatta-------------gaa-----gttct----atataaa
B D                    Baboon  gacaccccgcg-ttcctggagag-agggaatta-------------gaa-----gttct----atataaa
B D              Green monkey  gacaccccgcg-ttcctggagag-agggaatta-------------gaa-----gttct----atataaa
B D                  Marmoset  -acacccctca-tgcctggagga-gggcaatta-------------gaa-----gttct----atacaaa
B D           Squirrel monkey  -acacccctca-tgcctggagga-agggaatta-------------gaa-----gttcc----atacaaa
B D                  Bushbaby  ggtaccccaca-tg-ctggagtg-agggaatta-------------gaa-----gtgcc----atagaag
           Chinese tree shrew  gccttcccgcg-tgcctggagtg-aggcgatta--------------ca-----gtact----atagaaa
B D                  Squirrel  gatgccccgca-tgcctggagtg-aggagatta-------------gaa-----gtactgtaaatgaaaa
       Lesser Egyptian jerboa  gatgttctgaa-tgtttggggtg-aaggaatta-------------gaa-----cttct----atagaaa
                 Prairie vole  gatgtctcgcg-tgtctggagtg-aaggagcta-------------gaa-----atatt----acagaaa
B D           Chinese hamster  tgtgcctcgcg-tctctggag-------agcta-------------ga--------att----atagaaa
               Golden hamster  tatgtctcgcg-tgtctggagtg-aagaagcta-------------gaa-----gtatt----atagaaa
B D                     Mouse  gacgtctcaca-tgtctgcaggg-aaggagcta--------------aa-----gtatt----atagaaa
B D                       Rat  gacgtctcgca-tgtctggagtg-aaggaacta-------------gaa-----gtatt----atagaaa
B D                       Pig  gatcgaccccgttgcctggagtg-aaagaatta-------------gaa-----gtact----acagaag
B D                    Alpaca  gatctaccccg-tgcctggagcc-aggggatta-------------gaa-----atcct----acagaaa
               Bactrian camel  gatctaccccg-tgcctggagcc-aggggatta-------------gaa-----atcct----acagaaa
B D                   Dolphin  gatgtaccccg-tgcctggagcc-aggggggta-------------gaa-----gtact----atggacg
                 Killer whale  gatgtaccccg-tgcctggagcc-aggggggta-------------gaa-----gtact----atggacg
             Tibetan antelope  gatctaccccg-ggcctggagct-agagaatta-------------gaa-----gtgct----ataggcg
B D                       Cow  ggtctactccg-ggcctggagct-agaaaatta-------------gaa-----gtgct----gtaggcg
B D                     Sheep  gatctactccg-ggcctggagct-agagaatta-------------gaa-----gtgct----ataggcg
                Domestic goat  gatctactccg-ggcctggagct-agagaatta-------------gaa-----gtgct----atagacg
B D                     Horse  gataggtcccg-tccctggagtg-agggcatta-------------gga-----gtgtt----ctagaag
B D          White rhinoceros  gatctgccccc-tccgtggagtg-agggcatcg-------------gga-----gtagt----ctagaaa
B D                       Cat  gacacaccccg-tgcccggagtg-agggaatta-------------gaa-----gtcct----gtagaag
B D                       Dog  gccacaccccg-t-----gaggg-agggaattc-------------aaa-----gtact----gcacata
B D                   Ferret   gacacaccccg-tgcctggagtg-agggaatta-------------gaa-----gtact----gtagaaa
B D                     Panda  gacacaccccg-tgcctggagtg-agggaatta-------------gaa-----gtcct----gtagaaa
               Pacific walrus  gacacacccc--tgcctggagtg-agggaatta-------------gaa-----gtact----gtagaaa
                 Weddell seal  gacacaccccg-tgcctggagtg-agggaatta-------------gaa-----gtacc----gtagaaa
             Black flying-fox  gataaaccccg-tgcctggggtg-agggaatt----------------a-----gtact----atagaaa
B D                   Megabat  gataaaccccg-tgcctggggtg-agggaatt----------------a-----gtact----atagaaa
B D                  Hedgehog  tacataacctg-cacctgcggtg-aagcactta-------------gaa-----ttatc----atagaaa
B D                     Shrew  gctaaacccca-tgagtgcagtg-agggacttc-------------gaa-----gtatt----acagaaa
B D                  Elephant  gatatcccgc--ggcctgaagtg-agggaatta-------------gac-----gtact----ctagaca
          Cape elephant shrew  gagtttaaga--ctcttggagtg-agcacatta-------------agtattcaatact----gtagaaa
B D                   Manatee  gatattccgc--tgcctggagtg-agggaatta-------------gac-----gtact----atagaaa
             Cape golden mole  gaca-cccgc--ttcctggagtg-agtaaacta-------------gac-----gt--t----ata-aga
                     Aardvark  gatatccccc--tgcctggagtg-agggatttt-------------gac-----atact----atagaaa
B D                 Armadillo  gatattcttcg-tgcctggagcgcagggaagtactataaaaatagggaa-----gtact----gtagaaa
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
        David's myotis (bat)  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
                  Chinchilla  ======================================================================
            Brush-tailed rat  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
B D            Naked mole-rat  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D                Coelacanth  ======================================================================
                 Spotted gar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  tc
                        Chimp  tc
                      Gorilla  tc
                    Orangutan  tc
                       Gibbon  tc
                       Rhesus  tc
          Crab-eating macaque  tc
                       Baboon  tc
                 Green monkey  tc
                     Marmoset  tc
              Squirrel monkey  tc
                     Bushbaby  tc
           Chinese tree shrew  tc
                     Squirrel  ta
       Lesser Egyptian jerboa  tc
                 Prairie vole  tc
              Chinese hamster  cc
               Golden hamster  tc
                        Mouse  ta
                          Rat  tt
                          Pig  cc
                       Alpaca  cc
               Bactrian camel  cc
                      Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
                          Cow  cc
                        Sheep  cc
                Domestic goat  cc
                        Horse  tc
             White rhinoceros  tc
                          Cat  tc
                          Dog  tc
                      Ferret   tc
                        Panda  tc
               Pacific walrus  tc
                 Weddell seal  tc
             Black flying-fox  tc
                      Megabat  tc
                     Hedgehog  cc
                        Shrew  tc
                     Elephant  tc
          Cape elephant shrew  tt
                      Manatee  tc
             Cape golden mole  tc
                     Aardvark  tc
                    Armadillo  tc
                       Tenrec  ==
                   Guinea pig  ==
         David's myotis (bat)  ==
              Star-nosed mole  ==
                         Pika  ==
                       Rabbit  ==
                   Chinchilla  ==
             Brush-tailed rat  ==
                     Microbat  ==
                Big brown bat  ==
               Naked mole-rat  ==
       Yellowbelly pufferfish  ==
                         Fugu  ==
          Pundamilia nyererei  ==
                  Zebra mbuna  ==
        Burton's mouthbreeder  ==
                   Coelacanth  ==
                  Spotted gar  ==
                      Wallaby  ==
                       Lizard  ==
           Southern platyfish  --
     Mexican tetra (cavefish)  ==
             Peregrine falcon  ==
                    Zebrafish  ==
                  Rock pigeon  ==
                 Nile tilapia  ==
               Painted turtle  ==
                    Tetraodon  ==
                      Chicken  ==
                     Platypus  ==
          Collared flycatcher  ==
     Chinese softshell turtle  ==
                  Zebra finch  ==
                 Saker falcon  ==
                X. tropicalis  ==
              Green seaturtle  ==
          Medium ground finch  ==
                      Opossum  ==
           American alligator  --
       White-throated sparrow  ==
           Tibetan ground jay  ==
              Tasmanian devil  ==

Inserts between block 19 and 20 in window
                Prairie vole 17bp

Alignment block 20 of 1240 in window, 40288410 - 40288410, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  c
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  a
B D                   Megabat  a
B D                  Hedgehog  a
B D                     Shrew  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                 Armadillo  a
B D                    Tenrec  =
B D                Guinea pig  =
                Prairie vole  =
        David's myotis (bat)  =
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  =
                  Chinchilla  =
            Brush-tailed rat  =
B D                  Microbat  =
               Big brown bat  =
B D            Naked mole-rat  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 20 and 21 in window
              Golden hamster 4bp

Alignment block 21 of 1240 in window, 40288411 - 40288411, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D           Chinese hamster  c
B D                     Mouse  a
B D                       Rat  c
B D                       Pig  a
B D                   Dolphin  a
                 Killer whale  c
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
B D                  Hedgehog  a
B D                     Shrew  a
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  a
                     Aardvark  g
B D                 Armadillo  a
B D                    Tenrec  =
B D                Guinea pig  =
              Golden hamster  =
                Prairie vole  =
        David's myotis (bat)  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  =
                  Chinchilla  =
            Brush-tailed rat  =
B D                  Microbat  =
               Big brown bat  =
B D            Naked mole-rat  =
              Bactrian camel  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 21 and 22 in window
B D                    Shrew 207bp
            Cape golden mole 335bp

Alignment block 22 of 1240 in window, 40288412 - 40288412, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
B D           Chinese hamster  t
B D                     Mouse  t
B D                       Rat  t
B D                       Pig  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                    Tenrec  =
B D                Guinea pig  =
              Golden hamster  =
                Prairie vole  =
B D                     Shrew  =
        David's myotis (bat)  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  =
                  Chinchilla  =
            Brush-tailed rat  =
          Chinese tree shrew  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  =
B D            Naked mole-rat  =
              Bactrian camel  -
            Cape golden mole  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D           Tasmanian devil  =

Inserts between block 22 and 23 in window
      Lesser Egyptian jerboa 4093bp
B D                    Mouse 10bp

Alignment block 23 of 1240 in window, 40288413 - 40288418, 6 bps 
B D                     Human  tcatgt
B D                     Chimp  tcatgt
B D                   Gorilla  tcatgt
B D                 Orangutan  tcatgt
B D                    Gibbon  tcatgt
B D                    Rhesus  tcatgt
B D       Crab-eating macaque  tcattt
B D                    Baboon  tcatgt
B D              Green monkey  tcatgt
B D                  Marmoset  tcaagt
B D           Squirrel monkey  tgaagt
B D           Chinese hamster  ggaggt
B D                       Rat  ggagat
B D                       Pig  taagat
B D                   Dolphin  taagat
                 Killer whale  taagat
             Tibetan antelope  taagat
B D                       Cow  taagat
B D                     Sheep  taagat
                Domestic goat  aaagat
B D                     Horse  taagat
B D          White rhinoceros  taaggt
B D                       Cat  taagat
B D                       Dog  taagat
B D                   Ferret   taagat
B D                     Panda  taagat
               Pacific walrus  taagat
                 Weddell seal  tgagat
             Black flying-fox  caagat
B D                   Megabat  caaaat
B D                  Hedgehog  ttagat
B D                  Elephant  caaaat
          Cape elephant shrew  taagat
B D                   Manatee  taaaat
                     Aardvark  taagat
B D                 Armadillo  taagat
B D                    Tenrec  ======
B D                Guinea pig  ======
B D                     Mouse  ======
              Golden hamster  ======
                Prairie vole  ======
B D                     Shrew  ======
        David's myotis (bat)  ======
B D                    Alpaca  ------
             Star-nosed mole  ======
B D                  Squirrel  ------
B D                      Pika  ======
B D                    Rabbit  ======
                  Chinchilla  ======
      Lesser Egyptian jerboa  ======
            Brush-tailed rat  ======
          Chinese tree shrew  ------
B D                  Microbat  ======
B D                  Bushbaby  ------
               Big brown bat  ======
B D            Naked mole-rat  ======
              Bactrian camel  ------
            Cape golden mole  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D                Coelacanth  ======
                 Spotted gar  ======
B D                   Wallaby  ======
B D                    Lizard  ======
          Southern platyfish  ------
    Mexican tetra (cavefish)  ======
  D          Peregrine falcon  ======
B D                 Zebrafish  ======
  D               Rock pigeon  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D                   Chicken  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
B D               Zebra finch  ======
  D              Saker falcon  ======
B D             X. tropicalis  ======
  D           Green seaturtle  ======
B D       Medium ground finch  ======
B D                   Opossum  ======
B D        American alligator  ------
  D    White-throated sparrow  ======
          Tibetan ground jay  ======
B D           Tasmanian devil  ======

Inserts between block 23 and 24 in window
B D                      Pig 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Dog 1bp

Alignment block 24 of 1240 in window, 40288419 - 40288419, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D           Chinese hamster  a
B D                       Rat  a
B D                   Dolphin  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
B D                  Hedgehog  a
B D                  Elephant  g
          Cape elephant shrew  a
B D                   Manatee  a
                     Aardvark  g
B D                 Armadillo  a
B D                    Tenrec  =
B D                Guinea pig  =
B D                     Mouse  =
              Golden hamster  =
                Prairie vole  =
            Tibetan antelope  =
B D                     Shrew  =
        David's myotis (bat)  =
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
          Chinese tree shrew  -
B D                       Dog  =
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
            Cape golden mole  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 24 and 25 in window
B D         White rhinoceros 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Hedgehog 1bp
         Cape elephant shrew 4bp
                    Aardvark 1bp

Alignment block 25 of 1240 in window, 40288420 - 40288421, 2 bps 
B D                     Human  -a-c
B D                     Chimp  -a-c
B D                   Gorilla  -c-c
B D                 Orangutan  -a-c
B D                    Gibbon  -a-c
B D                    Rhesus  -a-c
B D       Crab-eating macaque  -a-c
B D                    Baboon  -a-c
B D              Green monkey  -a-c
B D                  Marmoset  -a-c
B D           Squirrel monkey  -a-c
B D           Chinese hamster  -a-a
B D                       Rat  -a-a
B D                   Dolphin  -ac-
B D          White rhinoceros  -a--
B D                   Ferret   -a--
B D                     Panda  -a--
               Pacific walrus  -a--
                 Weddell seal  -a--
             Black flying-fox  -a--
B D                   Megabat  -a--
B D                  Hedgehog  -a--
          Cape elephant shrew  aa--
                     Aardvark  ag--
B D                 Armadillo  aa--
B D                    Tenrec  ====
B D                Guinea pig  ====
B D                     Mouse  ====
              Golden hamster  ====
                Prairie vole  ====
B D                  Elephant  ----
            Tibetan antelope  ====
B D                     Shrew  ====
        David's myotis (bat)  ====
B D                     Horse  ----
               Domestic goat  ====
B D                     Sheep  ====
B D                       Cow  ====
B D                    Alpaca  ----
             Star-nosed mole  ====
B D                  Squirrel  ----
B D                      Pika  ====
B D                    Rabbit  ====
B D                   Manatee  ----
                  Chinchilla  ====
      Lesser Egyptian jerboa  ====
            Brush-tailed rat  ====
          Chinese tree shrew  ----
B D                       Dog  ====
B D                       Cat  ----
B D                  Microbat  ====
B D                  Bushbaby  ----
               Big brown bat  ====
B D            Naked mole-rat  ====
                Killer whale  ====
              Bactrian camel  ----
            Cape golden mole  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
B D                Coelacanth  ====
                 Spotted gar  ====
B D                   Wallaby  ====
B D                    Lizard  ====
          Southern platyfish  ----
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D                   Opossum  ====
B D        American alligator  ----
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D                       Pig  ====
B D           Tasmanian devil  ====

Inserts between block 25 and 26 in window
B D                Orangutan 1bp
B D                   Rhesus 4bp
B D      Crab-eating macaque 4bp
B D                   Baboon 4bp
B D             Green monkey 10bp
B D          Chinese hamster 1bp
B D                      Rat 1bp

Alignment block 26 of 1240 in window, 40288422 - 40288422, 1 bps 
B D                     Human  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                   Dolphin  t
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  t
          Cape elephant shrew  t
                     Aardvark  t
B D                 Armadillo  c
B D                    Tenrec  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
                Prairie vole  =
B D                  Elephant  -
            Tibetan antelope  =
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
            Cape golden mole  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                  Marmoset  -
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D              Green monkey  =
B D           Squirrel monkey  -
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                       Pig  =
B D           Tasmanian devil  =
B D                     Chimp  -

Alignment block 27 of 1240 in window, 40288423 - 40288423, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                   Ferret   t
B D                     Panda  t
B D                  Hedgehog  t
          Cape elephant shrew  t
                     Aardvark  t
B D                 Armadillo  t
B D                    Tenrec  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
                Prairie vole  =
B D                  Elephant  -
            Tibetan antelope  =
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
            Black flying-fox  -
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D              Green monkey  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  -
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 27 and 28 in window
B D                   Rhesus 14bp
B D      Crab-eating macaque 14bp

Alignment block 28 of 1240 in window, 40288424 - 40288424, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D           Chinese hamster  t
B D                       Rat  t
B D                   Dolphin  t
B D                   Ferret   t
B D                     Panda  t
          Cape elephant shrew  t
                     Aardvark  t
B D                 Armadillo  t
B D                    Tenrec  =
B D                  Hedgehog  -
B D                Guinea pig  =
B D                     Mouse  =
              Golden hamster  =
                Prairie vole  =
B D                  Elephant  -
            Tibetan antelope  =
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
            Black flying-fox  -
            Cape golden mole  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D              Green monkey  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  -
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 28 and 29 in window
B D                  Dolphin 1bp
B D                  Ferret  1bp
B D                    Panda 275bp

Alignment block 29 of 1240 in window, 40288425 - 40288425, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D           Chinese hamster  t
B D                       Rat  t
          Cape elephant shrew  c
                     Aardvark  t
B D                 Armadillo  t
B D                    Tenrec  =
B D                  Hedgehog  -
B D                Guinea pig  =
B D                     Mouse  =
              Golden hamster  =
                Prairie vole  =
B D                  Elephant  -
            Tibetan antelope  =
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  -
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                  Squirrel  -
B D                      Pika  =
B D                    Rabbit  =
B D                   Manatee  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  =
B D                  Bushbaby  -
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  =
            Black flying-fox  -
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  =
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D                Coelacanth  =
                 Spotted gar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  -
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D                  Platypus  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D              Green monkey  =
B D               Zebra finch  =
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  -
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  -
B D                       Pig  =
B D           Tasmanian devil  =

Inserts between block 29 and 30 in window
B D          Chinese hamster 1bp
B D                      Rat 1bp

Alignment block 30 of 1240 in window, 40288426 - 40288427, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                   Gorilla  tt-
B D                 Orangutan  tt-
B D                    Gibbon  tt-
B D                    Rhesus  tt-
B D       Crab-eating macaque  tt-
B D                    Baboon  tt-
B D                  Marmoset  tt-
B D           Squirrel monkey  tt-
B D                   Dolphin  tt-
B D                   Ferret   tt-
          Cape elephant shrew  -t-
                     Aardvark  -t-
B D                 Armadillo  -tt
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D           Chinese hamster  ===
                Prairie vole  ===
B D                  Elephant  ---
            Tibetan antelope  ===
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ===
B D                     Sheep  ===
B D                       Cow  ===
B D                    Alpaca  ---
             Star-nosed mole  ===
B D                  Squirrel  ---
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
B D          White rhinoceros  ---
            Brush-tailed rat  ===
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ===
B D                  Bushbaby  ---
               Big brown bat  ===
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ===
            Black flying-fox  ---
            Cape golden mole  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D                Coelacanth  ===
                 Spotted gar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ---
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D              Green monkey  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ---
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ===
B D           Tasmanian devil  ===

Inserts between block 30 and 31 in window
B D                  Dolphin 1bp
B D                  Ferret  252bp

Alignment block 31 of 1240 in window, 40288428 - 40288429, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                   Gorilla  tt-
B D                 Orangutan  tt-
B D                    Gibbon  tt-
B D                    Rhesus  gt-
B D       Crab-eating macaque  gt-
B D                    Baboon  tt-
B D                  Marmoset  tt-
B D           Squirrel monkey  tt-
B D                   Dolphin  tt-
                     Aardvark  --g
B D                 Armadillo  -ta
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D           Chinese hamster  ===
                Prairie vole  ===
B D                  Elephant  ---
            Tibetan antelope  ===
         Cape elephant shrew  ---
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ---
               Domestic goat  ===
B D                     Sheep  ===
B D                       Cow  ===
B D                    Alpaca  ---
             Star-nosed mole  ===
B D                  Squirrel  ---
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
B D          White rhinoceros  ---
            Brush-tailed rat  ===
          Chinese tree shrew  ---
              Pacific walrus  ---
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ===
B D                  Bushbaby  ---
               Big brown bat  ===
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ---
B D                     Panda  ===
            Black flying-fox  ---
B D                   Ferret   ===
            Cape golden mole  ===
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
B D                Coelacanth  ===
                 Spotted gar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ---
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D              Green monkey  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D</