Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 965 in window, 110873100 - 110873330, 231 bps 
B D                   Human  gtcg---tcacagcatgatcata----ttttttca------------cccttcacttctccttttacaca
B D                   Chimp  gtcg---tcacagcatgatcata----ttttttca------------cccttcacttctgcttttacaca
B D                 Gorilla  gtcg---tcacagcatgatcata----ttttttca------------cccttcacttctgcttttacaca
B D               Orangutan  gtcg---tcacagcacgatcata----ttttttca------------cccttcacttctccttttacaca
B D                  Gibbon  gtcg---tcacagcacgatcata----ttttttca------------cccttcacttctccttttacaca
B D                  Rhesus  gtcg---tcacagcacgatcata----ttttttcg------------ccctttacttctccttttacaca
B D     Crab-eating macaque  gtcg---tcacagcacgatcata----ttttttcg------------ccctttacttctccttttacaca
B D                  Baboon  gtcg---tcacagcacgatcata----ttttttcg------------ccctttacttctccttttacaca
B D            Green monkey  gtcg---tcacagcacgatcata----ttttttca------------ccctttacttctccttttacaca
B D                Marmoset  gtcg---tcacagcacgatcata----ttttttca------------cccttcacttctccttttacaca
B D         Squirrel monkey  gtcg---tcacagcacgatcata----ttttttca------------cccttcacttctccttttacaca
B D                Bushbaby  gtca---tcacagtgtgatcgta----ttttttct------------ctgttcacttctcctttcacaca
         Chinese tree shrew  gtcg---tcacagcgagatcatcatatttttttct------------cccttcacttctccttttacaca
B D                Squirrel  gtcg---tcacagcatggtcata--ttttttttct------------cccttcacttccccttttacaca
     Lesser Egyptian jerboa  gttg---tcacagcatgattatattctttttttct------------cttctcacttctccttttacaca
               Prairie vole  gtcc---tcacggcacgaccata---tttttttct------------ctcttcacttctccttttacaca
B D         Chinese hamster  gtcg---tcacagcatgatcata----ttttttct------------ctcttcacttctccttttacaca
             Golden hamster  gtcg---tcacaacatgttcata----ttttttct------------ctcttcacttctccttttacaca
B D                   Mouse  gtcg---tcacagcatgattgta----ttttttct------------ctcttcacttctccttttacaca
B D                     Rat  gtcg---tcacagcatgatcgta----ttttttct------------ctcttcacttctccttttacaca
B D          Naked mole-rat  gtcg---tcacagtaaaatcaca----tttttttttt----------ccctttacttctccttttacaca
B D              Guinea pig  ctca---tcgcagtacgatcacg----gtttttttt-----------ctctttacttctccttttacaca
                 Chinchilla  gtcg---tcacagtacgatcaca----tttttttttttttttttttgccctttacttctccttttacaca
           Brush-tailed rat  gtcg---tcacagtatgatcaca----tttttttt------------ctctttacttctctttttacaca
B D                  Rabbit  gtcg---tcacaacgtgatcgta---tttttttca------------ccctccacttctccttttacaca
B D                    Pika  gtcg---tcacagtgtgaccgga---cctttttca------------cccctcacttctccttttacaca
B D                     Pig  gtcg---tcacagtgtgatcaca----tttattcc------------cccttaacttctccttttacaca
B D                  Alpaca  gtca---tcacggcgtcatcaca----tttattcc------------ctcttcacttctccttttacaca
             Bactrian camel  gtca---tcacggtgtcatcaca----tttattcc------------ctcttcacttctccttttacaca
B D                 Dolphin  gtca---tcacagtgtgatcaca----tttattcc------------cccttcacttctccttttacaca
               Killer whale  gtca---tcacagtgtgatcaca----tttattcc------------cccttcacttctccttttacaca
           Tibetan antelope  gtcg---tcacagtgtgatcaca----tttattcc------------cccttcacttctccttttacaca
B D                     Cow  gtcg---tcagagtgtgatcaca----tttattcc------------cccttcacttctccttttacaca
B D                   Sheep  gtcg---tcacagtgtgatcaca----tttattcc------------cccttcacttctccttttacaca
              Domestic goat  gtcg---tcacagtgtgatcgca----tttattcc------------cccttcacttctccttttacaca
B D                   Horse  gtcg---tcacagtgtgatcaca----cttattcc------------tctttcatttctccttctacaca
B D        White rhinoceros  gtcg---tcacagtgtgatcaca----tttattcc------------tctttcatttctccttttacaca
B D                     Cat  gtcg---tcacagcgtgagcaca----tttatttt------------ccattcacttctccttttacaca
B D                     Dog  gttg---t--cagtgtgagcaca----tttatttt------------cccttcacttctccttttacaca
B D                 Ferret   gttg---tcacagtgtgagcaca----tttatttt------------cccttcacttctccttttataca
B D                   Panda  gttg---tcacagtgtgaacaca----tttatttt------------cccttcacttctccttttacaca
             Pacific walrus  gttg---tcacagtgtgagcaca----tttatttt------------cccttcacttctccttttacaca
               Weddell seal  gttg---tcacagtgtgagcaca----tttatttt------------cccttcacttctccttttacaca
           Black flying-fox  gttg---tcacagtgcaatcaca----tttattct------------cccttcacttctccttttacaca
B D                 Megabat  gttg---tcacagtgcaatcaca----tttattct------------cccttcacttctccttttacaca
              Big brown bat  gtcc---tcacgatgtgatgaca----tttattcc------------ccctccacttctccttttactca
       David's myotis (bat)  gtcc---ttgcagtgtgatgaca----tctattcc------------ccctccacttctccttttactca
B D                Microbat  gtcc---ttgcagtgtgatgaca----tttattcc------------ccctccacttctccttttactca
B D                Hedgehog  gtca---tcacagtgtga-cata----tttactcc------------cccttcacttctcctttcacaca
B D                   Shrew  gttg---tcatcgtgtga-cata----cttatacc------------tcctccacttctccttttacata
            Star-nosed mole  gtcg---tcag-atgtga-caca----tttataataa----------cccctcacttctccttttgcgca
B D                Elephant  gttg---tcacagcgcgatcata----tttatcaa------------cctttcacttctcctttttcaca
        Cape elephant shrew  gtcg---tcacagcgtgatcata----tttatcct------------ttcttcacttctcctttttcaca
B D                 Manatee  cttg---tcacagcgcgatctta----tttatgct------------cctttcacttctcctttttcaca
           Cape golden mole  gtcg---tcacagcaagatccta----tttatccc------------ctcttcacttctcctttt-caca
B D                  Tenrec  gtca---tcacagcgtgatcaca----tttatcct------------accatcacttctccttttgcaca
                   Aardvark  gtcgtcatcacagcgcaatcata----tttatccta-----------ccctttacttctcctttttcaca
B D               Armadillo  gtca---tcacagcttgatcgta----tttattcc------------cccctcacttctccttttaccca
B D         Tasmanian devil  ======================================================================

                      Human  aatagc-cccggatatctg-tgtt----accagccttgtctcggccacctcaaggataatcactaaattc
                      Chimp  aatagc-cccggatatctg-tgtt----accagccttgtctcggccacctcaaggataatcactaaattc
                    Gorilla  aatagc-cccggatatctg-tgtt----accagccttgtctcagccacctcaaggataatcactaaattc
                  Orangutan  aatagc-cccggatatctg-tgtt----accagccttgtctcggccacctcaaggataatcactaaattc
                     Gibbon  aatagc-cccggatatctg-tgtt----accagccttgtctcggccacctcaaggataatcactaaattc
                     Rhesus  aatagc-cccggatacccg-tgtt----accagccttgtctcagccacctcaaggataatcactaaattc
        Crab-eating macaque  aatagc-cccggatacccg-tgtt----accagccttgtctcagccacctcaaggataatcactaaattc
                     Baboon  aatagc-cccggatacccg-tgtt----accagccttgtctcagccacctcaaggataatcactaaattc
               Green monkey  aatagc-cccggatacccg-tgtt----accagccttgtctcagccacctcaaggataatcactaaattc
                   Marmoset  aatagt-accggacatccg-tgtt----a-cagccttatcttggccacctcaaggataatcaccaaattc
            Squirrel monkey  aatagt-accggacatccg-tgtt----a-cagccttatcttggccacctcaaggataatcaccagattc
                   Bushbaby  aatagc-cctagacacccg-tgtt----accaatcttgtctcaacggccacaaggatcatcaccaaattc
         Chinese tree shrew  aatagc-cctc-acgtccg-tgtt----accagccttgtttcaaccacctcaaggtagatcaccaaattc
                   Squirrel  aatagc-cccagacatctg-tgtg----atcagctctgtggtggccatctcaaagagaatcaccacactc
     Lesser Egyptian jerboa  aatagc-ccca-acttctg-tgtt----actacc-ctatggtaaccactttaacgataatcaccgaattc
               Prairie vole  aataga-ccacgacttctg-tgtt----accagc-cggtgttggccaccttaaagataatcaacaaattc
            Chinese hamster  aataga-cccagacttctg-tgtt----accagc-ctgtgctggccaccttaaagataatcaacaaattc
             Golden hamster  aataga-ctcagacttctg-tgtt----accagc-ctttgctggccaccttaaagataatcaacaaattc
                      Mouse  aataga-catagacttctg-ggtt----a-cagg-ctgtgctggccacctaaaagataatcagtgaattc
                        Rat  aataga-catagacttctg-ggtt----accaga-ctgtgctcgccactttaaagataataagcaaattc
             Naked mole-rat  aatag--cctggacatctg-tgtt----accagtcttgtggtagccacttcatagataataaccaaatcc
                 Guinea pig  aatag--cctgaccatctg-tata----accagtcctgtggaggccagctgaaagataataaccaaacat
                 Chinchilla  aatag--gccggacatctg-tttt----accagtcttgttgtagccacctcaaagataataaccaaatcc
           Brush-tailed rat  aatag--cccggacatctg-tgtt----accagtcttgttgtggccacctcaaagattataacccagtcc
                     Rabbit  aatatc-tcccgacatccg-ggtt----agcagccttgtcacagccacttcaagtataatcacagaagcc
                       Pika  aatagc-tcccaagagctg-tgttac--actagccttgtcgcctctgccccaagtatcgccactgaagtc
                        Pig  aatagc-ccc-gacatccg-catt----accagctttgtctcag-ggccgcattgataatcatt-aattc
                     Alpaca  aatagc-ccc-gacatcct-tgtt----accagccttgtcaagc-tacctcgaggatagtcaca-aattc
             Bactrian camel  aatagc-cccggacatcct-tgtt----accagccttgtcaagc-tacctcgaggatagtcaca-aattc
                    Dolphin  aatagc-ccc-aacttccg-tgtt----accagccttgtctcgg-tgcctcattgataatcacc-aattc
               Killer whale  aatagc-ccc-aacttccg-tgtt----accagccttgtctcgg-cacctcattgataatcacc-aattc
           Tibetan antelope  aatagc-cct-gacatccg-tgtt----accagtcttgtcttgg-cgcttcattgataatcacc-aattc
                        Cow  aatagc-cct-gacatctg-tgtt----accagtcttgttttgg-cgcttcattgataatcacc-aattc
                      Sheep  aatagc-tct-gacatccg-tgtt----accagtcttgtcttgg-ggcttcattgataatcacc-aattc
              Domestic goat  aatagc-cct-gacatccg-tgtt----accagtcttgtcttgg-cgcttcattgataatcacc-aattc
                      Horse  aatagc-cccagacatccg-tgtt----accagccttgtcgcagccaacgcaagaataatcacc-acttc
           White rhinoceros  aatagc-cctggacatccg-tgtt----accagccttgtcgcagccacctcaagagtaatcacc-aattc
                        Cat  aatagc-cccggacatccg-tgtt----accagccttgccgtggccatttcaagtataatcacc-aatcc
                        Dog  aatagc-ccctgacatccg-tgtt----accagccttattgtgacctcctcaagaataatcacc-aagcc
                    Ferret   aatagc-cccggacatccg-tgtt----accagcctcattgtgaccacctcaaggataatcact-gatcc
                      Panda  aatagc-cccggacatccg-tgtt----accagcctcgttgtgaccacctcaaggataatcacc-gatcc
             Pacific walrus  aatagc-cccggacatccg-tgtt----accagccttgttgtgaccacctcaaagataatcacc-gatct
               Weddell seal  aatagc-cccggacatccg-tgtt----accagtcttgttgtgaccatctcaaggataatcact-gatct
           Black flying-fox  aatagt-ttc-aacatccg-tgtt----accagccttctcacggccacctataggataatcatc-aattc
                    Megabat  aatagt-ttc-aacatccg-tgtt----accagccttctcacggccacctataggataatcatc-aattc
              Big brown bat  aatagc-cccggacatcct-tgtc----accagcctggtcgcagccacctcaaggacaaccatc-gatcc
       David's myotis (bat)  gatagc-cccgggcaccct-tgtcgccaaccagccttgtcgcaa-cgcctccaggacaatcatc-aaatc
                   Microbat  gatagc-cccggacatcct-tgtc----accagccttgtcccag-cgcctccaggacaatcatc-aaatc
                   Hedgehog  aatagc-ttg-gacatctg-tgtt----actaacctt-ttgtaa-cccttcaaggataatcgtc-aattc
                      Shrew  aatagcacca-gacatccg-tgtt----accagccttgtcgtgg-cccttcagggataatttga-acttt
            Star-nosed mole  aatagc-ccc-gatagctc-tgtc----accagccttgccttgg-ctcctcgaggataatcacc-aattc
                   Elephant  aatagc-cccgggcattag-tgtt----agcagtcttgtcgcagccatctcaaggataatcactgaattc
        Cape elephant shrew  aa-agc-cccggacgtccg-tgtt----agcagccttgttgcagtcacctcaaggataactgccaaattc
                    Manatee  aatagc-cccggacatccg-tgtt----agcagtcttgtcgcagcaacctcaagggcaatcaccaaattc
           Cape golden mole  aatagc-cctagacattca-tgtt----agcagatttgttgagaccacctcaaggataatcactaaattc
                     Tenrec  aatagc-tcaggacatccg-cgtc----agcagccttgttgcggccagctcaaggacagttagccaattc
                   Aardvark  aatagc-cctggacatccg-tgtt----agcagccttgttgcagccatcaccaggataatcaccaaattc
                  Armadillo  aataac-cccagacatctgttgtc----accagctttgtcacagccacctcaaggata-tcacaaaattc
            Tasmanian devil  ======================================================================

                      Human  tgccgaaaggactgaggaa----cggtg--cctgg-aaaaggtaaggttg-atgacg-tt------t--t
                      Chimp  tgtctaaaggactgaggaa----cggtg--cctgg-aaaaggtaaggttg-atgacg-tt------t--t
                    Gorilla  tgcctaaaggactgaggaa----cggtg--cctgg-aaaaggtaaggttg-atgacg-tt------t--t
                  Orangutan  tgcctaaaggactgaggaa----cggtg--cctgg-aaaaggtaaggttg-atgaca-tt------t--t
                     Gibbon  tgcctaaaggactgaggaa----cggtg--cctga-aaaaggtaaggttg-atgaca-tt------t--t
                     Rhesus  tgcctaaaggactgaggaa----cggtg--tctgg-aaaaggtaaggttg-atgaca-tt------t--t
        Crab-eating macaque  tgcctaaaggactgaggaa----cggtg--tctgg-aaaaggtaaggttg-atgaca-tt------t--t
                     Baboon  tgcctaaaggactgaggaa----cggtg--tctgg-aaaaggtaaggttg-atgaca-tt------t--t
               Green monkey  tgcctaaaggactgaggaa----cggtg--tctgg-aaaaggtaaggttg-atgaca-tt------t--t
                   Marmoset  tgcctaaaggactgaggaa----cggtg--cctgg-aacaggtaaggttg-atgaca-ct------t--t
            Squirrel monkey  tgcctaacggactgaggaa----cggtg--cctgg-aaaaggtaagcttg-atgaca-tt------t--t
                   Bushbaby  tgcctgaaggactga---------------------aaaaggtaagactc-aagac---t------t--t
         Chinese tree shrew  tgtctaaaggactgaaaag----cggag--cctga-aaaaggtaagatga-atggca-tt------t--t
                   Squirrel  gccctaaaggactgaggca----cgacggagcttg-tcaaggtaagactg-acgact-tt------t--t
     Lesser Egyptian jerboa  tgcctaagggactgaagga----cagtg--cctaa-aacaggtaagttta-a-tgtt-tt------tctt
               Prairie vole  tacctgaagtgctgaggga----cactg--cctac-aaaaggtaagactt-acagct-tt------t---
            Chinese hamster  tacctgaagtactgaggga----cactg--cctac-aaaaggtaagactt-a-tgct-tt------t---
             Golden hamster  tacctgaagtactgaggga----cactg--cctac-aaaaggtaagactt-a-agat-tt------t---
                      Mouse  tacctgaagtactgaggga----cactg--ccttc-aaaaggtaagattt-atgact-tt------t---
                        Rat  tacctgaagtactgaggga----cactg--ccttc-taaaggtaagccttgatgact-tt------t---
             Naked mole-rat  tgcctgaaggactgagaca----aggtg--cctgt-aaaaggtaagattg-atgatt-tt------t--t
                 Guinea pig  tgcctgacggactgaggca----aggtg--cctgt-gaaaggtaagac---atgatt-tt------t--t
                 Chinchilla  tgcttgaaggactgaggca----aggtg--cctgt-gaaaggtaagactg-atgact-tt------t--t
           Brush-tailed rat  tgcctgaaggactgaggca----aggtg--cgtga-gaaaggtaagactg-attact-tt------t--c
                     Rabbit  tgcctaaaggattgaggag----cagtg--cctga-ataaggtaagactg-atgaca---------t--t
                       Pika  ggcctataagattaaggag----tggta--cctag-aaaaggtaagattg-actatg-tt------t--t
                        Pig  tgcctaaaggaccgaggaa----aagtg--cctgc-aaaaggtaaga-tg-ggaaca-tt------g--t
                     Alpaca  tatctgaaggactgaggaa----aagag--tctgc-caaaggtaagattg-gtgaca-tt------t--t
             Bactrian camel  tatctgaaggactgaggaa----aagtg--tctgc-caaaggtaagattg-gtgaca-tt------t--t
                    Dolphin  tgcctaaaggactgaggaa----aagag--cctgc-aaaaggtaagattg-gtgata-tt------t--t
               Killer whale  tgcctaaaggactgaggaa----aagag--cctgc-aaaaggtaagattg-gtgata-tt------t--t
           Tibetan antelope  tgtctaaaggagaaacgaa----aagtg--cctgcttaacggtaagattg-gtgaca-tt------t--t
                        Cow  tgtctaaaggtgagaggaa----aagtg--cctgcttaaaggtaagattg-gtgaca-tt------t--t
                      Sheep  tgtctaaaggagagacgaa----aagtg--cctgcttaacggtaagattg-gtgaca-tt------t--t
              Domestic goat  tgtctaaaggagagacgaa----aagtg--cctgcttaacggtaagattg-gtgaca-tt------t--t
                      Horse  tgtctaaacgactgaggag----aagtg--cttgc-aaaaggtaagactg-gtgaca-tt------t--t
           White rhinoceros  tgcctaagggactgaggag----acgtg--cctgc-aaaaggtaagactg-gtgacattt------t--t
                        Cat  tgcctgaagaactgagcga----aagtg--cctgc-aaaaggtaagattg-gtgata-tt------t--t
                        Dog  tgcctaaggaactgaagaa----aagtg--cctgc-aaaaggtaagattg-gtgaca-tt------t--t
                    Ferret   tgcctaaaagactaaggaagagtgagtg--cctgc-aaaaggtaagttgg-gtaaca-tt------t--t
                      Panda  tgcctaaaggactgaggaa----gagtg--cctgc-gaaaggtaagcgtg-gtgata-tt------t--t
             Pacific walrus  tgcctaaaggactgaggaa----gagtg--cctgc-gaaaggtaagcttg-gtgaca-tt------t--t
               Weddell seal  tgcctaaagaactgaggaa----gagtg--cctgc-gaaaggtaagcttg-gtgaca-tt------t--t
           Black flying-fox  tacctaaaggactgaagaa----aattg--cctgc-aaaaggtaagaccg-atgaca-tt------t--t
                    Megabat  cacctaaaggactgaagaa----aattg--cctgc-aaaaggtaagacca-atgaca-tt------t--t
              Big brown bat  tgcctgagggacggaggaa----cagca--cctgc-aggaggtaagagtg-gggaca-ct------g--c
       David's myotis (bat)  tgcttaggggactgaggag----cagca--cccac-agaaggtaagactg-gggaca-ct------g--c
                   Microbat  tgcctcggggactgaggaa----cagca--cccgc-agaaggtaagacgg-gggaca-ct------g--c
                   Hedgehog  tgcctggaagactgaagaa----aagca--cctga-gataagtaaggtag-gtgata-tt------t--t
                      Shrew  cgcctaaaagactgaggag----tagtg--actgc-aaaaggtaagatcc-acgaca-ct------t--t
            Star-nosed mole  tgcctaaaggactgaggaa----aagtg--cctcc-aaaaggtaaggtcg-atgact-tttggtcgt--t
                   Elephant  tgcctaaaagacttaagga----aagtg--cctgc-aaaaggtaaggctg-atggca-tt------t--t
        Cape elephant shrew  tgttcaaaggacttaacac----aggtg--cctaa-aaaaggtaagactg-atgaca-tt------t--t
                    Manatee  tgcctaaaggacttaagaa----aggtg--cctgc-aaaaggtaagagtg-atggca-tt------t--t
           Cape golden mole  tgcctcaagaacttcagaa----cactg--tctg--aaaaggtaagtttg-atagaa-tt------t--t
                     Tenrec  tgcctaaagaacctaagaa----aggcg--ccc-----aaggtaagtttg-atggca-tt------t--t
                   Aardvark  tgcctaaaggacttaaagg----tggta--ccttc-taaaggtaagaatg-atggca-tt------t--t
                  Armadillo  tgcctttaggacttgggag----cagtg--cctgc-aaaaggtaagactg-atggtg-tt------t--t
            Tasmanian devil  ======================================================================

                      Human  aactt-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                      Chimp  aactt-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                    Gorilla  aactt-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                  Orangutan  aactt-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                     Gibbon  aactt-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                     Rhesus  aacct-ggt--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
        Crab-eating macaque  aacct-ggt--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                     Baboon  aacct-ggt--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
               Green monkey  aacct-ggt--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                   Marmoset  tacct-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
            Squirrel monkey  aacct-ggc--ttg-----------------ctgtctaatgt-gg-------------------gg-t--
                   Bushbaby  aaccc-agc--ttg-----------------ccatcttatgt-gg-------------------gc-t--
         Chinese tree shrew  aacct-gac--ttgagagcaaag-ctctgaaccaatttgcgt-gg-------------------gg-g--
                   Squirrel  agccc-agt--ttgagagcaaag-ctctgaaccattttatgc-cg-------------------gg-tca
     Lesser Egyptian jerboa  tcttt-ttt--ttttttaagtatgatttgaaccaattaatgt-ca-------------------gg-t--
               Prairie vole  ------------------aacat-ctccgaacaagctcatgtggg-------------------gg-c--
            Chinese hamster  ------------------aacat-ctctgaaccagctaatgt-gg-------------------gg-c--
             Golden hamster  ------------------aacat-ctctgaaacagctaatgt-gg-------------------gg-c--
                      Mouse  ------------------aacag-ctctaaatcagctaataa-gg-------------------ca-c--
                        Rat  ------------------aacag-ccctgaaccagctaatgc-ag-------------------ca-c--
             Naked mole-rat  aacct-tgt--ttgagtgtaaag-ctctgaacgactctatgt-ag-------------------gc-t--
                 Guinea pig  aatct-tgt--ttgagtgcaaag-ctctggataattctgtgt-aa-------------------gg-t--
                 Chinchilla  aacct-tgt--ttgagtgtaaag-ctctaaacaattctatgt-ag-------------------gg-t--
           Brush-tailed rat  aacct-tgt--ttgagtgtaaat-ctctgaccaattctgtgt-ag-------------------tg-t--
                     Rabbit  gaact-ggt--tcaaaagcagag-ctctggatcattttgtgt-ag-------------------gg-g--
                       Pika  tgcct-ggc--tcaaaagcaaag-atctgaaccatgttgtgt-ag-------------------aa-c--
                        Pig  aatct-ggt--ttgagagcaaag-acctgagccatattacgt-gg-------------------gc-t--
                     Alpaca  aatct-ggt--ttgagaacaaag-acttgaactgtattatgt-gg-------------------gc-t--
             Bactrian camel  aatct-ggt--ttgagaacaaag-acttgaactgtattatgt-gg-------------------gc-t--
                    Dolphin  aacct-tgt--ttgagagcagag-acctgaaccatattatgt-gg-------------------gc-t--
               Killer whale  aacct-tgt--ttgagagcagag-acctgaaccatattatgt-gg-------------------gc-t--
           Tibetan antelope  aattt-ggc--ttgaaagcaaag-aactgaaccatattatgt-ag-------------------gg-t--
                        Cow  aattt-ggc--ttgaaagcagag-aactgaaccatattatgt-gg-------------------gc-t--
                      Sheep  aattt-ggc--ttgaaagcagag-aactgaaccatattatgt-gg-------------------gg-t--
              Domestic goat  aattt-ggc--ttgaaagcagag-aactgaaccatattatgt-gg-------------------gg-t--
                      Horse  aatct-gct--ttgagagcgaag-acccgaaccatattatgt-gg-------------------ga-t--
           White rhinoceros  aatct-g-t--ttgagagcaaag-acctgagtgatattatgt-gg-------------------ga-t--
                        Cat  cattg-gac--ttgagagcaaag-acctgaaccatattgtgt-gg-------------------ga-t--
                        Dog  aatct-ggc--ttgagagcaaag-acctgaaccatattatgt-aa-------------------ga-t--
                    Ferret   gatct-ggc--ttga----taag-acctgaactgtattatgt-gg-------------------ga-t--
                      Panda  aatct-ggc--ttga----caag-acctgaaccatattacgt-gg-------------------ga-t--
             Pacific walrus  aatct-ggc--ttga----caag-accggaatcatattatgt-gg-------------------ga-t--
               Weddell seal  aatct-ggc--ttga----caag-acctgaaccatattatgt-gg-------------------ga-t--
           Black flying-fox  aatct-gat--ttgacagcagag-acctaaactatataacgt-gg-------------------gg----
                    Megabat  aatct-gat--ttaacagcagag-acctaaactatataacgt-gg-------------------gg----
              Big brown bat  aggctgggc--ttgagcgcagag-gcctgggccaggtcacat-gg-------------------gg-t--
       David's myotis (bat)  agtctgggc--ttgagagcagag-acctgagccaggtaacat-gg-------------------gg-g--
                   Microbat  agtctgggc--ttgagagcagag-acctgagccaggtaacat-gg-------------------gg-g--
                   Hedgehog  attct-aat--cttagagtagga-aggccaactatcttttgt-ga-------------------ag-c--
                      Shrew  attat-gat--ttgagagcaaaa-acatgaaccattaagtgt-ga-------------------ga-t--
            Star-nosed mole  gttat-tattattgagagcagag-actggagccatt--ttac-cg-------------------ac-t--
                   Elephant  aatct-ggt--tggagaatgaag-ccccaagccattttacgt-gg-------------------gg----
        Cape elephant shrew  gatct-ggt--ttgtgaaggaaa-tcctgactcatttcactt-gg-------------------ggta--
                    Manatee  aatct-ggt--ttgagagtgaag-ccccgagccgttttgtgt-gg-------------------gg-t--
           Cape golden mole  aagct-ggt--ttgagagcgaag-ccctgaaccattttatgg-ggaggtggggaggggggggtagg-a--
                     Tenrec  gatct-ggt--ttaagagtgaag--------ccattgtacgt-gg-------------------gg-t--
                   Aardvark  aatgt-agt--ttgggaacgaag-ccctgagacattttatgt-gg-------------------tg-t--
                  Armadillo  aattt-ggt--ttgaa---------------ctatttcatgt-gg-------------------ta----
            Tasmanian devil  ======================================================================

                      Human  --agggcgta--ttcttagggg--tctcc-ata-tac--ctctcta
                      Chimp  --agggcgta--ttcttagggg--tctcc-ata-tac--ctctcta
                    Gorilla  --agggcgta--ttcttagggg--tctcc-ata-tac--ctctcta
                  Orangutan  --agggcgta--ttcttagggg--tctcc-ata-tac--ctttcta
                     Gibbon  --agggcgta--ttcttagggg--tctcc-ata-tac--ctctcta
                     Rhesus  --agggcgta--ttcttagggg--tctcc-ata-tac--ctcgtta
        Crab-eating macaque  --agggcgta--ttcttagggg--tctcc-ata-tac--ctcgtta
                     Baboon  --agggcgta--ttcttagggg--tctcc-aca-tac--ctcgtta
               Green monkey  --agggtgta--ttcttagggg--tctcc-ata-tac--ctcgtta
                   Marmoset  --aggacatt--ttcttagtgg--tctccgaca-tgc--ctctcta
            Squirrel monkey  --aggacatt--ttcttagggg--gctccaata-tac--ctctcta
                   Bushbaby  --aggggata--ccttcacgga--agtct-cct-taa--ctcccta
         Chinese tree shrew  --aaagtatc--ttcttaggagtctctcc-aca-tac--caaccta
                   Squirrel  gga---tatc--accttaggag--tctcc-acattac--ctctcta
     Lesser Egyptian jerboa  --a---gggc--a-tttaggag--tctcc-ata-tac--tgctcta
               Prairie vole  --a---catc--actttaagag--tcccc-att-cat--ctctcta
            Chinese hamster  --a---cagc--attttaagtg--acccc-ata-cat--ttcacta
             Golden hamster  --a---cagc--atcttaagag--ttctc-ata-cag--ctctcta
                      Mouse  --a---tagc--attttgagag--tctcc-aca-cat--cccttta
                        Rat  --a---cagc--attttaaga---tcttc-aca-tat--cccttta
             Naked mole-rat  --aaggcatc--ttcttaggag--tttcc-ata-tac--ctctcta
                 Guinea pig  --a-ggtagc--tttttaggag--tct-c-ata-tat--ctttcta
                 Chinchilla  --agggtagc--tttttaggag--acccc-ata-tac--cactcta
           Brush-tailed rat  --agggtagc--tttttaggag--tctcc-acg-tgt--tccacta
                     Rabbit  --agggtgtc--tgtctacgag--tctc---ta-cat--ccttgta
                       Pika  --agggtgta--gtttttagaa--tctt---ta-cag--cctctta
                        Pig  --aggctctc--ttcctaggag--tctcc-ata-gac--ctctcta
                     Alpaca  ------------------ggag--tctct-gca-tac----ctcta
             Bactrian camel  ------------------ggag--tctct-gta-tac----ctcta
                    Dolphin  --agggtatc--ttctcaggag--tctct-ata-tac--ctctcta
               Killer whale  --agggtatc--ttctcaggag--tctct-ata-tac--ctctcta
           Tibetan antelope  --aaggtatc--ttcttaggag--tctct-gtt-tat--ctctcta
                        Cow  --aaggtatc--ttcttaggag--tctct-gtg-tat--ctctcta
                      Sheep  --aaggtatc--ttcttagaag--tctct-gtt-tat--ctctcta
              Domestic goat  --aaggtatc--ttcttaggag--tctct-gtt-tat--ctctcta
                      Horse  --agagtatc--ttcttaggag--gctct-gta-gacttctctcta
           White rhinoceros  --agagtatc--ttcttaggaa--tctcc-ata-gactcctctcta
                        Cat  --agggtatc--ttcttaggag--tctcc-gta-gat--ctctcta
                        Dog  --agagtatt-----ttaggat--tgtct-gca-tac--ctctt-a
                    Ferret   --gggctgtc-----ttaggat--tgtct-ata-tgc--ctcttca
                      Panda  --agggtttc------taggat--tgtcc-ata-cac--ctcttca
             Pacific walrus  --aggatgtc-----ttaggat--tgtcc-gta-cac--ctcttca
               Weddell seal  --agggtgtc-----ttaggat--tgtcc-gta-cac--ctcttca
           Black flying-fox  --aaggtatc--tgcttaggag--tttcc-aga-tac--ttcacta
                    Megabat  --aaggtatc--tgcttaggag--tttcc-aga-tac--ttca---
              Big brown bat  --aaggtatc--ttctcaggag--cctcc-agg-cgc--cactcta
       David's myotis (bat)  --aaggtgtc--ttctcaggag--ccgcc-agg-cac--cgctcta
                   Microbat  --aaggtgtc--ttctcaggag--ccgcc-agg-cac--tgctcta
                   Hedgehog  --cacgaatc--ttcttaggat--tctcc-ttg-tag--ttttcta
                      Shrew  --aaggtgtt-----ttaggcg--tctcc-aaa-t--------cta
            Star-nosed mole  --atggtgtttgttcttcagag--tctcc-gtt-tg-----cctca
                   Elephant  -------------ttctgggag--tctcc-ata-cac--ctctgtg
        Cape elephant shrew  --gggttctc--ttcttgagag--tctcc-ata-ccc--ctttata
                    Manatee  --aggttgtc--ttcttgggca--tctcc-ata-cac--ctttata
           Cape golden mole  --agtgtatc--ttcttaggag--tttcc-aca-cat--ctctatc
                     Tenrec  --agcgtgtc--ttcttggatg--tcacc-ata-tgc--ctct---
                   Aardvark  --agagtatc--ttcttgggag--tctcc-ata-ccc--ctctata
                  Armadillo  --------tc--ttctcaggag--tctcc-ata--gc--ctctaga
            Tasmanian devil  ==============================================

Inserts between block 1 and 2 in window
       Cape elephant shrew 979bp
          Cape golden mole 5bp
B D                 Tenrec 4bp
                  Aardvark 2bp

Alignment block 2 of 965 in window, 110873331 - 110873345, 15 bps 
B D                   Human  gta-accat-aaaatct
B D                   Chimp  gta-accaa-aaaatct
B D                 Gorilla  gta-accat-aaaatct
B D               Orangutan  gta-accat-aaaatct
B D                  Gibbon  gta-accat-aaaatct
B D                  Rhesus  gta-accat-aaaatct
B D     Crab-eating macaque  gta-accat-aaaatct
B D                  Baboon  gta-accat-aaaatct
B D            Green monkey  gta-accat-aaaatct
B D                Marmoset  gta-accat-acaatct
B D         Squirrel monkey  gga-accat-acaatct
B D                Bushbaby  gta-catgt-aaaattt
         Chinese tree shrew  gta--cttt-aaaatct
B D                Squirrel  cta-acttt-aaaatgt
     Lesser Egyptian jerboa  gta-acatt-aaggtct
               Prairie vole  gta-acttt-aaaatat
B D         Chinese hamster  gta-acttt-aaaattt
             Golden hamster  gta-acttt-aaaattt
B D                   Mouse  gta-acttt-aaaatgt
B D                     Rat  gta-acttt-aaaatat
B D          Naked mole-rat  gtg-acatt-ataatct
B D              Guinea pig  gta--------------
                 Chinchilla  gta-acttt-aaaacct
           Brush-tailed rat  gta-actgt-aaaatct
B D                  Rabbit  cta-actct-gaaatcc
B D                    Pika  gtg-acttt-aaaaccc
B D                     Pig  gta-acttg-gaagtct
B D                  Alpaca  gta-actct-aaaatct
             Bactrian camel  gta-actct-aaaatct
B D                 Dolphin  gta-actac-aa--ttt
               Killer whale  gta-actac-aa--ttt
           Tibetan antelope  gtagactgt-aaacttt
B D                     Cow  gtagactgt-aaacttt
B D                   Sheep  gtagactgt-aaacttt
              Domestic goat  gtagactgt-aaacttt
B D                   Horse  gca-accct-aaaatgt
B D        White rhinoceros  gta-acact-gaaagct
B D                     Cat  gta-agcct-aaaacct
B D                     Dog  gta-ggcct-aaaatct
B D                 Ferret   gta-agtcc-aaaatct
B D                   Panda  gta-agcct-aaaatct
             Pacific walrus  gta-agtct-aaaatct
               Weddell seal  gta-agtct-aaaatct
           Black flying-fox  gtg-acctt-aaaatct
B D                 Megabat  ------ctt-aaaatct
              Big brown bat  gtc-accct-acaat--
       David's myotis (bat)  gtc-accct-acaatcg
B D                Microbat  gtc-accct-acaatca
B D                Hedgehog  gta-gccctaaaaat--
B D                   Shrew  gca-acgctaaaaatct
            Star-nosed mole  tta-accct-aagatct
B D                Elephant  gga-accct-aaacttt
B D                 Manatee  gga-accct-aaaattt
           Cape golden mole  caa-aacc---aaacct
B D                  Tenrec  gga-cgcc---aagttc
                   Aardvark  aga-aacc---aaaccc
B D               Armadillo  gta-accct-aaaatct
B D         Tasmanian devil  =================
       Cape elephant shrew  =================

Inserts between block 2 and 3 in window
          Brush-tailed rat 115bp
B D               Microbat 2bp

Alignment block 3 of 965 in window, 110873346 - 110873353, 8 bps 
B D                   Human  ccggcaac
B D                   Chimp  ccggcaac
B D                 Gorilla  ccggcaac
B D               Orangutan  ccggcaat
B D                  Gibbon  ccggcaac
B D                  Rhesus  cctgcaac
B D     Crab-eating macaque  cctgcaac
B D                  Baboon  cctgcaac
B D            Green monkey  cctgcaac
B D                Marmoset  ccggcaac
B D         Squirrel monkey  ccggcaac
B D                Bushbaby  cctgca--
         Chinese tree shrew  cttacgac
B D              Guinea pig  -------c
           Brush-tailed rat  -------c
B D                  Rabbit  ---acaac
B D                    Pika  ---a-gag
B D                     Pig  ccagaaac
B D                  Alpaca  tttgtaac
             Bactrian camel  tttgtaac
B D                 Dolphin  cctgaaac
               Killer whale  cctgaaac
           Tibetan antelope  cttgaagc
B D                     Cow  cctgaagc
B D                   Sheep  cttgaagc
              Domestic goat  cttgaagc
B D                   Horse  cctactat
B D        White rhinoceros  cctgcaac
B D                     Cat  cctgcaac
B D                     Dog  cctgcaac
B D                 Ferret   cctggaac
B D                   Panda  cctgcaac
             Pacific walrus  cc-gcaac
               Weddell seal  cctgcaac
           Black flying-fox  tctg---c
B D                 Megabat  tctg---c
              Big brown bat  -------c
       David's myotis (bat)  cctg---c
B D                Microbat  atgg---c
B D                Hedgehog  -ttgtact
B D                   Shrew  cttttaac
            Star-nosed mole  accgtgac
B D                Elephant  ccttcaa-
B D                 Manatee  ccttcaa-
           Cape golden mole  actgccac
B D                  Tenrec  ccttcagc
                   Aardvark  tctgc---
B D               Armadillo  cctgcaac
B D                     Rat  --------
              Prairie vole  --------
            Golden hamster  --------
B D                   Mouse  --------
    Lesser Egyptian jerboa  --------
B D         Tasmanian devil  ========
B D          Naked mole-rat  --------
                Chinchilla  --------
       Cape elephant shrew  ========
B D         Chinese hamster  --------
B D                Squirrel  --------

Inserts between block 3 and 4 in window
          Cape golden mole 769bp

Alignment block 4 of 965 in window, 110873354 - 110873367, 14 bps 
B D                   Human  t------------------------------tctct-ttcacaaa
B D                   Chimp  t------------------------------tctct-ttcacaaa
B D                 Gorilla  t------------------------------tctct-ttcacaaa
B D               Orangutan  t------------------------------tctct-ttcacaaa
B D                  Gibbon  t------------------------------tctct-ttcacaaa
B D                  Rhesus  t------------------------------tctct-ttcgcaaa
B D     Crab-eating macaque  t------------------------------tctct-ttcgcaaa
B D                  Baboon  t------------------------------tctct-ttcgcaaa
B D            Green monkey  t------------------------------tctct-ttcgcaaa
B D                Marmoset  t------------------------------tctct-ttcacaaa
B D         Squirrel monkey  t------------------------------tccct-ttcacaaa
B D                Bushbaby  --------------------------------ttgt-ttcacaag
         Chinese tree shrew  t------------------------------tctgt-ttcacaag
B D                Squirrel  -------------------------------ctggt-ttcacaga
     Lesser Egyptian jerboa  -------------------------------tcagt-tacacaaa
               Prairie vole  -------------------------------ctgat-ttcacaga
B D         Chinese hamster  -------------------------------ctgat-ttcacaaa
             Golden hamster  -------------------------------cttac-ttcacaaa
B D                   Mouse  -------------------------------gatgtgtttacaaa
B D                     Rat  -------------------------------gtggtgtttacaaa
B D          Naked mole-rat  ---------------------------------cat-ttcacaac
B D              Guinea pig  agtct--------------------------tttgt-ttcacaac
                 Chinchilla  -------------------------------cttat-ttcacaac
           Brush-tailed rat  tggctcattgctatctgtgtctcaaaaatcctttgt-ttcataac
B D                  Rabbit  t------------------------------cttgt-ttcacaaa
B D                    Pika  t------------------------------tttgt-ttcacaaa
B D                     Pig  t------------------------------tctgt-tttgctaa
B D                  Alpaca  t------------------------------tctgt-ttcgtaaa
             Bactrian camel  t------------------------------tctgt-ttcgtaaa
B D                 Dolphin  -----------------------------------t-tttgcaaa
               Killer whale  -----------------------------------t-tttgcaaa
           Tibetan antelope  -----------------------------------t-tttgcaaa
B D                     Cow  -----------------------------------t-tttgcaaa
B D                   Sheep  -----------------------------------t-tttgcaaa
              Domestic goat  -----------------------------------t-tttgcaaa
B D                   Horse  g------------------------------cctgt-ttcgcaaa
B D        White rhinoceros  t------------------------------tctgt-ttcatgaa
B D                     Cat  t------------------------------tctat-ttcacaga
B D                     Dog  t------------------------------tctat-ttttcaaa
B D                 Ferret   t------------------------------tctat-ttcacaaa
B D                   Panda  t------------------------------tccat-ttcacaaa
             Pacific walrus  t------------------------------gctat-ttcacaaa
               Weddell seal  t------------------------------gctat-ttcacaaa
           Black flying-fox  t------------------------------gctct-ttcacaaa
B D                 Megabat  t------------------------------tctct-ttcacaaa
              Big brown bat  t------------------------------tctgt-ttcgcgaa
       David's myotis (bat)  t------------------------------tctgt-ttcacgaa
B D                Microbat  t------------------------------ccata-ttcacttc
B D                Hedgehog  t------------------------------tctgt-ttcacaaa
B D                   Shrew  t------------------------------tctgt-ttcacaaa
            Star-nosed mole  t------------------------------tctgc-ttcaaaaa
B D                Elephant  t------------------------------tctgt-tttacaaa
B D                 Manatee  t------------------------------ttcgt-ttcacaga
B D                  Tenrec  ---------------------------------ttg-ttcacgta
                   Aardvark  -------------------------------tctct-cttacaga
B D               Armadillo  t------------------------------tctgt-ttcacaaa
          Cape golden mole  =============================================
B D         Tasmanian devil  =============================================
       Cape elephant shrew  =============================================

Inserts between block 4 and 5 in window
                  Aardvark 787bp
B D              Armadillo 2bp

Alignment block 5 of 965 in window, 110873368 - 110873402, 35 bps 
B D                   Human  t-atttagt--------------------------------gcac---aaa-gt----aaaacag-----
B D                   Chimp  t-atttagt--------------------------------gcac---aaa-gt----aaaacag-----
B D                 Gorilla  t-atttagt--------------------------------gtac---aaa-gt----gaaaaag-----
B D               Orangutan  t-atttagt--------------------------------gcac---aaa-gt----aaaaagg-----
B D                  Gibbon  t-atttagt--------------------------------gcac---aaa-gt----aaaaaag-----
B D                  Rhesus  t-attaagt--------------------------------gcac---aaa-gt----aagacag-----
B D     Crab-eating macaque  t-attaagt--------------------------------gcac---aaa-gt----aagacag-----
B D                  Baboon  t-atttagt--------------------------------gcac---aaa-gt----aagacag-----
B D            Green monkey  t-atttagt--------------------------------gcac---aaa-gt----aagacag-----
B D                Marmoset  t-atttagt--------------------------------gcac---aaa-gt--------aag-----
B D         Squirrel monkey  taacttagt--------------------------------gcac---aaa-gt----aa-aaag-----
B D                Bushbaby  t-----ggt--------------------------------gaag---gaa-gttaaaaaaacaa-----
         Chinese tree shrew  t-atttagt--------------------------------gcag---gaa-gt----agaaaag-----
B D                Squirrel  t-gtttagt--------------------------------actg---aaa-gt----aaagaaaaaaga
     Lesser Egyptian jerboa  t-atttag--------------------------------------------------------------
               Prairie vole  t-agttag--------------------------------------------------------------
B D         Chinese hamster  t-atttag--------------------------------------------------------------
             Golden hamster  t-atttag--------------------------------------------------------------
B D                   Mouse  t-atttag--------------------------------------------------------------
B D                     Rat  t-atttag--------------------------------------------------------------
B D          Naked mole-rat  t-atttagg--------------------------------gctg---caa-gt----aaaaaag-----
B D              Guinea pig  t-atttagt--------------------------------gctg---caa-gt----agaaaag-----
                 Chinchilla  t-atctagt--------------------------------gctg---caa-gt----aaaaaag-----
           Brush-tailed rat  t-atttagt--------------------------------actg---caa-gt----aaaaata-----
B D                  Rabbit  t-actgagg--------------------------------gcaggaagaa-gt----agagaca-----
B D                    Pika  t-acttagc--------------------------------gcaggaagaa-gt----agagaca-----
B D                     Pig  t-ttttact--------------------------------acag---ata-gt-----caaatt-----
B D                  Alpaca  t-atatacc--------------------------------gcag---gaa-gt-----aaaatg-----
             Bactrian camel  t-atatact--------------------------------gcag---gaa-gt-----aaaatg-----
B D                 Dolphin  t-atttact--------------------------------gcag---gta-gt-----aaaatt-----
               Killer whale  t-atttact--------------------------------gcag---gta-gt-----aaaatt-----
           Tibetan antelope  t-gtttagt--------------------------------gcag---gta-gt-----aaaatt-----
B D                     Cow  t-gtttact--------------------------------gcag---gta-gt-----aaaatt-----
B D                   Sheep  t-gtttagt--------------------------------gcag---gta-gt-----aaaatt-----
              Domestic goat  t-gtttagt--------------------------------gcag---gta-gt-----aaaatt-----
B D                   Horse  t-ctttagt--------------------------------gtag---gaa-gt-----aaaaag-----
B D        White rhinoceros  t-atttagt--------------------------------gcag---gaa-gt-----aaaaag-----
B D                     Cat  t-atttagt--------------------------------gcat---gaaggt-----agaaag-----
B D                     Dog  t-atttaat--------------------------------gcag---gaaaat-----aaaaag-----
B D                 Ferret   t-atttagt--------------------------------gcag---gaaagt-----caaaag-----
B D                   Panda  t-atttagt--------------------------------gcag---gaaatt-----aaaaag-----
             Pacific walrus  t-atttagt--------------------------------gcag---gaagat-----aaaaag-----
               Weddell seal  t-atttagt--------------------------------gcag---gaaagt-----aaaaag-----
           Black flying-fox  --gat--at--------------------------------gtag---gaa-gt-----aaaagg-----
B D                 Megabat  --gat--gt--------------------------------gtag---gaa-gt-----aaaagg-----
              Big brown bat  t-att--gc--------------------------------acag---gaa-gt-----agaaag-----
       David's myotis (bat)  t-gtt--gt--------------------------------acag---gaa-gc-----agaaag-----
B D                Microbat  tagtc--ac--------------------------------ccta---caa-gc-----agaaag-----
B D                Hedgehog  t-acttagt--------------------------------gaag---gaa-gt-----aaaatg-----
B D                   Shrew  t-tgttagtaaggaagtaaagtta-----------------tcgg---gaa-gt-----aaaaag-----
            Star-nosed mole  t-atttatt--------------------------------ccag---gaa-gt-----aaaaag-----
B D                Elephant  t-atttagtgtaaagtaaagtaaaaagtaagtaagtaagtaaaag---gaa-gt----aaaaaag-----
B D                 Manatee  t-at-------------------------------------acag---gaa-gt-----aaaaag-----
B D                  Tenrec  c-gtctgct--------------------------------gtaa---gaa-gt-----aaaatg-----
B D               Armadillo  t-gt-------------------------------------gcaa---gaa-gt-----aaaatg-----
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D         Tasmanian devil  ======================================================================
       Cape elephant shrew  ======================================================================

                      Human  -------------attagcaagat
                      Chimp  -------------attagcaagat
                    Gorilla  -------------attagcaagat
                  Orangutan  -------------attagcaagat
                     Gibbon  -------------attagcgagat
                     Rhesus  -------------attagcaagat
        Crab-eating macaque  -------------attagcaagat
                     Baboon  -------------attagcaagat
               Green monkey  -------------attaacaagat
                   Marmoset  -------------attggcaagat
            Squirrel monkey  -------------attggcaagat
                   Bushbaby  -------------atcagcaagat
         Chinese tree shrew  -------------atcagcaatat
                   Squirrel  agggtaatatcttagtagca----
     Lesser Egyptian jerboa  -------------atcagcaaaag
               Prairie vole  -------------atcagca----
            Chinese hamster  -------------atcagca----
             Golden hamster  -------------atcagca----
                      Mouse  -------------atcagca----
                        Rat  -------------atcagct----
             Naked mole-rat  -------------atcagcaatat
                 Guinea pig  -------------atcagc-----
                 Chinchilla  -------------atgagcaatgt
           Brush-tailed rat  -------------atcagaaatat
                     Rabbit  -------------gccattgagat
                       Pika  -------------accattgagat
                        Pig  -------------atcggcaaggt
                     Alpaca  -------------atcagcaaggc
             Bactrian camel  -------------atcagcaaggc
                    Dolphin  -------------atgaacaagat
               Killer whale  -------------atgaacaagat
           Tibetan antelope  -------------atcagcaagat
                        Cow  -------------ataagcaagat
                      Sheep  -------------atcagcaagat
              Domestic goat  -------------atcagcaagat
                      Horse  -------------atcagtaggat
           White rhinoceros  -------------atcagtaagat
                        Cat  -------------acc---aagat
                        Dog  -------------at----aagat
                    Ferret   -------------att---aagat
                      Panda  -------------atca--aagat
             Pacific walrus  -------------atc---aagat
               Weddell seal  -------------atc---aagat
           Black flying-fox  -------------atcagcaagat
                    Megabat  -------------atcagcaagat
              Big brown bat  -------------atcagcaagat
       David's myotis (bat)  -------------atcggcaagat
                   Microbat  -------------atcggcaagat
                   Hedgehog  -------------atctgtgaggt
                      Shrew  -------------ctcggcaagaa
            Star-nosed mole  -------------attagcaagtc
                   Elephant  -------------atcagcaagat
                    Manatee  -------------atcagcaagat
                     Tenrec  -------------atcagccagtt
                  Armadillo  -------------atcagtgac--
           Cape golden mole  ========================
                   Aardvark  ========================
            Tasmanian devil  ========================
        Cape elephant shrew  ========================

Inserts between block 5 and 6 in window
B D                 Tenrec 38bp

Alignment block 6 of 965 in window, 110873403 - 110873405, 3 bps 
B D                   Human  cct
B D                   Chimp  cct
B D                 Gorilla  cct
B D               Orangutan  cct
B D                  Gibbon  cct
B D                  Rhesus  act
B D     Crab-eating macaque  act
B D                  Baboon  act
B D            Green monkey  act
B D                Marmoset  cct
B D         Squirrel monkey  cct
B D                Bushbaby  cct
         Chinese tree shrew  tct
     Lesser Egyptian jerboa  gct
B D          Naked mole-rat  ctt
                 Chinchilla  ctt
           Brush-tailed rat  gtt
B D                  Rabbit  ccc
B D                    Pika  cct
B D                     Pig  ccc
B D                  Alpaca  cct
             Bactrian camel  cct
B D                 Dolphin  tct
               Killer whale  tct
           Tibetan antelope  cct
B D                     Cow  tct
B D                   Sheep  cct
              Domestic goat  cct
B D                   Horse  cct
B D        White rhinoceros  cct
B D                     Cat  cct
B D                     Dog  a--
B D                 Ferret   ttt
B D                   Panda  gct
             Pacific walrus  cct
               Weddell seal  cct
           Black flying-fox  cct
B D                 Megabat  cct
              Big brown bat  cct
       David's myotis (bat)  cct
B D                Microbat  cct
B D                Hedgehog  cct
B D                   Shrew  cct
            Star-nosed mole  cct
B D                Elephant  cct
B D                 Manatee  cct
           Cape golden mole  cct
B D                  Tenrec  ccc
B D               Armadillo  cct
B D                     Rat  ---
              Prairie vole  ---
            Golden hamster  ---
B D                   Mouse  ---
B D              Guinea pig  ---
                  Aardvark  ===
B D         Tasmanian devil  ===
       Cape elephant shrew  ===
B D         Chinese hamster  ---
B D                Squirrel  ---

Inserts between block 6 and 7 in window
B D               Elephant 529bp
B D                Manatee 204bp

Alignment block 7 of 965 in window, 110873406 - 110873412, 7 bps 
B D                   Human  ag------------------------taac-a
B D                   Chimp  ag------------------------taac-a
B D                 Gorilla  ag------------------------taac-a
B D               Orangutan  ag------------------------taac-a
B D                  Gibbon  ag------------------------taac-a
B D                  Rhesus  ag------------------------taac-a
B D     Crab-eating macaque  ag------------------------taac-a
B D                  Baboon  ag------------------------taac-a
B D            Green monkey  ag------------------------taac-a
B D                Marmoset  gg------------------------taac-a
B D         Squirrel monkey  gg------------------------taac-a
B D                Bushbaby  ag------------------------caat-a
         Chinese tree shrew  gg------------------------taac-a
B D                Squirrel  -------------------------------a
     Lesser Egyptian jerboa  ag------------------------aaat-g
               Prairie vole  -------------------------------g
B D         Chinese hamster  -------------------------------g
             Golden hamster  -------------------------------g
B D                   Mouse  -------------------------------c
B D                     Rat  -------------------------------c
B D          Naked mole-rat  ag------------------------caac-a
                 Chinchilla  ag------------------------taac-a
           Brush-tailed rat  ag------------------------taac-a
B D                  Rabbit  ag------------------------tgac-g
B D                    Pika  ga------------------------tgtt-g
B D                     Pig  ag------------------------tgac--
B D                  Alpaca  tg------------------------taat--
             Bactrian camel  tg------------------------taac--
B D                 Dolphin  ag------------------------tgac--
               Killer whale  ag------------------------tgac--
           Tibetan antelope  ag------------------------tggc--
B D                     Cow  ag------------------------tggc--
B D                   Sheep  ag------------------------tggc--
              Domestic goat  ag------------------------tggc--
B D                   Horse  ag------------------------taac--
B D        White rhinoceros  ag------------------------taac--
B D                     Cat  ag------------------------cacc--
B D                     Dog  ag------------------------aacc--
B D                 Ferret   gg------------------------cacc--
B D                   Panda  gg------------------------cacc--
             Pacific walrus  gg------------------------cacc--
               Weddell seal  gg------------------------cacc--
           Black flying-fox  ag------------------------taat--
B D                 Megabat  ag------------------------taat--
              Big brown bat  gg------------------------taac--
       David's myotis (bat)  ag------------------------t--c--
B D                Microbat  ag------------------------t--c--
B D                Hedgehog  ac------------------------t-----
B D                   Shrew  ag------------------------taat--
            Star-nosed mole  ac------------------------taat--
B D                Elephant  ag------------------------taac--
        Cape elephant shrew  aa------------------------taac--
           Cape golden mole  ag------------------------tgac--
B D                  Tenrec  agaggttcgacaacgcagagtagaaatgcc--
B D               Armadillo  ------------------------cataaca-
B D              Guinea pig  --------------------------------
                  Aardvark  ================================
B D         Tasmanian devil  ================================
B D                 Manatee  ================================

Alignment block 8 of 965 in window, 110873413 - 110873417, 5 bps 
B D                   Human  tcccc
B D                   Chimp  tcccc
B D                 Gorilla  tcccc
B D               Orangutan  tcccc
B D                  Gibbon  tcccc
B D                  Rhesus  tcccc
B D     Crab-eating macaque  tcccc
B D                  Baboon  tcccc
B D            Green monkey  tcccc
B D                Marmoset  tcccc
B D         Squirrel monkey  tcccc
B D                Bushbaby  tcccc
         Chinese tree shrew  cgcct
B D                Squirrel  gtt-c
     Lesser Egyptian jerboa  tcttc
               Prairie vole  ttcct
B D         Chinese hamster  ttccc
             Golden hamster  ttccc
B D                   Mouse  ttccc
B D                     Rat  tttcc
B D          Naked mole-rat  tccca
B D              Guinea pig  ----a
                 Chinchilla  gtgaa
           Brush-tailed rat  ttgaa
B D                  Rabbit  tctcc
B D                    Pika  cctc-
B D                     Pig  cctcc
B D                  Alpaca  tctcg
             Bactrian camel  tctca
B D                 Dolphin  cctca
               Killer whale  cctca
           Tibetan antelope  cctca
B D                     Cow  cttca
B D                   Sheep  cctca
              Domestic goat  cctca
B D                   Horse  cttca
B D        White rhinoceros  cctca
B D                     Cat  cctca
B D                     Dog  cttca
B D                 Ferret   cctga
B D                   Panda  tctca
             Pacific walrus  cctca
               Weddell seal  cctca
           Black flying-fox  cctca
B D                 Megabat  cctca
              Big brown bat  cctcc
       David's myotis (bat)  cctca
B D                Microbat  cctca
B D                   Shrew  cctca
            Star-nosed mole  cctc-
B D                Elephant  tccc-
        Cape elephant shrew  cttc-
           Cape golden mole  cccc-
B D                  Tenrec  cccc-
                   Aardvark  ttcc-
B D               Armadillo  ccac-
B D                Hedgehog  -----
B D         Tasmanian devil  =====
B D                 Manatee  =====

Inserts between block 8 and 9 in window
B D               Elephant 1bp
       Cape elephant shrew 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp

Alignment block 9 of 965 in window, 110873418 - 110873439, 22 bps 
B D                   Human  aaa-------------------------------------------------------------------
B D                   Chimp  aaa-------------------------------------------------------------------
B D                 Gorilla  aaa-------------------------------------------------------------------
B D               Orangutan  aaa-------------------------------------------------------------------
B D                  Gibbon  aaa-------------------------------------------------------------------
B D                  Rhesus  aaa-------------------------------------------------------------------
B D     Crab-eating macaque  aaa-------------------------------------------------------------------
B D                  Baboon  aaa-------------------------------------------------------------------
B D            Green monkey  aca-------------------------------------------------------------------
B D                Marmoset  aaa-------------------------------------------------------------------
B D         Squirrel monkey  aaa-------------------------------------------------------------------
B D                Bushbaby  aaa-------------------------------------------------------------------
         Chinese tree shrew  cga-------------------------------------------------------------------
B D                Squirrel  aaa-------------------------------------------------------------------
     Lesser Egyptian jerboa  aaa-------------------------------------------------------------------
               Prairie vole  tca-------------------------------------------------------------------
B D         Chinese hamster  tca-------------------------------------------------------------------
             Golden hamster  tga-------------------------------------------------------------------
B D                   Mouse  tta-------------------------------------------------------------------
B D                     Rat  tca-------------------------------------------------------------------
B D          Naked mole-rat  aga-------------------------------------------------------------------
B D              Guinea pig  aga-------------------------------------------------------------------
                 Chinchilla  aga-------------------------------------------------------------------
           Brush-tailed rat  aga-------------------------------------------------------------------
B D                  Rabbit  gaa-------------------------------------------------------------------
B D                    Pika  ----------------------------------------------------------------------
B D                     Pig  aaa-------------------------------------------------------------------
B D                  Alpaca  aaa-------------------------------------------------------------------
             Bactrian camel  aaa-------------------------------------------------------------------
B D                 Dolphin  aaa-------------------------------------------------------------------
               Killer whale  aaa-------------------------------------------------------------------
           Tibetan antelope  aaa-------------------------------------------------------------------
B D                     Cow  aaa-------------------------------------------------------------------
B D                   Sheep  aaa-------------------------------------------------------------------
              Domestic goat  aaa-------------------------------------------------------------------
B D                   Horse  aca-------------------------------------------------------------------
B D        White rhinoceros  aca-------------------------------------------------------------------
B D                     Cat  aaa-------------------------------------------------------------------
B D                     Dog  aaa-------------------------------------------------------------------
B D                 Ferret   aaa-------------------------------------------------------------------
B D                   Panda  aaa-------------------------------------------------------------------
             Pacific walrus  aaa-------------------------------------------------------------------
               Weddell seal  aaa-------------------------------------------------------------------
           Black flying-fox  aaa-------------------------------------------------------------------
B D                 Megabat  aaa-------------------------------------------------------------------
              Big brown bat  caa-------------------------------------------------------------------
       David's myotis (bat)  gaa-------------------------------------------------------------------
B D                Microbat  gaa-------------------------------------------------------------------
B D                   Shrew  aaa-------------------------------------------------------------------
            Star-nosed mole  aag-------------------------------------------------------------------
B D                Elephant  aaa-------------------------------------------------------------------
        Cape elephant shrew  aaa-------------------------------------------------------------------
B D                 Manatee  aaa-------------------------------------------------------------------
           Cape golden mole  aaa-------------------------------------------------------------------
B D                  Tenrec  aagtttcccaggctgaaatctttccaggagacggtggccgggtcttaagtgccacagctctcctatgggg
                   Aardvark  aaa-------------------------------------------------------------------
B D               Armadillo  aaa-------------------------------------------------------------------
B D                Hedgehog  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  -----------------------ggcaatcaggccag------------------------a----aata
                      Chimp  -----------------------ggcaatcaggccag------------------------a----aata
                    Gorilla  -----------------------ggcaatcaggccag------------------------a----aata
                  Orangutan  -----------------------ggcaatcaggccag------------------------a----aata
                     Gibbon  -----------------------ggcaatcaggccaa------------------------a----aata
                     Rhesus  -----------------------ggcaatcaggccag------------------------a----aatg
        Crab-eating macaque  -----------------------ggcaatcaggccag------------------------a----aatg
                     Baboon  -----------------------ggcaatcaggccag------------------------a----aatg
               Green monkey  -----------------------ggcaatcaggccag------------------------a----aatg
                   Marmoset  -----------------------ggcaatgaggtgag------------------------a----aata
            Squirrel monkey  -----------------------gggaatcaggtgag------------------------a----aata
                   Bushbaby  -----------------------ggcaatcaggttgg------------------------a----aata
         Chinese tree shrew  -----------------------ggcgatcaggccag------------------------a----aata
                   Squirrel  -----------------------agcaatcaggtcaa------------------------a----agta
     Lesser Egyptian jerboa  -----------------------ggcaatcaggctag------------------------a----aata
               Prairie vole  -----------------------ggcaaccaggctag------------------------a----aata
            Chinese hamster  -----------------------ggcaatcaggctag------------------------a----aaaa
             Golden hamster  -----------------------ggcaatctggttag------------------------a----aaca
                      Mouse  -----------------------ggcaactgggctag------------------------a----aata
                        Rat  -----------------------ggcaattggtccag------------------------a----aata
             Naked mole-rat  -----------------------ggcaatcaagtcag---------------------------------
                 Guinea pig  -----------------------agcagtcaagtcag------------------------a----atca
                 Chinchilla  -----------------------ggtagtcaagtcag------------------------a----acta
           Brush-tailed rat  -----------------------ggtagtcaagtcag------------------------a----aata
                     Rabbit  -----------------------ggcagccaggcccc------------------------a----aa-a
                       Pika  -------------------------cagtttgggcct------------------------g--------
                        Pig  -----------------------ggaaaccaggccag------------------------a----aaga
                     Alpaca  -----------------------ggcaattaggccag------------------------a----agga
             Bactrian camel  -----------------------ggcaattaggccag------------------------a----agga
                    Dolphin  -----------------------ggcaatcaggctgg------------------------a----agga
               Killer whale  -----------------------ggcaatcaggctgg------------------------a----agga
           Tibetan antelope  -----------------------ggcaatccggccag------------------------a----aaga
                        Cow  -----------------------ggcaatctgcccag------------------------a----aaga
                      Sheep  -----------------------ggcaatccgaccag------------------------a----aaga
              Domestic goat  -----------------------ggcaatatggccag------------------------a----aaga
                      Horse  -----------------------ggcaatcaggccag------------------------a----aaca
           White rhinoceros  -----------------------ggcaatcaggccag------------------------a----aaaa
                        Cat  -----------------------ggcaagcaggccag------------------------a----aaga
                        Dog  -----------------------gacaagcaagccat------------------------a----aaga
                    Ferret   -----------------------gacaagcaggccat------------------------a----gaga
                      Panda  -----------------------gacaagcaggccat------------------------a----aaga
             Pacific walrus  -----------------------gacaagcaggccgt------------------------a----aaga
               Weddell seal  -----------------------gacaagcaggctgt------------------------a----aaga
           Black flying-fox  -----------------------ggcaatcaggccag------------------------a----aaga
                    Megabat  -----------------------ggcaatcaggccag------------------------a----aaga
              Big brown bat  -----------------------ggtaaaccggccag------------------------a----aagg
       David's myotis (bat)  -----------------------ggcaaaccagccag------------------------a----aagg
                   Microbat  -----------------------ggcaaaccggccag------------------------a----aagg
                      Shrew  -----------------------ggcaatcgggtcgg------------------------a----aaga
            Star-nosed mole  -----------------------tgctatcaggctag------------------------a----aaga
                   Elephant  -----------------------ggcaatctggacag------------------------aaagg----
        Cape elephant shrew  -----------------------agttacttgggcag------------------------a--------
                    Manatee  -----------------------ggcaatccggacaa------------------------a--ga----
           Cape golden mole  -----------------------ggcaatctggacat------------------------a--------
                     Tenrec  ttagaaccactgacctctgggttagcagacttaccattatgctaccagggtccctgtaacaa--------
                   Aardvark  -----------------------gactatctggacag------------------------a--------
                  Armadillo  -----------------------gactatcaggccga------------------------a--------
                   Hedgehog  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================

Inserts between block 9 and 10 in window
B D               Bushbaby 240bp

Alignment block 10 of 965 in window, 110873440 - 110873518, 79 bps 
B D                   Human  cttttac---------------------------------------------------------------
B D                   Chimp  cttttac---------------------------------------------------------------
B D                 Gorilla  cttttac---------------------------------------------------------------
B D               Orangutan  cttttac---------------------------------------------------------------
B D                  Gibbon  cttttac---------------------------------------------------------------
B D                  Rhesus  cttttac---------------------------------------------------------------
B D     Crab-eating macaque  cttttac---------------------------------------------------------------
B D                  Baboon  cttttac---------------------------------------------------------------
B D            Green monkey  cttttac---------------------------------------------------------------
B D                Marmoset  cttttac---------------------------------------------------------------
B D         Squirrel monkey  cttttac---------------------------------------------------------------
B D                Bushbaby  ctttcacctctgccttccatagggctaggattataggcatgagcctctgtgctcagcccagaaatacttt
         Chinese tree shrew  cttttgc---------------------------------------------------------------
B D                Squirrel  cttcagc---------------------------------------------------------------
     Lesser Egyptian jerboa  ctttgat---------------------------------------------------------------
               Prairie vole  cttggat---------------------------------------------------------------
B D         Chinese hamster  ctttgat---------------------------------------------------------------
             Golden hamster  cttggat---------------------------------------------------------------
B D                   Mouse  ctttgat---------------------------------------------------------------
B D                     Rat  ctttgat---------------------------------------------------------------
B D          Naked mole-rat  -----ac---------------------------------------------------------------
B D              Guinea pig  ctttaac---------------------------------------------------------------
                 Chinchilla  ctttgac---------------------------------------------------------------
           Brush-tailed rat  ctttgac---------------------------------------------------------------
B D                  Rabbit  tgttcat---------------------------------------------------------------
B D                    Pika  ----------------------------------------------------------------------
B D                     Pig  ctttcca---------------------------------------------------------------
B D                  Alpaca  ctttcaa---------------------------------------------------------------
             Bactrian camel  gtttcaa---------------------------------------------------------------
B D                 Dolphin  gtttcaa---------------------------------------------------------------
               Killer whale  gtttcaa---------------------------------------------------------------
           Tibetan antelope  gttccag---------------------------------------------------------------
B D                     Cow  gtttcag---------------------------------------------------------------
B D                   Sheep  gttccag---------------------------------------------------------------
              Domestic goat  gttccag---------------------------------------------------------------
B D                   Horse  cttttaa---------------------------------------------------------------
B D        White rhinoceros  cttgtaa---------------------------------------------------------------
B D                     Cat  cttttca---------------------------------------------------------------
B D                     Dog  c-tttca---------------------------------------------------------------
B D                 Ferret   cttttca---------------------------------------------------------------
B D                   Panda  cttttca---------------------------------------------------------------
             Pacific walrus  cttttca---------------------------------------------------------------
               Weddell seal  cttttca---------------------------------------------------------------
           Black flying-fox  cttttaa---------------------------------------------------------------
B D                 Megabat  cttttaa---------------------------------------------------------------
              Big brown bat  cttttca---------------------------------------------------------------
       David's myotis (bat)  cttttca---------------------------------------------------------------
B D                Microbat  gttttca---------------------------------------------------------------
B D                Hedgehog  ----------------------------------------------------------------------
B D                   Shrew  tttttaa---------------------------------------------------------------
            Star-nosed mole  cttttaa---------------------------------------------------------------
B D                Elephant  cttttaa---------------------------------------------------------------
        Cape elephant shrew  ttttcag---------------------------------------------------------------
B D                 Manatee  cttttta---------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
B D                  Tenrec  ----------------------------------------------------------------------
                   Aardvark  agactta---------------------------------------------------------------
B D               Armadillo  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  ----ttaatcaggt---tccc-at-----tatctaa-----atc-------tctgagtcgaggcattca-
                      Chimp  ----ttaatcaggt---tccc-at-----tatctaa-----atc-------tctgagtcgaggcattca-
                    Gorilla  ----ttaatcaggt---tccc-at-----tatctaa-----atc-------tctgagtcgaggcattcg-
                  Orangutan  ----ttaatcaggt---tccc-at-----tatctaa-----atc-------tctgagtcgaggcattca-
                     Gibbon  ----ttaatcaggt---tccc-at-----tatctaa-----atc-------tctgagtcgaggcattca-
                     Rhesus  ----ttaatcaggt---tccc-gg-----tatctaa-----atc-------tctgagttgaggcattca-
        Crab-eating macaque  ----ttaatcaggt---tccc-gg-----tatctaa-----atc-------tctgagttgaggcattca-
                     Baboon  ----ttaatcaggt---tccc-gg-----tatctaa-----atc-------tctgagttgaggcattca-
               Green monkey  ----ttaatcaggt---tccc-gg-----tatctaa-----atc-------tctgagttgaggcattca-
                   Marmoset  ----ttaatcaggt---t-------------tctga-----atc-------tctgagtccacatattca-
            Squirrel monkey  ----ttaatcaggt---t-------------tctga-----atcagaatcttctgagtccacatattca-
                   Bushbaby  cgatttacctaggt---ttgc-at-----tttctgatagatctc-------tttgagttagggcattca-
         Chinese tree shrew  ----ttaagtgcgt---ttcctat-----tatctgg--tatttc-------tttgggtt-aggcattca-
                   Squirrel  ----ttacctgggt---tcct-at-----catctgg--aatctg-------tttgggatggcgcattcc-
     Lesser Egyptian jerboa  ----tta----------actg-gg-----tttctg---------------------gcctggggactca-
               Prairie vole  ----tga----------cttt-gt-----tatctga--tatctc-------tttgggcctgagcatctt-
            Chinese hamster  ----tta----------ctgt-gt-----tgtctga--tatctc-------tttgtgcctgagcttcct-
             Golden hamster  ----tta----------ctat-gt-----tatctga--tatctc-------tttgtgcctgagcttcct-
                      Mouse  ----ttaattggtg---tttt-at-----tttctga--tatctc-------tttgggcctaagtattca-
                        Rat  ----ttaattggtg---tttt-at-----tttctga--tatctc-------tttgggcctgagtatcct-
             Naked mole-rat  ----ttaaccagtt---tccc-at-----tatctga--tatctc----------------------tta-
                 Guinea pig  ----ttaaccagtt---tccc-at-----tacctgc--tgtatc-------tctgggtctggcagttta-
                 Chinchilla  ----ttaaccagtt---tccc-at-----tatctaa--catctc-------tttgagtctagcgattta-
           Brush-tailed rat  ----ttaaccagtt---tccc-at-----tatctgc--tatgac-------tttgggtctagcaattta-
                     Rabbit  ----ttaatcaagc---tcct-tt-----tgcctga--tgtctc-------tttgggcctggcattcca-
                       Pika  ----------------------------------gg--tgtctg-------t---agcttaagctgcta-
                        Pig  ----ttgattgggt---gcct-at-----tgtctgc--tatctc-------tttgagtcacggcatttc-
                     Alpaca  ----ttaactgggt---tccc-gt-----gatctgt----------------ttggctcagggcattta-
             Bactrian camel  ----ttaactgggt---tccc-gt-----gatctgt----------------ttggctcagggcattta-
                    Dolphin  ----ttaactggat---tccc-at-----tatctga--tatcac-------tttgggtcagggcattta-
               Killer whale  ----ttaactggat---tccc-at-----tatctga--tatcac-------tttgggtcagggcattta-
           Tibetan antelope  ----ttaactgggt---tcca-at-----catttaa-----------------tgggtcgtggttttca-
                        Cow  ----ttaactgggt---tcca-at-----tatttga-----------------tgggtcatggttttca-
                      Sheep  ----ttaactgggt---tcca-at-----tatttga-----------------tgggtcgtggttttca-
              Domestic goat  ----ttaactgggt---tcca-at-----tatttga-----------------tgggtcgtggttttca-
                      Horse  ----ttgaccagct---tcca-attacagtatctga--tatcaa-------tttgggtcagggcattca-
           White rhinoceros  ----ctaatcaggt---tccc-attaaagtatctga--tatctc-------tttgggtcagggcattca-
                        Cat  ----attaattggt---tcgc-at-----tatctga--tacctc-------tttgggtcagggcattta-
                        Dog  ----ttaaccaggt---tcct-at-----tgtctga--tacctc-------gctgggccaaggcattcg-
                    Ferret   ---tttaactgggt---gacc-at-----tatctga--aacctc-------tttgggccaggac-ctcg-
                      Panda  ----ctaaccaggt---tccc-at-----tatctga--tacctc-------tttgggtcagggcattca-
             Pacific walrus  ----ctaaccaggt---tcct-gt-----tatctga--tacctc-------tttgggtcagggtattca-
               Weddell seal  ----ctaaccaggt---tccc-gt-----tatctga--tacctc-------tttgggtcagggcattca-
           Black flying-fox  ----ttaatcaggt---ttcc-at-----tatctga--tatctc-------tttgggtcagggcattct-
                    Megabat  ----ttaatcaggt---ttcc-at-----tatctga--tatctc-------tttgggtcagggcattct-
              Big brown bat  ----tgaacccggg---tccc-ag-----gacctga--catggc-------tttgggccagtgcgttc--
       David's myotis (bat)  ----ggaa-ccggt---tccc-ag-----gatctga--gatcgc-------tttggg-cag-gcgttc--
                   Microbat  ----ggaa-ccggt---tccc-ag-----gatctga--tatcgc-------tttgggccag-gtgttc--
                   Hedgehog  -----------------------------gactg--------------------------------tca-
                      Shrew  ----ttaaccaagt---ttcc-a------gattgga--tatctc-------cttagctgactccattta-
            Star-nosed mole  ----ttaaccaggc---tccc-att----aactgg---tatctc-------tttgggtcagaacactca-
                   Elephant  ----ttaactagat---tccc-gt-----tatctta--tatc------------------aggcattca-
        Cape elephant shrew  ----gtaactagtt---tccc--t-----tatctga------------------------ggcctttca-
                    Manatee  ----ttaactggat---tccc-at-----tttctga--tatc-----------------agggaattca-
           Cape golden mole  -----aagctaggt---tccc-at-----tatccca--tatc-----------------aggacattca-
                     Tenrec  -----aagccgagtctctccc-gt-----tatctaa--tatt-----------------gtggcattta-
                   Aardvark  ----attactaggc---tccc-at-----tatctga--tatc-----------------agggcattca-
                  Armadillo  ----ttaaccaagt---t-tc-at-----tatccga--tatctc-------tttgag-cacggtattcat
            Tasmanian devil  ======================================================================

                      Human  ------catgcc-------------t-taattgcttc----aga-----gcttgaat
                      Chimp  ------catgcc-------------t-taattgcttc----aga-----gcttgaat
                    Gorilla  ------catgcc-------------t-taattgcttc----aga-----gcttgaat
                  Orangutan  ------catggc-------------t-taattgcttc----aga-----gcttgaat
                     Gibbon  ------catgcc-------------t-taattgcttc----aga-----gcttgaat
                     Rhesus  ------cacgcc-------------t-taattgctac----aga-----gcttgaat
        Crab-eating macaque  ------cacgcc-------------t-taattgctac----aga-----gcttgaat
                     Baboon  ------cacgcc-------------t-taattgctac----aga-----gcttgaat
               Green monkey  ------cacgcc-------------t-taattgctac----aga-----gcttgaat
                   Marmoset  ------caggcc-------------t-taattgctac----aga-----acttgaat
            Squirrel monkey  ------cgtgcc-------------t-taattgcaac----aga-----acttgaat
                   Bushbaby  ------tgtgct-------------t-aaattgcttc----aga-----gcttgaat
         Chinese tree shrew  ------agtgct-------------t-aaatttctac----aaa-----acttgact
                   Squirrel  ------ttaggt-------------t-aaatgactac----aga-----acttgaat
     Lesser Egyptian jerboa  ------tgtgct-------------t-aaatccttta----tgctttaaacttaaat
               Prairie vole  ------tgagcc-------------t-acctatctgt----agc-----ac-tgaat
            Chinese hamster  ------tgagca-------------t-acatcattac----agc-----ac-tgaat
             Golden hamster  ------tgagga-------------c-acatcactac----agc-----ac-tgaat
                      Mouse  ------taagct-------------t-acattattat----gcc-----acttgaat
                        Rat  ------tgagca-------------t-acattattat----gac-----acttgaat
             Naked mole-rat  ------tatgct-------------t-aaattactac----aga-----atgtgaat
                 Guinea pig  ------catgcc-------------t-taattactac----aga-----atgtgaat
                 Chinchilla  ------catgtt-------------t-aaattgctac----aga-----atgtgaat
           Brush-tailed rat  ------catgct-------------t-gaattactac----aga-----atgcgaat
                     Rabbit  ------t------------------------------------------gcttgagt
                       Pika  ------caca---------------------------------------acttgaac
                        Pig  ------tgtgct-------------t-aaattgcttt----gga-----acttgaat
                     Alpaca  ------tgtgct-------------t-aaattgcttc----aga-----acttaagt
             Bactrian camel  ------tgtgct-------------t-aaattgcttc----aga-----acttaagt
                    Dolphin  ------tgtgct-------------t-aaattgcttc----aga-----acttgaat
               Killer whale  ------tgtgct-------------t-aaattgcttc----aga-----acttgaat
           Tibetan antelope  ------tgtgct-------------t-aaattgcttc----aga-----acttgaac
                        Cow  ------tgtgct-------------t-aaattgcttc----aga-----acttgaac
                      Sheep  ------tgtgct-------------t-aaattgcttc----aga-----acttgaac
              Domestic goat  ------tgtgct-------------t-aaattgcttc----aga-----acttgaac
                      Horse  ------tgtgct-------------t-aagttgcctc----aga-----acttgaat
           White rhinoceros  ------tgtgct-------------t-aaattgcttc----aga-----acttgaat
                        Cat  ------tatgct-------------t-aagttgcttc----aga-----acttgaat
                        Dog  ------tgctttagaacctaattgct-taattgcctc----aga-----acttgaat
                    Ferret   ------tgggct-------------t-aaattgcttc----aga-----acttgaat
                      Panda  ------cgggtt-------------t-aca-tgcttc----aga-----acttgaat
             Pacific walrus  ------tgagct-------------t-aaattgtttc----aga-----acttgaat
               Weddell seal  ------tgagct-------------t-aaattgtttc----aga-----acttgaat
           Black flying-fox  ------tgtgct-------------t-aaattgtttc----caa-----aattgaat
                    Megabat  ------tgtgct-------------t-aaattgtttc----caa-----aattgaat
              Big brown bat  ---------------------------------------------------------
       David's myotis (bat)  ---------------------------------------------------------
                   Microbat  ---------------------------------------------------------
                   Hedgehog  ------caagct-------------t-aaaaagcttt----agt-----acttgaat
                      Shrew  ------actgct-------------t-acgtctcttc----aga-----aattgaat
            Star-nosed mole  ------ggggct-------------c-aaattgcttt----gga-----acttgaat
                   Elephant  ------cgtgct-------------t-aaattgcttgctacata-----atttgaat
        Cape elephant shrew  ------tgtgct-------------g-aaactgccag----aca-----attagaat
                    Manatee  ------tgtgct-------------t-aaattgcttgctacaca-----acttgaat
           Cape golden mole  ------tgtgct-------------t-aaattgctcc----aca-----acttgaac
                     Tenrec  ------cttgct-------------t-aaattgctat----aca-----acttgaat
                   Aardvark  ------cgtgct-------------t-aaattgttac----aca-----acttaaat
                  Armadillo  cacctgcatact-------------tgaaattgttat----acg-----ccttgact
            Tasmanian devil  =========================================================

Inserts between block 10 and 11 in window
B D               Squirrel 4bp
              Prairie vole 4bp
B D        Chinese hamster 4bp
            Golden hamster 4bp
B D                  Mouse 4bp
B D                    Rat 6bp
B D         Naked mole-rat 4bp
B D             Guinea pig 4bp
                Chinchilla 4bp
          Brush-tailed rat 4bp

Alignment block 11 of 965 in window, 110873519 - 110873553, 35 bps 
B D                   Human  tactctgtgtag-taattcctgatgcctggagcttt
B D                   Chimp  tactctgtgtag-taatt-ctgatgcctggagcttt
B D                 Gorilla  tactctgtgtag-taattcctgatgcctggagcttt
B D               Orangutan  tactctgtgtag-taattcctgatgcctggagcttt
B D                  Gibbon  tactctgtgtag-taattcctgatgcctggagcttt
B D                  Rhesus  tactctgtgtag-taattcctgatgcctggagcttt
B D     Crab-eating macaque  tactctgtgtag-taattcctgatgcctggagcttt
B D                  Baboon  tactctgtgtag-taattcctgatgcctggagcttt
B D            Green monkey  tactctgtgtag-taattcctgatgcctggagcttt
B D                Marmoset  ttctctgtgtag-taattcctgatgcttggagcttt
B D         Squirrel monkey  ttcttcgtgtag-taattcctgatgcttggagcttt
B D                Bushbaby  tactgtgggtag-taatttctgatgcttggagcttt
         Chinese tree shrew  tactgtgtgtgg-taatttctgatgccc-gagcttt
B D                Squirrel  tattctgtgtgg-taatttcta--------------
               Prairie vole  tactttgtatgg-tggtttctgatggttgaaatttt
B D         Chinese hamster  tactgtgaatgg-tggtttctgatggttgaagtttt
             Golden hamster  tacagtgtatgg-tggtttctgatggttgaagtttt
B D                   Mouse  tactgtatatgg-tggtttctaatgcttgaagtttt
B D                     Rat  tacactaga-at-tggtttctagtgcttgaagtttt
B D          Naked mole-rat  aactgtgtatgg-taatttctagtgcttagag-ttt
B D              Guinea pig  tgctgggtatgg-taatttctggtg-ctggagtttt
                 Chinchilla  gattatgtatgg-tagtttgtggtgcctggagtttt
           Brush-tailed rat  tattgtatactg-tagtttctggtgcctgtaatttt
B D                  Rabbit  tgctttgtccgg-taacttctgatgcctggagctct
B D                    Pika  tgctgcctccac-tactttctgatacccggagctgt
B D                     Pig  ttctctgtgtgg-tcgct-----------------t
B D                  Alpaca  ttctgtgtgtgg-tcatttctgatcaccagagcctt
             Bactrian camel  ttctgtgtgtgg-tcatttctgatgaccagagcctt
B D                 Dolphin  ttgg--gtctgg-tcatttctgttgaccagagccat
               Killer whale  ttgg--gtctgg-tcatttctgttgaccagagccat
           Tibetan antelope  ttctctgtctgg-tcattactgatgactagagccat
B D                     Cow  ttctctgtctgg-ccattaccgatgaccagagccat
B D                   Sheep  ttctccatctgg-tcattactgatgactagagccat
              Domestic goat  ttctctgtctgg-tcattactgatgactagagccat
B D                   Horse  ttctgtgtatag-tcattgctgatgcctggacattt
B D        White rhinoceros  ttctgtgtatgg-tcatttctgatgcctggagtttt
B D                     Cat  ttttctgtgtag-tcatttctgatgtctggagccct
B D                     Dog  ttctgtgagttg-tcatttttgatgcctggagcctt
B D                 Ferret   ttctgtgtgtag-tcatttctgatgcctggagcctt
B D                   Panda  ttctgtatgtag-tcatttctgatgcctggagcctt
             Pacific walrus  ttctgtgtgtag-tcatttctgatgcctggagcctt
               Weddell seal  ttctgtgtgtag-tcatttctgatgcctggagcctt
           Black flying-fox  ttctgtatgtga-ctatttctgatgcctggagcttt
B D                 Megabat  ttctgtatgtga-ctatttctgatgcctggagcttt
              Big brown bat  -------------------ctggcgcctggggccta
       David's myotis (bat)  -------------------ctgacgcctggagcctc
B D                Microbat  -------------------ctgacgcctggagcctt
B D                Hedgehog  ttctgggaa-gg-ttatttctaatgtctagagcctt
B D                   Shrew  ttctctgtgtag-ttacttctggtgactagag-cct
            Star-nosed mole  ttctctgaatgg-tcatttctgatgcctggaatctt
B D                Elephant  ttctctgtgtgg-taatttctgatgcctggagcttt
        Cape elephant shrew  tt-tttgtgtga-tggtctgggctttctg----ttt
B D                 Manatee  ttctctttgtgg-taattgctgatgcctggggcttt
           Cape golden mole  ttctgtgtgtgg-taatttctgatgcctggagcttt
B D                  Tenrec  ttctctgtgtgg-taatttctgacgcctgggg----
                   Aardvark  tactctgtgtgg-tgatttttgatgcctgaggcttt
B D               Armadillo  ctctgtgtgtggttaacttccgatgcctggaacttt
    Lesser Egyptian jerboa  ------------------------------------
B D         Tasmanian devil  ====================================

Inserts between block 11 and 12 in window
B D                Manatee 217bp

Alignment block 12 of 965 in window, 110873554 - 110873562, 9 bps 
B D                   Human  ctatgcgag
B D                   Chimp  ctatgtgag
B D                 Gorilla  ctatgtgag
B D               Orangutan  ctatgtgag
B D                  Gibbon  ctatgtgag
B D                  Rhesus  ctctgcgag
B D     Crab-eating macaque  ctctgcgag
B D                  Baboon  ctctgcgag
B D            Green monkey  ctctgcaag
B D                Marmoset  ctatgtgag
B D         Squirrel monkey  ctatgtgag
B D                Bushbaby  ctgtgtgaa
         Chinese tree shrew  cagtgtgag
B D                Squirrel  ---tgtgag
               Prairie vole  ctttgtgag
B D         Chinese hamster  ctgtgtgag
             Golden hamster  ctgtgtaag
B D                   Mouse  tgaggtgag
B D                     Rat  ctaggtgag
B D          Naked mole-rat  ctgtgtgag
B D              Guinea pig  ctgtgtgag
                 Chinchilla  ctgtgtgag
           Brush-tailed rat  ctgtgtgag
B D                  Rabbit  ctgtgtgag
B D                    Pika  ctgtgtgag
B D                     Pig  ttgtgtgag
B D                  Alpaca  ctgtgagag
             Bactrian camel  ctgtgagag
B D                 Dolphin  ctgtacaag
               Killer whale  ctgtacatg
           Tibetan antelope  ttgtgtgaa
B D                     Cow  ttatgtgaa
B D                   Sheep  ttgtgcgaa
              Domestic goat  ttgtgtgaa
B D                   Horse  gtgtgcgag
B D        White rhinoceros  ctatgggag
B D                     Cat  ctgtgtgac
B D                     Dog  ctgtgtgat
B D                 Ferret   ctgcgggac
B D                   Panda  ctgtgggat
             Pacific walrus  ctgtgggac
               Weddell seal  ctgtgggac
           Black flying-fox  ctgtgcaag
B D                 Megabat  ctgtgcaag
              Big brown bat  atgtgcggg
       David's myotis (bat)  ttgtgcgag
B D                Microbat  ctgtgcgag
B D                Hedgehog  ct------a
B D                   Shrew  ctgtagcag
            Star-nosed mole  ctgggcctg
B D                Elephant  ctagaggag
        Cape elephant shrew  gta------
B D                 Manatee  ctatttgaa
           Cape golden mole  ctgtttgga
B D                  Tenrec  ctgtctaga
                   Aardvark  ttatgggag
B D               Armadillo  ctggggtag
    Lesser Egyptian jerboa  ---------
B D         Tasmanian devil  =========

Inserts between block 12 and 13 in window
B D               Elephant 217bp
                  Aardvark 202bp
B D              Armadillo 16bp

Alignment block 13 of 965 in window, 110873563 - 110873620, 58 bps 
B D                   Human  atg-----acatt----------------------ggggagatttccta------------tgtgctc-t
B D                   Chimp  atg-----acatt----------------------ggggagatttccta------------tgtgctc-t
B D                 Gorilla  atg-----acatt----------------------ggggagatttccta------------tgtgctc-t
B D               Orangutan  atg-----acact----------------------ggggagatttccta------------tgtgctc-t
B D                  Gibbon  atg-----acatt----------------------ggggagatttccta------------tgtgctc-t
B D                  Rhesus  atg-----acaat----------------------ggggagatttccta------------tgtgctc-t
B D     Crab-eating macaque  atg-----acaat----------------------ggggagatttccta------------tgtgctc-t
B D                  Baboon  atg-----acaat----------------------ggggagatttccta------------tgtgctc-t
B D            Green monkey  atg-----acaat----------------------ggggagatttccta------------tgtgctc-t
B D                Marmoset  atg-----acact----------------------ggggagatttcctg------------tgtgctc-t
B D         Squirrel monkey  atg-----acact----------------------ggggagatttccta------------tgtgctc-t
B D                Bushbaby  atg-----gagtt----------------------ggagagattttcta------------tgtgctctt
         Chinese tree shrew  aag--------tt----------------------agggagatttcctg------------tgttctc-t
B D                Squirrel  agga----agtta----------------------ggggagatttccta------------tgtgcgt-a
               Prairie vole  gcgag---aaatg----------------------ggggagatcttctc------------tgttgct-g
B D         Chinese hamster  atgagttgaaatg----------------------ggagagatcttcta------------tgctgct-t
             Golden hamster  atgagtttacatg----------------------ggagagatcttcta------------tgctgtt-t
B D                   Mouse  atgagatgaaatt----------------------ggggagatcttcta------------tgttgtt-t
B D                     Rat  atgagatgaaatt----------------------gggaaaatcttctg------------tgttgtt-t
B D          Naked mole-rat  atg-----aagtt----------------------ggggagatttccta------------tgtgctt-t
B D              Guinea pig  atg-----aagtt----------------------ggaaagatttctta------------tgtgctt-t
                 Chinchilla  atg-----aagtt----------------------ggggagatttccta------------tgtgctt-t
           Brush-tailed rat  ttg-----aagtt----------------------caggagatttccta------------tgtactt-t
B D                  Rabbit  atg-----aagtt----------------------ggaacgatttcct-------------tgtgctc-a
B D                    Pika  atg-----aagtt----------------------gagaagatttcct-------------tgtactc-t
B D                     Pig  ttg-----aagtt----------------------ggagagatttccta------------tgtgctc-t
B D                  Alpaca  atg-----aaact----------------------gggggaacttccta------------cctgctg-t
             Bactrian camel  atg-----aagct----------------------gggggaacttccta------------catgctg-t
B D                 Dolphin  atg-----aagct----------------------ggggaaatttccta------------catgtgc-t
               Killer whale  atg-----aagct----------------------ggggagatttccta------------catgtgc-t
           Tibetan antelope  atg-----aaact-----------------------ggaagatttccta------------cttgatc-t
B D                     Cow  atg-----aaact-----------------------ggaagatttccta------------cttgatc-t
B D                   Sheep  atg-----aaact-----------------------ggaagatttccta------------cttgatc-t
              Domestic goat  atg-----aaact-----------------------ggaagatttccta------------cttgatc-t
B D                   Horse  atg-----aagtt----------------------ggggagatttctta------------catgctc-t
B D        White rhinoceros  atg-----aagtt----------------------ggggagatttccta------------catgttc-c
B D                     Cat  atg-----aaatt----------------------gtggagatttcata------------catgttc-a
B D                     Dog  atg-----atatt----------------------ggggagatttcata------------catgctc-a
B D                 Ferret   atg-----acatt----------------------ggggagatttcata------------catgctc-a
B D                   Panda  gtg-----acgct----------------------ggggagatttcata------------catgctc-a
             Pacific walrus  atg-----atatt----------------------ggggagatttcata------------catactt-a
               Weddell seal  atg-----acgtt----------------------ggggagatttcata------------catactt-a
           Black flying-fox  atg-----aagtt----------------------ggagagattttcta------------catgctc-t
B D                 Megabat  atg-----aaatt----------------------ggagagattttcta------------catgctc-t
              Big brown bat  atg-----aagcg----------------------ggggccacctcctg---------------------
       David's myotis (bat)  atg-----aagctgggcggactcctacaggcccctgggcccacctccta------------cagg-cc-c
B D                Microbat  atg-----aagct---------------ggcccctggggcgacctccta------------caggccc-c
B D                Hedgehog  ata-----aagtt----------------------gaggagattttcta------------tatatgc-t
B D                   Shrew  atg-----at-tt----------------------ggggagatttccat------------catgttc-t
            Star-nosed mole  atg-----atgtt----------------------ggagacattttc-----------------------
B D                Elephant  atg-----aaact----------------------ggggagatttcttc------------tgtgctg-t
        Cape elephant shrew  atg-----aaact----------------------ggagaaagttccta------------tgtac----
B D                 Manatee  atg-----aaact----------------------ggggagatttcctg------------tgtgctc-t
           Cape golden mole  atg-----aaact----------------------aggggagatttgtgtgtgtgtgtgtgtgtgctt-c
B D                  Tenrec  atg-----aaact----------------------aggaga--------------------tgtccta-t
                   Aardvark  atg-----aaact----------------------gggaagatttccta------------ttaactt-t
B D               Armadillo  atg-----gagct----------------------gggaagattcccca------------tgtgctt-t
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  ----ggtc-------t-tcag-aaa------attggtcttgtga-ttt
                      Chimp  ----ggtc-------t-tcag-aaa------attggtcttgtga-ttt
                    Gorilla  ----ggtc-------t-tcag-aaa------attggtcttgtga-ttt
                  Orangutan  ----ggtc-------t-tcag-aaa------atcggtcttgtga-ttt
                     Gibbon  ----ggtc-------t-tcag-aag------actggtcttgtga-ttt
                     Rhesus  ----ggtt-------t-tcag-aaa------attggccttgtga-ttt
        Crab-eating macaque  ----ggtt-------t-tcag-aaa------attggccttgtga-ttt
                     Baboon  ----ggtt-------t-tcag-aaa------attggccttgtga-ttt
               Green monkey  ----ggtt-------t-tcag-aaa------attggccttgtga-ttt
                   Marmoset  ----ggtc-------t-tcag-aaa------attggtcttgtgatttt
            Squirrel monkey  ----ggtc-------t-tcag-aaa------attggccttgtga-ttt
                   Bushbaby  ----ggtc-------t-tttg-aaa------attggttgtgtga-ttt
         Chinese tree shrew  ----ggtc-------t-ttag-aaa------actagtcttgtga-ttt
                   Squirrel  ----gttc-------t-ttga-aaattgttttttttttttttga-ttt
               Prairie vole  ----gtgc-------t-ttag-aaa------acttgagttttga-ctt
            Chinese hamster  ----tttc-------t-ttag-aaa------acttgaattttga-ttt
             Golden hamster  ----gttc-------t-ttca-aaa------acttgaattttga-ttt
                      Mouse  ----tttc-------t-tca--aaa------acttgaagtttca-ttt
                        Rat  ----attc-------t-ttag-aaa------acttggagtttca-ttt
             Naked mole-rat  ----tgtc-------t-ttac-aga------actggacttgtgatttt
                 Guinea pig  ----tgtc-------t-tcag-aaa------attgatcttgtgatttt
                 Chinchilla  ----tgtc-------t-ttag-aag------attggtcttgtgatttt
           Brush-tailed rat  ----tgtc-------t-ttag-aag------attggtcttgtgatttt
                     Rabbit  ----ggtc-------t-ttag-aaa------atcggtcttgtga-ttt
                       Pika  ----agtc----------cag-aaa------atcaatcttggga-gtt
                        Pig  ----gttt-------g-ttaacaag------actggtcttgtaa----
                     Alpaca  ----ggtc-------t-ttag-aaa------gttcatcttgtga-ttt
             Bactrian camel  ----ggtc-------t-ttag-aaa------gttcatcttgtga-ttt
                    Dolphin  ----gatc-------t-tcag-aag------atttgtcttgtgatttt
               Killer whale  ----gatc-------t-tcag-aag------atttgtcttgttatttt
           Tibetan antelope  ----ggtc-------t-ttag-aag------attggtcttataa-ttt
                        Cow  ----ggtt-------t-ttag-aag------attggtcttgtaa-ttt
                      Sheep  ----ggtc-------t-ttag-aag------actggtcttgtaa-ttt
              Domestic goat  ----ggtc-------t-ttag-aag------actggtcttgtaa-ttt
                      Horse  ----ggtc-------t-tcag-aag------actggttttgtga-tgt
           White rhinoceros  ----ggtc-------t-ttag-aag------atgggtcttgtga-ttt
                        Cat  ----ggtc-------tcttag-aag------accgatcttgtga-ttt
                        Dog  ----ggtc-------tcttag-aag------cctgattttgtga-ttt
                    Ferret   ----ggtc-------tcttag-tag------atagatcttgtga-ttt
                      Panda  ----ggtc-------tcttaa-aag------attaatctcgtga-ttt
             Pacific walrus  ----ggtc-------tcttag-aag------attgatcttgtga-ttt
               Weddell seal  ----ggtc-------tcttag-aag------actgatcttgtga-ttt
           Black flying-fox  ----ggtc-------t-ttag-aag------attggttttgtaa-ttt
                    Megabat  ----ggtc-------t-ttag-aag------attggttttgtaa-ttt
              Big brown bat  ----ggtc-------g-ttag-gag------acgggttttgtga-ttt
       David's myotis (bat)  ggtcggtc-------g-ttgg-gag------atgggtctggtga-ttt
                   Microbat  ggtcggta-------g-ttgg-gag------atgggtctggtga-ctt
                   Hedgehog  ----aatc-------t-ttaa-aag------tctagtctaataa-tta
                      Shrew  ----ggct-------t-ttag-aag------agtggttttataa-ttt
            Star-nosed mole  ---------------t-caaa-aat------tctggtcttgtta-ttt
                   Elephant  ----ggtc-------t-ttag-aag------actggtcttgtga-ttt
        Cape elephant shrew  ------tc-------t-tcag-aag------attgcttttg----ttt
                    Manatee  ----ggtc-------t-ttag-aaa------attggtcttgtga-ttt
           Cape golden mole  ----agga-------t-ttag-aag------actgatcttgtgatttt
                     Tenrec  ----aggaggtcgtct-ttag-aag------attggtcttgtga--tt
                   Aardvark  ----ggtc-------t-ttag-aag------gttcatcttgtga-ttt
                  Armadillo  ----ggtc------------------------------ttgtga-ttt
     Lesser Egyptian jerboa  ------------------------------------------------
            Tasmanian devil  ================================================

Inserts between block 13 and 14 in window
B D               Bushbaby 1444bp

Alignment block 14 of 965 in window, 110873621 - 110873655, 35 bps 
B D                   Human  --ta-aagtga------------------ggaaag--aa-----cccacagcc-----------------
B D                   Chimp  --ta-aagt-a------------------agaaag--aa-----cccacagcc-----------------
B D                 Gorilla  --ta-aggtga------------------ggaaag--aa-----cccacagcc-----------------
B D               Orangutan  --ta-aagtga------------------ggaaag--aa-----cccacagcc-----------------
B D                  Gibbon  --ta-aagtga------------------ggaaag--aa-----cccacatcc-----------------
B D                  Rhesus  --ta-aagtga------------------ggaaag--ag-----cccacagcc-----------------
B D     Crab-eating macaque  --ta-aagtga------------------ggaaag--ag-----cccacagtc-----------------
B D                  Baboon  --ta-aagtga------------------ggaaag--aa-----cccacagcc-----------------
B D            Green monkey  --ta-aagtga------------------ggaaag--aa-----cccacagcc-----------------
B D                Marmoset  --ta-aagtga------------------ggaaag--aa-----cccacagcc-----------------
B D         Squirrel monkey  --ta-aaatga------------------ggaaag--aa-----cccacagcc-----------------
         Chinese tree shrew  --tg-aactgc------------------agcgag--aa-----cctgcagcc-----------------
B D                Squirrel  --tt-agat---------------------gagag--aa-----ttcatagcc-----------------
               Prairie vole  --ta-aagtgg------------------ggagag--ag-----gtaatagct-----------------
B D         Chinese hamster  --ta-aagtgg------------------tgagag--aa-----gtaata--------------------
             Golden hamster  --ta-aagtgg------------------ggagag--aa-----gtaata--------------------
B D                   Mouse  --ta-gagcag------------------ggagga--aa-----atcataacc-----------------
B D                     Rat  --ta-aagaag------------------gggaga--aa-----atcatagcc-----------------
B D          Naked mole-rat  --ta-aagtgg------------------gaagaa--aa-----ctcatactc-----------------
B D              Guinea pig  --ta-aagtgg------------------gatgaa--aa-----ctcacag-------------------
                 Chinchilla  --ta-aagtag------------------gacaaa--aa-----ctctcagtc-----------------
           Brush-tailed rat  --ta-aagtag------------------gaagaa--ac-----cttacagtc-----------------
B D                  Rabbit  --ta-aagtga------------------ggagag--aa-----ctcacggct-----------------
B D                    Pika  --tc-agatga------------------agcaag--aa-----gcca---cc-----------------
B D                     Pig  -------gtga------------------gcagag--aa-----ccaacagac-----------------
B D                  Alpaca  --ta-aagtga------------------ggagag--aa-----acaacagct-----------------
             Bactrian camel  --ta-aagtga------------------ggagag--ga-----tcaacagcc-----------------
B D                 Dolphin  --ta-aagtga------------------gcagag--aa-----caaacagtc-----------------
               Killer whale  --ta-aagtga------------------gcagag--aa-----caaacagtc-----------------
           Tibetan antelope  --ta-aagtga------------------gcagag--aa-----ccaacagct-----------------
B D                     Cow  --ta-aagtga------------------gcagag--aa-----ccaacagct-----------------
B D                   Sheep  --ta-aagtga------------------gcagag--aa-----ccaacagct-----------------
              Domestic goat  --ta-aagtga------------------gcagag--aa-----ccaacagct-----------------
B D                   Horse  --ta-aaatga------------------ggagag--aa-----ccaacagcc-----------------
B D        White rhinoceros  --ta-aagtga------------------ggagag--aa-----ccaatagcc-----------------
B D                     Cat  --ta-aggtga------------------ggagag--ag-----ccaacagcc-----------------
B D                     Dog  --ta-aagtga------------------ggagag--aa-----ccaacagcc-----------------
B D                 Ferret   --ta-gagtga------------------ggagag--aa-----ctaacggcc-----------------
B D                   Panda  --ta-gagtga------------------ggaggg--aa-----ctgacggcc-----------------
             Pacific walrus  --ta-gagtga------------------ggagag--aa-----ccaatggcc-----------------
               Weddell seal  --ta-gagtga------------------ggagag--aa-----ccaacggcc-----------------
           Black flying-fox  --ta-aagtgc------------------gaagag--aa-----ccaacaacc-----------------
B D                 Megabat  --ta-aagtgc------------------gaagag--aa-----ccaacaacc-----------------
              Big brown bat  --ttgaaggga------------------gcagag--ag-----ccaacagcc-----------------
       David's myotis (bat)  --tc-aagtga------------------ccagag--aaccaacccagcagcc-----------------
B D                Microbat  --tc-aagtga------------------gcagag--aa-----ccagcagcc-----------------
B D                Hedgehog  --ta-tacagatattgtatgtgcctgatgaaagag--aa-----accaaagcccaactggacactgggaa
B D                   Shrew  --ca-aagtga------------------gaaaag--aa-----ccaaaagc------------------
            Star-nosed mole  --tt-aaacga------------------agagag--ac-----ctgacagct-----------------
B D                Elephant  taaa-aagtaa------------------gaagag--aa-----ccaacagcc-----------------
        Cape elephant shrew  taaa-aagtaa------------------ggaaag--aa-----ccaatagtc-----------------
B D                 Manatee  taaa-aagtaa------------------ggggag--aa-----gcaacagcc-----------------
           Cape golden mole  taaa-aagtaa------------------ggaaat--aa-----ccaacagat-----------------
B D                  Tenrec  taaa-atgtaa------------------agagag--aa-----ccaccaggc-----------------
                   Aardvark  aaaa-atgtaa------------------ggagagaaaa-----acaacagcc-----------------
B D               Armadillo  tcaa-ggg--a------------------gaagaa--aa-----ccaatagct-----------------
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D                Bushbaby  ======================================================================

                      Human  ----------------------------------------------------------------------
                      Chimp  ----------------------------------------------------------------------
                    Gorilla  ----------------------------------------------------------------------
                  Orangutan  ----------------------------------------------------------------------
                     Gibbon  ----------------------------------------------------------------------
                     Rhesus  ----------------------------------------------------------------------
        Crab-eating macaque  ----------------------------------------------------------------------
                     Baboon  ----------------------------------------------------------------------
               Green monkey  ----------------------------------------------------------------------
                   Marmoset  ----------------------------------------------------------------------
            Squirrel monkey  ----------------------------------------------------------------------
         Chinese tree shrew  ----------------------------------------------------------------------
                   Squirrel  ----------------------------------------------------------------------
               Prairie vole  ----------------------------------------------------------------------
            Chinese hamster  ----------------------------------------------------------------------
             Golden hamster  ----------------------------------------------------------------------
                      Mouse  ----------------------------------------------------------------------
                        Rat  ----------------------------------------------------------------------
             Naked mole-rat  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
                 Chinchilla  ----------------------------------------------------------------------
           Brush-tailed rat  ----------------------------------------------------------------------
                     Rabbit  ----------------------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  ----------------------------------------------------------------------
                     Alpaca  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                    Dolphin  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
           Tibetan antelope  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
              Domestic goat  ----------------------------------------------------------------------
                      Horse  ----------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                    Ferret   ----------------------------------------------------------------------
                      Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------
                   Hedgehog  tcaaacccagggctgcatgcatgcaaggtatgtactctacctcttgggccacctttctcagctctgacct
                      Shrew  ----------------------------------------------------------------------
            Star-nosed mole  ----------------------------------------------------------------------
                   Elephant  ----------------------------------------------------------------------
        Cape elephant shrew  ----------------------------------------------------------------------
                    Manatee  ----------------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  ----------------------------------------------------------------------
                  Armadillo  ----------------------------------------------------------------------
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================
                   Bushbaby  ======================================================================

                      Human  ----aga---gctgt--------ct
                      Chimp  ----aga---gctgt--------ct
                    Gorilla  ----aga---gctgt--------ct
                  Orangutan  ----aga---gctgt--------ct
                     Gibbon  ----aga---gctgt--------ct
                     Rhesus  ----aga---gctgt--------ct
        Crab-eating macaque  ----aga---gctgt--------ct
                     Baboon  ----aga---gctgt--------ct
               Green monkey  ----aga---gctgt--------ct
                   Marmoset  ----aga---gctgt--------ct
            Squirrel monkey  ----aga---gctgt--------ct
         Chinese tree shrew  ----aga---gcca----------t
                   Squirrel  ----aga---gccat----------
               Prairie vole  ----gga---gtgat----------
            Chinese hamster  -----ga---gtgat----------
             Golden hamster  -----ga---gtgag--ttcttt--
                      Mouse  ----aga---gtgat----------
                        Rat  ----tga---gtgat----------
             Naked mole-rat  ----aga---gccat----------
                 Guinea pig  ------a---gccat----------
                 Chinchilla  ----aga---gccat----------
           Brush-tailed rat  ----aaa---gagat----------
                     Rabbit  ----gga---gccat----------
                       Pika  ----aga---gccat----------
                        Pig  ----aga---gccattt--------
                     Alpaca  ----aga---gccat----------
             Bactrian camel  ----aga---gccat----------
                    Dolphin  ----ata---gttat----------
               Killer whale  ----ata---gttat----------
           Tibetan antelope  ----aga---actat----------
                        Cow  ----aga---actat----------
                      Sheep  ----aga---actat----------
              Domestic goat  ----aga---actat----------
                      Horse  ----gga---gccat----------
           White rhinoceros  ----aga---gccat----------
                        Cat  ----aga---gcc-t----------
                        Dog  ----aga---gccat----------
                    Ferret   ----aga---gccat----------
                      Panda  ----aga---gccct----------
             Pacific walrus  ----aga---accat----------
               Weddell seal  ----aga---gccat----------
           Black flying-fox  ----aga---gccat----------
                    Megabat  ----aga---gccat----------
              Big brown bat  ----aga---gccgt----------
       David's myotis (bat)  ----aggaaaggcag----------
                   Microbat  ----agg---gccat----------
                   Hedgehog  tttaata---tttat----------
                      Shrew  ----aga---actat----------
            Star-nosed mole  ----gga---gccat----------
                   Elephant  ----aga---gccat----------
        Cape elephant shrew  ----agc---atcat----------
                    Manatee  ----aga---gccat----------
           Cape golden mole  ----agg---gtcat----------
                     Tenrec  ----aga---gccat----------
                   Aardvark  ----aga---gccat----------
                  Armadillo  ----aga---gtcat----------
     Lesser Egyptian jerboa  -------------------------
            Tasmanian devil  =========================
                   Bushbaby  =========================

Inserts between block 14 and 15 in window
            Golden hamster 2456bp
B D                    Pig 147bp

Alignment block 15 of 965 in window, 110873656 - 110873693, 38 bps 
B D                   Human  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D                   Chimp  ttagaaagacagctaga------ag----------------------a--c-acagttccttttcatt--
B D                 Gorilla  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D               Orangutan  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D                  Gibbon  ttagaaagacagctaga------ag----------------------a--c-acagtattttttcatt--
B D                  Rhesus  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D     Crab-eating macaque  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D                  Baboon  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D            Green monkey  ttagaaagacagctaga------ag----------------------a--c-acagttctttttcatt--
B D                Marmoset  ttagaaagacagctagg------ag----------------------a--c-gcagttctttttcatt--
B D         Squirrel monkey  ttagaaagacagctagg------ag----------------------a--c-gcagttctttttcatt--
         Chinese tree shrew  taggaaaggcagttagg------ag----------------------a--t-gtggatc---ttcatt--
B D                Squirrel  tcagaaaggcagcgggg------ag----------------------aggt-gga--ccttctccact--
               Prairie vole  ttagaacagtagccacg------ag----------------------a--t-gta--ttgtcttcatc--
B D         Chinese hamster  ttagcacagtagccagg------ag----------------------a--t-aca--ttgtcttcatc--
             Golden hamster  ttagaacagtaggcagg------ag----------------------a--t-aca--ttgtcttcatc--
B D                   Mouse  ttagaacagtagccaga------ag----------------------a--c-atg--ttgtctttgtt--
B D                     Rat  ttagagcagttgccagg------ag----------------------a--t-gta--ttgccttcatt--
B D          Naked mole-rat  ttagaaaggcagctggg------ag----------------------a--t-gtagatgtttcct-tt--
B D              Guinea pig  ttagaaaggcagctggg------ag----------------------t--t-gtagctcttcttcatt--
                 Chinchilla  ttagaaaggcagctggg------ag----------------------a--t-gtagctcttccccatt--
           Brush-tailed rat  gtagaaaggcagctggg------aa----------------------a--t-gtagctcttccccatt--
B D                  Rabbit  gtagaaagaccgctggg------ag----------------------a--c-gtgggtcttcttcatt--
B D                    Pika  ttggggaggctgctggg------ag----------------------a--t-gtggatctcgttcatt--
B D                     Pig  ataaataggtggctggg------ag----------------------a--t-gcagatctttttcatt--
B D                  Alpaca  ttaaaaaggcagcaggg------ag----------------------a--t-gcagatcttcttcatt--
             Bactrian camel  ttaaaaaggcagcaggg------ag----------------------g--t-gcagatcttcttcatt--
B D                 Dolphin  tttaaaaggtagctggg------ag----------------------a--t-gcagatcttcttcatc--
               Killer whale  tttaaaaggtagctggg------ag----------------------a--t-gcagatcttcttcatc--
           Tibetan antelope  tctaaaaggcagctggg------ag----------------------a--t-gcagatcttcttaatt--
B D                     Cow  tctaaaaggcaactggg------ag----------------------a--t-gcagatcttcttaatt--
B D                   Sheep  tctaaaaggcagctggg------ag----------------------a--t-gcagatcttcttaatt--
              Domestic goat  tctaaaaggcagctggg------ag----------------------a--t-gcagatcttcttaatt--
B D                   Horse  ttagaaaggcagctgtg------ag----------------------a--t-gcaggtctttttcatt--
B D        White rhinoceros  ttagaaaggcagctgag------ag----------------------a--t-acaggtctttttcatt--
B D                     Cat  taagaaaggcagccgga------ag----------------------a--tggcag---ttcttaatt--
B D                     Dog  ttagaaaggcagctggg------ag----------------------a--tggcag---ttcttaatt--
B D                 Ferret   ttagaaaggcagctggg------ag----------------------a--tggcag---ttcttcatt--
B D                   Panda  ttagaatggcagctggg------ag----------------------a--cggcag---ttctgaatt--
             Pacific walrus  ttagagaggcagttggg------ag----------------------a--tggcag---ttcttaatt--
               Weddell seal  ttagagaggcagttggg------ag----------------------a--tggcag---ttcttaatt--
           Black flying-fox  ttagaaaggtaatcgag------ag----------------------a--t-gtaggtctacttcatc--
B D                 Megabat  ttagaaaggtaaccgag------ag----------------------a--t-gtaggtctacttcatc--
              Big brown bat  ctggaaaggcagctggg------aa-------------------------c-gcaggtcttctgcgcg--
       David's myotis (bat)  ctggaaaggcagctgga------ag-------------------------c-gcaggtcttctgcgca--
B D                Microbat  ttggaaaggcagctggg------ag-------------------------c-gcaggtcttctgcgtg--
B D                Hedgehog  ttagacaagcagagaga------gagagagacagagagagacatgaca--c-ccaagcttccttcaatga
B D                   Shrew  ttagaaaatcagctaga------ag----------------------a--t-tcaggccttcatcac---
            Star-nosed mole  ttagaaaagcagcgagg------tg----------------------a--c-gcaggtcttcttcact--
B D                Elephant  ttagaagggcacctgggagtctgaa----------------------a--t-gtgagtcttgttcatt--
        Cape elephant shrew  ttcaaagggcagcttgacttttcaa----------------------a--t-gggagttttgtttact--
B D                 Manatee  ttagaaaggcacctgggcatttgaa----------------------a--t-gtgagtcttgttcatt--
           Cape golden mole  ttataaaggcagcttggcttctgag----------------------a--t-ataggccttgttcatt--
B D                  Tenrec  ttagaaagacagttgggagtttgag----------------------a--c-acgggtcctgttcatt--
                   Aardvark  ttagaaaagtcatggggcatttggg----------------------a--t-gtggggcttgctcatt--
B D               Armadillo  ttagaaaggtaactgggagtttgag----------------------a--t-gctagtcttcttcatg--
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D                Bushbaby  ======================================================================

                      Human  ----t
                      Chimp  ----t
                    Gorilla  ----t
                  Orangutan  ----t
                     Gibbon  ----t
                     Rhesus  ----t
        Crab-eating macaque  ----t
                     Baboon  ----t
               Green monkey  ----t
                   Marmoset  ----t
            Squirrel monkey  ----t
         Chinese tree shrew  ----c
                   Squirrel  ----t
               Prairie vole  ----t
            Chinese hamster  ----a
             Golden hamster  ----a
                      Mouse  ----t
                        Rat  ----t
             Naked mole-rat  ----t
                 Guinea pig  ----t
                 Chinchilla  ----t
           Brush-tailed rat  ----t
                     Rabbit  ----t
                       Pika  ----a
                        Pig  ----t
                     Alpaca  ----t
             Bactrian camel  ----t
                    Dolphin  ----t
               Killer whale  ----t
           Tibetan antelope  ----t
                        Cow  ----t
                      Sheep  ----t
              Domestic goat  ----t
                      Horse  ----t
           White rhinoceros  ----t
                        Cat  ----t
                        Dog  ----c
                    Ferret   ----c
                      Panda  ----t
             Pacific walrus  ----c
               Weddell seal  ----c
           Black flying-fox  ----t
                    Megabat  ----t
              Big brown bat  ----g
       David's myotis (bat)  ----t
                   Microbat  ----t
                   Hedgehog  gttaa
                      Shrew  -----
            Star-nosed mole  ----a
                   Elephant  ----t
        Cape elephant shrew  ----t
                    Manatee  ----t
           Cape golden mole  ----t
                     Tenrec  ----t
                   Aardvark  ----t
                  Armadillo  ----t
     Lesser Egyptian jerboa  -----
            Tasmanian devil  =====
                   Bushbaby  =====

Alignment block 16 of 965 in window, 110873694 - 110873745, 52 bps 
B D                   Human  g--a-gaaa-atttcaaa----agtaaatttagtg-----ac-------------tcccactgtggttct
B D                   Chimp  g--a-gaaa-atttcaaa----agtaaatttagtg-----ac-------------tcccactgtggttct
B D                 Gorilla  g--a-gaaa-atttcaaa----agtaaatttagtg-----ac-------------tcccactgtggttct
B D               Orangutan  g--a-gaaa-atttcaaa----agtaaatttagtg-----ac-------------tcccactgtggttct
B D                  Gibbon  g--a-gaaa-atttcaaa----agtaaatttagtg-----ac-------------tcccactgtggttct
B D                  Rhesus  g--a-gaaa-ttttctaa----agttaagttagtg-----ac-------------------------tct
B D     Crab-eating macaque  g--a-gaaa-ttttctaa----agttaagttagtg-----ac-------------------------tct
B D                  Baboon  g--a-gaaa-ttttctaa----agttaagttagtg-----ac-------------------------tct
B D            Green monkey  g--a-gaaa-ttttctaa----agttaagttagtg-----ac-------------------------tct
B D                Marmoset  g--a-gaaa-ttttcaaa----agtaaagttag----------------------tcccgctgtgattct
B D         Squirrel monkey  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------tcccagtgtgattct
B D                Bushbaby  g--a-gaaa-tttacaaa----attaaagtgagtg-----at-------------tcccattgtgattcc
         Chinese tree shrew  g--a-gaaa-ttttttaa----aacaaacttagtg-----ac-------------ttccaccgtgactct
B D                Squirrel  g--a-gaaa-ttttca----------aagtctgtg----act--------------cccactgtgatttc
               Prairie vole  g--a-aaac-attttata----agggaagttagtg-----ct--------------ctgaccattgtgtt
B D         Chinese hamster  g--a-aaac-attttata----aggaaagttgatg-----ct--------------ctgactgtcatgct
             Golden hamster  g--a-aaac-attttata----aggaaagttggtg-----ct--------------ctgactgtcatgct
B D                   Mouse  g--a-aaac-atttta-a----aggaaagttagtg-----ct--------------gagaatgtcatgtt
B D                     Rat  gaaa-aaaa-atttaa-a----aggaaagttagtg-----ct--------------gtgactgtcatgtt
B D          Naked mole-rat  g--a-gaaa-ttttca-a----aagtaaagagcca-----ct----------------------------
B D              Guinea pig  g--a-gaaa-ttttca-a----aaataaagagata-----ct----------------------------
                 Chinchilla  g--a-gaaa-ttttca-a----aagtaaagaggca-----ct----------------------------
           Brush-tailed rat  c--a-gaaa-ttttca-a----aagtaatgagact-----ct----------------------------
B D                  Rabbit  g--a-gaaa-cattcaaa----agggaagttagtg-----at-------------ttccactgtgactcc
B D                    Pika  g--g-gaaa-tttcctaa----atgaaaattattg-----at-------------------------tcc
B D                     Pig  g--a-gagc-attttgag----agtgaagttagtg-----ac-------------ccccactgtgattcc
B D                  Alpaca  g--a-gaaa-tttc----------aagagttagtg-----ac-------------tcgcactgtgattcc
             Bactrian camel  g--a-gaaa-tttc----------tagagttagtg-----ac-------------tcgcactgtgattcc
B D                 Dolphin  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------tcccactgtgattcc
               Killer whale  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------tcccactgtgattcc
           Tibetan antelope  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------------------tcc
B D                     Cow  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------------------tcc
B D                   Sheep  g--a-gaaa-ttttcaaa----agtacagttagtg-----ac-------------------------tcc
              Domestic goat  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------------------tcc
B D                   Horse  g--a-gaaa-ttttcaaa----agtaaagttagtg-----aa-------------tctcactgtgattcc
B D        White rhinoceros  g--a-gaaa-ttttcaaa----agtaaagttagtg-----ac-------------tctcactgtgtttcc
B D                     Cat  t--a-caaa-ttttta-----------------tg-----aa-------------tctcactgtgattcc
B D                     Dog  a--a-caag-ttttca-----------------tgttgaatt-------------cctcactgtgattcc
B D                 Ferret   a--a-ccaa-ttttca-----------------tg-----cc-------------tcttactgtgattct
B D                   Panda  g--a-ccaa-ttttca-----------------tg-----ac-------------tctcactgcgattcc
             Pacific walrus  g--a-tcag-ttttca-----------------tg-----ac-------------tctcactgtgattcc
               Weddell seal  a--a-tcag-ttttca-----------------tg-----ac-------------tctcactgtgattcc
           Black flying-fox  g--aggaaa-cttcaa-a----tgtaaatttagta-----ac-------------tcctactgtgattcc
B D                 Megabat  g--aggaaa-cttcaa-a----tgtaaatttagta-----ac-------------tcctactgtgattcc
              Big brown bat  g--a-gaaa-tttcca-a----agtcaagtcagcg-----gt-------------tcccgctgtgatggc
       David's myotis (bat)  g--a-gcaa-tttcca-a----agtcaagtcaatg-----gc-------------tcccgctgtgaggcc
B D                Microbat  g--a-gaaa-tttcca-a----agtcaagtcagtg-----gc-------------tcccgctgtgaggcc
B D                Hedgehog  g--g-gaca-ggatcaaactaggtaacatacaggg-----gtaagcagcacactatccaagagctatt-t
B D                   Shrew  ---a-gaaa-ttgtctaa----agtatatatagtg-----ac-------------tctcattgtaattgc
            Star-nosed mole  g--a-gaaa-tgttcaaa----tctcaagcttgtg-----at-------------tctcattacgatt-c
B D                Elephant  g--a-aaaa-atttcaaa----agcaaacttagtg-----ac-------------tcccagtgcagttcc
        Cape elephant shrew  g--a-aaaatgattgaaa----atcaaatttagta-----ac-------------tcccatcacatttcc
B D                 Manatee  g--a-aaaa-aattcaaa----agcaaacttagtg-----ac-------------tcccactgcagttcc
           Cape golden mole  g--g-ggaaaagttcaaa----agcaaacctagtg-----ac-------------tcacactacaattcc
B D                  Tenrec  g--a-aacaaatttcaat----agcagacttcatg-----ac-------------gcccacaacatttcc
                   Aardvark  g--a-aaaa-aattcaaa----agtaaacttagtg-----ac-------------tctcactgcagttcc
B D               Armadillo  g--a-gaag-ttttcaaa----aataaaagtagtg-----at-------------atgcacggtgattcc
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  tcaaagcc
                      Chimp  tcaaagcc
                    Gorilla  tcaaagcc
                  Orangutan  tcaaagcc
                     Gibbon  tcagagcc
                     Rhesus  tcaaagcc
        Crab-eating macaque  tcaaagcc
                     Baboon  tcaaagcc
               Green monkey  tcaaagcc
                   Marmoset  tcaaagcc
            Squirrel monkey  tcaaggcc
                   Bushbaby  ttagatcc
         Chinese tree shrew  tcagagcc
                   Squirrel  tca-----
               Prairie vole  ttg-----
            Chinese hamster  ttg-----
             Golden hamster  ttg-----
                      Mouse  ttg-----
                        Rat  ttg-----
             Naked mole-rat  --------
                 Guinea pig  --------
                 Chinchilla  --------
           Brush-tailed rat  --------
                     Rabbit  ccacagcc
                       Pika  ccacagac
                        Pig  tcagagac
                     Alpaca  tcagagcc
             Bactrian camel  tcagagcc
                    Dolphin  tcagagac
               Killer whale  tcagagac
           Tibetan antelope  tgagagac
                        Cow  tcagagac
                      Sheep  tgagagac
              Domestic goat  tgagagac
                      Horse  tcacagcc
           White rhinoceros  tcacagcc
                        Cat  tcagagcc
                        Dog  tcagagcc
                    Ferret   tcagagcc
                      Panda  tcaaagcc
             Pacific walrus  tcagagcc
               Weddell seal  tcagagcc
           Black flying-fox  tcagagcc
                    Megabat  tcagagcc
              Big brown bat  tcagagcc
       David's myotis (bat)  tcagagcc
                   Microbat  tcagagcc
                   Hedgehog  ccccagcc
                      Shrew  tcagaggc
            Star-nosed mole  ccaca---
                   Elephant  tcagagac
        Cape elephant shrew  tcagagac
                    Manatee  tcagagac
           Cape golden mole  tcagagac
                     Tenrec  ttagagat
                   Aardvark  tcagaaac
                  Armadillo  tcagagtc
     Lesser Egyptian jerboa  --------
            Tasmanian devil  ========

Inserts between block 16 and 17 in window
       Cape elephant shrew 443bp

Alignment block 17 of 965 in window, 110873746 - 110873749, 4 bps 
B D                   Human  ac-ta
B D                   Chimp  ac-ta
B D                 Gorilla  ac-ta
B D               Orangutan  ac-ta
B D                  Gibbon  ac-ta
B D                  Rhesus  ac-ta
B D     Crab-eating macaque  ac-ta
B D                  Baboon  ac-ta
B D            Green monkey  ac-ta
B D                Marmoset  ac-ta
B D         Squirrel monkey  ac-ta
B D                Bushbaby  ac-tg
         Chinese tree shrew  acaaa
B D                Squirrel  ----g
               Prairie vole  ----a
B D         Chinese hamster  ----a
             Golden hamster  ----g
B D                   Mouse  ----a
B D                     Rat  ----g
B D          Naked mole-rat  ----a
B D              Guinea pig  ----a
                 Chinchilla  ----a
           Brush-tailed rat  ----g
B D                  Rabbit  gc-ta
B D                    Pika  ac-ta
B D                     Pig  ac-ta
B D                  Alpaca  ac-ta
             Bactrian camel  ac-ta
B D                 Dolphin  ac-ta
               Killer whale  ac-ta
           Tibetan antelope  ac-ta
B D                     Cow  ac-ta
B D                   Sheep  ac-ta
              Domestic goat  ac-ta
B D                   Horse  ac-ta
B D        White rhinoceros  ac-ta
B D                     Cat  ac-ta
B D                     Dog  ac-ta
B D                 Ferret   ac-ta
B D                   Panda  ac-ta
             Pacific walrus  ac-ta
               Weddell seal  ac-ta
           Black flying-fox  ac-ta
B D                 Megabat  ac-ta
              Big brown bat  ac-ta
B D                Hedgehog  gt-gg
B D                   Shrew  gc---
B D                Elephant  ac-ta
        Cape elephant shrew  ac-ta
B D                 Manatee  ac-ta
           Cape golden mole  cc-ta
B D                  Tenrec  gc-cg
                   Aardvark  ac-ta
B D               Armadillo  gt-ga
    Lesser Egyptian jerboa  -----
B D         Tasmanian devil  =====
           Star-nosed mole  -----
      David's myotis (bat)  -----
B D                Microbat  -----

Inserts between block 17 and 18 in window
B D               Squirrel 3bp
B D                    Pig 316bp
B D               Hedgehog 18bp
B D                  Shrew 2bp

Alignment block 18 of 965 in window, 110873750 - 110873804, 55 bps 
B D                   Human  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                   Chimp  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                 Gorilla  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D               Orangutan  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                  Gibbon  aa-cagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                  Rhesus  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D     Crab-eating macaque  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                  Baboon  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D            Green monkey  aa-taaaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                Marmoset  aa-cagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D         Squirrel monkey  aa-tagaaa-g-gtgg-----------------------------------ct-----a------aaa--
B D                Bushbaby  aa-cagaaa-c-acaa-----------------------------------ct-----a------aaa--
         Chinese tree shrew  aa-tagaag-g-tcag-----------------------------------ct-----a------aaa--
B D                Squirrel  ca-ctagat-a-gaag-----------------------------------catatcta------aaa--
               Prairie vole  ta-taaaatag-gatt-----------------------------------ta-----a------agg--
B D         Chinese hamster  tattaagat-g-ggta-----------------------------------aa-----aaaaaacaaa--
             Golden hamster  ta-gaagat-g-ggtt-----------------------------------ta-----a------aaa--
B D                   Mouse  ta-taagat-a-gata-----------------------------------ca-----a------aaa--
B D                     Rat  ta-taagac-c-ggta-----------------------------------ca-----a------aaa--
B D          Naked mole-rat  ta-tggaag-g-atgg-----------------------------------ct-----a------aaa--
B D              Guinea pig  ta-tggaag-a-atat-----------------------------------ct-----g------aaa--
                 Chinchilla  ta-tgacaa-g-atgt-----------------------------------ct-----g------aaa--
           Brush-tailed rat  ta-tggaag-t-ttgt-----------------------------------ct-----a------aaa--
B D                  Rabbit  aa-tagaag-g-atgg-----------------------------------tt-----a------aagga
B D                    Pika  ga-t---ag-g-acag-----------------------------------tt-----a------aaa--
B D                     Pig  aa-tagaaa-t-agtg-----------------------------------ct-----a------taa--
B D                  Alpaca  aa-tagaag-gcatta-----------------------------------ca-----a------ctg--
             Bactrian camel  aa-tagaag-gcatta-----------------------------------ca-----a------ctg--
B D                 Dolphin  aa-cagaag-g-actg-----------------------------------at-----a------taa--
               Killer whale  aa-cagaag-g-actg-----------------------------------at-----a------taa--
           Tibetan antelope  aa-cagaaa-g-actg-----------------------------------tg-----a------tta--
B D                     Cow  aa-cagaag-g-actg-----------------------------------tg-----a------tta--
B D                   Sheep  aa-cagaag-g-acta-----------------------------------tg-----a------tta--
              Domestic goat  aa-cagaag-g-acta-----------------------------------tg-----a------tta--
B D                   Horse  aa-tggaac-g-atag-----------------------------------ct-----a------caa--
B D        White rhinoceros  aa-tataag-g-ataa-----------------------------------ct-----a------caa--
B D                     Cat  aa-tagaag-g-acag-----------------------------------ct-----a------caa--
B D                     Dog  aa-a--tag-g-acag-----------------------------------ct-----g------caa--
B D                 Ferret   aa-t------------------------------------------------------------------
B D                   Panda  aa-tagaag-g-acag-----------------------------------ct-----g------caa--
             Pacific walrus  aa-tagaag-g-acag-----------------------------------tt-----a------caa--
               Weddell seal  aa-tagaag-g-acag-----------------------------------tt-----a------caa--
           Black flying-fox  aa-tacaag-g-agta-----------------------------------ct-----a------caa--
B D                 Megabat  aa-tacaag-g-acta-----------------------------------ct-----a------caa--
              Big brown bat  aa-tggaag-g-accg-----------------------------------ct-----t------cga--
       David's myotis (bat)  ------------atca-----------------------------------ct-----a------cag--
B D                Microbat  ------------atca-----------------------------------ct-----a------cag--
B D                Hedgehog  ag-gagaaa-a-acaaaggccataaaaacaaacaaacaaacaaacaaatacct-----a------caa--
B D                   Shrew  aa-tagaaa-g-acaa-----------------------------------c------a------aaa--
            Star-nosed mole  aa-tagaag-g-acag-----------------------------------ct-----a------caa--
B D                Elephant  aa-tggaag-g-gcag-----------------------------------tc-----a-------aa--
        Cape elephant shrew  aa-tggaag-g-acat-----------------------------------tt-----a-------aa--
B D                 Manatee  aa-tggaag-a-acag-----------------------------------tt-----a-------aa--
           Cape golden mole  aa-tggaag-g-atag-----------------------------------tt-----a-------aa--
B D                  Tenrec  ga-cggaag-g-accg-----------------------------------tt-----a-------ac--
                   Aardvark  aa-aggaag-g-agaa-----------------------------------ct-----c-------aa--
B D               Armadillo  ag-ccaaag-g-gc--------------------------------------------------------
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
                      Chimp  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
                    Gorilla  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
                  Orangutan  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
                     Gibbon  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
                     Rhesus  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
        Crab-eating macaque  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
                     Baboon  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tgc
               Green monkey  ----a--tcaaa-----ac-acc-------------ag-g---------a------------tg---tac
                   Marmoset  ----a--tcaca---------cc-------------ag-g---------a------------tg---tgc
            Squirrel monkey  ----a--tcaca-----ac-ccc-------------ag-g---------a------------tg---tgc
                   Bushbaby  ----a--tgaca-----gc-acc-------------ac-g---------a------------tg---cgt
         Chinese tree shrew  ----t--tca--------c-acc-------------ag-g---------a------------tc---tgt
                   Squirrel  ----a--ttatg-----ac-ac--------------ag-a---------a------------ag---tgc
               Prairie vole  ----aacctgga-----ac-ac--------------ag-t---------ag-----------gg---tgc
            Chinese hamster  ----actctgca-----at-gc--------------ag-t---------a------------gg---tgc
             Golden hamster  ----actctgca-----gt-gc--------------ag-t---------a------------tg---tgt
                      Mouse  ----ac-ctgca-----ac-a------------------t---------a------------gg---tgt
                        Rat  ----a--ctgct-----ac-at--------------agtt---------a------------gg---tgt
             Naked mole-rat  ----a--tcata-----ac-ac--------------ag-g---------a------------ga---tgc
                 Guinea pig  ----a--ttata-----ac-at-----------------g---------a------------ga---tgc
                 Chinchilla  ----t--tcata-----ac-ac--------------aa-g---------a------------ga---tgc
           Brush-tailed rat  ----a--tcaca-----ac-ac--------------aa-g---------a------------gg---tgt
                     Rabbit  acaca--tca-----------------------------g---------a------------tg---tgc
                       Pika  ----a--tcata-----a-------------------g-g---------g------------tg---tgc
                        Pig  ----a--tcgca-----at-acccagtgcggagtc-aa-g----gccaca------------gggaatgc
                     Alpaca  ----c--t---------ac-acccagctcagagtc-aa-g----aacaca------------agacatgc
             Bactrian camel  ----c--t---------ac-acccagctcagagtc-aa-g----aacaca------------ggacatgc
                    Dolphin  ----a--tcaca-----at-acccaactcagagtc-aa-g----gacaca------------ggacatgc
               Killer whale  ----a--tcaca-----at-acccaactcagagtc-aa-g----gacaca------------ggacatgc
           Tibetan antelope  ----a--tctta-----ac-gcccagctcagagtc-aa-g----gacaca------------ggacatgc
                        Cow  ----a--tctta-----ac-acccagctcagagtc-aa-g----gacaca------------ggacatgt
                      Sheep  ----a--tctta-----ac-tcccagctcagagtc-aa-g----gacaca------------ggacatgc
              Domestic goat  ----a--tctta-----ac-gcccagctcagagtc-aa-g----gacaca------------ggacatgc
                      Horse  ----a--tcgca-----ac-ccccagctcagac---aa-g----aactca------------ggacgtgc
           White rhinoceros  ----a--tcacaacttgac-tctcagctggggctcaga-gtcccagctca------------ggacatgc
                        Cat  ----a--tgaca-----ac-acccagctcagagtc-ag-g----aacaca------------gagaatgc
                        Dog  ----a--tgaca-----ac-accgagttcagagtc-ag-g----aacata------------gggcatgc
                    Ferret   ------------------------agctcagagtc-ag-g----aatgca------------gggcattc
                      Panda  ----a--tgaca-----at-acgtagttcagagtc-ag-g----agcaca------------gggcatgc
             Pacific walrus  ----a--tgaca-----ac-acccagttcatagtc-ag-g----aatatgttcctgacatacaggcatgc
               Weddell seal  ----a--tgaca-----ac-acccagttcagagtc-ag-g----aacaca------------gggcatgc
           Black flying-fox  ----a--tc-----------actcagcttag--tc-ag-g----aacaaa------------ggatgtgg
                    Megabat  ----a--tc-----------acccagcttag--tc-ag-g----aacaaa------------ggatgtgg
              Big brown bat  ----a--cccca-----gcggcccagc-------------------------------------------
       David's myotis (bat)  ----a--cccca-----gc-gcccagctccg--tg-gg-g----cgcaca------------gggcgcgt
                   Microbat  ----a--cccca-----gc-gcccagctcgg--tc-ag-g----cccaca------------ggacgcgt
                   Hedgehog  ----a--ttaaa-----at-gtttgtcttacagtt-ga-g----aatgga------------aagcatac
                      Shrew  ----a--ttaca-----ac-acatagttcagagct-ag-g----aacaca------------gggtgtgc
            Star-nosed mole  ----a--tccca-----ac-acctggttcagaatc-tg-a----aacaca------------tgacatgg
                   Elephant  ----a--tcgca-----ac-acctagctcagactc-ag-g----gacaca------------gca--tgc
        Cape elephant shrew  ----a--ttaca-----ac-atcaagctcatgtcc-aa-t----aactca------------aaatgtgt
                    Manatee  ----a--tcaca-----gc-gcccagctcagactc-ag-a----aacaca------------gaacacac
           Cape golden mole  ----t--ttcca-----ac-atccagctcaggccc-ag-g----aacata------------gaacatgc
                     Tenrec  ----a--tc--------ac-atttaact------c-ag-g----agcaca------------tgacatgc
                   Aardvark  ----a--tcaca-----ac-acccagcttaagccc-aa-g----aaccca------------ggacatga
                  Armadillo  -----------------ac-accgagctgagggcc-ag-g----aacaca------------acgcgagc
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================

                      Human  tc--------------------------------------agtaactgtatt---tt
                      Chimp  tc--------------------------------------agtaactgtatt---tt
                    Gorilla  tc--------------------------------------agtaactgtatt---tt
                  Orangutan  tc--------------------------------------agtaactgtatt---tt
                     Gibbon  tc--------------------------------------agtaactgtatt---tt
                     Rhesus  tc--------------------------------------agtaactgtatt---tt
        Crab-eating macaque  tc--------------------------------------agtaactgtatt---tt
                     Baboon  tc--------------------------------------agtaactgtatt---tt
               Green monkey  tc--------------------------------------agtaactgtatt---tt
                   Marmoset  tc--------------------------------------agtaactgtata---tt
            Squirrel monkey  tc--------------------------------------agtaactgtata---tt
                   Bushbaby  ttagtaactgcttttttttttttta---------------agtaactgtatt---tt
         Chinese tree shrew  cc---------------------------------------gtaactgtatt---tt
                   Squirrel  tt--------------------------------------gatgactgtatg---gt
               Prairie vole  ct--------------------------------------tgtaactgtgct---ta
            Chinese hamster  cc--------------------------------------tgtaactgtact---tt
             Golden hamster  ct--------------------------------------tgtaactgtact---tt
                      Mouse  tc--------------------------------------tgcaa-tgtact---tc
                        Rat  tc--------------------------------------tgcaa-tgcact---tc
             Naked mole-rat  ta--------------------------------------cgtaaatgtact---gt
                 Guinea pig  ta--------------------------------------tgtaaatttaat---at
                 Chinchilla  ta--------------------------------------tgtgaatgtact---gc
           Brush-tailed rat  ta--------------------------------------tgtaaatttact---at
                     Rabbit  tcagtaactggatgattttttaaagtacgtatttatttttagtaactggatg---tt
                       Pika  ac--------------------------------------agtcactgggtg---tt
                        Pig  tc--------------------------------------agaacctgtatc---tt
                     Alpaca  tc--------------------------------------tgtacctgtatt---tc
             Bactrian camel  tc--------------------------------------tgtacctgtatt---tc
                    Dolphin  tc--------------------------------------agaacctgtatt---tt
               Killer whale  tc--------------------------------------agaacctgtatt---tt
           Tibetan antelope  tc--------------------------------------agaacctgtgtt---tc
                        Cow  tc--------------------------------------agaacctgtgtt---tc
                      Sheep  tc--------------------------------------agaacctgtgtt---tc
              Domestic goat  tc--------------------------------------agaacctgtgtt---tc
                      Horse  cc--------------------------------------agtacctgtatt---tc
           White rhinoceros  cc--------------------------------------agtacctgtatt---tt
                        Cat  cc--------------------------------------actgtctgtata---tc
                        Dog  cc--------------------------------------actgcctgtata---tc
                    Ferret   cc--------------------------------------actgcctgtgta---tc
                      Panda  tc--------------------------------------actgtctgcttg---tc
             Pacific walrus  cc--------------------------------------actgcctgtata---tc
               Weddell seal  cc--------------------------------------actgcctgtata---tc
           Black flying-fox  tc--------------------------------------agtatctgtatc---tc
                    Megabat  tc--------------------------------------agtatctgtatc---tc
              Big brown bat  tc--------------------------------------agcccctgtatc---tc
       David's myotis (bat)  tc--------------------------------------agcccctgtatc---ta
                   Microbat  tc--------------------------------------agcccctgtatc---tc
                   Hedgehog  tt--------------------------------------agtacttgtattctgtt
                      Shrew  tc--------------------------------------agtacttttatt---tc
            Star-nosed mole  tc--------------------------------------agtacctgtatt---tt
                   Elephant  tc--------------------------------------agtaaatgtatt---tt
        Cape elephant shrew  tt--------------------------------------tataaatatatg---tt
                    Manatee  tc--------------------------------------agtaaacgtatt---tt
           Cape golden mole  tt--------------------------------------agcaaatgtatt---tt
                     Tenrec  tc--------------------------------------agtaaatg-att---tt
                   Aardvark  tc--------------------------------------agtaaatgtatt---tt
                  Armadillo  tc--------------------------------------agcagacggctc---cc
     Lesser Egyptian jerboa  ---------------------------------------------------------
            Tasmanian devil  =========================================================

Inserts between block 18 and 19 in window
B D                    Cow 106bp

Alignment block 19 of 965 in window, 110873805 - 110873835, 31 bps 
B D                   Human  aaa-aggtgaaagc--------------------------------------------------------
B D                   Chimp  aaa-aggtgaaagc--------------------------------------------------------
B D                 Gorilla  aaa-aggtgaaagc--------------------------------------------------------
B D               Orangutan  aaa-aggtgaaagc--------------------------------------------------------
B D                  Gibbon  aaa-aggtgaaagc--------------------------------------------------------
B D                  Rhesus  aaa-aggt--cctt--------------------------------------------------------
B D     Crab-eating macaque  aaa-aggt--cctt--------------------------------------------------------
B D                  Baboon  aaa-aggtgaaagt--------------------------------------------------------
B D            Green monkey  aaa-aggtgaaagt--------------------------------------------------------
B D                Marmoset  aga-aggtgaaagc--------------------------------------------------------
B D         Squirrel monkey  aaa-aggtgaaagc--------------------------------------------------------
B D                Bushbaby  agg-aggtgaaaaa--------------------------------------------------------
         Chinese tree shrew  aac-agatgaaatg--------------------------------------------------------
B D                Squirrel  agg-------------------------------------------------------------------
               Prairie vole  atg-cttttattcc--------------------------------------------------------
B D         Chinese hamster  atg-attttatt-c--------------------------------------------------------
             Golden hamster  atg-attttattcc--------------------------------------------------------
B D                   Mouse  atgtattttattcc--------------------------------------------------------
B D                     Rat  atg-attttatttc--------------------------------------------------------
B D          Naked mole-rat  aag-aagtgaaggc--------------------------------------------------------
B D              Guinea pig  aag-cgataaaagc--------------------------------------------------------
                 Chinchilla  aaa-aagtgaaggc--------------------------------------------------------
           Brush-tailed rat  aag-aggtaaaggc--------------------------------------------------------
B D                  Rabbit  aag-aggtggaagc--------------------------------------------------------
B D                    Pika  gag-agatgaaagc--------------------------------------------------------
B D                     Pig  gag-aggtaaaatc--------------------------------------------------------
B D                  Alpaca  -------aaaaagc--------------------------------------------------------
             Bactrian camel  -------aaaaagc--------------------------------------------------------
B D                 Dolphin  gag-aagtaaaagc--------------------------------------------------------
               Killer whale  gag-aagtaaaagc--------------------------------------------------------
           Tibetan antelope  aag-aggtaaaaga--------------------------------------------------------
B D                     Cow  aag-aggtaaaaga--------------------------------------------------------
B D                   Sheep  aag-aggtaaaaga--------------------------------------------------------
              Domestic goat  aag-aggtaaaaga--------------------------------------------------------
B D                   Horse  gag-aggcgaaatc--------------------------------------------------------
B D        White rhinoceros  gag-aggtaaaaac--------------------------------------------------------
B D                     Cat  aag-aggtaaaaac--------------------------------------------------------
B D                     Dog  aag-aagtaaaagc--------------------------------------------------------
B D                 Ferret   aag-aggtaaaagc--------------------------------------------------------
B D                   Panda  aag-aggtaaaagc--------------------------------------------------------
             Pacific walrus  aag-aggtaaaagc--------------------------------------------------------
               Weddell seal  aag-aggtaaaagc--------------------------------------------------------
           Black flying-fox  aag-aggtgaaagt--------------------------------------------------------
B D                 Megabat  aag-aggtgaaagt--------------------------------------------------------
              Big brown bat  -ag-aggtgaaagg--------------------------------------------------------
       David's myotis (bat)  -ac-aggcgaaagg--------------------------------------------------------
B D                Microbat  -ac-aggcgaaagg--------------------------------------------------------
B D                Hedgehog  gag-aggtgaaaga--------------------------------------------------------
B D                   Shrew  aag-agataaaagttaccatgtttgggcctggagtgatagtacagtgggtaaggcatttgccttgcacac
            Star-nosed mole  gag-agttga------------------------------------------------------------
B D                Elephant  t-g-aggtgaaagc--------------------------------------------------------
        Cape elephant shrew  g-a-gagtgaaagt--------------------------------------------------------
B D                 Manatee  gag-aggtgaaagc--------------------------------------------------------
           Cape golden mole  gag-aggtgaaagc--------------------------------------------------------
B D                  Tenrec  gag-aagtgaaagg--------------------------------------------------------
                   Aardvark  gag-aggtgaaagc--------------------------------------------------------
B D               Armadillo  ggg-aggtgaacgc--------------------------------------------------------
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  ----------------------------------------------------------t-----------
                      Chimp  ----------------------------------------------------------t-----------
                    Gorilla  ----------------------------------------------------------t-----------
                  Orangutan  ----------------------------------------------------------c-----------
                     Gibbon  ----------------------------------------------------------t-----------
                     Rhesus  ----------------------------------------------------------t-----------
        Crab-eating macaque  ----------------------------------------------------------t-----------
                     Baboon  ----------------------------------------------------------t-----------
               Green monkey  ----------------------------------------------------------t-----------
                   Marmoset  ----------------------------------------------------------t-----------
            Squirrel monkey  ----------------------------------------------------------t-----------
                   Bushbaby  ----------------------------------------------------------t-----------
         Chinese tree shrew  ----------------------------------------------------------t-----------
                   Squirrel  ----------------------------------------------------------------------
               Prairie vole  ----------------------------------------------------------a-----------
            Chinese hamster  ----------------------------------------------------------t-----------
             Golden hamster  ----------------------------------------------------------t-----------
                      Mouse  ----------------------------------------------------------t-----------
                        Rat  ----------------------------------------------------------t-----------
             Naked mole-rat  ----------------------------------------------------------t-----------
                 Guinea pig  ----------------------------------------------------------t-----------
                 Chinchilla  ----------------------------------------------------------t-----------
           Brush-tailed rat  ----------------------------------------------------------t-----------
                     Rabbit  ----------------------------------------------------------t-----------
                       Pika  ----------------------------------------------------------c-----------
                        Pig  ----------------------------------------------------------ttcctgtcgtca
                     Alpaca  ----------------------------------------------------------t-----------
             Bactrian camel  ----------------------------------------------------------t-----------
                    Dolphin  ----------------------------------------------------------t-----------
               Killer whale  ----------------------------------------------------------t-----------
           Tibetan antelope  ----------------------------------------------------------t-----------
                        Cow  ----------------------------------------------------------t-----------
                      Sheep  ----------------------------------------------------------t-----------
              Domestic goat  ----------------------------------------------------------t-----------
                      Horse  ----------------------------------------------------------t-----------
           White rhinoceros  ----------------------------------------------------------t-----------
                        Cat  ----------------------------------------------------------t-----------
                        Dog  ----------------------------------------------------------t-----------
                    Ferret   ----------------------------------------------------------t-----------
                      Panda  ----------------------------------------------------------t-----------
             Pacific walrus  ----------------------------------------------------------t-----------
               Weddell seal  ----------------------------------------------------------t-----------
           Black flying-fox  ----------------------------------------------------------t-----------
                    Megabat  ----------------------------------------------------------t-----------
              Big brown bat  ----------------------------------------------------------t-----------
       David's myotis (bat)  ----------------------------------------------------------t-----------
                   Microbat  ----------------------------------------------------------t-----------
                   Hedgehog  ----------------------------------------------------------t-----------
                      Shrew  agtgtacccaggttcgatcccaggtatcccagatggttccccacgcacttcctgagtgc-----------
            Star-nosed mole  ----------------------------------------------------------t-----------
                   Elephant  ----------------------------------------------------------t-----------
        Cape elephant shrew  ----------------------------------------------------------t-----------
                    Manatee  ----------------------------------------------------------t-----------
           Cape golden mole  ----------------------------------------------------------t-----------
                     Tenrec  ----------------------------------------------------------t-----------
                   Aardvark  ----------------------------------------------------------t-----------
                  Armadillo  ----------------------------------------------------------c-----------
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================

                      Human  ----aga---cat---------ctc---t-aaaggat
                      Chimp  ----aga---cat---------ctc---t-aaaggat
                    Gorilla  ----aga---cat---------ctc---t-aaaggat
                  Orangutan  ----aga---cat---------ctc---t-aaaggac
                     Gibbon  ----aga---cac---------ctc---t-aaaggat
                     Rhesus  ----aga---cac---------ctc---t-aaaggac
        Crab-eating macaque  ----aga---cac---------ctc---t-aaaggac
                     Baboon  ----aga---cac---------ctc---t-aaaggac
               Green monkey  ----aga---cac---------ctc---t-aaaggac
                   Marmoset  ----aga---cac---------ctc---t-aaaagac
            Squirrel monkey  ----aga---cac---------ctc---t-aaaggac
                   Bushbaby  ----aga---cac---------ctc---t-aaaagat
         Chinese tree shrew  ----aga---cac---------ctg---t-aagcgat
                   Squirrel  ----agg---ta-------------------aaggcc
               Prairie vole  ----aga---taa---------a-a---c-tggggat
            Chinese hamster  ----ggg---tac---------ctc---c-taaggat
             Golden hamster  ----agg---cac---------ctc---c-taaggat
                      Mouse  ----atg------------------------------
                        Rat  ----atg---tac---------cct---c-taggggt
             Naked mole-rat  ----agatattat---------t-a---c-taggaat
                 Guinea pig  ----aga---tat---------c-a---c-taaggat
                 Chinchilla  ----aga---tat---------c-a---c-taaggat
           Brush-tailed rat  ----aga---tat---------c-c---c-taaggat
                     Rabbit  ----aca---tag---------cac---t-aagggat
                       Pika  ----acc---cag---------agc---c-aatgaat
                        Pig  caggaaa---tac---------cacattt-aagagat
                     Alpaca  ----aga---tgc---------ctc---t-aacggat
             Bactrian camel  ----aga---tgt---------gtc---t-aacagat
                    Dolphin  ----aga---tac---------cac---t-aagagat
               Killer whale  ----aga---tac---------cac---t-aagagat
           Tibetan antelope  ----aga---cat---------tgt---t-aagagct
                        Cow  ----aga---cat---------tgc---t-aagagct
                      Sheep  ----ggc---cat---------tgt---t-aagaact
              Domestic goat  ----aga---cat---------tgt---t-aagagct
                      Horse  ----aga---tac---------ttc---t-aagagat
           White rhinoceros  ----aga---tac---------ctc---t-aagaggt
                        Cat  ----gaa---tgc---------gcc---t-aagagat
                        Dog  ----gaa---cac---------ccc---taaagagat
                    Ferret   ----gaa---cac---------tcc---a-aagagat
                      Panda  ----gaa---cac---------ccc---t-acgagtt
             Pacific walrus  ----gaa---cac---------ccc---t-aagagat
               Weddell seal  ----gaa---cac---------ccc---t-aagagat
           Black flying-fox  ----aga---cac---------ttc---t-aagagac
                    Megabat  ----aga---cac---------ttc---t-aagagac
              Big brown bat  -----gg---cat---------ccc---t-caggggc
       David's myotis (bat)  -----ga---cat---------ccc---t-aaggggc
                   Microbat  -----ga---cat---------ccc---t-aaggggc
                   Hedgehog  ----aga---ga----------ccc---t-gaggaat
                      Shrew  ----aga---gccagaactaagccc---g-aagaact
            Star-nosed mole  ----aga---gctaccac----ctc---t-aagggat
                   Elephant  ----aga---cac---------ctg---t-aagaggt
        Cape elephant shrew  ----tga---cac---------ttg---t-agggaaa
                    Manatee  ----aga---cac---------tta---t-aagggat
           Cape golden mole  ----aga---cac---------cta---t-aaagaat
                     Tenrec  ----aga---cat---------cta---t-aagggat
                   Aardvark  ----aga---tat---------cta---t-aaggaat
                  Armadillo  ----aga---tgc---------cca---t-gaggaac
     Lesser Egyptian jerboa  -------------------------------------
            Tasmanian devil  =====================================

Inserts between block 19 and 20 in window
                  Aardvark 366bp

Alignment block 20 of 965 in window, 110873836 - 110873839, 4 bps 
B D                   Human  g---cat
B D                   Chimp  g---cat
B D                 Gorilla  g---cat
B D               Orangutan  g---cat
B D                  Gibbon  g---cat
B D                  Rhesus  g---tgt
B D     Crab-eating macaque  g---tgt
B D                  Baboon  g---tgt
B D            Green monkey  g---tgt
B D                Marmoset  g---ctt
B D         Squirrel monkey  g---ctt
B D                Bushbaby  a---ctt
         Chinese tree shrew  g---ctt
B D                Squirrel  a---ctt
               Prairie vole  g---ctt
B D         Chinese hamster  gcttctt
             Golden hamster  g---ctt
B D                   Mouse  g---ctt
B D                     Rat  g---ttt
B D          Naked mole-rat  a---ctt
B D              Guinea pig  a---ctg
                 Chinchilla  a---cct
           Brush-tailed rat  a---ttt
B D                  Rabbit  g---ctt
B D                    Pika  g---ctt
B D                     Pig  g---ctt
B D                  Alpaca  g---ctt
             Bactrian camel  g---ctt
B D                 Dolphin  g---ctt
               Killer whale  g---ctt
           Tibetan antelope  g---ctt
B D                     Cow  g---cat
B D                   Sheep  g---ctt
              Domestic goat  g---ctt
B D                   Horse  g---ctt
B D        White rhinoceros  g---ctt
B D                     Cat  g---ctt
B D                     Dog  g---cgt
B D                 Ferret   g---ctt
B D                   Panda  g---ctt
             Pacific walrus  g---ctt
               Weddell seal  g---ctt
           Black flying-fox  a---cgt
B D                 Megabat  a---cgt
              Big brown bat  a---ctt
       David's myotis (bat)  a---ctt
B D                Microbat  a---ctt
B D                Hedgehog  g---ctt
B D                   Shrew  g---ctg
            Star-nosed mole  g---cct
B D                Elephant  a---ctt
        Cape elephant shrew  g---ctt
B D                 Manatee  a---ctt
           Cape golden mole  a---att
B D                  Tenrec  a---ccc
B D               Armadillo  a---ctt
    Lesser Egyptian jerboa  -------
                  Aardvark  =======
B D         Tasmanian devil  =======

Alignment block 21 of 965 in window, 110873840 - 110873854, 15 bps 
B D                   Human  agatt----gtt-----------------------ggctttt
B D                   Chimp  agatt----gtt-----------------------ggctttt
B D                 Gorilla  agatt----gtt-----------------------ggctttt
B D               Orangutan  agatt----gtt-----------------------ggctttt
B D                  Gibbon  agatt----att-----------------------ggctttt
B D                  Rhesus  agatt----gtt-----------------------ggctttt
B D     Crab-eating macaque  agatt----gtt-----------------------ggctttt
B D                  Baboon  agatt----gtt-----------------------ggctttt
B D            Green monkey  agatt----gtt-----------------------ggctttt
B D                Marmoset  agatt----gtt-----------------------ggcttct
B D         Squirrel monkey  agatt----gtt-----------------------ggctgct
B D                Bushbaby  agatt----att-----------------------ggctttt
         Chinese tree shrew  agttt----gtt-----------------------gactttt
B D                Squirrel  ggtt-------------------------------ggctttc
               Prairie vole  agttt----ggg-----------------------ggctttc
B D         Chinese hamster  agctt----ggg-----------------------gactttc
             Golden hamster  agctt----tgg-----------------------ggctttc
B D                   Mouse  agttt----ggg------------------------------
B D                     Rat  agttt----tggg----------------------ggctttc
B D          Naked mole-rat  agtgt----gtt-----------------------ggctttc
B D              Guinea pig  aatat----gtt-----------------------ggttttc
                 Chinchilla  aatat----gtt-----------------------ggctttc
           Brush-tailed rat  attac----att-----------------------gcctttc
B D                  Rabbit  agtgt----ccc------------------------------
B D                    Pika  agttt----ctt-----------------------ggttttc
B D                     Pig  agttt----ggt-----------------------t-ttgtt
B D                  Alpaca  agatt----ggt-----------------------tgttttt
             Bactrian camel  agatt----ggt-----------------------tgttttt
B D                 Dolphin  agatt----tgt-----------------------tgttttt
               Killer whale  agatt----tgt-----------------------tgttttt
           Tibetan antelope  agatt----agt-----------------------tctttaa
B D                     Cow  agatt----agt-----------------------tgtttta
B D                   Sheep  agatt----agt-----------------------tgtttta
              Domestic goat  agatt----agt-----------------------tgtttta
B D                   Horse  agatt----gat-----------------------tgttttc
B D        White rhinoceros  agatt----gat-----------------------tgttttc
B D                     Cat  agatt----gat-----------------------tgttttc
B D                     Dog  a--------gat-----------------------tgttttc
B D                 Ferret   agatt----gat-----------------------tgttttc
B D                   Panda  tgatt----gat-----------------------tgttttc
             Pacific walrus  agatt----gat-----------------------tgttttc
               Weddell seal  agatt----gat-----------------------tgttttc
           Black flying-fox  acatt----ttt-----------------------tgttttc
B D                 Megabat  acatt----ttt-----------------------tgttttc
              Big brown bat  agatt----gg------------------------ggttttc
       David's myotis (bat)  agact----ggt-----------------------gattttc
B D                Microbat  agatt----ggt-----------------------ggttttc
B D                Hedgehog  agctt----tgt-----------------------tgttttc
B D                   Shrew  gatgt----gatccaaaaacaaaaaacaaaagttacatttcc
            Star-nosed mole  aattt----gat-----------------------tattttc
B D                Elephant  ggtttggcaggc-----------------------aggtttt
        Cape elephant shrew  tgttt----ggc-----------------------aagtttt
B D                 Manatee  ggtttggcaggc-----------------------aggtttt
           Cape golden mole  agttt----gac-----------------------aggtatt
B D                  Tenrec  agtct----ggc-----------------------caggttt
                   Aardvark  agttt----ggc-----------------------aggtttt
B D               Armadillo  agttg----ggt-----------------------ggtttcc
    Lesser Egyptian jerboa  ------------------------------------------
B D         Tasmanian devil  ==========================================

Inserts between block 21 and 22 in window
        Chinese tree shrew 274bp

Alignment block 22 of 965 in window, 110873855 - 110873896, 42 bps 
B D                   Human  aaggagcaggaa-gcacattgggatcct------cagc-atttcc----ccaa----a
B D                   Chimp  aaggagcaggaa-gcacattgtgatcct------cagc-atttcc----ccaa----a
B D                 Gorilla  aaggagcaggaa-gcacattgtgatcct------cagc-atttcc----ccaa----a
B D               Orangutan  aaggagcaggaa-gcacattgtgatcct------cagc-atttcc----ccaa----a
B D                  Gibbon  aaggagcaggaa-gcacattgtgatcct------cagc-atttcc----ccaa----a
B D                  Rhesus  aaggagcaggaa-gcgcattgtgatcct------cagc-atttct----ccag----a
B D     Crab-eating macaque  aaggagcaggaa-gcgcattgtgatcct------cagc-atttct----ccag----a
B D                  Baboon  aaggagcaggaa-gcgcattgtgatcct------cagc-atttct----ccag----a
B D            Green monkey  aaggagcaggaa-gcgcattatgatcct------cggc-atttct----ccag----a
B D                Marmoset  aagaagcaggaa-gagcactgtgatctt------cagc-atttcc----ccaa----a
B D         Squirrel monkey  aagaagcaggaa-gagcattgtgatctt------cagc-atttcc----ccaa----a
B D                Bushbaby  aaagagcaggaa-aagtattttgatatt------cagg-gctccc----ccca----a
         Chinese tree shrew  aaagagcaggaa-gaacattgtgatcct------cagg-actccc----ccaattacc
B D                Squirrel  aaagagcaggaa-gaacatagtgatcta------cagg-gctcct----ccac----a
               Prairie vole  aaagagcaatgc-aaacattgtaatct-------aagg-gcttctttctccat----a
B D         Chinese hamster  aaagagcaacgc-aaacattgtgatcta------aagg-gtttctttctctac----a
             Golden hamster  aaagagcaatac-aaacattatgatcta------aaga-gtttctttctccac----a
B D                   Mouse  -----ggaaggt-aaacattgtgatctg------aagg-gcttctttcttcac----t
B D                     Rat  aaagaggaagag-aaacattatgatctg------aaag-gcttctttcctcac----g
B D          Naked mole-rat  aaaaagcagaaa-ggatattgtgatctg------cagg-gcaccc----ccaa----a
B D              Guinea pig  aaagagcaaaag-agatattatgatctg------caga-gctccc----cta------
                 Chinchilla  aaagagcagaaa-gaatattgtgatctg------cagg-gcaccc----ccaa----a
           Brush-tailed rat  aaagatcagaaa-gaatattgtgatctg------cagt-gctcct----ccaa----a
B D                  Rabbit  ----tacaggaa-gtgtgtagtggctct------taag-gcatac----ccac----a
B D                    Pika  aaagtacgggag-gtgcttggtgatgct------caag-gcttcc----ccac----a
B D                     Pig  aaaggaccggaa-gagatttgtgatcct------cagg-gttccc----ccaa----a
B D                  Alpaca  aaagggcaggaa-gatcattgtgatcct------cagg-gttccc----tcaa----a
             Bactrian camel  aaagggcaggaa-gagcattgtgatcct------cagg-gtttcc----tcaa----a
B D                 Dolphin  aaagggcaggaa-gaccactgtgatcct------cagg-tttccc----ccaa----a
               Killer whale  aaagggcaggaa-gaccactgtgatcct------cagg-tttccc----ccaa----a
           Tibetan antelope  aaagaacaggaa-gagcaccgtgatcct------cagg-attccc----ccaa----a
B D                     Cow  aaagagcaggaa-gagcactgtgatcct------cagg-attccc----ccaa----g
B D                   Sheep  aaagaacaggaa-gagcactgtgatcct------cagg-attccc----ccaa----a
              Domestic goat  aaagaacaggaa-gagcacagtgatcct------cagg-attccc----ccaa----a
B D                   Horse  aaagggcgggaa-gaacattgtgatcct------tagg-gttccc----ccaa----g
B D        White rhinoceros  aaagggcaggaa-gagcattgtggtcct------cagg-gttccc----tcaa----a
B D                     Cat  aaatagcagaaa-gaacattgtgatcct------cagg-gttcag----ccaa----a
B D                     Dog  agac---agaaa-gaacgttgtggtcct------aatg-gttctg----ctga----a
B D                 Ferret   aaacaataggaa-gaacattgtggtcct------cagg-gttctg----ccaa----a
B D                   Panda  aaacagcaggaa-gaacgttgtggtcct------cagg-gttctg----ccga----a
             Pacific walrus  aaacagcaggaa-gaacattgtgattt------------attctg----ccaa----a
               Weddell seal  aaacagcaggaa-gaacattgtggttt------------attctg----ctga----a
           Black flying-fox  aaatggcaggaaggggtatcatgaccac------caga-gttctc----ccaa----a
B D                 Megabat  aaatggcaggaaggggtatcgtgaccac------caga-gttctc----ccaa----a
              Big brown bat  cagtggcagcaa-gggcactgtggt--c------ctca-gagttc----cccc----a
       David's myotis (bat)  aaagggcagcaa-gggcaccgtgat--c------ctga-gttccc----ccag----a
B D                Microbat  aaagggcagcaa-gagcactgtgat--c------ctca-gttccc----ccag----a
B D                Hedgehog  aa---aaagaaa-gactattgtgatcct------catg-cttttc----ccaa----a
B D                   Shrew  agggtgaagaaa-agacaatgtgaactt------cagg-gttctt----ccaa----a
            Star-nosed mole  aaaggacaggaa-gaacattgtaactgg------tatt-tttctc----tcaa----a
B D                Elephant  aaaaagcaggaa-gaacattgttatcct------cagg-cttccc----ccaa----t
        Cape elephant shrew  aaagggcaggaa-gaacattattattattatttccaag-actatc----ccaa----a
B D                 Manatee  aaacagcaggaa-gaacattgttatcct------caggacttccc----ccaa----a
           Cape golden mole  aaaggtcaagaa-ggacattgttatcct------caag-actccc----tcaa----a
B D                  Tenrec  aaagggcaggaa-ggatattgtcaacct------caga-attccc----caga-----
                   Aardvark  aaagggcaagaa-gaacattgctatctt------taga-actccc----ccaa----a
B D               Armadillo  aaagagcc-------------ttctttt------cagg-gctcct----caaa----a
    Lesser Egyptian jerboa  ----------------------------------------------------------
B D         Tasmanian devil  ==========================================================

Inserts between block 22 and 23 in window
B D                    Pig 5bp
B D                 Alpaca 6bp
            Bactrian camel 6bp
B D                Dolphin 5bp
              Killer whale 5bp
          Tibetan antelope 5bp
B D                    Cow 228bp
B D                  Sheep 228bp
             Domestic goat 228bp
B D                  Horse 5bp
B D       White rhinoceros 5bp
B D                    Cat 11bp
B D                    Dog 5bp
B D                Ferret  4bp
B D                  Panda 5bp
            Pacific walrus 5bp
              Weddell seal 5bp
          Black flying-fox 5bp
B D                Megabat 5bp
             Big brown bat 5bp
      David's myotis (bat) 5bp
B D               Microbat 5bp
B D               Hedgehog 5bp
B D                  Shrew 5bp
           Star-nosed mole 5bp

Alignment block 23 of 965 in window, 110873897 - 110873901, 5 bps 
B D                   Human  tta-----tc
B D                   Chimp  tta-----tc
B D                 Gorilla  tta-----tc
B D               Orangutan  tta-----tc
B D                  Gibbon  taa-----tc
B D                  Rhesus  tta-----tc
B D     Crab-eating macaque  tta-----tc
B D                  Baboon  tta-----tc
B D            Green monkey  tta-----tc
B D                Marmoset  ttg-----tc
B D         Squirrel monkey  tta-----tt
B D                Bushbaby  cta-----tt
         Chinese tree shrew  tta-----tc
B D                Squirrel  ttaattcatc
               Prairie vole  ttcactaatc
B D         Chinese hamster  ttaattgatc
             Golden hamster  ttaactaatc
B D                   Mouse  ttaaatggtc
B D                     Rat  ttaaatgatc
B D          Naked mole-rat  ttaacttatc
B D              Guinea pig  -----ttatt
                 Chinchilla  ttaacttgtt
           Brush-tailed rat  ttaacttatt
B D                  Rabbit  ttaactt-gc
B D                    Pika  taaacttagc
B D                     Pig  tta-----tc
B D                  Alpaca  -ta-----tc
             Bactrian camel  -ta-----tc
B D                 Dolphin  gta-----tc
               Killer whale  gta-----tc
           Tibetan antelope  -tt-----at
B D                     Cow  -tt-----tc
B D                   Sheep  -tt-----tc
              Domestic goat  -tt-----tc
B D                   Horse  ttg-----tc
B D        White rhinoceros  cta-----tc
B D                     Cat  gta-----ta
B D                     Dog  ttg-----tt
B D                 Ferret   -tg-----tc
B D                   Panda  ttg-----tc
             Pacific walrus  ttg-----tc
               Weddell seal  ttg-----tc
           Black flying-fox  tta-----tt
B D                 Megabat  tta-----tc
              Big brown bat  ttc-----tc
       David's myotis (bat)  gtc-----tc
B D                Microbat  gtc-----tc
B D                Hedgehog  tta-----ac
B D                   Shrew  tta-----tt
            Star-nosed mole  ata-----ac
B D                Elephant  taa-----ac
        Cape elephant shrew  taa-----aa
B D                 Manatee  taa-----ac
           Cape golden mole  taa-----ac
B D                  Tenrec  -aa-----ac
                   Aardvark  taa-----ac
B D               Armadillo  taa-----gc
    Lesser Egyptian jerboa  ----------
B D         Tasmanian devil  ==========

Inserts between block 23 and 24 in window
B D               Elephant 3bp
       Cape elephant shrew 3bp
B D                Manatee 3bp
          Cape golden mole 172bp
B D                 Tenrec 1bp
                  Aardvark 3bp
B D              Armadillo 5bp

Alignment block 24 of 965 in window, 110873902 - 110873902, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  t
         Chinese tree shrew  c
B D                Squirrel  c
               Prairie vole  c
B D         Chinese hamster  c
             Golden hamster  c
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  c
                 Chinchilla  c
           Brush-tailed rat  c
B D                  Rabbit  c
B D                    Pika  c
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
B D                   Panda  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  c
       David's myotis (bat)  c
B D                Microbat  c
B D                Hedgehog  c
B D                   Shrew  c
            Star-nosed mole  c
B D                Elephant  c
        Cape elephant shrew  c
B D                 Manatee  c
           Cape golden mole  c
B D                  Tenrec  c
                   Aardvark  a
B D               Armadillo  c
    Lesser Egyptian jerboa  -
B D              Guinea pig  -
B D         Tasmanian devil  =

Inserts between block 24 and 25 in window
B D               Bushbaby 6bp
          Tibetan antelope 224bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                    Cat 2bp

Alignment block 25 of 965 in window, 110873903 - 110873958, 56 bps 
B D                   Human  ttggtgtacaaaacatgaccactgataaatgtcacatgaaatgcacgtataaaa--tg
B D                   Chimp  ttggtgtacaaaacatgaccactgataaatgtaacatgaaatgcacgtataaag--tg
B D                 Gorilla  ttggtgtacaaaacatgaccactgataaatgtaacatgaaatgcacgtataaaa--tg
B D               Orangutan  ttggtgtacaaaacatgaccactgataaatgtaacatgaaatgcacgtataaaa--tg
B D                  Gibbon  ttggtgtacaaaacatgaccactgataaatgtaacatgaaatgcacgtataaaa--tg
B D                  Rhesus  ttggtgtacaaaacgtgaccactg----------------atgcacgtataaa---tg
B D     Crab-eating macaque  ttggtgtacaaaacgtgaccactg----------------atgcatgtataaa---tg
B D                  Baboon  ttggtgtacaaaacgtgaccactg----------------atgcacgtataaa---tg
B D            Green monkey  ttggtgtacaaaacgtgaccactg----------------atgcacgtataaa---tg
B D                Marmoset  ctggtgcacaaaacatgaccattgataaatataacatgaaatccaagtataaaaca--
B D         Squirrel monkey  ttggtgtacaaaacatgaccattgataaatataacatgaaatccaaggataaag----
B D                Bushbaby  ttagt-tatcaaacatgaatattgatatatgt---------------tataaaa--ag
         Chinese tree shrew  ttggtgtatgaaacatgagtattgattagtataatacaaaatgcacttgggaaa--gg
B D                Squirrel  ttagtgtgtaaaaaatgaaggctagtagatataacatgaaatcaacttatgaaa--gg
               Prairie vole  ttgatatatgacgcatgcacatgaacaact-tcgtatgaagtgctcagctgaga--gc
B D         Chinese hamster  ttgatacatgaagcatgaaaattgacaaatctcatataaagtgttcagctgaga--gg
             Golden hamster  ttgatatatgatgcatgaacattgacaaatcttatataaagtgttcatctgaaa--gc
B D                   Mouse  gtgatacacaaagcttgaacattgacaaatttcacataaaatgtgcagcagaga--gg
B D                     Rat  gtgacatacgaagcttgtacattgacaaatctcatataaaatatgtagtccaga--gg
B D          Naked mole-rat  ttggtatacaaaacatgaatattgataaatataa-------------tatgaaa--at
B D              Guinea pig  ---gcatgcaaaacatgaatattgataaata---tattaaatgtatttatgaaa--at
                 Chinchilla  ttggtatacaaaacatgaacattgataaatacaatattaaatttacttatgaaa--ag
           Brush-tailed rat  ttggtatacaaaacatgaatattgataaatattgcatttaacatacatatgaaa--ag
B D                  Rabbit  cctgtacgcaaaacaggaatgctggtaaatataa-------------tttgaaa--ga
B D                    Pika  ttggtgtataaaacaga-----------------------------------------
B D                     Pig  ttagtatttaaaatatgaatattgataactataatat-atatgtgc------------
B D                  Alpaca  ttagtgtttaaaacatgaatatcaatcaat---atatggcatgcac------------
             Bactrian camel  ttagtgtttaaaacatgaatatcaatcaat---atatggcatgcac------------
B D                 Dolphin  ttagtattcaaaacaagaatattgataaatataatatgacgtgcac------------
               Killer whale  ttagtattcaaaacaagaatattgataaatataatatgacgtgcac------------
           Tibetan antelope  ttagtattcaaaacaagaatattgataaatataatatgacatgtac------------
B D                     Cow  ttagtattcaaaacaagaatattgataaatataatatgacatgtac------------
B D                   Sheep  ttagtattcaaaacaagaatattgataaatataatatgacatgtac------------
              Domestic goat  ttagtattcaaaacaagaatattgataaatataatatgacatgtac------------
B D                   Horse  ttggtgtacaaaacatcaatatagataaatatagtataaaatgcac------------
B D        White rhinoceros  ttggtgtacaaaacatgaatattgataaatataatgtgacatgcac------------
B D                     Cat  tcagtatacaaaatgtaaatattgataaacataatatgacatgcac------------
B D                     Dog  ttggtatacaaaacataaatattgataaatgtattatgacatgcac------------
B D                 Ferret   ttggtatacaaaccataaatattgataaatataatgtgacaggcac------------
B D                   Panda  ttggtgtacaaaacataactattgataaatataatacgacatgcac------------
             Pacific walrus  ttggtatacaaaacataaatattaataaatataatgtaacatgcac------------
               Weddell seal  ttggtatacaaaacataaatattgataaatataacgtgacatacac------------
           Black flying-fox  ttggtgttcaaaacaagaatattaataaatat-----gacatgctc------------
B D                 Megabat  ttggtgttcaaaacaagaatattaataaatat-----gacatgctc------------
              Big brown bat  gcggtgtacaaaacgtgactacgaatgcatct-----gccaggcgc------------
       David's myotis (bat)  gtggtgtacaaaacgtggctgcgaatacgtat-----gctgtgcgc------------
B D                Microbat  gtggtgtacaaaacgtgactac---------------gccgtgtgc------------
B D                Hedgehog  tcagtgtacaaaatgtgaatactgaca-------------------------------
B D                   Shrew  ttgctgcaaaaaatatgaaaattgataaatataatatgacatgcac------------
            Star-nosed mole  ttgatctacaagcctc--acattgataaataaaatatgacatacac------------
B D                Elephant  ttggtgcaaaaaacatgaatattaataaacataatatgaagtacacttatgacagt--
        Cape elephant shrew  ctggcgtataaaacaataatattagtaaacattatatgaagtaaacttatgaaagt--
B D                 Manatee  ttggtttataaaacatgaatattaataaacataatatgaagtacacttatgaaagt--
           Cape golden mole  ttggtatataaaacatgaatattaataaacataaaatgaagtacacttatgaaagt--
B D                  Tenrec  ttggtatacaaaacatgaatatgagtaaacacaacatggagtacatttatgaaaat--
                   Aardvark  ttgatgtctaaaacatgaatattaataaacatactatga--tacacttatgaaagt--
B D               Armadillo  ctggtgtccaaaacatgaatatcgataaacagaagatgaagaacccttaaga------
    Lesser Egyptian jerboa  ----------------------------------------------------------
B D         Tasmanian devil  ==========================================================

Inserts between block 25 and 26 in window
B D               Marmoset 152bp

Alignment block 26 of 965 in window, 110873959 - 110873971, 13 bps 
B D                   Human  caatc---------------cccaaaac
B D                   Chimp  caatc---------------cccaaaac
B D                 Gorilla  caatc---------------cccaaaac
B D               Orangutan  caatc---------------cccaaaac
B D                  Gibbon  caatc---------------cccaaaaa
B D                  Rhesus  caatc---------------cccaaaac
B D     Crab-eating macaque  caatc---------------cccaaaac
B D                  Baboon  caatc---------------cccaaaac
B D            Green monkey  caatc---------------cccaaaac
B D         Squirrel monkey  ----------------------ca----
B D                Bushbaby  caacc---------------cacaaaac
         Chinese tree shrew  cagcc---------------cacaaaat
B D                Squirrel  caacc---------------tgcaaaac
               Prairie vole  aaa-----------------cacagcac
B D         Chinese hamster  aaa-----------------cacacaac
             Golden hamster  aaa-----------------cactcaac
B D                   Mouse  aaacc---------------cacataac
B D                     Rat  aaacc---------------cgcataac
B D          Naked mole-rat  tgacc---------------cacaaatc
B D              Guinea pig  caatc---------------cacaaatc
                 Chinchilla  caatc---------------cactgatc
           Brush-tailed rat  caacc---------------cacaaaac
B D                  Rabbit  caacc---------------caca-aac
B D                     Pig  caaatttgcctaacttacaaaacaaaac
B D                  Alpaca  caaatctgcatgacttac-aaacaaaac
             Bactrian camel  caaatctgcatgacttacaaaacaaaat
B D                 Dolphin  caactttgcatgacttgcaaaacaaac-
               Killer whale  caactttgcatgacttgcaaaacaaac-
           Tibetan antelope  caaatctggatgacttggaaaacaaaa-
B D                     Cow  caaatctggatgacttggaaaacaaaa-
B D                   Sheep  caaatctggatgacttggaaaacaaaa-
              Domestic goat  caaatctggatgacttggaaaacaaaa-
B D                   Horse  caact---------------aacaaaac
B D        White rhinoceros  caagc---------------aacaaaac
B D                     Cat  caacc---------------aacaaaac
B D                     Dog  caacc---------------aacaaaat
B D                 Ferret   caacc---------------aacaaaat
B D                   Panda  caacc---------------aacaaaat
             Pacific walrus  caacc---------------aacaaaat
               Weddell seal  caacc---------------aacaaaat
           Black flying-fox  cagtc---------------aatgaaac
B D                 Megabat  cagtc---------------aatgaaac
              Big brown bat  caaac---------------ggtggaac
       David's myotis (bat)  caacc---------------ggtggaac
B D                Microbat  caacc---------------ggtggaac
B D                Hedgehog  -aacc---------------aataaaac
B D                   Shrew  caacc---------------aaataaat
            Star-nosed mole  caact---------------aacaaaac
B D                Elephant  caacc---------------aacaaaac
        Cape elephant shrew  caata---------------aataaaac
B D                 Manatee  caacc---------------aacaaaac
           Cape golden mole  caatc---------------aacaaaac
B D                  Tenrec  caacc---------------aacaaacc
                   Aardvark  caacc----------------acaaaac
B D               Armadillo  ----c---------------caaaaagc
    Lesser Egyptian jerboa  ----------------------------
B D                    Pika  ----------------------------
B D         Tasmanian devil  ============================
B D                Marmoset  ============================

Alignment block 27 of 965 in window, 110873972 - 110873988, 17 bps 
B D                   Human  ttgatactgcagtaa-tt
B D                   Chimp  ttgatactgcagtaa-tt
B D                 Gorilla  ttgatactgcagtaa-tt
B D               Orangutan  ttgatactgcagtaa-tt
B D                  Gibbon  ttgatactgcagtaa-tt
B D                  Rhesus  ttgatactgcagtaa-tt
B D     Crab-eating macaque  ttgatactgcagtaa-tt
B D                  Baboon  ttgatactgcagtaa-tt
B D            Green monkey  ttgatactgcagtag-tt
B D                Marmoset  ttggtactgcagtaa-tt
B D         Squirrel monkey  tcggtactgcaataa-tt
B D                Bushbaby  ttgatgttgtaataa-tt
         Chinese tree shrew  ttaatactgcaatga-tt
B D                Squirrel  ttgatgtagcaattgctt
               Prairie vole  ccgatacagcagtag-tt
B D         Chinese hamster  ttgatacagaagtag-tt
             Golden hamster  ttgatacagcagtag-tt
B D                   Mouse  ttgatacagtaatag-tt
B D                     Rat  ttgatacagtagtag-tt
B D          Naked mole-rat  ttgatataacaataa-tt
B D              Guinea pig  ttggttcaacaataa-tt
                 Chinchilla  tctatacaacaataa-tt
           Brush-tailed rat  ttgatacaacattaa-tt
B D                  Rabbit  ttgacctagccacaa-ct
B D                     Pig  ttgatattgcaatga-tt
B D                  Alpaca  ttgatattccaa-ga-tt
             Bactrian camel  ttgatattccaa-ga-tt
B D                 Dolphin  ttgatattgcaatga-tt
               Killer whale  ttgatattgcaatga-tt
           Tibetan antelope  -cgatattgcaagga-tt
B D                     Cow  -caatattgcaagga-tt
B D                   Sheep  -tgatattgcaagga-tt
              Domestic goat  -cgatattgcaagga-tt
B D                   Horse  tcgatattgcaaaga-tt
B D        White rhinoceros  ttcatattacaaaga-tt
B D                     Cat  ttgatattgtaacca-tt
B D                     Dog  ttgatattgtaatga-gt
B D                 Ferret   ttgatattgtaatga-tt
B D                   Panda  ttgatattgtaatga-tt
             Pacific walrus  ttgatattgtaatga-tt
               Weddell seal  ttgatattgtaatga-tt
           Black flying-fox  tggatattgcagta--tt
B D                 Megabat  tggatattgcagta--tt
              Big brown bat  ttgacgtggcaatg----
       David's myotis (bat)  ttggcctggcaatg----
B D                Microbat  ttggcatggcaatg----
B D                Hedgehog  ttgataatgcaatga-ta
B D                   Shrew  ttgatattgcaatga-tt
            Star-nosed mole  ccgatatttcaatgt-tc
B D                Elephant  ttgatattgcaataa-tt
        Cape elephant shrew  -tgattttggcataa-tt
B D                 Manatee  ttgatattgcaataa-tt
           Cape golden mole  ttaatattgcaataa-tt
B D                  Tenrec  tcaatgttgaaatga-t-
                   Aardvark  ttgatgttacaataa-tt
B D               Armadillo  ttgctattgcagtag-tt
    Lesser Egyptian jerboa  ------------------
B D                    Pika  ------------------
B D         Tasmanian devil  ==================

Inserts between block 27 and 28 in window
B D                  Shrew 347bp

Alignment block 28 of 965 in window, 110873989 - 110874032, 44 bps 
B D                   Human  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D                   Chimp  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D                 Gorilla  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D               Orangutan  tcca---a-tcatgt------------------gct-gtaactaatgactaaggttgc------------
B D                  Gibbon  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D                  Rhesus  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D     Crab-eating macaque  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D                  Baboon  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D            Green monkey  tcca---a-tcatgt------------------gct-gtaactaatgactgaggttgc------------
B D                Marmoset  tcca---a-tcacat------------------gct-gtaactaatgatggaggttgc------------
B D         Squirrel monkey  tcca---a-tcgcgt------------------gct-gtaactgatgacggaggttgc------------
B D                Bushbaby  tcca---attcctgt------------------gc---taactaa-------------------------
         Chinese tree shrew  tcca---attcatgt------------------gcc-ataactaatgatt--------------------
B D                Squirrel  tcca---attcctgg------------------gcc----------------------------------
               Prairie vole  tcca---gctgctaatttactaactaactaactacc-cacactaat--tctaggctgc------------
B D         Chinese hamster  tcca---actcatgg------------------atcaaaaactaat--tttagcttgc------------
             Golden hamster  tcca---actcgtgg------------------acc-aaaattaat--tttaggttgc------------
B D                   Mouse  tcca---acttgcaa------------------gcc--------at--tctagggtgt------------
B D                     Rat  tcca---acttacaa------------------att--------at--tctagggtgt------------
B D          Naked mole-rat  tcca---attcatgt------------------gcc-ataggtaat----gaaattgc------------
B D              Guinea pig  gcca---attcatgt------------------gct-atagctaat----gaagttac------------
                 Chinchilla  tcca---gttcatat------------------gct-atggctgat----gaagtcgc------------
           Brush-tailed rat  tcta---attccttg------------------gct-cgggttaat----gaagttgc------------
B D                  Rabbit  ttc-------tgtgt------------------gcc-ataactaatgtccgaggtgac------------
B D                    Pika  -----------gtat------------------gac-ataactaatgcctgaggctac------------
B D                     Pig  tcta---attcatgt------------------ccc-ataactaatgattgatgtctt------------
B D                  Alpaca  tcta---attcatgc------------------tcc-ataactaatgattgaggtctt------------
             Bactrian camel  tcta---attcacgc------------------tcc-ataactaatgattgaggtctt------------
B D                 Dolphin  tcta---atttaggc------------------ccc-ataactaataactgaggtctt------------
               Killer whale  tcta---attcaggc------------------ccc-ataactaataactgaggtctt------------
           Tibetan antelope  tcta---attcgggt------------------ccc-ataactaatgactgcggtatt------------
B D                     Cow  tcta---atttgggc------------------ccc-ataactaataactgcagtatt------------
B D                   Sheep  tcta---attcgggt------------------ccc-ataactaatgactgtggtatt------------
              Domestic goat  tcta---attcaggt------------------ccc-ataacaaatgactgcggtatt------------
B D                   Horse  tcta---attcatgt------------------ccc-ataactaatgattgaggtctc------------
B D        White rhinoceros  tcta---attcatgt------------------cac-ataactaacgattgaggtctc------------
B D                     Cat  tcta---attcacgc------------------cat-gtaacgaatgactgtggcctc------------
B D                     Dog  tcta---attcatgc------------------cct-gtaactagtgactggggtctt------------
B D                 Ferret   tcta---atttgtgc------------------cct-ataactactgactgtggtctc------------
B D                   Panda  tcta---attcatgc------------------cct-gtaacgagtgaatgtggtctc------------
             Pacific walrus  tcta---attcatgc------------------cct-gtaactagcgactggggtctc------------
               Weddell seal  tcta---attcatgc------------------cct-gtaactagcgactggggtctc------------
           Black flying-fox  tcca---atttatgc------------------ccc-gtaactaatgattgaggtgtc------------
B D                 Megabat  tcca---atttatgc------------------ccc-gtaactaatgactgaggtgtc------------
              Big brown bat  ---------acacgc------------------ccc-ataactaaggatcggggtctc------------
       David's myotis (bat)  ---------gcacgc------------------ccc-ataacggaggatcggggtctc------------
B D                Microbat  ---------agacgc------------------ccc-ataactgaggat-ggggtctc------------
B D                Hedgehog  tcca---tttcatcc------------------ctt-ataactaatgatcgaggtctc------------
            Star-nosed mole  cccaatgtttcgtgt------------------ctc-atcactaatgattgagagctc------------
B D                Elephant  tcca---attcatga------------------gct-ataactaatgattgagcttgc------------
        Cape elephant shrew  ttca---tttcataa------------------gtt-ataactagttattgagtatgcgtgttgctgttg
B D                 Manatee  tcca---attcatga------------------gct-ataactaatgattaagcttgc------------
           Cape golden mole  tcta---gttcatga------------------gtt-ttaactgatgtttgagtttgc------------
B D                  Tenrec  ----------------------------------tt-tcaacgaatgagtgagcttcc------------
                   Aardvark  tcca---atttatgg------------------gct-gtaactaatgatggagcttat------------
B D               Armadillo  ttca---tttctcaa------------------gct-ctaactcgtcatacaatttgg------------
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                   Shrew  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  --------------------atggactca
                      Chimp  --------------------atggactca
                    Gorilla  --------------------atggactca
                  Orangutan  --------------------atggactca
                     Gibbon  --------------------atggactca
                     Rhesus  --------------------atgaactca
        Crab-eating macaque  --------------------atgaactca
                     Baboon  --------------------atgaactca
               Green monkey  --------------------atgaactca
                   Marmoset  --------------------atggactca
            Squirrel monkey  --------------------acggactca
                   Bushbaby  ----------------------gagctca
         Chinese tree shrew  -----------------------------
                   Squirrel  -----------------------cacgca
               Prairie vole  --------------------aggtattca
            Chinese hamster  --------------------aaatactca
             Golden hamster  --------------------aagtattca
                      Mouse  --------------------aagtattca
                        Rat  --------------------aagtattca
             Naked mole-rat  --------------------aaggactca
                 Guinea pig  --------------------aaagagttg
                 Chinchilla  --------------------aaggaatca
           Brush-tailed rat  --------------------aaggaatca
                     Rabbit  --------------------atggactca
                       Pika  --------------------acggactca
                        Pig  --------------------atggacccg
                     Alpaca  --------------------atggactca
             Bactrian camel  --------------------atggactca
                    Dolphin  --------------------acggactca
               Killer whale  --------------------acggactca
           Tibetan antelope  --------------------atggactca
                        Cow  --------------------atggactca
                      Sheep  --------------------atggactca
              Domestic goat  --------------------atggactca
                      Horse  --------------------atggactc-
           White rhinoceros  --------------------atggactca
                        Cat  --------------------ctggactcg
                        Dog  --------------------atggactca
                    Ferret   --------------------atggactca
                      Panda  --------------------atggactca
             Pacific walrus  --------------------atggactca
               Weddell seal  --------------------atggactca
           Black flying-fox  --------------------atagactca
                    Megabat  --------------------atagactca
              Big brown bat  --------------------gcggactca
       David's myotis (bat)  --------------------gcggactca
                   Microbat  --------------------gcggactca
                   Hedgehog  --------------------acaaattca
            Star-nosed mole  --------------------atgaactca
                   Elephant  --------------------acagaccca
        Cape elephant shrew  ttgtttgccatcaactcagaactgactca
                    Manatee  --------------------atggaccca
           Cape golden mole  --------------------a-ggaccca
                     Tenrec  --------------------atggacccc
                   Aardvark  --------------------ttggaccca
                  Armadillo  --------------------atgaactca
     Lesser Egyptian jerboa  -----------------------------
                      Shrew  =============================
            Tasmanian devil  =============================

Inserts between block 28 and 29 in window
       Cape elephant shrew 130bp

Alignment block 29 of 965 in window, 110874033 - 110874079, 47 bps 
B D                   Human  g---caaagtgttagcagagc-------ttcggtcctgac--tctct----------------gtg---a
B D                   Chimp  g---caaagtgttagcagagc-------ttcggtcctgac--tctct----------------gtg---a
B D                 Gorilla  g---caaagtgttagcagagc-------ttgggtcctgac--tctct----------------gtg---a
B D               Orangutan  g---caaagtgttagcagagc-------tttggtcctgac--tctct----------------gtg---a
B D                  Gibbon  g---caaagtgttagcagagc-------tttggtcctgac--tctct----------------gtg---a
B D                  Rhesus  g---caaagtgatagcagagc-------tttggtcctga----ctct----------------gtg---a
B D     Crab-eating macaque  g---caaagtgatagcagagc-------tttggtcctga----ctct----------------gtg---a
B D                  Baboon  g---caaagtgatagcagagc-------tttggtcctgac--tctct----------------gtg---a
B D            Green monkey  g---caaagtgatagcagagc-------tttggtcctgac--tctct----------------gtg---a
B D                Marmoset  g---caaggtgatagccaagc-------ttttgtcctgac--tctct----------------gtg---a
B D         Squirrel monkey  g---taaaatgacagccaagc-------ttttgtcccgac--tctct----------------gtg---a
B D                Bushbaby  g---aaaagtgagagccaaac-------ttt-gtcttgac--tttcgtgaccactgtatcagagtg---t
         Chinese tree shrew  -------agtgg-agccaggc-------tttgatcctgac--tttct----------------gtg---a
B D                Squirrel  gtttcaaagacacagcaaagt-------tttggtcctgac--tttcg----------------gtgacca
               Prairie vole  g---cagagtaatagtcaagc-------tttggtcctgat--tttct----------------gag---a
B D         Chinese hamster  g---cagagggatagtcaaac-------tttggtcctaac--ttcct----------------gag---a
             Golden hamster  a---catagggatactcaagc-------tttggtcctaat--tttct----------------aag---a
B D                   Mouse  g---caaaatgatagtcaagc-------tttg--------------------------------------
B D                     Rat  g---caaaaggatagtcaagc-------tttg--------------------------------------
B D          Naked mole-rat  a---caaagtggtagccaggc-------tttggtactgac--tttcg----------------gtg---a
B D              Guinea pig  a---caaaatataagtcgagc-------tttgcttctgac--ttttg----------------atg---a
                 Chinchilla  a---caaaatggtagttcagc-------ttttattctgac--ttttg----------------gtg---a
           Brush-tailed rat  t---cagcatggcagtgcaac-------tttggttctgac--ttttg----------------gtg---a
B D                  Rabbit  g---tcacagggtagcc-agc-------tctggtcct----------------------------g---a
B D                    Pika  t---tcacgaggtagcc-aac-------ttggattctgac--tttat----------------gcg---a
B D                     Pig  g----aaagtgatagccgagc-------tttggtcctggc--ttttt----------------ttg---a
B D                  Alpaca  g----aaagtgatagc-aagc-------tatgatcctggc--tttct----------------gtg---a
             Bactrian camel  g----aaagtgatagc-tagc-------tgtgatcctggc--tttct----------------gtg---a
B D                 Dolphin  g----aaagtgatagctaagc-------tttggtcctggc--tttct----------------gta---a
               Killer whale  g----aaagtgatagctaagc-------tttggtcctggc--tttct----------------gta---a
           Tibetan antelope  g----aaagtgatagccaagc-------tttggtcctggc--tttct----------------gta---a
B D                     Cow  g----aaagtgatagccaagc-------tttggtcctggc--tttct----------------gta---a
B D                   Sheep  g----aaagtgatagccaagc-------ttcggtcctggc--tttct----------------gta---a
              Domestic goat  g----aaagtgatagccaagc-------ttcggtcctggc--tttct----------------gta---a
B D                   Horse  -----aaagtgatagccaagc-------tttggtcctggg--tttct----------------gtg---a
B D        White rhinoceros  g----aaggtgatagccaagc-------ttttgtcctggc--tttct----------------gtg---a
B D                     Cat  g----aaagtcatggccaagc-------tctggttctggt--ggtct----------------gtg---a
B D                     Dog  g----aaggtcatagtcaagct------tttggtcttgac--tttct----------------gtg---a
B D                 Ferret   g----aaggtcaaagtcaggc-------tttggttttggc--tttct----------------gtg---a
B D                   Panda  g----aaactcaaagtcaagc-------tttggtcctggc--tttct----------------gtg---a
             Pacific walrus  g----aaagtcaaagtcaagc-------tttggtcctgga--tttct----------------gtg---a
               Weddell seal  g----aaagtcaaagtcaagc-------tttggtcctggc--tttct----------------gtg---a
           Black flying-fox  t----aaagtc-----------------tttggtcttggg--tttct----------------gtg---a
B D                 Megabat  t----aaagtc-----------------tttggtcttggg--tttct----------------gtg---a
              Big brown bat  g----aaaggcacag-----------------------------tat----------------gtg---a
       David's myotis (bat)  g----aaaggcccagccaaga-------ttcggtcttggc--tttcc----------------gtg---g
B D                Microbat  g----aaaggcccagtcaagc-------ttcggtcctggc--tttcc----------------gtg---g
B D                Hedgehog  g----aaagtgatagttaacc-------ttt-atactgac--tttct----------------gtg---g
            Star-nosed mole  g----aaagtgatagttcgcg-------t-------tggc--tttct----------------gtg---g
B D                Elephant  ---gctaagtggtagctaagctttaagctttggtcctaactttttcc----------------gtg---a
        Cape elephant shrew  ---gcaaaatggtagctaagctttaaactttgctccacactttttct----------------gtg---t
B D                 Manatee  ---gccaagtggtagctaagctttaagctttggtcctgtctttttct----------------gtg---a
           Cape golden mole  ---gcaaagc-gtagctaagctttaagctatggtcctcactttttct----------------gtg---a
B D                  Tenrec  ---accaagtggtggccaaagtttaagccttggtcct-aatttttca----------------gtg---a
                   Aardvark  ---gcaaagaattagcaaggctttatgctttggtcctaattttttct----------------gtg---a
B D               Armadillo  ---gcaaaggg---------------------------actttctct----------------gta---a
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                   Shrew  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  cca-------------------------------------------------------------------
                      Chimp  cca-------------------------------------------------------------------
                    Gorilla  cca-------------------------------------------------------------------
                  Orangutan  cca-------------------------------------------------------------------
                     Gibbon  cct-------------------------------------------------------------------
                     Rhesus  cca-------------------------------------------------------------------
        Crab-eating macaque  cca-------------------------------------------------------------------
                     Baboon  cca-------------------------------------------------------------------
               Green monkey  cca-------------------------------------------------------------------
                   Marmoset  cca-------------------------------------------------------------------
            Squirrel monkey  cca-------------------------------------------------------------------
                   Bushbaby  tca-------------------------------------------------------------------
         Chinese tree shrew  tcaccatagtactggttgttagaaaagtcatgatgcattttttctatgcgaaaatgtgtcacgactttct
                   Squirrel  ccaccatagcagccgccggtca------------------------------------------------
               Prairie vole  ctaacgtgctcgtcccttgtca------------------------------------------------
            Chinese hamster  ctaacatggttctccattgtca------------------------------------------------
             Golden hamster  ctaatatggttcttcattgtca------------------------------------------------
                      Mouse  ------------------gtca------------------------------------------------
                        Rat  ------------------gtca------------------------------------------------
             Naked mole-rat  ccaccatagcaattggtgttca------------------------------------------------
                 Guinea pig  ccatgacagtaattgctggtca------------------------------------------------
                 Chinchilla  gcactatagcaactgctggtca------------------------------------------------
           Brush-tailed rat  ccaccgtagtaattgctggtca------------------------------------------------
                     Rabbit  ccaccacggtagttgctgggca------------------------------------------------
                       Pika  ccactgcattagttgctgatca------------------------------------------------
                        Pig  ccg-------------------------------------------------------------------
                     Alpaca  cca-------------------------------------------------------------------
             Bactrian camel  cca-------------------------------------------------------------------
                    Dolphin  cca-------------------------------------------------------------------
               Killer whale  cca-------------------------------------------------------------------
           Tibetan antelope  cca-------------------------------------------------------------------
                        Cow  cca-------------------------------------------------------------------
                      Sheep  cca-------------------------------------------------------------------
              Domestic goat  cca-------------------------------------------------------------------
                      Horse  cc--------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  cca-------------------------------------------------------------------
                        Dog  cca-------------------------------------------------------------------
                    Ferret   cca-------------------------------------------------------------------
                      Panda  tca-------------------------------------------------------------------
             Pacific walrus  cca-------------------------------------------------------------------
               Weddell seal  cca-------------------------------------------------------------------
           Black flying-fox  cca-------------------------------------------------------------------
                    Megabat  cca-------------------------------------------------------------------
              Big brown bat  cca-------------------------------------------------------------------
       David's myotis (bat)  cca-------------------------------------------------------------------
                   Microbat  cca-------------------------------------------------------------------
                   Hedgehog  cta-------------------------------------------------------------------
            Star-nosed mole  cca-------------------------------------------------------------------
                   Elephant  cgatcgtggtagttgttgggga------------------------------------------------
        Cape elephant shrew  ttattgtggtactttctgggg-------------------------------------------------
                    Manatee  ctatcgtggtagttgctgagg-------------------------------------------------
           Cape golden mole  tgatcacggtagtggctgaggg------------------------------------------------
                     Tenrec  ccgttgagctagctgctggggg------------------------------------------------
                   Aardvark  ctatcatgatagttgctggggg------------------------------------------------
                  Armadillo  ccaccgtaggggttgctgggag------------------------------------------------
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
                      Shrew  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  -------------------ccatc----------
                      Chimp  -------------------ccata----------
                    Gorilla  -------------------ccata----------
                  Orangutan  -------------------ccata----------
                     Gibbon  -------------------ccata----------
                     Rhesus  -------------------ccata----------
        Crab-eating macaque  -------------------ccata----------
                     Baboon  -------------------ccata----------
               Green monkey  -------------------ccata----------
                   Marmoset  -------------------ccaca----------
            Squirrel monkey  -------------------ccata----------
                   Bushbaby  -------------------ccaca----------
         Chinese tree shrew  gacgacccaatagtttctgccata----------
                   Squirrel  -------------------ccaca----------
               Prairie vole  -------------------ataca----------
            Chinese hamster  -------------------ataca----------
             Golden hamster  -------------------ataca----------
                      Mouse  -------------------ataca----------
                        Rat  -------------------aaaca----------
             Naked mole-rat  -------------------ctaca----------
                 Guinea pig  -------------------ctata----------
                 Chinchilla  -------------------ctaca----------
           Brush-tailed rat  -------------------ctaat----------
                     Rabbit  -------------------ccgcg----------
                       Pika  -------------------ctaca----------
                        Pig  -------------------ctata----------
                     Alpaca  -------------------ctgtt----------
             Bactrian camel  -------------------ctgtt----------
                    Dolphin  -------------------ctata----------
               Killer whale  -------------------ctata----------
           Tibetan antelope  -------------------ctata----------
                        Cow  -------------------ctata----------
                      Sheep  -------------------ctata----------
              Domestic goat  -------------------ctata----------
                      Horse  -------------------ccata----------
           White rhinoceros  -------------------ccacc----------
                        Cat  -------------------ccata----------
                        Dog  -------------------ccata----------
                    Ferret   -------------------cccta----------
                      Panda  -------------------ccgta----------
             Pacific walrus  -------------------ccata----------
               Weddell seal  -------------------ccata----------
           Black flying-fox  -------------------ccata----------
                    Megabat  -------------------ccata----------
              Big brown bat  -------------------ccatg----------
       David's myotis (bat)  -------------------cccta----------
                   Microbat  -------------------ccttt----------
                   Hedgehog  -------------------aacta----------
            Star-nosed mole  -------------------ccata----------
                   Elephant  -------------------tcaagtcttaccact
        Cape elephant shrew  -------------------tcatgtct----att
                    Manatee  -------------------tcaagtctcaccact
           Cape golden mole  -------------------tcaggtc--accact
                     Tenrec  -------------------tgaaatc--accact
                   Aardvark  -------------------ttaggtc--accact
                  Armadillo  -------------------tcaggtc--cccact
     Lesser Egyptian jerboa  ----------------------------------
                      Shrew  ==================================
            Tasmanian devil  ==================================

Inserts between block 29 and 30 in window
B D                    Pig 24bp
B D                 Alpaca 24bp
            Bactrian camel 24bp
B D                Dolphin 24bp
              Killer whale 24bp
          Tibetan antelope 24bp
B D                    Cow 24bp
B D                  Sheep 24bp
             Domestic goat 24bp
B D                  Horse 27bp
B D       White rhinoceros 27bp
B D                    Cat 27bp
B D                    Dog 27bp
B D                Ferret  27bp
B D                  Panda 27bp
            Pacific walrus 27bp
              Weddell seal 27bp
          Black flying-fox 24bp
B D                Megabat 24bp
             Big brown bat 25bp
      David's myotis (bat) 22bp
B D               Microbat 22bp
B D               Hedgehog 30bp
           Star-nosed mole 22bp

Alignment block 30 of 965 in window, 110874080 - 110874116, 37 bps 
B D                   Human  ggaaa-ctctat--gta----agagctttcttcttcc----aag-acct
B D                   Chimp  ggaaa-ctctat--ata----agagctttcttcttcc----aag-acct
B D                 Gorilla  ggaaa-ctc------ta----agagctttcttcttcc----aag-acct
B D               Orangutan  ggaaa-ctgtac--ata----agagctttcttcttcc----aag-acct
B D                  Gibbon  ggaaa-ctctat--ata----agagctttcttcttcc----aag-acct
B D                  Rhesus  ggaaa-ctctat--ata----agagctttcttcttcc----aag-acct
B D     Crab-eating macaque  ggaaa-ctctat--ata----agagctttcttcttcc----aag-acct
B D                  Baboon  ggaaa-ctctat--ata----agagctttcttcttcc----aag-acct
B D            Green monkey  ggaaa-ctctat--ata----agagctttcttcttcc----aag-acct
B D                Marmoset  gg-aa-ctctat--atgagatagagctttcttcttcc----aagaacct
B D         Squirrel monkey  gg-aa-ctctat--gtg----ggagctttcttcttcc----aagaacct
B D                Bushbaby  gcaaa-ctctat--atc----agagtgttcctcttct----aag-atcg
         Chinese tree shrew  ggaaa-cttta----tc----agtttttttctcttcc----aag-gcct
B D                Squirrel  gaaaa-atctac--atc----agatctttcttcctcc----aac-acct
               Prairie vole  -aaat-gtctct--gtc----aggtccttcttagtcc----agg-aact
B D         Chinese hamster  -acat-gtttgt--atc----aggtctttcttggtcc----agg-agct
             Golden hamster  -acat-gtctgt--atc----aggtctttcttggtcc----aag-agct
B D                   Mouse  -aaat-gtctgt--atc----aggtctttcttggtcc----aag-agct
B D                     Rat  -aaat-gtctgt--atc----gggtcttttttggtcc----aag-aact
B D          Naked mole-rat  ggaaa-atttat--atc----agatctttctacttcc----aag-atct
B D              Guinea pig  gggag-ctttat--att----agatatttcttcttcc----aag-atct
                 Chinchilla  ggaaa-ttctat--atc----ggatctttcttcttcc----aag-atct
           Brush-tailed rat  ggaaa-ctttat--atc----agatctttattcttca----aag-atct
B D                  Rabbit  ggag--ctctgt--gtc----ggagcttacttctcta----gag-gcct
B D                    Pika  gatga-ctctgt--atc----acagctttctgcttta-----ag-gcct
B D                     Pig  gagag-ttctag--atc----aaagctttttccttcc----aag-atgt
B D                  Alpaca  gggaa-ctctag--atc----atagctttctccttcc----aag-acct
             Bactrian camel  gggaa-ctctag--atc----atagctttctccttcc----aag-acct
B D                 Dolphin  gggaa-ctctag--atg----aaagctttctccttcc----aat-attt
               Killer whale  gggaa-ctctag--atg----aaagctttctccttcc----aat-attt
           Tibetan antelope  aagaa-ctctag--atg----aaagctttctccttcc----aag-atct
B D                     Cow  aggaa-ctctag--atg----aaagctttctccttcc----aag-atct
B D                   Sheep  aagaa-ctctag--atg----aaagctttctccttcc----aag-atct
              Domestic goat  aagaa-ctctag--atg----aaagctttctccttcc----aag-atct
B D                   Horse  ggaaa---ctag--atc----agagctttctctttcc----atg-acct
B D        White rhinoceros  ggaaa-ctctag--atc----agagctttctttttcc----aag-acct
B D                     Cat  ggaaa-cactgaatatc----agagctttctccttcc----aag-accc
B D                     Dog  ggaaa-cactaa--atc----agagctttctccttcc----aag-actt
B D                 Ferret   ggaaa-cactaa--atc----agagctttctccttct----aag-acct
B D                   Panda  ggaaa-cactca--atc----agagctttctccttct----aag-acct
             Pacific walrus  ggaaa-cactaa--atc----agagctttctccttct----aat-acct
               Weddell seal  ggaaa-cactaa--acc----agagctttctctttct----aat-acct
           Black flying-fox  gggaa-ctctag--atc----gaaactttctccttcc----agg-acct
B D                 Megabat  gggaa-ctctag--atc----gaaactttctccttcc----agg-acct
              Big brown bat  gggga-ctctag--acc----agagccctct-cctcc----agg-acct
       David's myotis (bat)  ---------------tt----agagctccctccctcc----agg-acct
B D                Microbat  ---------------tt----agagctctctccctca----ggg-acct
B D                Hedgehog  agaaa-ttctgg--atc----aaag---ttttctcctacaaaag-atca
B D                   Shrew  gaaaa-ctttat--atc----aaagcattctttttcc----aag-atct
            Star-nosed mole  aaaag-ct-------------aaaagagctttctcct----tag-atct
B D                Elephant  ggata-tgctgt--atc----agcgctttcttcttcc----agg-acct
        Cape elephant shrew  ggaaa---ctct--atc----agagttttcttcttct----aaa-atca
B D                 Manatee  ggaaa-tgctgt--atc----agagctttcttcttcc----agg-acct
           Cape golden mole  ggaaacttaagt--atc----agaacttt---cttct----aag-atct
B D                  Tenrec  ggaaa-ttctgt--att----agagatttctccttcc----aag-gtct
                   Aardvark  ggaaa-ctctgt--atc----agaacttcttttttac----aaa-atgt
B D               Armadillo  ggaaa-ctctgt--ttc----agagctttctctttcc----aag-actg
    Lesser Egyptian jerboa  -------------------------------------------------
B D         Tasmanian devil  =================================================

Alignment block 31 of 965 in window, 110874117 - 110874252, 136 bps 
B D                   Human  gtg-agaatttcacttgattatgccctggagcagaaaggagaaa-gttct-ctttgatta-cacccaccc
B D                   Chimp  gtg-agaatttcacttgattatgccctggagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D                 Gorilla  gtg-agaatttcacttgattatgccctggagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D               Orangutan  gtg-agaatttcacttgattatgccctggagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D                  Gibbon  gtg-agaatttcacttgattatgccctggagcagaaaagagaaa-gttct-ctttgacta-cacccaccc
B D                  Rhesus  gtg-agaatttcacttgagtacgccctggagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D     Crab-eating macaque  gtg-agaatttcacttgagtacgccctggagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D                  Baboon  gtg-agaatttcacttgattacgccctggagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D            Green monkey  gtg-agaatttcgcttgattacgccctagagcagaaaggagaaa-gttct-ctttgacta-cacccaccc
B D                Marmoset  gtg-agaatttcattggattatgccctggagcagagaggaggaa-gttct-ctttgacta-cacccaccc
B D         Squirrel monkey  gcg-agaatttcatttgattatgccctggaccagagaggaggaa-gttct-ctttgacta-cacccaccc
B D                Bushbaby  ggg-agaatctc-cttcattatgcctagaggcttgaagg-gaaa-gttct-ctgcaatca-catgcaccc
         Chinese tree shrew  gtg-agaatctcacttgattatgccctggtgggtagaggggaaa-gttcc-ctgtgacca-tat-catct
B D                Squirrel  gtg-agaatctcatttgattatgccctggaggagagagaggaaa-gtccc-ttgtgacca-catccacgt
               Prairie vole  gtg-ag-agctcttttgattatgatctaaaggagagagaagaaa-gtccc-ctgtgacct-catttactc
B D         Chinese hamster  tca-agaagctaatttgattatgatctaaaggagagagaagaaa-gtccc-ctgtggcca-catttactc
             Golden hamster  gcg-agaagctaatttgattatgagctaaacaagagagaagaaa-gtccc-ctgtgacca-catttactc
B D                   Mouse  gtg-aagagctcatttgattataatctaaaagggagaaagtaaa-gtatc-c-atgtcca-cattttctc
B D                     Rat  gtg-agaagatcgtttgattataatctaaaggggagaaagtaaa-gtacc-c-atgtcca-catttactt
B D          Naked mole-rat  atgaaaaatcttatatgattttgtcctagaatagataaaggaaa-gtcct-ctgtgatct-tgcccaacc
                 Chinchilla  atg-aaaatttcatatgattatgtcctagaatatatataggaaa-gtccc-ctgtgacct-catgcaccc
           Brush-tailed rat  atg-aaaatctcctatgaatatgtcctaga--atagataggatc-atctt-ctgtgacct-cacccaccc
B D                  Rabbit  gcg-agaatctcgcttgattagactctgggaggaagagaggaaa-gtccc-ctgtgacca-cactcacgt
B D                    Pika  gta-agattctcatttcattaggctctgggaggcagggaggaaa-gtccc-ctgtgacca-cactcacat
B D                     Pig  gca-agaatcttaccag-------------gaatggggaggaaa-gtccc-ctagaaccg-tacccaccc
B D                  Alpaca  gca-agaatcttccctg-------------gaatagcgagggaa-gtccc-atagaacca-cacacaccc
             Bactrian camel  gca-agaatcttccctg-------------gaatagcgagggaa-gtccc-acagaacca-cacccaccc
B D                 Dolphin  gca-aggatcttactgg-------------gaatggagaggaaa-gtccc-ctagaacca-cactcaccc
               Killer whale  gca-aggatcttactgg-------------gaatggagaggaaa-gtccc-ctagaacca-cactcaccc
           Tibetan antelope  gta-agaatcatacagg-------------gagtggaaaggaaa-gttct-gtagaacca-cactcatcc
B D                     Cow  gca-agaatcatacagg-------------gaatggaaaggaaa-tttct-gtagaacca-cactcatcc
B D                   Sheep  gca-agaatcatacagg-------------gaatggaatggaaa-gttct-gtagaacca-cactcatcc
              Domestic goat  gta-agaatcctacagg-------------gaatggaaaggaaa-gttct-gtagaaccg-cactcatcc
B D                   Horse  cca-agaatctcacctgattatgccctg--gaggggaaaagaaa-gtccc-ttaggacca-cactcactt
B D        White rhinoceros  cca-agaatctcagctgattatgccctg--aaggggagaggaaa-gtacc-ctaggacca-cactcacct
B D                     Cat  gca-agaatctcaactgatcataccctg--gaggagacagaaaa-gtcct-caaggacca-tacccaccc
B D                     Dog  gca-agcatctcaactgattatgccct----gggggagaggaaa-atctt-ccagaaaaa-tacttacac
B D                 Ferret   gta-ggaatctcaattgattataccct------tggagagaaaa-gccct-caaggaccattactaaccg
B D                   Panda  gca-ggaatctccactgattatgccct---agggggagaggaaa-gccct-caaggaccattacttacca
             Pacific walrus  gca-ggaatctcaactgattatgccct---aaggggagaggaag-gccct-caaggaccattccttacca
               Weddell seal  gca-ggagtctcaactgattatgccct---agggggagaggatg-gccct-caaggaccattacttacca
           Black flying-fox  gcc-agtatctggcttg-------------gaagggagaggaaa-tttcc-ctaagatga-caaccaccc
B D                 Megabat  gcc-agtatctggcttg-------------gaagggagaggaaa-tttcc-ctaagatga-caaccaccc
              Big brown bat  cca-ggagtgtctcctg-------------gcgggcagagcaga-gt--------------------ccc
       David's myotis (bat)  gca-agagt-----ctg-------------gcgggcagagcaga-gtccc-cgg--------gaccaccc
B D                Microbat  gca-agagtgcctcctg-------------gcgggcagagcaga-gtccc-cgg--------gaccaccc
B D                Hedgehog  aca-agactctcacatgactatta------gaaaagagaagaaa-gtacc-ttagaac------ccaccc
B D                   Shrew  tca-agaattttacttgacttttctct---ggaaagaaaggaaa-gtctc-atagaagca-ca-ctcacc
            Star-nosed mole  ata-tacatctctcctgagtacatgct---ggggggagagaaaa-gccct-ctaggatta-ca-ccacgc
B D                Elephant  gta-agactctgacttgactgtgccctggaagggagaggggaaaacatcc-ccaggacca-catctaccc
        Cape elephant shrew  gta-agattctcatttaatt-----------------------aacatctactaggacca-cgtctgccc
B D                 Manatee  gca-agactctcacttgattatgccctggaagggagagaggaaaacctcc-ccaggacca-catctaccc
           Cape golden mole  aca-agactctcacttgattatgccctggaaaagagaaaggaaacaaccc-ctaggccca-catgtatcc
B D                  Tenrec  gcg-agactctcacttgactgtgccct--aaaagaaaagggagccatccc-ctgagaccc-caactatcc
                   Aardvark  gca-agactttcatttgattatgcactggaagggataggagaaatatccc-cttggg-----atctactc
B D               Armadillo  gca-agaatctcacttgtttatgccgaggaggggag-ggggaaacacccc-agcagatca-cacccacct
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D              Guinea pig  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  -atc------------t------aagtatgaggattgggaac-agggc----------a-gagggctcta
                      Chimp  -atc------------t------aagtatgaggattgggaac-agggc----------a-gagggctcta
                    Gorilla  -atc------------t------aagtacgaggattgggaac-agggc----------a-gagggctcta
                  Orangutan  -atc------------t------aagtatgagggttgggaac-aggac----------a-gagggatcta
                     Gibbon  -atc------------t------aagaatgagggctgggaac-agggc----------a-gagggctcta
                     Rhesus  -atc------------t------aagaatgagggttgggaac-agggc----------a-gagggctcta
        Crab-eating macaque  -atc------------t------aagaatgagggttgggaac-agggc----------a-gagggctcta
                     Baboon  -atc------------t------aagaatgagggttgggaac-agggc----------a-gagggctcta
               Green monkey  -atc------------t------aagaatgagggttgggaac-agggc----------a-gagggctcta
                   Marmoset  -atc------------t------aagaatcagggttgagaac-agggc----------a-ga-ggctcta
            Squirrel monkey  -atc------------t------aagaa--agggttgagaac-agggc----------a-aa-ggctcta
                   Bushbaby  -cct------------c------------------------------c----------t-aagagct---
         Chinese tree shrew  -act------------t------aagaatgaagagt----------------------------------
                   Squirrel  -atc------------t------aaggaccaggggttgggat-ggggc----------a-ga--------
               Prairie vole  -acc------------t------aaaaatcaggggagaaaat-gggg-----------a-ga--------
            Chinese hamster  -acc------------t------aacaatcatgggggagaatagggg-----------a-ga--------
             Golden hamster  -act------------t------aaaaatcaggggagagaat-gggg-----------a-ga--------
                      Mouse  -acc------------t------aaaattcaagggagatgat-tggg-----------a-gt--------
                        Rat  -acc------------t------gaaactcaagggagatcat-gtgg-----------a-ga--------
             Naked mole-rat  -acc------------t------aaaaatgagaggtggggat-ttggcag--------a-gg--------
                 Chinchilla  -acc------------t------aagaatgagaggttgggat-ttggcac--------a-gg--------
           Brush-tailed rat  -acc------------t------aagaatgacacatggggat-ttggcaatttggcaga-gg--------
                     Rabbit  -agc------------t------gtggaggaggggtggtgac-ggg------------a-ga--------
                       Pika  -aga------------ggaggaagaggaggagaggttgcagc-aggac----------a-gg--------
                        Pig  --cc------------t------aacaatgggggataggcat-gagta----------a-aggggc----
                     Alpaca  -acc------------t------aacaatgaggaatgggaat-ggaac----------c-aagggctcta
             Bactrian camel  -acc------------t------aacaatgagggatgggaat-ggaac----------c-aagggctcta
                    Dolphin  -acc------------t------aacaatgaggcatgggaat-ggggg----------a-aagggctgta
               Killer whale  -acc------------t------aacaatgaggcatgggaat-ggggg----------a-aagggctgta
           Tibetan antelope  -acc------------t------aatgatgaggcaggggaat-ggggc----------a-aagggctatc
                        Cow  -acc------------t------aataatgagacacgggaat-ggggc----------a-aagggctata
                      Sheep  -acc------------t------aatgatgaggcaggggaat-ggggc----------a-aaggactatc
              Domestic goat  -acc------------t------aatgatgaggcaggggaat-gggac----------a-aagggctatc
                      Horse  -acc------------t------aacaatgaaggatgggaat-gagcc----------a-gagagctcta
           White rhinoceros  -acc------------t------aacaatgagggatgggaat-gcacc----------g-cagggatcta
                        Cat  -acc------------t------aacaatgagggatagcaat-gccac----------c-gagggcttta
                        Dog  -acc------------t------aacaatggaggatggcaat-gccac----------tggggggttcta
                    Ferret   -acc------------t------aacaatgagggatggcaac-acctc----------c-aagggctcta
                      Panda  -acc------------t------aacagtgaggaatggcaag-gccac----------c-gagggctctt
             Pacific walrus  -act------------t------aacaatgagggatggcaac-gtcac----------c-aagggctcta
               Weddell seal  -acc------------t------aacaatgagggatggcaac-gtcac----------c-aagggctcta
           Black flying-fox  -acc------------t------aacagtg------------------------------agtggtgg--
                    Megabat  -acc------------t------aacagtg------------------------------agtggcgg--
              Big brown bat  -acc------------t------gacc-------------------------------------------
       David's myotis (bat)  -acc------------t------gaccatactc---------------------------gagggttc--
                   Microbat  -acc------------t------gaccgagctcggtgggcat-tcggc----------a-gagggttc--
                   Hedgehog  -agt------------g------aacagtgagggatggg-at-ggtgc----------a-gagagttgta
                      Shrew  -tcc------------t------aacaaagagaaatgaaaat-----------------------ttgta
            Star-nosed mole  -act------------t------gacagtgaggattgggaat-agaga----------a-aaagattcca
                   Elephant  -ccacacc--------c------aactaaggg-ggatgggag-ga-gc----------a-gaggtgtcta
        Cape elephant shrew  ttcacaccaccaccatc------ccccaagag-gacaggaat-ga-ac----------a-gaggtctctg
                    Manatee  -ccacacc--------c------aactaagggagatgggaat-gg-gc----------a-gcggtctctg
           Cape golden mole  -ccac-----------t------agctaaaggggatgggaat-gg-gc----------a-gaggtctcta
                     Tenrec  -tctc-----------t------aactaaaggggatgggaag-gg-ac----------a-ga--------
                   Aardvark  -cccc-----------t------aactaaacgagatgggaat-gg-------------------------
                  Armadillo  -actt-----------c------c-----gagggtcgggact-gaggc----------c-gaggtctttt
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
            Tasmanian devil  ======================================================================

                      Human  gatttccaagaggggtggggac-ggggagagg---------------------
                      Chimp  gatttccaagaggggtggggac-ggggagagg---------------------
                    Gorilla  gatttccaagaggggtggggac-ggggagagg---------------------
                  Orangutan  gatttccaagaggggtggggacaggggagagg---------------------
                     Gibbon  gatttccaagacggatggggacaggggagagg---------------------
                     Rhesus  gatttccaagaggggtggggacaggggagagg---------------------
        Crab-eating macaque  gatttccaagaggggtggggacaggggagagg---------------------
                     Baboon  gatttccaagaggggtggggacaggggagagg---------------------
               Green monkey  gatttccaagaggggtggggacaggggagagg---------------------
                   Marmoset  gatttccaagaggggtggggacagggcaaaga---------------------
            Squirrel monkey  gatttccacgaggggtggggacagggcaaagg---------------------
                   Bushbaby  ----------aggggtggggat--gatccagg---------------------
         Chinese tree shrew  -----------------gggactgggcagaaa---------------------
                   Squirrel  -----------------------------------------------------
               Prairie vole  -----------------------------------------------------
            Chinese hamster  -----------------------------------------------------
             Golden hamster  -----------------------------------------------------
                      Mouse  -----------------------------------------------------
                        Rat  -----------------------------------------------------
             Naked mole-rat  -----------------------------------------------------
                 Chinchilla  -----------------------------------------------------
           Brush-tailed rat  -----------------------------------------------------
                     Rabbit  -----------------------------------------------------
                       Pika  -----------------------------------------------------
                        Pig  -----------------------------------------------------
                     Alpaca  -----------------------------------------------------
             Bactrian camel  -----------------------------------------------------
                    Dolphin  -----------------------------------------------------
               Killer whale  -----------------------------------------------------
           Tibetan antelope  -----------------------------------------------------
                        Cow  -----------------------------------------------------
                      Sheep  -----------------------------------------------------
              Domestic goat  -----------------------------------------------------
                      Horse  -----------------------------------------------------
           White rhinoceros  -----------------------------------------------------
                        Cat  -----------------------------------------------------
                        Dog  -----------------------------------------------------
                    Ferret   -----------------------------------------------------
                      Panda  -----------------------------------------------------
             Pacific walrus  -----------------------------------------------------
               Weddell seal  -----------------------------------------------------
           Black flying-fox  -----------------------------------------------------
                    Megabat  -----------------------------------------------------
              Big brown bat  -----------------------------------------------------
       David's myotis (bat)  -----------------------------------------------------
                   Microbat  -----------------------------------------------------
                   Hedgehog  -----------------------------------------------------
                      Shrew  -----------------------------------------------------
            Star-nosed mole  -----------------------------------------------------
                   Elephant  --------------------------------gattt-gcaaag----gaaag
        Cape elephant shrew  --------------------------------tattt-ataaaggaaagaaag
                    Manatee  --------------------------------gattc-gtaaag----ggaag
           Cape golden mole  --------------------------------gattc-ataaac----aaaat
                     Tenrec  -----------------------------------------------------
                   Aardvark  -----------------------------------------------------
                  Armadillo  --------------------------------gcttcagccaag----gaaag
     Lesser Egyptian jerboa  -----------------------------------------------------
                 Guinea pig  -----------------------------------------------------
            Tasmanian devil  =====================================================

Inserts between block 31 and 32 in window
B D               Squirrel 17bp
              Prairie vole 2bp
B D        Chinese hamster 2bp
            Golden hamster 2bp
B D                  Mouse 2bp
B D                    Rat 2bp
B D                 Rabbit 2bp
B D                   Pika 2bp

Alignment block 32 of 965 in window, 110874253 - 110874268, 16 bps 
B D                   Human  gctctggattcccaaa
B D                   Chimp  gctctagattcccaaa
B D                 Gorilla  gctctggattcccaaa
B D               Orangutan  gctctagattcccaaa
B D                  Gibbon  gctccagattcccaaa
B D                  Rhesus  gttctagattcccaaa
B D     Crab-eating macaque  gttctagattcccaaa
B D                  Baboon  gttctagattcccaaa
B D            Green monkey  gttctagattcccaaa
B D                Marmoset  gttctagatt-ccaaa
B D         Squirrel monkey  gctctagatt-ccaaa
B D                Bushbaby  gctatagatttccaaa
         Chinese tree shrew  gttatagattcccaaa
B D                Squirrel  ---------------a
     Lesser Egyptian jerboa  gctttaaatttctaaa
               Prairie vole  gcgacagcttaccatg
B D         Chinese hamster  gctgcagcttaccaaa
             Golden hamster  gctgcagcttaccaaa
B D                   Mouse  gttgcagcttgtcaga
B D          Naked mole-rat  gcttcagattctcaaa
                 Chinchilla  gctttagactcccaaa
           Brush-tailed rat  gcttcagattcccaaa
B D                  Rabbit  gccctagactctgag-
B D                    Pika  gctctagactccaac-
B D                     Pig  -------------aaa
B D                  Alpaca  ------gattcccaaa
             Bactrian camel  ------gattcccaaa
B D                 Dolphin  ------gattcccaaa
               Killer whale  ------gattcccaaa
           Tibetan antelope  ------gattctataa
B D                     Cow  ------gattctataa
B D                   Sheep  ------aattctataa
              Domestic goat  ------gattctataa
B D                   Horse  ------gattcccaaa
B D        White rhinoceros  ------tgttcccaaa
B D                     Cat  ------gattcccaaa
B D                     Dog  ------gattcccaaa
B D                 Ferret   ------gattcccaaa
B D                   Panda  ------gattcccaaa
             Pacific walrus  ------gattcccaag
               Weddell seal  ------gattcccaaa
           Black flying-fox  ------gaatgccaaa
B D                 Megabat  ------gaatgccaaa
              Big brown bat  --------------aa
       David's myotis (bat)  ------gattcccaaa
B D                Microbat  ------gattcccaaa
B D                Hedgehog  ------aattcccaa-
B D                   Shrew  ------attctcaaa-
            Star-nosed mole  ------gattccaga-
B D                Elephant  -------gttca----
        Cape elephant shrew  -------gctca----
B D                 Manatee  -------gttca----
           Cape golden mole  -------g-tca----
B D               Armadillo  -------gttca----
B D                     Rat  ================
B D              Guinea pig  ----------------
                  Aardvark  ----------------
B D         Tasmanian devil  ================
B D                  Tenrec  ----------------

Inserts between block 32 and 33 in window
B D               Squirrel 2bp
    Lesser Egyptian jerboa 2bp
              Prairie vole 2bp
B D        Chinese hamster 2bp
            Golden hamster 1bp
B D                  Mouse 2bp

Alignment block 33 of 965 in window, 110874269 - 110874304, 36 bps 
B D                   Human  acacctcagag---ttt------------attgag--cct------------------------------
B D                   Chimp  acacctcagag---ttt------------attgag--cct------------------------------
B D                 Gorilla  acacctcagag---ttt------------attgag--cct------------------------------
B D               Orangutan  acacctcagag---ttt------------attgag--cct------------------------------
B D                  Gibbon  acacctcagag---ttt------------attgag--cct------------------------------
B D                  Rhesus  acacctgagag---ctt------------attgag--cct------------------------------
B D     Crab-eating macaque  acacctgagag---ctt------------attgag--cct------------------------------
B D                  Baboon  acacctcagag---ctt------------attgag--cct------------------------------
B D            Green monkey  acacctcagag---ctt------------attgag--cct------------------------------
B D                Marmoset  gcacctcagag---ctt------------attgag--cct------------------------------
B D         Squirrel monkey  gcacctcagag---ctt------------attgag--cct------------------------------
B D                Bushbaby  gcacctcaggg---gct------------atttgg--cct------------------------------
         Chinese tree shrew  gcacctcacgg---gct------------actgag--gct------------------------------
B D                Squirrel  a--cttcaggg---gct------------acaaag--cct------------------------------
     Lesser Egyptian jerboa  a--tgtcacaa---gct------------actgaa--tgt------------------------------
               Prairie vole  ttccctcagag---gct------------actaaa--cct------------------------------
B D         Chinese hamster  ctccctcagag---gct------------accaaa--ccc------------------------------
             Golden hamster  ctccctcagag---gct------------accaaa--ccc------------------------------
B D                   Mouse  caccctcagag---gct------------actaaa--cct------------------------------
B D                     Rat  ---cttcagag---gct------------cctaaa--cct------------------------------
B D          Naked mole-rat  acatgtcaggg---act------------atcgag--ctt------------------------------
B D              Guinea pig  acatgtcaggt---act------------attgag--ctt------------------------------
                 Chinchilla  acatgtcaggt---act------------attgag--ctt------------------------------
           Brush-tailed rat  acatgtcaggt---act------------gttcag--ctt------------------------------
B D                  Rabbit  gtacttcagga---gct------------cctggg--ccg------------------------------
B D                    Pika  gtactttgagg---gct------------cctagg--tct------------------------------
B D                     Pig  gcacctcaggg---gct------------attgag--tct------------------------------
B D                  Alpaca  gcacctcaggg---gct------------atcaag--cct------------------------------
             Bactrian camel  gcacctcaggg---gct------------atcaag--cct------------------------------
B D                 Dolphin  gcacctcaggg---act------------attgca--ctt------------------------------
               Killer whale  gcacctcaggg---act------------attgca--ctt------------------------------
           Tibetan antelope  gcatctcaggg---gct------------attgac--ctt------------------------------
B D                     Cow  gcatctcaggg---gct------------attgac--ctt------------------------------
B D                   Sheep  gcatctcaggg---gct------------attgac--ctt------------------------------
              Domestic goat  gcatctcaggg---gct------------attgac--ctt------------------------------
B D                   Horse  gcacctccggg---gct------------attagg--cct------------------------------
B D        White rhinoceros  gcacctcaggg---gct------------attaag--cct------------------------------
B D                     Cat  gcacctcaggg---gccgctgagccacaaattaaa--acaattttattttatttgtttaagattttgttt
B D                     Dog  gtatctcaggg---gcc------------attgag--cca------------------------------
B D                 Ferret   gcacctcaggg---gcc------------attgag--cca------------------------------
B D                   Panda  gcacctcaggg---gcc------------actaag--cca------------------------------
             Pacific walrus  gtacctcaggg---gcc------------attgag--cca------------------------------
               Weddell seal  gcacctcaggg---gcc------------attgag--cca------------------------------
           Black flying-fox  gcacctcaaaa---gct------------attgaa--cct------------------------------
B D                 Megabat  gcacctcaaaa---gct------------attgaa--cct------------------------------
              Big brown bat  gcacctcgggg---gct------------attgaa--cgt------------------------------
       David's myotis (bat)  gcacctcggtg---gct------------attgaa--cct------------------------------
B D                Microbat  gcacctcgggg---gct------------attgaa--cct------------------------------
B D                Hedgehog  --agtgcaggg---act------------actgat--act------------------------------
B D                   Shrew  tcacagtaagg---gct------------actgat--act------------------------------
            Star-nosed mole  gcaccacaggg---gca------------atggat--tct------------------------------
B D                Elephant  gcacttcaggg---gct------------gttgag--cct------------------------------
        Cape elephant shrew  gctcctca-ag---gct------------attgagctctt------------------------------
B D                 Manatee  gcatctcaggg---gcg------------attcag--cct------------------------------
           Cape golden mole  acactaatggaggcatt------------atggag--tct------------------------------
B D                  Tenrec  --------------gtt------------attgag--cct------------------------------
B D               Armadillo  gcactgtcgag---gtg------------atggag--tct------------------------------
                  Aardvark  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  -----------------------------tg--tatt-aaaaaat
                      Chimp  -----------------------------tg--tatt-aaaaaat
                    Gorilla  -----------------------------tg--tattaaaaaaat
                  Orangutan  -----------------------------tg--tatt-aaaaaat
                     Gibbon  -----------------------------tg--tatt-aaaaaat
                     Rhesus  -----------------------------tg--aatt-aaaaaat
        Crab-eating macaque  -----------------------------tg--aatt-aaaaaat
                     Baboon  -----------------------------tg--aatt-aaaaaat
               Green monkey  -----------------------------tg--aatt-aaaaaat
                   Marmoset  -----------------------------tg--aatt-gaaaaat
            Squirrel monkey  -----------------------------tg--aatt-aaaaaat
                   Bushbaby  -----------------------------tc--aatt-taaaaat
         Chinese tree shrew  -----------------------------tg--aatt-taagaat
                   Squirrel  -----------------------------taattttt-ttttaaa
     Lesser Egyptian jerboa  -----------------------------ta--aatt-tagaagc
               Prairie vole  -----------------------------ta--taat-tagaaaa
            Chinese hamster  -----------------------------ta--taa--tagaaat
             Golden hamster  -----------------------------ta--taa--tagaaat
                      Mouse  -----------------------------ta--tgtt-tataaat
                        Rat  -----------------------------ta--tgtt-tagaaat
             Naked mole-rat  -----------------------------tg--aatt-tggaaat
                 Guinea pig  -----------------------------cg--aatt-tgaaaat
                 Chinchilla  -----------------------------tg--aatt-t-gaaat
           Brush-tailed rat  -----------------------------tg--aact-tggaaat
                     Rabbit  -----------------------------tg--gctt-agaagat
                       Pika  -----------------------------tg--agtt-tcaaaat
                        Pig  -----------------------------tg--aatt-tt-taa-
                     Alpaca  -----------------------------tg--aatt-taaaaac
             Bactrian camel  -----------------------------tg--aatt-taaaaac
                    Dolphin  -----------------------------tg--aatt-ta-aaa-
               Killer whale  -----------------------------tg--aatt-ta-aaa-
           Tibetan antelope  -----------------------------tg--aatt-tc-aaat
                        Cow  -----------------------------tg--aatt-tcaaaat
                      Sheep  -----------------------------tg--aatt-tc-aaat
              Domestic goat  -----------------------------tg--aatt-tc-aaac
                      Horse  -----------------------------tg--aatt-taaaaat
           White rhinoceros  -----------------------------tg--aatt-taaaaat
                        Cat  taagtaatctctacgcccagcgtggggctcg--aact-tacaacc
                        Dog  -----------------------------ta--aatt-taaaaat
                    Ferret   -----------------------------tg--aatt-taaaaat
                      Panda  -----------------------------tg--aatt-taaaaat
             Pacific walrus  -----------------------------tg--aatt-taaaaat
               Weddell seal  -----------------------------tg--aatt-taaaaat
           Black flying-fox  -----------------------------tg--aatt-taaaaat
                    Megabat  -----------------------------tg--aatt-taaaaat
              Big brown bat  -----------------------------tg--aatt-taaaaat
       David's myotis (bat)  -----------------------------tg--agtt-taaaaat
                   Microbat  -----------------------------tg--aatt-taaaaat
                   Hedgehog  -----------------------------tg--aatt-taaaaat
                      Shrew  -----------------------------tg--cttt-taacaat
            Star-nosed mole  -----------------------------tg--aatt-aaaaagt
                   Elephant  -----------------------------tg--aatt-taaaaat
        Cape elephant shrew  -----------------------------tg--attt-taaaaat
                    Manatee  -----------------------------tg--aatt-taaaaat
           Cape golden mole  -----------------------------tg--aatc-taaaaat
                     Tenrec  -----------------------------tg--atta-tgaaact
                  Armadillo  -----------------------------tg--aatt-taaaaat
                   Aardvark  ---------------------------------------------
            Tasmanian devil  =============================================

Inserts between block 33 and 34 in window
B D                    Cat 40bp
B D                    Dog 334bp

Alignment block 34 of 965 in window, 110874305 - 110874305, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D                Squirrel  a
     Lesser Egyptian jerboa  a
               Prairie vole  a
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  a
B D                     Rat  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  a
       David's myotis (bat)  a
B D                Microbat  a
B D                Hedgehog  a
B D                   Shrew  a
            Star-nosed mole  g
B D                Elephant  a
        Cape elephant shrew  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  a
B D               Armadillo  a
                  Aardvark  -
B D                 Dolphin  -
B D         Tasmanian devil  =
B D                     Cat  =
              Killer whale  -

Inserts between block 34 and 35 in window
B D                  Panda 359bp

Alignment block 35 of 965 in window, 110874306 - 110874315, 10 bps 
B D                   Human  aa-----aagcagtc
B D                   Chimp  aa-----aagcagtc
B D                 Gorilla  aa-----aaacagtc
B D               Orangutan  aa-----aagcagtc
B D                  Gibbon  aa-----aagcagtc
B D                  Rhesus  aa-----aagcagtc
B D     Crab-eating macaque  aa-----aagcagtc
B D                  Baboon  aa-----aagcagtc
B D            Green monkey  aa-----aagcagtc
B D                Marmoset  aa-----ac-cagtc
B D         Squirrel monkey  aa-----ac-cagtc
B D                Bushbaby  aa-----gaccagac
         Chinese tree shrew  aa-----gaccaggc
B D                Squirrel  aa-----aaccatgc
     Lesser Egyptian jerboa  aa-----ggccagac
               Prairie vole  ac-----aaccag--
B D         Chinese hamster  ac-----aactag--
             Golden hamster  ac-----aactag--
B D                   Mouse  gt-----gacc----
B D                     Rat  gt-----gacc----
B D          Naked mole-rat  aa-----gaccaga-
B D              Guinea pig  aa-----taccaga-
                 Chinchilla  aa-----gaccaga-
           Brush-tailed rat  aa-----gaccaga-
B D                  Rabbit  ag-----gaaccaaa
B D                    Pika  aa-----gaacaaac
B D                     Pig  aa-----gactagac
B D                  Alpaca  aa-----gaccagac
             Bactrian camel  aa-----gaccagac
           Tibetan antelope  aa-----gaccagac
B D                     Cow  aa-----gatcagac
B D                   Sheep  aa-----gaccagac
              Domestic goat  aa-----gaccagac
B D                   Horse  aa-----gaccagat
B D        White rhinoceros  aa-----gactagac
B D                     Cat  aa-----gaccagac
B D                     Dog  aa-----gaccagac
B D                 Ferret   aa-----gatcagat
B D                   Panda  aa-----gaccagac
             Pacific walrus  aa-----gatcagat
               Weddell seal  aa-----gaccagat
           Black flying-fox  aa-----gatcagac
B D                 Megabat  aa-----gatcagac
              Big brown bat  aa-----gactggac
       David's myotis (bat)  aa-----cactggac
B D                Microbat  aa-----cactggac
B D                Hedgehog  ag-----gaccagac
B D                   Shrew  aacaaacaataagac
            Star-nosed mole  aa-----gactagac
B D                Elephant  aa-----gaccagac
        Cape elephant shrew  aa-----gaccagaa
B D                 Manatee  aa-----gaccagac
           Cape golden mole  aa-----gaccagac
B D                  Tenrec  aa-----gactgaac
                   Aardvark  --------------c
B D               Armadillo  aa-----gaccagac
B D                 Dolphin  ---------------
B D         Tasmanian devil  ===============
              Killer whale  ---------------

Inserts between block 35 and 36 in window
B D                  Horse 256bp
            Pacific walrus 337bp
B D               Hedgehog 1bp
B D                  Shrew 1bp
           Star-nosed mole 1bp

Alignment block 36 of 965 in window, 110874316 - 110874318, 3 bps 
B D                   Human  ttt
B D                   Chimp  ttt
B D                 Gorilla  ttt
B D               Orangutan  ttt
B D                  Gibbon  ttt
B D                  Rhesus  atc
B D     Crab-eating macaque  gtc
B D                  Baboon  gtc
B D            Green monkey  gtc
B D                Marmoset  ttt
B D         Squirrel monkey  ttt
B D                Bushbaby  tct
         Chinese tree shrew  ttt
B D                Squirrel  ttt
     Lesser Egyptian jerboa  atc
               Prairie vole  ttt
B D         Chinese hamster  ttt
             Golden hamster  ttt
B D          Naked mole-rat  att
B D              Guinea pig  ctt
                 Chinchilla  ctt
           Brush-tailed rat  ctt
B D                  Rabbit  gtt
B D                    Pika  ttt
B D                     Pig  ttt
B D                  Alpaca  ttt
             Bactrian camel  ttt
           Tibetan antelope  ttt
B D                     Cow  ttt
B D                   Sheep  ttt
              Domestic goat  ttt
B D                   Horse  ttt
B D        White rhinoceros  ttt
B D                     Cat  ttt
B D                     Dog  ttt
B D                 Ferret   ttt
B D                   Panda  ttt
             Pacific walrus  ttt
               Weddell seal  ttt
           Black flying-fox  ttt
B D                 Megabat  ttt
              Big brown bat  tgt
       David's myotis (bat)  tgt
B D                Microbat  tga
B D                Hedgehog  tct
B D                   Shrew  ttt
            Star-nosed mole  ttt
B D                Elephant  ttt
        Cape elephant shrew  tgt
B D                 Manatee  ttt
           Cape golden mole  ttt
B D                  Tenrec  ttt
                   Aardvark  ttt
B D               Armadillo  ttt
B D                     Rat  ---
B D                   Mouse  ---
B D                 Dolphin  ---
B D         Tasmanian devil  ===
              Killer whale  ---

Inserts between block 36 and 37 in window
B D                Ferret  521bp

Alignment block 37 of 965 in window, 110874319 - 110874322, 4 bps 
B D                   Human  ta----aa
B D                   Chimp  ta----aa
B D                 Gorilla  ta----aa
B D               Orangutan  ta----aa
B D                  Gibbon  ta----aa
B D                  Rhesus  ta----aa
B D     Crab-eating macaque  ta----aa
B D                  Baboon  ta----aa
B D            Green monkey  ta----aa
B D                Marmoset  tt----aa
B D         Squirrel monkey  tt----aa
B D                Bushbaby  tt----aa
         Chinese tree shrew  tt----aa
B D                Squirrel  ca----aa
     Lesser Egyptian jerboa  tt----gg
               Prairie vole  tt----ag
B D         Chinese hamster  tt----ag
             Golden hamster  tt----ag
B D                   Mouse  ta----ag
B D                     Rat  ta----ag
B D          Naked mole-rat  tt----aa
B D              Guinea pig  tt----aa
                 Chinchilla  tg----aa
           Brush-tailed rat  ta----aa
B D                  Rabbit  ct----ca
B D                    Pika  ct----ac
B D                     Pig  tt----aa
B D                  Alpaca  tt---aaa
             Bactrian camel  tt---aaa
           Tibetan antelope  gt----aa
B D                     Cow  gt----aa
B D                   Sheep  gt----aa
              Domestic goat  gt----aa
B D                   Horse  tt----aa
B D        White rhinoceros  tt----aa
B D                     Cat  tt----aa
B D                     Dog  tt----aa
B D                   Panda  tt----aa
             Pacific walrus  tt----aa
               Weddell seal  tt----at
           Black flying-fox  tt----aa
B D                 Megabat  tt----aa
              Big brown bat  tt----aa
       David's myotis (bat)  tt----aa
B D                Microbat  tt----aa
B D                Hedgehog  -ttacaaa
B D                   Shrew  -t------
            Star-nosed mole  -t---aaa
B D                Elephant  tc----aa
        Cape elephant shrew  tc----aa
B D                 Manatee  tc----aa
           Cape golden mole  tc----aa
B D                  Tenrec  tc----ag
                   Aardvark  tc----aa
B D               Armadillo  tt----aa
B D                 Dolphin  --------
B D         Tasmanian devil  ========
B D                 Ferret   ========
              Killer whale  --------

Inserts between block 37 and 38 in window
B D                 Rhesus 42bp
B D    Crab-eating macaque 38bp
B D                 Baboon 38bp

Alignment block 38 of 965 in window, 110874323 - 110874328, 6 bps 
B D                   Human  taaa---tt
B D                   Chimp  taaa---tt
B D                 Gorilla  taag---tt
B D               Orangutan  taaa---tt
B D                  Gibbon  taag---tt
B D     Crab-eating macaque  aaaa-----
B D                  Baboon  aaaa-----
B D            Green monkey  -acactt--
B D                Marmoset  taaa---tt
B D         Squirrel monkey  taaa---tt
B D                Bushbaby  tgaa---tt
         Chinese tree shrew  tgaa---tt
B D                Squirrel  ttaa---tt
     Lesser Egyptian jerboa  tgaa---at
               Prairie vole  tgaa---ct
B D         Chinese hamster  tgaa---ct
             Golden hamster  tgaa---at
B D                   Mouse  tgaa---ct
B D                     Rat  tgag---cc
B D          Naked mole-rat  tata---tt
B D              Guinea pig  tgta---tt
                 Chinchilla  taca---tt
           Brush-tailed rat  taca---tt
B D                  Rabbit  ggca---tt
B D                    Pika  caaa---tt
B D                     Pig  cgaa---tc
B D                  Alpaca  tgaa---tt
             Bactrian camel  tgaa---tt
           Tibetan antelope  tgaa---tt
B D                     Cow  tgaa---tt
B D                   Sheep  tgaa---tt
              Domestic goat  tgaa---tt
B D                   Horse  tgag---tt
B D        White rhinoceros  tgaa---tt
B D                     Cat  tgaa---tt
B D                     Dog  tgaa---tt
B D                   Panda  tgac---tt
             Pacific walrus  tgaa---tt
               Weddell seal  ttta---tt
           Black flying-fox  caaa---gt
B D                 Megabat  caaa---gt
              Big brown bat  ccaa---gt
       David's myotis (bat)  caca---gt
B D                Microbat  caaa---gt
B D                Hedgehog  ttta---ca
B D                   Shrew  --aa---ta
            Star-nosed mole  tgaa---tt
B D                Elephant  tgaa---tt
        Cape elephant shrew  tgaa---tt
B D                 Manatee  tgaa---tt
           Cape golden mole  tgaa---tt
B D                  Tenrec  tgaa---tg
                   Aardvark  ccaa---tt
B D               Armadillo  tgta---tt
B D                 Dolphin  ---------
B D                  Rhesus  =========
B D         Tasmanian devil  =========
B D                 Ferret   =========
              Killer whale  ---------

Inserts between block 38 and 39 in window
B D           Green monkey 36bp

Alignment block 39 of 965 in window, 110874329 - 110874333, 5 bps 
B D                   Human  cactt
B D                   Chimp  cactt
B D                 Gorilla  cactt
B D               Orangutan  cactt
B D                  Gibbon  cactt
B D                  Rhesus  cactt
B D     Crab-eating macaque  cactt
B D                  Baboon  cactt
B D            Green monkey  cactt
B D                Marmoset  cacta
B D         Squirrel monkey  cactt
B D                Bushbaby  cactt
         Chinese tree shrew  cactc
B D                Squirrel  cactt
     Lesser Egyptian jerboa  a----
               Prairie vole  gtgtt
B D         Chinese hamster  aagat
             Golden hamster  aagat
B D                   Mouse  aagtt
B D                     Rat  aagtt
B D          Naked mole-rat  cactt
B D              Guinea pig  tgctt
                 Chinchilla  cactt
           Brush-tailed rat  cactt
B D                  Rabbit  cactt
B D                    Pika  ccctt
B D                     Pig  cattt
B D                  Alpaca  tactt
             Bactrian camel  tactt
           Tibetan antelope  cattt
B D                     Cow  cattt
B D                   Sheep  cattt
              Domestic goat  cattt
B D                   Horse  aattt
B D        White rhinoceros  aattt
B D                     Cat  cattt
B D                     Dog  cattt
B D                   Panda  cattt
             Pacific walrus  cattt
               Weddell seal  ttttt
           Black flying-fox  tattt
B D                 Megabat  tattt
              Big brown bat  tcctt
       David's myotis (bat)  tactt
B D                Microbat  aactt
B D                Hedgehog  aattt
B D                   Shrew  tattt
            Star-nosed mole  cattc
B D                Elephant  aattt
        Cape elephant shrew  atttt
B D                 Manatee  aattt
           Cape golden mole  aattt
B D                  Tenrec  tattt
                   Aardvark  aattt
B D               Armadillo  cactc
B D                 Dolphin  -----
B D         Tasmanian devil  =====
B D                 Ferret   =====
              Killer whale  -----

Alignment block 40 of 965 in window, 110874334 - 110874358, 25 bps 
B D                   Human  aa-----------------taa------------------------------------------------
B D                   Chimp  aa-----------------taa------------------------------------------------
B D                 Gorilla  aa-----------------taa------------------------------------------------
B D               Orangutan  aa-----------------taa------------------------------------------------
B D                  Gibbon  aa-----------------taa------------------------------------------------
B D                  Rhesus  aa-----------------taa------------------------------------------------
B D     Crab-eating macaque  aa-----------------taa------------------------------------------------
B D                  Baboon  aa-----------------taa------------------------------------------------
B D            Green monkey  aa-----------------taa------------------------------------------------
B D                Marmoset  aa-----------------taa------------------------------------------------
B D         Squirrel monkey  aa-----------------taa------------------------------------------------
B D                Bushbaby  aa-----------------tat------------------------------------------------
         Chinese tree shrew  -a-----------------taa------------------------------------------------
B D                Squirrel  aa-----------------taa------------------------------------------------
     Lesser Egyptian jerboa  -a-----------------cag------------------------------------------------
               Prairie vole  aa-----------------caa------------------------------------------------
B D         Chinese hamster  aa-----------------caa------------------------------------------------
             Golden hamster  aa-----------------caa------------------------------------------------
B D                   Mouse  aa-----------------aaa------------------------------------------------
B D                     Rat  -a-----------------aaa------------------------------------------------
B D          Naked mole-rat  at-----------------taa------------------------------------------------
B D              Guinea pig  at-----------------tga------------------------------------------------
                 Chinchilla  at-----------------tga------------------------------------------------
           Brush-tailed rat  at-----------------tga------------------------------------------------
B D                  Rabbit  aa-----------------tca------------------------------------------------
B D                    Pika  ag-----------------taa------------------------------------------------
B D                     Pig  aa-----------------taa------------------------------------------------
B D                  Alpaca  aa-----------------taa------------------------------------------------
             Bactrian camel  aa-----------------taa------------------------------------------------
B D                 Dolphin  aa-----------------taa------------------------------------------------
               Killer whale  aa-----------------taa------------------------------------------------
           Tibetan antelope  aa-----------------taa------------------------------------------------
B D                     Cow  aa-----------------taa------------------------------------------------
B D                   Sheep  aa-----------------taa------------------------------------------------
              Domestic goat  aa-----------------taa------------------------------------------------
B D                   Horse  aa-----------------taa------------------------------------------------
B D        White rhinoceros  aa-----------------tga------------------------------------------------
B D                     Cat  aa-----------------taa------------------------------------------------
B D                     Dog  ac-----------------taa------------------------------------------------
B D                 Ferret   aa-----------------tga------------------------------------------------
B D                   Panda  aa-----------------taa------------------------------------------------
             Pacific walrus  aa-----------------taa------------------------------------------------
               Weddell seal  aagattttaaaaaagattgtat------------------------------------------------
           Black flying-fox  aacaat-------------caa------------------------------------------------
B D                 Megabat  aa-----------------caa------------------------------------------------
              Big brown bat  aa-----------------taa------------------------------------------------
       David's myotis (bat)  aa-----------------taa------------------------------------------------
B D                Microbat  aa-----------------taa------------------------------------------------
B D                Hedgehog  aa-----------------t--------------------------------------------------
B D                   Shrew  ga--------------------------------------------------------------------
            Star-nosed mole  aa-----------------taa------------------------------------------------
B D                Elephant  aa-----------------taa------------------------------------------------
        Cape elephant shrew  tg-----------------taa------------------------------------------------
B D                 Manatee  aa-----------------taa------------------------------------------------
           Cape golden mole  aa-----------------taaccaggttctaatctcaaggtcagtagttcaaaatgaccagctgttcca
B D                  Tenrec  aa-----------------taa------------------------------------------------
                   Aardvark  ta-----------------taa------------------------------------------------
B D               Armadillo  ag-----------------taa------------------------------------------------
B D         Tasmanian devil  ======================================================================

                      Human  ---------------------------------------------------------tca--agtggt--