Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 885 in window, 68736132 - 68736135, 4 bps 
B D                     Human  gact
B D                     Chimp  gact
B D                   Gorilla  gact
B D                 Orangutan  gact
B D                    Gibbon  gact
B D                    Rhesus  gacc
B D       Crab-eating macaque  gacc
B D                    Baboon  gacc
B D              Green monkey  gacc
B D                  Marmoset  gact
B D           Squirrel monkey  gact
B D                  Bushbaby  gact
           Chinese tree shrew  gact
B D                  Squirrel  ggct
       Lesser Egyptian jerboa  ggct
B D                       Rat  ----
B D            Naked mole-rat  ggct
B D                Guinea pig  ggct
                   Chinchilla  ggct
             Brush-tailed rat  cgct
B D                    Rabbit  gact
B D                       Pig  gact
B D                    Alpaca  gact
               Bactrian camel  gact
B D                   Dolphin  gact
                 Killer whale  gact
             Tibetan antelope  gact
B D                       Cow  gact
B D                     Sheep  gact
                Domestic goat  gact
B D                     Horse  gact
B D          White rhinoceros  gact
B D                       Cat  gact
B D                   Ferret   ggct
B D                     Panda  gact
               Pacific walrus  gact
                 Weddell seal  gact
             Black flying-fox  gatc
B D                   Megabat  gatc
                Big brown bat  gaaa
         David's myotis (bat)  gaaa
B D                  Microbat  gaaa
B D                     Shrew  gact
B D                  Elephant  gact
          Cape elephant shrew  ggct
B D                   Manatee  gact
                     Aardvark  ggct
B D                 Armadillo  gact
B D                   Wallaby  gact
B D                      Pika  ====
B D                     Mouse  ====
                Prairie vole  ====
B D           Chinese hamster  ====
              Golden hamster  ====
B D                    Tenrec  ====
B D                       Dog  ====
B D                Coelacanth  ====
B D                    Lizard  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====
            Cape golden mole  ====

Inserts between block 1 and 2 in window
B D                 Bushbaby 160bp

Alignment block 2 of 885 in window, 68736136 - 68736136, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
B D                    Rabbit  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                     Shrew  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Wallaby  c
B D                      Pika  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  -
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D            Naked mole-rat  -
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =

Inserts between block 2 and 3 in window
B D                  Wallaby 1710bp

Alignment block 3 of 885 in window, 68736137 - 68736151, 15 bps 
B D                     Human  --ttgaatattctttat
B D                     Chimp  --ttgaatattctttat
B D                   Gorilla  --ttaaatattctttat
B D                 Orangutan  --ttgaatattctttat
B D                    Gibbon  --ttgaatattctttat
B D                    Rhesus  --ttgaatattctctat
B D       Crab-eating macaque  --ttgaatattctctat
B D                    Baboon  --ttgaatattctctat
B D              Green monkey  --ttgaatattctctat
B D                  Marmoset  --tggaatattcttcat
B D           Squirrel monkey  --tggaatattcttcat
B D                  Bushbaby  --tcaaatatcctttat
           Chinese tree shrew  --ttgag-gtccttcgt
B D                  Squirrel  --ccggatgttctttat
       Lesser Egyptian jerboa  --ctgacggttctgc--
B D            Naked mole-rat  --ctggctgttctttat
B D                Guinea pig  --ctgaatagtcttcat
                   Chinchilla  --ctggaaattctttat
             Brush-tailed rat  --ctggaaattcttaat
B D                    Rabbit  ttatgtatgtcttt---
B D                       Pig  --ttgaatattctttat
B D                    Alpaca  --ttgaatattctttat
               Bactrian camel  --ttgaatattctttat
B D                   Dolphin  --ttgca-------tat
                 Killer whale  --ttgca-------tat
             Tibetan antelope  --atgaa-------ttt
B D                       Cow  --ttgaa-------ttt
B D                     Sheep  --gtgaa-------ttt
                Domestic goat  --gtgaa-------ttt
B D                     Horse  --ttgaatattctatgt
B D          White rhinoceros  --ttgaatattctttct
B D                       Cat  --gtgaatgttctttat
B D                   Ferret   --gtgagtgtcctttat
B D                     Panda  --ttgaatgttctttat
               Pacific walrus  --ttgaatgttctttat
                 Weddell seal  --ttgaatgttctttat
             Black flying-fox  --tt-aatagtctttat
B D                   Megabat  --tt-aatagtctttat
                Big brown bat  --tt-catgttctttat
         David's myotis (bat)  --tt-catattccttat
B D                  Microbat  --tt-catattccttat
B D                     Shrew  --atagaaattccttat
B D                  Elephant  --ctgaatattctttat
          Cape elephant shrew  --ctgaatgttc--tgt
B D                   Manatee  --tt-aatattccttac
                     Aardvark  --cagaatactctgtag
B D                 Armadillo  --ttcaatatccattac
B D                      Pika  =================
B D                     Mouse  =================
                Prairie vole  =================
B D                       Rat  -----------------
B D           Chinese hamster  =================
              Golden hamster  =================
B D                    Tenrec  =================
B D                       Dog  =================
B D                Coelacanth  =================
B D                    Lizard  =================
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
  D           Green seaturtle  =================
B D                    Turkey  =================
B D                   Chicken  =================
  D              Mallard duck  =================
  D             Scarlet macaw  =================
  D                    Parrot  =================
B D                Budgerigar  =================
          Tibetan ground jay  =================
B D               Zebra finch  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
  D       Collared flycatcher  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
  D               Rock pigeon  =================
B D                   Wallaby  =================
B D        American alligator  =================
B D                   Opossum  =================
B D           Tasmanian devil  =================
            Cape golden mole  =================

Alignment block 4 of 885 in window, 68736152 - 68736251, 100 bps 
B D                     Human  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                     Chimp  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                   Gorilla  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                 Orangutan  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                    Gibbon  tatgatgctcattat-gtta-ctaaagc-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                    Rhesus  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgagt----cagaattcacatttatt
B D       Crab-eating macaque  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                    Baboon  tatggtgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D              Green monkey  tatgatgttcattat-gtta-ctaaaac-cagtagcatcaacaatgtgt----cagaattcacatttatt
B D                  Marmoset  taatatgttcattat-gtta-ctaaaaa-cagtggcatcaacaatgtgt----cagaattcacatttgtt
B D           Squirrel monkey  tatgatgttcattat-gtta-ctaaaaa-cagtggcatcaacaatgtct----cagaattcacatttgtt
B D                  Bushbaby  tatgatcttcatcat-ggta-ccaaaaa-caatagcatcaacaagg--t----cagaattcacatttgtt
           Chinese tree shrew  tatgatgatt-ctat-gtcacccaaaat-aaatagcatcaacaatgtgt----aaaaatccacatttatt
B D                  Squirrel  gatgatgctcagtat--gtt-ccccaaacccacagcatga-gcacgcgt----cgggacccaccttcatc
       Lesser Egyptian jerboa  -aacctctgtagtac--act-acacaaa-tgacggtgtcaagcatggac----tataattcacatccatt
B D                       Rat  -------tgttgt------t-gcacaaa-agatagtgtcacccatgggg----caggattcacatccatt
B D            Naked mole-rat  tatgaagctgagtat--tta-ccaaaaa-tgatagcatcagccttgtgt----caggattcacatttatg
B D                Guinea pig  catgaagttcggca---tca-ccagaaa-tgaaagcatcagctatgggt----caggattcacatttata
                   Chinchilla  tgtgaaagtcagtat--tta-ccaaaaa-tgaaagtatcagccatgtgt----caggattcacagttacg
             Brush-tailed rat  ggtgaaattcagtat--tta-ccaaaaa-tgaaagtatcaatcatgtgt----tgggattcacatttatg
B D                    Rabbit  catgatgtgcattat-gtta-ccaaaaa-tgagacaatcagtgatgtgt----cagaactcacacttatt
B D                      Pika  taggaggtctgttac-gtca-ccaaaat-gaggacagtctgtgctatgt----cagaatttacagttaca
B D                       Pig  cataatgttcattat-gtta-ccaggaa-taatagcatcaatgatatat----aagaattcacattaat-
B D                    Alpaca  tataatgttcattat-ttta-ccaaaaa-taatagcatcaatgatgtatgaaacagaatttcatgtaa--
               Bactrian camel  tataatgttcattat-ttta-ccaaaaa-taatagcatcaatgatgtatgaaacagaatttcatgtaa--
B D                   Dolphin  tataatgttcattat-gtca-ccaaaaa-taaaggcctcaatgatgtaa----caaaattcacattaac-
                 Killer whale  tataatgttccttat-gtca-ccaaaaa-taaaggcctcaatgatgtaa----caaaattcacattaac-
             Tibetan antelope  tataattttcagtat-gtta-ccaaaaa-taaagacatcagggacacat----cagaattcacagtgac-
B D                       Cow  tataatgttcatgat-gtta-ccaaaaa-taaagatctcaaggg-atat----cagaattcacagtaat-
B D                     Sheep  tataattttcagtat-gtta-ccaaaaa-tatagacatcagggacacat----cagaattcacagtgac-
                Domestic goat  tataattttcagtat-gtta-ccaaaaa-taaagacatcagggacacat----cagaattcacagtgac-
B D                     Horse  tataacgttcattat-gtta-cc-aaaa-caatagcacaaacaacgtat----cagaattcacgtttat-
B D          White rhinoceros  tataatgttcattat-gtta-ccaaaaa-taatagcaccaatgatgtat----cagaattcacattaat-
B D                       Cat  tgtaacgctcatgac-gttg-cccaaaa-tagtagcgtctacgacgtat----ccgaattcacccggac-
B D                   Ferret   tacgacgttcattgc-gcta-ca-aaag-tcatagcgtcagcgctgtgt----cagaactcacattaac-
B D                     Panda  tataacgttcattat-gtta-cc-aaag-taataggatcaacaatgtat----gagaattcacattaac-
               Pacific walrus  tataacgttcattac-gtca-ccaaaag-taataggatccacgataaat----cagaattcacattaac-
                 Weddell seal  tataacgctcattat-gtta-ccaaaag-taataggatcaacgacatat----cagaattcacattaac-
             Black flying-fox  aatc-------ttac-gtta-ccaaaga-taacatcaccaacaatgcat----cggaattcacatacca-
B D                   Megabat  aatc-------ttac-ctta-ccaaaaa-taacatcaccaacaatgcat----cagaattcacatacca-
                Big brown bat  tgtagtcgtcattac-gtta-ccaaaaa-taacagcaggcacgctgcgt----cagaatgcacaccgat-
         David's myotis (bat)  tatagtcgtcatgac-gtta-ccaaaaa-t---agcagcaatgatgcgt----cagaattcacaccaac-
B D                  Microbat  tatagtcgtcgttac-gtta-ccagaaa-tgacagcagcaatgatgcgt----cagaattcacaccaat-
B D                     Shrew  tataatgctccttgc-acta-gcaaaaa-taat-ttatcaaagatgttt----tacaagtcgcattgat-
B D                  Elephant  tatggtgttcattaaattaa-ccaaaaa-cgttagcgtcaaggaggtgt----cagaattcgtat--act
          Cape elephant shrew  catgaccctc-ttaa---ca-ccaccac-catcagcatcagggagcggt----cagcacaccggt--gct
B D                   Manatee  tatgatgttcattagattga-ccaaaaa-cattagcatcaaggaggtac----cagaattcatat--att
                     Aardvark  tgggacgtccattagcttca-ccagaac-c-ttagcatcaaggtcatcg----caggggccacac--atg
B D                 Armadillo  tatgatgttcactgt---ta-cca-aac-tggtaacatcaaaga--tgt----cagaattc--ac--gtt
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Dog  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================

                        Human  accagattggtaataggattattaaagc--t----a-------c-agagtg
                        Chimp  accagattggtaataggattattaaagc--t----a-------c-agagtg
                      Gorilla  accagattggtaataggattattaaagc--t----a-------c-agagtg
                    Orangutan  accagattggtaatgggattattaaagc--t----a-------c-agaatg
                       Gibbon  accagattggtaatgggattattaaagc--t----a-------c-agagcg
                       Rhesus  accagattgataatgggattattaaagc--t----a-------c-agagtg
          Crab-eating macaque  accagattgataatgggattattaaagc--t----a-------c-agagtg
                       Baboon  accagattgataatgggattattaaagc--t----a-------c-agaatg
                 Green monkey  accagattgataatgggattattaaagc--t----a-------c-agaatg
                     Marmoset  accagattgattatgtgatcattaaacc--t----a-------c-agagtg
              Squirrel monkey  accagattggttatgtgatcat--aagc--t----a-------c-agagtg
                     Bushbaby  aactgactggtaataagattatcaaagctat----a-------c-agagag
           Chinese tree shrew  acttgactgataatcaaattattaaagttat----a-------t-agagtg
                     Squirrel  gcctgactggcaattgggtcactaatgc--t----g---------------
       Lesser Egyptian jerboa  acctggctggggatcagagcattagagc--c----agaaagag--------
                          Rat  acctggc-aggtatctgagtgctaaagt--c----a---------------
               Naked mole-rat  acctgactgaggggcagattattaaagc--t----a-------t-acagta
                   Guinea pig  acctgtctgaggatcacattattaatgc--g----a-------t-ataata
                   Chinchilla  atccgactgaggatcagattattaaagc--t----a-------t-atagaa
             Brush-tailed rat  agctgaatgaggatcagattattaaaat--t----a-------t-atagta
                       Rabbit  acttgag-tataatcacactattaaagc--t----atcgttg---------
                         Pika  gcctgac-gacagtcacattattaa--------------------------
                          Pig  gcctgattgattatcaggttagtaaagctct----g-------c-agagtg
                       Alpaca  -tctgattgataatcagatcattaaagctat----g-------c-agagtg
               Bactrian camel  -tctgattgataatcagatcattaaagctat----g-------c-agagtg
                      Dolphin  gcctgactgataatcagattattaaagctat----g-------c-agagtg
                 Killer whale  gcctgactgataatcagattgttaaagctat----g-------c-agagtg
             Tibetan antelope  gtctgatagacaatttgattgttaaagccgt----g-------c-agagtg
                          Cow  gtctgattgataatttgattattaaagccgt----g-------c-agagtg
                        Sheep  gtctgatggacaatttgattgttaaagccgt----g-------c-agagtg
                Domestic goat  gtctgatcaaaaatttgattgttaaagccgt----g-------c-agagtg
                        Horse  acctgattgataatcagattactaacgctat----a-------c-ggagtg
             White rhinoceros  acctgatgggtaatcagattactaaagctat----c-------c-agagtc
                          Cat  acccgactcataacaagattactaaagccat----a-------cgggggtg
                      Ferret   acctgactgaggacaggatgacgaaagccatatgga-------c-ggagtg
                        Panda  acctgactgatgacaagatgatggaaacctt----a-------c-agagtg
               Pacific walrus  gcctgactgacgacaagatgacgaaagccat----g-------c-agagtg
                 Weddell seal  acctgactgatgacaagatgacgaaagccat----g-------c-agagtg
             Black flying-fox  cc-----tgattatgagattattaaagctat----a-------c-agagtg
                      Megabat  cc-----tgattatgagattattaaagctag----a-------c-agagtg
                Big brown bat  gc-----tggtg-ctggatcactggaaggac----a-------c-cg-gtg
         David's myotis (bat)  ac-----tggtgaccggattgttggaccaac----a-------c-cg-gtg
                     Microbat  ac-----tggtgaccggattgttggaccaac----a-------c-cg-gtg
                        Shrew  agatgactcataatcaggttattaaagcttt----a-------c-aaagca
                     Elephant  acctgatggataatcagattattaaagctat----a-------c-caaggg
          Cape elephant shrew  gcctggtggactgtcagattattaacgcaac----a-------g-gaagtg
                      Manatee  acctgctggataatcaggttagtaaagctat----a-------c-tgagtg
                     Aardvark  acccaatgggtcatcaggtcattgaggctgt----a-------c-caagag
                    Armadillo  acctaactgataatcagattcttaaagttac----a-------g-agagtg
                        Mouse  ===================================================
                 Prairie vole  ===================================================
              Chinese hamster  ===================================================
               Golden hamster  ===================================================
                       Tenrec  ===================================================
                          Dog  ===================================================
                   Coelacanth  ===================================================
                       Lizard  ===================================================
     Chinese softshell turtle  ===================================================
               Painted turtle  ===================================================
              Green seaturtle  ===================================================
                       Turkey  ===================================================
                      Chicken  ===================================================
                 Mallard duck  ===================================================
                Scarlet macaw  ===================================================
                       Parrot  ===================================================
                   Budgerigar  ===================================================
           Tibetan ground jay  ===================================================
                  Zebra finch  ===================================================
          Medium ground finch  ===================================================
       White-throated sparrow  ===================================================
          Collared flycatcher  ===================================================
             Peregrine falcon  ===================================================
                 Saker falcon  ===================================================
                  Rock pigeon  ===================================================
                      Wallaby  ===================================================
           American alligator  ===================================================
                      Opossum  ===================================================
              Tasmanian devil  ===================================================
             Cape golden mole  ===================================================

Inserts between block 4 and 5 in window
      Lesser Egyptian jerboa 1bp
B D           Naked mole-rat 148bp
B D               Guinea pig 96bp
                  Chinchilla 148bp
            Brush-tailed rat 249bp
B D                   Rabbit 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                    Shrew 1bp

Alignment block 5 of 885 in window, 68736252 - 68736252, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -a
           Chinese tree shrew  -a
B D                  Elephant  g-
          Cape elephant shrew  g-
B D                   Manatee  g-
                     Aardvark  t-
B D                 Armadillo  a-
B D                      Pika  --
B D                     Shrew  ==
B D                     Mouse  ==
                Prairie vole  ==
B D                       Rat  --
B D           Chinese hamster  ==
              Golden hamster  ==
B D                    Rabbit  ==
            Black flying-fox  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                   Dolphin  ==
                Weddell seal  ==
B D                   Megabat  ==
                Killer whale  ==
B D                     Panda  ==
               Big brown bat  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D          White rhinoceros  ==
B D                     Horse  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                  Squirrel  --
B D            Naked mole-rat  ==
B D                       Dog  ==
B D                   Ferret   ==
B D                       Cat  ==
              Pacific walrus  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==

Alignment block 6 of 885 in window, 68736253 - 68736263, 11 bps 
B D                     Human  cagga----caagga
B D                     Chimp  cagga----caagga
B D                   Gorilla  cagga----caagga
B D                 Orangutan  cagga----cacgga
B D                    Gibbon  cagga----cacgga
B D                    Rhesus  cagga----cacgga
B D       Crab-eating macaque  cagga----cacgga
B D                    Baboon  cagga----cacgga
B D              Green monkey  cagga----cacgga
B D                  Marmoset  cagga----catgga
B D           Squirrel monkey  cagga----catgga
B D                  Bushbaby  caggg----catgag
           Chinese tree shrew  caggg----tatgac
B D                  Squirrel  --gga----caggag
       Lesser Egyptian jerboa  --gat----cgggac
B D                       Rat  ---at----caccaa
B D            Naked mole-rat  cagga----catgac
B D                Guinea pig  tgagacctgcaggac
                   Chinchilla  tagga----catgac
             Brush-tailed rat  tagga----caggac
B D                    Rabbit  cagaa----taggaa
B D                      Pika  -agaa----catgaa
B D                       Pig  cagga----cat---
B D                    Alpaca  cagga----tgt---
               Bactrian camel  cagga----tgt---
B D                   Dolphin  cagga----cgt---
                 Killer whale  cagga----cat---
             Tibetan antelope  cagga----cat---
B D                       Cow  cagga----cgt---
B D                     Sheep  cagga----cat---
                Domestic goat  cagga----cat---
B D                     Horse  cagga----catgag
B D          White rhinoceros  cagga----catgaa
B D                       Cat  cggga----catgaa
B D                   Ferret   cagga----cacaaa
B D                     Panda  cagga----catgaa
               Pacific walrus  cagga----cattaa
                 Weddell seal  cagga----catgaa
             Black flying-fox  cagga----cgt---
B D                   Megabat  cagga----cgt---
                Big brown bat  -cgga----c-----
         David's myotis (bat)  ccgga----c-----
B D                  Microbat  ccgga----c-----
B D                     Shrew  aagga----catgac
B D                  Elephant  caggg----tgtcaa
          Cape elephant shrew  cagca----cgtgaa
B D                   Manatee  cag-g----tgtaac
                     Aardvark  cagga----cccgaa
B D                 Armadillo  cagga----tgtgga
B D                     Mouse  ===============
                Prairie vole  ===============
B D           Chinese hamster  ===============
              Golden hamster  ===============
B D                    Tenrec  ===============
B D                       Dog  ===============
B D                Coelacanth  ===============
B D                    Lizard  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
B D                Budgerigar  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
B D       Medium ground finch  ===============
  D    White-throated sparrow  ===============
  D       Collared flycatcher  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ===============
B D                   Wallaby  ===============
B D        American alligator  ===============
B D                   Opossum  ===============
B D           Tasmanian devil  ===============
            Cape golden mole  ===============

Inserts between block 6 and 7 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
                    Aardvark 1bp

Alignment block 7 of 885 in window, 68736264 - 68736293, 30 bps 
B D                     Human  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D                     Chimp  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D                   Gorilla  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D                 Orangutan  t-----------tt-----atatt--------aaaga--gtttttattaatatgat
B D                    Gibbon  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D                    Rhesus  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D       Crab-eating macaque  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D                    Baboon  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D              Green monkey  t-----------tt-----gtatt--------aaaga--gtttttattaatatgat
B D                  Marmoset  t-----------tt-----ttatt--------aaagg--ggtttcgttaatatggt
B D           Squirrel monkey  c-----------tt-----ttatt--------aaaga--gtttttattaatatgat
B D                  Bushbaby  t-----------tt-----ttattatta--taaaagg--atttttcttaatatgat
           Chinese tree shrew  t-----------tt-----ttatt--------aaaaag-gttttcatcaatatgac
B D                  Squirrel  a-----------tg---------------------ga--tttaatta--atatgct
       Lesser Egyptian jerboa  a-----------tgagcgtttacc-------ccaagg--gctaccat--atgtgag
B D                       Rat  g-----------tg-----ttatc-------tcagga--cgttctag-aatatagt
B D            Naked mole-rat  t-----------tt-----ttatt-------aagagg--gtttctggtactataat
B D                Guinea pig  tttaattacggctt-----taatt-------aagaga--gtttttagtactatgat
                   Chinchilla  t-----------tt-----ttatt-------aagaca--gtttttaggattatcat
             Brush-tailed rat  t-----------tt-----ttctt-------ag---a--gtttttagtattatgct
B D                    Rabbit  t-----------tt-----ttatt-------aaaaga--ttt-ttataaatatgat
B D                      Pika  t-----------t---------tt-------aaaagc--tttaaaataaacataat
B D                       Pig  -----------------------------------gg--gtttttattagcatgat
B D                    Alpaca  -----------------------------------ga--attttgattaatatgat
               Bactrian camel  -----------------------------------ga--atttttattaatatgat
B D                   Dolphin  -----------------------------------ga--atttttattcatatgat
                 Killer whale  -----------------------------------ga--atttttattcatatgat
             Tibetan antelope  -----------------------------------ga--atttttattcatatgat
B D                       Cow  -----------------------------------ga--atttttattcatatgat
B D                     Sheep  -----------------------------------ga--atttttattcatatgat
                Domestic goat  -----------------------------------ga--atttttattcatatgat
B D                     Horse  t-----------tt-----ttatt-------aaaggg----ttttattaatatgat
B D          White rhinoceros  t-----------tt-----ttatt-------aaaagg--atgtttattaatatgat
B D                       Cat  -------------------ttatt-------aaagggatatttttactgatatgac
B D                   Ferret   t-----------tt-----ttact-------gaaagggcattttcaggagtatgat
B D                     Panda  t-----------tt-----ttact-------agaagggcactttcattaatatgat
               Pacific walrus  t-----------tt-----ttact-------aaaagggcatttttattaatataat
                 Weddell seal  t-----------tt-----ttact-------aaaagggcatttttattaatatgat
             Black flying-fox  -----------------------------------gg--acttttattaatatgat
B D                   Megabat  -----------------------------------gg--acttttattaatatgat
                Big brown bat  -----------------------------------gg--actttcgtcggcctgat
         David's myotis (bat)  -----------------------------------ag--actttcatccgcgtgat
B D                  Microbat  -----------------------------------ag--actttcatccgcgtggt
B D                     Shrew  t-----------tt-----ttatt-------aaaagg--gtttttactactgtgat
B D                  Elephant  ------------------------ctggattaaaagg--gtttttattaatacgat
          Cape elephant shrew  ------------------------ctggactgaaagg--a-gtttattaat--gat
B D                   Manatee  ------------------------cttgattaaaagg--gtatgtattaatatgat
             Cape golden mole  ------------------------tttgattaaaagg--gtttttactaatgtgat
                     Aardvark  ------------------------gctcactcacagg--gttcttattgatatgat
B D                 Armadillo  ----------------------------------------tttttattgatatgat
B D                     Mouse  ========================================================
                Prairie vole  ========================================================
B D           Chinese hamster  ========================================================
              Golden hamster  ========================================================
B D                    Tenrec  ========================================================
B D                       Dog  ========================================================
B D                Coelacanth  ========================================================
B D                    Lizard  ========================================================
  D  Chinese softshell turtle  ========================================================
  D            Painted turtle  ========================================================
  D           Green seaturtle  ========================================================
B D                    Turkey  ========================================================
B D                   Chicken  ========================================================
  D              Mallard duck  ========================================================
  D             Scarlet macaw  ========================================================
  D                    Parrot  ========================================================
B D                Budgerigar  ========================================================
          Tibetan ground jay  ========================================================
B D               Zebra finch  ========================================================
B D       Medium ground finch  ========================================================
  D    White-throated sparrow  ========================================================
  D       Collared flycatcher  ========================================================
  D          Peregrine falcon  ========================================================
  D              Saker falcon  ========================================================
  D               Rock pigeon  ========================================================
B D                   Wallaby  ========================================================
B D        American alligator  ========================================================
B D                   Opossum  ========================================================
B D           Tasmanian devil  ========================================================

Inserts between block 7 and 8 in window
B D                   Rabbit 317bp

Alignment block 8 of 885 in window, 68736294 - 68736301, 8 bps 
B D                     Human  aagctag-t
B D                     Chimp  aagctag-t
B D                   Gorilla  aagctag-t
B D                 Orangutan  aagctag-t
B D                    Gibbon  aagctag-t
B D                    Rhesus  aagctag-t
B D       Crab-eating macaque  aagctag-t
B D                    Baboon  aagctag-t
B D              Green monkey  aagctag-t
B D                  Marmoset  aagctag-t
B D           Squirrel monkey  aagctag-t
B D                  Bushbaby  aagctag-t
           Chinese tree shrew  aagctag-t
B D                  Squirrel  -aataaa-c
       Lesser Egyptian jerboa  -aataaa-a
B D                       Rat  -aacaaa-a
B D            Naked mole-rat  -aaccaa-a
B D                Guinea pig  -aaccaa-a
                   Chinchilla  -aacgaa-a
             Brush-tailed rat  -aactta-a
B D                    Rabbit  aagcca---
B D                      Pika  atgcta---
B D                       Pig  tagctag-t
B D                    Alpaca  aagctag-t
               Bactrian camel  aagctag-t
B D                   Dolphin  aaggtag-t
                 Killer whale  aaggtag-t
             Tibetan antelope  aagctac-t
B D                       Cow  aggctac-t
B D                     Sheep  aagctac-t
                Domestic goat  aagctac-t
B D                     Horse  aagctag-t
B D          White rhinoceros  aagctag-t
B D                       Cat  aagctag-t
B D                   Ferret   aagctag-t
B D                     Panda  aagctag-t
               Pacific walrus  aagccag-t
                 Weddell seal  aagctag-t
             Black flying-fox  aagctag-t
B D                   Megabat  aagctag-t
                Big brown bat  aagctag-t
         David's myotis (bat)  cggctag-t
B D                  Microbat  cagctag-t
B D                     Shrew  aagcgagtt
B D                  Elephant  aagctag-t
          Cape elephant shrew  aaggcag-t
B D                   Manatee  aagccag-t
             Cape golden mole  gagatag-t
                     Aardvark  aagctag-t
B D                 Armadillo  aagctag-t
B D                     Mouse  =========
                Prairie vole  =========
B D           Chinese hamster  =========
              Golden hamster  =========
B D                    Tenrec  =========
B D                       Dog  =========
B D                Coelacanth  =========
B D                    Lizard  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
  D             Scarlet macaw  =========
  D                    Parrot  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D       Collared flycatcher  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D                   Wallaby  =========
B D        American alligator  =========
B D                   Opossum  =========
B D           Tasmanian devil  =========

Inserts between block 8 and 9 in window
          Chinese tree shrew 190bp
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 3bp
B D                      Rat 2bp
B D           Naked mole-rat 3bp
B D               Guinea pig 3bp
                  Chinchilla 3bp
            Brush-tailed rat 3bp
B D                   Rabbit 2bp
B D                     Pika 2bp

Alignment block 9 of 885 in window, 68736302 - 68736322, 21 bps 
B D                     Human  taataagttagccagtt-----cacc
B D                     Chimp  taataagttagccagtt-----cacc
B D                   Gorilla  taataagttagccagtt-----cacc
B D                 Orangutan  taataagttagccagtt-----cacc
B D                    Gibbon  taataagttagccagtt-----cacc
B D                    Rhesus  taataagttagccagtt-----cacc
B D       Crab-eating macaque  taataagttagccagtt-----cacc
B D                    Baboon  taataagttagccagtt-----cacc
B D              Green monkey  taataagttagccagtt-----cacc
B D                  Marmoset  taataagctagccagtt-----cacc
B D           Squirrel monkey  taataagctagccagtt-----cact
B D                  Bushbaby  taataagttagccagtt-----cacc
           Chinese tree shrew  taataaattagc----t-----cacc
B D                  Squirrel  tagtgagttag-------cagtcact
       Lesser Egyptian jerboa  tattaaattagccaggtgtagccagt
B D                       Rat  --------tagacaggt-cagccagt
B D            Naked mole-rat  gaataagctaaccagtt-----cagt
B D                Guinea pig  taatgagctagccaggt-----cagt
                   Chinchilla  taataagttagccagtt-----cggt
             Brush-tailed rat  tagtaagttagccagtt-----cagt
B D                    Rabbit  taacaagttagccaggt-----catc
B D                      Pika  gaatcagttggtcagat-----gatc
B D                       Pig  aaattacttagtcagtt-----cacc
B D                    Alpaca  taataagttagccagct-----cacc
               Bactrian camel  taataagttagccagct-----cacc
B D                   Dolphin  taataagttagccagtt-----cacc
                 Killer whale  taataagttagccaggt-----cacc
             Tibetan antelope  taataagtcagccagtt-----cacc
B D                       Cow  gaataagtcagccagtt-----cacc
B D                     Sheep  taataagtcagccagtt-----cacc
                Domestic goat  taataagtcagccagtt-----cacc
B D                     Horse  taataagttagccaggc-----cctc
B D          White rhinoceros  taataagttagccagtt-----cccc
B D                       Cat  taataagttagccagtt-----cacc
B D                   Ferret   taataagttagccggtt-----cccc
B D                     Panda  taataagttagccggtt-----cacc
               Pacific walrus  taataagttagccggtt-----cacc
                 Weddell seal  taataagttagccgttt-----cacc
             Black flying-fox  taataagttagccagtt-----cacc
B D                   Megabat  taataagttagccagtt-----cacc
                Big brown bat  cagtaagtgag-ca--t-----ca-c
         David's myotis (bat)  tggtaagggag-cactt-----ca-c
B D                  Microbat  cggtaagggag-cactt-----ca-c
B D                     Shrew  taacaagtgagtcagtt-----gaga
B D                  Elephant  taatgcgttagccagct-----gacc
          Cape elephant shrew  caacgcatcggctgggt-----cacc
B D                   Manatee  taatacatgagccagct-----gacc
             Cape golden mole  taattggttaggcaggt-----cact
                     Aardvark  taatatgttagtcagtt-----cac-
B D                 Armadillo  taataagtttgccaatt-----ca--
B D                     Mouse  ==========================
                Prairie vole  ==========================
B D           Chinese hamster  ==========================
              Golden hamster  ==========================
B D                    Tenrec  ==========================
B D                       Dog  ==========================
B D                Coelacanth  ==========================
B D                    Lizard  ==========================
  D  Chinese softshell turtle  ==========================
  D            Painted turtle  ==========================
  D           Green seaturtle  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D              Mallard duck  ==========================
  D             Scarlet macaw  ==========================
  D                    Parrot  ==========================
B D                Budgerigar  ==========================
          Tibetan ground jay  ==========================
B D               Zebra finch  ==========================
B D       Medium ground finch  ==========================
  D    White-throated sparrow  ==========================
  D       Collared flycatcher  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
  D               Rock pigeon  ==========================
B D                   Wallaby  ==========================
B D        American alligator  ==========================
B D                   Opossum  ==========================
B D           Tasmanian devil  ==========================

Inserts between block 9 and 10 in window
      Lesser Egyptian jerboa 3bp
B D                 Elephant 131bp
         Cape elephant shrew 4bp
B D                  Manatee 136bp

Alignment block 10 of 885 in window, 68736323 - 68736323, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  g
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  t
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  g
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Shrew  a
             Cape golden mole  c
                     Aardvark  c
B D                 Armadillo  c
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  -
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =

Inserts between block 10 and 11 in window
            Cape golden mole 5bp
                    Aardvark 1bp

Alignment block 11 of 885 in window, 68736324 - 68736353, 30 bps 
B D                     Human  c----ccaaccctaac--aaa-tga-ccatcgggt-cag
B D                     Chimp  c----ccaaccctaac--aaa-tga-ccatcgggt-cag
B D                   Gorilla  c----ccaaccctaac--aaa-tga-ccatcgggt-cag
B D                 Orangutan  c----ccaaccctaaa--aaa-tga-ccatcgggt-cag
B D                    Gibbon  c----ccaaccctaac--aaa-tga-ccatcgggt-cag
B D                    Rhesus  c----ccaactctaac--aaa-tga-ccatcgggt-cag
B D       Crab-eating macaque  c----ccaactctaac--aaa-tga-ccatcgggt-cag
B D                    Baboon  c----ccaaccctaac--aaa-tga-ccatcagat-cag
B D              Green monkey  c----ccaaccctaac--aaa-tga-ccatcgggt-cag
B D                  Marmoset  ctca-ctaaccctaac--gaa-tga-ccagcgggt-cag
B D           Squirrel monkey  ctcgcctaaccctaac--aaa-tga-ccaacaggt-cag
B D                  Bushbaby  c----ccaactctaaa--gaa-tga-caattgggt-caa
           Chinese tree shrew  c----ccaactctaaa--gaa-tga-cgttttgat-ctg
B D                  Squirrel  c----ccaattctaa---ggagaag-caggtggcc-caa
       Lesser Egyptian jerboa  g----cccactctaa---gga-cgg-tgactggag-caa
B D                       Rat  ------cagcaccag---gct-ctg-tgactggac-caa
B D            Naked mole-rat  c----ccagctctaa---gaa-caa-tgattgagt-caa
B D                Guinea pig  a----ccagctctga---gaa-cga-c-attgggt--ca
                   Chinchilla  c----ccagctctaa---gaa-tga-tgattgggt-caa
             Brush-tailed rat  t----gcagctctaa---gaa-tga-tggctgggt--aa
B D                    Rabbit  c----ccagtcctaag--gaa-tga-cggtcgggt-cag
B D                      Pika  t----ccag---gaagcagca-tgg-tgaccaggt-gag
B D                       Pig  c----tcatctctaaa--gaa-tgg-tgactgggt-gaa
B D                    Alpaca  t----ctgcctctaaa--gaa-tgg-tgacggggc-gaa
               Bactrian camel  c----ccgcctgtaaa--gaa-tgg-tgacggggc-gaa
B D                   Dolphin  c----ctatctctaaa--gaa-tga-cgattgggt-gaa
                 Killer whale  c----ctatctctaaa--gaa-tga-cgattgggt-gaa
             Tibetan antelope  c----ctatatgtcaa--gaa-tgg-tgactgggt-gaa
B D                       Cow  c----ctgtatcttga--gaa-tgg-tgactgggt-gaa
B D                     Sheep  c----ctatatgccaa--gaa-tgg-tgactgagt-caa
                Domestic goat  c----ctatatgtcaa--gaa-tgg-tgactgggt-caa
B D                     Horse  t----tcaactctaaa--gaa-taa-tgactggat-gaa
B D          White rhinoceros  t----ttgactctaga--gaa-tga-tgact--------
B D                       Cat  c----ccaactggaaa--gaa-tga-ggacggggt-gag
B D                   Ferret   c----ccagctctgga--gag-cga-ggacacggt-gag
B D                     Panda  c----ccaactttgaa--gaa-cga-cgatggggt-gaa
               Pacific walrus  c----ccaactgtgaa--gag-cga-tgatggggt-gaa
                 Weddell seal  c----ccaactgtgaa--gaa-cga-tgatggggt-gaa
             Black flying-fox  c----ccagctctgaa--gaa-cga-tgactgggt-gag
B D                   Megabat  c----ccagctctgaa--gaa-tga-tgactgggt-gag
                Big brown bat  c----ccagcgctgaa--g----ga-cgcctggga-gtg
         David's myotis (bat)  c----ccagc-ctgaa--g----gg-cgactggga-ggg
B D                  Microbat  c----ccagc-ctgaa--g----gg-cgactggga-gtg
B D                     Shrew  c----ccatttttaga--gaa-tga-tgactaagtggaa
          Cape elephant shrew  ---------------c--aga-agactgacggggt-cga
             Cape golden mole  -------aattcgaac--cga-tgatgagttgggt-ggg
                     Aardvark  c-----caactctaaa--gaa-tga-agacagggt-gag
B D                 Armadillo  c----ccaactctaga--tga-taa-tgaccaggt-gaa
B D                     Mouse  =======================================
                Prairie vole  =======================================
B D           Chinese hamster  =======================================
              Golden hamster  =======================================
B D                    Tenrec  =======================================
B D                   Manatee  =======================================
B D                  Elephant  =======================================
B D                       Dog  =======================================
B D                Coelacanth  =======================================
B D                    Lizard  =======================================
  D  Chinese softshell turtle  =======================================
  D            Painted turtle  =======================================
  D           Green seaturtle  =======================================
B D                    Turkey  =======================================
B D                   Chicken  =======================================
  D              Mallard duck  =======================================
  D             Scarlet macaw  =======================================
  D                    Parrot  =======================================
B D                Budgerigar  =======================================
          Tibetan ground jay  =======================================
B D               Zebra finch  =======================================
B D       Medium ground finch  =======================================
  D    White-throated sparrow  =======================================
  D       Collared flycatcher  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
  D               Rock pigeon  =======================================
B D                   Wallaby  =======================================
B D        American alligator  =======================================
B D                   Opossum  =======================================
B D           Tasmanian devil  =======================================

Inserts between block 11 and 12 in window
B D                   Rabbit 4bp
         Cape elephant shrew 1bp
            Cape golden mole 1bp
                    Aardvark 16328bp

Alignment block 12 of 885 in window, 68736354 - 68736381, 28 bps 
B D                     Human  ctcgcacactcagcctgctggcctcca-g-
B D                     Chimp  ctcgcacactcagcctgctggcctcca-g-
B D                   Gorilla  ctcgcacactcagcctgctggcctcca-g-
B D                 Orangutan  ctcgcacactcagcctgctggcctcca-g-
B D                    Gibbon  ctcacacactcagcctgctggcctcca-g-
B D                    Rhesus  ctcgcacgctcagcctgctggcctcca-g-
B D       Crab-eating macaque  ctcgcacgctcagcctgctggcctcca-g-
B D                    Baboon  ctcgcacgctcagcctgctggcctcca-g-
B D              Green monkey  ctcgcacgctcagcctgctggcctcca-g-
B D                  Marmoset  ttcgcacactcagcctgctggcctcca-g-
B D           Squirrel monkey  ttcgcacactcagcctgctggcctcca-g-
B D                  Bushbaby  tttatgcatttcagatcttggtctcaagg-
           Chinese tree shrew  tttgca--ttcagactgctggtcctaa-g-
B D                  Squirrel  gcca--------------------------
       Lesser Egyptian jerboa  gccatgtattag--------gccttaa-a-
B D                       Rat  gccacacactta--------tctttta-g-
B D            Naked mole-rat  tttgtgcatttg--------gcctcaa-g-
B D                Guinea pig  gttctgcatctgc-------atcgcca-g-
                   Chinchilla  atcatgtatttg--------gtctcaa-g-
             Brush-tailed rat  ctcatgcatttg--------acctcaa-g-
B D                    Rabbit  ctctcacactca--------gcctcag-g-
B D                      Pika  ctctcccactca--------gcctgaa-g-
B D                       Pig  ttcagccatagggactgctggccgtca-g-
B D                    Alpaca  tttacccacgtggactactggccgt-a-g-
               Bactrian camel  ttcgcccacgtggactactggccat-a-g-
B D                   Dolphin  ttcacccatatggactgctggccgtaa-g-
                 Killer whale  ttcacccatatggactgctggccgtaa-g-
             Tibetan antelope  ttcacccatatggactgcttgctgtaa-g-
B D                       Cow  ttcacccacatggactgcttgctgtga-g-
B D                     Sheep  ttcacccatatggactgcttgctgtaa-g-
                Domestic goat  ttcacccatatggactgcttgctgtaa-g-
B D                     Horse  atcacccccacgggcagctggccatca-g-
B D          White rhinoceros  ----------------gttggctgtaa-g-
B D                       Cat  ctcgccctggaggacgactggcctgcc-t-
B D                   Ferret   tg-gcacctgaggactacgggccccga-g-
B D                     Panda  caccccccaaaggactgctggccagga-g-
               Pacific walrus  cgcacccctgaagactgctgaccagga-g-
                 Weddell seal  cgcacccctgaagactgctggccagga-g-
             Black flying-fox  tttgcccctgtggactggtggtcacaa-g-
B D                   Megabat  tttgcccctgtggactggtggtcacga-g-
                Big brown bat  aattcacccattcgccggcgg--ccag-a-
         David's myotis (bat)  aattcacccattcgctggcag--gcca-g-
B D                  Microbat  aattcacccagtcgctggcgg--gcca-g-
B D                     Shrew  ttcacccatctagatccctagccaaag-g-
          Cape elephant shrew  -------------gctg-------------
             Cape golden mole  -------------gctgccaaccctga-gg
B D                 Armadillo  ttcaggagcatgagcggctgaccatga-gg
B D                     Mouse  ==============================
                Prairie vole  ==============================
B D           Chinese hamster  ==============================
              Golden hamster  ==============================
B D                    Tenrec  ==============================
B D                   Manatee  ==============================
B D                  Elephant  ==============================
B D                       Dog  ==============================
B D                Coelacanth  ==============================
B D                    Lizard  ==============================
  D  Chinese softshell turtle  ==============================
  D            Painted turtle  ==============================
  D           Green seaturtle  ==============================
B D                    Turkey  ==============================
B D                   Chicken  ==============================
  D              Mallard duck  ==============================
  D             Scarlet macaw  ==============================
  D                    Parrot  ==============================
B D                Budgerigar  ==============================
          Tibetan ground jay  ==============================
B D               Zebra finch  ==============================
B D       Medium ground finch  ==============================
  D    White-throated sparrow  ==============================
  D       Collared flycatcher  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
  D               Rock pigeon  ==============================
B D                   Wallaby  ==============================
B D        American alligator  ==============================
B D                   Opossum  ==============================
B D           Tasmanian devil  ==============================
                    Aardvark  ==============================

Inserts between block 12 and 13 in window
          Chinese tree shrew 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                  Ferret  175bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 13 of 885 in window, 68736382 - 68736383, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  ct
       Lesser Egyptian jerboa  gc
B D                       Rat  gc
B D            Naked mole-rat  g-
B D                    Rabbit  gc
B D                      Pika  tc
B D                       Pig  tc
B D                    Alpaca  cc
               Bactrian camel  tc
B D                   Dolphin  cc
                 Killer whale  tc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  ct
                Domestic goat  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                   Ferret   cc
B D                     Panda  ct
               Pacific walrus  tc
                 Weddell seal  cc
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                     Shrew  cc
             Cape golden mole  cc
B D                 Armadillo  cc
         Cape elephant shrew  --
B D                     Mouse  ==
                Prairie vole  ==
B D           Chinese hamster  ==
              Golden hamster  ==
B D                    Tenrec  ==
            Brush-tailed rat  --
                  Chinchilla  --
B D                Guinea pig  --
B D                   Manatee  ==
B D                  Elephant  ==
B D                  Squirrel  --
B D                       Dog  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 13 and 14 in window
B D                      Cat 142bp

Alignment block 14 of 885 in window, 68736384 - 68736399, 16 bps 
B D                     Human  taagctga-------------------------------------------actgcttc
B D                     Chimp  taagctga-------------------------------------------actgcttc
B D                   Gorilla  taagctga-------------------------------------------actgcttc
B D                 Orangutan  tgagctga-------------------------------------------actgcttc
B D                    Gibbon  tgagttga-------------------------------------------actgcttc
B D                    Rhesus  tgagctga-------------------------------------------actgcttc
B D       Crab-eating macaque  tgagctga-------------------------------------------actgcttc
B D                    Baboon  tgagctga-------------------------------------------actgcttc
B D              Green monkey  tgagctga-------------------------------------------actgcttc
B D                  Marmoset  tgagctga-------------------------------------------actgcttc
B D           Squirrel monkey  tgagctga-------------------------------------------actgcttc
B D                  Bushbaby  caagctga-------------------------------------------cctgct--
           Chinese tree shrew  tgagctga-------------------------------------------cctgcttc
B D                  Squirrel  -------a-------------------------------------------cctgcttc
       Lesser Egyptian jerboa  cctagtga-------------------------------------------cttgcttc
B D                       Rat  cccagtga-------------------------------------------actgcttc
B D            Naked mole-rat  -----------------------------------------------------cccaag
B D                Guinea pig  -----------------------------------------------------ctcagc
                   Chinchilla  ------------------------------------------------------gcttc
             Brush-tailed rat  ------------------------------------------------------acttc
B D                    Rabbit  caggctga-------------------------------------------cctgcgtg
B D                      Pika  caggctga-------------------------------------------cctgtgtc
B D                       Pig  caagctgg-------------------------------------------cctgcttc
B D                    Alpaca  caagctgg-------------------------------------------ccttcttc
               Bactrian camel  cgagctgg-------------------------------------------ccttcttc
B D                   Dolphin  caagctgg-------------------------------------------cctgcttt
                 Killer whale  caagcggg-------------------------------------------cctgcttt
             Tibetan antelope  caagctgg-------------------------------------------cctgcatc
B D                       Cow  caagctgg-------------------------------------------cccacatc
B D                     Sheep  caagctgg-------------------------------------------cctgcatc
                Domestic goat  caagctgg-------------------------------------------cctgcatc
B D                     Horse  caagctga-------------------------------------------cccacctc
B D          White rhinoceros  caagctga-------------------------------------------cctgcctc
B D                   Ferret   tgagccgaaggcaacagcttaacccactgagccacccaggcgccccgtcactccgcttc
B D                     Panda  ccagccga-------------------------------------------cctgtgtc
               Pacific walrus  ccagctga-------------------------------------------cctgcttc
                 Weddell seal  ccagctga-------------------------------------------cctgcttc
             Black flying-fox  caagctga-------------------------------------------cctgcttc
B D                   Megabat  caagctga-------------------------------------------cctgcttc
                Big brown bat  cgcgctga--------------------------------------------ccgtgcc
         David's myotis (bat)  cacgctga-------------------------------------------cccccgcc
B D                  Microbat  cacgctga-------------------------------------------cccgcgcg
B D                     Shrew  cagaggga-------------------------------------------cctgagcc
          Cape elephant shrew  -cagctgc-------------------------------------------cctg--tc
             Cape golden mole  ccagctgg-------------------------------------------cctggtgc
B D                 Armadillo  tgagtaga-------------------------------------------cctgcttc
B D                     Mouse  ===========================================================
                Prairie vole  ===========================================================
B D           Chinese hamster  ===========================================================
              Golden hamster  ===========================================================
B D                    Tenrec  ===========================================================
B D                   Manatee  ===========================================================
B D                  Elephant  ===========================================================
B D                       Dog  ===========================================================
B D                       Cat  ===========================================================
B D                Coelacanth  ===========================================================
B D                    Lizard  ===========================================================
  D  Chinese softshell turtle  ===========================================================
  D            Painted turtle  ===========================================================
  D           Green seaturtle  ===========================================================
B D                    Turkey  ===========================================================
B D                   Chicken  ===========================================================
  D              Mallard duck  ===========================================================
  D             Scarlet macaw  ===========================================================
  D                    Parrot  ===========================================================
B D                Budgerigar  ===========================================================
          Tibetan ground jay  ===========================================================
B D               Zebra finch  ===========================================================
B D       Medium ground finch  ===========================================================
  D    White-throated sparrow  ===========================================================
  D       Collared flycatcher  ===========================================================
  D          Peregrine falcon  ===========================================================
  D              Saker falcon  ===========================================================
  D               Rock pigeon  ===========================================================
B D                   Wallaby  ===========================================================
B D        American alligator  ===========================================================
B D                   Opossum  ===========================================================
B D           Tasmanian devil  ===========================================================
                    Aardvark  ===========================================================

Inserts between block 14 and 15 in window
B D                   Rabbit 49bp
B D                     Pika 1958bp

Alignment block 15 of 885 in window, 68736400 - 68736406, 7 bps 
B D                     Human  tatggc----c----------
B D                     Chimp  tatggc----c----------
B D                   Gorilla  tatggc----c----------
B D                 Orangutan  tatggc----c----------
B D                    Gibbon  tatggc----c----------
B D                    Rhesus  tatggc----c----------
B D       Crab-eating macaque  tatggc----c----------
B D                    Baboon  tatggc----c----------
B D              Green monkey  tgtggc----c----------
B D                  Marmoset  agtggc----a----------
B D           Squirrel monkey  aatggc----a----------
B D                  Bushbaby  -atgtc----a----------
           Chinese tree shrew  tctg-c----a----------
B D                  Squirrel  cacatc----a----------
       Lesser Egyptian jerboa  tctgtc----c----------
B D                       Rat  tctgtc----c----------
B D            Naked mole-rat  ccaacc----t----------
B D                Guinea pig  tagata----g----------
                   Chinchilla  tgtatc----t----------
             Brush-tailed rat  tatatc----t----------
B D                    Rabbit  tctgac----a----------
B D                       Pig  gatggc----a----------
B D                    Alpaca  cgtgtc----a----------
               Bactrian camel  catgtc----a----------
B D                   Dolphin  tacgtc----a----------
                 Killer whale  tacgtc----g----------
             Tibetan antelope  caagtc----a----------
B D                       Cow  taagtc----a----------
B D                     Sheep  taagtc----a----------
                Domestic goat  taagtc----a----------
B D                     Horse  tgtgtcagcta----------
B D          White rhinoceros  tatgtcctcca----------
B D                   Ferret   tgtgtc----a----------
B D                     Panda  tatgcc----a----------
               Pacific walrus  tacgtc----a----------
                 Weddell seal  tacgtc----a----------
             Black flying-fox  tatgtc----a----------
B D                   Megabat  tatgtc----a----------
                Big brown bat  cacatc----c----------
         David's myotis (bat)  cacgtc----c----------
B D                  Microbat  cacgtc----c----------
B D                     Shrew  tttgta----a----------
          Cape elephant shrew  -----c----acgggggagcc
             Cape golden mole  -----c----gggtgtgaatc
B D                 Armadillo  -----c----tt------acc
B D                      Pika  =====================
B D                     Mouse  =====================
                Prairie vole  =====================
B D           Chinese hamster  =====================
              Golden hamster  =====================
B D                    Tenrec  =====================
B D                   Manatee  =====================
B D                  Elephant  =====================
B D                       Dog  =====================
B D                       Cat  =====================
B D                Coelacanth  =====================
B D                    Lizard  =====================
  D  Chinese softshell turtle  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D       Collared flycatcher  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  =====================
B D                   Wallaby  =====================
B D        American alligator  =====================
B D                   Opossum  =====================
B D           Tasmanian devil  =====================
                    Aardvark  =====================

Inserts between block 15 and 16 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 142bp

Alignment block 16 of 885 in window, 68736407 - 68736410, 4 bps 
B D                     Human  tcta-----
B D                     Chimp  tcta-----
B D                   Gorilla  tcta-----
B D                 Orangutan  tcta-----
B D                    Gibbon  tcta-----
B D                    Rhesus  tcta-----
B D       Crab-eating macaque  tcta-----
B D                    Baboon  tcta-----
B D              Green monkey  tcta-----
B D                  Marmoset  tcta-----
B D           Squirrel monkey  tcta-----
B D                  Bushbaby  tctg-----
           Chinese tree shrew  ccta-----
B D                  Squirrel  tctc-----
       Lesser Egyptian jerboa  tttt-----
B D                       Rat  tcta-----
B D            Naked mole-rat  actt-----
B D                Guinea pig  gttg-----
                   Chinchilla  cctg-----
             Brush-tailed rat  cttg-----
B D                    Rabbit  cctg-----
B D                       Pig  tcta-----
B D                    Alpaca  tcta-----
               Bactrian camel  tcta-----
B D                   Dolphin  tcta-----
                 Killer whale  tcta-----
             Tibetan antelope  tcta-----
B D                       Cow  ccta-----
B D                     Sheep  tcta-----
                Domestic goat  tcta-----
B D                     Horse  -gag-----
B D          White rhinoceros  -tag-----
B D                   Ferret   -ccg-----
B D                     Panda  -acg-----
               Pacific walrus  -acg-----
                 Weddell seal  -aca-----
             Black flying-fox  -cta-----
B D                   Megabat  -cta-----
                Big brown bat  -cta-----
B D                  Microbat  -cta-----
B D                     Shrew  tcta-----
          Cape elephant shrew  ---ggg--t
             Cape golden mole  ---atc--t
B D                 Armadillo  ---acccac
B D                      Pika  =========
B D                     Mouse  =========
                Prairie vole  =========
B D           Chinese hamster  =========
              Golden hamster  =========
B D                    Tenrec  =========
        David's myotis (bat)  =========
B D                   Manatee  =========
B D                  Elephant  =========
B D                       Dog  =========
B D                       Cat  =========
B D                Coelacanth  =========
B D                    Lizard  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
  D             Scarlet macaw  =========
  D                    Parrot  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D       Collared flycatcher  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D                   Wallaby  =========
B D        American alligator  =========
B D                   Opossum  =========
B D           Tasmanian devil  =========
                    Aardvark  =========

Inserts between block 16 and 17 in window
B D                    Chimp 1bp
B D                  Gorilla 1bp
B D                Orangutan 1bp
B D                   Gibbon 1bp
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
B D                   Baboon 1bp
B D             Green monkey 1bp
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
      Lesser Egyptian jerboa 2bp
B D                      Rat 166bp
B D           Naked mole-rat 33bp
B D               Guinea pig 60bp
                  Chinchilla 21bp
            Brush-tailed rat 73bp
B D                   Rabbit 19bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
            Tibetan antelope 134bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
B D                    Shrew 7bp

Alignment block 17 of 885 in window, 68736411 - 68736411, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  g
B D                       Pig  c
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  c
                 Killer whale  c
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                   Ferret   g
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
B D                  Microbat  t
B D                     Shrew  t
          Cape elephant shrew  c
             Cape golden mole  c
B D                 Armadillo  c
B D                      Pika  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D                       Dog  =
B D                       Cat  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Inserts between block 17 and 18 in window
B D                      Pig 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                      Cow 139bp

Alignment block 18 of 885 in window, 68736412 - 68736436, 25 bps 
B D                     Human  aggttagatatggct----gaaccacact
B D                     Chimp  aggttagatatggct----gaaccacact
B D                   Gorilla  aagttagatatggct----gaaccacact
B D                 Orangutan  aggttagatacggct----gaaccacact
B D                    Gibbon  aggttagatacatct----gaaccacact
B D                    Rhesus  aggttagatacatct----gaaccacact
B D       Crab-eating macaque  aggttagatacatct----gaaccacact
B D                    Baboon  aggttagatacatcg----gaaccacact
B D              Green monkey  aggttagatatatct----gaaccacact
B D                  Marmoset  aggttggatatgttc----gaatcacatt
B D           Squirrel monkey  aggttagatacgttt----gaaccacaat
B D                  Bushbaby  aggggagagatgttt----gaat---gct
           Chinese tree shrew  aggttaggtatgttt----gaaccatcct
B D                  Squirrel  aagttagagtggcta----gagcca-ggg
       Lesser Egyptian jerboa  agctcagctaggctg----gggcca-ctg
B D            Naked mole-rat  atgttg-----------------------
B D                Guinea pig  atcttgtggaagtca--------ca-aga
                   Chinchilla  atgttg-----------------------
             Brush-tailed rat  atcttgtggaa-tca--------ca-gga
B D                    Rabbit  atcttgtagaagcc---------ca-agg
B D                       Pig  -gctttagaacattt----accccatatt
B D                    Alpaca  -agagtagaatgttt----aaaccatatt
               Bactrian camel  -agagtagaatgttt----aaaccatatt
B D                   Dolphin  -attttagaacgttt----aaacagtatt
                 Killer whale  -attttagaacgttt----aaacagtatt
B D                     Sheep  ---ctcaggatgttt----acaccata-t
                Domestic goat  ---ctcagaacgttt----acaccata-t
B D                     Horse  agcttagcaacgttt----gagccctatt
B D          White rhinoceros  aggttagaaacgtgt----gaaccatatt
B D                   Ferret   cggttagaaaccttt----gagccatact
B D                     Panda  agcttagaaatgtct----gagccatgtt
               Pacific walrus  aggttagaaacgttc----gagccgtaac
                 Weddell seal  aggttagaaacgttt----gagccataat
             Black flying-fox  gggttagaaacgttt----gaaccacatt
B D                   Megabat  gggttagaaacgttt----gaaccacatt
                Big brown bat  cggtaaaaagcgtcc----gaacagagct
B D                  Microbat  cgg---accccgtc---------------
B D                     Shrew  aggttagcaatggct----gagtcatatt
          Cape elephant shrew  aggccgacactcttttctgggcccttc--
             Cape golden mole  aggctga---tggtttctcgtctcttt--
B D                 Armadillo  aggttagaagtattt----gaaccatc--
B D                      Pika  =============================
B D                     Mouse  =============================
                Prairie vole  =============================
B D                       Rat  =============================
B D           Chinese hamster  =============================
              Golden hamster  =============================
B D                    Tenrec  =============================
B D                       Cow  =============================
            Tibetan antelope  =============================
        David's myotis (bat)  =============================
B D                   Manatee  =============================
B D                  Elephant  =============================
B D                       Dog  =============================
B D                       Cat  =============================
B D                Coelacanth  =============================
B D                    Lizard  =============================
  D  Chinese softshell turtle  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D              Mallard duck  =============================
  D             Scarlet macaw  =============================
  D                    Parrot  =============================
B D                Budgerigar  =============================
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
B D       Medium ground finch  =============================
  D    White-throated sparrow  =============================
  D       Collared flycatcher  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D               Rock pigeon  =============================
B D                   Wallaby  =============================
B D        American alligator  =============================
B D                   Opossum  =============================
B D           Tasmanian devil  =============================
                    Aardvark  =============================

Inserts between block 18 and 19 in window
               Big brown bat 160bp
B D                 Microbat 8bp

Alignment block 19 of 885 in window, 68736437 - 68736443, 7 bps 
B D                     Human  gggc------------tga
B D                     Chimp  gggc------------tga
B D                   Gorilla  cggc------------tga
B D                 Orangutan  gggc------------tga
B D                    Gibbon  gggc------------tga
B D                    Rhesus  gggc------------tga
B D       Crab-eating macaque  gggc------------tga
B D                    Baboon  gggc------------tga
B D              Green monkey  ggac------------tga
B D                  Marmoset  gggc------------tga
B D           Squirrel monkey  gggc------------tga
B D                  Bushbaby  gggt------------tgt
           Chinese tree shrew  ggtt------------tga
B D                  Squirrel  ggga------------tga
       Lesser Egyptian jerboa  tggc------------tga
B D            Naked mole-rat  -ggt------------tga
B D                Guinea pig  aggc------------cct
                   Chinchilla  -ggc------------tga
             Brush-tailed rat  aggc------------taa
B D                    Rabbit  gggc------------taa
B D                       Pig  gggc------------tga
B D                    Alpaca  gggc------------tga
               Bactrian camel  gggc------------tga
B D                   Dolphin  gggc------------tga
                 Killer whale  gggc------------tga
B D                     Sheep  gggc------------tga
                Domestic goat  gggc------------tga
B D                     Horse  gtgc------------tga
B D          White rhinoceros  gtgc------------tga
B D                   Ferret   gagc------------cga
B D                     Panda  gggc------------cga
               Pacific walrus  gggc------------cga
                 Weddell seal  gggc------------cga
             Black flying-fox  gtgc------------tga
B D                   Megabat  gtgc------------tga
B D                     Shrew  gaga------------tga
          Cape elephant shrew  aggcctcagctcaccctgc
             Cape golden mole  agacctggtctgaccttgt
B D                 Armadillo  aggc------------tgg
B D                      Pika  ===================
B D                     Mouse  ===================
                Prairie vole  ===================
B D                       Rat  ===================
B D           Chinese hamster  ===================
              Golden hamster  ===================
B D                    Tenrec  ===================
               Big brown bat  ===================
B D                       Cow  ===================
            Tibetan antelope  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
B D                   Manatee  ===================
B D                  Elephant  ===================
B D                       Dog  ===================
B D                       Cat  ===================
B D                Coelacanth  ===================
B D                    Lizard  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
  D              Mallard duck  ===================
  D             Scarlet macaw  ===================
  D                    Parrot  ===================
B D                Budgerigar  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
B D       Medium ground finch  ===================
  D    White-throated sparrow  ===================
  D       Collared flycatcher  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D               Rock pigeon  ===================
B D                   Wallaby  ===================
B D        American alligator  ===================
B D                   Opossum  ===================
B D           Tasmanian devil  ===================
                    Aardvark  ===================

Inserts between block 19 and 20 in window
B D           Naked mole-rat 196bp
B D                   Alpaca 109bp
              Bactrian camel 111bp

Alignment block 20 of 885 in window, 68736444 - 68736444, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  t
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
B D                     Shrew  c
          Cape elephant shrew  t
             Cape golden mole  t
B D                 Armadillo  c
B D                      Pika  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
               Big brown bat  =
B D                       Cow  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Inserts between block 20 and 21 in window
B D                  Gorilla 2bp
B D                Orangutan 2bp
B D                   Gibbon 2bp
B D                   Rhesus 2bp
B D      Crab-eating macaque 2bp
B D                   Baboon 2bp
B D             Green monkey 2bp
B D                 Marmoset 30bp
B D          Squirrel monkey 30bp
B D                 Bushbaby 31bp
          Chinese tree shrew 116bp
B D                      Pig 120bp
                Killer whale 107bp
B D                    Sheep 108bp
               Domestic goat 104bp
B D                    Horse 101bp
B D         White rhinoceros 104bp
B D                    Shrew 99bp

Alignment block 21 of 885 in window, 68736445 - 68736445, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  g
       Lesser Egyptian jerboa  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
B D                     Shrew  a
          Cape elephant shrew  a
             Cape golden mole  g
B D                 Armadillo  a
B D                      Pika  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Inserts between block 21 and 22 in window
         Cape elephant shrew 32bp
            Cape golden mole 58bp
B D                Armadillo 100bp

Alignment block 22 of 885 in window, 68736446 - 68736446, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  g
             Brush-tailed rat  a
B D                    Rabbit  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
B D                     Shrew  g
B D                 Armadillo  g
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  =

Inserts between block 22 and 23 in window
B D                  Dolphin 114bp
B D                  Ferret  44bp
B D                    Panda 110bp
              Pacific walrus 42bp
                Weddell seal 42bp
            Black flying-fox 41bp
B D                  Megabat 41bp

Alignment block 23 of 885 in window, 68736447 - 68736447, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D            Naked mole-rat  t
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  a
B D                       Pig  t
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  c
B D                   Ferret   t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Microbat  t
B D                     Shrew  t
B D                 Armadillo  t
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Tenrec  =
B D                     Panda  =
               Big brown bat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  =

Alignment block 24 of 885 in window, 68736448 - 68736449, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  tt
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  ta
           Chinese tree shrew  tg
B D                  Squirrel  gt
       Lesser Egyptian jerboa  gt
B D            Naked mole-rat  gg
B D                Guinea pig  gc
                   Chinchilla  gc
             Brush-tailed rat  ac
B D                    Rabbit  gt
B D                       Pig  cg
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  cg
B D                       Cow  cg
B D                     Sheep  ca
                Domestic goat  cg
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Cat  cg
B D                   Ferret   cg
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  cc
B D                   Megabat  cc
B D                  Microbat  ct
B D                     Shrew  ca
B D                  Elephant  ca
B D                   Manatee  ca
             Cape golden mole  ca
B D                 Armadillo  cg
B D                      Pika  ==
         Cape elephant shrew  ==
B D                     Mouse  ==
                Prairie vole  ==
B D                       Rat  ==
B D           Chinese hamster  ==
              Golden hamster  ==
B D                    Tenrec  ==
B D                     Panda  ==
               Big brown bat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 24 and 25 in window
B D                 Squirrel 96bp
      Lesser Egyptian jerboa 157bp
B D               Guinea pig 31bp
                  Chinchilla 105bp
            Brush-tailed rat 30bp
B D                   Rabbit 34bp
            Cape golden mole 2bp

Alignment block 25 of 885 in window, 68736450 - 68736451, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  tg
B D                  Squirrel  cg
B D            Naked mole-rat  tg
B D                Guinea pig  ta
                   Chinchilla  tg
             Brush-tailed rat  tg
B D                    Rabbit  tg
B D                       Pig  tg
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  tg
B D                       Cow  tg
B D                     Sheep  tg
                Domestic goat  tg
B D                     Horse  cg
B D          White rhinoceros  tg
B D                       Cat  tg
B D                   Ferret   tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                   Megabat  tg
B D                  Microbat  tg
B D                     Shrew  tg
B D                  Elephant  cg
          Cape elephant shrew  gg
B D                   Manatee  tg
             Cape golden mole  ca
B D                 Armadillo  tg
B D                      Pika  ==
B D                     Mouse  ==
                Prairie vole  ==
B D                       Rat  ==
B D           Chinese hamster  ==
              Golden hamster  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
B D                     Panda  ==
               Big brown bat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 25 and 26 in window
B D                  Ferret  61bp
              Pacific walrus 65bp
                Weddell seal 65bp
            Black flying-fox 42bp
B D                  Megabat 42bp
B D                 Microbat 49bp

Alignment block 26 of 885 in window, 68736452 - 68736554, 103 bps 
B D                     Human  gttgg-----gaactcacacgg--aatgaaataaccagcaaaacgt-----tctctgactgcttt-ctta
B D                     Chimp  gttgg-----gaactcacacgg--aatgaaataaccagcaaaacgt-----tctctgactgcttt-ctta
B D                   Gorilla  gttgg-----gaactcacacgg--aatgaaataaccagcaaaacgt-----tctctgactgcttt-ctta
B D                 Orangutan  gttgg-----gaactcacacag--aatgaaacaaccagcaaaaggt-----tctctgactgcttc-ctta
B D                    Gibbon  gttgg-----gaactcacacag--aatgaaacaaccagcaaaacgt-----tctctgactgcttc-ctta
B D                    Rhesus  gttgg-----aaactcacacag--aatgaaacaaccagcaaaacgt-----tctctgactgcttc-ctta
B D       Crab-eating macaque  gttgg-----gaactcacacag--aatgaaacaaccagcaaaacgt-----tctctgactgcttc-ctta
B D                    Baboon  gttgg-----gaactcacacag--aatgaaacaaccagcaaaacgt-----tctctgactgcttc-ctta
B D              Green monkey  gttgg-----gaactcacacag--aatgaaacaaccagcaaaacgt-----tctctgactgcttc-ctta
B D                  Marmoset  gttgg-----gaacttatatag--aatgaaacaatcagcaaacaat-----tctctgactgcttc-ctta
B D           Squirrel monkey  gttgg-----gaccttatatag--aatgaaacaatcagcaaacaat-----tctctgactgcttc-ctta
B D                  Bushbaby  gctgg-----gaactcacacag--agtgaaataagcagcaaacagt-----tctctgactgcccc-cttc
           Chinese tree shrew  tttgg-----gaactcatatag--aaagaaacaactagcaaacagt-----ttcctgactcctcc-ctaa
B D                  Squirrel  gctgg-----ggactcacac-g--gaatgaagcgccag-ctgcagc-----cctccgactgccgc-----
B D            Naked mole-rat  gttgg-----gaacataca--g--aagaaaaccaccagccaacagt-----tctctgagtgctcc-ctca
B D                Guinea pig  gctgg-----ggacataca--g--aacaaaactaccag-caacagc-----tctctgagcgctcc-cttc
                   Chinchilla  gctgg-----gaacatata--ggaaaaaaagacaccagccgacagt-----tctctgagtgctcc-ctta
             Brush-tailed rat  gttgg-----gagcataca--g--aaaaaccccaccagccgacagt-----tctctcagtgctcc-ctta
B D                    Rabbit  gccag-----gaactcaca--g--agggaaaccacccggcagcggc-----tcaccggctgcccc-ttgc
B D                       Pig  gttgg-----gaactcatacag--aatgaaacagccagc----agt-----tttctgatggctcc-ct--
B D                    Alpaca  gctgg-----g-actcgtacag--agtgaacccaccagc----ggt-----gttccgactgctct-ctca
               Bactrian camel  gctgg-----g-actcgtacag--agtgaacccaccagc----ggt-----gttccgactgctcc-ctca
B D                   Dolphin  gttgg-----gaactcatacag--aatgagacaggcagcaaacagt-----tttctgacagctcc-ctca
                 Killer whale  gttgg-----gaactcatacag--aatgagacaggcagcaaacagt-----tttctgacagctcc-ctca
             Tibetan antelope  gttgg-----gaactcatacag--aatgaaacagccagcaaatggt-----tttctgacagcttc-ctca
B D                       Cow  gttgg-----gaactcatacag--aatgaaacagccagcaaatggt-----tttctgacagctcc-ctca
B D                     Sheep  gttgg-----gaactcatacag--aatgaaacagccagcaaatggt-----tttctgacagcttc-ctca
                Domestic goat  gttgg-----gaactcatacag--aatgaaacagccagcaaatggt-----tttctgacagctcc-ctca
B D                     Horse  actgg-----gaactcaaacag--aatgaaacagccggcgaccagc-----tttctggccact-c-cttc
B D          White rhinoceros  gttgg-----gaactcatacag--aatgaaacaaccagctaacaga-----tttctgacagctcc-ctta
B D                       Cat  gttgg-----gaactcgcacag--agccgcacag-cagca----gc-----tttcggaccgccccgctta
B D                   Ferret   agtgg-----gaggtcacacag--gacgacacaa-gagcgaacggg-----cttctgcatgcgcc-cttg
B D                     Panda  gctgg-----gaactcatccag--gatgaagcaa-cagcgaatggt-----tctctacgtgctcc-ctta
               Pacific walrus  gttgg-----gagctcatacag--gatgaagcaa-cagcaaacgtg-----tttctgcatgctcc-ctta
                 Weddell seal  gttgg-----gagctcatacag--gatgaagcaa-cagcaaacagg-----t---tgcatgctcc-ctta
             Black flying-fox  gccag-----gaac-----cag--cagagtgaga-cag-------------tcctggattgctcc-cttg
B D                   Megabat  gccag-----gaac-----cag--cagagtaaga-cag-------------tcctggattgttcc-cttg
B D                  Microbat  gccgggcc--gggc-----cag--aacggagcag-cag-------------cccctgaccgccct-ccag
B D                     Shrew  actag-----aaactcaaacag--cataaaacca-cagcaaagagt-----attccacctgttct-ctta
B D                  Elephant  gctgg-----ggacacgtacag--aaggaaacaaccagccagcagt-----tttctgcctccgcttcctg
          Cape elephant shrew  gatggtcagtgaactcgctggg--aaggacacgactgaccgacagtc-tgcttgctgcccctgtccccaa
B D                   Manatee  gttgg-----gaacacgtacag--aagg---caaatgaccaactgt-----tttctgcctctgcttcctg
             Cape golden mole  ggtgg-----gaaccggtaccg--aggg---taa------ggcagtcgtgctttttgcctctacctac--
B D                 Armadillo  gttgg-----gaactcagacag--aagg-aataaacggcagactct-----tttctgactgtac--ccta
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
                    Aardvark  ======================================================================

                        Human  -ccaccaaaaat-aaat--tggt--ag---------agattcc-agtata-tca--tcagtattg
                        Chimp  -ccaccaaaaat-aaat--tggt--ag---------agattcc-agtata-tca--tcagtattg
                      Gorilla  -ccaccaaaaat-aaat--tggt--ag---------agattcc-agtata-tca--tcagtattg
                    Orangutan  -ccaccaaaaat-aaat--tggt--ag---------agattcc-agtata-tca--tcagtattg
                       Gibbon  -ccaccaaaaat-aaat--tggtacag---------agattcc-agtata-tca--tcagtattg
                       Rhesus  -ccactaacaat-aaat--tggt--ag---------agattcc-agcata-tca--tcagcattg
          Crab-eating macaque  -ccactaacaat-aaat--tggt--ag---------agattcc-agcata-tca--tcagcattg
                       Baboon  -ccactaacaat-aaat--tggt--ag---------agattcc-agcata-tca--tcagcattg
                 Green monkey  -ccactaacaat-aaat--tggt--ag---------agattcc-agcata-tca--tcagcattg
                     Marmoset  -ccaaca---at-aaac--tggt--ag---------agattcc-agtata-tca--tcagtactg
              Squirrel monkey  -ccaccaatgat-gaac--tggt--ag---------agattcc-agtata-tca--tcagtactg
                     Bushbaby  -ctgcta-------------cac--aa---------caatacc-ttcaga-cca--tctgtcctg
           Chinese tree shrew  -ctataagtaat-agat--tggt--ag---------agattct-agtatg-cca--tgaatgt--
                     Squirrel  --------aaat-gaaccttggc--ag---------agatccc-agcaca-cca--tga--gctg
               Naked mole-rat  -ttagcaatgat-aaac--tggc--ag---------ag--tcc-agaaca-gta--tcagtgctg
                   Guinea pig  -ttactaatgag-aaac--tggc--ag---------ag--tcc-tgaaca-gca--ttactgctg
                   Chinchilla  -ctgtcagggat-aaac--tgcc--tg---------ag--ttc-agaaca-gca--tcagtgctg
             Brush-tailed rat  -ctgtcagtggt-aaac--tggc--tg---------ag--tcc-agaaca-gcg--tcagcgctg
                       Rabbit  -tgaat--tcct-aact--tggt--gg---------agatgcc-acaacg-cca--tccgaactc
                          Pig  ------aataat-aaat--tggt--at---------agtttct-cctata-ctg--tcagtactg
                       Alpaca  -ctgcaagtgat-aagc--cggt--ag---------agattcc-aggacacccg--tcagcactg
               Bactrian camel  -ctgcaagtgat-aaac--cggt--ag---------agattcc-aggacacccg--tcagcactg
                      Dolphin  -ccacaaataat-aaat--tggt--ag---------agattcc-agcaca-ccg--tcagtacca
                 Killer whale  -ccacaaataat-aaat--tggt--ag---------agattcc-agcaca-ccg--tcagtacca
             Tibetan antelope  -ccaacagtacc-aagt--tggt--ag---------agagtcc-agtatg-cca--tcagcactg
                          Cow  -ccaaaaataac-aagt--tggt--ag---------agattcc-agtatg-cca--tcagtgctg
                        Sheep  -ccaacaatacc-aagt--tggt--ag---------agagtcc-agtatg-cca--tcagtgctg
                Domestic goat  -ccaacaatacc-gagt--tggt--ag---------agagtgc-agtatg-ccg--tcagtgctg
                        Horse  -ccac-aataac-agac--tggt--gg---------agacgcc-cgca----cc--tcagtactg
             White rhinoceros  -ccac-aataat-aaat--tggg--ag---------agattcc-agtata-cca--gcagtactg
                          Cat  -ccacaaacggc-acag--tcct--gagtaccgtccagatgccactttca-cca--acggtacca
                      Ferret   -ccacgaggcac-acgc--tgcc--ag---------ag---tc-cgttca-ccg--tcagtgctg
                        Panda  --cacaggtcac-agac--cggt--ag---------agattcc-agatta-cca--tcagtactg
               Pacific walrus  -ccacgaatcct-aaat--tggt--ag---------agattcc-cgttta-cca--ttagtactg
                 Weddell seal  -ccacgaatcat-atat--tggt--ag---------agattcc-cgttta-cca--ttagtactg
             Black flying-fox  -ccacaaacaaa-aagc--aggc--ag---------gaattcc-cgtaga-cca--t-agtactg
                      Megabat  -ccacaaacaaa-aagc--aggc--ag---------gaattcc-agtaga-cca--t-agtactg
                     Microbat  accccaggccca-gcac-----c--gg---------gagttc-----------------------
                        Shrew  -gcacagttgataaaac--ccag--aa---------caattcc-agcatg-cca--tgagcacta
                     Elephant  -actcaaatact-taac--tgat--ag---------agatccc-ggaatg-ccgtctcaggaccg
          Cape elephant shrew  -ctgtgagtggt-cagc--tggc--at---------gactcca-gca---------tcagaactc
                      Manatee  -actcagatagg-caat--tggt--ag---------agatccc-agaacg-cca--tcaggacca
             Cape golden mole  -----agagagt-cgat--ccgg--ag---------cgacccc-aggatg-ccg--tcaggactg
                    Armadillo  -ctacaaagact-aaat--cagc--ag---------agattcc-ggcata-ctg--ttggttcta
                         Pika  =================================================================
                        Mouse  =================================================================
                 Prairie vole  =================================================================
                          Rat  =================================================================
              Chinese hamster  =================================================================
               Golden hamster  =================================================================
       Lesser Egyptian jerboa  =================================================================
                       Tenrec  =================================================================
                Big brown bat  =================================================================
         David's myotis (bat)  =================================================================
                          Dog  =================================================================
                   Coelacanth  =================================================================
                       Lizard  =================================================================
     Chinese softshell turtle  =================================================================
               Painted turtle  =================================================================
              Green seaturtle  =================================================================
                       Turkey  =================================================================
                      Chicken  =================================================================
                 Mallard duck  =================================================================
                Scarlet macaw  =================================================================
                       Parrot  =================================================================
                   Budgerigar  =================================================================
           Tibetan ground jay  =================================================================
                  Zebra finch  =================================================================
          Medium ground finch  =================================================================
       White-throated sparrow  =================================================================
          Collared flycatcher  =================================================================
             Peregrine falcon  =================================================================
                 Saker falcon  =================================================================
                  Rock pigeon  =================================================================
                      Wallaby  =================================================================
           American alligator  =================================================================
                      Opossum  =================================================================
              Tasmanian devil  =================================================================
                     Aardvark  =================================================================

Inserts between block 26 and 27 in window
B D                 Squirrel 1bp

Alignment block 27 of 885 in window, 68736555 - 68736555, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
B D            Naked mole-rat  t
B D                Guinea pig  c
                   Chinchilla  t
             Brush-tailed rat  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  c
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  c
B D          White rhinoceros  t
B D                       Cat  g
B D                   Ferret   c
B D                     Panda  g
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  g
B D                   Megabat  g
B D                     Shrew  t
B D                  Elephant  g
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                 Armadillo  t
B D                      Pika  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Rabbit  -
B D                    Tenrec  =
               Big brown bat  =
B D                  Microbat  -
        David's myotis (bat)  =
          Chinese tree shrew  -
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Alignment block 28 of 885 in window, 68736556 - 68736558, 3 bps 
B D                     Human  aga-
B D                     Chimp  aga-
B D                   Gorilla  aga-
B D                 Orangutan  aga-
B D                    Gibbon  aga-
B D                    Rhesus  aga-
B D       Crab-eating macaque  aga-
B D                    Baboon  aga-
B D              Green monkey  aga-
B D                  Marmoset  gga-
B D           Squirrel monkey  gga-
B D                  Bushbaby  gga-
B D                  Squirrel  aca-
       Lesser Egyptian jerboa  ggg-
B D            Naked mole-rat  ggg-
B D                Guinea pig  ggg-
                   Chinchilla  ggg-
             Brush-tailed rat  ggg-
B D                    Rabbit  -tg-
B D                       Pig  -gg-
B D                    Alpaca  -gg-
               Bactrian camel  -gg-
B D                   Dolphin  -gg-
                 Killer whale  -gg-
             Tibetan antelope  -gt-
B D                       Cow  -gg-
B D                     Sheep  -gg-
                Domestic goat  -gg-
B D                     Horse  -gg-
B D          White rhinoceros  -gg-
B D                       Cat  -ag-
B D                   Ferret   -gg-
B D                     Panda  -gg-
               Pacific walrus  -gg-
                 Weddell seal  -gg-
             Black flying-fox  ggg-
B D                   Megabat  ggg-
         David's myotis (bat)  ggg-
B D                     Shrew  --g-
B D                  Elephant  -gga
          Cape elephant shrew  -gtc
B D                   Manatee  -gg-
             Cape golden mole  -gga
B D                 Armadillo  -gat
B D                      Pika  ====
B D                     Mouse  ====
                Prairie vole  ====
B D                       Rat  ====
B D           Chinese hamster  ====
              Golden hamster  ====
B D                    Tenrec  ====
               Big brown bat  ====
B D                  Microbat  ----
          Chinese tree shrew  ----
B D                       Dog  ====
B D                Coelacanth  ====
B D                    Lizard  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                   Wallaby  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====
                    Aardvark  ====

Inserts between block 28 and 29 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
B D                    Shrew 2bp

Alignment block 29 of 885 in window, 68736559 - 68736572, 14 bps 
B D                     Human  tgt-cgagataaaa-a
B D                     Chimp  tgt-cgagataaaa-a
B D                   Gorilla  tgt-cgacataaaa-a
B D                 Orangutan  tgt-cgagataaaa-a
B D                    Gibbon  tgt-tgagataaaa-a
B D                    Rhesus  tgt-cgagataaaa-a
B D       Crab-eating macaque  tgt-cgagataaaa-a
B D                    Baboon  tgt-cgagataaaa-a
B D              Green monkey  tgt-cgagataaaa-a
B D                  Marmoset  tgt-tgagataaaa-a
B D           Squirrel monkey  tgc-tgagataaaa-g
B D                  Bushbaby  tgt-tgaggtaaaa-a
           Chinese tree shrew  -----gagataaac-a
B D                  Squirrel  tgc-tgagacaaag--
       Lesser Egyptian jerboa  tat-tgagaggaaac-
B D            Naked mole-rat  tgt-tgagataaaa-a
B D                Guinea pig  tgt-tgagacgaaa-a
                   Chinchilla  tgc-tgagataaaa-a
             Brush-tailed rat  tgt-tcagagaaaa-a
B D                    Rabbit  cac-tgacggaaaa--
B D                       Pig  tgc-tgagataaaa-a
B D                    Alpaca  tat-tgacataaaa-a
               Bactrian camel  tat-tgacataaaa-a
B D                   Dolphin  tgt-tgagatgaaa-a
                 Killer whale  tgt-tgagatgaaa-a
             Tibetan antelope  tgt-agagataatg-a
B D                       Cow  tgt-agagataata-a
B D                     Sheep  tgt-agagataatg-a
                Domestic goat  tgt-agagataacg-a
B D                     Horse  tgg-tgccacaaca-a
B D          White rhinoceros  tgt-tgacataaca-a
B D                       Cat  ggt-ggggatacac-a
B D                   Ferret   tgc-cgagatcaaa-c
B D                     Panda  tgt-tgagataaaa-a
               Pacific walrus  tgt-tgagataaaa-a
                 Weddell seal  tgt-tgagataaaa-a
             Black flying-fox  tgt-tgatacagaa-g
B D                   Megabat  tgt-tgatacagaa-g
                Big brown bat  cgt-tcaggtgaag-a
         David's myotis (bat)  cgt-tcagatgcag-a
B D                  Microbat  ------cgatgcag-a
B D                     Shrew  tgc-cgaggcaaaa-g
B D                  Elephant  -gg-cgagataaaa-a
          Cape elephant shrew  -gg-tcaagatgga-g
B D                   Manatee  ------agataaaa-a
             Cape golden mole  -ggtcgaggcagaa-g
B D                 Armadillo  -gt-tgagatagtc--
B D                      Pika  ================
B D                     Mouse  ================
                Prairie vole  ================
B D                       Rat  ================
B D           Chinese hamster  ================
              Golden hamster  ================
B D                    Tenrec  ================
B D                       Dog  ================
B D                Coelacanth  ================
B D                    Lizard  ================
  D  Chinese softshell turtle  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
  D             Scarlet macaw  ================
  D                    Parrot  ================
B D                Budgerigar  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
  D       Collared flycatcher  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D                   Wallaby  ================
B D        American alligator  ================
B D                   Opossum  ================
B D           Tasmanian devil  ================
                    Aardvark  ================

Alignment block 30 of 885 in window, 68736573 - 68736581, 9 bps 
B D                     Human  tcatcag-g-c
B D                     Chimp  tcatcag-g-c
B D                   Gorilla  tcatcag-g-c
B D                 Orangutan  tcatcag-g-c
B D                    Gibbon  tcatcag-g-c
B D                    Rhesus  tcatcag-a-c
B D       Crab-eating macaque  tcatcag-a-c
B D                    Baboon  tcatcag-a-c
B D              Green monkey  tcatcag-a-c
B D                  Marmoset  tcgtcag-g-g
B D           Squirrel monkey  tcatcag-g-g
B D                  Bushbaby  cta-cgg-g-g
           Chinese tree shrew  tcatcag-g-g
B D                  Squirrel  ccat--c-a-g
       Lesser Egyptian jerboa  ------t-c-g
B D                       Rat  cccacag-g-g
B D            Naked mole-rat  ttatcag-g-g
B D                Guinea pig  tcatcag-a-g
                   Chinchilla  tcatcag-g-g
             Brush-tailed rat  tcatcag-g-g
B D                    Rabbit  tcaccag-a-g
B D                       Pig  tcaccca-gc-
B D                    Alpaca  tcatctg-g--
               Bactrian camel  tcatctg-g--
B D                   Dolphin  tcatctg-g--
                 Killer whale  tcatctg-g--
             Tibetan antelope  tcatctg-g--
B D                       Cow  tcatctg-g--
B D                     Sheep  tcatctg-g--
                Domestic goat  tcatctg-g--
B D                     Horse  ccatcag-g-g
B D          White rhinoceros  tcatcat-g-g
B D                       Cat  tcaccag-g-g
B D                   Ferret   tca-cgc-g-g
B D                     Panda  tcatcag-g-g
               Pacific walrus  tcatcag-g-g
                 Weddell seal  tcatcag-g-g
             Black flying-fox  caatcag-g-g
B D                   Megabat  caatcag-g-g
                Big brown bat  taacc---c-g
         David's myotis (bat)  tcacc---g-g
B D                  Microbat  tcacc---g-g
B D                     Shrew  tcatc------
B D                  Elephant  tcaccagtg--
          Cape elephant shrew  ccaccag-g--
B D                   Manatee  tcgccaggg--
             Cape golden mole  tcaagag-g--
B D                 Armadillo  tcatcaagg--
B D                      Pika  ===========
B D                     Mouse  ===========
                Prairie vole  ===========
B D           Chinese hamster  ===========
              Golden hamster  ===========
B D                    Tenrec  ===========
B D                       Dog  ===========
B D                Coelacanth  ===========
B D                    Lizard  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
  D             Scarlet macaw  ===========
  D                    Parrot  ===========
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
  D       Collared flycatcher  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D                   Wallaby  ===========
B D        American alligator  ===========
B D                   Opossum  ===========
B D           Tasmanian devil  ===========
                    Aardvark  ===========

Inserts between block 30 and 31 in window
B D                      Pig 295bp

Alignment block 31 of 885 in window, 68736582 - 68736661, 80 bps 
B D                     Human  ccaattaagtggag----------aggcattggattaagtaattatgtgcat--------a--aa-----
B D                     Chimp  ccaattaagtggag----------aggcattggattaagtaattatgtgcat--------a--aa-----
B D                   Gorilla  ccaattaagtggag----------aggcattggattaagtaattatgtgcat--------a--aa-----
B D                 Orangutan  ccaattaagtggag----------agacattggattaagtaattatgtgcat--------a--aa-----
B D                    Gibbon  ccaattaagtggag----------aggcatcggattaggtaattatgtgcat--------a--aa-----
B D                    Rhesus  ccaattaagtggag----------aggcatcagatcaagtaattatgtgcat--------a--aa-----
B D       Crab-eating macaque  ccaattaagtggag----------aggcatcagatcaagtaattatgtgcat--------a--aa-----
B D                    Baboon  ccaattaagtggag----------aggcatcagatcaagtaattatgtgcat--------a--aa-----
B D              Green monkey  ccaattaagtggag----------aggcatcagatcaagtaattatgtgcat--------a--aa-----
B D                  Marmoset  ctgattgagtggag----------aggcatcggatctagtaattatgtgcat--------a--aa-----
B D           Squirrel monkey  ctgactgagtggag----------aggcatcggatcaagtaatcacatgcat--------a--aa-----
B D                  Bushbaby  acatttcagtggag----------caaaatcaaatgaagtaattgattgtat------c-a--ag-----
           Chinese tree shrew  ttgacccagtggtc----------tgacg-cagaataaatcattatttgcag--------g--aatgaat
B D                  Squirrel  ctgattcaggggaa----------tgacagcaagtcaggtaattatttgcag--------g--aa-----
       Lesser Egyptian jerboa  ctgatatggtggca----------cggcagcaagtcaggtcattgtcggcag--------c--aa-----
B D                       Rat  ctggctcagtggag----------tggcagctggtcaggtcatcacc-acag--------c--ac-----
B D            Naked mole-rat  ctgattcaggggag----------tgatggtgaatcgagtaattatttgcag--------c--aa-----
B D                Guinea pig  atggttcagaacac----------tgatggtgatttgagtaatta-ttacag--------c--aa-----
                   Chinchilla  ctgattcagaacag----------tgatggtgaatcgagtaattatttgcag--------c--ta-----
             Brush-tailed rat  ctgattcaggacag----------tgatggtgaatcaagtaattatttgccg--------c---------
B D                    Rabbit  ctggctcagtggaa----------cgacagagaa-cagggagtcatttccag--------a--aa-----
B D                       Pig  ctgattcagtggca----------tgacatcaaatcaagtaattgtttggaa--------a--aa-----
B D                    Alpaca  ctgattgagtgcaa----------ggacatcaaatcaactaattatttgcag------c-a--aa-----
               Bactrian camel  ctgatttagtgcaa----------ggacatcaaatcaactaattatttgcag------c-a--aa-----
B D                   Dolphin  ctggttcagtggtg----------tgac-----atcaagtaattatttgcag------caa--aa-----
                 Killer whale  ctggttcagtggtg----------tgac-----atcaagtaattatttgcag------caa--aa-----
             Tibetan antelope  gtgattcagtggca----------tgacatcaaatcaagtaattatttgcag------c-a--aa-----
B D                       Cow  ctgattcagtggca----------tgacatcaaatcaagtagttatttgcag------c-a--aa-----
B D                     Sheep  gtgattcagtggca----------tgacatcaaatcaagtaattatttgcag------c-a--aa-----
                Domestic goat  gtgattcagcggca----------cgacatcaaatcaagtaattatttgcag------c-a--aa-----
B D                     Horse  ctgactcaagggaa----------tgacagcacatcaagtaatcatttgccg------caa--aa-----
B D          White rhinoceros  ctgactcaagggag----------caacagcaaatcaagtaattatttgcag------caa--aa-----
B D                       Cat  ccg-ttcagtcgag----------tgacatcgaatcaagtcattgttggcag------caa--cg-----
B D                   Ferret   ctgactcaaggcag----------tgacatcaactcaagtgattctttgcag------caa--aa-----
B D                     Panda  ctgcttcagtggag----------tgacatcaaatcaagtcattctttgcagaaaaaaaaa--aa-----
               Pacific walrus  ctgattcagaggag----------tgacatcaaatcaagcaattctttgcag------caa--aa-----
                 Weddell seal  ctgattcagaggag----------tgacatcaaatcaaggaattctttgcag------caa--aa-----
             Black flying-fox  cggattcagtgcagtgacatgaaatgacatcaaatcgggtaattatttgcag------tga--aa-----
B D                   Megabat  cggattcagtgcagtgacatgaaatgacatcaaatcgggtaattatttgcag------cga--aa-----
                Big brown bat  ctgggtccgcgcag----------tgacagcaaatcaagtaattatttgcag------caa--aa-----
         David's myotis (bat)  ctgggttcctgcag----------tgacagcaaatcaagtaattattcgcag------caa--aa-----
B D                  Microbat  ctgggttcgtgcag----------tgacagcaaatcaagtaattattcgcag------caa--aa-----
B D                     Shrew  -------agtggag----------tgacgcagaattgagtaact--------------t-----------
B D                  Elephant  ccgattca-ccgag----------tgacaccaaatcaagcaattccttgcag--------c--aa-----
          Cape elephant shrew  ctga-cca-tggag----------tgacatcagatcacgtcat---ttgcat--------c--aa-----
B D                   Manatee  ccgatgca-cggag----------taactac---------------tggcag--------c--aa-----
             Cape golden mole  gggattca-cagcg----------tg----cgtgtcaagtcatctcttgagg--------c--aa-----
B D                 Armadillo  ctgagtcagtggag----------tgacagcaaatcgagtagttattggcag--------ccaaa-----
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Dog  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
                    Aardvark  ======================================================================

                        Human  --------------------aa---------------------------------------a--tac---
                        Chimp  --------------------aa---------------------------------------a--tac---
                      Gorilla  --------------------aa---------------------------------------a--tac---
                    Orangutan  --------------------aa---------------------------------------a--tac---
                       Gibbon  --------------------aa---------------------------------------a--tac---
                       Rhesus  --------------------aa---------------------------------------a--tac---
          Crab-eating macaque  --------------------aa---------------------------------------a--tac---
                       Baboon  --------------------aa---------------------------------------a--tac---
                 Green monkey  --------------------aa---------------------------------------a--tac---
                     Marmoset  --------------------aa---------------------------------------a--ttc---
              Squirrel monkey  --------------------aa---------------------------------------a--tac---
                     Bushbaby  --------------------aa---------------------------------------a--tag---
           Chinese tree shrew  gaatgaatgaatgaataaatga---------------------------------------a--tac---
                     Squirrel  --------------------aa---------------------------------------c--a-----
       Lesser Egyptian jerboa  --------------------ag---------------------------------------t--aat---
                          Rat  --------------------aa---------------------------------------c--aat---
               Naked mole-rat  --------------------aa---------------------------------------a--aaaaac
                   Guinea pig  --------------------ag---------------------------------------a--aaa---
                   Chinchilla  --------------------ag---------------------------------------a--act---
             Brush-tailed rat  -------------------------------------------------------------a--aat---
                       Rabbit  --------------------aa---------------------------------------g--aca---
                          Pig  --------------------aa---------------------------------------a--tac---
                       Alpaca  --------------------aa---------------------------------------aatcac---
               Bactrian camel  --------------------aa---------------------------------------aattac---
                      Dolphin  --------------------aa---------------------------------------a--tac---
                 Killer whale  --------------------aa---------------------------------------a--tac---
             Tibetan antelope  --------------------aa---------------------------------------a--tac---
                          Cow  --------------------aa---------------------------------------a--tac---
                        Sheep  --------------------aa---------------------------------------a--tac---
                Domestic goat  --------------------aa---------------------------------------a--tac---
                        Horse  --------------------at---------------------------------------a--tac---
             White rhinoceros  --------------------aa---------------------------------------a--tac---
                          Cat  --------------------aa---------------------------------------a--cac---
                      Ferret   --------------------cc---------------------------------------c--cac---
                        Panda  --------------------aa---------------------------------------a--cgc---
               Pacific walrus  --------------------aa---------------------------------------c--cac---
                 Weddell seal  --------------------aa---------------------------------------a--cac---
             Black flying-fox  --------------------ta---------------------------------------a--tag---
                      Megabat  --------------------ta---------------------------------------a--tag---
                Big brown bat  --------------------aa---------------------------------------a--tac---
         David's myotis (bat)  --------------------aatgagaacacaaagctcatattgttcctggcacatcattta--tgc---
                     Microbat  --------------------a----------------------------------------a--tgc---
                        Shrew  --------------------aa---------------------------------------a--tac---
                     Elephant  --------------------aa---------------------------------------a--tat---
          Cape elephant shrew  --------------------aa---------------------------------------a--tac---
                      Manatee  --------------------aa---------------------------------------a--cag---
             Cape golden mole  --------------------ag---------------------------------------a--cag---
                    Armadillo  --------------------aa---------------------------------------a--tac---
                         Pika  ======================================================================
                        Mouse  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                          Dog  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Aardvark  ======================================================================

                        Human  -------------------a-aatacacatctcatgttt-------------tt-cctggcac
                        Chimp  -------------------a-aatacacatctcatgttt-------------tt-cctggcac
                      Gorilla  -------------------a-aatacacatctcatgttt-------------tt-cctggcac
                    Orangutan  -------------------a-aatacacatctcatgttt-------------tt-cctggcac
                       Gibbon  -------------------a-aatacacacctcatgttg-------------tt-cctggcac
                       Rhesus  -------------------a-aatacacatctcatgttg-------------tt-cctggcac
          Crab-eating macaque  -------------------a-aatacacatctcatgttg-------------tt-cctggcac
                       Baboon  -------------------a-aatacacatctcatgttg-------------tt-cctggcac
                 Green monkey  -------------------a-aatacacatctcatgttg-------------tt-cctggcac
                     Marmoset  -------------------a-aacacaaaacttaggttg-------------ct-cctggcac
              Squirrel monkey  -------------------a-aacacaaaactcaggttg-------------ct-cctggcac
                     Bushbaby  -------------------a-aacacaaagctcatgtta-------------tt-tctggcac
           Chinese tree shrew  -------------------a-aacacaaagctcacattg-------------tt-cctggcac
                     Squirrel  ---------------------aacacaaagctc---atg-------------tt-tctgacac
       Lesser Egyptian jerboa  -------------------ataacacaaagctt---gtg-------------ct-cctgacac
                          Rat  -------------------a-ggctcaaagccca-ggtg-------------ttccctggtgc
               Naked mole-rat  caaaccaaaaaaacccctca-caaacaaagctcatgttg-------------ct-cctgacac
                   Guinea pig  -----------------------aaaaaagctcatattg-------------ct-cctgttac
                   Chinchilla  -------------------a-c-aacaaagctcatgttg-------------ct-cctgacac
             Brush-tailed rat  -------------------a-caaaccaagctcacggtg-------------ct-cctgacac
                       Rabbit  ------------------ca-aacaccaaactcgcggtg-------------tt-cctggccg
                          Pig  -------------------a-aaaacaaagctcatg----------------tt-cctggcac
                       Alpaca  -------------------c-aaaacaaagctcatgttg-------------tt-cctggcac
               Bactrian camel  -------------------c-aaaacaaagctcatgttg-------------tt-cctggcac
                      Dolphin  -------------------g-aaaacaaagctcatgttg-------------tt-cctggcac
                 Killer whale  -------------------a-aaaacaaagctcatgttg-------------tt-cctggcac
             Tibetan antelope  -------------------a-aaaacaaagctcatgttgttcctggcaaacctt-cctggcac
                          Cow  -------------------a-aaaacaaagctcatgttgttcctgacaaacctt-cctggcac
                        Sheep  -------------------a-aaaccaaagctcatgttgttcctggcaaacctt-cctggcac
                Domestic goat  -------------------a-gaaacaaagctcatgttgttcctggcaaacctt-cctggcac
                        Horse  -------------------a-agcacaaagcacacgttg-------------tt-cctggcac
             White rhinoceros  -------------------a-aacacaaagcacatattg-------------tt-cctggcac
                          Cat  -------------------a-aacagaaagcccgtgtgg-------------tt-cccggcac
                      Ferret   -------------------a-aacacaaggctcatgttg-------------tt-cctggcgc
                        Panda  -------------------a-aacacaaagctcacgttg-------------tt-cctggcac
               Pacific walrus  -------------------a-aacacaaagctcccattg-------------tt-cctggcac
                 Weddell seal  -------------------a-aacacaaagctcacattg-------------tt-cctggcac
             Black flying-fox  -------------------a-aagacaaagctcatgtcg-------------tt-cctggcac
                      Megabat  -------------------a-aagacaaagctcatgtcg-------------tt-cctggcac
                Big brown bat  -------------------g-aacacaaagctcatgttg-------------tt-cctggcac
         David's myotis (bat)  -------------------g-aacacaaagctcatattg-------------tt-cctggcac
                     Microbat  -------------------g-aacacaaagctcatgttg-------------tt-cctggcac
                        Shrew  -------------------a-aacacaaagttcat-ttg-------------tt-cctggcac
                     Elephant  -------------------a-aacccaaagcccctgttg-------------tt-tctgacac
          Cape elephant shrew  -------------------c-aagacaaagcccgtgtta-------------tt-tctgtcac
                      Manatee  -------------------a-aacacaaagcctgtgttg-------------tt-cccggcac
             Cape golden mole  -------------------a-aa--caaagaccatgccc-------------ct-cctggcac
                    Armadillo  -------------------t-aacacaaagctcatgttg-------------tt-cctagcac
                         Pika  ===============================================================
                        Mouse  ===============================================================
                 Prairie vole  ===============================================================
              Chinese hamster  ===============================================================
               Golden hamster  ===============================================================
                       Tenrec  ===============================================================
                          Dog  ===============================================================
                   Coelacanth  ===============================================================
                       Lizard  ===============================================================
     Chinese softshell turtle  ===============================================================
               Painted turtle  ===============================================================
              Green seaturtle  ===============================================================
                       Turkey  ===============================================================
                      Chicken  ===============================================================
                 Mallard duck  ===============================================================
                Scarlet macaw  ===============================================================
                       Parrot  ===============================================================
                   Budgerigar  ===============================================================
           Tibetan ground jay  ===============================================================
                  Zebra finch  ===============================================================
          Medium ground finch  ===============================================================
       White-throated sparrow  ===============================================================
          Collared flycatcher  ===============================================================
             Peregrine falcon  ===============================================================
                 Saker falcon  ===============================================================
                  Rock pigeon  ===============================================================
                      Wallaby  ===============================================================
           American alligator  ===============================================================
                      Opossum  ===============================================================
              Tasmanian devil  ===============================================================
                     Aardvark  ===============================================================

Inserts between block 31 and 32 in window
            Cape golden mole 744bp

Alignment block 32 of 885 in window, 68736662 - 68736699, 38 bps 
B D                     Human  accgtttacaatagagaaata--ttt-tgtaa--c-------------att----------c-aaaa
B D                     Chimp  accgtttacaatagagaaata--ttt-tgtaa--c-------------att----------c-aaaa
B D                   Gorilla  accgtttacaatagagaaata--ttt-tgtaa--c-------------att----------c-aaaa
B D                 Orangutan  actgtttacaatagagaaata--ttt-tgtaa--c-------------att----------c-aaaa
B D                    Gibbon  accgtttacaatagagaaata--ttt-tgtaa--c-------------ctt----------c-aaaa
B D                    Rhesus  accacttacaatagagaaatc--ttt-tgtaa--c-------------ctt----------c-aaaa
B D       Crab-eating macaque  accacttacaatagagaaatc--ttt-tgtaa--c-------------ctt----------c-aaaa
B D                    Baboon  accatttacaatagagaaatc--ttt-tgtaa--c-------------ttt----------c-aaaa
B D              Green monkey  accatttacaatagagaaatc--ttt-tgtaa--c-------------ctt----------c-aaaa
B D                  Marmoset  attgtttacaatagagaaata--ttt-cgtaa--cctgcataatc--actt----------c-aaaa
B D           Squirrel monkey  attgtttacaatagagaaatc--ttt-tgtaa--tgtgcataatc--actt----------a-aaaa
B D                  Bushbaby  atcatttataatagaaaaatc--ttt-tttaa--cttgcataatt--actt----------c-aaaa
           Chinese tree shrew  atcatttgtaatagaaaa-----ctt-tataa--atcccatgatt--actt----------c-aaaa
B D                  Squirrel  atcctttaaa-cagggaaagc--ttc-tgtgg--cccgcgcgatt--acct----------c-gaag
       Lesser Egyptian jerboa  actgtttatg--aggaaaatc--att-tgtga--ccagcatgagttaattt----------c-aaat
B D                       Rat  atcctctagg--agagggaac--gtt-tttgggccctgcagaattttattt----------a-aa--
B D            Naked mole-rat  atcacgtataatgagaaaagc--ttt-tgtat--cttgcataatt--actt----------c-aaaa
B D                Guinea pig  atcacttataatgagaacagc--ttt-tgtat--cttgcataagt--actt----------c-aaaa
                   Chinchilla  atcacttatgatgagaaaagc--ttt-tgtat--cttgcataatt--a-tt----------c-aaaa
             Brush-tailed rat  gtcacttataatgagaaaagc--ttt-tatat--cttgcataatt--actt----------c-aaaa
B D                    Rabbit  atgatctgta--gcagaaaac--cct-tgcaa--ctcgcacaact--ccgc----------c-aaaa
B D                       Pig  atcatttataatagaaaaata--ttt-tatga--c-------------ctg----------c-ataa
B D                    Alpaca  atcatttataatagagaaata--gct-tatga--t-------------ctg----------c-gtaa
               Bactrian camel  atcatttataatagagaaata--ttt-tatga--c-------------ctg----------c-gtaa
B D                   Dolphin  atcatttataatagaaaaata--ttt-tatga--c-------------ctg----------c-ataa
                 Killer whale  atcacttataatagaaaaata--ttt-tatga--c-------------ctg----------c-ataa
             Tibetan antelope  atcatttataatagaaaaata--ttt-tatgg--c-------------ctg----------c-ataa
B D                       Cow  atcatttataatagaaaaata--ttt-tatgg--c-------------ctg----------c-ataa
B D                     Sheep  atcatttataatagaaaaata--ttt-tatgg--c-------------ctg----------c-ataa
                Domestic goat  atcatttataatagaaaaata--ttt-tatgg--c-------------ctg----------c-ataa
B D                     Horse  atcatttataacagaaaaata--ttt-tatga--c-------------ctg----------c-acgg
B D          White rhinoceros  atcatttacaatagaaaaaca--ttt-tataa--c-------------cca----------c-ataa
B D                       Cat  atcatttgcaagggaagaata--tttgtagga--c-------------ccg----------c-acag
B D                   Ferret   ttcatttagaagagaaaaatgttttt-taaga--c-------------ccg----------c-gtaa
B D                     Panda  accatttataagagaaaagta--ttt-tacga--c-------------ctg----------caataa
               Pacific walrus  agcatttataagagaaaaata--ttt-tatga--c-------------ctg----------c-acag
                 Weddell seal  atcatttataagagaaaaata--ttt-tatga--c-------------ctg----------c-atag
             Black flying-fox  atcatttacaatagaaaaacc--ttt-tatga--c-------------ctg----------c-ataa
B D                   Megabat  atcgtttacgatagaaaaacc--ttt-tatga--c-------------ctg----------c-ataa
                Big brown bat  atcattcataacagaaacatc--tgt-tatga--c-------------ctg----------t-acaa
         David's myotis (bat)  atcatttataacagaaa-att--ggt-tgtga--c-------------ctg----------t-ataa
B D                  Microbat  atcatttataacagaaa-att--ggt-tatga--c-------------ctg----------t-ataa
B D                     Shrew  ataatttgta--ggaaaaatc--gct-tgcaa--c-------------ttgatgatcacttc-aaaa
B D                  Elephant  atcaattataatggaaaaatc--ctt-tacaa--tctgaataatta--ctt----------c-aaaa
          Cape elephant shrew  gccagtta----gaacagatt--ctc-agcga--ccagcatcatta--ctt----------c-aaaa
B D                   Manatee  gtcagcaataacggaaaaatc--ctt-tacaa--cctgaatgatta--ctt----------c-aaaa
B D                 Armadillo  ttcagttacaacagaaaaatc--ctt-tacaa--tctgcatcattt--ctt----------c-aaaa
B D                      Pika  ===================================================================
B D                     Mouse  ===================================================================
                Prairie vole  ===================================================================
B D           Chinese hamster  ===================================================================
              Golden hamster  ===================================================================
B D                    Tenrec  ===================================================================
B D                       Dog  ===================================================================
B D                Coelacanth  ===================================================================
B D                    Lizard  ===================================================================
  D  Chinese softshell turtle  ===================================================================
  D            Painted turtle  ===================================================================
  D           Green seaturtle  ===================================================================
B D                    Turkey  ===================================================================
B D                   Chicken  ===================================================================
  D              Mallard duck  ===================================================================
  D             Scarlet macaw  ===================================================================
  D                    Parrot  ===================================================================
B D                Budgerigar  ===================================================================
          Tibetan ground jay  ===================================================================
B D               Zebra finch  ===================================================================
B D       Medium ground finch  ===================================================================
  D    White-throated sparrow  ===================================================================
  D       Collared flycatcher  ===================================================================
  D          Peregrine falcon  ===================================================================
  D              Saker falcon  ===================================================================
  D               Rock pigeon  ===================================================================
B D                   Wallaby  ===================================================================
B D        American alligator  ===================================================================
B D                   Opossum  ===================================================================
B D           Tasmanian devil  ===================================================================
            Cape golden mole  ===================================================================
                    Aardvark  ===================================================================

Inserts between block 32 and 33 in window
B D                      Cow 25bp
B D                    Horse 11bp
B D         White rhinoceros 11bp
B D                      Cat 11bp
B D                  Ferret  11bp
B D                    Panda 11bp
              Pacific walrus 11bp
                Weddell seal 11bp
            Black flying-fox 11bp
B D                  Megabat 7bp
               Big brown bat 11bp
        David's myotis (bat) 11bp
B D                 Microbat 11bp

Alignment block 33 of 885 in window, 68736700 - 68736700, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  g
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                     Shrew  t
B D                  Elephant  t
          Cape elephant shrew  c
B D                   Manatee  t
B D                 Armadillo  t
B D                      Pika  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  -
B D           Chinese hamster  =
              Golden hamster  =
B D                    Rabbit  -
      Lesser Egyptian jerboa  -
B D                    Tenrec  =
               Big brown bat  =
B D                       Cow  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                       Dog  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  =

Inserts between block 33 and 34 in window
            Tibetan antelope 8bp
B D                    Sheep 8bp
               Domestic goat 11bp
B D                    Shrew 5bp

Alignment block 34 of 885 in window, 68736701 - 68736720, 20 bps 
B D                     Human  aaa----gaaaaacatgtgactga
B D                     Chimp  aaa----gaaaaac--gtgactga
B D                   Gorilla  aaa----gaaaaacatgtgactga
B D                 Orangutan  aaa----gaaaaacatgtgactga
B D                    Gibbon  aaa----gaaaaacatgtgactga
B D                    Rhesus  aaa----gaaaaacatgtgactga
B D       Crab-eating macaque  aaa----gaaaaacatgtgactga
B D                    Baboon  aaa----gaaaaacatgtgactga
B D              Green monkey  aaa----gaaaaacatgtgactga
B D                  Marmoset  aaa----gaaaaac--gtgactaa
B D           Squirrel monkey  aaa----gaaaaac--gcaactaa
B D                  Bushbaby  aaa----gaaaaa-----------
           Chinese tree shrew  aaa----ggaaaacatgtggctta
B D                  Squirrel  gaa----gagaagtgtgtggctgg
       Lesser Egyptian jerboa  ---------aaagcatgtcactaa
B D                       Rat  ---------aaatgaagacagcac
B D            Naked mole-rat  aaa----gaaaaatgtgtgac---
B D                Guinea pig  aaa----gaaagacacatggc---
                   Chinchilla  aaa----gaaaaatatgtcac---
             Brush-tailed rat  aaa----gaaaaatttgtgat---
B D                       Pig  -------------tacttcaca--
B D                    Alpaca  -------------tacttcaca--
               Bactrian camel  -------------tacttcaca--
B D                   Dolphin  -------------tccttcaca--
                 Killer whale  -------------tccttcaca--
B D                     Horse  aaa----g--aaatatgtgaccac
B D          White rhinoceros  aaa----gaaaaatgtgtgactga
B D                       Cat  aga----gaaagatacatgactgc
B D                   Ferret   aaa----gaaaactatgtgacc--
B D                     Panda  aaa----gaaaaatatgtgactga
               Pacific walrus  aaa----gaaaaacatgtgactga
                 Weddell seal  aaa----gaaaaatatgtgactga
             Black flying-fox  aca----gaaaagtaggtgactga
B D                   Megabat  aca----gaaaagtaggtgactga
                Big brown bat  --a----aaggagactgtg-ctga
         David's myotis (bat)  --a----aaggagactgtg-ctga
B D                  Microbat  --a----aaggagactgtg-ctga
B D                     Shrew  aaa----gcaaaatac--------
B D                  Elephant  aaa---------------------
          Cape elephant shrew  aaagggggaa------gtgacta-
B D                   Manatee  aaa----gaa---cctgtgactga
B D                 Armadillo  aaa----gaaaaacatgtggccaa
B D                      Pika  ========================
B D                     Mouse  ========================
                Prairie vole  ========================
B D           Chinese hamster  ========================
              Golden hamster  ========================
B D                    Rabbit  ------------------------
B D                    Tenrec  ========================
B D                       Cow  ========================
               Domestic goat  ========================
B D                     Sheep  ========================
            Tibetan antelope  ========================
B D                       Dog  ========================
B D                Coelacanth  ========================
B D                    Lizard  ========================
  D  Chinese softshell turtle  ========================
  D            Painted turtle  ========================
  D           Green seaturtle  ========================
B D                    Turkey  ========================
B D                   Chicken  ========================
  D              Mallard duck  ========================
  D             Scarlet macaw  ========================
  D                    Parrot  ========================
B D                Budgerigar  ========================
          Tibetan ground jay  ========================
B D               Zebra finch  ========================
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
  D       Collared flycatcher  ========================
  D          Peregrine falcon  ========================
  D              Saker falcon  ========================
  D               Rock pigeon  ========================
B D                   Wallaby  ========================
B D        American alligator  ========================
B D                   Opossum  ========================
B D           Tasmanian devil  ========================
            Cape golden mole  ========================
                    Aardvark  ========================

Inserts between block 34 and 35 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Panda 59bp
B D                    Shrew 5bp

Alignment block 35 of 885 in window, 68736721 - 68736741, 21 bps 
B D                     Human  ttgaaa--ataatctagtataga
B D                     Chimp  ttgaaa--aaaatctagtataga
B D                   Gorilla  ttgaaa--aaaatctagtataga
B D                 Orangutan  ttgaaa--aaaatctaaaataga
B D                    Gibbon  ttgaaa--aaaatctagtataga
B D                    Rhesus  ttgaaa--aaaatctagtataga
B D       Crab-eating macaque  ttgaaa--aaaatctagtataga
B D                    Baboon  ttgaaa--aaaatctagtataga
B D              Green monkey  ttgaaa--aaaatctagtataga
B D                  Marmoset  ttgaaa--aaagtctagtataga
B D           Squirrel monkey  ttg-aa--aaagtctagtataga
B D                  Bushbaby  ------------tctagtatagc
           Chinese tree shrew  ttg-aa--taaacctagaataaa
B D                  Squirrel  ttg-ag--aaaacctaatatg--
       Lesser Egyptian jerboa  atg-ag--aaaacttaacaga--
B D                       Rat  gtg-agacaaagtctaataga--
B D            Naked mole-rat  -tc-ag--aaaatctaatataga
B D                Guinea pig  -tg-ag--aaaatctaatataga
                   Chinchilla  -tg-ag--aaaatctaatataga
             Brush-tailed rat  -tg-ga--aaaatctaatacaga
B D                       Pig  taa-ag--aaaacctagcagata
B D                    Alpaca  taa-ag--aaaacctcata----
               Bactrian camel  tca-ag--aaaacctcata----
B D                   Dolphin  tag-ag--aaaacctagtagaga
                 Killer whale  tag-ag--aaaacctagtagaga
                Domestic goat  -ac-ag--aaaacct-ttagaga
B D                     Horse  ttg-ag--aaaacctagcagaga
B D          White rhinoceros  ttg-ag--aaaacgtagtagaga
B D                       Cat  tgg-ag--caaacctaggagagc
B D                   Ferret   --g-ag--aaaaccgaggcgggc
               Pacific walrus  -----g--aaaaccaagtagagt
                 Weddell seal  -----g--aaaaccaagtagagt
             Black flying-fox  ttg-ag--gaaa-----------
B D                   Megabat  ttg-ag--gaaacctagc-----
                Big brown bat  gtg-ag--aaaacctggcagagg
         David's myotis (bat)  gtg-ag--aaaacctggtagagg
B D                  Microbat  gtg-ag--aaaacctggtagagg
B D                     Shrew  ctg-gt--aaggaggaggagagg
B D                  Elephant  --g-aa--aaatactc-------
          Cape elephant shrew  -gg-ag--aaaggctcgtccaga
B D                   Manatee  cgg-ag--aagatctagtctaga
B D                 Armadillo  ttg-ag--caaacctagtaaata
B D                      Pika  =======================
B D                     Mouse  =======================
                Prairie vole  =======================
B D           Chinese hamster  =======================
              Golden hamster  =======================
B D                    Rabbit  -----------------------
B D                    Tenrec  =======================
B D                     Panda  =======================
B D                       Cow  =======================
B D                     Sheep  =======================
            Tibetan antelope  =======================
B D                       Dog  =======================
B D                Coelacanth  =======================
B D                    Lizard  =======================
  D  Chinese softshell turtle  =======================
  D            Painted turtle  =======================
  D           Green seaturtle  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
  D<