Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 423 in window, 86932880 - 86932880, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  -
B D       Crab-eating macaque  -
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  -
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  -
B D                       Rat  a
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  -
B D                       Pig  -
B D                    Alpaca  -
               Bactrian camel  -
B D                   Dolphin  -
                 Killer whale  -
             Tibetan antelope  -
B D                       Cow  -
B D                     Sheep  -
                Domestic goat  -
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Wallaby  t
B D                  Microbat  =
        David's myotis (bat)  =
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  =
B D                   Opossum  =

Inserts between block 1 and 2 in window
                Prairie vole 3bp
B D          Chinese hamster 5bp
              Golden hamster 5bp
B D                      Rat 123bp

Alignment block 2 of 423 in window, 86932881 - 86932891, 11 bps 
B D                     Human  tctggtc--------ttga
B D                     Chimp  tctggtc--------ttga
B D                   Gorilla  tctggtc--------ttga
B D                 Orangutan  tctggtc--------ttga
B D                    Gibbon  tctggtc--------ttga
B D                    Rhesus  tctggtc--------ttga
B D       Crab-eating macaque  tctggtc--------ttga
B D                    Baboon  tctggtc--------ttga
B D              Green monkey  tctggtc--------ttga
B D                  Marmoset  tctggtc--------ttga
B D           Squirrel monkey  tctggtc--------ttga
B D                  Bushbaby  ------c--------tcaa
           Chinese tree shrew  tctggac--------ttga
B D                  Squirrel  tttgggc----ttga----
       Lesser Egyptian jerboa  tctgggcttga--------
                 Prairie vole  ---gtgc------------
B D           Chinese hamster  --tgtga------------
               Golden hamster  ---gtgc------------
B D                     Mouse  -----gc------------
B D            Naked mole-rat  tctgggc--------ttga
B D                Guinea pig  tcagtgc--------ttga
                   Chinchilla  ttggggc--------ttga
             Brush-tailed rat  tctgggc--------ttgc
B D                    Rabbit  -tcgtga------------
B D                       Pig  --tgggc--------ttga
B D                    Alpaca  --tgggc--------ttgg
               Bactrian camel  --tgggc--------ttga
B D                   Dolphin  --tgggc--------ttga
                 Killer whale  --tgggc--------ttga
             Tibetan antelope  --tgggc--------ttga
B D                       Cow  --tgggc--------ttga
B D                     Sheep  --tgggc--------ttga
                Domestic goat  --tgggc--------ttga
B D                     Horse  tctgggc--------ttga
B D          White rhinoceros  tctgggc--------ttga
B D                       Cat  tttgagc--------ttgg
B D                       Dog  tctgggc--------ttga
B D                   Ferret   tctgggc--------ttga
B D                     Panda  tctgggc--------ttga
               Pacific walrus  tctgggc--------ttga
                 Weddell seal  tctgggc--------ttga
             Black flying-fox  gttggtc--------ttga
B D                   Megabat  gttggtc--------ttga
B D                  Hedgehog  tctggga--------tcac
              Star-nosed mole  tctgggc--------tgga
B D                  Elephant  tttggac--------ttga
          Cape elephant shrew  tctgagc--------ttga
B D                   Manatee  tctgtgt--------ttga
             Cape golden mole  tcttggc--------ttga
B D                    Tenrec  tctgggt--------ttga
                     Aardvark  tctgggc--------ttga
B D                 Armadillo  tctgggc--------ctga
B D                   Wallaby  tttagat--------ctga
B D                       Rat  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
  D               Rock pigeon  ===================
B D        American alligator  ===================
  D              Mallard duck  ===================
  D       Collared flycatcher  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
  D  Chinese softshell turtle  ===================
          Tibetan ground jay  ===================
B D                Budgerigar  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D                    Parrot  ===================
B D       Medium ground finch  ===================
  D    White-throated sparrow  ===================
B D               Zebra finch  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D                  Platypus  ===================
B D                   Opossum  ===================

Alignment block 3 of 423 in window, 86932892 - 86932948, 57 bps 
B D                     Human  ctgtctgtgagagccttcctggtggaaacagaattgttagtc-agctgtcatctccat
B D                     Chimp  ctgcctgtgagagccttcctggtggaaacagaattgttagtc-agctgtcatctccat
B D                   Gorilla  ctgcctatgagagccttcctggtggaaacagaatcgttagtc-agctgtcatctccat
B D                 Orangutan  ctgcctatgagagccttcctggtggaaacagaattgtgagtc-agctgtcatctccat
B D                    Gibbon  ctgcctatgagagccttcctggtggaaacagaattgttaggc-agctgtcgtctccat
B D                    Rhesus  ctgcctatgagagccttccttgtggaaacagaattgttagtc-agctgtcgtctccat
B D       Crab-eating macaque  ctgcctatgagagccttccttgtggaaacagaattgttagtc-agctgtcgtctccat
B D                    Baboon  ctgcctatgagagccttccttgtggaaacagaattgttagtc-agctgtcgtctccat
B D              Green monkey  ctgcctatgagagccttccttgtggaaacagaattgttagtc-agctgtcgtctccat
B D                  Marmoset  ctgtctatgagagccttccgggtgaaaacagaattgttagtc-agctgtcgtctccat
B D           Squirrel monkey  ctgtctatgagagccttctgggtgaaaacagaattgttagtc-agctgtcgtctccat
B D                  Bushbaby  ctgcctaggagagccttcctggtagaaacagaattgttagtc-agttgtggtctccat
           Chinese tree shrew  ctgtcta-gagagccttcttggtagaaacag-attattagtc-agctatggtatccat
B D                  Squirrel  ctgtgtataagaggcttcctggtggaagcagaattgttagtc-agctatggtctccat
       Lesser Egyptian jerboa  ctgtgtaggagaggcttcctagtggaaaccaaattgttagat-agctgtggtctccat
                 Prairie vole  ctgtgtaggaggaccttcccagtggagacagaattattagtcgggctatggtctccat
B D           Chinese hamster  ctgtgtaggagggcctttccagtagagacagaattgttagtc-ggctatggtctccat
               Golden hamster  ctgtgtaggagggcttttccagtagagtcagaattgttagtc-ggctatggtctccat
B D                     Mouse  ctgtgtaggagggccttcccagtggagacagaattgttagtc-agctacggtctccat
B D                       Rat  ctgtgtaggagggccttcccagaggagacagaattgttagtc-agctatggtctccat
B D            Naked mole-rat  ttgtgtatgagagccttcctgatggaaacagcattattaggc-agctatggtctccat
B D                Guinea pig  ctatatatgaaagccagcctgatggaagcagaattgttaggc-agatatggtctccat
                   Chinchilla  ctgtatatgagctcccgcct----gaaacagaactgttaggc-agatatggtctccat
             Brush-tailed rat  ctatatatgagagcctgcctgatggaaacagaattgttaggc-agatatggtctccat
B D                    Rabbit  --------aggggcctccctggtgca---aggcttgttcgt--ggctacagtatccat
B D                       Pig  ctgtctatgagagacttcctggtggaaatgaaattgttagtc-agctatggtctccat
B D                    Alpaca  ctgtctatgagcgagttcctggtggaaaggaaattattagtc-tgctgtggtctccat
               Bactrian camel  ctgtctatgagagacttcctggtggaaaggaaattattagtc-cgctgtggtctccat
B D                   Dolphin  c----taagagagaattcctggtggaaatgaaattgttagtc-agctatggtctccat
                 Killer whale  c----taagagagaattcctggtggaaacgaaattgttagtc-agctatggtctccat
             Tibetan antelope  ctgtctgtgagagacttcctggtggaaacaaaattgtt-----agctatggtctccat
B D                       Cow  ctctctatgagagacttcctggtggaaacaaaattgtt-----agctatggtctccat
B D                     Sheep  ctgtatatgagagacttcctggtggaaacaaaattgtt-----agctatggtctccat
                Domestic goat  ctgtctatgagagacttcctggtggaaacaaaattgtt-----agctatggtctccat
B D                     Horse  ctgtctatgagagatttcctggtggaaacagaattgttagtt-ctctatggtctccat
B D          White rhinoceros  ctgtctatgagagacttcctggtggaaacagaattgttagtt-agctgtggtctccat
B D                       Cat  ctgtctgcaagagccttcctggtggaaacagaattgttagtc-agttacagtctccat
B D                       Dog  ctgtctgtgagagccttcctggtggagatagaattgttagtc-agttacggtctccat
B D                   Ferret   ctgtctgcgagagccttcctggtggagacagaattgttagtc-agttacggtctccat
B D                     Panda  ctgtctttgagagccttcctggtggagacagacttgctagtc-agttatggtctccat
               Pacific walrus  ctggctgtgagaaccttcctggtggagacagaattgttagtc-agttacggtctccat
                 Weddell seal  ctggctgcgagaaccttcctggtggagac--aattgttagtc-agttacggtctccat
             Black flying-fox  ctgtctacgagtgccttcttggtggaagtagggttgttactt-agtgatggtctccat
B D                   Megabat  ctgtctacgagtgccttcttggtggaagtagggttgttactt-agtgatggtctccat
B D                  Hedgehog  tggcctcccagagccctccagagagaagcagaatccctagta-ggctgtggtcgccat
              Star-nosed mole  ccatccttgagagctctccttgtaacaacagaactgtgagtc-agctttggtctccat
B D                  Elephant  caatctatgagagtcttcctgataggaacagaattgttagtc-aactatggtctctgt
          Cape elephant shrew  caatctatgagagacttcctggtggaaacagaattgttagtc-aacgatggtgatcat
B D                   Manatee  caatctatgagagccttcctgatagaaacagaattgttagtc-aactgtggtctccat
             Cape golden mole  caatctctgagagccttcctaatgaaaagagaattgttggtc-aacgatagacaccat
B D                    Tenrec  caatctacgagagccttcctggtggaaacataattgttagat-caccatgatctccac
                     Aardvark  cagtctatgagagccttccttgtggaaacagaattgttagtc-aactatggtctccat
B D                 Armadillo  gagtctctgagagccttcctgacagaaacagagctgttcatc-aactatggtctccat
B D                   Wallaby  -tagctgtaaaagcttccttagtggaagtcttattgttgacc-aactttgatctcagt
B D                  Microbat  ==========================================================
        David's myotis (bat)  ==========================================================
  D               Rock pigeon  ==========================================================
B D        American alligator  ==========================================================
  D              Mallard duck  ==========================================================
  D       Collared flycatcher  ==========================================================
B D                    Turkey  ==========================================================
B D                   Chicken  ==========================================================
  D  Chinese softshell turtle  ==========================================================
          Tibetan ground jay  ==========================================================
B D                Budgerigar  ==========================================================
  D          Peregrine falcon  ==========================================================
  D              Saker falcon  ==========================================================
  D                    Parrot  ==========================================================
B D       Medium ground finch  ==========================================================
  D    White-throated sparrow  ==========================================================
B D               Zebra finch  ==========================================================
  D            Painted turtle  ==========================================================
  D           Green seaturtle  ==========================================================
B D                  Platypus  ==========================================================
B D                   Opossum  ==========================================================

Inserts between block 3 and 4 in window
            Cape golden mole 1371bp

Alignment block 4 of 423 in window, 86932949 - 86933033, 85 bps 
B D                     Human  ggtga------------tt--tttta-aggct---a-agtgtaagtcattcttctaaatattgaggcata
B D                     Chimp  ggtga------------tt--tttta-aggct---a-agtgtaagtcattcttctaaatattgaggcata
B D                   Gorilla  ggtga------------tt--tttta-aggct---a-agtgtaagtcagtcttctaaatattgaggcata
B D                 Orangutan  ggtga------------tt--tttta-aggct---c-agtgtaagtcagtcttctaaatattgaggcata
B D                    Gibbon  ggtga------------tt--tttta-aggct---a-agtgtaagtcaatcttctaaatattgaggcata
B D                    Rhesus  ggtga------------tc--tttta-aggtc---a-agtgtaagtcaatcttctaaatattgaggcata
B D       Crab-eating macaque  ggtga------------tc--tttta-aggtc---a-agtgtaagtcaatcttctaaatattgaggcata
B D                    Baboon  ggtga------------tc--tttta-aggtc---a-agtgtaagtcaatcttctaaatattgaggcata
B D              Green monkey  ggtga------------tt--tttta-aggtc---a-agtgtaagtcaatcttctaaatattgaggcata
B D                  Marmoset  ggtga-----------ttt--tttta-aggcc---a-agtttatgtcagccttctaaatattgaggcata
B D           Squirrel monkey  ggtga-----------ttt--tttta-aggcc---a-aggttatggcagccttctaaatattgaggcata
B D                  Bushbaby  ggtga------------tt-atatta-aggcc---a-agtttaagtcaatcttctgaatactgaggcata
           Chinese tree shrew  ggtga----------tttt--tttta-aggcc---a-agtttgaatcagttttctaaatattgaggcata
B D                  Squirrel  ggtga-----------ttttttttta-aggcc---a-agtttgaatcgattttctaaatattgaggtata
       Lesser Egyptian jerboa  ggtga------------tttttttaa-aggcc---a-agttagaatcaatcttctaaatattgaagtata
                 Prairie vole  ggtga------------tttttttaa-aggcc---a-agtttgaatcaatcttctaaatattgaggtata
B D           Chinese hamster  ggtga------------tttttttaa-aggcc---a-agtttgaatcaatcttctaaatattgaggtata
               Golden hamster  ggtga------------tttttttaa-aggcc---a-agtttgaatcaatcttctaaatattgaggtata
B D                     Mouse  ggtga------------tttttttaa-aggct---a-agtttgaatcagacttctaaatattgaagtata
B D                       Rat  ggtga------------tttttttaa-aggct---a-agtttgaatcagtcttctaaatattgaggtata
B D            Naked mole-rat  ggtga------------tt-ttttta-aggcc---a-agtttgaatcagtcttctaaatattgaggtaaa
B D                Guinea pig  ggtga------------tt------a-aggac---a-agtttaaatcaatcttctaagtactgaggttta
                   Chinchilla  ggtga------------tt-ttttaa-aggcc---a-agtttaaatcaatcctccaaatattgaggtaca
             Brush-tailed rat  ggtga------------ttattttaa-aggcc---a-agtttaaatcaatcttccaaatattgaggtata
B D                    Rabbit  ggtga------------tt-tcttta-aagcc---a-agcctgaatcaatcttataaatattgaggcatg
B D                       Pig  ggtga-----------ttt-ttttta-aggcc---a-agtttaaatcagtcttctaaatattgaagcata
B D                    Alpaca  ggtga------------tt-tttgta-agtct---a-agtttgaatcaatctcctaaatattgaggcata
               Bactrian camel  ggtga------------tt-tttgta-agtct---a-agtttgaatcagtctcctaaatattgaggcata
B D                   Dolphin  ggtga-----------ttt-ttttta-agacc---a-agtttgaatcagtcttctaaatattgaggcata
                 Killer whale  ggtga-----------ttt-ttttta-agacc---a-agtttgaatcagtcttctaaatattgaggcata
             Tibetan antelope  ggtga------------tt-ttttta-aggcc---a-agtttgagtcaatcttctaaatattgaggcata
B D                       Cow  ggtga------------tt-ttttta-aggcc---a-agtttgaatcaatcttctaaatattgaggcata
B D                     Sheep  ggtga------------tt-ttttta-aggcc---a-agtttgaatcaatcttctaaatattgaggcata
                Domestic goat  ggtga------------tt-ttttta-aggcc---a-agtttgaatcaatcttctaaatattgaggcata
B D                     Horse  ggtga-------------t-ttttta-aggcc---a-agtttgaatcagtcttctaaatattgaggcata
B D          White rhinoceros  ggtga------------tt-ttttta-aggcc---a-agtttgaatcaatctcctaaatattgaggcata
B D                       Cat  ggtga------------tt-ttttta-aggcg---a-agtttgaatcaatcttctaaacattgaggcata
B D                       Dog  ggtga------------tt-ttttta-aggca---a-agtttgaatcaatcgtctaaacatggaggcata
B D                   Ferret   ggtgatttttttttttttt-ttttta-gggta---a-agtttgattcaatcttctaaacattgaggcata
B D                     Panda  ggtga--------tttttt-ttttta-aggca---a-agtttgaatcaatcttctaaacattgaggcata
               Pacific walrus  ggtga------tttttttt-ttttta-aggcc---a-agtttgaatcaatcttctaaacatcgaggcata
                 Weddell seal  ggtga------tttttttt-ttttta-aggcc---a-agtttgaatcaatcttctaaacattgaggcata
             Black flying-fox  agtga------------ct-tttcta-aggcc---a-ggtttg-------catctaaagcttgaggcata
B D                   Megabat  agtga------------ct-tttcta-aggcc---a-ggtttg-------catctaaagattgaggcata
B D                  Hedgehog  ggtga-----------ttt-ttttta-aggcc---a-catttgaatcagtcttcaggatatcaaggcata
              Star-nosed mole  ggtga-------------t-ttttta-aggcc---a-cgtttgaatcaatcttctaaatattaaagcatc
B D                  Elephant  ggtaa------------tt-ttttta-aggcc---a-agtttgaagcagtcttctaaatcttgaggcata
          Cape elephant shrew  ggcaa------------ta-ttttta-aggcc---c-agtttaaattaatcttctaaatactgaggcaca
B D                   Manatee  ggtaa------------tt-tttttg-atacc---a-agtttgaatcaatcttctaaatattgaggcata
B D                    Tenrec  agtaa------------tt-cttcaa-aggcc---agattttaagtcagtcttctaaatatttaggcata
                     Aardvark  ggtaa------------tt-tttcta-ctgcc---a-agtttgaatcaatcttctaaatactgaagcata
B D                 Armadillo  ggtga------------tt-ttttaacagacc---a-catttgactctgtcttctaaatattgaagcata
B D                   Wallaby  agcaa------------at-tttaca-gtttcctaa-aatttgaattatgttttgaaatatttagaccta
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================
  D              Mallard duck  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                  Platypus  ======================================================================
B D                   Opossum  ======================================================================

                        Human  atttgtgaatatgcagttgaataaataataatag
                        Chimp  atttgtgaatatgcagtcgaataaataataatag
                      Gorilla  atttgtgaatatgcagttgaataaataataatag
                    Orangutan  atttgtgaatatgcagttgaataaacaataatag
                       Gibbon  atttgtgaatatgtagttgaata---aataatag
                       Rhesus  atttgtgaatatgcagttgaataaataataatag
          Crab-eating macaque  atttgtgaatatgcagttgaataaataataatag
                       Baboon  atttgtgaatatgcagttgaataaataataatag
                 Green monkey  atttgtgaatatgcagttgaataaataataatag
                     Marmoset  atttgtgaatatgcagttgaatgaataagaatag
              Squirrel monkey  atttgtgaatatgcagttgaataaatagtaatag
                     Bushbaby  atttgtgaaagtgcaattgaatgaataataatag
           Chinese tree shrew  atttgtgaacgtgcaattgaatgggtaataatag
                     Squirrel  atttgtgaatgtgcaattggttgaataataatag
       Lesser Egyptian jerboa  atttgtgaatgtacaattgaatgaataataa---
                 Prairie vole  atttgtgaatgtgcaattgaatgaataataatag
              Chinese hamster  atttgtgaatgtgcaattgaatgaataataatag
               Golden hamster  atttgtgaatgtgcaattgaatgaataataatag
                        Mouse  atttgtgaatgcacaattgaatgaataataatag
                          Rat  atttgtgaatgtgcaattgaatgaataataatag
               Naked mole-rat  atctgtgaatgtgcagttgagtaaataataatag
                   Guinea pig  acttgtgagcatgcaattgagtacacaataatag
                   Chinchilla  atttgtgaacatgcaattgagtgcatagtaatag
             Brush-tailed rat  atctgtgcacaggcaattgaaagcataataatag
                       Rabbit  atccgtgaacgtgcaattgagtgagtaataacag
                          Pig  atttgtgaa--tgcagttgaatg---aataatag
                       Alpaca  atttgtgaa--tgcaattgaatgaataataatag
               Bactrian camel  atttatgaa--tgcaattgaatgaataataatag
                      Dolphin  atttgtgaa--tgcaattgaatgaataataatag
                 Killer whale  atttgtgaa--tgcaattgaatgaataataatag
             Tibetan antelope  atttgtgaa--tgcaattgaatgaataataatag
                          Cow  atttgtgaa--tgcaattgaatgaataataatag
                        Sheep  atttgtgaa--tgcaattgaatgaataataatag
                Domestic goat  atttgtgaa--tgcaattgaatgaataataatag
                        Horse  atttgtaaa--tgcaattgaatgaataataacag
             White rhinoceros  atttgtgaa--tgcaattgaatgaataataatag
                          Cat  atttgtgaa--tgcaattgaatggataatagtag
                          Dog  atttgtgaa--cacaattgaatgaataatactag
                      Ferret   atttgtgaa--tgcaattgaatgaataacagcaa
                        Panda  atttgtgaa--tgcaattgaatgaataatagtag
               Pacific walrus  atttgtgaa--tgcagttgaatgaataatagtag
                 Weddell seal  atttgtgaa--tgcagttgaatgaatagtagtag
             Black flying-fox  atctgtgca--agtaattgcatgagtaataatag
                      Megabat  atctgtgca--agtaattgcatgagtaataatag
                     Hedgehog  attgaggcc--tgcatggga-cgaataataatag
              Star-nosed mole  atttatgaa--tgcagttga---attaataatag
                     Elephant  acttataaatgtgccatggaatgaataataatag
          Cape elephant shrew  acatgtggatgtataattgaatgagtaagaatgc
                      Manatee  acttgtgaatgtgcaattgaattaatagtaatag
                       Tenrec  acttgtgaatgtgcaattgaattaaagataatag
                     Aardvark  acttgcaaatatgaaaatgaatgaataataatag
                    Armadillo  atttgtgaatgtgcaattgaataattaa----ag
                      Wallaby  ttttttaaacataaaaaagactgaatgatactag
                     Microbat  ==================================
         David's myotis (bat)  ==================================
                  Rock pigeon  ==================================
           American alligator  ==================================
                 Mallard duck  ==================================
          Collared flycatcher  ==================================
                       Turkey  ==================================
                      Chicken  ==================================
             Cape golden mole  ==================================
     Chinese softshell turtle  ==================================
           Tibetan ground jay  ==================================
                   Budgerigar  ==================================
             Peregrine falcon  ==================================
                 Saker falcon  ==================================
                       Parrot  ==================================
          Medium ground finch  ==================================
       White-throated sparrow  ==================================
                  Zebra finch  ==================================
               Painted turtle  ==================================
              Green seaturtle  ==================================
                     Platypus  ==================================
                      Opossum  ==================================

Alignment block 5 of 423 in window, 86933034 - 86933075, 42 bps 
B D                     Human  aattttaaacaagata-------gactgcc-tttaattct--gctgtttgag
B D                     Chimp  aattttaaacaagata-------gactgcc-tttaattct--gctgtttgag
B D                   Gorilla  aattttaaacaaaata-------gactgcc-tttaattct--ggtgtttgag
B D                 Orangutan  aattataaacaagata-------gactgcc-tttaattct--ggagtttgag
B D                    Gibbon  aattataaacaagata-------gactgcc-tttaattct--ggtgtttgag
B D                    Rhesus  aattatcaacaagata-------gactgcc-tttaattct--ggtgtttgag
B D       Crab-eating macaque  aactatcaacaagata-------gactgcc-tttaattct--ggtgtttgag
B D                    Baboon  aattatcaacaagata-------gactgcc-tttaattct--ggtgtttgag
B D              Green monkey  aattatcaacaagata-------gactgcc-tttaattct--ggtgtttgag
B D                  Marmoset  aattatcaacaggata-------gactgccatttaatt--------------
B D           Squirrel monkey  aattatcaacaggaca-------gactgcc-tttaattct--ggtgtttgag
B D                  Bushbaby  aatgttcgacaatata-------ggttatc-tttaattct--gatatttgag
           Chinese tree shrew  aatattcagcaatgta------ccattacc-tctaattct--gttctttgag
B D                  Squirrel  aattatcaacaatata------acattact-tttaatact--ggtgtttgac
       Lesser Egyptian jerboa  acttgtcaacaatata------gcactacc-tttaatttttaattatttgag
                 Prairie vole  aattatcaacaatata------gcattagg-tttaattct--accatttgag
B D           Chinese hamster  aattatcaacaatata------gcattagc-tttaatttt--gccatttgag
               Golden hamster  aattatcaacaatata------gcattagc-tttaatttt--gccatttgag
B D                     Mouse  aattaccaatgatata------gcattacc-tttaattct--gccatttgag
B D                       Rat  aattactaatgataca------gcattagc-tttaattct--gccatttgag
B D            Naked mole-rat  aattatcaacaatgta------gaattatc-tttaattct--ggcatttgct
B D                Guinea pig  aattatcaacgatata-------gattatc-tttaattct--gacatttgac
                   Chinchilla  aattatcaacaatatagtaatggaattatc-tttaattct--ggcgtttgat
             Brush-tailed rat  aattatcaacaatata------gaattatc-tttaatttt--ggcatttgat
B D                    Rabbit  aattattaacaatatc------gcattata-ttt-ctgct--gatctttgat
B D                       Pig  aattattgacaatata------acattaccttttaattct--ggtatttgaa
B D                    Alpaca  aatcatcaacaataca------ggattacc-tttaattct--ggtatttgag
               Bactrian camel  aatcatcaacaataca------ggattacc-tttaattct--ggtatttgag
B D                   Dolphin  aattatcaacaataca------gcattacc-tttaattct--ggtatttgag
                 Killer whale  aattatcaacaataca------gcattacc-tttaattct--ggtatttgag
             Tibetan antelope  aataatcaacaataca------gcattacc-tttaattct--ggtgtttgag
B D                       Cow  aatcatcaacaataca------gcattacc-tttaattct--gatgtttgag
B D                     Sheep  aatcatcaacaataca------gcattacc-tttaattct--cgtggttgag
                Domestic goat  aatcatcaacaataca------gcattacc-tttaattct--ggtgtttgag
B D                     Horse  aattatcaacaataca------gtgttacc-tctaattct--ggtatttgag
B D          White rhinoceros  aattatcaacaataca------gcattacc-tttaattct--ggtatttgag
B D                       Cat  aattatcagcaataca------gtgttagc-tttaatttt--ggtatttgag
B D                       Dog  aattatcaacaataca------gcattacc-tttaatttt--ggtatttgag
B D                   Ferret   aattatcagcaagatg------gcattacc-t-----ttt--agtagttgag
B D                     Panda  aattatcagcaataaa------gcataacg-tttaatttt--ggtacttgag
               Pacific walrus  aattatcagccaaaca------gcgttacc-------ttt--ggtatttgag
                 Weddell seal  aattatcagccataca------gcattacc-tttaagttt--ggtatttgag
             Black flying-fox  aataatcaacaacatg------gcattatt-tttaattct--accgttggag
B D                   Megabat  aataatcaacagcatg------gcattctt-tttaattct--agcgttggag
B D                  Hedgehog  aatcatcagcaagaag------gcatcgcc-ttgagctct--cgcatgtgag
              Star-nosed mole  aattagcgaaaagact------gaattacc-tttcattct--gacatttgag
B D                  Elephant  aattattaataatacg------gcattgcc-tttaattct--ggtgtttgag
          Cape elephant shrew  cattaataataacaca------ccattccc-tttaatttt--agcatttgaa
B D                   Manatee  aattattaataataca------gcattacc-tttaattct--ggtatttgag
B D                    Tenrec  aa-tattaatcataca------gtattgct-tttcattct--ggtacttcac
                     Aardvark  aattattaataataca------gcattgtt-tttaatttt--ggtatttgag
B D                 Armadillo  aatcagtaacaatac---------attacc-tttagttct--ggtattgcag
B D                  Microbat  ====================================================
        David's myotis (bat)  ====================================================
  D               Rock pigeon  ====================================================
B D        American alligator  ====================================================
  D              Mallard duck  ====================================================
  D       Collared flycatcher  ====================================================
B D                    Turkey  ====================================================
B D                   Chicken  ====================================================
            Cape golden mole  ====================================================
  D  Chinese softshell turtle  ====================================================
          Tibetan ground jay  ====================================================
B D                Budgerigar  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
  D                    Parrot  ====================================================
B D       Medium ground finch  ====================================================
  D    White-throated sparrow  ====================================================
B D               Zebra finch  ====================================================
  D            Painted turtle  ====================================================
  D           Green seaturtle  ====================================================
B D                  Platypus  ====================================================
B D                   Opossum  ====================================================

Inserts between block 5 and 6 in window
B D                 Hedgehog 670bp

Alignment block 6 of 423 in window, 86933076 - 86933095, 20 bps 
B D                     Human  a-cttt-tcat-gtgctagtcta--
B D                     Chimp  a-cttt-tcac-gcgctagtcta--
B D                   Gorilla  a-cttt-tcac-gcactagtcta--
B D                 Orangutan  a-cttt-tcac-gcactagtctg--
B D                    Gibbon  g-cttt-ccac-atgctagtcta--
B D                    Rhesus  a-cttt-tcat-acactagtcta--
B D       Crab-eating macaque  a-cttt-tcat-acactagtcta--
B D                    Baboon  a-cttt-tcat-acactagtcta--
B D              Green monkey  a-cttt-tcat-acactagtcta--
B D                  Marmoset  --cttt-ccac-aaatcag------
B D           Squirrel monkey  a-cttg-tcac-aaattag------
B D                  Bushbaby  a-cttt-caat-aaactaatccg--
           Chinese tree shrew  a-cttt-gcat-aaactagtcca--
B D                  Squirrel  a-catt-ccat-aaagtagttta--
       Lesser Egyptian jerboa  t-cttt-atac-aaactagtttg--
                 Prairie vole  attttt-atac-aaactagtctg--
B D           Chinese hamster  g-tttt-atac-aaactagtcta--
               Golden hamster  g-tttt-atat-gaactagtcta--
B D                     Mouse  a-ttttgacag-gaactagtctg--
B D                       Rat  a-gttt-acag-agactactctg--
B D            Naked mole-rat  a-cttt-ccac-aaactagtcta--
B D                Guinea pig  a-ctat-gcat-aaattagtctc--
                   Chinchilla  a-cttt-ccac-aaattggtcta--
             Brush-tailed rat  a-cttt-ct-c-aaattagtctg--
B D                    Rabbit  a-cttc-ccac-acgctgctccg--
B D                       Pig  a-tttt-ccac-aaacta-------
B D                    Alpaca  a-cact-ccac-agacca-------
               Bactrian camel  a-ctct-ccac-agaccg-------
B D                   Dolphin  a-cttt-ccac-agacta-------
                 Killer whale  a-cttt-ccac-agacta-------
             Tibetan antelope  a-cttt-ctgc-agactt-------
B D                       Cow  a-cttt-ctgc-agactt-------
B D                     Sheep  a-cttt-ctgc-agactt-------
                Domestic goat  a-cttt-ctgc-agactt-------
B D                     Horse  a-cttt-ccat-agatta-------
B D          White rhinoceros  a-cttt-ccat-agacta-------
B D                       Cat  a-cttt-ccac-agactc-------
B D                       Dog  a-cttt-acac-agacta-------
B D                   Ferret   a-cttt-ccac-agtcta-------
B D                     Panda  a-cttt-ccac-acacta-------
               Pacific walrus  a-cttt-ccac-agacta-------
                 Weddell seal  a-cttt-ccat-agacta-------
             Black flying-fox  a-cttt-ccac-agactg-------
B D                   Megabat  a-cttt-ccac-agactg-------
              Star-nosed mole  g-catt-ccac-agagtc-------
B D                  Elephant  c-cttt-ccac-agactagctccta
          Cape elephant shrew  g-cttt-acac-aaactagtttcta
B D                   Manatee  c-cttt-ccac-agactagttcgta
B D                    Tenrec  a-cttt-acacgaaactagttccca
                     Aardvark  a-cttt-ccac-aatcctgccccta
B D                 Armadillo  a-tttt-cc---agactagtctcaa
B D                  Hedgehog  =========================
B D                  Microbat  =========================
        David's myotis (bat)  =========================
  D               Rock pigeon  =========================
B D        American alligator  =========================
  D              Mallard duck  =========================
  D       Collared flycatcher  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
            Cape golden mole  =========================
  D  Chinese softshell turtle  =========================
          Tibetan ground jay  =========================
B D                Budgerigar  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
B D       Medium ground finch  =========================
  D    White-throated sparrow  =========================
B D               Zebra finch  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D                  Platypus  =========================
B D                   Opossum  =========================

Inserts between block 6 and 7 in window
B D                   Rhesus 13bp
B D                 Bushbaby 5bp
          Chinese tree shrew 7bp
B D                 Squirrel 6bp
      Lesser Egyptian jerboa 6bp
                Prairie vole 6bp
B D          Chinese hamster 6bp
              Golden hamster 6bp
B D                    Mouse 6bp
B D                      Rat 6bp
B D           Naked mole-rat 6bp
B D               Guinea pig 6bp
                  Chinchilla 6bp
            Brush-tailed rat 6bp
B D                   Rabbit 6bp

Alignment block 7 of 423 in window, 86933096 - 86933101, 6 bps 
B D                     Human  atctat
B D                     Chimp  atctat
B D                   Gorilla  atctat
B D                 Orangutan  gtctgt
B D                    Gibbon  gtctgt
B D       Crab-eating macaque  -----t
B D                    Baboon  -----t
B D              Green monkey  -----t
B D                  Marmoset  -tctat
B D           Squirrel monkey  -tctat
B D                  Bushbaby  gccttc
           Chinese tree shrew  -ccttc
B D                  Squirrel  accttc
       Lesser Egyptian jerboa  acctac
                 Prairie vole  accttc
B D           Chinese hamster  accttc
               Golden hamster  accttc
B D                     Mouse  accttc
B D                       Rat  accttc
B D            Naked mole-rat  accttc
B D                Guinea pig  aacttt
                   Chinchilla  aaattt
             Brush-tailed rat  aacttt
B D                    Rabbit  gccctc
B D                       Pig  gctcat
B D                    Alpaca  gcttgt
               Bactrian camel  gcttgt
B D                   Dolphin  gctcat
                 Killer whale  gctcat
             Tibetan antelope  gctcat
B D                       Cow  gctcat
B D                     Sheep  gttcat
                Domestic goat  gttcat
B D                     Horse  cttcct
B D          White rhinoceros  attcaa
B D                       Cat  gttcat
B D                       Dog  actcct
B D                   Ferret   gtttac
B D                     Panda  tttcac
               Pacific walrus  gttcac
                 Weddell seal  gttcac
             Black flying-fox  gttcat
B D                   Megabat  gttcat
              Star-nosed mole  gctcat
B D                  Elephant  acctgc
          Cape elephant shrew  acccac
B D                   Manatee  acctac
B D                    Tenrec  ccatgc
                     Aardvark  accttc
B D                 Armadillo  atcggc
B D                  Hedgehog  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
  D               Rock pigeon  ======
B D        American alligator  ======
  D              Mallard duck  ======
  D       Collared flycatcher  ======
B D                    Turkey  ======
B D                   Chicken  ======
            Cape golden mole  ======
  D  Chinese softshell turtle  ======
          Tibetan ground jay  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
B D               Zebra finch  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                    Rhesus  ======
B D                  Platypus  ======
B D                   Opossum  ======

Inserts between block 7 and 8 in window
B D      Crab-eating macaque 12bp
B D                   Baboon 12bp
B D             Green monkey 12bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                 Elephant 5bp
         Cape elephant shrew 5bp
B D                  Manatee 5bp
B D                   Tenrec 5bp
                    Aardvark 2bp
B D                Armadillo 5bp

Alignment block 8 of 423 in window, 86933102 - 86933124, 23 bps 
B D                     Human  aa-ctagtcttc------------aaacatgacctt
B D                     Chimp  aa-ctagtcttc------------aaacatgacctt
B D                   Gorilla  aa-ctaatcttc------------aaacatgacctc
B D                 Orangutan  aa-ctagtcttcaaactggtctctaaacatgacctt
B D                    Gibbon  aa-cttgccttcaaactagtctctaaacatgacctt
B D                    Rhesus  aa-ctggtctct------------aaacatgacctt
B D       Crab-eating macaque  aa-ctggtctct------------aaacatgacctt
B D                    Baboon  aa-ttggtctct------------aaacatgacgtt
B D              Green monkey  aa-ctgttctct------------aaacatgacctt
B D                  Marmoset  aa-ctagccttcagtctggt-tctaaacatgacctt
B D           Squirrel monkey  aa-ctaggcttcgatctggtctctaagcacgacttt
B D                  Bushbaby  aa-caggtctgt------------aaacatgaccgc
           Chinese tree shrew  aa-ctggtctct------------aaacatgacctt
B D                  Squirrel  aa-ctggtctct------------aaatgcggtctt
       Lesser Egyptian jerboa  ag-ctggttgct------------aaatatgacctt
                 Prairie vole  ag-ctagccttg------------aaatgtggcctt
B D           Chinese hamster  ag-ctagccttg------------aaatgtggcctt
               Golden hamster  ag-ctagccttg------------aaatgtggcctt
B D                     Mouse  ag-ctggccttg------------aaatgtggcctt
B D                       Rat  gg-ctggccttg------------aaatgtggtctt
B D            Naked mole-rat  ga-ccagtttt----------------tatgacctt
B D                Guinea pig  ga-ctgttctc----------------tgtgacctt
                   Chinchilla  ga-ctggtctc----------------tatgaactt
             Brush-tailed rat  gacccggtctg----------------tatgacctt
B D                    Rabbit  gc-------------------------cgtgaccct
B D                       Pig  aa-ctggccttcaaaatggtctctaaacatgacctt
B D                    Alpaca  ag-caggcattcgagttggtctctaaacttgacctt
               Bactrian camel  ag-cgggccttcgagttggtctctaaacttgacctt
B D                   Dolphin  aa-ctggtcttcaaattggtctctgagcatgacctt
                 Killer whale  aa-ctggtcttcaaattggtctctgagcatgacctt
             Tibetan antelope  aa-ctcaccttcaaattggtttctcagcatgacctt
B D                       Cow  aa-ctgaccttcaaattggtttctcagcatgacctt
B D                     Sheep  aa-ctcaccttcaaattggtttctcagcatgacctt
                Domestic goat  aa-ctcaccttccaattggtttctcagcatgacctt
B D                     Horse  aa-ctggtcttcaaattggcctctgagcgtgacctt
B D          White rhinoceros  aa-ctggccttcaaattggtctctaaacatgacctt
B D                       Cat  aa-ctggccttcaaattggtccttaaacatgacctt
B D                       Dog  ac-ctggccttcaaaatggtccctaaacatgactgt
B D                   Ferret   ta-ctagccttcaaattggt-cctgaacatgacctt
B D                     Panda  aa-ctggcctt-aaattgtttcctaaacataaccct
               Pacific walrus  ac-ctggccttcaaattggtccctaaacatgacctt
                 Weddell seal  aa-ccggccctcaaattggtccctaaacatgacctt
             Black flying-fox  ga-caggccttcagattggtccctaa----------
B D                   Megabat  ga-caggccttcaaattggtccctaa----------
              Star-nosed mole  aa-ttggacttccactcgggctttaa----------
B D                  Elephant  -------------aactagtctctaaacaggagatt
          Cape elephant shrew  -------------ggttggtctctaaaaataacact
B D                   Manatee  -------------aactggtctctaa----------
B D                    Tenrec  -------------aactgatctcaaaacttgacatt
                     Aardvark  -------------------tctctaaacatgacatt
B D                 Armadillo  -------------aattggtctctcaacgtggcgtt
B D                  Hedgehog  ====================================
B D                  Microbat  ====================================
        David's myotis (bat)  ====================================
  D               Rock pigeon  ====================================
B D        American alligator  ====================================
  D              Mallard duck  ====================================
  D       Collared flycatcher  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
            Cape golden mole  ====================================
  D  Chinese softshell turtle  ====================================
          Tibetan ground jay  ====================================
B D                Budgerigar  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D                    Parrot  ====================================
B D       Medium ground finch  ====================================
  D    White-throated sparrow  ====================================
B D               Zebra finch  ====================================
  D            Painted turtle  ====================================
  D           Green seaturtle  ====================================
B D                  Platypus  ====================================
B D                   Opossum  ====================================

Inserts between block 8 and 9 in window
B D                   Rabbit 134bp
            Black flying-fox 14bp
B D                  Megabat 14bp
             Star-nosed mole 41bp
B D                  Manatee 14bp

Alignment block 9 of 423 in window, 86933125 - 86933126, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  ca
B D           Squirrel monkey  aa
B D                  Bushbaby  cg
           Chinese tree shrew  ag
B D                  Squirrel  ac
       Lesser Egyptian jerboa  aa
                 Prairie vole  aa
B D           Chinese hamster  aa
               Golden hamster  -a
B D                     Mouse  aa
B D                       Rat  aa
B D            Naked mole-rat  ag
B D                Guinea pig  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                       Pig  aa
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  aa
                 Killer whale  aa
             Tibetan antelope  aa
B D                       Cow  aa
B D                     Sheep  aa
                Domestic goat  aa
B D                     Horse  aa
B D          White rhinoceros  ga
B D                       Cat  aa
B D                       Dog  aa
B D                   Ferret   ag
B D                     Panda  gg
               Pacific walrus  ga
                 Weddell seal  ga
B D                  Elephant  ag
          Cape elephant shrew  gg
B D                    Tenrec  ag
                     Aardvark  ag
B D                 Armadillo  ca
B D                  Hedgehog  ==
             Star-nosed mole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
B D                   Manatee  ==
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  ==
B D                   Megabat  ==
B D                   Opossum  ==
            Black flying-fox  ==

Inserts between block 9 and 10 in window
              Bactrian camel 6bp

Alignment block 10 of 423 in window, 86933127 - 86933130, 4 bps 
B D                     Human  cagt
B D                     Chimp  cagt
B D                   Gorilla  cagt
B D                 Orangutan  cagt
B D                    Gibbon  cagt
B D                    Rhesus  cagt
B D       Crab-eating macaque  cagt
B D                    Baboon  cagt
B D              Green monkey  cagt
B D                  Marmoset  cagt
B D           Squirrel monkey  cagt
B D                  Bushbaby  ctgt
           Chinese tree shrew  ccgt
B D                  Squirrel  cagt
       Lesser Egyptian jerboa  ctgt
                 Prairie vole  gagt
B D           Chinese hamster  gagt
               Golden hamster  gagt
B D                     Mouse  cagt
B D                       Rat  cagt
B D            Naked mole-rat  cagg
B D                Guinea pig  tggt
                   Chinchilla  cagt
             Brush-tailed rat  cagt
B D                       Pig  gggt
B D                    Alpaca  gggt
B D                   Dolphin  gggt
                 Killer whale  gggt
             Tibetan antelope  aggt
B D                       Cow  aggt
B D                     Sheep  aggt
                Domestic goat  aggt
B D                     Horse  --gt
B D          White rhinoceros  --gt
B D                       Cat  --ga
B D                       Dog  --ga
B D                   Ferret   --ga
B D                     Panda  --ga
               Pacific walrus  --ga
                 Weddell seal  --ga
B D                  Elephant  cggt
          Cape elephant shrew  cact
B D                    Tenrec  cagt
                     Aardvark  cagt
B D                 Armadillo  cagt
B D                  Hedgehog  ====
             Star-nosed mole  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Rabbit  ====
B D                   Manatee  ====
  D               Rock pigeon  ====
B D        American alligator  ====
  D              Mallard duck  ====
  D       Collared flycatcher  ====
B D                    Turkey  ====
B D                   Chicken  ====
            Cape golden mole  ====
  D  Chinese softshell turtle  ====
          Tibetan ground jay  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
B D               Zebra finch  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                  Platypus  ====
B D                   Megabat  ====
              Bactrian camel  ====
B D                   Opossum  ====
            Black flying-fox  ====

Inserts between block 10 and 11 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 35bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D                   Alpaca 3bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp

Alignment block 11 of 423 in window, 86933131 - 86933131, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  c
           Chinese tree shrew  c
       Lesser Egyptian jerboa  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                  Hedgehog  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                   Manatee  =
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
                Killer whale  =
B D                   Megabat  =
B D                       Pig  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
            Black flying-fox  =
B D                  Squirrel  =
B D          White rhinoceros  =
B D                     Horse  =

Alignment block 12 of 423 in window, 86933132 - 86933132, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  c
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                       Pig  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
B D                  Elephant  t
          Cape elephant shrew  a
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                   Manatee  =
B D                       Dog  -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
                Killer whale  =
B D                   Megabat  =
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
            Black flying-fox  =
B D                  Squirrel  =
B D                       Cat  -
B D          White rhinoceros  =
B D                     Horse  =

Inserts between block 12 and 13 in window
B D                      Pig 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp

Alignment block 13 of 423 in window, 86933133 - 86933134, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  tt
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  ct
           Chinese tree shrew  ct
B D           Chinese hamster  c-
               Golden hamster  c-
B D                     Mouse  c-
B D                       Rat  c-
B D            Naked mole-rat  c-
B D                Guinea pig  c-
                   Chinchilla  c-
             Brush-tailed rat  c-
B D                   Ferret   c-
B D                     Panda  c-
               Pacific walrus  c-
                 Weddell seal  c-
B D                  Elephant  ct
          Cape elephant shrew  ct
B D                    Tenrec  ct
                     Aardvark  ct
B D                 Armadillo  ct
      Lesser Egyptian jerboa  --
B D                  Hedgehog  ==
             Star-nosed mole  ==
                Prairie vole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
B D                   Manatee  ==
B D                       Dog  --
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Dolphin  ==
B D                  Platypus  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  ==
B D                   Megabat  ==
B D                       Pig  ==
B D                    Alpaca  ==
              Bactrian camel  ==
B D                   Opossum  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                       Cat  --
B D          White rhinoceros  ==
B D                     Horse  ==

Inserts between block 13 and 14 in window
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1396bp
B D                      Rat 21bp
B D           Naked mole-rat 5bp
B D               Guinea pig 2bp
                  Chinchilla 3bp
            Brush-tailed rat 37bp
         Cape elephant shrew 3bp

Alignment block 14 of 423 in window, 86933135 - 86933135, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  g
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                    Tenrec  -
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                   Manatee  =
B D                     Panda  -
B D                   Ferret   -
B D                       Dog  -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                   Megabat  =
B D                       Pig  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                Weddell seal  -
                    Aardvark  -
            Black flying-fox  =
B D                  Squirrel  =
B D                       Cat  -
B D                  Elephant  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
              Pacific walrus  -
B D          White rhinoceros  =
B D                     Horse  =

Alignment block 15 of 423 in window, 86933136 - 86933136, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  c
B D           Chinese hamster  t
               Golden hamster  t
B D                Guinea pig  c
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
B D                    Tenrec  t
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                       Rat  =
B D                     Mouse  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                   Manatee  =
B D                       Dog  -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                   Megabat  =
B D                       Pig  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                    Aardvark  -
            Black flying-fox  =
B D                  Squirrel  =
B D                       Cat  -
B D                  Elephant  -
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D          White rhinoceros  =
B D                     Horse  =

Inserts between block 15 and 16 in window
          Chinese tree shrew 3bp
B D          Chinese hamster 823bp
              Golden hamster 27bp
B D                   Tenrec 701bp

Alignment block 16 of 423 in window, 86933137 - 86933137, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D                Guinea pig  t
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
          Cape elephant shrew  g
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                   Manatee  =
B D                       Dog  -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                   Megabat  =
B D                       Pig  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                    Aardvark  -
            Black flying-fox  =
B D                  Squirrel  =
B D                       Cat  -
B D                  Bushbaby  -
B D                  Elephant  -
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D          White rhinoceros  =
B D                     Horse  =

Alignment block 17 of 423 in window, 86933138 - 86933139, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  -a
B D           Squirrel monkey  aa
           Chinese tree shrew  tt
B D                Guinea pig  aa
          Cape elephant shrew  aa
B D                    Tenrec  ==
      Lesser Egyptian jerboa  --
B D                  Hedgehog  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
                Prairie vole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
B D                   Manatee  ==
B D                     Panda  --
B D                   Ferret   --
B D                       Dog  --
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Dolphin  ==
B D                  Platypus  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  ==
B D                   Megabat  ==
B D                       Pig  ==
B D                 Armadillo  --
B D                    Alpaca  ==
              Bactrian camel  ==
B D                   Opossum  ==
                Weddell seal  --
                    Aardvark  --
            Black flying-fox  ==
B D                  Squirrel  ==
B D                       Cat  --
B D                  Bushbaby  --
B D                  Elephant  --
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
              Pacific walrus  --
B D          White rhinoceros  ==
B D                     Horse  ==

Inserts between block 17 and 18 in window
B D               Guinea pig 1bp

Alignment block 18 of 423 in window, 86933140 - 86933150, 11 bps 
B D                     Human  accacctttgc
B D                     Chimp  accacctttgc
B D                   Gorilla  accacctttgc
B D                 Orangutan  accaccgttgc
B D                    Gibbon  accactgttgc
B D                    Rhesus  accaccgttgc
B D       Crab-eating macaque  accaccgttgc
B D                    Baboon  accaccgttgc
B D              Green monkey  accaccgttgc
B D                  Marmoset  atcacctttgc
B D           Squirrel monkey  atcacctttac
           Chinese tree shrew  atcacgtctgc
          Cape elephant shrew  ttgacagttac
B D                    Tenrec  ===========
      Lesser Egyptian jerboa  -----------
B D                  Hedgehog  ===========
B D                       Rat  ===========
B D                     Mouse  ===========
              Golden hamster  ===========
B D           Chinese hamster  ===========
             Star-nosed mole  ===========
                Prairie vole  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
B D                    Rabbit  ===========
B D                   Manatee  ===========
B D                     Panda  -----------
B D                   Ferret   -----------
B D                       Dog  -----------
  D               Rock pigeon  ===========
B D        American alligator  ===========
  D              Mallard duck  ===========
  D       Collared flycatcher  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
            Cape golden mole  ===========
  D  Chinese softshell turtle  ===========
          Tibetan ground jay  ===========
B D                Budgerigar  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D                    Parrot  ===========
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
B D               Zebra finch  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D                   Dolphin  ===========
B D                  Platypus  ===========
B D                       Cow  ===========
               Domestic goat  ===========
B D                     Sheep  ===========
            Tibetan antelope  ===========
                Killer whale  ===========
B D                   Megabat  ===========
B D                       Pig  ===========
B D                 Armadillo  -----------
B D                    Alpaca  ===========
              Bactrian camel  ===========
B D                   Opossum  ===========
                Weddell seal  -----------
                    Aardvark  -----------
            Black flying-fox  ===========
B D                  Squirrel  ===========
B D                       Cat  -----------
B D                  Bushbaby  -----------
B D                  Elephant  -----------
B D                Guinea pig  ===========
            Brush-tailed rat  ===========
B D            Naked mole-rat  ===========
                  Chinchilla  ===========
              Pacific walrus  -----------
B D          White rhinoceros  ===========
B D                     Horse  ===========

Inserts between block 18 and 19 in window
          Chinese tree shrew 708bp

Alignment block 19 of 423 in window, 86933151 - 86933151, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
          Cape elephant shrew  a
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                   Manatee  =
B D                     Panda  -
B D                   Ferret   -
B D                       Dog  -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                   Megabat  =
B D                       Pig  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                Weddell seal  -
                    Aardvark  -
            Black flying-fox  =
B D                  Squirrel  =
B D                       Cat  -
B D                  Bushbaby  -
B D                  Elephant  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -
B D          White rhinoceros  =
B D                     Horse  =

Inserts between block 19 and 20 in window
         Cape elephant shrew 7636bp

Alignment block 20 of 423 in window, 86933152 - 86933153, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  aa
B D                  Marmoset  a-
B D           Squirrel monkey  aa
B D                    Tenrec  ==
      Lesser Egyptian jerboa  --
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
                Prairie vole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
B D                   Manatee  ==
B D                     Panda  --
B D                   Ferret   --
B D                       Dog  --
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Dolphin  ==
B D                  Platypus  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  ==
B D                   Megabat  ==
B D                       Pig  ==
B D                 Armadillo  --
B D                    Alpaca  ==
              Bactrian camel  ==
B D                   Opossum  ==
                Weddell seal  --
                    Aardvark  --
            Black flying-fox  ==
B D                  Squirrel  ==
B D                       Cat  --
B D                  Bushbaby  --
B D                  Elephant  --
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
              Pacific walrus  --
B D          White rhinoceros  ==
B D                     Horse  ==

Inserts between block 20 and 21 in window
B D                 Marmoset 202bp

Alignment block 21 of 423 in window, 86933154 - 86933655, 502 bps 
B D                     Human  gattatggaagtgagagaaatctaacgtggctgactccatcctgc--ttgta-gccttacaggctggctg
B D                     Chimp  gattatgaaagtgagagaaatgtaacgtggctgactccatcctgc--ttgta-gccttacaggctggctg
B D                   Gorilla  gattatgaaagtgagagaaatctaacgcggctgactccatcctgc--ttcta-gccttacaggctggcta
B D                 Orangutan  gattatgaaggtgagagaaatctaacatggctgactccatcctgctattcta-gacttacaggctggctg
B D                    Gibbon  gattatgaaagtgagagaaatctaatgtggctga--ccatcctgc--ttcta-gccgtacagtctggctg
B D                    Rhesus  gattatgaaagtgagagaaatctaatgtggctgactccatcctgc--ttcta-gccttacaggctggctg
B D       Crab-eating macaque  gattatgaaagtgagagaaatctaatgtggctgactccatcctgc--ttcta-gccttacaggctggctg
B D                    Baboon  gattatgaaagtgagagaaatctaatgtggctgactccatcctgc--ttcta-gccttacaggctggctg
B D              Green monkey  gattatgaaagtgagagaaatctaacgtggctgactccatcctgc--ttcta-gccttacaggctggctg
B D                  Marmoset  gattatgaaagtgagagaaatctaacatggttgactccatcctgc--ttctatttcttacgggtgggctg
B D           Squirrel monkey  gattatgaaagtgagagaaatctaacatggttgactccatcctgc--ttcca-gtcttatgggctggctg
B D                    Tenrec  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
                Prairie vole  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Manatee  ======================================================================
B D                     Panda  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================
  D              Mallard duck  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Dolphin  ======================================================================
B D                  Platypus  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
                Killer whale  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ----------------------------------------------------------------------
                    Aardvark  ----------------------------------------------------------------------
            Black flying-fox  ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ----------------------------------------------------------------------
B D                  Bushbaby  ----------------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------------------
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
          Chinese tree shrew  ======================================================================
              Pacific walrus  ----------------------------------------------------------------------
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================

                        Human  tccctgttcattcctgggcagaggccaagataaccatgggaggactttagtttttagtttaactttgaag
                        Chimp  tccctgttcattcctgggcagaggccaagataaccatgggaggaatttagtttttagtttaactttgaag
                      Gorilla  tccctgttcattcccgggcagaggccaagataaccatgggaggaatttagtttttagtttaactttgaag
                    Orangutan  tccttgttcattcctgggcagaggccaagataaccatgggaggaatttagtttttagtttaactttgaag
                       Gibbon  tccttgctcattcctgggcagaggccaagataaccatgagaggaatttagtttttagtttaactttgaag
                       Rhesus  tccttgctcattcctgggcagaggccaagataaccgtgggaggaatttagtttatagtttaactttgaag
          Crab-eating macaque  tccttgctcattcctgggcagaggccaagataaccgtgggaggaatttagtttatagtttaactttgaag
                       Baboon  tccttgctcattcctgggcagaggccaagataaccgtgggaggaatttagtttatagtttaactttgaag
                 Green monkey  tccttgctcattcctgggcagaggccaagataaccatgggaggaatttagtttatagtttaactttgaag
                     Marmoset  tccttgctcattcctgggcataggccaagataaccatgggaggaatttagtttatagtttaactttgaag
              Squirrel monkey  cccttgctcattcctgggcataggccaagataaccatgggaggaatttagtttatagtttaattttgaag
                       Tenrec  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                 Prairie vole  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                        Panda  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Cape golden mole  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Dolphin  ======================================================================
                     Platypus  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Killer whale  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
           Chinese tree shrew  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  caaggatgataatagtccctccctacaactga-tcccctccttgtttgggggatgaaaccaaaaggccac
                        Chimp  caaggatgataatagtccctccctacaactga-tcccctccttgtttgggggatgaaaccaaaaggccac
                      Gorilla  caag---gataatagtccctccctacaactga-tcccctccttgtttgggggatgaaaccaaaaggccac
                    Orangutan  caaagatgataatagtccctccctacaactga-tcccctccttgtttgggggatgaaactgaaaggccac
                       Gibbon  caaggatgataatagtccctccctacaactgattcccctccttgtttaggggatgaaactgaaagcccac
                       Rhesus  caaggatgataatagtccctctctacaactga-tcccttccttgtttgggggatgaaactgaaaggccac
          Crab-eating macaque  caaggatgataatagtccctctctacaactga-tcccttccttgtttgggggatgaaactgaaaggccac
                       Baboon  caaggatgataatagtccctctctacaactga-tcccttccttgtttgggggatgaaactgaaaggccac
                 Green monkey  caaggatgataatagtccctctctacaactga-tcccttccttgtttgggggatgaaactgaaagtccac
                     Marmoset  caaggatgataagagtccctccctataactga-tcccctccttgttaggggggtaaaactgaaaggccac
              Squirrel monkey  caaggatgataagagtcccttcctataactga-tcccctccttgtttgaggggtgaaactgaaaggccac
                       Tenrec  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                 Prairie vole  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                        Panda  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Cape golden mole  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Dolphin  ======================================================================
                     Platypus  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Killer whale  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
           Chinese tree shrew  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  aaaataagggatatgggaggggtctgaattctgctcaaatgtaggcataatttctatagctcattacagc
                        Chimp  aaaataagggatatgggaggggtctgaattctgctcaaatgtaggcttaatttctatagctcattacagc
                      Gorilla  aaaataagggatatgggaggggtctgaattctgctcaaatgtaggcataatttctatagctcattacagc
                    Orangutan  agaataagggatataggaggggtctgaattctgctcaaatgtaggcataatttctgtaactcattacagc
                       Gibbon  aaaataagggatatgggaggggtctgaattctgctgaaatgtaggcataatttctataactcattacagt
                       Rhesus  aaaataagggatatggaaggggcctgaattctgctcaaatataggcataatttctataactgtttacagt
          Crab-eating macaque  aaaataagtgatatggaaggggcctgaattctgctcaaatataggcataatttctataactctttacagt
                       Baboon  aaaataaggaatatggaaggggcctgaattctgctcaaatataggcataatttctataactcttaacagt
                 Green monkey  aaaataagggatatggaaggggcctgaattctgctcaaatataggcataatttctataactctttacagc
                     Marmoset  agaacaagggatatgggaggggcctgaattctgctaaaatgtaggcataatttctgtaactcattacagc
              Squirrel monkey  acaataaggaatatgggaagggcctgaattctgataaaatgtaggcataatttctgtaactcattacagc
                       Tenrec  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                 Prairie vole  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                        Panda  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Cape golden mole  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Dolphin  ======================================================================
                     Platypus  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Killer whale  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
           Chinese tree shrew  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  tcaggagtcatgtagccagaggtcgcaagatttgtgacttccccaattgctctcatagatctcatctcta
                        Chimp  tcaggagtcatgtagccagaggtcgcaagatttgtgacttccccaattgctcccatagatctcatctcta
                      Gorilla  tcagtagtcatgtagccagaggtcgcaagatttgtgacttccccagttgctcccatagatctcatctcta
                    Orangutan  tcaggagtcatgtggccagaggtcaaaagatttgtgacttccccaattgcttccatagatctcatctcta
                       Gibbon  tcaggagtcaggtggccagaggtcacaagatttgtgacttccccaattgctcccacagatctcatctcta
                       Rhesus  tcaggagtcatgtggccagaggtcacaagatttgtgacttcctcaattgctcccatagatctcatctcta
          Crab-eating macaque  tcaggagtcatgtggccagaggtcacaagatttgtgacttcctcaattgctcccatagatctcatctcta
                       Baboon  tcaggagtcatgtggccagaggtcacaagatttgtgacttcctcaattgctcccatagatctcatctcta
                 Green monkey  tcaggagtcatgtggccagaggtcacaagatttgtgacttcctcagttgctcccatagatctcatctcta
                     Marmoset  tccagagtcatgtggccagaggtcacaagatttgtgacttccccaattgctcccatagatctcatctcta
              Squirrel monkey  tccagagttgtgtggccagaggtcacaa-atttgtgacttccccaattgcccccatagatctcatctcta
                       Tenrec  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                 Prairie vole  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                        Panda  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Cape golden mole  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Dolphin  ======================================================================
                     Platypus  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Killer whale  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
           Chinese tree shrew  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  ttgtagaacctaagattgatcttttgagatcaactccagttatcctgtgtgtctggccttgcatcagtta
                        Chimp  ttgtagaacctaagattgaccttttgagatcaactccagttatcctgtgtgtctggccttgcatcagtta
                      Gorilla  ttgtagaacctaagattgatcttttgagatcaactccagttatcctgtgtgtctggccttgcatcaatta
                    Orangutan  ttgtagaacctaagattgatcttttgagatcaactccagttatcctgtgtgtctggccttgcatcagtta
                       Gibbon  ttgtagaacctaagattgatcttttgatatcaactccatttatcctgtgtgtctggccttgtatcagtta
                       Rhesus  ttgtagaacctaagattgatctcttgagatcaactctagttatcctgtgggactggccttgcatcagtta
          Crab-eating macaque  ttgtagaacctaagattgatctcttgagatcaactctagttatcctgtgggactggccttgcatcagtta
                       Baboon  ttgtagaacctaagattgatctcttgagatcaactctagttatcctgtgggactggccttgcatcagtta
                 Green monkey  ttgtagaacctaagattgagctcttgagatcaacttcagttatcctgtgggactggccttgcatcagtta
                     Marmoset  tcgtagaacctaagattgatcttctgagatcaactcgagttatcctgtgtgtctggccttgcatcagtta
              Squirrel monkey  ttgtagaaccgaagattgatcttttgagatcaactcaagttatcctgtgtgtctggccttgcatcggtta
                       Tenrec  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                 Prairie vole  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                        Panda  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Cape golden mole  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Dolphin  ======================================================================
                     Platypus  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Killer whale  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
           Chinese tree shrew  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  aactcctttcttg-actgcaataccacagtctcagggaattggatttgtctgtgcagcaggcaggaagaa
                        Chimp  aactcatttcttg-actggaataccacagtctcagggaattggatttgtctgtgcagcaggcaggaagaa
                      Gorilla  aactcatttcttg-actgccataccacagtctcagggaattggatttgtctgtgcagcaggcaggaagaa
                    Orangutan  aactcatttcttg-actgcaataccacagtctcagggaattggatttgtctgtgcagcaggcaggaagaa
                       Gibbon  aactcatttcttg-actgcaataccactgtctcagggaattggatttgtctgtgcagcagggaagaagag
                       Rhesus  aactcatttcttg-actgcaataccacagttacagggaattggatttgtctgtgcagcaggcaggaagaa
          Crab-eating macaque  aactcatttcttg-actgcaataccacagttacagggaattggatttgtctgtgcagcaggcaggaagaa
                       Baboon  aactcatttcttg-actgcaataccacagttacagggaattggatttgtctgtgcagcaggcaggaagaa
                 Green monkey  aactcatttcttg-actgcaataccacagttacagggaattggatttgtctgtgcagcaggcaggaagaa
                     Marmoset  aactcatttcttgaactgcaataacttggtctcagtgaattggatctgtctgtgctgcaggcaggaagaa
              Squirrel monkey  aactcatttcctg-actgcagtaccatagtctcggtgaattggatctgtctgtgtagcaggcaggaagaa
                       Tenrec  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                 Prairie vole  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                        Panda  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Cape golden mole  ======================================================================
     Chinese softshell turtle  ======================================================================
           Tibetan ground jay  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Dolphin  ======================================================================
                     Platypus  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                 Killer whale  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
           Chinese tree shrew  ======================================================================
               Pacific walrus  ----------------------------------------------------------------------
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  cctgctaggtgattaca
                        Chimp  cctgctaggtgattaca
                      Gorilla  cctgctaggtgattaca
                    Orangutan  cctgctaggtgattaca
                       Gibbon  cctgctaggtgattaca
                       Rhesus  cctgctgggtgagtaca
          Crab-eating macaque  cctgctgggtgagtaca
                       Baboon  cctgctgggtgagtaca
                 Green monkey  cctgctgggtgagtaca
                     Marmoset  tctgccaggcgattaca
              Squirrel monkey  cctgccaggtgattaca
                       Tenrec  =================
       Lesser Egyptian jerboa  -----------------
                     Hedgehog  =================
          Cape elephant shrew  =================
                          Rat  =================
                        Mouse  =================
               Golden hamster  =================
              Chinese hamster  =================
              Star-nosed mole  =================
                 Prairie vole  =================
                     Microbat  =================
         David's myotis (bat)  =================
                       Rabbit  =================
                      Manatee  =================
                        Panda  -----------------
                      Ferret   -----------------
                          Dog  -----------------
                  Rock pigeon  =================
           American alligator  =================
                 Mallard duck  =================
          Collared flycatcher  =================
                       Turkey  =================
                      Chicken  =================
             Cape golden mole  =================
     Chinese softshell turtle  =================
           Tibetan ground jay  =================
                   Budgerigar  =================
             Peregrine falcon  =================
                 Saker falcon  =================
                       Parrot  =================
          Medium ground finch  =================
       White-throated sparrow  =================
                  Zebra finch  =================
               Painted turtle  =================
              Green seaturtle  =================
                      Dolphin  =================
                     Platypus  =================
                          Cow  =================
                Domestic goat  =================
                        Sheep  =================
             Tibetan antelope  =================
                 Killer whale  =================
                      Megabat  =================
                          Pig  =================
                    Armadillo  -----------------
                       Alpaca  =================
               Bactrian camel  =================
                      Opossum  =================
                 Weddell seal  -----------------
                     Aardvark  -----------------
             Black flying-fox  =================
                     Squirrel  =================
                          Cat  -----------------
                     Bushbaby  -----------------
                     Elephant  -----------------
                   Guinea pig  =================
             Brush-tailed rat  =================
               Naked mole-rat  =================
                   Chinchilla  =================
           Chinese tree shrew  =================
               Pacific walrus  -----------------
             White rhinoceros  =================
                        Horse  =================

Alignment block 22 of 423 in window, 86933656 - 86933656, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
             Black flying-fox  t
B D                   Megabat  t
B D                   Manatee  t
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                     Panda  -
B D                   Ferret   -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Dolphin  =
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                       Pig  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                Weddell seal  -
                    Aardvark  -
B D                  Bushbaby  -
B D                  Elephant  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -

Alignment block 23 of 423 in window, 86933657 - 86933657, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  c
B D                       Pig  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
             Black flying-fox  c
B D                   Megabat  c
B D                   Manatee  t
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                     Panda  -
B D                   Ferret   -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  =
B D                 Armadillo  -
B D                    Alpaca  =
B D                   Opossum  =
                Weddell seal  -
                    Aardvark  -
B D                  Bushbaby  -
B D                  Elephant  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -

Alignment block 24 of 423 in window, 86933658 - 86933658, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
             Black flying-fox  c
B D                   Megabat  c
B D                   Manatee  t
B D                    Tenrec  =
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                     Panda  -
B D                   Ferret   -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  =
B D                 Armadillo  -
B D                   Opossum  =
                Weddell seal  -
                    Aardvark  -
B D                  Bushbaby  -
B D                  Elephant  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -

Alignment block 25 of 423 in window, 86933659 - 86933660, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Squirrel  tg
       Lesser Egyptian jerboa  cc
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  ct
B D                       Cow  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  ct
B D          White rhinoceros  ct
B D                       Cat  ct
B D                       Dog  cc
             Black flying-fox  ct
B D                   Megabat  ct
B D                  Elephant  cc
B D                   Manatee  cc
                     Aardvark  cc
B D                 Armadillo  cc
B D                    Tenrec  ==
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
                Prairie vole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
B D                     Panda  --
B D                   Ferret   --
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  ==
B D                   Opossum  ==
                Weddell seal  --
B D                  Bushbaby  --
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
              Pacific walrus  --

Alignment block 26 of 423 in window, 86933661 - 86933661, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
             Black flying-fox  g
B D                   Megabat  g
B D                  Elephant  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                    Tenrec  =
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
                Prairie vole  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Rabbit  =
B D                     Panda  -
B D                   Ferret   -
  D               Rock pigeon  =
B D        American alligator  =
  D              Mallard duck  =
  D       Collared flycatcher  =
B D                    Turkey  =
B D                   Chicken  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  =
B D                   Opossum  =
                Weddell seal  -
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -

Alignment block 27 of 423 in window, 86933662 - 86933670, 9 bps 
B D                     Human  cctcaatga-
B D                     Chimp  cctcaatga-
B D                   Gorilla  cctcaatga-
B D                 Orangutan  cctcaatga-
B D                    Gibbon  cctcaatga-
B D                    Rhesus  ccacaatga-
B D       Crab-eating macaque  ccacaatga-
B D                    Baboon  ccacaatga-
B D              Green monkey  ccacaatga-
B D                  Marmoset  cctcaatga-
B D           Squirrel monkey  cctcaatga-
B D                  Bushbaby  cttcaatta-
B D                  Squirrel  ccccaacta-
       Lesser Egyptian jerboa  cctcaatta-
B D                       Pig  tcttaatca-
B D                    Alpaca  cctcagtca-
               Bactrian camel  cctcagtca-
B D                   Dolphin  cctcaatca-
                 Killer whale  cctcaatca-
             Tibetan antelope  cctcaatca-
B D                       Cow  cctcaatca-
B D                     Sheep  cctcaatca-
                Domestic goat  cctcaatca-
B D                     Horse  ctccactca-
B D          White rhinoceros  ctccactca-
B D                       Cat  cctcaagca-
B D                       Dog  cttcaagca-
B D                   Ferret   cttctagca-
B D                     Panda  cctccagca-
               Pacific walrus  cctccagca-
                 Weddell seal  cctccagca-
             Black flying-fox  cctccgtct-
B D                   Megabat  ccccaggca-
B D                  Elephant  cctgaattta
B D                   Manatee  cctgaattta
                     Aardvark  cctgaattta
B D                 Armadillo  actcaattta
B D                    Tenrec  ==========
B D                  Hedgehog  ==========
         Cape elephant shrew  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
              Golden hamster  ==========
B D           Chinese hamster  ==========
             Star-nosed mole  ==========
                Prairie vole  ==========
B D                  Microbat  ==========
        David's myotis (bat)  ==========
B D                    Rabbit  ==========
  D               Rock pigeon  ==========
B D        American alligator  ==========
  D              Mallard duck  ==========
  D       Collared flycatcher  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
            Cape golden mole  ==========
  D  Chinese softshell turtle  ==========
          Tibetan ground jay  ==========
B D                Budgerigar  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
B D               Zebra finch  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D                  Platypus  ==========
B D                   Opossum  ==========
B D                Guinea pig  ==========
            Brush-tailed rat  ==========
B D            Naked mole-rat  ==========
                  Chinchilla  ==========
          Chinese tree shrew  ==========

Inserts between block 27 and 28 in window
      Lesser Egyptian jerboa 8bp

Alignment block 28 of 423 in window, 86933671 - 86933672, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tt
B D                  Bushbaby  tc
B D                  Squirrel  ta
       Lesser Egyptian jerboa  ta
B D            Naked mole-rat  tc
                   Chinchilla  tc
B D                       Pig  tg
B D                    Alpaca  gg
               Bactrian camel  ag
B D                   Dolphin  tg
                 Killer whale  tg
             Tibetan antelope  tg
B D                       Cow  tg
B D                     Sheep  tg
                Domestic goat  tg
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  tc
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  tc
B D                   Megabat  tc
B D                  Elephant  ta
B D                   Manatee  ta
                     Aardvark  ta
B D                 Armadillo  ga
B D                    Tenrec  ==
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
                Prairie vole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  ==
B D                   Opossum  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
          Chinese tree shrew  ==

Alignment block 29 of 423 in window, 86933673 - 86933674, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  at
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  at
B D           Squirrel monkey  ac
B D                  Bushbaby  gt
B D                  Squirrel  at
       Lesser Egyptian jerboa  ct
B D            Naked mole-rat  at
B D                Guinea pig  at
                   Chinchilla  at
B D                       Pig  at
B D                    Alpaca  at
               Bactrian camel  at
B D                   Dolphin  at
                 Killer whale  at
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  at
B D          White rhinoceros  at
B D                       Cat  at
B D                       Dog  at
B D                   Ferret   ac
B D                     Panda  at
               Pacific walrus  at
                 Weddell seal  at
             Black flying-fox  ac
B D                   Megabat  ac
B D                  Elephant  at
B D                   Manatee  at
                     Aardvark  at
B D                 Armadillo  at
B D                    Tenrec  ==
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
                Prairie vole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  ==
B D                   Opossum  ==
            Brush-tailed rat  ==
          Chinese tree shrew  ==

Alignment block 30 of 423 in window, 86933675 - 86933692, 18 bps 
B D                     Human  gttttatctgcctgcctg
B D                     Chimp  gttttatctgcctgcctg
B D                   Gorilla  gttttatctgcctgcctg
B D                 Orangutan  gctttatctgcctgcctg
B D                    Gibbon  gttttatctgcctgcgtg
B D                    Rhesus  gttttatctgcctacctg
B D       Crab-eating macaque  gttttatctgcctacctg
B D                    Baboon  gttttatctgcctacctg
B D              Green monkey  gttttatctgcctacctg
B D                  Marmoset  gttttat-----------
B D           Squirrel monkey  gttttat-----------
B D                  Bushbaby  gttgtatctgcccacctg
B D                  Squirrel  cttccatctacttc----
       Lesser Egyptian jerboa  ttatgattttcttcctaa
B D            Naked mole-rat  atttgatccgcctgcttt
B D                Guinea pig  gtttgatctgcctgcttt
                   Chinchilla  gtttgatctgcctacttt
B D                       Pig  gttctatccagacagctg
B D                    Alpaca  gttctagctgggcacttg
               Bactrian camel  gttctagctgggcagttg
B D                   Dolphin  gttcttgccaggcagctg
                 Killer whale  gttcttgccaggcagctg
             Tibetan antelope  gttctagccaagcagttg
B D                       Cow  gttctagccaagcagttg
B D                     Sheep  gttctagccaagcagttg
                Domestic goat  gttctagccaagcagttg
B D                     Horse  gttctagccg-ctgcctg
B D          White rhinoceros  gttctagccgcctgcctg
B D                       Cat  gttccagctgcctgcctg
B D                       Dog  gttctagctgcctgcttg
B D                   Ferret   attctagctgcctgccta
B D                     Panda  gttctagctgcctgcctg
               Pacific walrus  gttctagctgccggccta
                 Weddell seal  gttctagctgcctgccta
             Black flying-fox  cgtccagctgcccgtctg
B D                   Megabat  cgtccagctggccgtctg
              Star-nosed mole  gccctgcctgtctgcctc
B D                  Elephant  gttccatctgccagcttg
B D                   Manatee  gttccgtctgcctgcttg
                     Aardvark  gttccatctgcctgct--
B D                 Armadillo  gttctgtctgctagcctg
B D                    Tenrec  ==================
B D                  Hedgehog  ==================
         Cape elephant shrew  ==================
B D                       Rat  ==================
B D                     Mouse  ==================
              Golden hamster  ==================
B D           Chinese hamster  ==================
                Prairie vole  ==================
B D                  Microbat  ==================
        David's myotis (bat)  ==================
B D                    Rabbit  ==================
  D               Rock pigeon  ==================
B D        American alligator  ==================
  D              Mallard duck  ==================
  D       Collared flycatcher  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
            Cape golden mole  ==================
  D  Chinese softshell turtle  ==================
          Tibetan ground jay  ==================
B D                Budgerigar  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D                    Parrot  ==================
B D       Medium ground finch  ==================
  D    White-throated sparrow  ==================
B D               Zebra finch  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D                  Platypus  ==================
B D                   Opossum  ==================
            Brush-tailed rat  ==================
          Chinese tree shrew  ==================

Inserts between block 30 and 31 in window
      Lesser Egyptian jerboa 5bp
B D           Naked mole-rat 10bp
B D               Guinea pig 10bp
                  Chinchilla 10bp
B D                      Pig 13bp
B D                  Dolphin 10bp
                Killer whale 3bp

Alignment block 31 of 423 in window, 86933693 - 86933694, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Bushbaby  tg
       Lesser Egyptian jerboa  tg
                 Prairie vole  tg
B D            Naked mole-rat  tg
B D                Guinea pig  tg
                   Chinchilla  tg
             Brush-tailed rat  tg
B D                       Pig  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  ca
B D                       Cow  tg
B D                     Sheep  cg
                Domestic goat  cg
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  tg
B D                       Dog  ca
B D                   Ferret   cg
B D                     Panda  cg
               Pacific walrus  cg
                 Weddell seal  ca
             Black flying-fox  cg
B D                   Megabat  cg
              Star-nosed mole  cc
B D                  Elephant  tg
B D                   Manatee  tg
                     Aardvark  tg
B D                 Armadillo  tg
B D                    Tenrec  ==
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Rabbit  ==
B D           Squirrel monkey  --
  D               Rock pigeon  ==
B D        American alligator  ==
  D              Mallard duck  ==
  D       Collared flycatcher  ==
B D                    Turkey  ==
B D                   Chicken  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  ==
B D                    Alpaca  --
              Bactrian camel  --
B D                   Opossum  ==
B D                  Marmoset  --
B D                  Squirrel  --
          Chinese tree shrew  ==

Alignment block 32 of 423 in window, 86933695 - 86933698, 4 bps 
B D                     Human  tttt
B D                     Chimp  tttt
B D                   Gorilla  tttt
B D                 Orangutan  tttt
B D                    Gibbon  tttt
B D                    Rhesus  tttt
B D       Crab-eating macaque  tttt
B D                    Baboon  tttt
B D              Green monkey  tttt
B D                  Bushbaby  tttt
B D                  Squirrel  tttt
       Lesser Egyptian jerboa  tttt
                 Prairie vole  ttag
               Golden hamster  tttt
B D            Naked mole-rat  tttc
B D                Guinea pig  tttt
                   Chinchilla  tttc
             Brush-tailed rat  tttc
B D                       Pig  tgtt
B D                    Alpaca  tttt
               Bactrian camel  tttt
B D                   Dolphin  tttt
                 Killer whale  tttt
             Tibetan antelope  tttt
B D                       Cow  tttt
B D                     Sheep  cttt
                Domestic goat  tttt
B D                     Horse  tttt
B D          White rhinoceros  tttt
B D                       Cat  cttt
B D                       Dog  cttt
B D                   Ferret   cttt
B D                     Panda  cttt
               Pacific walrus  cttt
                 Weddell seal  cttt
             Black flying-fox  tttt
B D                   Megabat  ttct
              Star-nosed mole  gttt
B D                  Elephant  tttt
B D                   Manatee  tttt
                     Aardvark  tttt
B D                 Armadillo  tttt
B D                    Tenrec  ====
B D                  Hedgehog  ====
         Cape elephant shrew  ====
B D                       Rat  ====
B D                     Mouse  ====
B D           Chinese hamster  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Rabbit  ====
B D           Squirrel monkey  ----
  D               Rock pigeon  ====
B D        American alligator  ====
  D              Mallard duck  ====
  D       Collared flycatcher  ====
B D                    Turkey  ====
B D                   Chicken  ====
            Cape golden mole  ====
  D  Chinese softshell turtle  ====
          Tibetan ground jay  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
B D               Zebra finch  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                  Platypus  ====
B D                   Opossum  ====
B D                  Marmoset  ----
          Chinese tree shrew  ====

Alignment block 33 of 423 in window, 86933699 - 86933729, 31 bps 
B D                     Human  atttcactctacccactttccgtgtatccgg
B D                     Chimp  atttcactctacccactttccgtgtatccga
B D                   Gorilla  atttcactctacccactttctgtgtatccga
B D                 Orangutan  atttcactctacccactttctgtgtatccgg
B D                    Gibbon  atttcactctacccactttctgtgtatccag
B D                    Rhesus  atttcactctacccactttctgtgtatctgg
B D       Crab-eating macaque  atttcactctacccactttctgtgtatctgg
B D                    Baboon  atttcactctacccactttctgtgtatctgg
B D              Green monkey  agttcactctacccactttttgtgtatctgg
B D                  Marmoset  --ttcactctacctaccttctgtgtatccag
B D           Squirrel monkey  --ttcactctacctaccttctgtgtagccag
B D                  Bushbaby  ctttcattccactccctttctgtggatctgg
B D                  Squirrel  atttcatgttatc-attttctatgtattttg
       Lesser Egyptian jerboa  atttcactgttgt-attttcaatatatctgg
                 Prairie vole  gtatctctctgtc-acttttgatgtatctgc
               Golden hamster  atttctccctgtc-acttttggtgtatctgc
B D                       Rat  atttctctccgtc-acttttggggtgtccgc
B D            Naked mole-rat  ctttcactctatc-acttgctgtgtgtttca
B D                Guinea pig  cttttattctgcc-actcactgcatgtttcc
                   Chinchilla  cttttactctctc-acttgctgtg--tttgg
             Brush-tailed rat  tcttcactctgtc-acctgctgtgcattttt
B D                       Pig  tttccactgta--------ttttatatctgc
B D                    Alpaca  ctctcactgta-------tctgtatgtctgg
               Bactrian camel  ctctcactgta-------tctgtatgtctgg
B D                   Dolphin  ttttcactgca-------tctgtatatctgg
                 Killer whale  ttttcactgca-------tctgtatatctgg
             Tibetan antelope  ctttcacagca--------ctatatatctgg
B D                       Cow  ctctcacagca--------ctatatatctgg
B D                     Sheep  ctttcaccgca--------ctatatatctgg
                Domestic goat  ctttcaccgca--------ctatatatctgg
B D                     Horse  ctttcactccatccactttctattcatctga
B D          White rhinoceros  tctttgctttatccactttctatatatctgg
B D                       Cat  ccttcactctatctgctttctgtgtatccgg
B D                       Dog  ccttcactctatccactttccatgtatcagg
B D                   Ferret   ccttccttctgtccgcttcccgtgtatcagg
B D                     Panda  ccttcattctatccactttctgtatatcggg
               Pacific walrus  ccttca-tctaaccattttccatgtatcggg
                 Weddell seal  ccttcattctaatcattttccgtgtattggg
             Black flying-fox  ccttcactcggtctgctttctgtgtctctgg
B D                   Megabat  ccttcactctgtctgctttctgtgtctctgg
              Star-nosed mole  tccttgctctctcccctttctgtctacccag
B D                  Elephant  ccttcactctacccactttctgcttatcttg
B D                   Manatee  ccttcactgtacccactttctgcttatcttg
                     Aardvark  tcttcactctacccactttctgcttatcttg
B D                 Armadillo  gcttcattctaccctctttctgctcat-tag
B D                    Tenrec  ===============================
B D                  Hedgehog  ===============================
         Cape elephant shrew  ===============================
B D                     Mouse  ===============================
B D           Chinese hamster  ===============================
B D                  Microbat  ===============================
        David's myotis (bat)  ===============================
B D                    Rabbit  ===============================
  D               Rock pigeon  ===============================
B D        American alligator  ===============================
  D              Mallard duck  ===============================
  D       Collared flycatcher  ===============================
B D                    Turkey  ===============================
B D                   Chicken  ===============================
            Cape golden mole  ===============================
  D  Chinese softshell turtle  ===============================
          Tibetan ground jay  ===============================
B D                Budgerigar  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D                    Parrot  ===============================
B D       Medium ground finch  ===============================
  D    White-throated sparrow  ===============================
B D               Zebra finch  ===============================
  D            Painted turtle  ===============================
  D           Green seaturtle  ===============================
B D                  Platypus  ===============================
B D                   Opossum  ===============================
          Chinese tree shrew  ===============================

Alignment block 34 of 423 in window, 86933730 - 86933753, 24 bps 
B D                     Human  ttccttcaaagaatagctctatt-----c
B D                     Chimp  ttccttcaaagaatagctctatt-----c
B D                   Gorilla  ttccttcaaagaatagctctatt-----c
B D                 Orangutan  ttccttcaaagaatagctctgtt-----c
B D                    Gibbon  ttccttcaaagaatagctctatt-----c
B D                    Rhesus  ttccctcaaagaatagctctatt-----c
B D       Crab-eating macaque  ttccctcaaagaatagctctatt-----c
B D                    Baboon  ttccctcaaagaatagctctatt-----c
B D              Green monkey  ttccctcaaagaatagctctatt-----c
B D                  Marmoset  ttccttcaaggaatagctctatt-----c
B D           Squirrel monkey  ttccttcaaggaatcactccatt-----c
B D                  Bushbaby  ttccttcacagcatagctctact-----g
           Chinese tree shrew  ttcctttaaacaatagcttt-ta-----c
B D                  Squirrel  accctct---gaatagctccacc-----t
       Lesser Egyptian jerboa  ttccttt---aagtagctccttg-----c
                 Prairie vole  ttcattt---gcatagatttttg-----t
               Golden hamster  ttcattt---gtatagatctctg-----c
B D                       Rat  tttattt---gcatagatctctg-----c
B D            Naked mole-rat  ttccttt---gagtggctctatg-----c
B D                Guinea pig  ttccttt---gaggggctatgtg-----c
                   Chinchilla  ttctgtt---gagtggctttatg-----c
             Brush-tailed rat  tcccttt---gagcaacttcgtg-----c
B D                       Pig  ttcctctaaagagcagctctatttccacc
B D                    Alpaca  ttcctttaaagagcagctctctt-----t
               Bactrian camel  ttcctttaaagagcagctctctt-----t
B D                   Dolphin  ttcctttaaagagcagctctatt-----c
                 Killer whale  ttcctttaaagagcagctctatt-----c
             Tibetan antelope  tt-ctttaaagaacagctctagt-----c
B D                       Cow  tt-ctttaaagagcagctctatt-----c
B D                     Sheep  tt-ctttaaagaacagctctagt-----c
                Domestic goat  tt-ctttaaagaacagctctagt-----c
B D                     Horse  tttctttaaagagcagctctatt-----c
B D          White rhinoceros  ttcctttaaagagcagctctaat-----c
             Black flying-fox  ttcctttcaggagcagcttgatc-----c
B D                   Megabat  ttcctttccggagcagcttgatc-----c
              Star-nosed mole  ttcctttaaagaagacctctgtt-----c
B D                  Elephant  tgtctgtgaagagaaaatctctt-----c
B D                   Manatee  tttctgtaaagagcagatctctt-----c
                     Aardvark  tttctgtaaagagcagatctctt-----c
B D                 Armadillo  ttccttgaaagagcagctctatt-----c
B D                    Tenrec  =============================
B D                  Hedgehog  =============================
         Cape elephant shrew  =============================
B D                     Mouse  =============================
B D           Chinese hamster  =============================
B D                  Microbat  =============================
        David's myotis (bat)  =============================
B D                    Rabbit  =============================
B D                     Panda  -----------------------------
B D                   Ferret   -----------------------------
B D                       Dog  -----------------------------
  D               Rock pigeon  =============================
B D        American alligator  =============================
  D              Mallard duck  =============================
  D       Collared flycatcher  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
            Cape golden mole  =============================
  D  Chinese softshell turtle  =============================
          Tibetan ground jay  =============================
B D                Budgerigar  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D                    Parrot  =============================
B D       Medium ground finch  =============================
  D    White-throated sparrow  =============================
B D               Zebra finch  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================
B D                  Platypus  =============================
B D                   Opossum  =============================
                Weddell seal  -----------------------------
B D                       Cat  -----------------------------
              Pacific walrus  -----------------------------

Alignment block 35 of 423 in window, 86933754 - 86933762, 9 bps 
B D                     Human  ta-------accac---ta
B D                     Chimp  ta-------accac---ta
B D                   Gorilla  ta-------accac---tg
B D                 Orangutan  ta-------accac---ta
B D                    Gibbon  ta-------accac---ta
B D                    Rhesus  ta-------accac----a
B D       Crab-eating macaque  ta-------accac----a
B D                    Baboon  ta-------accac----a
B D              Green monkey  ta-------accac----a
B D                  Marmoset  ta-------actgc---ta
B D           Squirrel monkey  tg-------actgc---ta
B D                  Bushbaby  ca-------accactgctg
           Chinese tree shrew  cc-------actcc---tg
B D                  Squirrel  gg-------ctaaccactg
       Lesser Egyptian jerboa  ca-------tccgctcctg
                 Prairie vole  ctcccacttcctaactctg
               Golden hamster  cctgcacagcccactcctg
B D                       Rat  cc-------ccttttcctg
B D            Naked mole-rat  ca-------cccaatcatt
B D                Guinea pig  c--------tcctgtcttt
                   Chinchilla  ta-------tcttgtcatt
             Brush-tailed rat  ca-------ccctgtcatc
B D                       Pig  cg-------ttccctcctg
B D                    Alpaca  ca-------actgctcctg
               Bactrian camel  ca-------gctgctcctg
B D                   Dolphin  ct-------cccattcctg
                 Killer whale  ct-------cccattcctg
             Tibetan antelope  ca-------cccactcctg
B D                       Cow  ca-------cccactcctg
B D                     Sheep  ca-------ccccctcctg
                Domestic goat  ca-------ccccctcctg
B D                     Horse  ca-------cccactcctg
B D          White rhinoceros  ca-------cccactcctg
B D                       Cat  --------------tcctg
B D                       Dog  --------------tcctg
B D                   Ferret   --------------tcctg
B D                     Panda  --------------tcctg
               Pacific walrus  --------------tcctg
                 Weddell seal  --------------tcctg
             Black flying-fox  gc-------cat--ccctg
B D                   Megabat  gc-------cat--ccctg
              Star-nosed mole  ca-------ccccctgctg
B D                  Elephant  ta-------ctcactc---
B D                   Manatee  ta-------cgcactc---
B D                    Tenrec  ta-------acaaatg---
                     Aardvark  ta-------ctcacgc---
B D                 Armadillo  ta-------cccatt----
B D                  Hedgehog  ===================
         Cape elephant shrew  ===================
B D                     Mouse  ===================
B D           Chinese hamster  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
B D                    Rabbit  ===================
  D               Rock pigeon  ===================
B D        American alligator  ===================
  D              Mallard duck  ===================
  D       Collared flycatcher  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
            Cape golden mole  ===================
  D  Chinese softshell turtle  ===================
          Tibetan ground jay  ===================
B D                Budgerigar  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D                    Parrot  ===================
B D       Medium ground finch  ===================
  D    White-throated sparrow  ===================
B D               Zebra finch  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D                  Platypus  ===================
B D                   Opossum  ===================

Inserts between block 35 and 36 in window
B D                 Elephant 231bp
B D                  Manatee 4bp
                    Aardvark 124bp

Alignment block 36 of 423 in window, 86933763 - 86933780, 18 bps 
B D                     Human  agtctt-ctcttaca----------------------ccca-
B D                     Chimp  agtctt-ctcttaca----------------------ccca-
B D                   Gorilla  agtctt-ctcttaca----------------------ccca-
B D                 Orangutan  agtctt-ctcttaca----------------------ccca-
B D                    Gibbon  agtctt-ctcttaca----------------------ccca-
B D                    Rhesus  agtcct-ctcttaca----------------------ccca-
B D       Crab-eating macaque  agtcct-ctcttaca----------------------ccca-
B D                    Baboon  agtcct-ctcttaca----------------------ccca-
B D              Green monkey  agtcct-ctcttaca----------------------ccca-
B D                  Marmoset  agtcct-ctcttcca----------------------ctca-
B D           Squirrel monkey  agtcct-ctcttaca----------------------ctca-
B D                  Bushbaby  agtctt-ttttaaac----------------------ccca-
           Chinese tree shrew  agttct-ttcttaaa----------------------tcca-
B D                  Squirrel  agtcct-ttctta-t----------------------accc-
       Lesser Egyptian jerboa  tgtcct-gtcata-a----------------------actc-
                 Prairie vole  aatcct-ctctga-a----------------------gcta-
               Golden hamster  agttcc-ctctaa-a----------------------gcca-
B D                       Rat  aatcct-ttctca-a----------------------gcca-
B D            Naked mole-rat  agtccc-ttctta-a----------------------tcca-
B D                Guinea pig  agtacc-ttctta-a----------------------tata-
                   Chinchilla  aaaccc-ttctga-a----------------------ccca-
             Brush-tailed rat  aggccc--tctga-g----------------------ccca-
B D                       Pig  aatt------cttaa---------------------tacta-
B D                    Alpaca  agttct-ttccttaa---------------------ttctg-
               Bactrian camel  agttct-ttccttaa---------------------ttctg-
B D                   Dolphin  agttct-ttccttaa---------------------tactg-
                 Killer whale  agttct-ttccttaa---------------------tactg-
             Tibetan antelope  ggtctt-ttccttaa---------------------atcta-
B D                       Cow  ggtttt-ttccttaa---------------------atctg-
B D                     Sheep  ggtctt-ttccttaa---------------------atcta-
                Domestic goat  ggtctt-ttccttaa---------------------atgta-
B D                     Horse  agtcct-gtctttac---------------------tacca-
B D          White rhinoceros  agtcct-gtccttaa---------------------tactg-
B D                       Cat  agcact-tttct-ag----------------------acta-
B D                       Dog  agccct-ttcctcag----------------------accg-
B D                   Ferret   agcctt-ttcctcag----------------------actg-
B D                     Panda  agcctt-ttcctcgg----------------------actg-
               Pacific walrus  agcctt-ttccttag----------------------actg-
                 Weddell seal  agcctt-ttcctcag----------------------actg-
             Black flying-fox  agccctcttcctcaa---------------------tgccg-
B D                   Megabat  agccctcttcctcga---------------------tgacg-
              Star-nosed mole  agtcct-gtctacaa---------------------ccctg-
B D                   Manatee  -gccct-tttcttaa----------------------tacta
B D                    Tenrec  -gatct-ttgctacc----------------------cctta
                     Aardvark  -ggtgt-ctgcttccataaaggttacagccttagaaacccta
B D                 Armadillo  --ccct-ttccttga----------------------gccg-
B D                  Hedgehog  ==========================================
         Cape elephant shrew  ==========================================
B D                     Mouse  ==========================================
B D           Chinese hamster  ==========================================
B D                  Microbat  ==========================================
        David's myotis (bat)  ==========================================
B D                    Rabbit  ==========================================
  D               Rock pigeon  ==========================================
B D        American alligator  ==========================================
  D              Mallard duck  ==========================================
  D       Collared flycatcher  ==========================================
B D                    Turkey  ==========================================
B D                   Chicken  ==========================================
            Cape golden mole  ==========================================
  D  Chinese softshell turtle  ==========================================
          Tibetan ground jay  ==========================================
B D                Budgerigar  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
  D                    Parrot  ==========================================
B D       Medium ground finch  ==========================================
  D    White-throated sparrow  ==========================================
B D               Zebra finch  ==========================================
  D            Painted turtle  ==========================================
  D           Green seaturtle  ==========================================
B D                  Platypus  ==========================================
B D                   Opossum  ==========================================
B D                  Elephant  ==========================================

Inserts between block 36 and 37 in window
B D                  Manatee 211bp
                    Aardvark 4bp

Alignment block 37 of 423 in window, 86933781 - 86933819, 39 bps 
B D                     Human  tc-tcttt----gtattccccagt---------------------gtcttatgcaatgcatataa
B D                     Chimp  tc-tcttt----gtattccccagt---------------------gtcttatgcaatgcatataa
B D                   Gorilla  tc-tcttt----gtattccccagt---------------------gtcttatgcaatgcatataa
B D                 Orangutan  tc-tcttt----gtattccccagt---------------------gtcttatgcaatgcacataa
B D                    Gibbon  tc-tcttt----gtattccccagt---------------------gtcttatgcaatgcacataa
B D                    Rhesus  tc-tcttt----gtattccccagt---------------------gccttatgcaatgcatgtaa
B D       Crab-eating macaque  tc-tcttt----gtattccccagt---------------------gccttatgcaatgcatgtaa
B D                    Baboon  tc-tcttt----gtattccccagt---------------------gccttatgcaatgcatgtaa
B D              Green monkey  tc-tcttt----gtattccccagt---------------------gccttatgcaatgcatgtaa
B D                  Marmoset  tc-tttct----ttattccccagt---------------------gtcttatgcaatgcatataa
B D           Squirrel monkey  tc-tttct----ttattccccagt---------------------gtcttctgcaatacccatga
B D                  Bushbaby  tt-attttcctgacaattcctagt---------------------gtcttataaaattcaggtaa
           Chinese tree shrew  tc-ccctt----ataatctctagt---------------------atcttgtgcagttcagataa
B D                  Squirrel  atttcctt----ttaatctccagt---------------------gtcctatgtaatttagacaa
       Lesser Egyptian jerboa  tcttcttc----ctgatcccaggc---------------------acgtcatgcaagtcagacaa
                 Prairie vole  tc----ac----ccaatccctagtcacctaatcccttatcacctaacctcatgaaagtgctaaaa
               Golden hamster  tc----ac----ctatcccctagt---------------------gtctgatgaaagacctgtaa
B D                       Rat  tc--------------ttcctagt---------------------gtctcatgaaagtcctaaag
B D            Naked mole-rat  tc-tcttc----acaatctcttac---------------------atcttacaggattagtattt
B D                Guinea pig  gc-tcttc----acaatctccagt---------------------gttttacacaattggtattt
                   Chinchilla  tc-tcttg----gctctctctaat---------------------gtcttacacaattagcattt
             Brush-tailed rat  tc-tcttc----acaatctctaat---------------------gtctcacacaattagtattt
B D                       Pig  ta-tcatt----gtaatccctatt---------------------attttatgcaattcatagaa
B D                    Alpaca  tc-ttatt----ttaatccctaat---------------------attttatgcaattcatataa
               Bactrian camel  tc-ttatt----ttaatccctatt---------------------attttatgcaattcatataa
B D                   Dolphin  tt-tcatt----gtaatcccactt---------------------actttatgcaattcatatag
                 Killer whale  tt-tcatt----gtaatcccactt---------------------actttatgcaattcatatag
             Tibetan antelope  tt-ccatt----gtaatc---ctt---------------------attttatgcaattcacgaaa
B D                       Cow  tt-ccatt----gtaatccttctt---------------------attttatgcaattcacgaaa
B D                     Sheep  tc-ccatt----gtaatccttctt---------------------attttatgcaattcacgaaa
                Domestic goat  tt-ccatt----ataatccttctt---------------------attttatgcaattcacgaaa
B D                     Horse  tc-tcctt----gtaatccctggg---------------------atcttacccaattccgataa
B D          White rhinoceros  tc-tcctt----gtaatccctagt---------------------atcttatgcaattcagataa
B D                       Cat  tc-tcctt----gtaatccctcgt---------------------attgtatgcaattcagataa
B D                       Dog  tc-tcctt----gtaatccctagt---------------------attttatacaattcagataa
B D                   Ferret   tc-tcctt----gtaatccctagt---------------------atcttatgcaatccaggtaa
B D                     Panda  tc-tcctt----ataatccctagt---------------------atcttatgcgattcagataa
               Pacific walrus  tc-tcctt----ataatccctagt---------------------atcttatgcgattcagataa
                 Weddell seal  tc-tcctt----ataatccctagt---------------------atcttatgcgattcagataa
             Black flying-fox  gc-tcctc----gtgattcctggc---------------------atttcacacagttcagagag
B D                   Megabat  gc-tcctt----gtgattcctggc---------------------atttcacacggttcagagag
              Star-nosed mole  ----------------------------------------------------------cagagtg
B D                  Elephant  tc-tcttt----gttatccctagt---------------------attctagagaattcaggttg
          Cape elephant shrew  tc-tcttt----gctgtttctgct---------------------acattatacagttcagatgg
B D                   Manatee  tc-tcttt----gttacccttagt---------------------attttatataattgagattg
B D                    Tenrec  -----------------------c---------------------cttttctataactgagg---
                     Aardvark  cc-tcttt----gctatcactagt---------------------attttacataattcagattg
B D                 Armadillo  tc-tcctt----gtattccttgat---------------------gccctacgcaattcagataa
B D                  Hedgehog  =================================================================
B D                     Mouse  =================================================================
B D           Chinese hamster  =================================================================
B D                  Microbat  =================================================================
        David's myotis (bat)  =================================================================
B D                    Rabbit  =================================================================
  D               Rock pigeon  =================================================================
B D        American alligator  =================================================================
  D              Mallard duck  =================================================================
  D       Collared flycatcher  =================================================================
B D                    Turkey  =================================================================
B D                   Chicken  =================================================================
            Cape golden mole  =================================================================
  D  Chinese softshell turtle  =================================================================
          Tibetan ground jay  =================================================================
B D                Budgerigar  =================================================================
  D          Peregrine falcon  =================================================================
  D              Saker falcon  =================================================================
  D                    Parrot  =================================================================
B D       Medium ground finch  =================================================================
  D    White-throated sparrow  =================================================================
B D               Zebra finch  =================================================================
  D            Painted turtle  =================================================================
  D           Green seaturtle  =================================================================
B D                  Platypus  =================================================================
B D                   Opossum  =================================================================

Inserts between block 37 and 38 in window
                Prairie vole 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 38 of 423 in window, 86933820 - 86933868, 49 bps 
B D                     Human  cataggc-tcccttgc------cggaggaattgccactttgggaaaaacaactcta
B D                     Chimp  tataggc-ccccttgc------cggaggaattgccactttgggaaaaacaactcta
B D                   Gorilla  cataggc-tcccttgc------cagaggaattgccactttgggaaaaacaactcta
B D                 Orangutan  cgtaggc-tcccttgc------cggaggaattgccactttgggaaaaacaactcta
B D                    Gibbon  cgtaggc-tcccttgc------cagaggaattgccagtttgggaaaaaaaactcta
B D                    Rhesus  cgtaggc-tcccttgc------cggagggattgccactttcagaaaaa-aactcta
B D       Crab-eating macaque  cgtaggc-tcccttgc------cggagggattgccactttcagaaaaa-aactcta
B D                    Baboon  cgtaggc-tcccttgc------cggagggattgccactttcagaaaaa-aactcta
B D              Green monkey  cgtaggc-tcccttgc------cggagggattgccactttcagaaaaa-aactcta