Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 255 in window, 9648047 - 9648048, 2 bps 
B D                Human  ag
B D                Chimp  ag
B D              Gorilla  ag
B D            Orangutan  ag
B D               Gibbon  ag
B D               Rhesus  gg
B D  Crab-eating macaque  gg
B D               Baboon  gg
B D         Green monkey  -g
            Weddell seal  gg
        Black flying-fox  gg
B D             Hedgehog  ==
B D           Guinea pig  ==
             Chinchilla  ==
  D     Peregrine falcon  ==
       Cape golden mole  ==
     Chinese tree shrew  ==
B D              Manatee  ==
               Aardvark  ==
B D             Elephant  ==
B D                  Cat  ==
B D             Bushbaby  ==
B D                  Pig  ==
B D              Ferret   --
B D              Dolphin  ==
B D                Panda  --
          Domestic goat  ==
B D                Sheep  ==
       Tibetan antelope  ==
        Star-nosed mole  ==
         Bactrian camel  ==
B D     White rhinoceros  ==
B D                Horse  ==
B D             Squirrel  ==
B D            Armadillo  ==
B D      Squirrel monkey  NN
B D                  Dog  --
B D                  Cow  ==
           Killer whale  ==

Alignment block 2 of 255 in window, 9648049 - 9648103, 55 bps 
B D                Human  tgctgggcgc-----------agccg-------cgcctcgcgcctcccgccc-------------cccgg
B D                Chimp  tgctgggcgc-----------agtcg-------cgcctcgcgcctcccgccc-------------cccgg
B D              Gorilla  tgctgggcgc-----------agctgcgcgtctcgcctcgcgcctcccgctc-------------cccgg
B D            Orangutan  tgctgggcgc-----------agcct--------------cgcctcccgccc-------------cccgg
B D               Gibbon  tgctgggcgc-----------agcct--------------cgcctcccgccc-------------cccgg
B D               Rhesus  tgctgggcgc-----------agcct--------------cgcttcccgccc------------acccgg
B D  Crab-eating macaque  tgctgggcgc-----------agcct--------------cgcttcccgccc------------acccgg
B D               Baboon  tgctgggcgc-----------agcct--------------cgcttcccgccc------------acgcgg
B D         Green monkey  tgctgggcgg-----------agcct--------------cgcctcccgccc------------acccgg
B D     White rhinoceros  tgctgggcccccggctggcgccgcc------------------gtcctgggc------------------
            Weddell seal  tgctgcttcc-----------------------------------cctgga-------------------
        Black flying-fox  --ttgggcct-----tgagaaagcca--------------agtatcctgcacatactttcttctactcga
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
  D     Peregrine falcon  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D                  Cat  ======================================================================
B D             Bushbaby  ======================================================================
B D                  Pig  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D              Dolphin  ======================================================================
B D                Panda  ----------------------------------------------------------------------
          Domestic goat  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ======================================================================
         Bactrian camel  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
B D      Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Dog  ----------------------------------------------------------------------
B D                  Cow  ======================================================================
           Killer whale  ======================================================================

                   Human  ggctgcggcggggacg
                   Chimp  ggctgcggcggggacg
                 Gorilla  ggctgcggcggggacg
               Orangutan  ggctgcggcggggagg
                  Gibbon  ggctgcggcggggacg
                  Rhesus  ggctgcggcggggacg
     Crab-eating macaque  ggctgcggcggggacg
                  Baboon  ggct-----------g
            Green monkey  agctgcggcggggacg
        White rhinoceros  -gctggcact------
            Weddell seal  ----------------
        Black flying-fox  ggccggtatc------
                Hedgehog  ================
              Guinea pig  ================
              Chinchilla  ================
        Peregrine falcon  ================
        Cape golden mole  ================
      Chinese tree shrew  ================
                 Manatee  ================
                Aardvark  ================
                Elephant  ================
                     Cat  ================
                Bushbaby  ================
                     Pig  ================
                 Ferret   ----------------
                 Dolphin  ================
                   Panda  ----------------
           Domestic goat  ================
                   Sheep  ================
        Tibetan antelope  ================
         Star-nosed mole  ================
          Bactrian camel  ================
                   Horse  ================
                Squirrel  ================
               Armadillo  ================
         Squirrel monkey  NNNNNNNNNNNNNNNN
                     Dog  ----------------
                     Cow  ================
            Killer whale  ================

Inserts between block 2 and 3 in window
B D    White rhinoceros 18bp
       Black flying-fox 8bp

Alignment block 3 of 255 in window, 9648104 - 9648106, 3 bps 
B D                Human  ctt
B D                Chimp  ctt
B D              Gorilla  ctt
B D            Orangutan  ctt
B D               Gibbon  ctt
B D               Rhesus  ctt
B D  Crab-eating macaque  ctt
B D               Baboon  ctt
B D         Green monkey  ctt
B D                Horse  ctt
B D     White rhinoceros  cgt
        Black flying-fox  cct
B D             Hedgehog  ===
B D           Guinea pig  ===
             Chinchilla  ===
  D     Peregrine falcon  ===
       Cape golden mole  ===
     Chinese tree shrew  ===
B D              Manatee  ===
               Aardvark  ===
B D             Elephant  ===
B D                  Cat  ===
B D             Bushbaby  ===
B D                  Pig  ===
B D              Ferret   ---
B D              Dolphin  ===
B D                Panda  ---
          Domestic goat  ===
B D                Sheep  ===
       Tibetan antelope  ===
        Star-nosed mole  ===
         Bactrian camel  ===
B D             Squirrel  ===
B D            Armadillo  ===
           Weddell seal  ---
B D      Squirrel monkey  NNN
B D                  Dog  ---
B D                  Cow  ===
           Killer whale  ===

Alignment block 4 of 255 in window, 9648107 - 9648112, 6 bps 
B D                Human  ctctgg
B D                Chimp  ctctgg
B D              Gorilla  ctctgg
B D            Orangutan  ctctgg
B D               Gibbon  ctctgg
B D               Rhesus  ctctgg
B D  Crab-eating macaque  ctctgg
B D               Baboon  ctctgg
B D         Green monkey  ctctgg
B D                Horse  ctctg-
B D     White rhinoceros  cctcc-
B D                  Dog  ccctg-
        Black flying-fox  ccccc-
B D             Hedgehog  ======
B D           Guinea pig  ======
             Chinchilla  ======
  D     Peregrine falcon  ======
       Cape golden mole  ======
     Chinese tree shrew  ======
B D              Manatee  ======
               Aardvark  ======
B D             Elephant  ======
B D                  Cat  ======
B D             Bushbaby  ======
B D                  Pig  ======
B D              Ferret   ------
B D              Dolphin  ======
B D                Panda  ------
          Domestic goat  ======
B D                Sheep  ======
       Tibetan antelope  ======
        Star-nosed mole  ======
         Bactrian camel  ======
B D             Squirrel  ======
B D            Armadillo  ======
           Weddell seal  ------
B D      Squirrel monkey  NNNNNN
B D                  Cow  ======
           Killer whale  ======

Alignment block 5 of 255 in window, 9648113 - 9648129, 17 bps 
B D                Human  aggg---tgtg-gcggaaact
B D                Chimp  aggg---tgtg-gcggaaact
B D              Gorilla  aggg---tgtg-gcggaaact
B D            Orangutan  aggg---tgtg-gcagaaact
B D               Gibbon  aggg---tgtg-gcggaaact
B D               Rhesus  gaga---tgt--gcggaaact
B D  Crab-eating macaque  agga---tgt--gcggaaact
B D               Baboon  agga---tgt--gcggaaact
B D         Green monkey  agga---tgt--gcggaaact
B D              Dolphin  aggc---ggtg-gcagaaggt
            Killer whale  aggc---ggtg-gcagaaggt
B D                Horse  agaa---cgtg-gcaggaagt
B D     White rhinoceros  agaa---ctgg-gcaggaggt
B D                  Dog  gcaggtgctggtgcaggtagt
            Weddell seal  -------ctgg-acaggtggt
        Black flying-fox  agga---cttg-gcgggtggt
B D             Hedgehog  =====================
B D           Guinea pig  =====================
             Chinchilla  =====================
  D     Peregrine falcon  =====================
       Cape golden mole  =====================
     Chinese tree shrew  =====================
B D              Manatee  =====================
               Aardvark  =====================
B D             Elephant  =====================
B D                  Cat  =====================
B D             Bushbaby  =====================
B D                  Pig  =====================
B D              Ferret   ---------------------
B D                Panda  ---------------------
          Domestic goat  =====================
B D                Sheep  =====================
       Tibetan antelope  =====================
        Star-nosed mole  =====================
         Bactrian camel  =====================
B D             Squirrel  =====================
B D            Armadillo  =====================
B D      Squirrel monkey  NNNNNNNNNNNNNNNNNNNNN
B D                  Cow  =====================

Alignment block 6 of 255 in window, 9648130 - 9648130, 1 bps 
B D                Human  t
B D                Chimp  t
B D              Gorilla  t
B D            Orangutan  t
B D               Gibbon  t
B D               Rhesus  t
B D  Crab-eating macaque  t
B D               Baboon  t
B D         Green monkey  g
B D              Dolphin  t
            Killer whale  t
B D                Horse  t
B D     White rhinoceros  t
B D                  Dog  t
B D                Panda  t
            Weddell seal  t
        Black flying-fox  t
B D             Hedgehog  =
B D           Guinea pig  =
             Chinchilla  =
  D     Peregrine falcon  =
       Cape golden mole  =
     Chinese tree shrew  =
B D              Manatee  =
               Aardvark  =
B D             Elephant  =
B D                  Cat  =
B D             Bushbaby  =
B D                  Pig  =
B D              Ferret   -
          Domestic goat  =
B D                Sheep  =
       Tibetan antelope  =
        Star-nosed mole  =
         Bactrian camel  =
B D             Squirrel  =
B D            Armadillo  =
B D      Squirrel monkey  N
B D                  Cow  =

Alignment block 7 of 255 in window, 9648131 - 9648207, 77 bps 
B D                Human  gaggcttggagtccg--------cgggaccgg--a-aggggctccgta-gctcggg-g------------
B D                Chimp  gaggcttggagtccg--------cgggaccgg--a-agtggctccgta-gctcggg-g------------
B D              Gorilla  gaggcttggagtccg--------cgggaccgg--a-aggggctccgta-gctcggg-g------------
B D            Orangutan  gaggcttggagtccg--------cgggaccgg--a-aggggctccgtagggtcggg-g------------
B D               Gibbon  gaggcttggagtccg--------cgggcccgg--a-aggggctccgta-ggtcggg-g------------
B D               Rhesus  gaggtttggagcccg--------ttggaccgg-aa-aggggctgcgta-ggtgggt-g------------
B D  Crab-eating macaque  gaggtttggagcccg--------ttggaccgg-aa-aggggctgcgta-ggtgggt-g------------
B D               Baboon  gaggtttggagcccg--------ttggaccgg-aa-aggggctccgta-ggtgggt-g------------
B D         Green monkey  gaggtttgcagcccg--------tgggaccgg--a-aggggctccgta-ggtgggg-g------------
B D              Dolphin  gaggcctggaagcca---------gagaccgtcca-ggaggggctgcg-gatggggag------------
            Killer whale  gaggcctggaagcca---------gagaccgtcca-ggaggggccgcg-gatggggag------------
B D                Horse  gaggcctggctg------------------gg----aggggttctgca-gatggtgag------------
B D     White rhinoceros  gagacctggcagccgcggagccggggcctcgg----cggagttccgca-gacggtgagcgggtcagggac
B D                  Dog  gtggcctgggagcag-------agggccctgggca-caaggacccgca-gctgcagag------------
B D                Panda  gcagcctggaagtgg--------gggcactgggctcagggggtctgca-gccatggag------------
            Weddell seal  gcggcctggaagcag--------gggcactgggct-agggggtccgca-gctgtggag------------
        Black flying-fox  gaggcctggatctag-----tgaagacctaggact-tgtggtgagata-gatgtga--------------
  D     Peregrine falcon  gagccttggtccccc--------------cgg--g-agggtctgcatg-gctgagg-g------------
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D                  Cat  ======================================================================
B D             Bushbaby  ======================================================================
B D                  Pig  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
          Domestic goat  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ======================================================================
         Bactrian camel  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
B D      Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Cow  ======================================================================

                   Human  ----cagggtggg----------------------c--gcgagaga---------gcctagaagcccat
                   Chimp  ----cagggtggg----------------------c--gcgagaga---------gcctagaagcccat
                 Gorilla  ----cagggtggg----------------------c--gcgagaga---------gcctagaagcccat
               Orangutan  ----cagggtggg----------------------t--gcgagaga---------gcctagaagcccat
                  Gibbon  ----cagggtggg----------------------c--gcgagaga---------gcctagaagcccat
                  Rhesus  ----cagtgtggg----------------------c--gcgagaga---------gcctagaagcctat
     Crab-eating macaque  ----cagtgtggg----------------------c--gcgagaga---------gcctagaagcctat
                  Baboon  ----cagtgtggg----------------------c--gcgagaga---------gcctagaagcctat
            Green monkey  ----cagggtggg----------------------c--gcgagaga---------gcctagaagcctat
                 Dolphin  ----ggatgtggg--------------------------atgggga---------gggat---------
            Killer whale  ----ggatgtgggcgcagaccctgaagctggagccc--cctggagagcgcgc---ggggg---------
                   Horse  ----gagccttga-------------------ggcc--accggaga---------gggcgtgggcctgg
        White rhinoceros  tgaagaactttga-------------------cgcc--actgg-ga---------gggcgcgggcctgg
                     Dog  ----gggtccagg-------------------gcacagactggaaa---------aggacaggccacct
                   Panda  ----gagtctggg-------------------gcacagatgggaga---------aggacaggccccat
            Weddell seal  ----gggtctggg-------------------gcacagacgggaga---------aggacagaccatgt
        Black flying-fox  ----gaacttgag-------------------gctt--cctggaggtcacagttctggggaggtcacat
        Peregrine falcon  ----cagggtggg----------------------t--acagaggt---------gct-----------
                Hedgehog  =====================================================================
              Guinea pig  =====================================================================
              Chinchilla  =====================================================================
        Cape golden mole  =====================================================================
      Chinese tree shrew  =====================================================================
                 Manatee  =====================================================================
                Aardvark  =====================================================================
                Elephant  =====================================================================
                     Cat  =====================================================================
                Bushbaby  =====================================================================
                     Pig  =====================================================================
                 Ferret   ---------------------------------------------------------------------
           Domestic goat  =====================================================================
                   Sheep  =====================================================================
        Tibetan antelope  =====================================================================
         Star-nosed mole  =====================================================================
          Bactrian camel  =====================================================================
                Squirrel  =====================================================================
               Armadillo  =====================================================================
         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Cow  =====================================================================

Alignment block 8 of 255 in window, 9648208 - 9648221, 14 bps 
B D                Human  gtagccg-cgaatcc-
B D                Chimp  gtagccg-cgaatcc-
B D              Gorilla  gtagccg-cgaatcc-
B D            Orangutan  gtagcag-cgaatcc-
B D               Gibbon  gtagccg-cgaatcc-
B D               Rhesus  gtaggtg-cgaatcc-
B D  Crab-eating macaque  gtaggtg-cgaatcc-
B D               Baboon  gtaggtg-cgaatcc-
B D         Green monkey  gtaggtg-cgaatcc-
B D                  Pig  gtgacag-tggagtt-
B D              Dolphin  gtgggcg-cagaccc-
            Killer whale  gggggca-gagagtt-
B D                Horse  ------g-gagcagc-
B D     White rhinoceros  ------g-gagcagc-
B D                  Dog  ------g-cagaggt-
B D                Panda  ------g-cagaggt-
            Weddell seal  ------g-cagaggt-
        Black flying-fox  ------gtcagagtt-
  D     Peregrine falcon  ---gtgg-ccgtttct
B D             Hedgehog  ================
B D           Guinea pig  ================
             Chinchilla  ================
       Cape golden mole  ================
     Chinese tree shrew  ================
B D              Manatee  ================
               Aardvark  ================
B D             Elephant  ================
B D                  Cat  ================
B D             Bushbaby  ================
B D              Ferret   ----------------
          Domestic goat  ================
B D                Sheep  ================
       Tibetan antelope  ================
        Star-nosed mole  ================
         Bactrian camel  ================
B D             Squirrel  ================
B D            Armadillo  ================
B D      Squirrel monkey  NNNNNNNNNNNNNNNN
B D                  Cow  ================

Inserts between block 8 and 9 in window
B D               Horse 10bp
B D    White rhinoceros 10bp
B D                 Dog 2bp
B D               Panda 2bp
           Weddell seal 2bp
       Black flying-fox 2bp

Alignment block 9 of 255 in window, 9648222 - 9648222, 1 bps 
B D                Human  -c
B D                Chimp  -c
B D              Gorilla  -c
B D            Orangutan  -c
B D               Gibbon  -c
B D               Rhesus  -c
B D  Crab-eating macaque  -c
B D               Baboon  -c
B D         Green monkey  -c
B D                  Pig  -t
B D              Dolphin  -c
            Killer whale  -c
B D                  Cow  -c
  D     Peregrine falcon  g-
B D             Hedgehog  ==
B D           Guinea pig  ==
             Chinchilla  ==
       Cape golden mole  ==
     Chinese tree shrew  ==
B D              Manatee  ==
               Aardvark  ==
B D             Elephant  ==
B D                  Cat  ==
B D             Bushbaby  ==
B D              Ferret   --
B D                Panda  ==
          Domestic goat  ==
B D                Sheep  ==
       Tibetan antelope  ==
        Star-nosed mole  ==
         Bactrian camel  ==
       Black flying-fox  ==
B D     White rhinoceros  ==
B D                Horse  ==
B D             Squirrel  ==
B D            Armadillo  ==
           Weddell seal  ==
B D      Squirrel monkey  NN
B D                  Dog  ==

Alignment block 10 of 255 in window, 9648223 - 9648227, 5 bps 
B D                Human  ---gcagc
B D                Chimp  ---gcagc
B D              Gorilla  ---gcagc
B D            Orangutan  ---gcagc
B D               Gibbon  ---gcag-
B D               Rhesus  ---gcagc
B D  Crab-eating macaque  ---gcagc
B D               Baboon  ---gcagc
B D         Green monkey  ---gcagc
B D                  Pig  ---gcagt
B D              Dolphin  ---gaagc
            Killer whale  ---atagc
B D                  Cow  ---gcagc
B D                Horse  ---gcagc
B D     White rhinoceros  ---gcagc
B D                  Cat  ---gcagc
B D                  Dog  ---gtagc
B D                Panda  ---gcagc
            Weddell seal  ---gcagc
        Black flying-fox  ---gtagc
  D     Peregrine falcon  tttgc---
B D             Hedgehog  ========
B D           Guinea pig  ========
             Chinchilla  ========
       Cape golden mole  ========
     Chinese tree shrew  ========
B D              Manatee  ========
               Aardvark  ========
B D             Elephant  ========
B D             Bushbaby  ========
B D              Ferret   --------
          Domestic goat  ========
B D                Sheep  ========
       Tibetan antelope  ========
        Star-nosed mole  ========
         Bactrian camel  ========
B D             Squirrel  ========
B D            Armadillo  ========
B D      Squirrel monkey  NNNNNNNN

Inserts between block 10 and 11 in window
B D             Dolphin 74bp

Alignment block 11 of 255 in window, 9648228 - 9648252, 25 bps 
B D                Human  cccagtac--acctccctccgtgcctc
B D                Chimp  cccaatac--acctccctccgtgcctc
B D              Gorilla  cccaatac--acctccctccgtgcctc
B D            Orangutan  cccaatac--acctccctccgtccctc
B D               Gibbon  ccgaatac--acctccctccgtgcctc
B D               Rhesus  cccagtac--tcctccctcggtgcttc
B D  Crab-eating macaque  cccagtac--tcctccctcggtgcttc
B D               Baboon  cccagtac--tcctacctcggtgcttc
B D         Green monkey  cccagtac--tcctccctcggtgcttc
B D                  Pig  cctaaga---ccctccatccccac---
            Killer whale  cctgaga---ccagccatccccac---
B D                  Cow  cctgaga---cgccgcatcccc-c---
B D                Horse  cctgagat--ccgtgggtccgcacatc
B D     White rhinoceros  cccgagac--ccctgtgtccgcacttc
B D                  Cat  cctgagac--tcctccgtccccgcttt
B D                  Dog  cctaaga---cctcctacctgcactct
B D                Panda  cctaagac--ccccctagctgcactct
            Weddell seal  cctaagaccaccccccagctgcatttt
        Black flying-fox  tgtgaaac--atcttcttctgcactcc
  D     Peregrine falcon  cttaccac--tcccgactgtttacaaa
B D             Hedgehog  ===========================
B D           Guinea pig  ===========================
             Chinchilla  ===========================
       Cape golden mole  ===========================
     Chinese tree shrew  ===========================
B D              Manatee  ===========================
               Aardvark  ===========================
B D             Elephant  ===========================
B D             Bushbaby  ===========================
B D              Ferret   ---------------------------
B D              Dolphin  ===========================
          Domestic goat  ===========================
B D                Sheep  ===========================
       Tibetan antelope  ===========================
        Star-nosed mole  ===========================
         Bactrian camel  ===========================
B D             Squirrel  ===========================
B D            Armadillo  ===========================
B D      Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 11 and 12 in window
B D                 Pig 4bp
           Killer whale 4bp
B D                 Cow 7bp
B D               Horse 1bp
B D    White rhinoceros 1bp
B D                 Cat 1bp
B D                 Dog 1bp
B D               Panda 1bp
           Weddell seal 1bp
       Black flying-fox 1bp

Alignment block 12 of 255 in window, 9648253 - 9648253, 1 bps 
B D                Human  c
B D                Chimp  c
B D              Gorilla  c
B D            Orangutan  c
B D               Gibbon  c
B D               Rhesus  c
B D  Crab-eating macaque  c
B D               Baboon  c
B D         Green monkey  c
  D     Peregrine falcon  c
B D             Hedgehog  =
B D           Guinea pig  =
             Chinchilla  =
       Cape golden mole  =
     Chinese tree shrew  =
B D              Manatee  =
               Aardvark  =
B D             Elephant  =
B D                  Cat  =
B D             Bushbaby  =
B D                  Pig  =
B D              Ferret   -
B D              Dolphin  =
B D                Panda  =
          Domestic goat  =
B D                Sheep  =
       Tibetan antelope  =
        Star-nosed mole  =
         Bactrian camel  =
       Black flying-fox  =
B D     White rhinoceros  =
B D                Horse  =
B D             Squirrel  =
B D            Armadillo  =
           Weddell seal  =
B D      Squirrel monkey  N
B D                  Dog  =
B D                  Cow  =
           Killer whale  =

Alignment block 13 of 255 in window, 9648254 - 9648270, 17 bps 
B D                Human  -ccgccttttctgcagag
B D                Chimp  -ccgccttttctgcagag
B D              Gorilla  -ccgccttttctgcagag
B D            Orangutan  -ccgccttttctgcagag
B D               Gibbon  -ccgccttttctgcagag
B D               Rhesus  -ccgccttttctgcagag
B D  Crab-eating macaque  -ccgccttttctgcagag
B D               Baboon  -ccgccttttctgcagag
B D         Green monkey  -ccgccttttctgcagag
      Chinese tree shrew  -ccgccctgtctgccgcg
B D                  Pig  -ccgcccctgctccaatg
B D              Dolphin  -ccgccaccgctccagca
            Killer whale  -ccgccaccgctccagca
B D                  Cow  -ccacttctgatccagag
B D                Horse  -ctactttttctccagag
B D     White rhinoceros  -ctgctccttctccggag
B D                  Cat  -cctct--ttctccggag
B D                  Dog  -cttct--tttttgagag
B D                Panda  -ccgct--ttgtccagag
            Weddell seal  -ccact--ttctccagag
        Black flying-fox  -tggctttttctccagag
  D     Peregrine falcon  actggcctttttaa----
B D             Hedgehog  ==================
B D           Guinea pig  ==================
             Chinchilla  ==================
       Cape golden mole  ==================
B D              Manatee  ==================
               Aardvark  ==================
B D             Elephant  ==================
B D             Bushbaby  ==================
B D              Ferret   ------------------
          Domestic goat  ==================
B D                Sheep  ==================
       Tibetan antelope  ==================
        Star-nosed mole  ==================
         Bactrian camel  ==================
B D             Squirrel  ==================
B D            Armadillo  ==================
B D      Squirrel monkey  NNNNNNNNNNNNNNNNNN

Alignment block 14 of 255 in window, 9648271 - 9648274, 4 bps 
B D                Human  -ctcc
B D                Chimp  -ctcc
B D              Gorilla  -ctcc
B D            Orangutan  -ctcc
B D               Gibbon  -ctcc
B D               Rhesus  -cccc
B D  Crab-eating macaque  -cccc
B D               Baboon  -cccc
B D         Green monkey  -cccc
B D             Bushbaby  -ctcc
B D                  Pig  -cctg
B D              Dolphin  -ccat
            Killer whale  -ccag
B D                  Cow  -caaa
B D                Horse  -ctcc
B D     White rhinoceros  -ctcc
B D                  Cat  -ttcc
B D                  Dog  -ctca
B D                Panda  -cttc
            Weddell seal  -ctcc
        Black flying-fox  -tcc-
  D     Peregrine falcon  attt-
B D             Hedgehog  =====
B D           Guinea pig  =====
             Chinchilla  =====
       Cape golden mole  =====
     Chinese tree shrew  -----
B D              Manatee  =====
               Aardvark  =====
B D             Elephant  =====
B D              Ferret   -----
          Domestic goat  =====
B D                Sheep  =====
       Tibetan antelope  =====
        Star-nosed mole  =====
         Bactrian camel  =====
B D             Squirrel  =====
B D            Armadillo  =====
B D      Squirrel monkey  NNNNN

Inserts between block 14 and 15 in window
B D               Horse 4730bp
B D    White rhinoceros 6000bp

Alignment block 15 of 255 in window, 9648275 - 9648381, 107 bps 
B D                Human  gccc---------------tg----gagt---g-aa-ggaggagccgtcacctggagctc----cgaaaa
B D                Chimp  gccc---------------tg----gagt---g-aa-ggaggaggcgtcacctggagctc----cgaaaa
B D              Gorilla  gccc---------------tg----gagt---g-aa-ggaggagccgtcacctggagctc----cgaaaa
B D            Orangutan  gccc---------------tggagtgagt---g-aa-ggaggagccgtcacctggggctc----cg-aaa
B D               Gibbon  gccc---------------tg----gagt---g-aa-ggaggagccgtcacctggagctc----cgaaaa
B D               Rhesus  gccc---------------tg----gagt---g-aa-ggaggagccttctcctggagctc----cgaaaa
B D  Crab-eating macaque  gccc---------------tg----gagt---g-aa-ggaggagccttctcctggagctc----cgaaaa
B D               Baboon  gccc---------------tg----gagt---g-aa-ggaggagccttctcctggagctc----ggaaaa
B D         Green monkey  gccc---------------tg----gagt---g-aa-ggaggagccttcacctggagctc----cgaaaa
B D             Bushbaby  tccc---------------cc----g-gt---t-aa-agagagacagtcacctggagaac----agaaaa
      Chinese tree shrew  -ctc---------------cc----gagttggg-ga-ggaggagccattaccgggaaaga----aagaca
B D                  Pig  --gt---------------ca----tggt---g-aa-ggaggaaccgccact---------------aag
B D              Dolphin  --gt---------------ca----cagt---gaaa-agaggagccgccaaagggaga------accgag
            Killer whale  --gt---------------ca----cagt---gaaa-agaggagccgccgacgggaga------accgag
B D                  Cow  --gc---------------ca----tagt---g-aa-agagaaaccgctaccga-------------gag
B D                  Cat  caga---------------------gagt---g-aa-ggaggaaccagcatcgggag-----ccaaaaaa
B D                  Dog  gagtgaaacaggaacca--ta----gagt---g-aa-acaggaaccataattaggagagggggaaaagaa
B D                Panda  ctgt---------------tg----gagt---g-aa-agaggaactaccaccaggaaggg--gaaaaaaa
            Weddell seal  ccgt---------------tg----gagt---g-aa-agagaaaccatcaccaggaaagg----aaaaaa
        Black flying-fox  ---------------taacta----ctcc---a-aa-tgaggaac-attaccagaaacag----aaacaa
  D     Peregrine falcon  ---------attttatacgtg----caga---a-agcggagggacctcgact------------caataa
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
          Domestic goat  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ======================================================================
         Bactrian camel  ======================================================================
B D     White rhinoceros  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
B D      Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  aagca----gaagaaggcgctt------tttatttagcc---agtgtgacccc--gccagggccttctcg
                   Chimp  aagca----gaagaaggcgctt------tttatttagcc---agtgtgacccc--gccagggccttctcg
                 Gorilla  aagca----gaagaaggcgctt------tttatttagcc---agtgtgacccc--gccagggccttctcg
               Orangutan  aagca----gaagaaggcgctt------tttatttagcc---agtgtgacccc--gccagggccttctca
                  Gibbon  aagc-------agaaggcgctt------tttatttagct---agtgtgacccc--gccagagccttctca
                  Rhesus  aagcg----gaagaaggcggcttcgc-ttcgatttaccc---agtgtgacccc--tccagggccttctca
     Crab-eating macaque  aagcg----gaaggcggcggcttcgc-ttcgatttaccc---agtgtgacccc--tccagggccttctca
                  Baboon  aagcg----gaagaaggcggcttcgc-ctcgatttaccc---agtgtgacccc--tccggggccttctca
            Green monkey  aagcg----gaagaaggcggcttcgc-ttcgatttaccc---agtgtgacccc--tccagggccttctca
                Bushbaby  gcgcg----aaagaaggcagcttctc-cgggagcacaag---agagtgacaccaagccaggggcttccta
      Chinese tree shrew  aagagggacgaggagagcgccccctc-cagggctcgccc--gactgtgacctc--agccgggctgtccca
                     Pig  aagag----gaag--------gcctt-----------------------------gccgggtctttccca
                 Dolphin  aagag----gaagaagaaaacgccttccttggtttcacccaggctgtgaactc--tccagggctttccca
            Killer whale  aagag----gaagaagaaaacgccttccttggtttcacccaggctgtgaactc--tccagggctttccca
                     Cow  aagag----aaagaagaaattgcctt-cttggtctctagcaggttgcaaactc--tccagggctgtccca
                     Cat  aggcg----gaagaagaaaaggccgc-ccgggtttcgcccagggtgtgacct---ccgagggccttccta
                     Dog  agggg----gaaggagaacatgcctt-ctggatttctca--gggtttgacct---ctcagggccttacta
                   Panda  agggg----aaaaaaggaaatacttt-ctgagtttctctcagggtttgactt---cccagggccttccta
            Weddell seal  atgag----gaagaagaaaatgcctt-ct------------gggtttggcct---cccagggccttccta
        Black flying-fox  aaaat----gcagaag-------------------------ggg--tgactt---gccagggacttcc--
        Peregrine falcon  aagtg----acattgtggtgcgtgtg-ccaggcaggcat---gaggtggtttt--tgtggagc-------
                Hedgehog  ======================================================================
              Guinea pig  ======================================================================
              Chinchilla  ======================================================================
        Cape golden mole  ======================================================================
                 Manatee  ======================================================================
                Aardvark  ======================================================================
                Elephant  ======================================================================
                 Ferret   ----------------------------------------------------------------------
           Domestic goat  ======================================================================
                   Sheep  ======================================================================
        Tibetan antelope  ======================================================================
         Star-nosed mole  ======================================================================
          Bactrian camel  ======================================================================
        White rhinoceros  ======================================================================
                   Horse  ======================================================================
                Squirrel  ======================================================================
               Armadillo  ======================================================================
         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                   Human  gt---tgggtgag
                   Chimp  gt---tgggtgag
                 Gorilla  gt---tgggtgag
               Orangutan  gt---tgggtgag
                  Gibbon  gt---tgggtgag
                  Rhesus  ga---tgggtgag
     Crab-eating macaque  ga---tgggtgag
                  Baboon  gt---tgggtgag
            Green monkey  gc---tgggtgag
                Bushbaby  g-----gggtgag
      Chinese tree shrew  gc---gaggtgag
                     Pig  atgtgggggtgag
                 Dolphin  aca--gaggtgag
            Killer whale  aca--ggggtgag
                     Cow  atac-ggggtgaa
                     Cat  gt---ctggtgaa
                     Dog  gc---ctggtgaa
                   Panda  gc---ctggtaaa
            Weddell seal  gc---ctggtaaa
        Black flying-fox  -------------
        Peregrine falcon  -----tgggggag
                Hedgehog  =============
              Guinea pig  =============
              Chinchilla  =============
        Cape golden mole  =============
                 Manatee  =============
                Aardvark  =============
                Elephant  =============
                 Ferret   -------------
           Domestic goat  =============
                   Sheep  =============
        Tibetan antelope  =============
         Star-nosed mole  =============
          Bactrian camel  =============
        White rhinoceros  =============
                   Horse  =============
                Squirrel  =============
               Armadillo  =============
         Squirrel monkey  NNNNNNNNNNNNN

Alignment block 16 of 255 in window, 9648382 - 9648389, 8 bps 
B D                Human  -cactct-ct
B D                Chimp  -cactct-ct
B D              Gorilla  -cactcc-ct
B D            Orangutan  -caccct-ct
B D               Gibbon  -caccct-ct
B D               Rhesus  -catccg-ct
B D  Crab-eating macaque  -catccg-ct
B D               Baboon  -catacg-ct
B D         Green monkey  -catccg-ct
B D             Bushbaby  -tatctg-tc
      Chinese tree shrew  -catcgt-cc
B D                  Pig  ------c-gt
          Bactrian camel  --caccc-gc
B D              Dolphin  ------g-gt
            Killer whale  ------g-gt
B D                  Cow  ------c-at
B D                  Cat  -cat--g-cc
B D                  Dog  -cttctgccc
B D                Panda  -cttctg-ct
            Weddell seal  -cttcag-cc
        Black flying-fox  -ccacagcat
  D     Peregrine falcon  gaagatg-ct
B D             Hedgehog  ==========
B D           Guinea pig  ==========
             Chinchilla  ==========
       Cape golden mole  ==========
B D              Manatee  ==========
               Aardvark  ==========
B D             Elephant  ==========
B D              Ferret   ----------
          Domestic goat  ==========
B D                Sheep  ==========
       Tibetan antelope  ==========
        Star-nosed mole  ==========
B D     White rhinoceros  ==========
B D                Horse  ==========
B D             Squirrel  ==========
B D            Armadillo  ==========
B D      Squirrel monkey  NNNNNNNNNN

Alignment block 17 of 255 in window, 9648390 - 9648402, 13 bps 
B D                Human  -ctgaccaggccat
B D                Chimp  -ttgaccaggccat
B D              Gorilla  -ctgaccaggccat
B D            Orangutan  -ctgaccaggccat
B D               Gibbon  -ctgaccagtccat
B D               Rhesus  -ctgaccaggccat
B D  Crab-eating macaque  -ctgaccaggccat
B D               Baboon  -ctgaccaggccat
B D         Green monkey  -ctgaacagaccat
B D      Squirrel monkey  -ccgaccaggccat
B D             Bushbaby  -cataccaggccat
      Chinese tree shrew  -gtggccaggctct
B D                  Pig  -ccaggctaaacag
          Bactrian camel  -tttggctggccat
B D              Dolphin  -ctggcctagacag
            Killer whale  -ctggcctagacag
B D                  Cow  -ctggcctagttgc
B D                  Cat  -ctggccaggccac
B D                  Dog  -ctggccagaccat
B D                Panda  -ctggccaggccat
            Weddell seal  -ctggccaggccat
        Black flying-fox  -ttcgccaggctat
  D     Peregrine falcon  ccgaggcaggat--
B D             Hedgehog  ==============
B D           Guinea pig  ==============
             Chinchilla  ==============
       Cape golden mole  ==============
B D              Manatee  ==============
               Aardvark  ==============
B D             Elephant  ==============
B D              Ferret   --------------
          Domestic goat  ==============
B D                Sheep  ==============
       Tibetan antelope  ==============
        Star-nosed mole  ==============
B D     White rhinoceros  ==============
B D                Horse  ==============
B D             Squirrel  ==============
B D            Armadillo  ==============

Inserts between block 17 and 18 in window
B D                 Pig 9bp
         Bactrian camel 2bp
B D             Dolphin 8bp
           Killer whale 8bp
B D                 Cow 2bp
B D                 Cat 2bp
B D                 Dog 2bp
B D               Panda 2bp
           Weddell seal 2bp
       Black flying-fox 2bp

Alignment block 18 of 255 in window, 9648403 - 9648407, 5 bps 
B D                Human  ga--aaa
B D                Chimp  ga--aaa
B D              Gorilla  ga--aaa
B D            Orangutan  aa--aaa
B D               Gibbon  ga--aaa
B D               Rhesus  ga--aaa
B D  Crab-eating macaque  ga--aaa
B D               Baboon  ga--aaa
B D         Green monkey  ga--aaa
B D      Squirrel monkey  g---gaa
B D             Bushbaby  tag-gga
      Chinese tree shrew  tc--aga
B D                  Pig  ------a
          Bactrian camel  ------a
B D              Dolphin  ------a
            Killer whale  ------a
B D                  Cow  ------g
           Domestic goat  ------a
B D                  Cat  ------g
B D                  Dog  ------g
B D                Panda  ------g
            Weddell seal  ------g
        Black flying-fox  ------c
  D     Peregrine falcon  --gcagg
B D             Hedgehog  =======
B D           Guinea pig  =======
             Chinchilla  =======
       Cape golden mole  =======
B D              Manatee  =======
               Aardvark  =======
B D             Elephant  =======
B D              Ferret   -------
B D                Sheep  =======
       Tibetan antelope  =======
        Star-nosed mole  =======
B D     White rhinoceros  =======
B D                Horse  =======
B D             Squirrel  =======
B D            Armadillo  =======

Inserts between block 18 and 19 in window
B D             Dolphin 1bp
           Killer whale 1bp
B D                 Cow 6bp
          Domestic goat 1bp
B D                 Cat 1bp

Alignment block 19 of 255 in window, 9648408 - 9648420, 13 bps 
B D                Human  gaaaaatctgtgc
B D                Chimp  gaaaaatctgtgc
B D              Gorilla  gaaaaatctgtgc
B D            Orangutan  gaaaaatctgtcc
B D               Gibbon  gaaaaatctgttc
B D               Rhesus  gaaaaatctgtcc
B D  Crab-eating macaque  gaaaaatctgtcc
B D               Baboon  gaaaaatctgtcc
B D         Green monkey  gaaaaatctgtcc
B D      Squirrel monkey  ggaaaatctgtcc
B D             Bushbaby  gacagatctg---
      Chinese tree shrew  gaggatt------
B D                  Pig  --aaaacccaact
          Bactrian camel  ggaaaatccatcc
B D              Dolphin  --gaaatgtgacc
            Killer whale  --gaaatgtgacc
B D                  Cow  aaaatatttgact
B D                Sheep  ggaaaatccatcc
           Domestic goat  -----atataacc
B D                  Cat  -aaaaatctgacc
B D                  Dog  -aaaaatctgacc
B D                Panda  -aaaaatctgacc
            Weddell seal  -aaaaatctgacc
        Black flying-fox  -gaaaatctgacc
  D     Peregrine falcon  gatgaagc-----
B D             Hedgehog  =============
B D           Guinea pig  =============
             Chinchilla  =============
       Cape golden mole  =============
B D              Manatee  =============
               Aardvark  =============
B D             Elephant  =============
B D              Ferret   -------------
       Tibetan antelope  =============
        Star-nosed mole  =============
B D     White rhinoceros  =============
B D                Horse  =============
B D             Squirrel  =============
B D            Armadillo  =============

Inserts between block 19 and 20 in window
B D                 Pig 1bp
         Bactrian camel 1bp
B D             Dolphin 1bp
           Killer whale 1bp
B D                 Cow 1bp
B D               Sheep 1bp
          Domestic goat 1bp
B D                 Cat 1bp
B D                 Dog 1bp
B D               Panda 1bp
           Weddell seal 1bp
       Black flying-fox 1bp

Alignment block 20 of 255 in window, 9648421 - 9648443, 23 bps 
B D                Human  gatgc--------ctcc------cc-acatgt--cacggg
B D                Chimp  gatgc--------ctcc------cc-acatgt--cacggg
B D              Gorilla  gatgc--------ctcc------cc-acatgt--cacggg
B D            Orangutan  gatgc--------ctcc------cc-acaagt--cacggg
B D               Gibbon  gatgc--------ctcc------cc-acatgt--cacggg
B D               Rhesus  gatgc--------ctcc------cc-acatgt--cacagg
B D  Crab-eating macaque  gatgc--------ctcc------cc-acacgt--cacagg
B D               Baboon  gatgc--------ctcc------cc-acacgt--cacagg
B D         Green monkey  gatgc--------ctcc------cc-acacgt--cacggg
B D      Squirrel monkey  gaagc--------ctcc------gc-acctgt--cacggg
B D             Bushbaby  ----------------c------cc-agacgt--cacggg
      Chinese tree shrew  --------------tac------cc-acttgt--ctcggg
B D                  Pig  gattt--------cact------cc-agctgc---ctggg
          Bactrian camel  gacct--------cccc------ccaagatgt--cccagg
B D              Dolphin  gattt--------ctcc------cc-agatgc---ctggg
            Killer whale  gattt--------ctcc------cc-agatgc---ctggg
B D                  Cow  gattt--------ctcc------cc-agatgg---ctgtg
B D                Sheep  gacct--------ctcc-------c-acacaagacccagg
           Domestic goat  gattt--------ctcc------ac-agataa---ctgtg
B D                  Cat  aagac--------cccc---acccc-agacgt--cctgag
B D                  Dog  gacttcactcctgccccaccacccc-agatgt--caggaa
B D                Panda  gattc--cccccacccc----ctcc-agatat--cttgag
            Weddell seal  gattt--------cccc----accg-agatgt--cctgag
        Black flying-fox  gattt--------cctc------tc-agatgt--cctgag
         Star-nosed mole  gattt--------cttc------ct-gcagtt--cccagg
  D     Peregrine falcon  ---------------------------cgtgt--cccgag
B D             Hedgehog  ========================================
B D           Guinea pig  ========================================
             Chinchilla  ========================================
       Cape golden mole  ========================================
B D              Manatee  ========================================
               Aardvark  ========================================
B D             Elephant  ========================================
B D              Ferret   ----------------------------------------
       Tibetan antelope  ========================================
B D     White rhinoceros  ========================================
B D                Horse  ========================================
B D             Squirrel  ========================================
B D            Armadillo  ========================================

Inserts between block 20 and 21 in window
B D            Bushbaby 3638bp
     Chinese tree shrew 8bp

Alignment block 21 of 255 in window, 9648444 - 9648481, 38 bps 
B D                Human  actct-------gac----ttgcctttgtcgtcagagtttgcagaactt
B D                Chimp  actct-------gaa----ttgcctttgtcgtcagagtttgcagaactt
B D              Gorilla  actct-------gac----ttgcctttgtcgtcagagtttgcaggactt
B D            Orangutan  actct-------gac----ttgcctttgtcgtcagagtttgcagaactt
B D               Gibbon  actct-------gac----ttgcctttgtcgtcagagtttgcagccctt
B D               Rhesus  actct-------gac----ttgcctttgtcgtcagagtttgcagaactt
B D  Crab-eating macaque  actct-------gac----ttgcctttgtcgtcagagtttgcagaactt
B D               Baboon  actct-------gac----ttgcctttgtcgtcagagtttgcagaactt
B D         Green monkey  actct-------gac----ttgcctttgtcgtcagagtttgcagaactt
B D      Squirrel monkey  cctct-------gac----ctgcctgcgtcatcagagtttgcagaactt
      Chinese tree shrew  cccct-------ggt----ccgccctcttctgc--aattcgcagaact-
B D                  Pig  gccct-------gac----ccgctctcttcactggagt-----------
          Bactrian camel  tgtct-------gct----ctaccctcttcatcagaatttgcaggattt
B D              Dolphin  cccct-------aag----ccgccctcttcatgggagtttgcgcaactt
            Killer whale  cccct-------aag----ccgccctcttcatgggagtttgcgcaactt
B D                  Cow  cgcct-------aag----ccgccctcttcataggagtttgcagaactt
B D                Sheep  tgcct-------gct----tcatcctcttcatcagaatttgcagagctt
           Domestic goat  cccct-------aag----ctgccctcttcatgggagtttgcagaacat
B D                  Cat  cccct-------gac----ctattctgttcatcagagtttgcagaactt
B D                  Dog  cccct-------cat----ttgccctcttcatcagagtgtgcagaactt
B D                Panda  ccctt-------gatctgcttgctcttttcatcagagtgttcagagctt
            Weddell seal  cccct-------gacctgcttgctctcttcttcagaatgtgcacagctt
        Black flying-fox  gccct-------gac----ctgtcctctttatcatagttggcagaactc
         Star-nosed mole  cctccaggcctggac----ttgccctggctatcagatttta--------
  D     Peregrine falcon  ------------------------accaccatcccagctctccaagctt
B D             Hedgehog  =================================================
B D           Guinea pig  =================================================
             Chinchilla  =================================================
       Cape golden mole  =================================================
B D              Manatee  =================================================
               Aardvark  =================================================
B D             Elephant  =================================================
B D             Bushbaby  =================================================
B D              Ferret   -------------------------------------------------
       Tibetan antelope  =================================================
B D     White rhinoceros  =================================================
B D                Horse  =================================================
B D             Squirrel  =================================================
B D            Armadillo  =================================================

Inserts between block 21 and 22 in window
         Bactrian camel 6868bp
           Weddell seal 7bp

Alignment block 22 of 255 in window, 9648482 - 9648482, 1 bps 
B D                Human  t
B D                Chimp  t
B D              Gorilla  t
B D            Orangutan  t
B D               Gibbon  t
B D               Rhesus  t
B D  Crab-eating macaque  t
B D               Baboon  t
B D         Green monkey  t
B D      Squirrel monkey  t
B D              Dolphin  t
            Killer whale  t
B D                  Cow  t
B D                Sheep  t
           Domestic goat  t
B D                  Cat  a
B D                  Dog  t
B D                Panda  c
        Black flying-fox  c
  D     Peregrine falcon  t
B D             Hedgehog  =
B D           Guinea pig  =
             Chinchilla  =
       Cape golden mole  =
     Chinese tree shrew  -
B D              Manatee  =
               Aardvark  =
B D             Elephant  =
B D             Bushbaby  =
B D                  Pig  -
B D              Ferret   -
       Tibetan antelope  =
        Star-nosed mole  -
         Bactrian camel  =
B D     White rhinoceros  =
B D                Horse  =
B D             Squirrel  =
B D            Armadillo  =
           Weddell seal  =

Inserts between block 22 and 23 in window
B D             Dolphin 3bp
           Killer whale 3bp
B D                 Cow 3bp
B D               Sheep 8521bp
          Domestic goat 3bp
B D                 Cat 9bp
B D                 Dog 6bp
B D               Panda 10bp
       Black flying-fox 9bp

Alignment block 23 of 255 in window, 9648483 - 9648573, 91 bps 
B D                Human  -gggggacc----tgagaggggagtgccccctg-gacgggc-----------------------------
B D                Chimp  -gggggacc----tgagaggggagtgccccctg-gacgggc-----------------------------
B D              Gorilla  -gggggacc----tgagaggggagtgcccccta-gacgggc-----------------------------
B D            Orangutan  -gggggacc----tgagaggggagtgccccctg-gacgggc-----------------------------
B D               Gibbon  -gggggacc----tgagaggggagtgccccctg-gacgggc-----------------------------
B D               Rhesus  -gggggacc----tgagaggggagtgccccctg-gatgggc-----------------------------
B D  Crab-eating macaque  -gggggacc----tgagaggggagtgccccctg-gatgggc-----------------------------
B D               Baboon  -gggggacc----tgagaggggagtgccccctg-gacgggc-----------------------------
B D         Green monkey  -gggggacc----tgagaggggagtgccccctg-gacgggc-----------------------------
B D      Squirrel monkey  -gggggacc----tgagaaggg-gtgtcccctg-gacagga-----------------------------
      Chinese tree shrew  -------------------ggaagtg---catg-aatttgcgg---------------------------
B D                  Pig  -----g--------atgggtgggagattcctta-ggacagg-----------------------------
B D              Dolphin  ----ga--------gtgagtgggagattcctta-ggacagg-----------------------------
            Killer whale  ----ga--------gtgagtgggagattcctta-ggacagg-----------------------------
B D                  Cow  ----gg--------gtgactgggagattcctta-gggtaag-----------------------------
           Domestic goat  ----ag--------gtgactgggagattcctta-ggacagg-----------------------------
B D                  Cat  ----gg--------gcgagtaatggagtccctg-ggacagac----------------------------
B D                  Dog  --------------gtgagtagtggagtccctg-ggacagg-----------------------------
B D                Panda  ----gggtg----ggagagtagtggagtccctgggaccagg-----------------------------
            Weddell seal  ----ggagc----agggagtagtggagtccctg-------------------------------------
        Black flying-fox  ----gaga------actagtaaaggattactga-ggacagccaccaccaccaccatcccaccccattctc
         Star-nosed mole  ------------------------gagtccaga-------------------------------------
  D     Peregrine falcon  gggggggccagtgtgggaccagtgtggctttca-gtgctgatc---------------------------
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D             Bushbaby  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
         Bactrian camel  ======================================================================
B D     White rhinoceros  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================

                   Human  ---cacggctgtc-tgtggcttaagggcttttggaagggcggag------agagggaaac--g-------
                   Chimp  ---cacggctgtc-tgtggcttaagggcttttggaagggcggag------agagggaaacagg-------
                 Gorilla  ---cacggctgtc-tgtggcttaagggcttttggaagggcggag------agagggaaacagg-------
               Orangutan  ---cacggctgtc-tgtggcttaagggcttttggaagggcggag------agagggaaacagg-------
                  Gibbon  ---cacggctgtc-tgtggtttaaggacttttggaagggcggag------agagggaaacagg-------
                  Rhesus  ---cacggctgtc-tgtggcttaaggacttttggaaaggcggag------agagggaaacagg-------
     Crab-eating macaque  ---cacggctgtc-tgtggcttaaggacttttggaaaggcggag------agagggaaacagg-------
                  Baboon  ---cacggctgtc-tgtggcttaaggacttttggaaaggcggag------agagggaaacagg-------
            Green monkey  ---cacggctgtc-tgtggcttaaggacttttggaaaggcggag------agagggaaacagg-------
         Squirrel monkey  ---cacgggtgtc-tgtggcttacgggcttttggaaggacaggg------agagggaaacggg-------
      Chinese tree shrew  ---aactttagtcttgtgggttcagggctttcggaaagactgtc------tgtgggaaactggccttctc
                     Pig  ---tcctgtggtc-tggggataaaggcttgg--gaaaggctgca------gg--ttcagcagg-------
                 Dolphin  ---ccctgtggtc-tggggattaagggcttt--gaaaggctggg------agactgcggcagg-------
            Killer whale  ---ccctgtggtc-tggggattaagggcttt--gaaagactggg------agactgcggcagg-------
                     Cow  ---ctctgcggtc-tagggattaagggcttt--gaaaggctgag------agagggcagcagg-------
           Domestic goat  ---ctgtgtggtc-tggggattaagagcttt--ggaaagctggg------agagggtggccag-------
                     Cat  ---ccccatgggc-tgaggcataaggacttttggaaaggccgca------ggg-----ggaaa-------
                     Dog  ---tctcatcact-tgaggcttaagaacttttggaaagttctta------aag--ggggaaag-------
                   Panda  ---tcccttggtt-tgaagcttaaggacttttggaaaggctgca------gtg-----------------
            Weddell seal  ---------ggtt-tgaggcttaaggacttttggaaaggctgca------aga-----gaaaa-------
        Black flying-fox  cttccccgggatc-tgggtcttaag-acttctggaaagactgcc------aga---aggaaag-------
         Star-nosed mole  ---cttt----cc-ttggcttcaagggcttttggaaaggcttca------gcagggaaacagg-------
        Peregrine falcon  ---cgctggtggc-tgtggggtgggg-------gtggggtggggtcccccagccagaggcggg-------
                Hedgehog  ======================================================================
              Guinea pig  ======================================================================
              Chinchilla  ======================================================================
        Cape golden mole  ======================================================================
                 Manatee  ======================================================================
                Aardvark  ======================================================================
                Elephant  ======================================================================
                Bushbaby  ======================================================================
                 Ferret   ----------------------------------------------------------------------
                   Sheep  ======================================================================
        Tibetan antelope  ======================================================================
          Bactrian camel  ======================================================================
        White rhinoceros  ======================================================================
                   Horse  ======================================================================
                Squirrel  ======================================================================
               Armadillo  ======================================================================

                   Human  -g--cgtc
                   Chimp  -a--cgtc
                 Gorilla  -g--cgtc
               Orangutan  -g--cgtc
                  Gibbon  -g--cgtc
                  Rhesus  -g--cgtc
     Crab-eating macaque  -g--cgtc
                  Baboon  -g--cgtc
            Green monkey  -a--cgtc
         Squirrel monkey  -g--gatc
      Chinese tree shrew  ag--tgac
                     Pig  -c--ctt-
                 Dolphin  -c--att-
            Killer whale  -c--att-
                     Cow  -t--gtt-
           Domestic goat  -t--gtt-
                     Cat  -caagta-
                     Dog  -t--gtg-
                   Panda  -----tg-
            Weddell seal  -c--cta-
        Black flying-fox  -gggttt-
         Star-nosed mole  -g--cc--
        Peregrine falcon  -g--cc--
                Hedgehog  ========
              Guinea pig  ========
              Chinchilla  ========
        Cape golden mole  ========
                 Manatee  ========
                Aardvark  ========
                Elephant  ========
                Bushbaby  ========
                 Ferret   --------
                   Sheep  ========
        Tibetan antelope  ========
          Bactrian camel  ========
        White rhinoceros  ========
                   Horse  ========
                Squirrel  ========
               Armadillo  ========

Inserts between block 23 and 24 in window
B D                 Pig 2bp
B D             Dolphin 1bp
           Killer whale 1bp
B D                 Cow 1bp
          Domestic goat 1bp
B D                 Cat 1bp
B D                 Dog 1bp
B D               Panda 1bp
           Weddell seal 1bp
       Black flying-fox 1bp
        Star-nosed mole 3404bp

Alignment block 24 of 255 in window, 9648574 - 9648599, 26 bps 
B D                Human  ctagtggcctgcttca--gggccac-cca
B D                Chimp  ctagtggcctgcttca--gggccac-cca
B D              Gorilla  ctagtggcctgcttca--gggccac-cca
B D            Orangutan  ctagtggcctgcttcg--gggtcac-cca
B D               Gibbon  ctagtggcctgcttca--gggccac-cca
B D               Rhesus  ctagtggcctgcttca--gggccac-cca
B D  Crab-eating macaque  ctagtggcctgcttca--gggccac-cca
B D               Baboon  ctagtggcctgcttca--gggccac-cca
B D         Green monkey  ctagtggcctgcttca--gggccac-cca
B D      Squirrel monkey  ccagtggcctgcttaa--gggccac-cca
      Chinese tree shrew  ccagtgacctggtata--gggccac----
B D                  Pig  ctagtgacttggttca--gggtctctccc
B D              Dolphin  ctagtgacctggttca--gggcccctccc
            Killer whale  ctagtgacctggttca--gggtccctccc
B D                  Cow  ttagtgacctgtttca--gggtctt-tcc
           Domestic goat  ctagtgagctggttca--gaatattgccc
B D                  Cat  ttagtgttccagctca--gggtccc-tgc
B D                  Dog  gtagtgttttggttca--gaccccc-tcc
B D                Panda  ttagtgttctggttca--gaccccc-tct
            Weddell seal  ttagtgttctggttca--gaccccc-ttc
        Black flying-fox  ctaatgttcttgttcaaggactctc-tct
  D     Peregrine falcon  -ttatggcctcccgca--ggccctc-gca
B D             Hedgehog  =============================
B D           Guinea pig  =============================
             Chinchilla  =============================
       Cape golden mole  =============================
B D              Manatee  =============================
               Aardvark  =============================
B D             Elephant  =============================
B D             Bushbaby  =============================
B D              Ferret   -----------------------------
B D                Sheep  =============================
       Tibetan antelope  =============================
        Star-nosed mole  =============================
         Bactrian camel  =============================
B D     White rhinoceros  =============================
B D                Horse  =============================
B D             Squirrel  =============================
B D            Armadillo  =============================

Inserts between block 24 and 25 in window
B D     Squirrel monkey 6837bp
B D                 Pig 1bp
B D             Dolphin 1bp
           Killer whale 1bp
B D                 Cow 1bp
          Domestic goat 1bp
B D                 Cat 1bp
B D                 Dog 1bp
B D               Panda 1bp
           Weddell seal 1bp
       Black flying-fox 1bp

Alignment block 25 of 255 in window, 9648600 - 9648616, 17 bps 
B D                Human  ----cgggccctcc-----cccaacc
B D                Chimp  ----cgggccctcc-----cccaacc
B D              Gorilla  ----cgggccctcc-----cccaacc
B D            Orangutan  ----caggccctcc-----cccaacc
B D               Gibbon  ----caggccctcc-----tccaacc
B D               Rhesus  ----caggccctcc-----cccaacc
B D  Crab-eating macaque  ----caggccctcc-----cccaacc
B D               Baboon  ----caggccctcc-----cccaacc
B D         Green monkey  ----caggccctcc-----cccaacc
      Chinese tree shrew  -------gtcctc-------------
B D                  Pig  ---------ctttttatgtctcagac
B D              Dolphin  ---------ctttttatgtctcagtg
            Killer whale  ---------ctttttatgtctcagtg
B D                  Cow  ---------ctttttatgtctctgtc
           Domestic goat  ---------ccccttttttctcaata
B D                  Cat  ---------cttcttatttctcagta
B D                  Dog  ---------cctcttatttctcaata
B D                Panda  ---------tctcatatttctcaatc
            Weddell seal  ---------cctcttatttctcaatc
        Black flying-fox  ---------tcttttacagctcag--
  D     Peregrine falcon  ccacggggtcccct-----cctagcc
B D             Hedgehog  ==========================
B D           Guinea pig  ==========================
             Chinchilla  ==========================
       Cape golden mole  ==========================
B D              Manatee  ==========================
               Aardvark  ==========================
B D             Elephant  ==========================
B D             Bushbaby  ==========================
B D              Ferret   --------------------------
B D                Sheep  ==========================
       Tibetan antelope  ==========================
        Star-nosed mole  ==========================
         Bactrian camel  ==========================
B D     White rhinoceros  ==========================
B D                Horse  ==========================
B D             Squirrel  ==========================
B D            Armadillo  ==========================
B D      Squirrel monkey  ==========================

Alignment block 26 of 255 in window, 9648617 - 9648687, 71 bps 
B D                Human  tctct--ct------------gatccaacttgtttttccagccta-gttggaaacttgtggatg-ctgtg
B D                Chimp  tctct--ct------------gatccaacttgtttttccagccta-gttggaaacttgtggatg-ctgtg
B D              Gorilla  tctct--ct------------gatccaacttgtttttccagccta-gttggaaacttgtggatg-ctgtg
B D            Orangutan  tctct--ct------------gatccaacttgtttttccagcccaggttggaaacttggggatg-ctgtg
B D               Gibbon  tccct--ct------------gatccaacttgtttttccagcctaggttggaaacttgtggatg-ctgtg
B D               Rhesus  tgtct--ct------------gatccgacttgtttttccaggctaggttggaaacttgtggatg-ctgtg
B D  Crab-eating macaque  tgtct--ct------------gatccgacttgtttttccaggctaggttggaaacttgtggatg-ctgtg
B D               Baboon  tgtct--ct------------gatccgacttgtttttccaggctaggttggaaacttgtggatg-ctgtg
B D         Green monkey  tgtct--ct------------gatccgacttgtttttccaggctaggttggaaacttgtggatg-ctgtg
      Chinese tree shrew  ---------------------------acttgtgcct-caaccttggcaggcaactggtaaaag-ctgtg
B D                  Pig  caccc--tg------------cccccacatcgc-------------------------------------
B D              Dolphin  caccc--ca------------accccaggttgg-------------------------------------
            Killer whale  caccc--ca------------accccaggttgg-------------------------------------
B D                  Cow  tgcct--ct------------ctcccaggattg-------------------------------------
           Domestic goat  taccctgcc------------ccccaggaatgg-------------------------------------
B D                  Cat  tcgtc--ctcccccccactcgtccccaactccttggcctt-cctgggtggaaaatcggtgaaagtttctc
B D                  Dog  ttctc--cctctct-------ccctcaactccttggcctt-tttgggttaaaaatttgtgaaag---ctg
B D                Panda  tcctc--cctcccct------cccccaactccttggcctt-cttgggttgaaaatttgtgaaag---ctg
            Weddell seal  tcctc--tctctcc-------cccccaaatccttggtctt-cttgggttgaaaatttgtggaag---ctg
        Black flying-fox  --ctc--tttacccc------tcttcaacttctttgccttgcttggcgtggaaatttgtggaag-ttatg
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D             Bushbaby  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ======================================================================
         Bactrian camel  ======================================================================
B D     White rhinoceros  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
B D      Squirrel monkey  ======================================================================

                   Human  --acctcaagaagacttgg
                   Chimp  --acctcaagaagacttgg
                 Gorilla  --acctcaagaagacttgg
               Orangutan  --acctcaagaagacttgg
                  Gibbon  acacctcaagaagacttgg
                  Rhesus  --acctcaacaagacttga
     Crab-eating macaque  --acctcaacaagacttga
                  Baboon  --acctcaagaagacttga
            Green monkey  --acctcaagaagacttgg
      Chinese tree shrew  --acctccagaa-acatag
                     Pig  -------------------
                 Dolphin  -------------------
            Killer whale  -------------------
                     Cow  -------------------
           Domestic goat  -------------------
                     Cat  --ctctcaagaagcgttgg
                     Dog  --ctcccaagaagcattgc
                   Panda  --ctctcaagaagcattgg
            Weddell seal  --ctctcaagaagcattgg
        Black flying-fox  --acttcgagaagcattgg
                Hedgehog  ===================
              Guinea pig  ===================
              Chinchilla  ===================
        Cape golden mole  ===================
                 Manatee  ===================
                Aardvark  ===================
                Elephant  ===================
                Bushbaby  ===================
                 Ferret   -------------------
                   Sheep  ===================
        Tibetan antelope  ===================
         Star-nosed mole  ===================
          Bactrian camel  ===================
        White rhinoceros  ===================
                   Horse  ===================
                Squirrel  ===================
               Armadillo  ===================
         Squirrel monkey  ===================

Inserts between block 26 and 27 in window
       Black flying-fox 6073bp

Alignment block 27 of 255 in window, 9648688 - 9648744, 57 bps 
B D                Human  cattttatttggaagatagacatctatttgcaactgtcctga---------------------gcccc--
B D                Chimp  cattttatttggaagataggcatctatttgcaactgtcctga---------------------gcccc--
B D              Gorilla  cattttatttggaagataggcatctatttgcaactgtcctga---------------------gcccc--
B D            Orangutan  cattttatttggaagataggcatctatttgcaactgtcctga---------------------gcccc--
B D               Gibbon  cattttatttggaagataggcatctatttgcaactgtcctga---------------------gcccc--
B D               Rhesus  cattttatttggaagataggcatctatttgcaactgtcctga---------------------acccc--
B D  Crab-eating macaque  cattttatttggaagataggcatctatttgcaactgtcctga---------------------acccc--
B D               Baboon  cattttatttggaagataggcatctatttgcaactgtcctga---------------------acccc--
B D         Green monkey  cattttatttggaagataggcatctatttgcaactgtcctga---------------------acccc--
      Chinese tree shrew  cattatatttggaatacagggacccatttgggaaggcctgcg---------------------ttgtc--
B D                  Pig  tattttaattggaaagtagagatccatttggaactggcctgagtctcttctccctgcccccccgccccta
B D              Dolphin  tatcttaattggaaaatagagatccctttggaactggcatgg-------ccccctctggaactggccc--
            Killer whale  tatcttaattggaaaatagagatccctttggaactggcatgg-------ccccctctagaactggccc--
B D                  Cow  tatcttaattgaaaagttgagatccctttggaaccggcctga---------------------attct--
           Domestic goat  catcttaattggaaactagagatctctctggaactggcctga---------------------atccc--
B D                  Cat  tattttaagtggaaggtagagatccacttggaactggtccct---------------------gtctc--
B D                  Dog  t-ttttaagcagaaggtagaggtccctttggaactggcccag---------------------atctc--
B D                Panda  tattttaaatggaagatagagatccatttgaaactggcccag---------------------gtctc--
            Weddell seal  tattttaactggaaggtaaagatct-tttggaactggcccag---------------------gtctc--
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D             Bushbaby  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ======================================================================
         Bactrian camel  ======================================================================
       Black flying-fox  ======================================================================
B D     White rhinoceros  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
B D      Squirrel monkey  ======================================================================

                   Human  -----tattttcc--------------tc
                   Chimp  -----tattttcc--------------tc
                 Gorilla  -----tattttcc--------------tc
               Orangutan  -----tattttcc--------------tc
                  Gibbon  -----tattttcc--------------tc
                  Rhesus  -----tattttcc--------------tc
     Crab-eating macaque  -----tattttcc--------------tc
                  Baboon  -----tattttcc--------------tc
            Green monkey  -----tattttcc--------------tc
      Chinese tree shrew  -----tggtttccctggagcacaagtgcc
                     Pig  ctcagccccattt--------------ct
                 Dolphin  -----cctccatt--------------cc
            Killer whale  -----cctccatt--------------cc
                     Cow  -----gctccttt--------------cc
           Domestic goat  -----cctctttt--------------cc
                     Cat  -----cttttc-----------------c
                     Dog  -----cttctttt--------------cc
                   Panda  -----cttctt------------------
            Weddell seal  -----cttttt-----------------c
                Hedgehog  =============================
              Guinea pig  =============================
              Chinchilla  =============================
        Cape golden mole  =============================
                 Manatee  =============================
                Aardvark  =============================
                Elephant  =============================
                Bushbaby  =============================
                 Ferret   -----------------------------
                   Sheep  =============================
        Tibetan antelope  =============================
         Star-nosed mole  =============================
          Bactrian camel  =============================
        Black flying-fox  =============================
        White rhinoceros  =============================
                   Horse  =============================
                Squirrel  =============================
               Armadillo  =============================
         Squirrel monkey  =============================

Inserts between block 27 and 28 in window
B D                 Pig 15bp
B D             Dolphin 15bp
           Killer whale 15bp
B D                 Cow 15bp
          Domestic goat 14bp
B D                 Cat 15bp
B D                 Dog 15bp
B D               Panda 700bp
           Weddell seal 15bp

Alignment block 28 of 255 in window, 9648745 - 9648771, 27 bps 
B D                Human  ccacctttcttggggaaacttgttttt
B D                Chimp  ccacctttcttggggaaacttgttttt
B D              Gorilla  ccacctttcttggggaaacttgttttt
B D            Orangutan  ccacctttcttggggaaacttgttttt
B D               Gibbon  ccacctttcttggggaaacttgttttt
B D               Rhesus  ccacctttcttggggaaacttgttttt
B D  Crab-eating macaque  ccacctttcttggggaaacttgttttt
B D               Baboon  ccacctttcttggggaaacttgttttt
B D         Green monkey  ---cctttcttggggaaacgtg---tt
      Chinese tree shrew  ccagctttcttggggagacttgtcttt
B D                  Pig  cc---------ggggagacttgtcttt
B D              Dolphin  ccaactttcttggggagaattgccttt
            Killer whale  ccaactttcttggggagaattgccttt
B D                  Cow  ccagtgttcttggggagacttttcttt
           Domestic goat  ccaatgttctcagggagacttctcttt
B D                  Cat  ctaacttttggggggagacttgttttt
B D                  Dog  tcaattttggggcagagacttgtctta
            Weddell seal  tcaactttgggacagagacttgtctta
B D             Hedgehog  ===========================
B D           Guinea pig  ===========================
             Chinchilla  ===========================
       Cape golden mole  ===========================
B D              Manatee  ===========================
               Aardvark  ===========================
B D             Elephant  ===========================
B D             Bushbaby  ===========================
B D              Ferret   ---------------------------
B D                Panda  ===========================
B D                Sheep  ===========================
       Tibetan antelope  ===========================
        Star-nosed mole  ===========================
         Bactrian camel  ===========================
       Black flying-fox  ===========================
B D     White rhinoceros  ===========================
B D                Horse  ===========================
B D             Squirrel  ===========================
B D            Armadillo  ===========================
B D      Squirrel monkey  ===========================

Inserts between block 28 and 29 in window
B D              Rhesus 4bp
B D Crab-eating macaque 4bp
B D              Baboon 4bp
B D        Green monkey 4bp
     Chinese tree shrew 4bp
B D                 Pig 63bp
B D                 Cow 9394bp

Alignment block 29 of 255 in window, 9648772 - 9648773, 2 bps 
B D                Human  aa
B D                Chimp  aa
B D              Gorilla  aa
B D            Orangutan  aa
B D               Gibbon  aa
B D               Rhesus  ga
B D  Crab-eating macaque  ga
B D               Baboon  ga
B D         Green monkey  ga
      Chinese tree shrew  ta
B D                  Pig  aa
B D              Dolphin  aa
            Killer whale  aa
           Domestic goat  aa
B D                  Cat  aa
B D                  Dog  aa
            Weddell seal  aa
B D             Hedgehog  ==
B D           Guinea pig  ==
             Chinchilla  ==
       Cape golden mole  ==
B D              Manatee  ==
               Aardvark  ==
B D             Elephant  ==
B D             Bushbaby  ==
B D              Ferret   --
B D                Panda  ==
B D                Sheep  ==
       Tibetan antelope  ==
        Star-nosed mole  ==
         Bactrian camel  ==
       Black flying-fox  ==
B D     White rhinoceros  ==
B D                Horse  ==
B D             Squirrel  ==
B D            Armadillo  ==
B D      Squirrel monkey  ==
B D                  Cow  ==

Inserts between block 29 and 30 in window
B D                 Dog 31941bp
           Weddell seal 39481bp

Alignment block 30 of 255 in window, 9648774 - 9648774, 1 bps 
B D                Human  g
B D                Chimp  g
B D              Gorilla  g
B D            Orangutan  g
B D               Gibbon  g
B D               Rhesus  g
B D  Crab-eating macaque  g
B D               Baboon  g
B D         Green monkey  g
      Chinese tree shrew  a
B D                  Pig  g
B D              Dolphin  g
            Killer whale  g
           Domestic goat  g
B D                  Cat  a
B D             Hedgehog  =
B D           Guinea pig  =
             Chinchilla  =
       Cape golden mole  =
B D              Manatee  =
               Aardvark  =
B D             Elephant  =
B D             Bushbaby  =
B D              Ferret   -
B D                Panda  =
B D                Sheep  =
       Tibetan antelope  =
        Star-nosed mole  =
         Bactrian camel  =
       Black flying-fox  =
B D     White rhinoceros  =
B D                Horse  =
B D             Squirrel  =
B D            Armadillo  =
           Weddell seal  =
B D      Squirrel monkey  =
B D                  Dog  =
B D                  Cow  =

Inserts between block 30 and 31 in window
B D                 Pig 25bp
B D             Dolphin 11321bp
           Killer whale 11404bp
          Domestic goat 8646bp

Alignment block 31 of 255 in window, 9648775 - 9648775, 1 bps 
B D                Human  g
B D                Chimp  g
B D              Gorilla  g
B D            Orangutan  g
B D               Gibbon  g
B D               Rhesus  g
B D  Crab-eating macaque  g
B D               Baboon  g
B D         Green monkey  g
      Chinese tree shrew  g
B D                  Pig  g
B D                  Cat  g
B D             Hedgehog  =
B D           Guinea pig  =
             Chinchilla  =
       Cape golden mole  =
B D              Manatee  =
               Aardvark  =
B D             Elephant  =
B D             Bushbaby  =
B D              Ferret   -
B D              Dolphin  =
B D                Panda  =
          Domestic goat  =
B D                Sheep  =
       Tibetan antelope  =
        Star-nosed mole  =
         Bactrian camel  =
       Black flying-fox  =
B D     White rhinoceros  =
B D                Horse  =
B D             Squirrel  =
B D            Armadillo  =
           Weddell seal  =
B D      Squirrel monkey  =
B D                  Dog  =
B D                  Cow  =
           Killer whale  =

Inserts between block 31 and 32 in window
B D                 Cat 324bp

Alignment block 32 of 255 in window, 9648776 - 9648777, 2 bps 
B D                Human  -ga
B D                Chimp  -gg
B D              Gorilla  -gg
B D            Orangutan  -gg
B D               Gibbon  -gg
B D               Rhesus  -gg
B D  Crab-eating macaque  -gg
B D               Baboon  -gg
B D         Green monkey  -gg
      Chinese tree shrew  -cg
B D                  Pig  tg-
B D             Hedgehog  ===
B D           Guinea pig  ===
             Chinchilla  ===
       Cape golden mole  ===
B D              Manatee  ===
               Aardvark  ===
B D             Elephant  ===
B D                  Cat  ===
B D             Bushbaby  ===
B D              Ferret   ---
B D              Dolphin  ===
B D                Panda  ===
          Domestic goat  ===
B D                Sheep  ===
       Tibetan antelope  ===
        Star-nosed mole  ===
         Bactrian camel  ===
       Black flying-fox  ===
B D     White rhinoceros  ===
B D                Horse  ===
B D             Squirrel  ===
B D            Armadillo  ===
           Weddell seal  ===
B D      Squirrel monkey  ===
B D                  Dog  ===
B D                  Cow  ===
           Killer whale  ===

Alignment block 33 of 255 in window, 9648778 - 9648795, 18 bps 
B D                Human  tgccactgtttttgtaac
B D                Chimp  tgccactgtttttgtaac
B D              Gorilla  tgccactgtttttgtaac
B D            Orangutan  tgccactgtttttgtaac
B D               Gibbon  tgccactgtttttgtaac
B D               Rhesus  tgccactgtttttgtaac
B D  Crab-eating macaque  tgccactgtttttgtaac
B D               Baboon  cgccactgtttttgtaac
B D         Green monkey  tgccactgtttttgtaac
      Chinese tree shrew  taccgctgttttcttagc
B D                  Pig  taccaatgtttttgtaat
B D                  Cat  tgccactgttttcctaac
B D                Panda  tgccactgttttcataac
B D             Hedgehog  ==================
B D           Guinea pig  ==================
             Chinchilla  ==================
       Cape golden mole  ==================
B D              Manatee  ==================
               Aardvark  ==================
B D             Elephant  ==================
B D             Bushbaby  ==================
B D              Ferret   ------------------
B D              Dolphin  ==================
          Domestic goat  ==================
B D                Sheep  ==================
       Tibetan antelope  ==================
        Star-nosed mole  ==================
         Bactrian camel  ==================
       Black flying-fox  ==================
B D     White rhinoceros  ==================
B D                Horse  ==================
B D             Squirrel  ==================
B D            Armadillo  ==================
           Weddell seal  ==================
B D      Squirrel monkey  ==================
B D                  Dog  ==================
B D                  Cow  ==================
           Killer whale  ==================

Inserts between block 33 and 34 in window
     Chinese tree shrew 23768bp

Alignment block 34 of 255 in window, 9648796 - 9648807, 12 bps 
B D                Human  atgttgctccta
B D                Chimp  atgttgctccta
B D              Gorilla  atgttgctccta
B D            Orangutan  atgttgctccta
B D               Gibbon  atgttactccta
B D               Rhesus  atgttgctccta
B D  Crab-eating macaque  atgttgctccta
B D               Baboon  atgttgctccta
B D         Green monkey  atgttgctccta
B D                  Pig  atactgctctta
B D                  Cat  gtattgctcttg
B D                Panda  atattgctcttg
B D             Hedgehog  ============
B D           Guinea pig  ============
             Chinchilla  ============
       Cape golden mole  ============
     Chinese tree shrew  ============
B D              Manatee  ============
               Aardvark  ============
B D             Elephant  ============
B D             Bushbaby  ============
B D              Ferret   ------------
B D              Dolphin  ============
          Domestic goat  ============
B D                Sheep  ============
       Tibetan antelope  ============
        Star-nosed mole  ============
         Bactrian camel  ============
       Black flying-fox  ============
B D     White rhinoceros  ============
B D                Horse  ============
B D             Squirrel  ============
B D            Armadillo  ============
           Weddell seal  ============
B D      Squirrel monkey  ============
B D                  Dog  ============
B D                  Cow  ============
           Killer whale  ============

Inserts between block 34 and 35 in window
B D                 Pig 4987bp

Alignment block 35 of 255 in window, 9648808 - 9648827, 20 bps 
B D                Human  gctct----tagcattcatggtac
B D                Chimp  gctct----tagcattcatggtac
B D              Gorilla  gctct----tagcattcatggtac
B D            Orangutan  gctct----tagcattcatggtac
B D               Gibbon  gctct----tagcattcatggtac
B D               Rhesus  gctct----tagcattcctggtac
B D  Crab-eating macaque  gctct----tagcattcctggtac
B D               Baboon  gctct----tagcattcctggtac
B D         Green monkey  gctct----tagcattcctggtac
B D                  Cat  gctttgccatggttttcaggatac
B D                Panda  gctctgtcatagttttcatggtgc
B D             Hedgehog  ========================
B D           Guinea pig  ========================
             Chinchilla  ========================
       Cape golden mole  ========================
     Chinese tree shrew  ========================
B D              Manatee  ========================
               Aardvark  ========================
B D             Elephant  ========================
B D             Bushbaby  ========================
B D                  Pig  ========================
B D              Ferret   ------------------------
B D              Dolphin  ========================
          Domestic goat  ========================
B D                Sheep  ========================
       Tibetan antelope  ========================
        Star-nosed mole  ========================
         Bactrian camel  ========================
       Black flying-fox  ========================
B D     White rhinoceros  ========================
B D                Horse  ========================
B D             Squirrel  ========================
B D            Armadillo  ========================
           Weddell seal  ========================
B D      Squirrel monkey  ========================
B D                  Dog  ========================
B D                  Cow  ========================
           Killer whale  ========================

Inserts between block 35 and 36 in window
B D                 Cat 28776bp
B D               Panda 26828bp

Alignment block 36 of 255 in window, 9648828 - 9648999, 172 bps 
B D                Human  tgttgtaaccgtccagtgggttcactttgtctgctagatagagccgatttatcaagac--ggggattaca
B D                Chimp  tgttgtaaccgtccagtgggttcactttgcctgctagatagagccgatttatcaagac--ggggattaca
B D              Gorilla  tgttgtaaccgtccagtgggttcactttgcctgctagatagagccgatttatcaagac--ggggattaca
B D            Orangutan  tgttgtagccgcccagtgggttcactttgcctgctagatagagccgatttatgaagacagagggtttaca
B D               Gibbon  tgttgtaaccgtccaatgggtttactttgcctgctagatagagccgatttatcaagacagggggattaca
B D               Rhesus  tgttgtaaccgtccaatgggttccctttgcttgctagatagagccgatttatcaagacagggggattaca
B D  Crab-eating macaque  tgttgtaaccgtccaatgggttccctttgcttgctagatagagccgatttatcaagacagggggattaca
B D               Baboon  tgttgtaaccgtccaatgggttccctttgcttgctagatagagccgatttatgaagacagggggattaca
B D         Green monkey  tgttgtaactgtccaatgggttccctttgcttgctagatagagccgatttatcaagacagggggattaca
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D              Manatee  ======================================================================
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D                  Cat  ======================================================================
B D             Bushbaby  ======================================================================
B D                  Pig  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D              Dolphin  ======================================================================
B D                Panda  ======================================================================
          Domestic goat  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ======================================================================
         Bactrian camel  ======================================================================
       Black flying-fox  ======================================================================
B D     White rhinoceros  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
           Weddell seal  ======================================================================
B D      Squirrel monkey  ======================================================================
B D                  Dog  ======================================================================
B D                  Cow  ======================================================================
           Killer whale  ======================================================================

                   Human  atggagaaagagtaattcacgcagagccggctttgcaggtgatgggagttttattattactcaaatcggt
                   Chimp  atggagaaagagtaattcacgcagagccggctttgcaggtgatgggagttttattattactcaaatcggt
                 Gorilla  atggagaaagagtaattcacgcagagccggctttgcaggtgatgggagttttattattactcaaatcggt
               Orangutan  atggagaaagagtaattcacgcagagccggctgtgcaggagatgggagttttattattactcaaatcggt
                  Gibbon  atggagaaagagtaattcatgcagagccggctgtgcaggagatgggagttttattattactcaaatcggt
                  Rhesus  gtggagaaagagaaattaacgcagagccgactgtgccg--gacgggaattttgttattactcaaatcggt
     Crab-eating macaque  gtggagaaagagaaattaacgcagagccgactgtgccg--gacgggagttttgttattactcaaatcggt
                  Baboon  gtggagaaagagaaattaacgcagagcccactgtgccg--gacgggagttttgttattactcaaatcggg
            Green monkey  gtggagaaagagaaattaacgcagagccgactgtgccg--gacgggagttttgttattactcaaatcggt
                Hedgehog  ======================================================================
              Guinea pig  ======================================================================
              Chinchilla  ======================================================================
        Cape golden mole  ======================================================================
      Chinese tree shrew  ======================================================================
                 Manatee  ======================================================================
                Aardvark  ======================================================================
                Elephant  ======================================================================
                     Cat  ======================================================================
                Bushbaby  ======================================================================
                     Pig  ======================================================================
                 Ferret   ----------------------------------------------------------------------
                 Dolphin  ======================================================================
                   Panda  ======================================================================
           Domestic goat  ======================================================================
                   Sheep  ======================================================================
        Tibetan antelope  ======================================================================
         Star-nosed mole  ======================================================================
          Bactrian camel  ======================================================================
        Black flying-fox  ======================================================================
        White rhinoceros  ======================================================================
                   Horse  ======================================================================
                Squirrel  ======================================================================
               Armadillo  ======================================================================
            Weddell seal  ======================================================================
         Squirrel monkey  ======================================================================
                     Dog  ======================================================================
                     Cow  ======================================================================
            Killer whale  ======================================================================

                   Human  cttcttaaatttgtgtcccggagcagtacgttct
                   Chimp  cttctttaatttgtctcccggagcagtacgttct
                 Gorilla  cttcttaaatttgtctcccggagcagtacgttct
               Orangutan  cttcttaaatctgtctcctggagcagtacgttct
                  Gibbon  cttctcaaatctgtctcccggagcagtgcgttct
                  Rhesus  cttttcaaatctgtctcccggagcagtgcattcc
     Crab-eating macaque  cttttcaaatctgtctcccggagcagtgcattcc
                  Baboon  cttttcaaatctgtctcccggagcagtgcattcc
            Green monkey  cttttcaaatctgtctcccggagcagtgcattcc
                Hedgehog  ==================================
              Guinea pig  ==================================
              Chinchilla  ==================================
        Cape golden mole  ==================================
      Chinese tree shrew  ==================================
                 Manatee  ==================================
                Aardvark  ==================================
                Elephant  ==================================
                     Cat  ==================================
                Bushbaby  ==================================
                     Pig  ==================================
                 Ferret   ----------------------------------
                 Dolphin  ==================================
                   Panda  ==================================
           Domestic goat  ==================================
                   Sheep  ==================================
        Tibetan antelope  ==================================
         Star-nosed mole  ==================================
          Bactrian camel  ==================================
        Black flying-fox  ==================================
        White rhinoceros  ==================================
                   Horse  ==================================
                Squirrel  ==================================
               Armadillo  ==================================
            Weddell seal  ==================================
         Squirrel monkey  ==================================
                     Dog  ==================================
                     Cow  ==================================
            Killer whale  ==================================

Alignment block 37 of 255 in window, 9649000 - 9649053, 54 bps 
B D                Human  aacattttttagatgttacaaatgtaacttttggctaagttacattcctactaa
B D                Chimp  aacattttttagatgttacaaatgtaacttttggctaagttacattcctactaa
B D              Gorilla  aacattttttagatgttacaaatgtaacttttggctaagttacattcctactaa
B D            Orangutan  aacattttttagatgttacaaatgtaacttttggctaaattacattcctactaa
B D               Gibbon  aacattctttagatgttacaaatataacttttggctaagttacattcctattaa
B D               Rhesus  aacattctttagatgttacaaatgtaccttttggctaagttacattcttgctaa
B D  Crab-eating macaque  aacattctttagatgttacaaatgtaccttttggctaagttacattcttgctaa
B D               Baboon  aacattctttagatgttacaaatgtaccttttggctaagttacattcttgctaa
B D         Green monkey  aacattctttagatgctacaaatgtaccttttggctaagttacattcttgctaa
B D     White rhinoceros  aaaagtttttaaatgtta-----atgtttaccagctaagccaagtgcttacaaa
B D             Hedgehog  ======================================================
B D           Guinea pig  ======================================================
             Chinchilla  ======================================================
       Cape golden mole  ======================================================
     Chinese tree shrew  ======================================================
B D              Manatee  ======================================================
               Aardvark  ======================================================
B D             Elephant  ======================================================
B D                  Cat  ======================================================
B D             Bushbaby  ======================================================
B D                  Pig  ======================================================
B D              Ferret   ------------------------------------------------------
B D              Dolphin  ======================================================
B D                Panda  ======================================================
          Domestic goat  ======================================================
B D                Sheep  ======================================================
       Tibetan antelope  ======================================================
        Star-nosed mole  ======================================================
         Bactrian camel  ======================================================
       Black flying-fox  ======================================================
B D                Horse  ======================================================
B D             Squirrel  ======================================================
B D            Armadillo  ======================================================
           Weddell seal  ======================================================
B D      Squirrel monkey  ======================================================
B D                  Dog  ======================================================
B D                  Cow  ======================================================
           Killer whale  ======================================================

Alignment block 38 of 255 in window, 9649054 - 9649058, 5 bps 
B D                Human  gttat
B D                Chimp  gttat
B D              Gorilla  gttat
B D            Orangutan  gttat
B D               Gibbon  gttat
B D               Rhesus  gttac
B D  Crab-eating macaque  gttac
B D               Baboon  gttac
B D         Green monkey  gttac
B D              Dolphin  gttaa
            Killer whale  gttaa
B D     White rhinoceros  gctga
B D             Hedgehog  =====
B D           Guinea pig  =====
             Chinchilla  =====
       Cape golden mole  =====
     Chinese tree shrew  =====
B D              Manatee  =====
               Aardvark  =====
B D             Elephant  =====
B D                  Cat  =====
B D             Bushbaby  =====
B D                  Pig  =====
B D              Ferret   -----
B D                Panda  =====
          Domestic goat  =====
B D                Sheep  =====
       Tibetan antelope  =====
        Star-nosed mole  =====
         Bactrian camel  =====
       Black flying-fox  =====
B D                Horse  =====
B D             Squirrel  =====
B D            Armadillo  =====
           Weddell seal  =====
B D      Squirrel monkey  =====
B D                  Dog  =====
B D                  Cow  =====

Inserts between block 38 and 39 in window
B D              Rhesus 1bp
B D Crab-eating macaque 1bp
B D              Baboon 1bp
B D        Green monkey 1bp
B D    White rhinoceros 4bp

Alignment block 39 of 255 in window, 9649059 - 9649067, 9 bps 
B D                Human  attctt----act
B D                Chimp  attctt----act
B D              Gorilla  attctt----act
B D            Orangutan  attctt----act
B D               Gibbon  attctt----act
B D               Rhesus  attcttatgaact
B D  Crab-eating macaque  attcttatgaact
B D               Baboon  attcttatgaact
B D         Green monkey  attcttatgaact
B D              Dolphin  tgtttt----tct
            Killer whale  tgtttt----tct
B D                Horse  atgttt----acc
B D     White rhinoceros  --attc----a--
B D             Hedgehog  =============
B D           Guinea pig  =============
             Chinchilla  =============
       Cape golden mole  =============
     Chinese tree shrew  =============
B D              Manatee  =============
               Aardvark  =============
B D             Elephant  =============
B D                  Cat  =============
B D             Bushbaby  =============
B D                  Pig  =============
B D              Ferret   -------------
B D                Panda  =============
          Domestic goat  =============
B D                Sheep  =============
       Tibetan antelope  =============
        Star-nosed mole  =============
         Bactrian camel  =============
       Black flying-fox  =============
B D             Squirrel  =============
B D            Armadillo  =============
           Weddell seal  =============
B D      Squirrel monkey  =============
B D                  Dog  =============
B D                  Cow  =============

Alignment block 40 of 255 in window, 9649068 - 9649108, 41 bps 
B D                Human  a------------------------actaagccaaatg-ttatattctaaagaatgtttacagaac
B D                Chimp  a------------------------actaagccaaatg-ttatattctaaagaatgtttacagaac
B D              Gorilla  a------------------------actaagccaaatg-ttatattctaaagaatgtttacagaac
B D            Orangutan  aagcccaaatgttacgttctt----attaagccaaatg-ttatattttaaagaatgtttacagaac
B D               Gibbon  aagcccaaatgttacgttctt----actaagccaaatt-ttgtattctaaagaatgtttacagaac
B D               Rhesus  aagcccaaatgttacattcttactaactaaaccaaatg-ttatattctaaagaatgtttacaaaac
B D  Crab-eating macaque  aagcccaaatgttacattcttactaactaagccaaatg-ttatattctaaagaatgtttacaaaac
B D               Baboon  aagcccaaatgttacattcttactaactaagccaaatg-ttatattctaaagaatgtttacaaaac
B D         Green monkey  aagcccaaatgttacattcttactaactaagccaaatg-ttatattctaaagaatgtttacaaaac
B D              Dolphin  a------------------------gctaagtca------------------agtgattacataac
            Killer whale  a------------------------gctaagtca------------------agtgattacataac
B D                Horse  a------------------------gctaagcca------------------agtgctcacaaagc
B D     White rhinoceros  -----------------------------------------------------------accaatc
B D              Manatee  ------------------------agctaagccaagtgcttacgtaatggagaa-----acaaaat
B D             Hedgehog  ==================================================================
B D           Guinea pig  ==================================================================
             Chinchilla  ==================================================================
       Cape golden mole  ==================================================================
     Chinese tree shrew  ==================================================================
               Aardvark  ==================================================================
B D             Elephant  ==================================================================
B D                  Cat  ==================================================================
B D             Bushbaby  ==================================================================
B D                  Pig  ==================================================================
B D              Ferret   ------------------------------------------------------------------
B D                Panda  ==================================================================
          Domestic goat  ==================================================================
B D                Sheep  ==================================================================
       Tibetan antelope  ==================================================================
        Star-nosed mole  ==================================================================
         Bactrian camel  ==================================================================
       Black flying-fox  ==================================================================
B D             Squirrel  ==================================================================
B D            Armadillo  ==================================================================
           Weddell seal  ==================================================================
B D      Squirrel monkey  ==================================================================
B D                  Dog  ==================================================================
B D                  Cow  ==================================================================

Alignment block 41 of 255 in window, 9649109 - 9649122, 14 bps 
B D                Human  --cgaa------actaaatatt
B D                Chimp  --cgaa------actaaatatt
B D              Gorilla  --cgaa------actaaatatt
B D            Orangutan  --cgaa------cctaaatatt
B D               Gibbon  --cgaa------actaaatatt
B D               Rhesus  --tgaa------actaaatatt
B D  Crab-eating macaque  --tgaa------actaaatatt
B D               Baboon  --tgaa------actaaatatt
B D         Green monkey  --tgaa------actaaatatt
B D             Bushbaby  --caaa------attaaatgtt
B D              Dolphin  --cgaa------actatttgac
            Killer whale  --cgaa------actatttgac
B D                Horse  --tgaaagttatacttgttaac
B D     White rhinoceros  --tgaaagttacacttgttaac
B D              Manatee  gaccag------tcagaat---
B D             Hedgehog  ======================
B D           Guinea pig  ======================
             Chinchilla  ======================
       Cape golden mole  ======================
     Chinese tree shrew  ======================
               Aardvark  ======================
B D             Elephant  ======================
B D                  Cat  ======================
B D                  Pig  ======================
B D              Ferret   ----------------------
B D                Panda  ======================
          Domestic goat  ======================
B D                Sheep  ======================
       Tibetan antelope  ======================
        Star-nosed mole  ======================
         Bactrian camel  ======================
       Black flying-fox  ======================
B D             Squirrel  ======================
B D            Armadillo  ======================
           Weddell seal  ======================
B D      Squirrel monkey  ======================
B D                  Dog  ======================
B D                  Cow  ======================

Inserts between block 41 and 42 in window
B D            Bushbaby 12bp
B D               Horse 15bp
B D    White rhinoceros 15bp

Alignment block 42 of 255 in window, 9649123 - 9649131, 9 bps 
B D                Human  tgttacctg
B D                Chimp  tgttacctg
B D              Gorilla  tgttacctg
B D            Orangutan  tgttacctg
B D               Gibbon  tgttacctg
B D               Rhesus  tattacctg
B D  Crab-eating macaque  tattacctg
B D               Baboon  tattacctg
B D         Green monkey  tattacctg
B D             Bushbaby  tgttataca
B D              Dolphin  -------ca
            Killer whale  -------ca
B D                Horse  cgttacaca
B D     White rhinoceros  tgttacaca
B D             Elephant  tgttacacg
B D              Manatee  -gttacacg
B D             Hedgehog  =========
B D           Guinea pig  =========
             Chinchilla  =========
       Cape golden mole  =========
     Chinese tree shrew  =========
               Aardvark  =========
B D                  Cat  =========
B D                  Pig  =========
B D              Ferret   ---------
B D                Panda  =========
          Domestic goat  =========
B D                Sheep  =========
       Tibetan antelope  =========
        Star-nosed mole  =========
         Bactrian camel  =========
       Black flying-fox  =========
B D             Squirrel  =========
B D            Armadillo  =========
           Weddell seal  =========
B D      Squirrel monkey  =========
B D                  Dog  =========
B D                  Cow  =========

Alignment block 43 of 255 in window, 9649132 - 9649138, 7 bps 
B D                Human  gtacagt
B D                Chimp  gtacagt
B D              Gorilla  gtacagt
B D            Orangutan  gtacagt
B D               Gibbon  gcacagt
B D               Rhesus  gtacagt
B D  Crab-eating macaque  gtacagt
B D               Baboon  gtacagt
B D         Green monkey  gtacagt
B D             Bushbaby  atacaat
B D              Dolphin  gtgcaaa
            Killer whale  gtgcaaa
B D                Horse  ttgcagt
B D     White rhinoceros  ttgcaat
         Star-nosed mole  ttgca--
B D             Elephant  ttggaaa
B D              Manatee  ttggaaa
B D             Hedgehog  =======
B D           Guinea pig  =======
             Chinchilla  =======
       Cape golden mole  =======
     Chinese tree shrew  =======
               Aardvark  =======
B D                  Cat  =======
B D                  Pig  =======
B D              Ferret   -------
B D                Panda  =======
          Domestic goat  =======
B D                Sheep  =======
       Tibetan antelope  =======
         Bactrian camel  =======
       Black flying-fox  =======
B D             Squirrel  =======
B D            Armadillo  =======
           Weddell seal  =======
B D      Squirrel monkey  =======
B D                  Dog  =======
B D                  Cow  =======

Alignment block 44 of 255 in window, 9649139 - 9649142, 4 bps 
B D                Human  tgtg
B D                Chimp  tgtg
B D              Gorilla  tgtg
B D            Orangutan  tgtg
B D               Gibbon  tgtg
B D               Rhesus  tgtg
B D  Crab-eating macaque  tgtg
B D               Baboon  tgtg
B D         Green monkey  tgtg
B D             Bushbaby  tatg
B D              Dolphin  tgtg
            Killer whale  tgtg
B D                Horse  tatg
B D     White rhinoceros  tatg
B D             Elephant  tatg
B D              Manatee  tgtg
B D            Armadillo  tgtc
B D             Hedgehog  ====
B D           Guinea pig  ====
             Chinchilla  ====
       Cape golden mole  ====
     Chinese tree shrew  ====
               Aardvark  ====
B D                  Cat  ====
B D                  Pig  ====
B D              Ferret   ----
B D                Panda  ====
          Domestic goat  ====
B D                Sheep  ====
       Tibetan antelope  ====
        Star-nosed mole  ----
         Bactrian camel  ====
       Black flying-fox  ====
B D             Squirrel  ====
           Weddell seal  ====
B D      Squirrel monkey  ====
B D                  Dog  ====
B D                  Cow  ====

Alignment block 45 of 255 in window, 9649143 - 9649155, 13 bps 
B D                Human  aaacttgtt-tttt
B D                Chimp  aaacttgtt-tttt
B D              Gorilla  aaacttgtt-tttt
B D            Orangutan  aaactcgtt-tttt
B D               Gibbon  aaacttgtt-tttt
B D               Rhesus  aaacttgtt-tttt
B D  Crab-eating macaque  aaacttgtt-tttt
B D               Baboon  aaacttgtt-tttt
B D         Green monkey  aaacttgtt-tttt
B D             Bushbaby  aaacttttt-tttt
B D                  Pig  aaacttatt-tttt
B D              Dolphin  aaacctattctttt
            Killer whale  aaacctattctttt
B D                Horse  aaacatg---tttt
B D     White rhinoceros  aaacctg---tttt
         Star-nosed mole  aaagttg---tttt
B D             Elephant  aaatttata-tgtg
B D              Manatee  aaatttgta-tgta
B D            Armadillo  aaatttatt-ttt-
B D             Hedgehog  ==============
B D           Guinea pig  ==============
             Chinchilla  ==============
       Cape golden mole  ==============
     Chinese tree shrew  ==============
               Aardvark  ==============
B D                  Cat  ==============
B D              Ferret   --------------
B D                Panda  ==============
          Domestic goat  ==============
B D                Sheep  ==============
       Tibetan antelope  ==============
         Bactrian camel  ==============
       Black flying-fox  ==============
B D             Squirrel  ==============
           Weddell seal  ==============
B D      Squirrel monkey  ==============
B D                  Dog  ==============
B D                  Cow  ==============

Alignment block 46 of 255 in window, 9649156 - 9649215, 60 bps 
B D                Human  aaaatgca-------t-----cctgtgat----t------------------------------------
B D                Chimp  aaaatgca-------t-----cctgtgat----t------------------------------------
B D              Gorilla  aaaatgca-------t-----cctgtgat----t------------------------------------
B D            Orangutan  aaaatgca-------t-----cctgtga-----t------------------------------------
B D               Gibbon  aaaatgca-------t-----cctgtga-----t------------------------------------
B D               Rhesus  aaaatgca-------t-----cctgtgg-----t------------------------------------
B D  Crab-eating macaque  aaaatgca-------t-----cctgtgg-----t------------------------------------
B D               Baboon  aaaatgca-------t-----cctgtgg-----t------------------------------------
B D         Green monkey  aaaatgca-------t-----cctgtgg-----t------------------------------------
B D             Bushbaby  --aatgta-------t-----cctgtttt----t------------------------------------
B D                  Pig  gaaact-------t-t-----cctgtaagttaac------------------------------------
B D              Dolphin  gaaatttaaactgt-t-----cctgtaagttaac------------------------------------
            Killer whale  gaaatttaaactgt-t-----cctgtaagttaac------------------------------------
B D                Horse  gaaacgccaatgat-t------ttgtaaattaac------------------------------------
B D     White rhinoceros  gaaatgccaacggt-t------ttataaattaaaatatttacaaaatattaaatattacaaaatatattt
         Star-nosed mole  taaataccaagggtgt-----tttgtaaattcat------------------------------------
B D             Elephant  gaaatata-------t--gtttttgtaag----t------------------------------------
B D              Manatee  gaactgtc-------tgagtttttgtaag----t------------------------------------
                Aardvark  aaatcgtc-------t-----tttgtaag----t------------------------------------
B D            Armadillo  gaaatgta-------a--ccttttgtaga----t------------------------------------
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D                  Cat  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D                Panda  ======================================================================
          Domestic goat  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
         Bactrian camel  ======================================================================
       Black flying-fox  ======================================================================
B D             Squirrel  ======================================================================
           Weddell seal  ======================================================================
B D      Squirrel monkey  ======================================================================
B D                  Dog  ======================================================================
B D                  Cow  ======================================================================

                   Human  --t-aagtttt-tcagatcctgaaactg--ag--ttaaaat---ttgatcagt
                   Chimp  --t-aagtttt-tcagatcctgaaactg--ag--ttaaaat---ttgatcagt
                 Gorilla  --t-aagtttt-tcagatcctgaaactg--ag--ttaaaat---ttgatcagt
               Orangutan  --t-aagtttt-tcagatcctgaaactg--ag--ttaaaat---ttgatcagt
                  Gibbon  --t-aagtttt-tcagatcctgaaactg--ag--ttaaaat---ttgatcagt
                  Rhesus  --t-aagtttt-acagatcctgaaactg--ag---tacaat---ttgaccagt
     Crab-eating macaque  --t-aagtttt-acagatcctgaaactg--ag---taaaat---ttgaccagt
                  Baboon  --t-aagtttt-acagatcctgaaactg--ag---taaaat---ttgaccagt
            Green monkey  --t-aagtttt-acagatcctgaaactg--ag---taaaat---ttgaccagt
                Bushbaby  --t-aagtttt-ttggatcctgaaactg--ag--ttaaaac---attatcagc
                     Pig  --a-aaggttt-ttagatcatgaaactaaaag------aaccagtagaccagt
                 Dolphin  --t-aagtttt-ctagaacatgaaaataaaag--ttaaaaccagtagaccagt
            Killer whale  --t-aagtttt-ctagaacatgaaaataaaag--ttaaaaccagtagaccagt
                   Horse  --t-aagtatt-ttggatgatgaaactaataa--ttaaaat---tagactagt
        White rhinoceros  tgt-aaatatt-ttggattatgaaactaaaaa--ttaaaat---tagactagt
         Star-nosed mole  --t-caactttattggactctgtaactataaaatttaaaat---caggccagt
                Elephant  --t-aagtttt-gtggatcatgctacaa--agaattaaaat---taaatgagt
                 Manatee  --t-aagtttt-gtggatcatgcagcta--agaattaaaat---tcgagaaat
                Aardvark  --t---gtttt-gtagttcataaaacta--tg--ttaaaat---tagacaaat
               Armadillo  --taaaatttt-gtgagtaatggatgta--agggttagaat---tacaacact
                Hedgehog  =====================================================
              Guinea pig  =====================================================
              Chinchilla  =====================================================
        Cape golden mole  =====================================================
      Chinese tree shrew  =====================================================
                     Cat  =====================================================
                 Ferret   -----------------------------------------------------
                   Panda  =====================================================
           Domestic goat  =====================================================
                   Sheep  =====================================================
        Tibetan antelope  =====================================================
          Bactrian camel  =====================================================
        Black flying-fox  =====================================================
                Squirrel  =====================================================
            Weddell seal  =====================================================
         Squirrel monkey  =====================================================
                     Dog  =====================================================
                     Cow  =====================================================

Inserts between block 46 and 47 in window
B D              Rhesus 4856bp
B D Crab-eating macaque 5527bp
B D              Baboon 5531bp
B D        Green monkey 3636bp

Alignment block 47 of 255 in window, 9649216 - 9649229, 14 bps 
B D                Human  aataat-gctttatt
B D                Chimp  aataat-gctttatt
B D              Gorilla  aataat-gctttatt
B D            Orangutan  aataat-gctttatt
B D               Gibbon  aataat-gctttatt
B D               Rhesus  aataat-gctttatt
B D  Crab-eating macaque  aataat-gctttatt
B D               Baboon  aataat-gctttatt
B D         Green monkey  aataat-gctttatt
B D             Bushbaby  aat-at-agtttatt
B D                  Pig  aat-at-gttttgtt
B D              Dolphin  aat-at-ggttcatt
            Killer whale  aat-at-ggttcatt
B D                Horse  tat-at-cgttaatt
B D     White rhinoceros  aat-at-ggttaata
         Star-nosed mole  aat-atgggctcatt
B D             Elephant  aat-at-ggttcatt
B D              Manatee  aat-at-ggttcatt
                Aardvark  aat-at-tattcatt
B D            Armadillo  aat-gt-agctcatt
B D             Hedgehog  ===============
B D           Guinea pig  ===============
             Chinchilla  ===============
       Cape golden mole  ===============
     Chinese tree shrew  ===============
B D                  Cat  ===============
B D              Ferret   ---------------
B D                Panda  ===============
          Domestic goat  ===============
B D                Sheep  ===============
       Tibetan antelope  ===============
         Bactrian camel  ===============
       Black flying-fox  ===============
B D             Squirrel  ===============
           Weddell seal  ===============
B D      Squirrel monkey  ===============
B D                  Dog  ===============
B D                  Cow  ===============

Alignment block 48 of 255 in window, 9649230 - 9649309, 80 bps 
B D                Human  tctctgttcttctgagagataattcctaatgttg-tttttccaactagaagt-ctgaagagttattgtg-
B D                Chimp  tctctgttcttctgagaggtaattcctaatgttg-tttttccaactagaagt-ctgaagagttattgtg-
B D              Gorilla  tctctgttcttctgagagataattcctaatgttg-tttttccaactagaagt-ctgaagagttattgtg-
B D            Orangutan  tctttgttcttctgagacataattcctaacgttg-tttttccaactagaagt-ctgaagag-tattgtg-
B D               Gibbon  tctttgttcttctgagagataattcctaa---tg-tttttccaactggaagt-ctgaagag-tattgtg-
B D               Rhesus  tctttgttcttctgagagataattcctaatgttg-tttttccaactagaagt-ctgaagag-tattgtg-
B D  Crab-eating macaque  tctttgttcttctgagagataattcctaatgttg-tttttccaactagaagt-ctgaagag-tattgtg-
B D               Baboon  tctttgttcttctgagagataattcctaatgttg-tttttccaactagaagt-ttgaagag-tattgtg-
B D         Green monkey  tctttgttcttctgagagataattcctaatgttg-tttttccaactagaagt-ctgaagag-tattgtg-
B D             Bushbaby  tctttg---ttctgacagataattcctaa------cttttccaactagaaat-ctgaagga-ca-cgtg-
B D                  Pig  tttttgttcttctgtgagaccattcccaacagca-cttctcagatgagaaat-ttgaaggt-tattgtgg
B D              Dolphin  tctctgttcttctgtgagataatttctgacacca-tttttcaaactagaaat-ttgaaggt-tgttgtg-
            Killer whale  tctctgttcttctgtgagataatttctgacacca-tttttcaaactagaaat-ttgaaggt-tgttgtg-
           Domestic goat  tctctgttcttctgtgagataatttctaaaaccattttttcaaactagaaat-ttgaaggt-tattgtg-
B D                Horse  tatttgttctctt--gagataattcctaatacca-tttttccaactagaaat-ttgaagat-taatgtg-
B D     White rhinoceros  tctttgttcttctaagagataattcctaatacca-ttttt-caactagaaat-ttgtaggt-tattgtg-
         Star-nosed mole  gctttgttcttctgggagagaattcctaatgctgatttttccaactagaaatattgaagat-tattagg-
B D             Elephant  actttgttcttctaagagataattcctaatacta-tttt--cacctagaaat-ttgaaggt-ttttgta-
B D              Manatee  attttgttctcctaagagataattcctaatacta-tttttccaactagaaat-ttgaaggt-tactgtg-
                Aardvark  actttgttcttctaaaagatatttcctaatacta-tttttcctgctaaaaat-tggaaggt-tattgtg-
B D            Armadillo  gctttgttcttctgagagataattattactactg-tttttttaactagaaat-ttgaagtt-gattgtc-
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D                  Cat  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D                Panda  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
         Bactrian camel  ======================================================================
       Black flying-fox  ======================================================================
B D             Squirrel  ======================================================================
           Weddell seal  ======================================================================
B D      Squirrel monkey  ======================================================================
B D                  Dog  ======================================================================
B D                  Cow  ======================================================================

                   Human  --ttcagtgtgtacc
                   Chimp  --ttcagtgtgtacc
                 Gorilla  --ttcagtgtgtacc
               Orangutan  --ttcactgtgtact
                  Gibbon  --ttcagtgtgtact
                  Rhesus  --ttcagtgtgtact
     Crab-eating macaque  --ttcagtgtgtact
                  Baboon  --ttcagtgtgtact
            Green monkey  --ttcagtgtgtact
                Bushbaby  --tttagtgtgtact
                     Pig  ttctttgaagataat
                 Dolphin  --ttcagagtgtaat
            Killer whale  --ttcagagtgtaat
           Domestic goat  --ttcagagtgtaat
                   Horse  --ttcagagtgtagt
        White rhinoceros  --ttcagagtatagt
         Star-nosed mole  --agcacgttgtgct
                Elephant  --ttgagagtgtgat
                 Manatee  --ttgagagtgtgat
                Aardvark  --ctgagagtgtgat
               Armadillo  --ttgagaatgagat
                Hedgehog  ===============
              Guinea pig  ===============
              Chinchilla  ===============
        Cape golden mole  ===============
      Chinese tree shrew  ===============
                     Cat  ===============
                 Ferret   ---------------
                   Panda  ===============
                   Sheep  ===============
        Tibetan antelope  ===============
          Bactrian camel  ===============
        Black flying-fox  ===============
                Squirrel  ===============
            Weddell seal  ===============
         Squirrel monkey  ===============
                     Dog  ===============
                     Cow  ===============

Inserts between block 48 and 49 in window
B D            Bushbaby 453bp

Alignment block 49 of 255 in window, 9649310 - 9649369, 60 bps 
B D                Human  tt--------------aagagtggtatgaatttgcgggagt-------caggacacactgt-aagaaagg
B D                Chimp  tt--------------aagagtggtatgaatttgcgggagt-------caggacacactgt-aagaaagg
B D              Gorilla  tt--------------aagagtggtatgaatttgcgggagt-------caggacacactgt-aagaaagg
B D            Orangutan  tt--------------aagagtggtatgaatttgtgggagt-------caggacacactat-aagaaagg
B D               Gibbon  tt----------------gagtggtatgaatttgcgggagt-------cagcacacactat-aagaaagg
B D               Rhesus  tt--------------aagagtgatatgaatctgcaggagt-------caggacacactat-tagaaagg
B D  Crab-eating macaque  tt--------------aagagtgatatgaatctgcaggagt-------caggacacactat-tagaaagg
B D               Baboon  tt--------------aagagtgatatgaatctgcaggagt-------caggacacactat-tagaaagg
B D         Green monkey  tt--------------aagagtgatatgaatctgcaggagt-------caggacacactat-tagaaagg
B D                  Pig  at--------------taaaggcag--gaatttggagggagacaagaggaggacacaccat-aggaaagt
B D              Dolphin  at--------------aagaggcatacgaatttagagggagacaaaaaaaggacacaccag-aggagtgt
            Killer whale  at--------------aagaggcatacaaatttagagggagacaaaaaaaggacacaccag-aggagtgt
           Domestic goat  at--------------aaaagccatatgaatttaaagggaaacaggaagaggacacaccac-aggagagt
B D                Horse  at--------------aaga--catatgaatttggagggagactggaagaggacataccat-aagaaagg
B D     White rhinoceros  at--------------aagagtcttatgaatttggagggagactggaagaggacacactat-aagaaagg
         Star-nosed mole  gt--------------------catgtgaattgacatagaaataag--ggggaactagcag-ggagaggg
B D             Elephant  acaaacagtatatgaaaagcagcatgtgaatttggggggagataagaagaagacacaacat----aaata
B D              Manatee  at--------------aagcagcatgtgaatttggggggagacaagaagaggagacagcat-aagaagta
                Aardvark  ataagcagcatatgaagagcatcatatgaatttggaagcatagaggaagaggacacatcac-aagaactg
B D            Armadillo  at-------------agggatacataagaatttggagagagatcagaagaaggcacaccaaaaaaaaatg
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D                  Cat  ======================================================================
B D             Bushbaby  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D                Panda  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
         Bactrian camel  ======================================================================
       Black flying-fox  ======================================================================
B D             Squirrel  ======================================================================
           Weddell seal  ======================================================================
B D      Squirrel monkey  ======================================================================
B D                  Dog  ======================================================================
B D                  Cow  ======================================================================

                   Human  tagaagagaaat
                   Chimp  tagaagagaaat
                 Gorilla  tagaagagaaat
               Orangutan  tataagagaaat
                  Gibbon  tagaagagaaat
                  Rhesus  tagaagagaagt
     Crab-eating macaque  tagaagagaagt
                  Baboon  tagaagagaagt
            Green monkey  tagaagagaagt
                     Pig  atcagggaaag-
                 Dolphin  taggaaggaagc
            Killer whale  taggaaggaagc
           Domestic goat  --gtaag--agc
                   Horse  tagaagaaaaat
        White rhinoceros  tagaagaaaaat
         Star-nosed mole  acgat-------
                Elephant  tacaagaaaagt
                 Manatee  tacaagaaaagt
                Aardvark  tgcaaaataaat
               Armadillo  cacaaaatgga-
                Hedgehog  ============
              Guinea pig  ============
              Chinchilla  ============
        Cape golden mole  ============
      Chinese tree shrew  ============
                     Cat  ============
                Bushbaby  ============
                 Ferret   ------------
                   Panda  ============
                   Sheep  ============
        Tibetan antelope  ============
          Bactrian camel  ============
        Black flying-fox  ============
                Squirrel  ============
            Weddell seal  ============
         Squirrel monkey  ============
                     Dog  ============
                     Cow  ============

Inserts between block 49 and 50 in window
B D             Dolphin 35bp
           Killer whale 35bp
          Domestic goat 1134bp
        Star-nosed mole 1bp
B D           Armadillo 960bp

Alignment block 50 of 255 in window, 9649370 - 9649373, 4 bps 
B D                Human  aagt
B D                Chimp  aagt
B D              Gorilla  aagt
B D            Orangutan  aagt
B D               Gibbon  aatt
B D               Rhesus  aagt
B D  Crab-eating macaque  aagt
B D               Baboon  aagt
B D         Green monkey  aagt
B D                  Pig  aaat
B D              Dolphin  aaat
            Killer whale  aaat
B D                Horse  aagt
B D     White rhinoceros  aagt
         Star-nosed mole  gag-
B D             Elephant  aagg
B D              Manatee  aagc
                Aardvark  aaat
B D             Hedgehog  ====
B D           Guinea pig  ====
             Chinchilla  ====
       Cape golden mole  ====
     Chinese tree shrew  ====
B D                  Cat  ====
B D             Bushbaby  ====
B D              Ferret   ----
B D                Panda  ====
          Domestic goat  ====
B D                Sheep  ====
       Tibetan antelope  ====
         Bactrian camel  ====
       Black flying-fox  ====
B D             Squirrel  ====
B D            Armadillo  ====
           Weddell seal  ====
B D      Squirrel monkey  ====
B D                  Dog  ====
B D                  Cow  ====

Inserts between block 50 and 51 in window
B D                 Pig 1147bp
B D             Dolphin 13bp
           Killer whale 13bp
B D               Horse 2bp
B D    White rhinoceros 2bp

Alignment block 51 of 255 in window, 9649374 - 9649385, 12 bps 
B D                Human  gagca--agag------aga
B D                Chimp  gagca--agag------aga
B D              Gorilla  gagca--agag------aga
B D            Orangutan  gagcaagagag------aga
B D               Gibbon  gagcaagaggg------aga
B D               Rhesus  gagcaagagag------gga
B D  Crab-eating macaque  gagcaagagag------gga
B D               Baboon  gagcaagagag------gga
B D         Green monkey  gagcaaaagag------gga
B D              Dolphin  --ataacagga------gaa
            Killer whale  --ataacagga------gaa
B D                Horse  --gccagaggg------aga
B D     White rhinoceros  --gccagagtg------aga
         Star-nosed mole  --gagacacag------aga
B D             Elephant  --------aag------aga
B D              Manatee  --------aag------aga
                Aardvark  --------aagtatgtcaga
B D             Hedgehog  ====================
B D           Guinea pig  ====================
             Chinchilla  ====================
       Cape golden mole  ====================
     Chinese tree shrew  ====================
B D                  Cat  ====================
B D             Bushbaby  ====================
B D                  Pig  ====================
B D              Ferret   --------------------
B D                Panda  ====================
          Domestic goat  ====================
B D                Sheep  ====================
       Tibetan antelope  ====================
         Bactrian camel  ====================
       Black flying-fox  ====================
B D             Squirrel  ====================
B D            Armadillo  ====================
           Weddell seal  ====================
B D      Squirrel monkey  ====================
B D                  Dog  ====================
B D                  Cow  ====================

Inserts between block 51 and 52 in window
B D            Elephant 4bp
B D             Manatee 6bp
               Aardvark 4bp

Alignment block 52 of 255 in window, 9649386 - 9649400, 15 bps 
B D                Human  agtggaacaag---------------atgc
B D                Chimp  agtggaacaag---------------atgc
B D              Gorilla  agtggaacaag---------------atgc
B D            Orangutan  agtggaacaag---------------atgc
B D               Gibbon  agtggaacaag---------------atgc
B D               Rhesus  aatggaacaag---------------atgc
B D  Crab-eating macaque  aatggaacaag---------------atgc
B D               Baboon  aatggaacaag---------------atgc
B D         Green monkey  aatggaacaag---------------atgc
B D              Dolphin  aatcaaacaaaagtttaataacatgtatac
            Killer whale  aatcaaacaaaagtttaataacatgtatac
B D                Horse  aatggagcatg---------------atat
B D     White rhinoceros  aatggagcatg---------------atac
         Star-nosed mole  agtggagcttg---------------atcc
B D             Elephant  aataggacatg---------------atac
B D              Manatee  aacaaggc----------------------
                Aardvark  gatggtgcgtg---------------atac
B D             Hedgehog  ==============================
B D           Guinea pig  ==============================
             Chinchilla  ==============================
       Cape golden mole  ==============================
     Chinese tree shrew  ==============================
B D                  Cat  ==============================
B D             Bushbaby  ==============================
B D                  Pig  ==============================
B D              Ferret   ------------------------------
B D                Panda  ==============================
          Domestic goat  ==============================
B D                Sheep  ==============================
       Tibetan antelope  ==============================
         Bactrian camel  ==============================
       Black flying-fox  ==============================
B D             Squirrel  ==============================
B D            Armadillo  ==============================
           Weddell seal  ==============================
B D      Squirrel monkey  ==============================
B D                  Dog  ==============================
B D                  Cow  ==============================

Inserts between block 52 and 53 in window
               Aardvark 7bp

Alignment block 53 of 255 in window, 9649401 - 9649401, 1 bps 
B D                Human  a
B D                Chimp  a
B D              Gorilla  a
B D            Orangutan  a
B D               Gibbon  a
B D               Rhesus  a
B D  Crab-eating macaque  a
B D               Baboon  a
B D         Green monkey  a
B D              Dolphin  a
            Killer whale  a
B D                Horse  a
B D     White rhinoceros  a
         Star-nosed mole  a
B D             Elephant  a
B D             Hedgehog  =
B D           Guinea pig  =
             Chinchilla  =
       Cape golden mole  =
     Chinese tree shrew  =
B D              Manatee  -
               Aardvark  =
B D                  Cat  =
B D             Bushbaby  =
B D                  Pig  =
B D              Ferret   -
B D                Panda  =
          Domestic goat  =
B D                Sheep  =
       Tibetan antelope  =
         Bactrian camel  =
       Black flying-fox  =
B D             Squirrel  =
B D            Armadillo  =
           Weddell seal  =
B D      Squirrel monkey  =
B D                  Dog  =
B D                  Cow  =

Inserts between block 53 and 54 in window
B D            Elephant 6bp

Alignment block 54 of 255 in window, 9649402 - 9649409, 8 bps 
B D                Human  tgtgggaa
B D                Chimp  tgtgggaa
B D              Gorilla  tgtggaaa
B D            Orangutan  tgtgggaa
B D               Gibbon  tgtgggaa
B D               Rhesus  tgtgggaa
B D  Crab-eating macaque  tgtgggaa
B D               Baboon  tgtgggaa
B D         Green monkey  tgtgggaa
B D              Dolphin  tgggagag
            Killer whale  tgggagag
B D                Horse  agggaa--
B D     White rhinoceros  agggag--
         Star-nosed mole  aaggagga
B D              Manatee  ----agaa
B D             Hedgehog  ========
B D           Guinea pig  ========
             Chinchilla  ========
       Cape golden mole  ========
     Chinese tree shrew  ========
               Aardvark  ========
B D             Elephant  ========
B D                  Cat  ========
B D             Bushbaby  ========
B D                  Pig  ========
B D              Ferret   --------
B D                Panda  ========
          Domestic goat  ========
B D                Sheep  ========
       Tibetan antelope  ========
         Bactrian camel  ========
       Black flying-fox  ========
B D             Squirrel  ========
B D            Armadillo  ========
           Weddell seal  ========
B D      Squirrel monkey  ========
B D                  Dog  ========
B D                  Cow  ========

Inserts between block 54 and 55 in window
B D             Dolphin 25bp
           Killer whale 25bp
B D    White rhinoceros 2bp

Alignment block 55 of 255 in window, 9649410 - 9649411, 2 bps 
B D                Human  ta
B D                Chimp  ta
B D              Gorilla  ta
B D            Orangutan  ta
B D               Gibbon  ta
B D               Rhesus  ta
B D  Crab-eating macaque  ta
B D               Baboon  ta
B D         Green monkey  ta
B D              Dolphin  -a
            Killer whale  -a
B D                Horse  -g
         Star-nosed mole  tg
B D              Manatee  tg
B D             Hedgehog  ==
B D           Guinea pig  ==
             Chinchilla  ==
       Cape golden mole  ==
     Chinese tree shrew  ==
               Aardvark  ==
B D             Elephant  ==
B D                  Cat  ==
B D             Bushbaby  ==
B D                  Pig  ==
B D              Ferret   --
B D                Panda  ==
          Domestic goat  ==
B D                Sheep  ==
       Tibetan antelope  ==
         Bactrian camel  ==
       Black flying-fox  ==
B D     White rhinoceros  ==
B D             Squirrel  ==
B D            Armadillo  ==
           Weddell seal  ==
B D      Squirrel monkey  ==
B D                  Dog  ==
B D                  Cow  ==

Inserts between block 55 and 56 in window
B D             Dolphin 1bp
           Killer whale 1bp
B D               Horse 1bp

Alignment block 56 of 255 in window, 9649412 - 9649422, 11 bps 
B D                Human  ttgctgcagga
B D                Chimp  ttgctgcagga
B D              Gorilla  ttgctgcagga
B D            Orangutan  ttgctgcagga
B D               Gibbon  ttgctgcagga
B D               Rhesus  ttgctgtagga
B D  Crab-eating macaque  ttgctgtagga
B D               Baboon  ttgctgtagga
B D         Green monkey  ttgctgcagga
B D              Dolphin  atggccaaaaa
            Killer whale  atggccaaaaa
B D              Manatee  taccagcagga
B D             Hedgehog  ===========
B D           Guinea pig  ===========
             Chinchilla  ===========
       Cape golden mole  ===========
     Chinese tree shrew  ===========
               Aardvark  ===========
B D             Elephant  ===========
B D                  Cat  ===========
B D             Bushbaby  ===========
B D                  Pig  ===========
B D              Ferret   -----------
B D                Panda  ===========
          Domestic goat  ===========
B D                Sheep  ===========
       Tibetan antelope  ===========
        Star-nosed mole  -----------
         Bactrian camel  ===========
       Black flying-fox  ===========
B D     White rhinoceros  ===========
B D                Horse  ===========
B D             Squirrel  ===========
B D            Armadillo  ===========
           Weddell seal  ===========
B D      Squirrel monkey  ===========
B D                  Dog  ===========
B D                  Cow  ===========

Alignment block 57 of 255 in window, 9649423 - 9649445, 23 bps 
B D                Human  cttttcctta--------------tttcagctaaaaa
B D                Chimp  cttttcctta--------------tttcagctaaaaa
B D              Gorilla  cttttcctta--------------tttcagctaaaaa
B D            Orangutan  cttttcctta--------------tttcagctaaaaa
B D               Gibbon  cttttcctta--------------tttcagctaaaaa
B D               Rhesus  cctttcctta--------------tttcagctaaaaa
B D  Crab-eating macaque  cctttcctta--------------tttcagctaaaaa
B D               Baboon  cctttcctta--------------tttcagctaaaaa
B D         Green monkey  cctttcctta--------------tttcagcttaaaa
B D              Dolphin  cttcaccttaaatactgt------ctccagctaatga
            Killer whale  cttcaccttaaatactgt------ctccagctaatga
         Star-nosed mole  -------ttagatacaggggaatacaggagcaaaaaa
B D             Hedgehog  =====================================
B D           Guinea pig  =====================================
             Chinchilla  =====================================
       Cape golden mole  =====================================
     Chinese tree shrew  =====================================
B D              Manatee  -------------------------------------
               Aardvark  =====================================
B D             Elephant  =====================================
B D                  Cat  =====================================
B D             Bushbaby  =====================================
B D                  Pig  =====================================
B D              Ferret   -------------------------------------
B D                Panda  =====================================
          Domestic goat  =====================================
B D                Sheep  =====================================
       Tibetan antelope  =====================================
         Bactrian camel  =====================================
       Black flying-fox  =====================================
B D     White rhinoceros  =====================================
B D                Horse  =====================================
B D             Squirrel  =====================================
B D            Armadillo  =====================================
           Weddell seal  =====================================
B D      Squirrel monkey  =====================================
B D                  Dog  =====================================
B D                  Cow  =====================================

Inserts between block 57 and 58 in window
B D             Dolphin 374bp
           Killer whale 379bp

Alignment block 58 of 255 in window, 9649446 - 9649454, 9 bps 
B D                Human  tgggattct
B D                Chimp  tgggattct
B D              Gorilla  tgggattct
B D            Orangutan  tgggcttct
B D               Gibbon  taaggaaaa
B D               Rhesus  tgggattct
B D  Crab-eating macaque  tgggattct
B D               Baboon  tgggattct
B D         Green monkey  tgggattct
         Star-nosed mole  gggggttct
B D             Hedgehog  =========
B D           Guinea pig  =========
             Chinchilla  =========
       Cape golden mole  =========
     Chinese tree shrew  =========
B D              Manatee  ---------
               Aardvark  =========
B D             Elephant  =========
B D                  Cat  =========
B D             Bushbaby  =========
B D                  Pig  =========
B D              Ferret   ---------
B D              Dolphin  =========
B D                Panda  =========
          Domestic goat  =========
B D                Sheep  =========
       Tibetan antelope  =========
         Bactrian camel  =========
       Black flying-fox  =========
B D     White rhinoceros  =========
B D                Horse  =========
B D             Squirrel  =========
B D            Armadillo  =========
           Weddell seal  =========
B D      Squirrel monkey  =========
B D                  Dog  =========
B D                  Cow  =========
           Killer whale  =========

Alignment block 59 of 255 in window, 9649455 - 9649743, 289 bps 
B D                Human  ttgtcccacggccacggaaattcaggctcgcagatggtttaaagggtgtgtgaagcagagttttattggg
B D                Chimp  ttgtcccacggccacggaaattcaggctcggagatggtttaaagggtgtgtgaagcagagttttattggg
B D              Gorilla  ttgtcccacggccacggaaattcaggctcgcagatggtttaaagggtgtgtgaagcagagttttattggg
B D            Orangutan  ttgtccca-ggccacggaaattcaggctcgcatacggtttaaagggtgtgtgaagcagagttttattggg
B D               Gibbon  tt-tcccacggccacggaaattcaggcttgcagatggtttaaagggtgtgtaaagcagagttttattggg
B D               Rhesus  ttgtcccacagccatgaaaattcaggctcacagatactttttagagtgtatgaagcagagttttattggg
B D  Crab-eating macaque  ttgtcccacagccatgaaaattcaggctcacagatactttaaagagtgtatgaagcagagttttattggg
B D               Baboon  ttgtcccacagccatgaaaattcaggctcacagatactttaaagagtgtatgaagcagagttttattggt
B D         Green monkey  ttgtccgacagtcatgaaaattcaggctcacagatactttaaagagtatatgaagcagagttttattggg
B D             Hedgehog  ======================================================================
B D           Guinea pig  ======================================================================
             Chinchilla  ======================================================================
       Cape golden mole  ======================================================================
     Chinese tree shrew  ======================================================================
B D              Manatee  ----------------------------------------------------------------------
               Aardvark  ======================================================================
B D             Elephant  ======================================================================
B D                  Cat  ======================================================================
B D             Bushbaby  ======================================================================
B D                  Pig  ======================================================================
B D              Ferret   ----------------------------------------------------------------------
B D              Dolphin  ======================================================================
B D                Panda  ======================================================================
          Domestic goat  ======================================================================
B D                Sheep  ======================================================================
       Tibetan antelope  ======================================================================
        Star-nosed mole  ----------------------------------------------------------------------
         Bactrian camel  ======================================================================
       Black flying-fox  ======================================================================
B D     White rhinoceros  ======================================================================
B D                Horse  ======================================================================
B D             Squirrel  ======================================================================
B D            Armadillo  ======================================================================
           Weddell seal  ======================================================================
B D      Squirrel monkey  ======================================================================
B D                  Dog  ======================================================================
B D                  Cow  ======================================================================
           Killer whale  ======================================================================

                   Human  tgaaaaagggaaaaaa-agggggaaacaggtactcttgcagggccagagtccttccgccggagcgcttcc
                   Chimp  tgaaaaagggaaaaaa-agggggaaacaggtactcttgcaaggccagagtccttccgccggagcgcttcc
                 Gorilla  tgaaaaagggaaaaaa-agggggaaacaggtactcttgcaaggccagactccttccgccggagcgcttcc
               Orangutan  tgaaaaagggaaaaaagggggggaaacaggtactcttgcaaggccagagtccttccgccagagcgcttcc
                  Gibbon  tgaaaaagggaaaaaa-ggggggaaacatgtactctggtaaggccatagtccttccgccagagcgcttcc
                  Rhesus  tgaaaaatgggaaaaa-ggggggaaacagttactttggcaaggccagagtccttccgctggagtgcttcc
     Crab-eating macaque  tgaaaaatggaaaaaa-ggggggaaacagttactttggcaaggccagagtccttccgctggagtgcttcc
                  Baboon  tgaaaaatggaaaaaa-ggggggaaacagttactttggcaaggccagagtccttccgctggagtgcttcc
            Green monkey  tgaaaaatggaaaaaa-ggggggaaacagttactttggcaaggccagagtccttccgctggagtgcttcc
                Hedgehog  ======================================================================
              Guinea pig  ======================================================================
              Chinchilla  ======================================================================
        Cape golden mole  ======================================================================
      Chinese tree shrew  ======================================================================
                 Manatee  ----------------------------------------------------------------------
                Aardvark  ======================================================================
                Elephant  ======================================================================
                     Cat  ======================================================================
                Bushbaby  ======================================================================
                     Pig  ======================================================================
                 Ferret   ----------------------------------------------------------------------
                 Dolphin  ======================================================================
                   Panda  ======================================================================
           Domestic goat  ======================================================================
                   Sheep  ======================================================================
        Tibetan antelope  ======================================================================
         Star-nosed mole  ----------------------------------------------------------------------
          Bactrian camel  ======================================================================
        Black flying-fox  ======================================================================
        White rhinoceros  ======================================================================
                   Horse  ======================================================================
                Squirrel  ======================================================================
               Armadillo  ======================================================================
            Weddell seal  ======================================================================
         Squirrel monkey  ======================================================================
                     Dog  ======================================================================
                     Cow  ======================================================================
            Killer whale  ======================================================================

                   Human  cacctgacagtttgaatcccaggttctacaaatgaaaaactgggg----------------ccaggctca
                   Chimp  cacctgacagtttgaatcccaggttctacaaatgaaaaacagggg----------------ccaggctca
                 Gorilla  cacctgacagtttgaatcccaggttcttcaaatgaaaaacagggg----------------ccaggctca
               Orangutan  cacctgacagtttgaatcccaggttctacaaatgaaaaagagggg----------------caaggctca
                  Gibbon  cacctgatagtttgaatcccaggttccacaaatgaaaaagaggggccaggctcaggcttctccaggctca
                  Rhesus  cacctggccgtttggatcccaggttccacacataaaaaagagggg----------------ccagactca
     Crab-eating macaque  cacctggccgtttggatcccaggttccacacataaaaaagagggg----------------ccagactca
                  Baboon  cacctggccgtttggatcccaggttccacacat-aaaaagagggg----------------ccagactca
            Green monkey  cacctggccgtttggatcccaggttccacacataaaacagagggg----------------ccagactca
                Hedgehog  ======================================================================
              Guinea pig  ======================================================================
              Chinchilla  ======================================================================
        Cape golden mole  ======================================================================
      Chinese tree shrew  ======================================================================
                 Manatee  ----------------------------------------------------------------------
                Aardvark  ======================================================================
                Elephant  ======================================================================
                     Cat  ======================================================================
                Bushbaby  ======================================================================
                     Pig  ======================================================================
                 Ferret   ----------------------------------------------------------------------
                 Dolphin  ======================================================================
                   Panda  ======================================================================
           Domestic goat  ======================================================================
                   Sheep  ======================================================================
        Tibetan antelope  ======================================================================
         Star-nosed mole  ----------------------------------------------------------------------
          Bactrian camel  ======================================================================
        Black flying-fox  ======================================================================
        White rhinoceros  ======================================================================
                   Horse  ======================================================================
                Squirrel  ======================================================================
               Armadillo  ======================================================================
            Weddell seal  ======================================================================
         Squirrel monkey  ======================================================================
                     Dog  ======================================================================
                     Cow  ======================================================================
            Killer whale  ======================================================================

                   Human  ggcttctctctgctgcaaaccttgtgaacttcccaaggctccacctcagtgggcaggctaattggagttt
                   Chimp  ggcttctctctgctgcaaaccttgtgaacttcccaaggctccacctcagtgggcaggctaattggagttt
                 Gorilla  ggcttctctctgctgcaaaccttgtgaacttcccaaggctccacctcagtgggcaggctaattggagttt
               Orangutan  ggcttctccctgcggcaaaccttgttaacttcccaaggctccacctcattgggcaggctaattggagttt
                  Gibbon  ggcttctccctgctgcaatccttgtgaacttcccaaggctccacctcagtgggcaggctaattggagttt
                  Rhesus  ggcttctccctgctgcgaaccttgtgaacttcccaaggctccacctcagtgggcaggctagttggagttt
     Crab-eating macaque  ggcttctccctgctgcgaaccttgtgaacttcccaaggctccacctcagtgggcaggctagttggagttt
                  Baboon  ggcttctccctgctgcgaaccttgtgaacttcccaaggctccacctcagtgggcaggctagttggagttt
            Green monkey  ggcttctccctgctgcaaaccttgtgaacttcccaaggctccacctcagtgggcaggctagttggagttt
                Hedgehog  ======================================================================
              Guinea pig  ======================================================================
              Chinchilla  ======================================================================
        Cape golden mole  ======================================================================
      Chinese tree shrew  ======================================================================
                 Manatee  ----------------------------------------------------------------------
                Aardvark  ======================================================================
                Elephant  ======================================================================
                     Cat  ======================================================================
                Bushbaby  ======================================================================
                     Pig  ======================================================================
                 Ferret   ----------------------------------------------------------------------
                 Dolphin  ======================================================================
                   Panda  ======================================================================
           Domestic goat  ======================================================================
                   Sheep  ======================================================================
        Tibetan antelope  ======================================================================
         Star-nosed mole  ----------------------------------------------------------------------
          Bactrian camel  ======================================================================
        Black flying-fox  ======================================================================
        White rhinoceros  ======================================================================
                   Horse  ======================================================================
                Squirrel  ======================================================================
               Armadillo  ======================================================================
            Weddell seal  ======================================================================
         Squirrel monkey  ======================================================================
                     Dog  ======================================================================
                     Cow  ======================================================================
            Killer whale  ======================================================================

                   Human  ctccagggaccccttcccacctggct
                   Chimp  ctccagggaccccttcccacctggct
                 Gorilla  ctccagggaccccttcccacctggct
               Orangutan  ctccagggaccccttcccacctggct
                  Gibbon  ctccagggaccccttcccacttggct
                  Rhesus  ctccagggaccccttcatgcctggct
     Crab-eating macaque  ctccagggaccccttcatgcctggct
                  Baboon  ctccagggaccccttcatgcctggct
            Green monkey  ctccagggaccccttcatgcctggct
                Hedgehog  ==========================
              Guinea pig  ==========================
              Chinchilla  ==========================
        Cape golden mole  ==========================
      Chinese tree shrew  ==========================
                 Manatee  --------------------------
                Aardvark  ==========================
                Elephant  ==========================
                     Cat  ==========================
                Bushbaby  ==========================
                     Pig  ==========================
                 Ferret   --------------------------
                 Dolphin  ==========================
                   Panda  ==========================
           Domestic goat  ==========================
                   Sheep  ==========================
        Tibetan antelope  ==========================
         Star-nosed mole  --------------------------
          Bactrian camel  ==========================
        Black flying-fox  ==========================
        White rhinoceros  ==========================
                   Horse  ==========================
                Squirrel  ==========================
               Armadillo  ==========================
            Weddell seal  ==========================
         Squirrel monkey  ==========================
                     Dog  ==========================
                     Cow  ==========================
            Killer whale  ==========================

Alignment block 60 of 255 in window, 9649744 - 9649748, 5 bps 
B D                Human  gtctc
B D                Chimp  gtctc
B D              Gorilla  gtctc
B D            Orangutan  gtctc
B D               Gibbon  ctctc
B D               Rhesus  gtctc
B D  Crab-eating macaque  gtctc
B D               Baboon  gtctc
B D         Green monkey  gtctc
B D             Bushbaby  gccag
B D             Hedgehog  =====
B D           Guinea pig  =====
             Chinchilla  =====
       Cape golden mole  =====
     Chinese tree shrew  =====
B D              Manatee  -----
               Aardvark  =====
B D             Elephant  =====
B D                  Cat  =====
B D                  Pig  =====
B D              Ferret   -----
B D              Dolphin  =====
B D                Panda  =====
          Domestic goat  =====
B D                Sheep  =====
       Tibetan antelope  =====
        Star-nosed mole  -----
         Bactrian camel  =====
       Black flying-fox  =====
B D     White rhinoceros  =====
B D                Horse  =====
B D             Squirrel  =====
B D            Armadillo  =====
           Weddell seal  =====
B D      Squirrel monkey  =====
B D                  Dog  =====
B D                  Cow  =====
           Killer whale  =====

Alignment block 61 of 255 in window, 9649749 - 9649750, 2 bps 
B D                Human  ag
B D                Chimp  ag
B D              Gorilla  ag
B D            Orangutan  ag
B D               Gibbon  ag
B D               Rhesus  ag
B D  Crab-eating macaque  ag
B D               Baboon  ag
B D         Green monkey  ag
B D             Bushbaby  ga
B D              Dolphin  ag
            Killer whale  ag
B D             Elephant  aa
                Aardvark  ag
B D             Hedgehog  ==
B D           Guinea pig  ==
             Chinchilla  ==
       Cape golden mole  ==
     Chinese tree shrew  ==
B D              Manatee  --
B D                  Cat  ==
B D                  Pig  ==
B D              Ferret   --
B D                Panda  ==
          Domestic goat  ==
B D                Sheep  ==
       Tibetan antelope  ==
        Star-nosed mole  --
         Bactrian camel  ==
       Black flying-fox  ==
B D     White rhinoceros  ==
B D                Horse  ==
B D             Squirrel  ==
B D            Armadillo  ==
           Weddell seal  ==
B D      Squirrel monkey  ==
B D                  Dog  ==
B D                  Cow  ==

Alignment block 62 of 255 in window, 9649751 - 9649760, 10 bps 
B D                Human  tattagtagg
B D                Chimp  tattagtagg
B D              Gorilla  tattagtagg
B D            Orangutan  tattagtagg
B D               Gibbon  tattagtagg
B D               Rhesus  tattagcagg
B D  Crab-eating macaque  tattagcagg
B D               Baboon  tattagcagg
B D         Green monkey  tattagcagg
B D             Bushbaby  catcagtagg
B D              Dolphin  tattaataag
            Killer whale  tattaataag
B D                Horse  tgttagtagc
B D     White rhinoceros  tgttagtagc
B D             Elephant  tgttaccagc
                Aardvark  tgttggcagc
B D            Armadillo  tgttggtagg
B D             Hedgehog  ==========
B D           Guinea pig  ==========
             Chinchilla  ==========
       Cape golden mole  ==========
     Chinese tree shrew  ==========
B D              Manatee  ----------
B D                  Cat  ==========
B D                  Pig  ==========
B D              Ferret   ----------
B D                Panda  ==========
          Domestic goat  ==========
B D                Sheep  ==========
       Tibetan antelope  ==========
        Star-nosed mole  ----------
         Bactrian camel  ==========
       Black flying-fox  ==========
B D             Squirrel  ==========
           Weddell seal  ==========
B D      Squirrel monkey  ==========
B D                  Dog  ==========
B D                  Cow  ==========

Inserts between block 62 and 63 in window
B D             Dolphin 43bp
           Killer whale 43bp

Alignment block 63 of 255 in window, 9649761 - 9649764, 4 bps 
B D                Human  aggg
B D                Chimp  aggg
B D              Gorilla  agag
B D            Orangutan  agga
B D               Gibbon  agga
B D               Rhesus  agga
B D  Crab-eating macaque  agga
B D               Baboon  agga
B D         Green monkey  agga
B D             Bushbaby  ggaa
B D              Dolphin  agga
            Killer whale  agga
           Domestic goat  agga
B D                Horse  agga
B D     White rhinoceros  agga
B D             Elephant  agaa
                Aardvark  agga
B D            Armadillo  agga
B D             Hedgehog  ====
B D           Guinea pig  ====
             Chinchilla  ====
       Cape golden mole  ====
     Chinese tree shrew  ====
B D              Manatee  ----
B D                  Cat  ====
B D                  Pig  ====
B D              Ferret   ----
B D                Panda  ====
B D                Sheep  ====
       Tibetan antelope  ====
        Star-nosed mole  ----
         Bactrian camel  ====
       Black flying-fox  ====
B D             Squirrel  ====
           Weddell seal  ====
B D      Squirrel monkey  ====
B D                  Dog  ====
B D                  Cow  ====

Alignment block 64 of 255 in window, 9649765 - 9649775, 11 bps 
B D                Human  gctagagatgt---
B D                Chimp  gctagagatgt---
B D              Gorilla  gctagagatgt---
B D            Orangutan  actagagatgt---
B D               Gibbon  gctagagatgt---
B D               Rhesus  accagagatat---
B D  Crab-eating macaque  accagagatat---
B D               Baboon  accagagatat---
B D         Green monkey  accagagatat---
B D             Bushbaby  agtacagacag---
B D              Dolphin  gctagatatag---
            Killer whale  gctagatatag---
           Domestic goat  gaaagatatag---
B D                Horse  gctagatatag---
B D     White rhinoceros  gctagctttag---
B D             Elephant  gctagatatgggga
B D              Manatee  gctagatataggga
                Aardvark  gctagaggtaggga
B D            Armadillo  gctagatataggaa
B D             Hedgehog  ==============
B D           Guinea pig  ==============
             Chinchilla  ==============
       Cape golden mole  ==============
     Chinese tree shrew  ==============
B D                  Cat  ==============
B D                  Pig  ==============
B D              Ferret   --------------
B D                Panda  ==============
B D                Sheep  ==============
       Tibetan antelope  ==============
        Star-nosed mole  --------------
         Bactrian camel  ==============
       Black flying-fox  ==============
B D             Squirrel  ==============
           Weddell seal  ==============
B D      Squirrel monkey  ==============
B D                  Dog  ==============
B D                  Cow  ==============

Inserts between block 64 and 65 in window
B D             Dolphin 3bp
           Killer whale 3bp
          Domestic goat 3bp
B D               Horse 3bp
B D    White rhinoceros 3bp

Alignment block 65 of 255 in window, 9649776 - 9649802, 27 bps 
B D                Human  aaaaaagaagaagagaaagcaggcaca
B D                Chimp  aaaaaagaagaagagaaagcaggcaca
B D              Gorilla  aaaa---aagaagagaaagcaggcaca
B D            Orangutan  aaaaaagaagaagagaaagcaggcaca
B D               Gibbon  aaaaaagaagaagagaaaggaggcaca
B D               Rhesus  aaaaaagaagaagagaaagcagggaca
B D  Crab-eating macaque  aaaaaagaagaagagaaagcagggaca
B D               Baboon  aaaaaagaagaagagaaagcagggaca
B D         Green monkey  aaaaaagaagaagagaaagcagggaca
B D             Bushbaby  gcaaaa-cccaggagaaagcaggaact
B D             Squirrel  aggaaaggagaagagaaaggaggaact
B D              Dolphin  aataaaggagaagaaaaaggggggact
            Killer whale  aataaaggagaagaaaaaggggggact
           Domestic goat  aat---gaagaagaaaaagggaggact
B D                Horse  aataaaggagaagagaaaaggggg-ct
B D     White rhinoceros  aataaaggagaagagaaaaggagg-ct
B D             Elephant  aataaaggtgaagagaaaagaaggaat
B D              Manatee  aataaagggaaagagacaagaaggaat
                Aardvark  aataaaggagaagagaaagtgaggaat
B D            Armadillo  aacaaaagagaaaagtaagtaaggaat
B D             Hedgehog  ===========================
B D           Guinea pig  ===========================
             Chinchilla  ===========================
       Cape golden mole  ===========================
     Chinese tree shrew  ===========================
B D                  Cat  ===========================
B D                  Pig  ===========================
B D              Ferret   ---------------------------
B D                Panda  ===========================
B D                Sheep  ===========================
       Tibetan antelope  ===========================
        Star-nosed mole  ---------------------------
         Bactrian camel  ===========================
       Black flying-fox  ===========================
           Weddell seal  ===========================
B D      Squirrel monkey  ===========================
B D                  Dog  ===========================
B D                  Cow  ===========================

Alignment block 66 of 255 in window, 9649803 - 9649809, 7 bps 
B D                Human  tttag--aa
B D                Chimp  tttag--aa
B D              Gorilla  tttag--aa
B D            Orangutan  tttag--aa
B D               Gibbon  tttag--aa
B D               Rhesus  tttag--aa
B D  Crab-eating macaque  tttag--aa
B D               Baboon  tttag--aa
B D         Green monkey  tttag--aa
B D             Bushbaby  tttag--aa
B D             Squirrel  tttag--aa
B D              Dolphin  tttag--aa
            Killer whale  tttag--aa
           Domestic goat  tttag--aa
B D                Horse  tttag--aa
B D     White rhinoceros  tttag--aa
         Star-nosed mole  tttag--aa
B D             Elephant  tttag----
B D              Manatee  tttaggt--
                Aardvark  tgtag----
B D            Armadillo  tttag-a--
B D             Hedgehog  =========
B D           Guinea pig  =========
             Chinchilla  =========
       Cape golden mole  =========
     Chinese tree shrew  =========
B D                  Cat  =========
B D                  Pig  =========
B D              Ferret   ---------
B D                Panda  =========
B D                Sheep  =========
       Tibetan antelope  =========
         Bactrian camel  =========
       Black flying-fox  =========
           Weddell seal  =========
B D      Squirrel monkey  =========
B D                  Dog  =========
B D                  Cow  =========

Inserts between block 66 and 67 in window
          Domestic goat 1468bp

Alignment block 67 of 255 in window, 9649810 - 9649824, 15 bps 
B D                Human  gattattaagagagg
B D                Chimp  gattattaagagagg
B D              Gorilla  gattattaagagagg
B D            Orangutan  gattattaagagagg
B D               Gibbon  gattattaagagagg
B D               Rhesus  gatgattaagagagg
B D  Crab-eating macaque  gatgattaagagagg
B D               Baboon  gatgattaagagagg
B D         Green monkey  gatgattaagagagg
B D             Bushbaby  gattagtaagagagg
B D             Squirrel  gactagtcagagggg
B D              Dolphin  gattagtaagg-ggg
            Killer whale  gattagtaagg-ggg
B D                Horse  gatttgtaagatgga
B D     White rhinoceros  gattagtaaaacagg
         Star-nosed mole  gataagtaagagggg
B D             Elephant  -attaataaaagggg
B D              Manatee  aattaataaaagggg
                Aardvark  -attaacaatagggg
B D            Armadillo  agatgataagacagg
B D             Hedgehog  ===============
B D           Guinea pig  ===============
             Chinchilla  ===============
       Cape golden mole  ===============
     Chinese tree shrew  ===============
B D                  Cat  ===============
B D                  Pig  ===============
B D              Ferret   ---------------
B D                Panda  ===============
          Domestic goat  ===============
B D                Sheep  ===============
       Tibetan antelope  ===============
         Bactrian camel  ===============
       Black flying-fox  ===============
           Weddell seal  ===============
B D      Squirrel monkey  ===============
B D                  Dog  ===============
B D                  Cow  ===============

Inserts between block 67 and 68 in window
B D           Armadillo 611bp

Alignment block 68 of 255 in window, 9649825 - 9649883, 59 bps 
B D                Human  caaatgggagatttg-ggggaagttttaaggggagagttacacattaccctagtagcaat
B D                Chimp  caaatgggagatttg-ggggaagttttaaggggagagttacacattaccctagtagcaat
B D              Gorilla  caaatgggagatttg-ggggaagttttaaggggagagttacacattaccctagtagcaat
B D            Orangutan  caaatgggagatttg-ggggaagttttaaggggagagttacacattaccctagtaacaat
B D               Gibbon  caaatgggagatttg-ggagaagttttaaggggagagttacacattaccctagtaacaat
B D               Rhesus  caaatgggagatttg-ggggaaattttaagggttgagttacacattaccctagtaacaac
B D  Crab-eating macaque  caaatgggagatttg-ggggaaattttaagggttgagttacacattaccctagtaacaac
B D               Baboon  caaatgggagatttg-ggggaaattttaagggttgagttacacattaccctagtaacaac
B D         Green monkey  caaatgggagatttg-ggggaaattttaagggttgagttacacattcccctagtaacaac
B D             Bushbaby  caaatgggagattta-ggggaaaatttaagtggagatttacatattactctagtaacagt
B D             Squirrel  caagtaggagcttta-cagaaa---ttcaagggaaatttttatactatcttaatgacaat
B D              Dolphin  caaataggagatttattggagaggtgtaaggggagatgtacgtcttactcttctaacaat
            Killer whale  caaataggagatttattggagaggtgtaaggggagatgtacgtcttactcttctaacaat
B D                Horse  caaataggagatttattggggagattt------------acatcttacccttctaacaat
B D     White rhinoceros  caaataggggatttattggggagatttcaggggagattcacatcttacccttctaacaat
         Star-nosed mole  cac-------attcttcgaggagatataagggaagatgttcatgccatccttctagcaat
B D             Elephant  caagtaggagatttattggaggtatttaagtagagatttacatcttgcccttttaatatt
B D              Manatee  caagtaggagatttactggggatatttaaggggagatttacattttactcttctaatatt
                Aardvark  caagtgggagatttattggatatatttaaggagagatttacatcttacccatccaatatt
B D            Armadillo  caaaaggcagattt----------tttgaactaaggtttaaatcttactcttttatcaag
B D             Hedgehog  ============================================================
B D           Guinea pig  ============================================================
             Chinchilla  ============================================================
       Cape golden mole  ============================================================
     Chinese tree shrew  ============================================================
B D                  Cat  ============================================================
B D                  Pig  ============================================================
B D              Ferret   ------------------------------------------------------------
B D                Panda  ============================================================
          Domestic goat  ============================================================
B D                Sheep  ============================================================
       Tibetan antelope  ============================================================
         Bactrian camel  ============================================================
       Black flying-fox  ============================================================
           Weddell seal  ============================================================
B D      Squirrel monkey  ============================================================
B D                  Dog  ============================================================
B D                  Cow  ============================================================

Alignment block 69 of 255 in window, 9649884 - 9649895, 12 bps 
B D                Human  gaaaaagaatta
B D                Chimp  gaaaaagaatta
B D              Gorilla  gaaaaagaatta
B D            Orangutan  gaaaaagaattg
B D               Gibbon  gaaaaagaatta
B D               Rhesus  gaaaaagaatta
B D  Crab-eating macaque  gaaaaagaatta
B D               Baboon  gaaaaagaatta
B D         Green monkey  gaaaaagaatta
B D             Bushbaby  g--gaatgattg
B D             Squirrel  gaaaaata--ta
B D              Dolphin  gaaaaaaatt--
            Killer whale  gaaaaaaatt--
B D                Horse  gaaaaaattg--
B D     White rhinoceros  gaaaaagtta--
         Star-nosed mole  gcaaaaatca--
B D             Elephant  ggaaaaaagtta
B D              Manatee  gggaaaaaatta
        Cape golden mole  ggggaagaatta
                Aardvark  ggggaaaattta
B D            Armadillo  ----aaaaaaca
B D             Hedgehog  ============
B D           Guinea pig  ============
             Chinchilla  ============
     Chinese tree shrew  ============
B D                  Cat  ============
B D                  Pig  ============
B D              Ferret   ------------
B D                Panda  ============
          Domestic goat  ============
B D                Sheep  ============
       Tibetan antelope  ============
         Bactrian camel  ============
       Black flying-fox  ============
           Weddell seal  ============
B D      Squirrel monkey  ============
B D                  Dog  ============
B D                  Cow  ============

Inserts between block 69 and 70 in window
B D             Dolphin 1bp
           Killer whale 1bp

Alignment block 70 of 255 in window, 9649896 - 9649970, 75 bps 
B D                Human  cggaagtctta-------gtattctgaac-c-tttaagacaa-ttttgc-gttagtgtagaaccagaaag
B D                Chimp  cggaagtctta-------gtattctgaac-c-tttaagacaa-ttttgc-attagtgtagaaccaaaaag
B D              Gorilla  cggaagtctta-------gtattctgaac-c-tttaagacaa-ttttgc-attagtgtagaaccagaaag
B D            Orangutan  cggaagtctta-------gtattctgaac-c-tttaagacaa-ttttgc-attagtgtagaaccagaaag
B D               Gibbon  cggaagtctta-------gtattctgaac-t-tttaagacaa-ttttgc-attagtgtagaaccagaaag
B D               Rhesus  tggaagtctta-------gtattctgaac-c-tgtaagacaa-ttttgc-attagtgtagaaccagaaag
B D  Crab-eating macaque  tggaagtctta-------gtattctgaac-c-tgtaagacaa-ttttgc-attagtgtagaaccagaaag
B D               Baboon  tggaagtctta-------gtattctgaac-c-tgtaagacaa-ttttgc-attagtgtagaaccagaaag
B D         Green monkey  tggaagtctta-------gtattctgaac-c-tgtaagacaa-ttttgc-attagtgtagaaccagaaag
B D             Bushbaby  tagaaatcata-------atgt-----ac-c-tcaaagacac-ttttgc-tttaatgttgagccagaaag
B D             Squirrel  cgaaaattagg-------atgcactgag-----ttaagatac-ttttac------tatagaactaaaaat
B D              Dolphin  tggaagtcata-------acatactgagt-t-tctaagacaa-ttttgc-tttaatgtagagccagaaag
            Killer whale  tggaagtcata-------acatactgagt-t-tctaagacaa-ttttgc-tttaatgtagaaccagaaag
           Domestic goat  cagaaatcata-------acatatggaat-t-tctgagacaa-ttttgc-tttaatgcagaaccagaaag