Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 199 in window, 11576535 - 11576582, 48 bps 
B D                     Human  ggagtttctc-t------ggcacactc----tttg-aggaaatagaattcgccaaaccaa
B D                     Chimp  ggagtttctc-t------ggcacactc----tttg-aggaaatagaattcgccaaaccaa
B D                   Gorilla  ggagtttctt-t------ggcacactc----tttg-aggaaatagaattcgccaaaccaa
B D                 Orangutan  ggagtttctt-t------ggcacactc----tttg-aggaaataggatttgccaaaccaa
B D                    Gibbon  ggagtttctg-t------ggcacactc----tttg-aggaaataggattcgccaaaccaa
B D                    Rhesus  ggagtttctt-t------ggcacactc----tttg-aggaaacaggatttgccaaaccaa
B D       Crab-eating macaque  ggagtttctt-t------ggcacactc----tttg-aggaaacaggatttgccaaaccaa
B D                    Baboon  ggagtttctt-t------ggcacactc------tg-aggaaacaggatttgccaaaccaa
B D              Green monkey  ggagtttctt-t------ggcacgctc----tttg-aggaaacaggatttgccaaaccaa
B D                  Marmoset  ggagtttctc-t------ggcacactc----tttg-aggaaataggatttgccaaaacaa
B D           Squirrel monkey  -------ctc-t------ggcacagtc----tttg-aggagataggatttgccaaaacaa
B D                  Bushbaby  gaagtttctt-c------tgtacactc----cttg-aggaagtagaatttgccacaccag
           Chinese tree shrew  gccgtttctc--------gatactctc----ttgg-aggaactagg--ttggcaaaccca
B D                  Squirrel  caagtttctt-t------ggtactcac----cttg-aggaaatacaattctcctaaatag
                 Prairie vole  aaagtatctt-g------gatgcttactgttcttg-gtgaaataggatttgccaagct-g
B D           Chinese hamster  agagtttctt-a------gatacttactgttcct--gggaaataggatttggcaaactgg
               Golden hamster  ggagtttctt-a------aatacttactgttcttg-gggaggtaggatttaccaagctgg
B D                     Mouse  ggagtttttt-a------ga----cactgttcttg-gggaaagagcattttccaagctgg
B D            Naked mole-rat  aaagtttctt-t------ggcattctc----cctg-agagaatagtttgtg--------g
                   Chinchilla  caaatttctt-t------ggtattctc----cttg-agagaacagagtttgccaaaccag
             Brush-tailed rat  caagtttctt-g------ggtactctc----cttg-agagactagagtttgccaagccag
B D                      Pika  gaggattttt--------ggtattctc----cttg-aggagttcaggcttgccagagcag
B D                    Alpaca  gaagtttatt-t------tgttccctc----ctag-aggaaataggatttgccaaaccag
               Bactrian camel  gaagtttatt-t------tgttccctc----ctag-aggaaataggatttgccaaacgag
B D                   Dolphin  gacgtttgct-t------ggta-cccc----ctgg-aggaaataggatttgccgaactag
                 Killer whale  gacgtttgct-t------ggtaccccc----ctgg-aggaaataggatttgccaaactag
B D                     Horse  ggggtgtcct-t------ggtaccctc----cttg-aggagctgggattggccaaacaag
B D          White rhinoceros  gaagtctcct-t------ggcaccctt----cttg-aggaactaggatttgcaaaaccag
B D                       Cat  gaagttgctt-t------gttaccttc----tttgaaaaaaataggattggccaaaccag
B D                       Dog  gaagcttcct-t------ggtacttcc----tttg-agaaaataggattggccaaaccag
B D                   Ferret   gaagttttct-t------ggtaccgtc----tatg-agaaaataggattggccaaaccag
B D                     Panda  gaagtttcct-t------ggtaccctc----tttg-agaaaataggactgaccaaaccag
               Pacific walrus  gaagtttc------------------c----tttg-agaaaataggattggccaaaccag
                 Weddell seal  gaagtttc------------------c----tttg-agaaaataggattggccaaaccag
             Black flying-fox  gaactttcct-tgcacgcgatgccact----tttacaggaaatcgcatttgccaaatcag
B D                  Elephant  -----------t------agcactctt----cttg-agaaaatgggatttgccaaaccag
          Cape elephant shrew  ----ttttgctt------ggcactctc----cttg-acgaaataggatttgctgagccaa
B D                   Manatee  -----------t------agcactctc----cttg-acaaaatggaatttgataaaccat
             Cape golden mole  gaagttttgttt------ggcaccctc----cttg-gggaaatggaatttgccaaaccag
                     Aardvark  gaagttctgctt------ggtactctc----cttg-aggaaatggaatttgccaaactag
B D                 Armadillo  gaagttgtcctt------ga-actctc----cttg-aagaaataggatttgccaaaccag
             Star-nosed mole  ============================================================
B D                       Rat  ============================================================
B D                  Hedgehog  ============================================================
               Big brown bat  ============================================================
B D                  Microbat  ============================================================
        David's myotis (bat)  ============================================================
B D                    Turkey  ============================================================
B D                   Megabat  ============================================================
      Lesser Egyptian jerboa  ============================================================
B D                    Tenrec  ============================================================
B D                Guinea pig  ============================================================
B D                    Rabbit  ============================================================
               Domestic goat  ============================================================
B D                     Sheep  ============================================================
B D                       Cow  ============================================================
            Tibetan antelope  ============================================================
  D          Peregrine falcon  ============================================================
B D                    Lizard  ============================================================
          Tibetan ground jay  ============================================================
  D              Mallard duck  ============================================================
B D       Medium ground finch  ============================================================
  D    White-throated sparrow  ============================================================
  D             Scarlet macaw  ============================================================
  D       Collared flycatcher  ============================================================
  D              Saker falcon  ============================================================
B D                Budgerigar  ============================================================
B D           Tasmanian devil  ============================================================
B D                  Platypus  ============================================================
B D               Zebra finch  ============================================================
  D           Green seaturtle  ============================================================
B D                   Chicken  ============================================================
B D        American alligator  ============================================================
B D             X. tropicalis  ============================================================
  D               Rock pigeon  ============================================================
B D                   Opossum  ============================================================
  D  Chinese softshell turtle  ============================================================
  D            Painted turtle  ============================================================
B D                       Pig  ============================================================

Inserts between block 1 and 2 in window
B D                   Alpaca 12bp
              Bactrian camel 12bp
B D                  Dolphin 12bp
                Killer whale 12bp
B D                    Horse 12bp
B D         White rhinoceros 12bp
B D                      Cat 11bp
B D                      Dog 12bp
B D                  Ferret  12bp
B D                    Panda 12bp
              Pacific walrus 12bp
                Weddell seal 12bp
            Black flying-fox 12bp

Alignment block 2 of 199 in window, 11576583 - 11576628, 46 bps 
B D                     Human  tgcaaat-------gga-------gaa-----atatatttcacctgag---tag----ggaagaaaa---
B D                     Chimp  tgcaaat-------gga-------gaa-----atacatttcacctgag---tag----ggaagaaaa---
B D                   Gorilla  tgcaaat-------gga-------gaa-----atatatttcacctgag---tag----ggaagaaaa---
B D                 Orangutan  tgcaaat-------gga-------gaa-----atatatttcacctgag---tgg----ggaagaaaa---
B D                    Gibbon  tgcaaat-------gga-------gaa-----ctatatttcacctgag---tag----ggaagaaaa---
B D                    Rhesus  tg--------------------------------------cacctgag---taa----ggaagaaaa---
B D       Crab-eating macaque  tg--------------------------------------cacctgag---taa----ggaagaaaa---
B D                    Baboon  tg--------------------------------------cacctgag---tag----ggaagaaaa---
B D              Green monkey  tg--------------------------------------cacctgag---taa----ggaagaaaa---
B D                  Marmoset  tgcaaat-------gga-------gaa-----atgtatttcacctgag---tgg----gaaagaaaa---
B D           Squirrel monkey  tgcaaat-------gga-------gaa-----atgtatttcacctgag---tgg----ggaagaaaa---
B D                  Bushbaby  cgcaaag-------ggg-------gaa--------tatttcatctgag---tag----gaaaaaaa----
           Chinese tree shrew  tatgaattagacagtaa-------ggg-----agagatttcatctaag---tgg----ggggaaa-----
B D                  Squirrel  tagaaag--------------------------------------gaa---atatctcacctgagat---
                 Prairie vole  tgtgaaa--------------------------------------gag---tca----g-----------
B D           Chinese hamster  tgtaaaa--------------------------------------gag---tca----gtcagagaa---
               Golden hamster  tgtaaaa--------------------------------------aag---tca----atcagagaa---
B D                     Mouse  tgcaaaa--------------------------------------gcg---tca----gctagagaa---
B D            Naked mole-rat  tatgaag--------------------------------------gag---aca----gaaaggaaa---
                   Chinchilla  gataaag--------------------------------------gag---aca----gaaagggaa---
             Brush-tailed rat  taggaag--------------------------------------gag---aca----aaaagggca---
B D                      Pika  tgtaaat--------------------------------------ggg---ggc----gaagggggg---
B D                    Alpaca  ggcagag-------------------atttcccagtccttccccagag---cgg----ggaacacag---
               Bactrian camel  ggcagag-------------------atttcccagtccttccccagag---cgg----ggaacacag---
B D                   Dolphin  tgcagag-------------------atctcccagtccttcaccaggg---ccg----gg-atacaa---
                 Killer whale  tgcagag-------------------atttcccagtccttcaccaggg---ccg----gg-atacaa---
B D                     Horse  tgcaggg-------------------g-----acagacttcaccccag---tgg----gagagacaa---
B D          White rhinoceros  tgcagag-------------------g-----aaatacttgaccctgg---tgg----ggcagacga---
B D                       Cat  tgcaggg-------------------g-----agatactt---ctgagtatttg----aggcaacaa---
B D                       Dog  tgcaggg-------------------a-----aaatacta---ctgag---ttg----aggaaacat---
B D                   Ferret   tgcagag-------------------g-----aaatactt---ctgag---ttg----aggaaacaa---
B D                     Panda  tgcaggg-------------------a-----aaatactt---ctgag---ttg----aggaaacaa---
               Pacific walrus  tgcaggg-------------------a-----aaagactt---ctgag---ttg----gggaaacaa---
                 Weddell seal  tgcaggg-------------------a-----aaagactt---ctgag---ctg----gggaaacaa---
             Black flying-fox  tgcaggg-------gaa-------aag-----aaatacttcaccctag---gtg-----ggaaacaa---
B D                   Megabat  tgcaggg-------gaa-------aag-----aaatacttcacccgag---ttg-----ggaaacaa---
B D                  Elephant  tgtaaat-------aaggctgctgg-g-----aaatatttcatctgag---tag----gagaaccat---
          Cape elephant shrew  cataaat-------gagactatggg-g-----aaacatttcacctaag---agg----cacaacagt---
B D                   Manatee  tgtaaat-------gaggctgcaggag-----aaatatttcacctgag---tgg----aagaacaat---
             Cape golden mole  tgtaaac-------gag-------------------------tctgag---tta----gagaacaat---
                     Aardvark  tgtaaat-------aagactacagaga-----aaatatttcacctgag---tgg----gacaacaat---
B D                 Armadillo  tgtcagt-------gga------gggc-----agtgatgtcacctgat---tgg----gagaaaaacggt
             Star-nosed mole  ======================================================================
B D                       Rat  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Turkey  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                    Lizard  ======================================================================
          Tibetan ground jay  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D        American alligator  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================

                        Human  --acct----------------------------t
                        Chimp  --acct----------------------------t
                      Gorilla  --acct----------------------------t
                    Orangutan  --acct----------------------------t
                       Gibbon  --acct----------------------------t
                       Rhesus  --acct----------------------------t
          Crab-eating macaque  --acct----------------------------t
                       Baboon  --acct----------------------------t
                 Green monkey  --acct----------------------------t
                     Marmoset  --gcct----------------------------t
              Squirrel monkey  --ccca----------------------------t
                     Bushbaby  ----ct----------------------------t
           Chinese tree shrew  ----ct----------------------------c
                     Squirrel  ---gtt-------------gggggggtg------g
                 Prairie vole  ---gtt-------------ttcactctg------g
              Chinese hamster  --agtt-------------atcactctg------g
               Golden hamster  --agtt-------------atctctctg------g
                        Mouse  --ggtt-------------ttcagtctg------g
               Naked mole-rat  --gaat-------------ctcacctgagcaaggg
                   Chinchilla  --aaat-------------ttcacctaagtgagag
             Brush-tailed rat  --aaat-------------ttcatctgagtgag-g
                         Pika  --agttgatatttctttcctccaagtag------a
                       Alpaca  ----ct----------------------------g
               Bactrian camel  ----ct----------------------------g
                      Dolphin  ----ct----------------------------t
                 Killer whale  ----ct----------------------------t
                        Horse  ----ct----------------------------c
             White rhinoceros  ----ct----------------------------t
                          Cat  ----ct----------------------------t
                          Dog  ----ct----------------------------t
                      Ferret   ----ct----------------------------t
                        Panda  ----ct----------------------------t
               Pacific walrus  ----ct----------------------------t
                 Weddell seal  ----ct----------------------------t
             Black flying-fox  ----ct----------------------------c
                      Megabat  ----ct----------------------------c
                     Elephant  -----------------------------------
          Cape elephant shrew  -----------------------------------
                      Manatee  -----------------------------------
             Cape golden mole  -----------------------------------
                     Aardvark  -----------------------------------
                    Armadillo  tt---------------------------------
              Star-nosed mole  ===================================
                          Rat  ===================================
                     Hedgehog  ===================================
                Big brown bat  ===================================
                     Microbat  ===================================
         David's myotis (bat)  ===================================
                       Turkey  ===================================
       Lesser Egyptian jerboa  ===================================
                       Tenrec  ===================================
                   Guinea pig  ===================================
                       Rabbit  ===================================
                Domestic goat  ===================================
                        Sheep  ===================================
                          Cow  ===================================
             Tibetan antelope  ===================================
             Peregrine falcon  ===================================
                       Lizard  ===================================
           Tibetan ground jay  ===================================
                 Mallard duck  ===================================
          Medium ground finch  ===================================
       White-throated sparrow  ===================================
                Scarlet macaw  ===================================
          Collared flycatcher  ===================================
                 Saker falcon  ===================================
                   Budgerigar  ===================================
              Tasmanian devil  ===================================
                     Platypus  ===================================
                  Zebra finch  ===================================
              Green seaturtle  ===================================
                      Chicken  ===================================
           American alligator  ===================================
                X. tropicalis  ===================================
                  Rock pigeon  ===================================
                      Opossum  ===================================
     Chinese softshell turtle  ===================================
               Painted turtle  ===================================
                          Pig  ===================================

Inserts between block 2 and 3 in window
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 531bp
            Cape golden mole 4bp
                    Aardvark 13bp

Alignment block 3 of 199 in window, 11576629 - 11576629, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D            Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  a
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  a
                     Aardvark  g
B D                 Armadillo  g
             Star-nosed mole  =
B D                       Rat  =
         Cape elephant shrew  =
B D                  Hedgehog  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Turkey  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                Guinea pig  =
B D                    Rabbit  =
B D                   Manatee  =
               Domestic goat  =
B D                  Elephant  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
  D          Peregrine falcon  =
B D                    Lizard  =
          Tibetan ground jay  =
  D              Mallard duck  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
            Cape golden mole  =
  D             Scarlet macaw  =
  D       Collared flycatcher  =
  D              Saker falcon  =
B D                Budgerigar  =
B D           Tasmanian devil  =
B D                  Platypus  =
B D               Zebra finch  =
  D           Green seaturtle  =
B D                   Chicken  =
B D        American alligator  =
B D             X. tropicalis  =
  D               Rock pigeon  =
B D                   Opossum  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                       Pig  =

Alignment block 4 of 199 in window, 11576630 - 11576634, 5 bps 
B D                     Human  t-aa-----------ag
B D                     Chimp  t-aa-----------ag
B D                   Gorilla  t-aa-----------ag
B D                 Orangutan  t-aa-----------ag
B D                    Gibbon  t-aa-----------aa
B D                    Rhesus  t-aa-----------ag
B D       Crab-eating macaque  t-aa-----------ag
B D                    Baboon  t-aa-----------ag
B D              Green monkey  t-aa-----------ag
B D                  Marmoset  c-aa-----------ag
B D           Squirrel monkey  c-aa-----------ag
B D                  Bushbaby  c-aa-----------ag
           Chinese tree shrew  c-aa-----------ag
B D                  Squirrel  g-tg-----------ag
                 Prairie vole  t-tg-----------aa
B D           Chinese hamster  g-ta-----------ag
               Golden hamster  g-tg-----------ag
B D                     Mouse  a-tg-----------ag
B D            Naked mole-rat  a-ag-----------ga
                   Chinchilla  g-aa-----------aa
             Brush-tailed rat  g-ga-----------aa
B D                      Pika  g-aa-----------ag
B D                    Alpaca  g-aa-----------ag
               Bactrian camel  g-aa-----------ag
B D                   Dolphin  c-ag-----------ag
                 Killer whale  c-ag-----------ag
B D                     Horse  c-ca-----------ag
B D          White rhinoceros  c-ca-----------ag
B D                       Cat  ccta-----------ag
B D                       Dog  tgcaagatgtttggcag
B D                   Ferret   cata-----------ag
B D                     Panda  cata-----------ag
               Pacific walrus  caca-----------ag
                 Weddell seal  caca-----------ag
             Black flying-fox  c-aa-----------aa
B D                   Megabat  c-aa-----------aa
B D                  Elephant  -caa-----------ag
          Cape elephant shrew  -cac-----------ag
B D                   Manatee  -ca--------------
             Cape golden mole  --aa-----------ag
                     Aardvark  -caa-----------ag
B D                 Armadillo  -cga-----------ag
             Star-nosed mole  =================
B D                       Rat  =================
B D                  Hedgehog  =================
               Big brown bat  =================
B D                  Microbat  =================
        David's myotis (bat)  =================
B D                    Turkey  =================
      Lesser Egyptian jerboa  =================
B D                    Tenrec  =================
B D                Guinea pig  =================
B D                    Rabbit  =================
               Domestic goat  =================
B D                     Sheep  =================
B D                       Cow  =================
            Tibetan antelope  =================
  D          Peregrine falcon  =================
B D                    Lizard  =================
          Tibetan ground jay  =================
  D              Mallard duck  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
  D             Scarlet macaw  =================
  D       Collared flycatcher  =================
  D              Saker falcon  =================
B D                Budgerigar  =================
B D           Tasmanian devil  =================
B D                  Platypus  =================
B D               Zebra finch  =================
  D           Green seaturtle  =================
B D                   Chicken  =================
B D        American alligator  =================
B D             X. tropicalis  =================
  D               Rock pigeon  =================
B D                   Opossum  =================
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
B D                       Pig  =================

Inserts between block 4 and 5 in window
B D                 Squirrel 9bp
B D                 Elephant 498bp
            Cape golden mole 1bp

Alignment block 5 of 199 in window, 11576635 - 11576694, 60 bps 
B D                     Human  gct----------tccaag-aac-----------ct------------------------ccagaaacct
B D                     Chimp  gct----------tccaag-aac-----------ct------------------------ccagaaacct
B D                   Gorilla  gct----------tccaag-aac-----------ct------------------------ccagaaacct
B D                 Orangutan  gct----------tccaag-aac-----------ct------------------------ccagaaacct
B D                    Gibbon  gct----------tccaag-aac-----------ct------------------------ccagaaactt
B D                    Rhesus  gct----------tccacg-aac-----------ct------------------------ccaaaaacct
B D       Crab-eating macaque  gct----------tccaag-aac-----------ct------------------------ccaaaaacct
B D                    Baboon  gct----------tccaag-aac-----------ct------------------------ccaaaaacct
B D              Green monkey  gct----------tccaag-aac-----------ct------------------------cccaaaacct
B D                  Marmoset  gct----------tcccag-cac-----------ctccagaaacaaacctactggatgtgccagaaacct
B D           Squirrel monkey  gct----------tccaag-aat-----------ct------------------------ccagaaacct
B D                  Bushbaby  gct----------tctgag-aac-----------ct------------------------ccagaaacct
           Chinese tree shrew  tct----------cccaag-aac-----------ct------------------------gt-gaaacct
B D                  Squirrel  agg----------ttgcaagaac-----------ct------------------------ctagaaacct
                 Prairie vole  agg----------ttaaga-agc-----------tt------------------------ccagagacct
B D           Chinese hamster  aat----------ttacaa-agc-----------tt------------------------ccagagacct
               Golden hamster  aat----------ttacaa-agc-----------tt------------------------ccggagacct
B D                     Mouse  gat----------ttacaa-agc-----------ct------------------------ccggagacct
B D            Naked mole-rat  gga----------tgcaga-gac-----------tt------------------------gcaggagacc
                   Chinchilla  tgatccaaagacttccagg-gac-----------tt------------------------ccaggaacct
             Brush-tailed rat  tga----------tcgaga-gac-----------tt------------------------ccgggagcac
B D                      Pika  gac----------ttgcaa-agtctcctaagtagct------------------------ccagactcct
B D                    Alpaca  gct----------tcggag-aac-----------ct------------------------ctgggaaccc
               Bactrian camel  cct----------tccgag-aac-----------ct------------------------ctgggaaccc
B D                   Dolphin  tct----------tccaag-gac-----------ct------------------------ccggaaacct
                 Killer whale  tct----------tccaag-aac-----------ct------------------------ccggaaacct
B D                     Horse  gct----------tccaag-aac-----------ct------------------------ccggagacct
B D          White rhinoceros  gct----------tccaag-aac-----------ct------------------------ccagaaacct
B D                       Cat  tct----------tccaag-aac-----------ct------------------------ctggaaaact
B D                       Dog  gcg----------tccaag-aac-----------ct------------------------ctggaaacct
B D                   Ferret   gct----------tccaag-aac-----------ct------------------------ctggaaacct
B D                     Panda  gct----------tccaag-aac-----------ct------------------------ctggaaacct
               Pacific walrus  gct----------tccaag-aac-----------ct------------------------ctggaaacct
                 Weddell seal  gct----------tccaag-aac-----------ct------------------------ctggaaacct
             Black flying-fox  gct----------tccaag-aac-----------ct------------------------ccagaaatct
B D                   Megabat  gct----------tccaag-aac-----------ct------------------------ccagaaatct
B D                  Elephant  gct----------tctgag-aac-----------ct-------------------------aaaaaacct
          Cape elephant shrew  gct----------tccaag-aac-----------ct-------------------------aaaaatccc
B D                   Manatee  gct----------tccaag-aac-----------ct-------------------------aaaaaacct
             Cape golden mole  ctt----------ttcaat-aact----------ct-------------------------gaaaagcct
                     Aardvark  gct----------tccaag-aac-----------ct------------------------gaaaaaacat
B D                 Armadillo  -tc----------ttccag-aac-----------cg-------------------------gtgagccct
             Star-nosed mole  ======================================================================
B D                       Rat  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Turkey  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                    Lizard  ======================================================================
          Tibetan ground jay  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D        American alligator  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================

                        Human  ac-----tgga-----------------tgagct---ta--------ccact--aa---tc---t-----
                        Chimp  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---t-----
                      Gorilla  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---t-----
                    Orangutan  ac-----tgga-----------------tgtact---ta--------ccact--aa---tc---t-----
                       Gibbon  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---a-----
                       Rhesus  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---c-----
          Crab-eating macaque  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---c-----
                       Baboon  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---c-----
                 Green monkey  ac-----tgga-----------------tgtgct---ta--------ccact--aa---tc---c-----
                     Marmoset  ac-----tgga-----------------tgtgct---tg--------ccagt--aatcttc---c-----
              Squirrel monkey  ac-----caga-----------------tgtgct---ta--------ccacg--aatcttc---c-----
                     Bushbaby  gc--------g-----------------tgtgct---ca--------ccata--aa---cctgat-----
           Chinese tree shrew  cc-----cgaa-----------------tgtgct---ca--------ccatg--aa---tct--t-----
                     Squirrel  gc-----tgaa-----------------tgtgctcacca--------t------aa---gt---tccctg
                 Prairie vole  ac-----caaa-----------------ggtgtc---ca--------g------aa---gc---tgccta
              Chinese hamster  gt-----caaa-----------------ggtgtt---tg--------g------ga---gc---t-ccta
               Golden hamster  gc-----caaa-----------------ggtgtt---cg--------g------ga---gc---t-ccta
                        Mouse  gc-----caga-----------------ggtgtt---ta--------g------ga---gc---tgccta
               Naked mole-rat  cc-----cgaa-----------------acctca---ga--------gtccgtgaa---gc---c-cctc
                   Chinchilla  gc-----agaa-----------------tgtgca---ca--------tcccg--aa---gc---t-cctc
             Brush-tailed rat  gc-----agtg-----------------tatcca---ca--------gcatg---a---gc---g-cctc
                         Pika  ac-----taaa-----------------agtacc---ca--------ccagg--aa---ta---t-gctt
                       Alpaca  gc-----agag-----------------cgtgct---ca--------gcacg--ga---tc---t----a
               Bactrian camel  gc-----agag-----------------cgtg--------------------------------------
                      Dolphin  ac-----agag-----------------cgtgct---ca--------ccaca--ga---tc---t-gcca
                 Killer whale  ac-----atag-----------------cgtgct---ca--------ccaca--ga---tc---t-gcca
                        Horse  tc-----agaa-----------------cgtgcc---ca--------ctgtg--aa---tc---t-tcta
             White rhinoceros  ac-----agaa-----------------tgtgcc---ca--------ccatg--aa---tc---t-tcta
                          Cat  gt-----agaa-----------------cgtgct------------------------------t-tcta
                          Dog  ac-----agaa-----------------tgcact---ca--------ccatg--ga---cc---t-tcta
                      Ferret   ac-----caaa-----------------cacatt---ca--------ccaca--ga---tc---t-tcta
                        Panda  ctgcatgagaa-----------------tgcact---ca--------ccatg--ga---tc---t-tcta
               Pacific walrus  ac-----agaa-----------------cgcgct---ca--------ccatg--ga---tc---t-tctc
                 Weddell seal  ac-----agaa-----------------tgcgct---ca--------ccatg--ga---ta---t-tctc
             Black flying-fox  ac-----agaa-----------------cgtgct---ca--------ccaca--aa---ta---t-gctg
                      Megabat  ac-----agaa-----------------aatgct---ca--------tcaca--aa---ta---t-gctg
                     Elephant  ac-----agaa-----------------tgtgct---ca--------ctgca--aa---tc---t-----
          Cape elephant shrew  ac-----agag-----------------tgggct---ca--------ctgca--ag---tc---t-----
                      Manatee  ac-----agaa-----------------tgtgct---ca--------ccaca--aa---tc---t-----
             Cape golden mole  at-----aaaa-----------------tgcgct---ca--------ccata--aa---tc---t-----
                     Aardvark  at-----agaatgttcaccacaaatctttgtgtt---ca--------ccaca--aa---tc---t-----
                    Armadillo  ac-----agag-----------------cgcgct---cagaacacacctgcg--ac---tc---a-----
              Star-nosed mole  ======================================================================
                          Rat  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Turkey  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
                       Rabbit  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Peregrine falcon  ======================================================================
                       Lizard  ======================================================================
           Tibetan ground jay  ======================================================================
                 Mallard duck  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                Scarlet macaw  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                   Budgerigar  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                  Zebra finch  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
           American alligator  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================

                        Human  --cttt--taaagcaa
                        Chimp  --cttt--taaagcaa
                      Gorilla  --cttt--taaagcaa
                    Orangutan  --cttt--caaagaaa
                       Gibbon  --cttt--taaagcaa
                       Rhesus  --cttt--taaagcaa
          Crab-eating macaque  --cttt--taaagcaa
                       Baboon  --cttt--taaagcaa
                 Green monkey  --cttt--taaagcaa
                     Marmoset  --cttt--taaagcga
              Squirrel monkey  --cttt--taaagcaa
                     Bushbaby  --cctt--gaaagcaa
           Chinese tree shrew  --cttc--taaagcgg
                     Squirrel  ctcctc--taaggcct
                 Prairie vole  ctcttt--gaaagcca
              Chinese hamster  ctcttt--gaaagcca
               Golden hamster  ctcttt--gaaagtca
                        Mouse  ctcttt--aaaaacca
               Naked mole-rat  cccttg--taaggcca
                   Chinchilla  ctcacg--tgaagcca
             Brush-tailed rat  ctctca--taagggca
                         Pika  ctcttt--aaaaaaaa
                       Alpaca  ctttct--ggaagcag
               Bactrian camel  ctttct--ggaaacag
                      Dolphin  ctcttt--ggaagcaa
                 Killer whale  ctcttg--ggaagcaa
                        Horse  ctcttt--gaaagtaa
             White rhinoceros  ctcttt--gaaagcaa
                          Cat  ctt--g--gaaagcaa
                          Dog  ctc--t--gaaagcaa
                      Ferret   ctc--t--gaaagcaa
                        Panda  ctc--t--gaaagcaa
               Pacific walrus  ctc--t--g-aagcaa
                 Weddell seal  ctc--t--g-aagcaa
             Black flying-fox  ctcttt--g-aggcaa
                      Megabat  ctcttt--g-aggcaa
                     Elephant  ----tctttgaagcaa
          Cape elephant shrew  ----tc--tgaaacaa
                      Manatee  ----tc--tgaagcaa
             Cape golden mole  ----cc--tgaagcaa
                     Aardvark  ----tc--tgaagcaa
                    Armadillo  ----tt--taaagtta
              Star-nosed mole  ================
                          Rat  ================
                     Hedgehog  ================
                Big brown bat  ================
                     Microbat  ================
         David's myotis (bat)  ================
                       Turkey  ================
       Lesser Egyptian jerboa  ================
                       Tenrec  ================
                   Guinea pig  ================
                       Rabbit  ================
                Domestic goat  ================
                        Sheep  ================
                          Cow  ================
             Tibetan antelope  ================
             Peregrine falcon  ================
                       Lizard  ================
           Tibetan ground jay  ================
                 Mallard duck  ================
          Medium ground finch  ================
       White-throated sparrow  ================
                Scarlet macaw  ================
          Collared flycatcher  ================
                 Saker falcon  ================
                   Budgerigar  ================
              Tasmanian devil  ================
                     Platypus  ================
                  Zebra finch  ================
              Green seaturtle  ================
                      Chicken  ================
           American alligator  ================
                X. tropicalis  ================
                  Rock pigeon  ================
                      Opossum  ================
     Chinese softshell turtle  ================
               Painted turtle  ================
                          Pig  ================

Inserts between block 5 and 6 in window
B D                     Pika 629bp

Alignment block 6 of 199 in window, 11576695 - 11576701, 7 bps 
B D                     Human  tt----ccctg
B D                     Chimp  tt----ccctg
B D                   Gorilla  tt----ccctg
B D                 Orangutan  tt----ccctg
B D                    Gibbon  tt----ccctg
B D                    Rhesus  tt----ccctg
B D       Crab-eating macaque  tt----ccctg
B D                    Baboon  tt----ccctg
B D              Green monkey  tt----ccctg
B D                  Marmoset  ct----ccctg
B D           Squirrel monkey  tt----ctctg
B D                  Bushbaby  tt----ctctg
           Chinese tree shrew  tg----tctgg
B D                  Squirrel  cg----ccctg
                 Prairie vole  gc----ccctg
B D           Chinese hamster  gg----tcctg
               Golden hamster  gc----ccctg
B D                     Mouse  g-----ccctg
B D            Naked mole-rat  tcctgtcccca
                   Chinchilla  tccatccccca
             Brush-tailed rat  t-----ccctg
B D                    Alpaca  tt----cgctg
               Bactrian camel  tt----cgctg
B D                   Dolphin  tt----ccccg
                 Killer whale  tt----ccccg
B D                     Horse  tt----cactg
B D          White rhinoceros  tt----cgctg
B D                       Cat  tt----gcttg
B D                       Dog  tt----ccctg
B D                   Ferret   tt----ccctg
B D                     Panda  tt----ccctg
               Pacific walrus  tt----ccctg
                 Weddell seal  tt----ccctg
             Black flying-fox  tt----cacta
B D                   Megabat  tt----cacta
B D                  Elephant  tc----tcctg
          Cape elephant shrew  tt----ccttg
B D                   Manatee  tt----ccctg
             Cape golden mole  tt----ccctg
                     Aardvark  tt----ccctg
B D                 Armadillo  tt----cctgg
             Star-nosed mole  ===========
B D                       Rat  ===========
B D                  Hedgehog  ===========
               Big brown bat  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
B D                    Turkey  ===========
      Lesser Egyptian jerboa  ===========
B D                    Tenrec  ===========
B D                Guinea pig  ===========
B D                    Rabbit  ===========
               Domestic goat  ===========
B D                      Pika  ===========
B D                     Sheep  ===========
B D                       Cow  ===========
            Tibetan antelope  ===========
  D          Peregrine falcon  ===========
B D                    Lizard  ===========
          Tibetan ground jay  ===========
  D              Mallard duck  ===========
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
  D             Scarlet macaw  ===========
  D       Collared flycatcher  ===========
  D              Saker falcon  ===========
B D                Budgerigar  ===========
B D           Tasmanian devil  ===========
B D                  Platypus  ===========
B D               Zebra finch  ===========
  D           Green seaturtle  ===========
B D                   Chicken  ===========
B D        American alligator  ===========
B D             X. tropicalis  ===========
  D               Rock pigeon  ===========
B D                   Opossum  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
B D                       Pig  ===========

Alignment block 7 of 199 in window, 11576702 - 11576704, 3 bps 
B D                     Human  aca
B D                     Chimp  aca
B D                   Gorilla  aca
B D                 Orangutan  aca
B D                    Gibbon  aca
B D                    Rhesus  aca
B D       Crab-eating macaque  aca
B D                    Baboon  aca
B D              Green monkey  aca
B D                  Marmoset  ctg
B D           Squirrel monkey  cca
B D                  Bushbaby  aca
           Chinese tree shrew  gca
B D                  Squirrel  aca
                 Prairie vole  gag
B D           Chinese hamster  gtg
               Golden hamster  gtg
B D                     Mouse  gag
B D            Naked mole-rat  aca
                   Chinchilla  aga
             Brush-tailed rat  gca
B D                      Pika  --a
B D                    Alpaca  gca
               Bactrian camel  gca
B D                   Dolphin  gca
                 Killer whale  gca
B D                     Horse  gca
B D          White rhinoceros  gta
B D                       Cat  gca
B D                       Dog  gca
B D                   Ferret   gca
B D                     Panda  gca
               Pacific walrus  gca
                 Weddell seal  gca
             Black flying-fox  gca
B D                   Megabat  gca
B D                  Elephant  aca
          Cape elephant shrew  gca
B D                   Manatee  aca
             Cape golden mole  aca
                     Aardvark  aca
B D                 Armadillo  acg
             Star-nosed mole  ===
B D                       Rat  ===
B D                  Hedgehog  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                    Turkey  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                Guinea pig  ===
B D                    Rabbit  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                       Cow  ===
            Tibetan antelope  ===
  D          Peregrine falcon  ===
B D                    Lizard  ===
          Tibetan ground jay  ===
  D              Mallard duck  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D             Scarlet macaw  ===
  D       Collared flycatcher  ===
  D              Saker falcon  ===
B D                Budgerigar  ===
B D           Tasmanian devil  ===
B D                  Platypus  ===
B D               Zebra finch  ===
  D           Green seaturtle  ===
B D                   Chicken  ===
B D        American alligator  ===
B D             X. tropicalis  ===
  D               Rock pigeon  ===
B D                   Opossum  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                       Pig  ===

Inserts between block 7 and 8 in window
B D                     Pika 2bp

Alignment block 8 of 199 in window, 11576705 - 11576793, 89 bps 
B D                     Human  acactctgt--taatct----ctcctgagctc------cttagtaccc--cctgaaagtagc-agg-aca
B D                     Chimp  acactctgt--taatct----ctcctgagctc------cttagta-cc--cctgaaagtagc-agg-aca
B D                   Gorilla  acactctgt--ttatct----ctcctgagctc------cttagta-cc--cctgaaagtagc-agg-aca
B D                 Orangutan  atactctat--taatct----ctcttgagctc------cttcata-cc--cctgaaagtagc-agg-aca
B D                    Gibbon  atactctgt--taatct----ctcttgagctc------cttcgta-cc--cctgaaagtagc-agg-aca
B D                    Rhesus  atactctgc--taatct----ctcttgaactc------cttcata-tc--cttaaaacgagc-agg-aca
B D       Crab-eating macaque  atactctgc--taatct----ctcttgaactc------cttcata-tc--cttaaaactagc-agg-aca
B D                    Baboon  atactctgc--taatct----ctcttgaactc------cttcata-tc--cttaaaactagc-agg-aca
B D              Green monkey  atactctgc--taatct----ctcttgagctc------cttcata-tc--cctgaaagtagc-agg-aca
B D                  Marmoset  atgctcggt--caacct----ctcttgggttc------cttcatg-tt--cc-gaaagtaat-agg-aca
B D           Squirrel monkey  atactctgt--tagttt----cttttgagttc------cttccta-tt--cctgaaagtaat-agg-aca
B D                  Bushbaby  atactcagt--gcatct----gtctcaggtta------tcttaca-tc--tttgaaaataac-agg-aga
           Chinese tree shrew  atatt--gt--taacct----ctcgtgagtga------cgtagtg-tc--tctgaaagtaac-ggg-aca
B D                  Squirrel  gcac--tcccttagaag----ctctctagttg------cttcata-ac--cctcagagtcac-agg-aca
                 Prairie vole  atgc--tgc--tagccc----ctctccgggca------tcttat--ct--cctgaaagcaag-acc-aca
B D           Chinese hamster  aagc--tgc--tagccc----ttctccaggca------ctt------t--cctggaaa---------aca
               Golden hamster  aagc--tgc--tagcca----ttctccaggca------ctttct--ct--cttggaaa---------aca
B D                     Mouse  aggc--tgc--tagcct----ttctccagaca------cgt-tt--ct--cctagaag------------
B D            Naked mole-rat  gcactgtgc--catccg----ctctcctggggcacttcctttgt--gc--cccaggagtgac-agg-aca
                   Chinchilla  gtgctctgc--aagctg----ctctcgagtga------ctttgt--at--ccaggaagtcac-agg-aca
             Brush-tailed rat  gcactctgc--cagctg----ctcttgggtgg------ctttgt--ac--ccgggaaatgac-agg-aca
B D                    Rabbit  gtaccctgt--taacct----gtctggaatta------tttttgcatt--ccttgaaataac-agg-gca
B D                      Pika  atactccgt--tcacct----ctcttgaattg------tttc----ct--ccttgaaatagc-a-a-atg
B D                    Alpaca  --atgccat--gagt--------------gta------ccctgag-tcatcctgaaaggatc-agg-aca
               Bactrian camel  --atgccat--gagt--------------gta------ccctgag-tcatcctgaaaggatc-agg-aca
B D                   Dolphin  --gtgccct--acgtca----------agtta------ctttaca-tc--cctgaaagtatc-agg-aca
                 Killer whale  --gtgccct--acgtca----------agtta------ctttaca-tc--cctgaaagtatc-aag-aca
B D                     Horse  --gttccat--cagccg----acctcgagcaa------cgtcata-tc--ccttgaggtatc-agg-aca
B D          White rhinoceros  --attccat--ccacca----acctcgagtaa------cattata-tc--cctggaggtatc-agg-aca
B D                       Cat  --attccat--tagcct-ccttcctcaagtga------ctttata-tc--cctgaaagtatc-agg-aca
B D                       Dog  --actccat--tggcctgcctacctcaagtaa------ctttatg-tc--cctgaaagtatc-gggaaca
B D                   Ferret   --actccat--cagcctgcccacctcaagtaa------ctttata-tc--cctgaacgtatc-agg-aca
B D                     Panda  --actccat--tagcctgtctacctcaggtaa------gtttata-tc--cctgaatgtatc-agg-aca
               Pacific walrus  --actccat--tagcctgtctacctcaagtaa------cttcata-tc--cctgaaagtgtc-ggg-aca
                 Weddell seal  --actccat--tagcctgcctacctcaagtaa------cttcgta-tc--cctgaaagtatc-agg-aca
             Black flying-fox  --attccat--tagcct----gcctcgagtta------ttttatg-tc--tctgaaagtatc-agg-aca
B D                   Megabat  --attccat--tagcgt----gcctcgagtta------ttttatg-tc--tctgaaagtatc-agg-aca
B D                  Elephant  atgctcagt--taacct----atactgagtta------ctttatg-tt--tccgaaagtgag-ggggaca
          Cape elephant shrew  atatcttat--taacat----ct-ctgtgtta------ccttatg-tc--tttgaaagtgagaggggaca
B D                   Manatee  atactcagt--taacct----atactgagtta------ctttgtg-gc--tctgaaattgag-agggaca
             Cape golden mole  atacttggt--tcatct----atcttgagtta------cattagg-tt--tctgaaaataag-aggaagg
                     Aardvark  atattaaca--taacct----atcttgagtta------tttta-------tcaagaagtgag-agggaca
B D                 Armadillo  atattc----------------cctcgaggtg------ctccgtg-cc--cctgatggtatc-agg--cg
             Star-nosed mole  ======================================================================
B D                       Rat  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Turkey  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                    Lizard  ======================================================================
          Tibetan ground jay  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D        American alligator  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================

                        Human  gc------cttactttccaaatc----ttcaccttt-------------------------gca------
                        Chimp  gc------cttactttccaaatc----ttcaccttt-------------------------gca------
                      Gorilla  gc------cttactttccaaatc----ttcaccttt-------------------------gca------
                    Orangutan  gc------cttactttccaaacc----ttcaccttt-------------------------gca------
                       Gibbon  gc------cttactttccaaatc----ttcaccttt-------------------------gca------
                       Rhesus  gt------cttacttttcaaata----ctcaccttt-------------------------gca------
          Crab-eating macaque  gt------cttacttttcaaata----ctcaccttt-------------------------gca------
                       Baboon  gt------cttacttttcaaata----ttcaccttt-------------------------gca------
                 Green monkey  gt------cttacttttcaaata----ttcaccttt-------------------------gca------
                     Marmoset  gc------ctaactttcccagtc----ttcaccttt-------------------------gca------
              Squirrel monkey  gc------ctcactttccaagtc----ttcaccttt-------------------------gct------
                     Bushbaby  gt------cttgctttcaa--------------------------------------------c------
           Chinese tree shrew  gg------ctcgcttttaaaatc----tttcacttt-------------------------gcaacac--
                     Squirrel  gc------ctgactttagaaacc----tgtgacttt-------------------------gcaacac--
                 Prairie vole  gc------cctgctttaaagatc----ttcagtttg-------------------------accgcac--
              Chinese hamster  g---------------aaagata----ttcagtttg-------------------------acagcac--
               Golden hamster  g---------------aaagatc----ttcagtttg-------------------------acaacac--
                        Mouse  gc------cttacttttaagatc----ttcagttta-------------------------acagcac--
               Naked mole-rat  ga------ctcacaactaaaatc----cgccccttt-------------------------gc-------
                   Chinchilla  ga------ctcacatctaa---------aaatcttc-------------------------gc-------
             Brush-tailed rat  gattccagctcctatct-----------gccccttt-------------------------gc-------
                       Rabbit  gt------ctcactctcagaatc----tcccacctc-------------------------acagcag--
                         Pika  at------ctca-------aatc----tcccacctt-------------------------gcagaag--
                       Alpaca  gt------catacttttaaaact----gtcaacttt-------------------------ccaacac--
               Bactrian camel  gt------cttacttttaaaact----gtcaatttt-------------------------ccaacac--
                      Dolphin  gc------cttacttttaaaatc----ttcaacttt-------------------------ccagcac--
                 Killer whale  gt------cttacttttaaaatc----ttcaacttt-------------------------ccaacac--
                        Horse  gt------cttagttttaaaatc----tccaaggtt-------------------------ccaacac--
             White rhinoceros  gc------cttacttttgaaacc----tccaacgtt-------------------------ccaacac--
                          Cat  at------cttacttttttttttttaattcatttttgagagagagacagacagagcgagagccagggt--
                          Dog  at------cttacttttaaaatc----tttaacttc-------------------------tcaccat--
                      Ferret   at------cttactttcaaactc----ttcaccttt-------------------------ccaccac--
                        Panda  a----------aattttaaaatc----ttcaacttt-------------------------acaccac--
               Pacific walrus  at------cttgttttcaaaatc----ttcaacttt-------------------------ccaccac--
                 Weddell seal  at------cttactttcaaaatc----ttcatcttt-------------------------ccaccgc--
             Black flying-fox  gt------c----ttttaaaatc----ttcagcttt-------------------------tcaatgc--
                      Megabat  gt------c----ttttaaaatc----ttcagcttt-------------------------tcaatgc--
                     Elephant  a--------tcacttttccaatc----ttaatcttt-------------------------gcaacac--
          Cape elephant shrew  gt------tttgattttctaatt----ttcattttt-------------------------t--------
                      Manatee  gt------cttacttttctaatc----ttcatcttt-------------------------gcaacac--
             Cape golden mole  gt------cctactttccc-atc----ttcatcttt-------------------------gtaacac--
                     Aardvark  gt------cttacttttctaatc----atcatattt-------------------------gcaaca---
                    Armadillo  gt------cttgttt-----aaa----accttcttt-------------------------gcggcgcag
              Star-nosed mole  ======================================================================
                          Rat  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Turkey  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Peregrine falcon  ======================================================================
                       Lizard  ======================================================================
           Tibetan ground jay  ======================================================================
                 Mallard duck  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                Scarlet macaw  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                   Budgerigar  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                  Zebra finch  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
           American alligator  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================

                        Human  -------------agagtc
                        Chimp  -------------agagtc
                      Gorilla  -------------agagtc
                    Orangutan  -------------agagcc
                       Gibbon  -------------agagtc
                       Rhesus  -------------agagtc
          Crab-eating macaque  -------------agagtc
                       Baboon  -------------agagtc
                 Green monkey  -------------agagtc
                     Marmoset  -------------ggagtc
              Squirrel monkey  -------------agagtc
                     Bushbaby  -------------agagtt
           Chinese tree shrew  -------------agagtt
                     Squirrel  --------------gagtc
                 Prairie vole  -------------agaggc
              Chinese hamster  -------------agaggc
               Golden hamster  -------------agaggc
                        Mouse  -------------aaaggc
               Naked mole-rat  ---------------agtc
                   Chinchilla  ---------------agtc
             Brush-tailed rat  ---------------aatc
                       Rabbit  ---------------agtc
                         Pika  ---------------a-tc
                       Alpaca  ---------------agct
               Bactrian camel  ---------------agct
                      Dolphin  -------------agagct
                 Killer whale  -------------agagct
                        Horse  -------------acagct
             White rhinoceros  -------------agagct
                          Cat  -------------ggggca
                          Dog  -------------agagct
                      Ferret   -------------agtgct
                        Panda  -------------ggagct
               Pacific walrus  -------------agagct
                 Weddell seal  -------------agagct
             Black flying-fox  -------------agagct
                      Megabat  -------------agagct
                     Elephant  -------------------
          Cape elephant shrew  -------------------
                      Manatee  -------------------
             Cape golden mole  -------------------
                     Aardvark  -------------------
                    Armadillo  agtttcctgagtc------
              Star-nosed mole  ===================
                          Rat  ===================
                     Hedgehog  ===================
                Big brown bat  ===================
                     Microbat  ===================
         David's myotis (bat)  ===================
                       Turkey  ===================
       Lesser Egyptian jerboa  ===================
                       Tenrec  ===================
                   Guinea pig  ===================
                Domestic goat  ===================
                        Sheep  ===================
                          Cow  ===================
             Tibetan antelope  ===================
             Peregrine falcon  ===================
                       Lizard  ===================
           Tibetan ground jay  ===================
                 Mallard duck  ===================
          Medium ground finch  ===================
       White-throated sparrow  ===================
                Scarlet macaw  ===================
          Collared flycatcher  ===================
                 Saker falcon  ===================
                   Budgerigar  ===================
              Tasmanian devil  ===================
                     Platypus  ===================
                  Zebra finch  ===================
              Green seaturtle  ===================
                      Chicken  ===================
           American alligator  ===================
                X. tropicalis  ===================
                  Rock pigeon  ===================
                      Opossum  ===================
     Chinese softshell turtle  ===================
               Painted turtle  ===================
                          Pig  ===================

Inserts between block 8 and 9 in window
B D                      Cat 160bp
B D                 Elephant 6bp
         Cape elephant shrew 177bp
B D                  Manatee 6bp
            Cape golden mole 3bp
                    Aardvark 2bp

Alignment block 9 of 199 in window, 11576794 - 11576796, 3 bps 
B D                     Human  tag-
B D                     Chimp  tag-
B D                   Gorilla  tag-
B D                 Orangutan  tag-
B D                    Gibbon  tgg-
B D                    Rhesus  tag-
B D       Crab-eating macaque  tag-
B D                    Baboon  tag-
B D              Green monkey  tag-
B D                  Marmoset  tag-
B D           Squirrel monkey  tag-
B D                  Bushbaby  cag-
           Chinese tree shrew  cag-
B D                  Squirrel  cag-
                 Prairie vole  tag-
B D           Chinese hamster  tag-
               Golden hamster  tag-
B D                     Mouse  tag-
B D            Naked mole-rat  aag-
                   Chinchilla  tgg-
             Brush-tailed rat  tgg-
B D                    Rabbit  tgg-
B D                      Pika  tag-
             Cape golden mole  -att
                     Aardvark  -gtt
B D                 Armadillo  -tgg
             Star-nosed mole  ====
B D                       Rat  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Turkey  ====
              Bactrian camel  ----
B D                    Alpaca  ----
B D                   Megabat  ----
      Lesser Egyptian jerboa  ====
B D                     Panda  ----
B D                    Tenrec  ====
B D                Guinea pig  ====
B D                   Ferret   ----
B D                       Cat  ====
B D                   Manatee  ====
B D                       Dog  ----
               Domestic goat  ====
B D                  Elephant  ====
B D                     Sheep  ====
B D                       Cow  ====
            Tibetan antelope  ====
                Killer whale  ----
            Black flying-fox  ----
B D                     Horse  ----
  D          Peregrine falcon  ====
B D                    Lizard  ====
          Tibetan ground jay  ====
  D              Mallard duck  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D             Scarlet macaw  ====
  D       Collared flycatcher  ====
  D              Saker falcon  ====
B D                Budgerigar  ====
B D           Tasmanian devil  ====
B D                  Platypus  ====
B D               Zebra finch  ====
  D           Green seaturtle  ====
B D                   Chicken  ====
B D        American alligator  ====
B D             X. tropicalis  ====
  D               Rock pigeon  ====
B D                   Dolphin  ----
                Weddell seal  ----
              Pacific walrus  ----
B D          White rhinoceros  ----
B D                   Opossum  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
B D                       Pig  ====

Alignment block 10 of 199 in window, 11576797 - 11576817, 21 bps 
B D                     Human  tctgtgagtccag----gct----------c-----------------------acct
B D                     Chimp  tctgtgagtccag----gct----------c-----------------------acct
B D                   Gorilla  tctgtgagtccag----gct----------c-----------------------acct
B D                 Orangutan  tctgtgagtccag----gct----------c-----------------------acct
B D                    Gibbon  tc--tgagtccag----gct----------a-----------------------acct
B D                    Rhesus  tctgtgagtccag----gct----------c-----------------------acct
B D       Crab-eating macaque  tctgtgagtccag----gct----------c-----------------------acct
B D                    Baboon  tctgtgagtccag----gct----------c-----------------------acct
B D              Green monkey  tctgtgagtccag----gct----------c-----------------------acct
B D                  Marmoset  tc--tgagcccag----act----------c-----------------------acct
B D           Squirrel monkey  tctttgagcccag----gct----------c-----------------------acct
B D                  Bushbaby  tctgtgagtccgg----gctaagctcccccc-----------------------acct
           Chinese tree shrew  cctgggagtcgag----gcc----------c-----------------------actg
B D                  Squirrel  tcttcaggcccag----cct----------c-----------------------tccc
                 Prairie vole  agtgtgagttcag----gtt----------c-----------------------tacc
B D           Chinese hamster  agtgtgagttcaa----gtt----------c-----------------------tacc
               Golden hamster  agtgtgagttcaa----gtt----------c-----------------------tacc
B D                     Mouse  ggtgtgggctcag----ggt----------c-----------------------cacc
B D            Naked mole-rat  tctgccagcctgg----gct----------c-----------------------agcc
                   Chinchilla  cct-------------------------------------------------------
             Brush-tailed rat  cctgccagtccag----gct----------c-----------------------aaca
B D                    Rabbit  cctgggagtccagcgctgcc----------g-----------------------gacc
B D                      Pika  cctgg------------gtc----------t-----------------------tact
B D                    Alpaca  tccgagagc-cag----gcc----------c-----------------------acct
               Bactrian camel  tccgagagc-cag----gcc----------c-----------------------acct
B D                   Dolphin  tccaagagt-cag----gct----------c-----------------------acct
                 Killer whale  tccaagagt-cag----gct----------c-----------------------acct
B D                     Horse  cccatgagt-cag----gct----------t-----------------------gtct
B D          White rhinoceros  tctgtgagt-cag----gct----------c-----------------------acct
B D                       Cat  tttgtgagt-caa----gct----------c-----------------------acct
B D                       Dog  tctgtgggt-cag----gct----------c-----------------------accc
B D                   Ferret   tctgtgagt-cag----gct----------c-----------------------acct
B D                     Panda  tctgtgagc-ctg----gct----------c-----------------------atct
               Pacific walrus  tctgtgagt-cag----gct----------t-----------------------acct
                 Weddell seal  tctaagagt-cgg----gtt----------t-----------------------acct
             Black flying-fox  ttcatgagt-cag----gct----------c-----------------------atct
B D                   Megabat  ttcatgact-cag----gct----------c-----------------------atct
B D                  Elephant  tccatgaacccag----gct----------c-----------------------atct
B D                   Manatee  tccatgagcccag----gct----------c-----------------------acct
             Cape golden mole  tccatgagctcac----tct----------c-----------------------acct
                     Aardvark  tccatgagcccag----gct----------t-----------------------acct
B D                 Armadillo  gctggcagctccc----gct----------ctaaaggggctggcgtctcagggaatcc
             Star-nosed mole  ==========================================================
B D                       Rat  ==========================================================
         Cape elephant shrew  ==========================================================
B D                  Hedgehog  ==========================================================
               Big brown bat  ==========================================================
B D                  Microbat  ==========================================================
        David's myotis (bat)  ==========================================================
B D                    Turkey  ==========================================================
      Lesser Egyptian jerboa  ==========================================================
B D                    Tenrec  ==========================================================
B D                Guinea pig  ==========================================================
               Domestic goat  ==========================================================
B D                     Sheep  ==========================================================
B D                       Cow  ==========================================================
            Tibetan antelope  ==========================================================
  D          Peregrine falcon  ==========================================================
B D                    Lizard  ==========================================================
          Tibetan ground jay  ==========================================================
  D              Mallard duck  ==========================================================
B D       Medium ground finch  ==========================================================
  D    White-throated sparrow  ==========================================================
  D             Scarlet macaw  ==========================================================
  D       Collared flycatcher  ==========================================================
  D              Saker falcon  ==========================================================
B D                Budgerigar  ==========================================================
B D           Tasmanian devil  ==========================================================
B D                  Platypus  ==========================================================
B D               Zebra finch  ==========================================================
  D           Green seaturtle  ==========================================================
B D                   Chicken  ==========================================================
B D        American alligator  ==========================================================
B D             X. tropicalis  ==========================================================
  D               Rock pigeon  ==========================================================
B D                   Opossum  ==========================================================
  D  Chinese softshell turtle  ==========================================================
  D            Painted turtle  ==========================================================
B D                       Pig  ==========================================================

Inserts between block 10 and 11 in window
B D                 Bushbaby 52bp
          Chinese tree shrew 63bp
                  Chinchilla 5bp
B D                   Alpaca 72bp
              Bactrian camel 72bp
B D                  Dolphin 75bp
                Killer whale 75bp
B D                    Horse 75bp
B D         White rhinoceros 75bp
B D                      Cat 75bp
B D                      Dog 72bp
B D                  Ferret  75bp
B D                    Panda 65bp
              Pacific walrus 75bp
                Weddell seal 75bp
            Black flying-fox 74bp
B D                  Megabat 74bp
B D                 Elephant 55bp
B D                  Manatee 55bp
            Cape golden mole 179bp
B D                Armadillo 4bp

Alignment block 11 of 199 in window, 11576818 - 11576819, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  ta
                 Prairie vole  ca
B D           Chinese hamster  ca
               Golden hamster  ca
B D                     Mouse  cg
B D            Naked mole-rat  ga
             Brush-tailed rat  ga
B D                    Rabbit  ca
B D                      Pika  c-
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  -g
               Pacific walrus  cg
                 Weddell seal  gg
             Black flying-fox  gg
B D                   Megabat  gg
B D                  Elephant  -g
B D                   Manatee  -g
B D                 Armadillo  gg
             Star-nosed mole  ==
B D                       Rat  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Turkey  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
                  Chinchilla  ==
B D                Guinea pig  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
  D          Peregrine falcon  ==
B D                    Lizard  ==
          Tibetan ground jay  ==
  D              Mallard duck  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
            Cape golden mole  ==
  D             Scarlet macaw  ==
  D       Collared flycatcher  ==
  D              Saker falcon  ==
B D                Budgerigar  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
B D               Zebra finch  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D        American alligator  ==
B D             X. tropicalis  ==
  D               Rock pigeon  ==
B D                   Opossum  ==
                    Aardvark  --
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                       Pig  ==

Inserts between block 11 and 12 in window
B D                 Elephant 1bp
B D                  Manatee 1bp

Alignment block 12 of 199 in window, 11576820 - 11576838, 19 bps 
B D                     Human  agtctgag---------------attt---tgggagc
B D                     Chimp  agtctgag---------------attt---tgggagc
B D                   Gorilla  agtctgag---------------attt---tgggagc
B D                 Orangutan  agtctgag---------------attt---tgggagc
B D                    Gibbon  agtctgag---------------attt---tgggagc
B D                    Rhesus  agtctgag---------------attt---tgggagc
B D       Crab-eating macaque  agtctgag---------------attt---tgggagc
B D                    Baboon  agtctgag---------------attt---tgggagc
B D              Green monkey  agtctgag---------------attt---tgggagc
B D                  Marmoset  agtcggag---------------actt---taagagc
B D           Squirrel monkey  agtctgag---------------actt---tggaagc
B D                  Bushbaby  agtcggaggg-acggagccggcagtta---ggggagc
           Chinese tree shrew  gctctgagggcactctgc-----actg---tgagagc
B D                  Squirrel  actc--cc----------------tct---gaagggt
                 Prairie vole  ccccctag----------------ccc---caagggc
B D           Chinese hamster  cccc--aa----------------cct---caagggc
               Golden hamster  cccca-aa----------------ccc---caaaggc
B D                     Mouse  ccccc-aa----------------tcc---caagagc
B D            Naked mole-rat  ccct---------------------------------
             Brush-tailed rat  gccc---------------------------------
B D                    Rabbit  ctccccga----ctggcccct--ctct---agagggt
B D                      Pika  ctctgtgaagagttagcatgg--cagc---aaagaag
B D                    Alpaca  agcctggg---------------acct---ggagagc
               Bactrian camel  agcctggg---------------acct---ggggagc
B D                   Dolphin  agccgggg---------------atct---ggggagc
                 Killer whale  agccgggg---------------atct---ggggagc
B D                     Horse  agcccagg---------------attg---ggggagc
B D          White rhinoceros  agcctggg---------------attg---ggggagc
B D                       Cat  agcttggg---------------attt---agggagc
B D                       Dog  agtctggg---------------atct---ggggacc
B D                   Ferret   agtctagg---------------atct---ggggagc
B D                     Panda  agcctggg---------------atct---ggggagc
               Pacific walrus  agcctgcg---------------aact---ggggagc
                 Weddell seal  agcctggg---------------agct---ggggagc
             Black flying-fox  agcctgga---------------atttgcagggaggc
B D                   Megabat  agcctgga---------------atttgcaggaaggc
B D                  Elephant  agcctagg---------------attt---ttggagt
B D                   Manatee  agcctagg---------------attt---ttggagt
             Cape golden mole  agcctggg---------------attt---gggggat
B D                 Armadillo  agcctggg---------------a--c---ggggagc
             Star-nosed mole  =====================================
B D                       Rat  =====================================
         Cape elephant shrew  =====================================
B D                  Hedgehog  =====================================
               Big brown bat  =====================================
B D                  Microbat  =====================================
        David's myotis (bat)  =====================================
B D                    Turkey  =====================================
      Lesser Egyptian jerboa  =====================================
B D                    Tenrec  =====================================
                  Chinchilla  =====================================
B D                Guinea pig  =====================================
               Domestic goat  =====================================
B D                     Sheep  =====================================
B D                       Cow  =====================================
            Tibetan antelope  =====================================
  D          Peregrine falcon  =====================================
B D                    Lizard  =====================================
          Tibetan ground jay  =====================================
  D              Mallard duck  =====================================
B D       Medium ground finch  =====================================
  D    White-throated sparrow  =====================================
  D             Scarlet macaw  =====================================
  D       Collared flycatcher  =====================================
  D              Saker falcon  =====================================
B D                Budgerigar  =====================================
B D           Tasmanian devil  =====================================
B D                  Platypus  =====================================
B D               Zebra finch  =====================================
  D           Green seaturtle  =====================================
B D                   Chicken  =====================================
B D        American alligator  =====================================
B D             X. tropicalis  =====================================
  D               Rock pigeon  =====================================
B D                   Opossum  =====================================
                    Aardvark  -------------------------------------
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
B D                       Pig  =====================================

Inserts between block 12 and 13 in window
B D                 Squirrel 77bp
                Prairie vole 50bp
B D          Chinese hamster 63bp
              Golden hamster 63bp
B D                    Mouse 68bp
B D           Naked mole-rat 7bp
            Brush-tailed rat 7bp
B D                   Rabbit 76bp
B D                     Pika 57bp

Alignment block 13 of 199 in window, 11576839 - 11576893, 55 bps 
B D                     Human  tttgg-----------agaa-ttctggataaa-atcccttactggactt----agcaggaatctccgat-
B D                     Chimp  tttgg-----------agaa-ttctggataaa-atcccttactgaacttagacagcaggaatctccgat-
B D                   Gorilla  tttgg-----------agaa-ttctggataaa-atcccttactgaacttagacaacaggaatctccaat-
B D                 Orangutan  tttgg-----------agaa-tcctggataaa-atcccttactgaacttagatagcaggaatctctgat-
B D                    Gibbon  tttgg-----------agaa-ttctggataaa-atcccttactgaacttagacagcaggaatctccgat-
B D                    Rhesus  tttgg-----------agaa-ttccggataaa-atccctcactgaacttagacagcaggaatctccaat-
B D       Crab-eating macaque  tttgg-----------agaa-ttccggataaa-atccctcactgaacttagacagcaggaatctccaat-
B D                    Baboon  tttgg-----------agaa-ttccggataaa-atccctcactgaacttagacagcacgaatctccaat-
B D              Green monkey  tttgg-----------ggaa-ttccggataaa-atccctcactgaacttagacagcaggaatctccaat-
B D                  Marmoset  tttgg-----------agaa-ttctggataaa-atcgcttcatgaacttagagagcaggaatctccaat-
B D           Squirrel monkey  tttgg-----------agaa-ttctggataaa-attgcttcatgaacttagagagcaggaatctctaaa-
B D                  Bushbaby  tttag-----------gaaa-cgctggataaa-atccctttgtgatcctagggagctgggatctctggt-
           Chinese tree shrew  tttgg-----------aaaa-ttctggataaacatcccctgatgagtttagggagcagaga-atatggt-
B D                  Squirrel  tttgg-----------aaaa-ttctgggtaaa-ccctt--gatgagcccagggagtagtagcct---ct-
                 Prairie vole  tttgg---------aaaaaa-tcctgggtgaa-aacct--gaagagcccaaacaacattattct---cta
B D           Chinese hamster  tttgg---------aaaaaa-tcccaggtgaa-aacct--gctgagtccaaacaacatgattct---ct-
               Golden hamster  tttgg----------aaaaa-ttccgggtga------------------aaacaacatgattcc---ct-
B D                     Mouse  --tgg---------acaaaa-tcctgggtgaa-aacct--gaggagttcagacagcacgattct---gt-
B D                       Rat  tttgg---------acgaaa-tcctgggtgaa-aaccc--atggagaccagacaacccaattctc-ggt-
B D                    Rabbit  tctgg-----------gaaa-ttctgggtaaa-atccc---ttgagtttagggagcaggaagctctggt-
B D                      Pika  tttgg-----------aaaa-ttctggataaa-atccc---ttgagtttagggagcaggaagctccagt-
B D                    Alpaca  tttgg-----------aaaa---ctggataaa-a-----------------ggagcaagaccctgtggt-
               Bactrian camel  tttgg-----------aaaa---ctggataaa-a-----------------ggagcaggaccctgtggt-
B D                   Dolphin  tttgg-----------aaaaactctggataaa-atcccttcatgagttgagagagcaggaatctctggt-
                 Killer whale  tttgg-----------aaaaaatctggataaa-accccttcatgagttgagagagcaggaatctctggt-
B D                     Horse  tttgg-----------aaaa-ttctggacgaa-agcccttcctgagtttagggagcaggaacctctgat-
B D          White rhinoceros  tttgg-----------aaag-ttctggacaaa-atcccttcctgagtttaggcagcaggaatccgtggt-
B D                       Cat  tttgg-aaatttttggaaaa-ttctggacaaa-accccttcatgggcttagggagcaggaa---------
B D                       Dog  tttggaaaagttctggaaaa-ttctggacaaa-gccccttcatgagttcagggagtaggaatttctggt-
B D                   Ferret   tttgggaaagttttagaaaa-ttctggacaga-atcccttcgtgagtttagggagcagcaatttctggt-
B D                     Panda  tttggaaaagttttggaaaa-ttctggacaaa-atcccttcatgagtttaaggagcaggaatatctggt-
               Pacific walrus  ttcggaaaagtgttggaaaa-ttctggacaaa-atcccttcatgagtttagggggcaggcatttctggt-
                 Weddell seal  tttgggaaagtgttggaaaa-ttctggacaaa------ttctggagtttagggggcaggcatttctggt-
             Black flying-fox  tttgg-----------aaaa-ttctggacaaa-atccattcatgagtttagaaatcaggaatctctggt-
B D                   Megabat  tttgg-----------aaaa-ttccggacaaa-atccattcatgagtttagaaatcaggaatctctggt-
B D                  Elephant  tttga-----------aaaa-aattgggtaaa-atctct---tgggctt-----tcagagatttgttgt-
B D                   Manatee  tttga-----------aaaa-ttttggataaa-atcccttgatgagcttaagaagcaggaacatctggt-
             Cape golden mole  tttga-----------aaac-tttgggataaa-accccttcatgagcttaagaaacaggaacatctggt-
                     Aardvark  ------------------------------------------tcacctt-----cttgaaaccacaggt-
B D                 Armadillo  tctgg-----------aaag-ttctggataga-atctcttggtgagcctaaggagcaggacttccggga-
             Star-nosed mole  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Turkey  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                    Tenrec  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                    Lizard  ======================================================================
          Tibetan ground jay  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D        American alligator  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================

                        Human  ---ctg
                        Chimp  ---ctg
                      Gorilla  ---ctt
                    Orangutan  ---ctt
                       Gibbon  ----tt
                       Rhesus  ---ctt
          Crab-eating macaque  ---ctt
                       Baboon  ---ctt
                 Green monkey  ---ctt
                     Marmoset  ---ctt
              Squirrel monkey  ---ctt
                     Bushbaby  ---ctc
           Chinese tree shrew  ---ctt
                     Squirrel  ggtctt
                 Prairie vole  gagatc
              Chinese hamster  ---gtc
               Golden hamster  ---gtc
                        Mouse  ---ctt
                          Rat  ---ctt
                       Rabbit  ---ctc
                         Pika  ---cgt
                       Alpaca  ---gtt
               Bactrian camel  ---gtt
                      Dolphin  ---ctt
                 Killer whale  ---ctt
                        Horse  ---ctt
             White rhinoceros  ---ctc
                          Cat  ----tt
                          Dog  ---ctt
                      Ferret   ---ctt
                        Panda  ---ttt
               Pacific walrus  ---ctt
                 Weddell seal  ---ctt
             Black flying-fox  ---ctt
                      Megabat  ---ctt
                     Elephant  ---cta
                      Manatee  ---ctt
             Cape golden mole  ---ctt
                     Aardvark  ---c--
                    Armadillo  ---tct
              Star-nosed mole  ======
          Cape elephant shrew  ======
                     Hedgehog  ======
                Big brown bat  ======
                     Microbat  ======
         David's myotis (bat)  ======
                       Turkey  ======
       Lesser Egyptian jerboa  ======
             Brush-tailed rat  ======
                       Tenrec  ======
                   Chinchilla  ======
                   Guinea pig  ======
               Naked mole-rat  ======
                Domestic goat  ======
                        Sheep  ======
                          Cow  ======
             Tibetan antelope  ======
             Peregrine falcon  ======
                       Lizard  ======
           Tibetan ground jay  ======
                 Mallard duck  ======
          Medium ground finch  ======
       White-throated sparrow  ======
                Scarlet macaw  ======
          Collared flycatcher  ======
                 Saker falcon  ======
                   Budgerigar  ======
              Tasmanian devil  ======
                     Platypus  ======
                  Zebra finch  ======
              Green seaturtle  ======
                      Chicken  ======
           American alligator  ======
                X. tropicalis  ======
                  Rock pigeon  ======
                      Opossum  ======
     Chinese softshell turtle  ======
               Painted turtle  ======
                          Pig  ======

Inserts between block 13 and 14 in window
B D                 Elephant 39bp
B D                Armadillo 17bp

Alignment block 14 of 199 in window, 11576894 - 11576929, 36 bps 
B D                     Human  tggagaagtctcc----------tcagaga------------c-tgagcatctgttcct
B D                     Chimp  tggagaagtctcctcgg---ttttcagaga------------c-tgagcatctgttcct
B D                   Gorilla  tggagaagtctccccgg---ttttcagaga------------c-tgagcatctgttcct
B D                 Orangutan  tggagaagtctcctcgg---ttttcagaga------------c-tgagcatctgttcct
B D                    Gibbon  tggagaagtctcctcgg---ttttcagagt------------c-tgggcatctgttcct
B D                    Rhesus  tggagaagtctcctcag---ttttcagaga------------c-tgggcatctgttcct
B D       Crab-eating macaque  tggagaagtctcctcag---ttttcagaga------------c-tgggcatctgttcct
B D                    Baboon  tggagaagtctcctcag---ttttcggaga------------c-tgggcatctgttcct
B D              Green monkey  tagagaagtctcctcag---ttttctgaga------------c-tgggcatctgttcct
B D                  Marmoset  tggagaggtcgcctcgg---ttttcagaga------------c-tgggcatctgttcgt
B D           Squirrel monkey  tggagaggtctcctcgg---ttttcagaga------------c-tgggcatctgtacct
B D                  Bushbaby  tggagaagtcacctggg---gtttc--aga------------c-tgggcctctgttact
           Chinese tree shrew  tggagaagccacctgga---ttttcagaga------------c-tcagcgtctgttcct
B D                  Squirrel  tggaggcgcca-ca-ga---gtctcagaga------------t-ttagc-ttca-cccc
                 Prairie vole  tgtagatatcacct-ga---gtctcagaga------------t-tta------------
B D           Chinese hamster  tgcagacgtcacct-ga---gtct--gaga------------t-ttagc-tttgtcctc
               Golden hamster  tgcagatgtcgcct-ga---gtctcggaaa------------t-ttagt-tttgttccc
B D                     Mouse  tacagaggtcacca-ga---atctcggaga------------t-ttagt-tttatcctc
B D                       Rat  tacggaggtcacct-ga---atctcagaga------------t-ttagt-tttgtcctc
B D                    Rabbit  tgcagaactcacctggc---ttttctgagacgtggcctcatgg-ctggc-tctgtcctc
B D                      Pika  tgggacagtcacct--------------------gcaccttgt-ctggc-tctatcctc
B D                    Alpaca  tggagaagccccatgga---ttttcagggg------------c-ttggcacctgctccc
               Bactrian camel  tggagaagccccatgga---ttttcagggg------------c-ttggcacctgctctc
B D                   Dolphin  tgaagcagccacctgga---ttttcagagg------------c-ttaccatctgctccc
                 Killer whale  tgaagcagccacctgga---ttttcagagg------------c-ttaccatctgctccc
B D                     Horse  tggagaagccacctgga---ttttcagaga------------c-ttggcacttgct-ct
B D          White rhinoceros  tggagaagccacctgga---gcttcagaga------------c-tcggcacctgtt-ct
B D                       Cat  tggaaaagttacctgga---ttttcagaaa------------c-ttgacccctgttcct
B D                       Dog  tagagaagctacttgga---tttccagaga------------c-gtgacaccttcttct
B D                   Ferret   tggagaagatagctgga---ttttcagaaa------------c-tggttacctgtt-ct
B D                     Panda  tggagaagctacctgga---ttttcagaga------------c-ttgacaactgttcct
               Pacific walrus  tggagaggccacccaga---ctttcagaga------------c-tggacacctgttcct
                 Weddell seal  tggagtgcctacccaga---ctttcagaga------------c-tggacacctgttcct
             Black flying-fox  tagagaaaccacttggacacttttcagaca------------ctttgacacctattccc
B D                   Megabat  tagagaaaccacttggacacttttcagacc------------ctttgacacctattccc
B D                   Manatee  tggagaagctgcttggg---ctttcagaga------------t-ttgttgtc-------
             Cape golden mole  tgtagaagctgcttgag---ctttcagaga---------------tgttttc-------
B D                 Armadillo  tgc----gctcgccggg---ctaggaaagc------------a-c--------------
             Star-nosed mole  ===========================================================
         Cape elephant shrew  ===========================================================
B D                  Hedgehog  ===========================================================
               Big brown bat  ===========================================================
B D                  Microbat  ===========================================================
        David's myotis (bat)  ===========================================================
B D                    Turkey  ===========================================================
      Lesser Egyptian jerboa  ===========================================================
            Brush-tailed rat  ===========================================================
B D                    Tenrec  ===========================================================
                  Chinchilla  ===========================================================
B D                Guinea pig  ===========================================================
B D            Naked mole-rat  ===========================================================
               Domestic goat  ===========================================================
B D                  Elephant  ===========================================================
B D                     Sheep  ===========================================================
B D                       Cow  ===========================================================
            Tibetan antelope  ===========================================================
  D          Peregrine falcon  ===========================================================
B D                    Lizard  ===========================================================
          Tibetan ground jay  ===========================================================
  D              Mallard duck  ===========================================================
B D       Medium ground finch  ===========================================================
  D    White-throated sparrow  ===========================================================
  D             Scarlet macaw  ===========================================================
  D       Collared flycatcher  ===========================================================
  D              Saker falcon  ===========================================================
B D                Budgerigar  ===========================================================
B D           Tasmanian devil  ===========================================================
B D                  Platypus  ===========================================================
B D               Zebra finch  ===========================================================
  D           Green seaturtle  ===========================================================
B D                   Chicken  ===========================================================
B D        American alligator  ===========================================================
B D             X. tropicalis  ===========================================================
  D               Rock pigeon  ===========================================================
B D                   Opossum  ===========================================================
                    Aardvark  -----------------------------------------------------------
  D  Chinese softshell turtle  ===========================================================
  D            Painted turtle  ===========================================================
B D                       Pig  ===========================================================

Inserts between block 14 and 15 in window
B D                 Squirrel 18bp
                Prairie vole 13bp
B D          Chinese hamster 18bp
              Golden hamster 18bp
B D                    Mouse 18bp
B D                      Rat 18bp
B D                   Rabbit 13bp
B D                     Pika 9bp
B D                   Alpaca 30bp
              Bactrian camel 30bp
B D                  Dolphin 30bp
                Killer whale 28bp
B D                    Horse 30bp
B D         White rhinoceros 30bp
B D                      Cat 30bp
B D                      Dog 30bp
B D                  Ferret  26bp
B D                    Panda 30bp
              Pacific walrus 30bp
                Weddell seal 30bp
            Black flying-fox 30bp
B D                  Megabat 30bp
B D                  Manatee 41bp
            Cape golden mole 40bp

Alignment block 15 of 199 in window, 11576930 - 11576946, 17 bps 
B D                     Human  agct-----------------------------ccctcc-----gggctct
B D                     Chimp  agct-----------------------------ccctcc-----aggctct
B D                   Gorilla  agct-----------------------------ccctcc-----gggctct
B D                 Orangutan  agct-----------------------------ccctcc-----aggctct
B D                    Gibbon  agct-----------------------------ccctcc-----aggctct
B D                    Rhesus  agct-----------------------------ccctcc----tggactct
B D       Crab-eating macaque  agct-----------------------------ccctcc----tggactct
B D                    Baboon  agct-----------------------------ccctcc----tggactct
B D              Green monkey  agct-----------------------------ccctcc----tggactct
B D                  Marmoset  agct-----------------------------tcctcc----cgggctct
B D           Squirrel monkey  agct-----------------------------ttctcc----caggctct
B D                  Bushbaby  agttcaatccctgcgtggttacaaaatgcag-gccctcc----caggctct
           Chinese tree shrew  agcttcattcttgcctaataatgaaccacggcaccctcc-----cagtttg
B D                  Squirrel  agct-----------------------------catctt-----gg-----
                 Prairie vole  agct-----------------------------tcctct-----gggttct
B D           Chinese hamster  agct-----------------------------ccctct-----gggttct
               Golden hamster  agtt-----------------------------ccctct-----gggttct
B D                     Mouse  aatt-----------------------------ccctct-----gggttct
B D                       Rat  agct-----------------------------tcctct-----gggttct
B D            Naked mole-rat  ggct-----------------------------------------ggccca
                   Chinchilla  ggct-----------------------------------------ggctcc
             Brush-tailed rat  ggct-----------------------------------------ggcaca
B D                    Alpaca  ggct-----------------------------ccgtccagggagggtcct
               Bactrian camel  agct-----------------------------ccgtccagggagggtcct
B D                   Dolphin  agct-----------------------------ccctct-----gggtcct
                 Killer whale  agct-----------------------------ccctct-----gggtcct
B D                     Horse  agct-----------------------------ccctcc----cgggtcct
B D          White rhinoceros  agct-----------------------------ccctcc----caggtcct
B D                       Cat  agct-----------------------------ttctta----caggttgt
B D                       Dog  agct-----------------------------ccttcc----caggttgt
B D                   Ferret   agct-----------------------------ctctcc----caagttga
B D                     Panda  agct-----------------------------ccctcc----caggttga
               Pacific walrus  ag---------------------------------ctca----caggtcga
                 Weddell seal  ag---------------------------------ctca----cagctcaa
             Black flying-fox  ag-t-----------------------------ctctcc----tgacttct
B D                   Megabat  ag-t-----------------------------ctctcc----tggcttct
B D                  Elephant  agtt-----------------------------ccctcc----tgggttca
B D                   Manatee  agct-----------------------------ccttcc----cgggttcc
             Cape golden mole  agct-----------------------------ccct-c----taggtttt
                     Aardvark  ----------------------------------cctcc----caggttct
B D                 Armadillo  ggct-----------------------------ccct-c----cgggctcc
             Star-nosed mole  ===================================================
         Cape elephant shrew  ===================================================
B D                  Hedgehog  ===================================================
               Big brown bat  ===================================================
B D                  Microbat  ===================================================
        David's myotis (bat)  ===================================================
B D                    Turkey  ===================================================
      Lesser Egyptian jerboa  ===================================================
B D                    Tenrec  ===================================================
B D                Guinea pig  ===================================================
B D                    Rabbit  ===================================================
               Domestic goat  ===================================================
B D                      Pika  ===================================================
B D                     Sheep  ===================================================
B D                       Cow  ===================================================
            Tibetan antelope  ===================================================
  D          Peregrine falcon  ===================================================
B D                    Lizard  ===================================================
          Tibetan ground jay  ===================================================
  D              Mallard duck  ===================================================
B D       Medium ground finch  ===================================================
  D    White-throated sparrow  ===================================================
  D             Scarlet macaw  ===================================================
  D       Collared flycatcher  ===================================================
  D              Saker falcon  ===================================================
B D                Budgerigar  ===================================================
B D           Tasmanian devil  ===================================================
B D                  Platypus  ===================================================
B D               Zebra finch  ===================================================
  D           Green seaturtle  ===================================================
B D                   Chicken  ===================================================
B D        American alligator  ===================================================
B D             X. tropicalis  ===================================================
  D               Rock pigeon  ===================================================
B D                   Opossum  ===================================================
  D  Chinese softshell turtle  ===================================================
  D            Painted turtle  ===================================================
B D                       Pig  ===================================================

Alignment block 16 of 199 in window, 11576947 - 11576983, 37 bps 
B D                     Human  ga---tgcca-----ttaatgac----tgcaggaagctgttccaggcct
B D                     Chimp  ga---tgcca-----ttaatgac----tgcaggaagctgttccaggcct
B D                   Gorilla  ga---tgcca-----ttaatgac----tgcaggaagctgttccaggcct
B D                 Orangutan  ga---tgcca-----ttggtgag----tgccggaagctgttccaggcct
B D                    Gibbon  ga---tgcca-----ttaatgag----tgcaggaagctgtcccaggcct
B D                    Rhesus  ga---tgcca-----ttgatgag----tgcaggaagattttccaggcct
B D       Crab-eating macaque  ga---tgcca-----ttgataag----tgcaggaagcttttccaggcct
B D                    Baboon  ga---tgcca-----ttgatgag----tgcaggaagcttttccaggcct
B D              Green monkey  ga---tgcca-----ttgatgag----tgcaggaagcttttccaggcct
B D                  Marmoset  ga---tgcca-----ttgacgag----tgcaggaagctgtt-----cct
B D           Squirrel monkey  ga---tgcca-----ttgatgag----tgcaggaagctattctaggcct
B D                  Bushbaby  ga---tg-----------gtgag----gacaggaagccgctgtagccct
           Chinese tree shrew  gg---tgcca-----tttatgag----tgaaggaatctgttctgggcca
B D                  Squirrel  ----------------ttttgag----gacaggaggcttttccccgcct
                 Prairie vole  gc---tgtca-----tttctgtgtggaaggaagatggtgtcccagacct
B D           Chinese hamster  gc---tgcca-----tttctgag----gggaagatggtgtccc-tattt
               Golden hamster  gc---tgcca-----tttctgag----gcgaagatggtgtccc-tatct
B D                     Mouse  gc---tgcca-----tttctgag----aggcagatggtgttctacagct
B D                       Rat  gc---tgcca-----tttctaag----aggtagatggtgttccatgtct
B D            Naked mole-rat  ca---ggc-------------------aggaggaccc-------catgt
                   Chinchilla  gc---tgcac----------ggg----agggggaccctgtgtggcatct
             Brush-tailed rat  gc---tgctc-----------------aggaggaccctgtatggcatct
B D                    Rabbit  gc---tgcctcccaccttaggag----ttaagcaagctgctcaaggtc-
B D                    Alpaca  ga---tgcca-----cctgtgag----cagagcgagctgttccaggcct
               Bactrian camel  ga---tgcca-----cctgtgag----cagagcgagctgttccaggcct
B D                   Dolphin  aa---tgcta----tttttttag----tggacgaagctgtcccaggcct
                 Killer whale  aa---tgcta----tttttttag----tggacgaagctgtcccaggcct
B D                     Horse  ca---cgcca-----tttgtgag----tggaggaagctgttccaggctt
B D          White rhinoceros  ca---tgcca-----tttgtgag----tggaggaagctctttcgggcct
B D                       Cat  aa---tgtca-----tttgcagg----tggggaaagttgttgcaggctt
B D                       Dog  ga---tgcca-----tttgccgg----tggggaaagctgttgtaggccc
B D                   Ferret   ga---cgcca-----tttgggca----tgcagaaagttgttagaggcct
B D                     Panda  gatgccgcca-----tttgcaag----gggggagagctgttgcaggcct
               Pacific walrus  ga---cgcca-----tctgcaag----gggggagagctattgcaggccc
                 Weddell seal  ga---cgcca-----tttgaaag----ggggggtagctattgcaggccc
             Black flying-fox  ga---ggaca-----tttggaag----tggaggaagctgtttccggcct
B D                   Megabat  ga---ggcca-----tttggaag----tggaggaagctgtttctatcct
B D                  Elephant  gg---tacca-----tttatgaa----tagaagaagctgttccaggctt
B D                   Manatee  gg---tacca-----tttatgag----tggaggaagctcttccaggctt
             Cape golden mole  gg---agtcc-----tata-gga----tagagaaagctcttcaaggctt
                     Aardvark  gg---tacca-----tttatgag----taaaggaagctgttcaagttt-
B D                 Armadillo  ag---cgtcc-----cc---ggg----tggcgcgagctgccccagcg--
             Star-nosed mole  =================================================
         Cape elephant shrew  =================================================
B D                  Hedgehog  =================================================
               Big brown bat  =================================================
B D                  Microbat  =================================================
        David's myotis (bat)  =================================================
B D                    Turkey  =================================================
      Lesser Egyptian jerboa  =================================================
B D                    Tenrec  =================================================
B D                Guinea pig  =================================================
               Domestic goat  =================================================
B D                      Pika  =================================================
B D                     Sheep  =================================================
B D                       Cow  =================================================
            Tibetan antelope  =================================================
  D          Peregrine falcon  =================================================
B D                    Lizard  =================================================
          Tibetan ground jay  =================================================
  D              Mallard duck  =================================================
B D       Medium ground finch  =================================================
  D    White-throated sparrow  =================================================
  D             Scarlet macaw  =================================================
  D       Collared flycatcher  =================================================
  D              Saker falcon  =================================================
B D                Budgerigar  =================================================
B D           Tasmanian devil  =================================================
B D                  Platypus  =================================================
B D               Zebra finch  =================================================
  D           Green seaturtle  =================================================
B D                   Chicken  =================================================
B D        American alligator  =================================================
B D             X. tropicalis  =================================================
  D               Rock pigeon  =================================================
B D                   Opossum  =================================================
  D  Chinese softshell turtle  =================================================
  D            Painted turtle  =================================================
B D                       Pig  =================================================

Inserts between block 16 and 17 in window
B D                   Alpaca 2bp
              Bactrian camel 34bp

Alignment block 17 of 199 in window, 11576984 - 11576989, 6 bps 
B D                     Human  caatac
B D                     Chimp  caacac
B D                   Gorilla  caacac
B D                 Orangutan  caacac
B D                    Gibbon  cgacac
B D                    Rhesus  caacac
B D       Crab-eating macaque  caacac
B D                    Baboon  caacac
B D              Green monkey  caacac
B D                  Marmoset  caacag
B D           Squirrel monkey  caacac
B D                  Bushbaby  cagcat
           Chinese tree shrew  caacct
B D                  Squirrel  cgacac
                 Prairie vole  cagcat
B D           Chinese hamster  cagcat
               Golden hamster  cagcat
B D                     Mouse  aagcac
B D                       Rat  aagcac
B D            Naked mole-rat  cagggc
                   Chinchilla  cagggc
             Brush-tailed rat  caggga
B D                    Rabbit  cagcgt
B D                    Alpaca  caacct
               Bactrian camel  cagcct
B D                   Dolphin  cagcct
                 Killer whale  cagcct
B D                     Horse  cagcat
B D          White rhinoceros  cagcat
B D                       Cat  cagcat
B D                       Dog  cagtat
B D                   Ferret   cagcac
B D                     Panda  cagcat
               Pacific walrus  cagcat
                 Weddell seal  cagcat
             Black flying-fox  caatat
B D                   Megabat  cagtat
B D                  Elephant  cattgc
B D                   Manatee  caatgt
             Cape golden mole  caaaac
B D                    Tenrec  catggc
                     Aardvark  caatgt
B D                 Armadillo  cagggc
             Star-nosed mole  ======
         Cape elephant shrew  ======
B D                  Hedgehog  ======
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                    Turkey  ======
      Lesser Egyptian jerboa  ======
B D                Guinea pig  ======
               Domestic goat  ======
B D                      Pika  ======
B D                     Sheep  ======
B D                       Cow  ======
            Tibetan antelope  ======
  D          Peregrine falcon  ======
B D                    Lizard  ======
          Tibetan ground jay  ======
  D              Mallard duck  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
  D       Collared flycatcher  ======
  D              Saker falcon  ======
B D                Budgerigar  ======
B D           Tasmanian devil  ======
B D                  Platypus  ======
B D               Zebra finch  ======
  D           Green seaturtle  ======
B D                   Chicken  ======
B D        American alligator  ======
B D             X. tropicalis  ======
  D               Rock pigeon  ======
B D                   Opossum  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
B D                       Pig  ======

Inserts between block 17 and 18 in window
B D                   Rabbit 5bp
B D                      Dog 228bp

Alignment block 18 of 199 in window, 11576990 - 11576993, 4 bps 
B D                     Human  agaa
B D                     Chimp  agaa
B D                   Gorilla  agaa
B D                 Orangutan  agaa
B D                    Gibbon  agaa
B D                    Rhesus  agaa
B D       Crab-eating macaque  agaa
B D                    Baboon  agaa
B D              Green monkey  agaa
B D                  Marmoset  ag--
B D           Squirrel monkey  agca
B D                  Bushbaby  agag
           Chinese tree shrew  aaaa
B D                  Squirrel  ag--
                 Prairie vole  ag--
B D           Chinese hamster  ag--
               Golden hamster  aa--
B D                     Mouse  ag--
B D                       Rat  ag--
B D            Naked mole-rat  ag--
                   Chinchilla  at--
             Brush-tailed rat  gg--
B D                    Rabbit  gg--
B D                    Alpaca  agaa
               Bactrian camel  agaa
B D                   Dolphin  agaa
                 Killer whale  agaa
B D                     Horse  agaa
B D          White rhinoceros  agga
B D                       Cat  agag
B D                       Dog  agaa
B D                   Ferret   agaa
B D                     Panda  agaa
               Pacific walrus  agaa
                 Weddell seal  agaa
             Black flying-fox  agaa
B D                   Megabat  agaa
B D                  Elephant  agaa
B D                   Manatee  agaa
             Cape golden mole  acaa
B D                    Tenrec  a---
                     Aardvark  agaa
B D                 Armadillo  ggg-
             Star-nosed mole  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Turkey  ====
      Lesser Egyptian jerboa  ====
B D                Guinea pig  ====
               Domestic goat  ====
B D                      Pika  ====
B D                     Sheep  ====
B D                       Cow  ====
            Tibetan antelope  ====
  D          Peregrine falcon  ====
B D                    Lizard  ====
          Tibetan ground jay  ====
  D              Mallard duck  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D             Scarlet macaw  ====
  D       Collared flycatcher  ====
  D              Saker falcon  ====
B D                Budgerigar  ====
B D           Tasmanian devil  ====
B D                  Platypus  ====
B D               Zebra finch  ====
  D           Green seaturtle  ====
B D                   Chicken  ====
B D        American alligator  ====
B D             X. tropicalis  ====
  D               Rock pigeon  ====
B D                   Opossum  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
B D                       Pig  ====

Inserts between block 18 and 19 in window
            Cape golden mole 838bp

Alignment block 19 of 199 in window, 11576994 - 11577021, 28 bps 
B D                     Human  agaaccc--ttagaccctcagagct-ggagg
B D                     Chimp  agaaccc--ttaga-cctcagagct-ggagg
B D                   Gorilla  agaaccc--ttagatcctcagagct-ggagg
B D                 Orangutan  agaaccc--ttagaccttcagagct-ggagg
B D                    Gibbon  agaaccc--ttagaccctcagagct-ggagg
B D                    Rhesus  agaaccc--ttagaccctcagagct-ggagg
B D       Crab-eating macaque  agaaccc--ttagaccctcagagct-ggagg
B D                    Baboon  agaaccc--ttagaccctcagagct-ggagg
B D              Green monkey  agaactc--ttagaccctcagagct-ggagg
B D                  Marmoset  aggaccg--ttagatgctcagagctgggagg
B D           Squirrel monkey  aggaccc--ttagatgctcagagctgggacg
B D                  Bushbaby  aggacct--ttagactctcagagct-gggg-
           Chinese tree shrew  agaaccc--ctgtgtattcatagct-caggg
B D                  Squirrel  ---acac--ttagatccttggagtt-ggagg
                 Prairie vole  ---accc--ttaggccctcagtact-ggagg
B D           Chinese hamster  ---accc--tta-gccccccctact-ggagg
               Golden hamster  ---accc--ttaggccctccatgcc-ggagg
B D                     Mouse  ---accc--ttagaccctcagtgcg-ggagg
B D                       Rat  ---accc--ttagaccctcagtgat-ggagg
B D            Naked mole-rat  -----------------------tt-ggagg
                   Chinchilla  -----------------------ct-gagag
             Brush-tailed rat  -----------------------ct-atgag
B D                    Rabbit  ---accc--tccgagcctcagagca-ggagg
B D                    Alpaca  aggaccc--tcaggccggcagagct-ggcag
               Bactrian camel  aggaccc--tcagaccagcagagtt-ggcgg
B D                   Dolphin  aggaccc--ttagaccatcagacct-ggaga
                 Killer whale  aggaccc--ttagaccatcagacct-ggaga
B D                     Horse  aggaccc--ttagacc---------------
B D          White rhinoceros  aggaccc--ttagactgtcagagct-ggagg
B D                       Cat  ggggcct--ttagaccttcagagtt-ggaaa
B D                       Dog  gggaccc--atagactgtcagagct-ggaaa
B D                   Ferret   gggaccc--ttatgccatcagagca-ggaaa
B D                     Panda  gggaccc--ttagaccttcagagcc-gtaaa
               Pacific walrus  gggaccc--ttagactgtcagagct-ggaaa
                 Weddell seal  gggaccc--tcagactgtcagagct-ggaaa
             Black flying-fox  aggaccc--ttagaacatcagagct-ggagg
B D                   Megabat  aggaccc--ttagaacatcagagct-ggagg
B D                  Elephant  agggtcc--ttagactatcagagct-ggagg
B D                   Manatee  aggatcc--ttagaccatcagagct-ggagg
B D                    Tenrec  aggattc---taaactgtcagagct-aggga
                     Aardvark  aggatccttttagattgtcagagct-ggagg
B D                 Armadillo  -ggctcc-cttagaccctcagcgct-ggggg
             Star-nosed mole  ===============================
         Cape elephant shrew  ===============================
B D                  Hedgehog  ===============================
               Big brown bat  ===============================
B D                  Microbat  ===============================
        David's myotis (bat)  ===============================
B D                    Turkey  ===============================
      Lesser Egyptian jerboa  ===============================
B D                Guinea pig  ===============================
               Domestic goat  ===============================
B D                      Pika  ===============================
B D                     Sheep  ===============================
B D                       Cow  ===============================
            Tibetan antelope  ===============================
  D          Peregrine falcon  ===============================
B D                    Lizard  ===============================
          Tibetan ground jay  ===============================
  D              Mallard duck  ===============================
B D       Medium ground finch  ===============================
  D    White-throated sparrow  ===============================
            Cape golden mole  ===============================
  D             Scarlet macaw  ===============================
  D       Collared flycatcher  ===============================
  D              Saker falcon  ===============================
B D                Budgerigar  ===============================
B D           Tasmanian devil  ===============================
B D                  Platypus  ===============================
B D               Zebra finch  ===============================
  D           Green seaturtle  ===============================
B D                   Chicken  ===============================
B D        American alligator  ===============================
B D             X. tropicalis  ===============================
  D               Rock pigeon  ===============================
B D                   Opossum  ===============================
  D  Chinese softshell turtle  ===============================
  D            Painted turtle  ===============================
B D                       Pig  ===============================

Inserts between block 19 and 20 in window
B D                 Squirrel 7bp
                Prairie vole 8bp
B D          Chinese hamster 8bp
              Golden hamster 8bp
B D                    Mouse 8bp
B D                      Rat 8bp
                  Chinchilla 7bp
            Brush-tailed rat 15bp
B D                   Rabbit 9bp
B D                   Alpaca 9bp
              Bactrian camel 9bp
B D                  Dolphin 9bp
                Killer whale 9bp
B D                    Horse 8bp
B D         White rhinoceros 9bp
B D                      Cat 7bp
B D                      Dog 9bp
B D                  Ferret  9bp
B D                    Panda 9bp
              Pacific walrus 9bp
                Weddell seal 16bp
            Black flying-fox 9bp
B D                  Megabat 9bp

Alignment block 20 of 199 in window, 11577022 - 11577089, 68 bps 
B D                     Human  -------tgtgcagactggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D                     Chimp  -------tgtgcagactggtc----------tctgcctgggctcaa-------------cctc--tgg--
B D                   Gorilla  -------tgtgcagactggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D                 Orangutan  -------tgtgcagagtggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D                    Gibbon  -------tgtgcagagtggtc----------tgtgcctggcctcaa-------------cctc--tgt--
B D                    Rhesus  -------cgtgcagagaggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D       Crab-eating macaque  -------cgtgcagagaggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D                    Baboon  -------tgtgcagagaggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D              Green monkey  -------tgtgcagagaggtc----------tctgcctgggctcaa-------------cctc--tgt--
B D                  Marmoset  -------ggcgcagagtggtc----------tctgcctgagctcaa-------------agtc--tg---
B D           Squirrel monkey  -------ggcacagagtggtc----------tctgcctgagctcaa-------------agtc--ag---
B D                  Bushbaby  --------gctcagagtttcccccacctacatcggcctgggctcag-------------cttc--tgt--
           Chinese tree shrew  -------ttcccttgattgct----------tctgcctggactcga-------------cctc--cgtgg
B D                  Squirrel  -------gcctccctgtcagt----------cc-----------------------------c--cat--
                 Prairie vole  -------gtcctcaggtcact----------tctgtaaacattcaa-------------actc--tgg--
B D           Chinese hamster  -------gtcccctggtcact----------tctgtagacatccaa-------------actc--tgg--
               Golden hamster  -------gtcccctggtcact----------tctgcagacactcga-------------actc--tgg--
B D                     Mouse  -------gtcccttggtcatt----------tctgtagacatttaa-------------g--c--tgg--
B D                       Rat  -------gtcccctggtcacg----------tctgtagacattcaa-------------actc--tgg--
B D            Naked mole-rat  ----------ccctggg-act----------tgggatgaa----------------------t--gga--
             Brush-tailed rat  ------------------------------------agag----------------------t--gga--
B D                    Rabbit  -------tctgcctaatc-----------------catggcttcaa-------------actc--tgc--
B D                    Alpaca  -------ctcccctaatctct----------cctgcccaggcccga-------------cctc--tgtgt
               Bactrian camel  -------ctcccctaatctct----------cctgcccaggcccga-------------cctc--tgtgt
B D                   Dolphin  -------ctcccctaatctcc----------cctgcttgggtccaa-------------cctt--tgtgt
                 Killer whale  -------ctcccctaatctcc----------cctgcctgggtccaa-------------cctt--tgtgt
B D                     Horse  -------ttcccctcatctct----------tcgacctgggcccaa-------------tctc--tgtgt
B D          White rhinoceros  -------ttcccctgatctct----------tttgcctgggcccga-------------cctc--tgtgt
B D                       Cat  -------ttcccctaatctct----------tgtgcctgggcccaa-------------cctc--caagc
B D                       Dog  -------ttcccacaatctct----------tctacctgtgcccaa-------------cctc--caagt
B D                   Ferret   -------ttcccctaatctct----------tctgcctgggcccaa-------------cccc--caagc
B D                     Panda  -------ttcccctagtctct----------tctgcctgggcctaa-------------tccc--caagt
               Pacific walrus  -------ctcccctaatatct----------tctgcctgggcccaa-------------cctc--caagt
                 Weddell seal  -------ctcccctaatctct----------tctgcctgggcccaa-------------cctc--caagt
             Black flying-fox  -------tctccctaatctct-------------gtctgggcccaa-------------cctctgtgtgt
B D                   Megabat  -------tccccctaatctct-------------gtctgggcccaa-------------cctc--tgtgt
B D                  Elephant  gctcagagttccctaatctct----------tctgcctgggatcagatccctggctcaacctc--tgtgt
B D                   Manatee  gctcagagtcccctaatttct----------tctgcctggaatcagaaccctggctcaacctc--tgtgt
B D                    Tenrec  gctcagaggtccctaaactct----------tctgccagggatcag-------------tctc--tgggt
                     Aardvark  gctcagagttccctaatcttt----------tctggctgggctcat-accctggctcatcctc--tatgt
B D                 Armadillo  ggccggg---cccccagctcc----------tccacctggga-cag-gccccggctcggcctc--ggtgg
             Star-nosed mole  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Turkey  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
               Domestic goat  ======================================================================
B D                      Pika  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                    Lizard  ======================================================================
          Tibetan ground jay  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
            Cape golden mole  ======================================================================
  D             Scarlet macaw  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D        American alligator  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================

                        Human  gatttct----------ggcaagttactgaaatt-ctctgtgc
                        Chimp  gatttct----------ggcaagttactgaaatt-ctctgtgc
                      Gorilla  gatttct----------ggcaagttactgaattt-ctctgtgc
                    Orangutan  gatttct----------ggcaagttactgaaatt-ctctgtgc
                       Gibbon  gacttct----------ggcaagttactgaaatt-ctctgtgc
                       Rhesus  gatttct----------ggcaagttactgaaatt-ctctgtgc
          Crab-eating macaque  gatttct----------ggcaagttactgaaatt-ctctgtgc
                       Baboon  gatttct----------ggcaagttactgaaatt-ctctgtgc
                 Green monkey  gatttct----------ggcaagttactgaaatt-ctctgtgc
                     Marmoset  -------------------------------------tgattc
              Squirrel monkey  -------------------------gcagagatt-cctgattc
                     Bushbaby  gctccat----------ggcaagttgcctaaa-t-cgctgcgc
           Chinese tree shrew  gattttg----------agcgagttctctaaatt-ctctctgc
                     Squirrel  ggtttct----------ggcaagttgagtaaatg-ctttgtgt
                 Prairie vole  gcttttt----------agt-tgacatccaaatacctttgcac
              Chinese hamster  gctttct----------agc-tgtcatccaaatacttttgcac
               Golden hamster  gctttct----------agc-tgtcacccaaatacttttgcac
                        Mouse  gatttct----------ag--ggtcatccaaatg-tgttgcat
                          Rat  gatttct---------------gttatctgaata-ttttgcat
               Naked mole-rat  gcgtcct------------------------------------
             Brush-tailed rat  gcctcct------------------------------------
                       Rabbit  aattttt----------cgcaagttatctaaattctcttt---
                       Alpaca  gctttct----------ggcaagttacctaaatt-ctccaggc
               Bactrian camel  gctttct----------ggcaagttacctaaatt-ctccaggc
                      Dolphin  gctctcc----------agcaagtcacctaaatt-ctctgtgc
                 Killer whale  gctctcc----------agcaagtcaccgaaatt-ctctgtgc
                        Horse  ggcttct----------ggcaagttacctaaatt-ctttgtgc
             White rhinoceros  ggtttct----------gggaaattacgtaattt-ccctgtgc
                          Cat  aatcgct----------ggcaacttacctagatt-ctctgtgc
                          Dog  aattgct----------ggcaagtgttctagatt-ctctgtac
                      Ferret   aattgct----------ggcaagttacctagatt-ctctgtgc
                        Panda  aattgct----------ggcaaattacctagatt-ctctgtgc
               Pacific walrus  aattgct----------ggcaagttacctagatt-ctctgtgc
                 Weddell seal  aattgct----------ggcaagttacctagatt-ctctgtgc
             Black flying-fox  ggtttct----------ggaaagttacctaaatt-ctctgtta
                      Megabat  ggtttct----------ggaaagttacccaaatt-ctctgtta
                     Elephant  gacttca----------ggcaagttacataaatt-ctctatgc
                      Manatee  gacttca----------agcaagttacctaaatt-ctctgtgc
                       Tenrec  gacttca----------ggcaagttacctgggtt-ccctgtgc
                     Aardvark  gacttca----------gccaagttacctaaatt-ctctgtac
                    Armadillo  gacctcggtgggacctcggcgcgtcacctcggct-ctgcacac
              Star-nosed mole  ===========================================
          Cape elephant shrew  ===========================================
                     Hedgehog  ===========================================
                Big brown bat  ===========================================
                     Microbat  ===========================================
         David's myotis (bat)  ===========================================
                       Turkey  ===========================================
       Lesser Egyptian jerboa  ===========================================
                   Chinchilla  ===========================================
                   Guinea pig  ===========================================
                Domestic goat  ===========================================
                         Pika  ===========================================
                        Sheep  ===========================================
                          Cow  ===========================================
             Tibetan antelope  ===========================================
             Peregrine falcon  ===========================================
                       Lizard  ===========================================
           Tibetan ground jay  ===========================================
                 Mallard duck  ===========================================
          Medium ground finch  ===========================================
       White-throated sparrow  ===========================================
             Cape golden mole  ===========================================
                Scarlet macaw  ===========================================
          Collared flycatcher  ===========================================
                 Saker falcon  ===========================================
                   Budgerigar  ===========================================
              Tasmanian devil  ===========================================
                     Platypus  ===========================================
                  Zebra finch  ===========================================
              Green seaturtle  ===========================================
                      Chicken  ===========================================
           American alligator  ===========================================
                X. tropicalis  ===========================================
                  Rock pigeon  ===========================================
                      Opossum  ===========================================
     Chinese softshell turtle  ===========================================
               Painted turtle  ===========================================
                          Pig  ===========================================

Alignment block 21 of 199 in window, 11577090 - 11577113, 24 bps 
B D                     Human  ct-cag-gt--------------------------------ttcttttatgaaaatta
B D                     Chimp  ct-cag-gt--------------------------------ttcttttatgaaaatta
B D                   Gorilla  ct-cag-gt--------------------------------ttcttttatgaaaatta
B D                 Orangutan  ct-cag-gt--------------------------------ttcttttatgaaaatta
B D                    Gibbon  ct-cag-gt--------------------------------ttcttttatgaaaattt
B D                    Rhesus  ct-cag-gt--------------------------------ttctcttatgaaaatta
B D       Crab-eating macaque  ct-cag-gt--------------------------------ttctcttatgaaaatta
B D                    Baboon  ct-cag-gt--------------------------------ttctcttatgaaaatta
B D              Green monkey  ct-cag-gt--------------------------------ttctcttatgaaaatta
B D                  Marmoset  ct-cag-ct--------------------------------ttctcttatgaaaatta
B D           Squirrel monkey  ct-cag-ct--------------------------------ttctcttatgaaaatta
B D                  Bushbaby  ct---g-tt--------------------------------ttctcttatgaaaacta
           Chinese tree shrew  ct-cagtgg--------------------------------ttttattatgaaaact-
B D                  Squirrel  -c-tca-gt--------------------------------ttttcattt--caattt
                 Prairie vole  -t-ctg-gt--------------------------------ttttagttt--agacta
B D           Chinese hamster  -c-ctg-gt--------------------------------ttttagtttggagacta
               Golden hamster  -c-ctg-gt--------------------------------ttttagtttggagac--
B D                     Mouse  -a-ttg-gtgtttagtttttagtttagtttagtttagtttagtttagtt---------
B D                       Rat  -a-ttg-gt--------------------------------atttagtt---------
B D            Naked mole-rat  ct-cag-tt--------------------------------ttctactgtgcaagctc
B D                Guinea pig  ct-cgg-ct--------------------------------ttctcacgtggaaactc
             Brush-tailed rat  ct-cag-gg--------------------------------tcctcatgtgcaaactc
B D                    Alpaca  ct-ctg-tt--------------------------------ttctcttgtgaaaactg
               Bactrian camel  tt-ctg-tt--------------------------------ttctcttgtgaaaactg
B D                   Dolphin  ct-ccg-gt--------------------------------ttctcttgggaaaattg
                 Killer whale  ct-ccg-gt--------------------------------ttctcttgggaaaattg
B D                     Horse  ct-cag-tt--------------------------------ta--ctcgtgaaaattg
B D          White rhinoceros  ct-cag-tt--------------------------------tactctcatgaaaactg
B D                       Cat  ct-cag-tt--------------------------------tcctcttgtgcaaattg
B D                       Dog  ctccat-tt--------------------------------ttctcttgtgcaaattg
B D                   Ferret   tt-cag-tt--------------------------------ttctcttgggcaatttg
B D                     Panda  ct---g-tt--------------------------------ttctctagtgcaaatgg
               Pacific walrus  ct-cag-tt--------------------------------ttctcttgtgccaatta
                 Weddell seal  ct-cag-tt--------------------------------ttcttttgtgccattta
             Black flying-fox  ctgcag-tt--------------------------------ttctcttgtagaagtta
B D                   Megabat  ctgcag-tt--------------------------------ttctcttatagaagtta
B D                  Elephant  ct-tag-tt--------------------------------ttctcttatgaaatta-
B D                   Manatee  tt-tag-tt--------------------------------ttctattatgaaatta-
B D                    Tenrec  ct-ttg-tt--------------------------------ttctcttacgaagttc-
                     Aardvark  ct-tac-tt--------------------------------ttctcttaggaaatta-
B D                 Armadillo  ct-ccg-tt--------------------------------ttctcttttaacatcg-
             Star-nosed mole  ==========================================================
         Cape elephant shrew  ==========================================================
B D                  Hedgehog  ==========================================================
               Big brown bat  ==========================================================
B D                  Microbat  ==========================================================
        David's myotis (bat)  ==========================================================
B D                    Turkey  ==========================================================
      Lesser Egyptian jerboa  ==========================================================
                  Chinchilla  ==========================================================
B D                    Rabbit  ----------------------------------------------------------
               Domestic goat  ==========================================================
B D                      Pika  ==========================================================
B D                     Sheep  ==========================================================
B D                       Cow  ==========================================================
            Tibetan antelope  ==========================================================
  D          Peregrine falcon  ==========================================================
B D                    Lizard  ==========================================================
          Tibetan ground jay  ==========================================================
  D              Mallard duck  ==========================================================
B D       Medium ground finch  ==========================================================
  D    White-throated sparrow  ==========================================================
            Cape golden mole  ==========================================================
  D             Scarlet macaw  ==========================================================
  D       Collared flycatcher  ==========================================================
  D              Saker falcon  ==========================================================
B D                Budgerigar  ==========================================================
B D           Tasmanian devil  ==========================================================
B D                  Platypus  ==========================================================
B D               Zebra finch  ==========================================================
  D           Green seaturtle  ==========================================================
B D                   Chicken  ==========================================================
B D        American alligator  ==========================================================
B D             X. tropicalis  ==========================================================
  D               Rock pigeon  ==========================================================
B D                   Opossum  ==========================================================
  D  Chinese softshell turtle  ==========================================================
  D            Painted turtle  ==========================================================
B D                       Pig  ==========================================================

Alignment block 22 of 199 in window, 11577114 - 11577124, 11 bps 
B D                     Human  t------------aa------cag-tttta
B D                     Chimp  t------------aa------cag-tttta
B D                   Gorilla  t------------aa------cag-tttta
B D                 Orangutan  t------------aa------tagttttta
B D                    Gibbon  t------------aa------cag-tttta
B D                    Rhesus  t------------aa------cag-tttta
B D       Crab-eating macaque  t------------aa------cag-tttta
B D                    Baboon  t------------aa------cag-tttta
B D              Green monkey  t------------aa------cag-tttta
B D                  Marmoset  a------------aa------cag-tttta
B D           Squirrel monkey  a------------aa------cag-tttta
B D                  Bushbaby  t------------aa------tag-tttta
           Chinese tree shrew  -------------aa------tgg-tctta
B D                  Squirrel  t-----------------------------
                 Prairie vole  t-----------------------------
B D           Chinese hamster  t-----------------------------
               Golden hamster  t-----------------------------
B D            Naked mole-rat  agaccattcttct-----------------
B D                Guinea pig  a----------ca-----------------
             Brush-tailed rat  a-attgctcctct-----------------
B D                    Alpaca  c------------aat-----cac-ttctg
               Bactrian camel  c------------aat-----cac-ttctg
B D                   Dolphin  t------------agttcgtcccg-tcctg
                 Killer whale  t------------agttcgtcccg-tcctg
B D                     Horse  t------------ag------tag-ttccg
B D          White rhinoceros  t------------ag------tag-ttcca
B D                       Cat  t------------ag------cca-ctcca
B D                       Dog  t------------ag------ttt-gc---
B D                   Ferret   t------------ag------cag-cccca
B D                     Panda  t------------ag------cag-cccca
               Pacific walrus  t------------ag------cag-cccca
                 Weddell seal  t------------ag------cag-cccca
             Black flying-fox  c------------ag------tag-gccta
B D                   Megabat  c------------gg------tag-gtcta
B D                  Elephant  ------------caa------taa-ttcta
B D                   Manatee  ------------taa------taa-ttcta
             Cape golden mole  ------------taa------cag-caaca
B D                    Tenrec  ------------taa------gaa-ttcta
                     Aardvark  ------------taa------gaa-ttcta
B D                 Armadillo  -------------cg------gcg-gtcac
             Star-nosed mole  ==============================
B D                       Rat  ------------------------------
B D                     Mouse  ------------------------------
         Cape elephant shrew  ==============================
B D                  Hedgehog  ==============================
               Big brown bat  ==============================
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
B D                    Turkey  ==============================
      Lesser Egyptian jerboa  ==============================
                  Chinchilla  ==============================
B D                    Rabbit  ------------------------------
               Domestic goat  ==============================
B D                      Pika  ==============================
B D                     Sheep  ==============================
B D                       Cow  ==============================
            Tibetan antelope  ==============================
  D          Peregrine falcon  ==============================
B D                    Lizard  ==============================
          Tibetan ground jay  ==============================
  D              Mallard duck  ==============================
B D       Medium ground finch  ==============================
  D    White-throated sparrow  ==============================
  D             Scarlet macaw  ==============================
  D       Collared flycatcher  ==============================
  D              Saker falcon  ==============================
B D                Budgerigar  ==============================
B D           Tasmanian devil  ==============================
B D                  Platypus  ==============================
B D               Zebra finch  ==============================
  D           Green seaturtle  ==============================
B D                   Chicken  ==============================
B D        American alligator  ==============================
B D             X. tropicalis  ==============================
  D               Rock pigeon  ==============================
B D                   Opossum  ==============================
  D  Chinese softshell turtle  ==============================
  D            Painted turtle  ==============================
B D                       Pig  ==============================

Inserts between block 22 and 23 in window
B D                 Marmoset 292bp
B D          Squirrel monkey 293bp

Alignment block 23 of 199 in window, 11577125 - 11577146, 22 bps 
B D                     Human  tctcctagggttatggtgaata
B D                     Chimp  tctcctagggttatggtgaata
B D                   Gorilla  tctcctagggttatggtgaata
B D                 Orangutan  tctcctagggttatggtgaata
B D                    Gibbon  tctcctaggtttatggtgaata
B D                    Rhesus  tctccgtgggttatggtgaata
B D       Crab-eating macaque  tctccgtgggttatggtgaata
B D                    Baboon  tctccatgggttatggtgaata
B D              Green monkey  tctccgtgggttatggtgaata
B D                  Bushbaby  tctcctcggcatattgtgaata
           Chinese tree shrew  tctcctagggttatagtgagta
B D                  Squirrel  ---------gttattgtgaata
                 Prairie vole  ---------a-tactccttcta
B D           Chinese hamster  ---------attactcctcctg
               Golden hamster  ---------attactcctccca
B D                     Mouse  -----------tagtcctccta
B D                       Rat  -----------tagtcctccta
B D            Naked mole-rat  gcctctctggttacttcgcata
B D                Guinea pig  gttcttctggttaccatgaaca
             Brush-tailed rat  gcttctctggttactgtgacta
B D                    Rabbit  -------------cttctttca
B D                    Alpaca  tctcctagggtgactgaggaca
               Bactrian camel  tctcctagggtgactgaggaca
B D                   Dolphin  tgtcctaggg------------
                 Killer whale  tgtcctaggg------------
B D                     Horse  tcttctagggttgttgagaata
B D          White rhinoceros  tctcctcgggtaattgagaata
B D                       Cat  tctcctgaggttactgggaatg
B D                       Dog  tccccgcagggagcaggga--g
B D                   Ferret   cctcttgaggttactgggaatg
B D                     Panda  tcttctgaggttactgggaatg
               Pacific walrus  tctcctgaggttactgagaatg
                 Weddell seal  tctcctgaggttactgagaatg
             Black flying-fox  tctcctggggttattgagaatc
B D                   Megabat  tctcctggggttattgagaatc
B D                  Elephant  tgtcctaaggttattgtaaaca
B D                   Manatee  tattctagggttattgtaaatg
             Cape golden mole  tc----agggttattgaaaaca
B D                    Tenrec  tctcctagagccattga-----
                     Aardvark  tcttctaggattcttgtaaaca
B D                 Armadillo  tcttctcgggcccctgtgggcg
             Star-nosed mole  ======================
         Cape elephant shrew  ======================
B D                  Hedgehog  ======================
               Big brown bat  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
B D                    Turkey  ======================
      Lesser Egyptian jerboa  ======================
                  Chinchilla  ======================
               Domestic goat  ======================
B D                      Pika  ======================
B D                     Sheep  ======================
B D                       Cow  ======================
            Tibetan antelope  ======================
  D          Peregrine falcon  ======================
B D                    Lizard  ======================
          Tibetan ground jay  ======================
  D              Mallard duck  ======================
B D       Medium ground finch  ======================
  D    White-throated sparrow  ======================
  D             Scarlet macaw  ======================
  D       Collared flycatcher  ======================
  D              Saker falcon  ======================
B D                Budgerigar  ======================
B D           Tasmanian devil  ======================
B D                  Platypus  ======================
B D               Zebra finch  ======================
  D           Green seaturtle  ======================
B D                   Chicken  ======================
B D        American alligator  ======================
B D                  Marmoset  ======================
B D             X. tropicalis  ======================
  D               Rock pigeon  ======================
B D           Squirrel monkey  ======================
B D                   Opossum  ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
B D                       Pig  ======================

Inserts between block 23 and 24 in window
B D                 Squirrel 3bp
                Prairie vole 19bp
B D          Chinese hamster 6bp
              Golden hamster 5bp
B D                    Mouse 11bp
B D                      Rat 11bp
B D                   Rabbit 5bp

Alignment block 24 of 199 in window, 11577147 - 11577149, 3 bps 
B D                     Human  cct-
B D                     Chimp  cct-
B D                   Gorilla  cct-
B D                 Orangutan  cct-
B D                    Gibbon  cct-
B D                    Rhesus  cct-
B D       Crab-eating macaque  cct-
B D                    Baboon  cct-
B D              Green monkey  cct-
B D                  Bushbaby  cct-
           Chinese tree shrew  ctt-
                 Prairie vole  cct-
B D            Naked mole-rat  ctt-
B D                Guinea pig  ttt-
             Brush-tailed rat  ttt-
B D                    Alpaca  -ct-
               Bactrian camel  -ct-
B D                     Horse  -cc-
B D          White rhinoceros  -cc-
B D                       Cat  -ct-
B D                       Dog  -ca-
B D                   Ferret   -ct-
B D                     Panda  -ct-
               Pacific walrus  -ct-
                 Weddell seal  -ct-
             Black flying-fox  -gt-
B D                   Megabat  -gt-
B D                  Elephant  -ctt
B D                   Manatee  -ctt
             Cape golden mole  -cgt
B D                    Tenrec  ---c
                     Aardvark  -ctg
B D                 Armadillo  -ctt
             Star-nosed mole  ====
B D                       Rat  ====
B D                     Mouse  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Turkey  ====
      Lesser Egyptian jerboa  ====
              Golden hamster  ====
B D           Chinese hamster  ====
                  Chinchilla  ====
B D                  Squirrel  ====
B D                    Rabbit  ====
               Domestic goat  ====
B D                      Pika  ====
B D                     Sheep  ====
B D                       Cow  ====
            Tibetan antelope  ====
                Killer whale  ----
  D          Peregrine falcon  ====
B D                    Lizard  ====
          Tibetan ground jay  ====
  D              Mallard duck  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D             Scarlet macaw  ====
  D       Collared flycatcher  ====
  D              Saker falcon  ====
B D                Budgerigar  ====
B D           Tasmanian devil  ====
B D                  Platypus  ====
B D               Zebra finch  ====
  D           Green seaturtle  ====
B D                   Chicken  ====
B D        American alligator  ====
B D                  Marmoset  ====
B D             X. tropicalis  ====
  D               Rock pigeon  ====
B D           Squirrel monkey  ====
B D                   Dolphin  ----
B D                   Opossum  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
B D                       Pig  ====

Inserts between block 24 and 25 in window
                Prairie vole 284bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 25 of 199 in window, 11577150 - 11577154, 5 bps 
B D                     Human  a-gggc
B D                     Chimp  a-gggc
B D                   Gorilla  a-gggc
B D                 Orangutan  a-gggc
B D                    Gibbon  a-gggc
B D                    Rhesus  a-gggc
B D       Crab-eating macaque  a-gggc
B D                    Baboon  a-gggc
B D              Green monkey  a-gggc
B D                  Bushbaby  g-gggc
           Chinese tree shrew  a-ggac
B D                  Squirrel  a-gggc
                 Prairie vole  g-agag
B D           Chinese hamster  g-aggc
               Golden hamster  a-agac
B D                     Mouse  a-gggt
B D                       Rat  a-gggt
B D            Naked mole-rat  a-aggc
B D                Guinea pig  a-gggc
             Brush-tailed rat  a-agga
B D                    Alpaca  a-g---
               Bactrian camel  a-g---
B D                     Horse  a-gagc
B D          White rhinoceros  a-gagc
B D                       Cat  a-gtgc
B D                       Dog  g-gagc
B D                   Ferret   a-gcac
B D                     Panda  a-gtgc
               Pacific walrus  a-gtgc
                 Weddell seal  a-gtgc
             Black flying-fox  t-gagt
B D                   Megabat  t-gagt
B D                  Elephant  ataaaa
B D                   Manatee  a-gaaa
             Cape golden mole  a-gaaa
B D                    Tenrec  a-gaaa
                     Aardvark  a-gaaa
B D                 Armadillo  a-gaga
             Star-nosed mole  ======
         Cape elephant shrew  ======
B D                  Hedgehog  ======
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                    Turkey  ======
      Lesser Egyptian jerboa  ======
                  Chinchilla  ======
B D                    Rabbit  ======
               Domestic goat  ======
B D                      Pika  ======
B D                     Sheep  ======
B D                       Cow  ======
            Tibetan antelope  ======
                Killer whale  ------
  D          Peregrine falcon  ======
B D                    Lizard  ======
          Tibetan ground jay  ======
  D              Mallard duck  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
  D       Collared flycatcher  ======
  D              Saker falcon  ======
B D                Budgerigar  ======
B D           Tasmanian devil  ======
B D                  Platypus  ======
B D               Zebra finch  ======
  D           Green seaturtle  ======
B D                   Chicken  ======
B D        American alligator  ======
B D                  Marmoset  ======
B D             X. tropicalis  ======
  D               Rock pigeon  ======
B D           Squirrel monkey  ======
B D                   Dolphin  ------
B D                   Opossum  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
B D                       Pig  ======

Alignment block 26 of 199 in window, 11577155 - 11577190, 36 bps 
B D                     Human  aggaccgggcacttagaaag------ctctcatccaatgtc--c
B D                     Chimp  aggacctggcacttagaaag------ctctcatccaatgtc--c
B D                   Gorilla  aggacctggcacttagaaag------ctctcatcaaatgtc--c
B D                 Orangutan  aagacctggcacttagaaag------ctctcatcaaatgtc--c
B D                    Gibbon  aggacctggcacttagaaag------ctctcatccaatgtc--c
B D                    Rhesus  aggacctggcgcttagaaag------ctctcatccagtgtc--c
B D       Crab-eating macaque  aggacctggcgcttagaaag------ctctcatccagtgtc--c
B D                    Baboon  aggacctggtgcttagaaag------ctctcatccagtgtc--c
B D              Green monkey  aggacccggcgcttagaaag------ctctcatctagtgtc--c
B D                  Bushbaby  aagacctggcacttggaaag------ctctcatccaatgtc--c
           Chinese tree shrew  aagacccagcattcagaaa-------cgctcatccaatgtc--t
B D                  Squirrel  aggacctggctcttagaaag------ctcttgtcccacgtc--t
                 Prairie vole  agagagca------agagag------cccttactctac-at--t
B D           Chinese hamster  agggactacctctcagaaag------cccttactctgtgtt--c
               Golden hamster  aatgactacctgttggaaag------cccttaccggatgat--c
B D                     Mouse  gaggactacctcttagaaag------cccctactctatgta--c
B D                       Rat  gaggactgcctcttagaaag------cccttactctatata--c
B D            Naked mole-rat  agaagctg------agactc------gccagt------gtc--g
B D                Guinea pig  aggagctg------agatgc------acccagt----gttc--c
             Brush-tailed rat  gggatctg------aga---------------------ctc--a
B D                    Rabbit  ----cgcggcaccaagaaag------ttcatgtccaatgcc---
B D                      Pika  aggacccgacaccaagaaag------ttcatgtccagtgtcttt
B D                    Alpaca  -------ggcacttggaaag------ctcccttccagagtc--c
               Bactrian camel  -------ggcacttggaaag------ctcccttccagagta--c
B D                   Dolphin  -------------------------------ttctaggacc--c
                 Killer whale  -------------------------------ttctaggacc--c
B D                     Horse  -agggctggcgcttagaa--------ccctcatccagcatc--c
B D          White rhinoceros  -agggccggcacttgaaa--------gcctcgtccaacatc--c
B D                       Cat  -aaggccggcacggagaaag------tccttacctagcgcc--c
B D                       Dog  -aggcc---cacagggagcctggtctccctctgcctgtgtc--t
B D                   Ferret   -aggactggcctggagaaag------ccctcatccagcatc--c
B D                     Panda  -aggactggcatggagaaaa------ccctcatccagtgtc--a
               Pacific walrus  -aggaccggcatggggaaaa------ccctcatccagcatc--c
                 Weddell seal  -aggactggcatggggaaaa------ccctcatccagcata--a
             Black flying-fox  -aggattggcacctagcaac------cgctcatccaatatc--c
B D                   Megabat  -aggaatggcacctagcgac------cgctcatccaatatc--c
B D                  Elephant  aggatttgtcacttagaaag------ctctcatccaatgtc--c
B D                   Manatee  aggatccgtcacttagaaag------ctctcattcaatgtc--c
             Cape golden mole  aggatcggtcatttagaaag------ctctcatccagtg-----
B D                    Tenrec  aggatctgccgcttagaaag------ctctcatccaatg-----
                     Aardvark  atgacccatcacttagaaag------ctctcatccaatgtc--c
B D                 Armadillo  ggccctggcccc------ag------ctgtcacccggcgtc--c
             Star-nosed mole  ============================================
         Cape elephant shrew  ============================================
B D                  Hedgehog  ============================================
               Big brown bat  ============================================
B D                  Microbat  ============================================
        David's myotis (bat)  ============================================
B D                    Turkey  ============================================
      Lesser Egyptian jerboa  ============================================
                  Chinchilla  ============================================
               Domestic goat  ============================================
B D                     Sheep  ============================================
B D                       Cow  ============================================
            Tibetan antelope  ============================================
  D          Peregrine falcon  ============================================
B D                    Lizard  ============================================
          Tibetan ground jay  ============================================
  D              Mallard duck  ============================================
B D       Medium ground finch  ============================================
  D    White-throated sparrow  ============================================
  D             Scarlet macaw  ============================================
  D       Collared flycatcher  ============================================
  D              Saker falcon  ============================================
B D                Budgerigar  ============================================
B D           Tasmanian devil  ============================================
B D                  Platypus  ============================================
B D               Zebra finch  ============================================
  D           Green seaturtle  ============================================
B D                   Chicken  ============================================
B D        American alligator  ============================================
B D                  Marmoset  ============================================
B D             X. tropicalis  ============================================
  D               Rock pigeon  ============================================
B D           Squirrel monkey  ============================================
B D                   Opossum  ============================================
  D  Chinese softshell turtle  ============================================
  D            Painted turtle  ============================================
B D                       Pig  ============================================

Alignment block 27 of 199 in window, 11577191 - 11577302, 112 bps 
B D                     Human  cct---------------aactct-tgga-gacaat---------------------aatcaagac--tt
B D                     Chimp  cct---------------aactct-tgga-gacaat---------------------gatcaagac--tt
B D                   Gorilla  cct---------------aactct-tgga-gacaat---------------------gatcaagac--tt
B D                 Orangutan  tct---------------aactct-tgga-gacaat---------------------gaccaagac--tt
B D                    Gibbon  cct---------------aacttt-tgga-gacaat---------------------gatcaagac--tt
B D                    Rhesus  cct---------------aactct-tgga-gacaat---------------------gagcaagac--tt
B D       Crab-eating macaque  cct---------------aactct-tgga-gacaat---------------------gagcaagac--tt
B D                    Baboon  cct---------------aactct-tgga-gacaat---------------------gagcaagat--gt
B D              Green monkey  cct---------------aactct-tgga-gacaat---------------------gagcaagac--tt
B D                  Bushbaby  cct---------------ggcttt-cagg-gacaatgtcccctggctttctgtacaggatcaatat--at
           Chinese tree shrew  cct---------------ggttct-t-ga-gacaat-------------------------aagac--tt
B D                  Squirrel  gct---------------cactct-tggg-atcaa----------------------------gac--ct
                 Prairie vole  ccc---------------agttgt-gaga-gacaat---------------------gatggaggc--ct
B D           Chinese hamster  ccc---------------aactgtggggg-gacaat---------------------gatagatgc--ct
               Golden hamster  ccc---------------agctgt-gggg-gacaat---------------------gatagcggc--ct
B D                     Mouse  cct---------------agctgt-gggg-gacaat---------------------gatggaagc--ct
B D                       Rat  cct---------------agctat--ggg-gacaac---------------------gatgcaagc--ct
B D            Naked mole-rat  ccc---------------agctct-tggg-gacagt---------------------gatcaagtc--ct
B D                Guinea pig  ccc---------------agctct-tggg-gacaaa---------------------ggtcaagac---c
                   Chinchilla  ---------------------cct-tggg-aagaac---------------------ggagcatcctctc
             Brush-tailed rat  ccc---------------agctct-tggg-gacaat---------------------agtggagacattc
B D                    Rabbit  cct---------------agctct-tggg-gacgct---------------------ggttaagac--ac
B D                      Pika  tct---------------agttcc-tgggaggcaac---------------------agttaagat--ga
B D                    Alpaca  cct---------------agttct-cagg-ggtgac---------------------aatcaagac--tt
               Bactrian camel  cct---------------agttct-cagg-ggtgac---------------------aatcaagac--tt
B D                   Dolphin  ccc--------------------------------------------------------tcaagac--tc
                 Killer whale  ccc--------------------------------------------------------tcaacac--tc
B D                     Horse  ccc---------------agctct-tgga-gatgac---------------------gaccaagac--tt
B D          White rhinoceros  tgc---------------agctct-tggg-gatgat---------------------gatcaagac--tt
B D                       Cat  cct---------------agcggc-tgag-gatgcg---------------------gatcaagac----
B D                       Dog  ctcatgaataaacaaataaactct-taaa-aaaaaa---------------------aa-aaagac--tt
B D                   Ferret   cct---------------agctct-tgag-gatgat---------------------gatcaagac--tt
B D                     Panda  cct---------------agctct-tgag-gaagac---------------------aatcaagac--tt
               Pacific walrus  cc----------------aaccct-tgag-gatgat---------------------gatcaagac--tt
                 Weddell seal  cc----------------aaccct-tgcg-gatgat---------------------gatcaagac--tt
             Black flying-fox  tct---------------agctct-tagg-gatgac---------------------aatcaagac--tt
B D                   Megabat  tct---------------agctct-tagg-gatgac---------------------aatcaagac--tt
B D                  Elephant  cct---------------agacct-tggg-gacaaa---------------------aatcagtac--tt
          Cape elephant shrew  cct---------------agctct-cagg-gtcagc---------------------ggtcagcac--tt
B D                   Manatee  tct---------------agctct-tggg-gacaat---------------------aatcaatac--tt
             Cape golden mole  ------------------------------gacaac---------------------catcattat--tt
B D                    Tenrec  ------------------------------gacagc---------------------agtccctgc--tt
                     Aardvark  ctt---------------agctct-taga-gacaat---------------------agtcagtac--tt
B D                 Armadillo  -cc---------------ag--cc-tgag-gatggc---------------------ggtcacagt--ta
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Turkey  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                    Lizard  ======================================================================
          Tibetan ground jay  ======================================================================
  D              Mallard duck  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D        American alligator  ======================================================================
B D                  Marmoset  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D           Squirrel monkey  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================

                        Human  agaggaactgact-gggggaaacgtcaacactttctt-ggttctctcagaggccggtggagacgctgctc
                        Chimp  agaggaactgact-gggggaaacctcaacactttctt-ggttctcccagaggcctgtggagacgctgctc
                      Gorilla  aaagaaactgact-gggggaaacttcaacactttctt-ggttctcccagaggccggtggagacgctgctc
                    Orangutan  agaggaaatgatt-tgggggaacttcaccactttctt-ggttctctcggaggccggtggagacgctgctc
                       Gibbon  agaggaactaatt-tgggggaacttcaccactttgtt-ggttctcccagaggccagtggagacgctgctc
                       Rhesus  agaggagctgatt--gggggaacttcaccacttcctt-ggttctcc----------tggagacgctgctc
          Crab-eating macaque  agaggagctgatt--gggggaacttcaccacttcctt-ggttctcc----------tggagacgctgctc
                       Baboon  -gaggagctgatt--gggggaacttcaccacttcctt-ggttctcc----------tggagacactgctc
                 Green monkey  agaggagctgatt--gggggaacttcaccacttcctt-ggttctcc----------tggagacgctgctc
                     Bushbaby  agaggaacagatt-tagggaaacttcttcactgtctt-gattctcccagaggcggatggtgactttgctc
           Chinese tree shrew  agaggagctgatt-tggggaaattttccctcctcctt-ggttctgcccaaggccagtggtgactctgc--
                     Squirrel  agaggggttgatc-tgggaaaacctcacccccatctt-ggttctcctagaggtcacttggga--ctgctc
                 Prairie vole  ggaaaggttgatt-tgaggaaatcccactaccatctt-ctttcttccagatgccagtgatga--tggcta
              Chinese hamster  ggaaaggctgact-tggggaaatcccacttccatctt-cattctgccagatgccagtgatga--cggcta
               Golden hamster  ggaaaggctgatt-cgggggaatcccacttccatctt-catcctcccagatgacagtgagga--tggcta
                        Mouse  aggaaagccaatt-tggggaaat-ctatcaccatctt-cattc-cccaggcaccagtggtga--tagcta
                          Rat  ggaagaagtaact-tggagaaatcccaccagcatctt-cattt-cctacgcaccagtgatg---------
               Naked mole-rat  agagggactgatt-tgggcagacttcacaaccatcat-gttcctcccaga-gccagcagaga--ctgctc
                   Guinea pig  agcaggactgacc-tggagagaag-catgaccactgt-ggtcc-cccaga-gctggtggtgactctgctc
                   Chinchilla  ttc--ctccagtc-tggggagacttcaggacccctgt-ggtcctcccaga-gctagtggtgactctgctc
             Brush-tailed rat  agagggcctgatc-tggggagacgtcacggccactgc-agccctcccaga-gctcctgggaactctgctc
                       Rabbit  agaggggctgatc-aggggaaacatcaccatcatctt-tgttttcttagaggtcagggatggctctgctc
                         Pika  agaggaaatgatcttggagatatgtca----tatctt-tgttttccca-aggtcaggg-tgaccctgttc
                       Alpaca  aggggagctgatc-tgggggaacatcgccaacttcct-ggctct--------cccagggtgactctgctc
               Bactrian camel  aggggagctgatc-tgggggaacatcgccaacttcct-ggctct--------cccagggtgactctgctc
                      Dolphin  aggggagctgatt-tggggaaatgacatcaacttctt-ggttctctctgaggcccatggtgactctgctc
                 Killer whale  aggggagctgatt-tggggaaatgacatcaacttctt-ggttctctctgaggcccatggtgactctgctc
                        Horse  agaggaactgatt-tggggaaatgtcaccaacttgtt-agttctcccagagacccgt-gtgactctgctc
             White rhinoceros  agaggagctgatt-tggggaaatgtcaccaacttctt-agttctcccagaggcctgtggtgactctgctc
                          Cat  agaggaactga-t-tgaggaaacatggacaactcctt-ggctctcccagaggcctttggcgactgtgctc
                          Dog  agaggaaccaa-t-tcgaaaaacatgatcaatacctt-ggttctcccagaggcttttggtgactgtgtgc
                      Ferret   aaaggaactga-t-tggggaaatatcaccacctcctt-cattctcccagaggcctttggtgactgtgtgc
                        Panda  acagggacaga-g-tggggaaatatcaccaactccctgggttctcccaggggctttcagtgactgtgcgc
               Pacific walrus  agaggaacgga-t-tggggaaatatcaccaactcctt-ggttctcccagaggcttttggtgactatgagc
                 Weddell seal  agaggaacgga-t-tggggaaatatcaccaccgcctt-cgttctcccggaggcttttggtgactgtgcac
             Black flying-fox  agaggaactgatt-taggaaaacgtcactaacttctt-ggttcccccagaggcctgtggtgact-----c
                      Megabat  agaggagctgatc-taggaaaatgtcactaacttctt-ggttcccccagaggcctgtggtgact-----c
                     Elephant  gaaagagctgatt-tagggaaatttcaccaacttcct-aattattgcagattccagggatgactctgctc
          Cape elephant shrew  acaagagctgctg-tagagaaacttcaccagcttcct-ggttctcacagaggccagcagtgaccctgctc
                      Manatee  gtaagagctgatt-tagggaaacttcactaacttcct-gggtcttgcagatgccaggagtgactctgcta
             Cape golden mole  ataagagttgatt-tagggaaacttcaccaacttcct-ggttctcacagagaccagggataactctgctt
                       Tenrec  ---agaactgatt-taggtgggtt----caacttcct-ggttctcaaaggg----------gtgctgctc
                     Aardvark  ataagaactgatt-tagggaaacttcaccaacttcct-ggttcttgcagaggccaggggtgactctgctc
                    Armadillo  gggagcccagg----ggggagacttta-caacttccc-ggctctcccagaggccagg-gtgagggcgccc
              Star-nosed mole  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Turkey  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Peregrine falcon  ======================================================================
                       Lizard  ======================================================================
           Tibetan ground jay  ======================================================================
                 Mallard duck  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                Scarlet macaw  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                   Budgerigar  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                  Zebra finch  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
           American alligator  ======================================================================
                     Marmoset  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
              Squirrel monkey  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================

                        Human  cattctgcctggat
                        Chimp  cattctgcctggat
                      Gorilla  cattctgcctggat
                    Orangutan  cattctgcctggat
                       Gibbon  cattccgcctggat
                       Rhesus  tattccgtctggat
          Crab-eating macaque  tattccgtctggat
                       Baboon  tattccgcctggat
                 Green monkey  tattccgcctggat
                     Bushbaby  ca-tctacaaggat
           Chinese tree shrew  ---tctgcatggac
                     Squirrel  cgtcttg-ctgaat
                 Prairie vole  tatcttgcctggat
              Chinese hamster  tctcttgcctggat
               Golden hamster  catcttgcctggat
                        Mouse  tatattacctggat
                          Rat  ----ttgcctggat
               Naked mole-rat  catgctgcctgtgt
                   Guinea pig  catgctgcccgggt
                   Chinchilla  cgcgctgcctgggt
             Brush-tailed rat  catgctgcctgggt
                       Rabbit  cattctgcctgggt
                         Pika  cattctgcctgaat
                       Alpaca  cgttccaccgggag
               Bactrian camel  cgttctgccgggag
                      Dolphin  cattcttccagtat
                 Killer whale  cattcttccagtat
                        Horse  cactccaccgggat
             White rhinoceros  cattctgcctggat
                          Cat  cattctgctgggat
                          Dog  cattctaccaggac
                      Ferret   cattcttccaggat
                        Panda  cattcagccacgat
               Pacific walrus  cattctgccaggat
                 Weddell seal  cattctgccaggat
             Black flying-fox  cattctgcaaggat
                      Megabat  cattctgcaaggat
                     Elephant  tactctgcctgggt
          Cape elephant shrew  cactctgcctggac
                      Manatee  cactctgcctggat
             Cape golden mole  cattctgcctggat
                       Tenrec  ca--ctgtctctgc
                     Aardvark  cactctgcctgtat
                    Armadillo  cctcc--cccgggt
              Star-nosed mole  ==============
                     Hedgehog  ==============
                Big brown bat  ==============
                     Microbat  ==============
         David's myotis (bat)  ==============
                       Turkey  ==============
       Lesser Egyptian jerboa  ==============
                Domestic goat  ==============
                        Sheep  ==============
                          Cow  ==============
             Tibetan antelope  ==============
             Peregrine falcon  ==============
                       Lizard  ==============
           Tibetan ground jay  ==============
                 Mallard duck  ==============
          Medium ground finch  ==============
       White-throated sparrow  ==============
                Scarlet macaw  ==============
          Collared flycatcher  ==============
                 Saker falcon  ==============
                   Budgerigar  ==============
              Tasmanian devil  ==============
                     Platypus  ==============
                  Zebra finch  ==============
              Green seaturtle  ==============
                      Chicken  ==============
           American alligator  ==============
                     Marmoset  ==============
                X. tropicalis  ==============
                  Rock pigeon  ==============
              Squirrel monkey  ==============
                      Opossum  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
                          Pig  ==============

Alignment block 28 of 199 in window, 11577303 - 11577305, 3 bps 
B D                     Human  ca------t
B D                     Chimp  ca------t
B D                   Gorilla  ca------t
B D                 Orangutan  ca------t
B D                    Gibbon  ca------t
B D                    Rhesus  ca------t
B D       Crab-eating macaque  ca------t
B D                    Baboon  ca------t
B D              Green monkey  ca------t
B D                  Bushbaby  ga------t
           Chinese tree shrew  ca------t
B D                  Squirrel  ca------t
                 Prairie vole  ca------g
B D           Chinese hamster  cg------g
               Golden hamster  ca------g
B D                     Mouse  ct------g
B D                       Rat  ca------g
B D            Naked mole-rat  catca---g
B D                Guinea pig  cagcatggg
                   Chinchilla  cctca---g
             Brush-tailed rat  cagca---g
B D                    Rabbit  ta------g
B D                      Pika  ca------g
B D                       Pig  ca------t
B D                    Alpaca  ca------c
               Bactrian camel  ca------c
B D                   Dolphin  ca------t
                 Killer whale  ca------t
B D                     Horse  cc------t
B D          White rhinoceros  cc------t
B D                       Cat  ca------t
B D                       Dog  ca------t
B D                   Ferret   ca------t
B D                     Panda  ca------t
               Pacific walrus  ca------t
                 Weddell seal  ca------t
             Black flying-fox  ca------t
B D                   Megabat  ca------t
B D                  Elephant  ca------t
          Cape elephant shrew  ta------g
B D                   Manatee  ta------t
             Cape golden mole  aa------t
B D                    Tenrec  ta------g
                     Aardvark  ta------t
B D                 Armadillo  ca------a
             Star-nosed mole  =========
B D                  Hedgehog  =========
               Big brown bat  =========
B D                  Microbat  =========
        David's myotis (bat)  =========
B D                    Turkey  =========
      Lesser Egyptian jerboa  =========
               Domestic goat  =========
B D                     Sheep  =========
B D                       Cow  =========
            Tibetan antelope  =========
  D          Peregrine falcon  =========
B D                    Lizard  =========
          Tibetan ground jay  =========
  D              Mallard duck  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D             Scarlet macaw  =========
  D       Collared flycatcher  =========
  D              Saker falcon  =========
B D                Budgerigar  =========
B D           Tasmanian devil  =========
B D                  Platypus  =========
B D               Zebra finch  =========
  D           Green seaturtle  =========
B D                   Chicken  =========
B D        American alligator  =========
B D                  Marmoset  =========
B D             X. tropicalis  =========
  D               Rock pigeon  =========
B D           Squirrel monkey  =========
B D                   Opossum  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========

Alignment block 29 of 199 in window, 11577306 - 11577329, 24 bps 
B D                     Human  t-t---cccagggcaggtaaaagt--g---gt-g--
B D                     Chimp  t-t---cccagagcaggtaaaagt--g---gt-g--
B D                   Gorilla  t-t---cccagggcaggtaaaagt--g---gt-g--
B D                 Orangutan  t-t---cccagggcaggt--aagt--g---gt-g--
B D                    Gibbon  t-tgaaaccagggcaggtaaaagc--g---gt-g--
B D                    Rhesus  t-t---cccagggcaggtaaaagt--g---gt-g--
B D       Crab-eating macaque  t-t---cccagggcaggtaaaagt--g---gt-g--
B D                    Baboon  t-t---cccagggcaggtaaaagt--g---gt-g--
B D              Green monkey  t-t---cccagggcgggtaaaagt--g---gt-g--
B D                  Marmoset  t-t---ctcagggcaggtaaaagt--g---gt-g--
B D           Squirrel monkey  t-t---ttcagggcaggttaaagt--g---gt-g--
B D                  Bushbaby  --t---cccagggcagtcagaagt--g---gt-g--
           Chinese tree shrew  t-t---tccagggcagttgaaa-t--g---gt-g--
B D                  Squirrel  t-t---cccaggccagcagagaga--g---ga-g--
                 Prairie vole  t-t---cccagggcagctgaccat--g---ca-g--
B D           Chinese hamster  t-t---cccagagtatctgacaat--g---ca-g--
               Golden hamster  t-t---cccagagaagctgacaat--g---ca-g--
B D                     Mouse  tcc---cccagaaccactgattat--g---ca-g--
B D                       Rat  t-t---cccggagcagctgatgat--g---ca-g--
B D            Naked mole-rat  t-g---cccagggtagctgatggt--g---ga-g--
B D                Guinea pig  t-c---cccacagttgccgacagt--ggaaga-g--
                   Chinchilla  c-c---ctccgggtagccgacagt--g---ga-g--
             Brush-tailed rat  g-c---cccagggtcactgatggt--g---ga-g--
B D                    Rabbit  t-t---tccagggcagctgaaagt--g---gt-g--
B D                      Pika  t-t---tgcagttcaactgcaagtcag---gg-a--
B D                       Pig  t-t---cccaggatgattaaaagt--g---ct-g--
B D                    Alpaca  t-t---cctggggtggttgaaagt--g---ct-g--
               Bactrian camel  t-t---cctggggtggttgaaagt--g---ct-g--
B D                   Dolphin  t-t---cccagtttgactgaaagt--g---ct-g--
                 Killer whale  t-t---cccagtttgactgaaagt--g---ct-g--
B D                     Horse  t-t---ccca-ggtggttgaaagt--g---c--g--
B D          White rhinoceros  t-t---cccagggtagttgaaagt--g---ct-g--
B D                       Cat  t-t---cccaaggcgactaaaagt--g---ct-g--
B D                       Dog  t-t----ctagggtggctgaaagt--g---tt-c--
B D                   Ferret   t-t---cccagggaggctgaaagt--g---ctgg--
B D                     Panda  t-t---cccaggggggctgaa------------g--
               Pacific walrus  t-t---cccagggtggctgaaagt--g---ct-g--
                 Weddell seal  t-t---cccagggtggctgaaagt--g---ct-g--
             Black flying-fox  t-t---cccagcatgattgaaagt--g---ct-g--
B D                   Megabat  t-t---cccagc--------aagt--g---ct-g--
B D                  Elephant  t-t---tccagggcagttgaaagt--g---at-ggg
          Cape elephant shrew  t-t---tccaaggcttttgtaagc--t---gt-ggg
B D                   Manatee  t-t---tccagggtagttgaaagt--a---gt-ggg
             Cape golden mole  t-t---tccagagcagttgaaagt--g---gt-ggg
B D                    Tenrec  t-t---tcca-------------------------g
                     Aardvark  t-t---tccaggggagttgaaaat--a---gt-agg
B D                 Armadillo  t-t---cccagggcc-tggagggt--g---gc-caa
             Star-nosed mole  ====================================
B D                  Hedgehog  ====================================
               Big brown bat  ====================================
B D                  Microbat  ====================================
        David's myotis (bat)  ====================================
B D                    Turkey  ====================================
      Lesser Egyptian jerboa  ====================================
               Domestic goat  ====================================
B D                     Sheep  ====================================
B D                       Cow  ====================================
            Tibetan antelope  ====================================
  D          Peregrine falcon  ====================================
B D                    Lizard  ====================================
          Tibetan ground jay  ====================================
  D              Mallard duck  ====================================
B D       Medium ground finch  ====================================
  D    White-throated sparrow  ====================================
  D             Scarlet macaw  ====================================
  D       Collared flycatcher  ====================================
  D              Saker falcon  ====================================
B D                Budgerigar  ====================================
B D           Tasmanian devil  ====================================
B D                  Platypus  ====================================
B D               Zebra finch  ====================================
  D           Green seaturtle  ====================================
B D                   Chicken  ====================================
B D        American alligator  ====================================
B D             X. tropicalis  ====================================
  D               Rock pigeon  ====================================
B D                   Opossum  ====================================
  D  Chinese softshell turtle  ====================================
  D            Painted turtle  ====================================

Inserts between block 29 and 30 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 30 of 199 in window, 11577330 - 11577362, 33 bps 
B D                     Human  gg-acccc------------tcgc--cgggagg--ccag---gaaaga--tgcaa
B D                     Chimp  gg-acccc------------tacc--cgggagg--ccag---gaaaga--tgcaa
B D                   Gorilla  gg-acccc------------tacc--cgggagg--ccag---gaaaga--tgcaa
B D                 Orangutan  gg-acccc------------tccc--cgggagg--ccag---gaaaga--cgcaa
B D                    Gibbon  gg-acccc------------tctcttctggagg--ccag---gaaaga--cgcaa
B D                    Rhesus  gg-acccc------------tccc--caggagg--ccag---aaaaga--cacaa
B D       Crab-eating macaque  gg-acccc------------tccc--caggagg--ccag---aaaaga--cacaa
B D                    Baboon  gg-acccc------------tccc--caggagg--ccag---aaaaga--cacaa
B D              Green monkey  gg-acccc------------tccc--caggaga--ccag---aaaaga--cacaa
B D                  Marmoset  gg-actcc------------tccc--caggagg--ccag---gaaaga--tgtaa
B D           Squirrel monkey  gg-acttc------------tccc--caggagg--ccag---gcagga--tgtaa
B D                  Bushbaby  g----ttc------------ctcc--caaggat--ccag---ggaagg--gttaa
           Chinese tree shrew  ga-gaccc------------ctcc--ctggggg--atgg---atgtgt--catgg
B D                  Squirrel  ggtgcccc------------gccc-----aggg--ctcc---aggggatcatcag
                 Prairie vole  gg-attcc------------atcc-----agtg--ccca---agaaga--gtcag
B D           Chinese hamster  gg-a-ccc------------attc-----agtg--ccca---agaaga--gtcag
               Golden hamster  ag-acccc------------atcc-----agtg--ccca---agaaga--gtcag
B D                     Mouse  gg-accct------------atgc-----agta--ccca---agaaga--gacat
B D                       Rat  gg-acccc------------atgc-----agtg--ccca---agaaga--gacag
B D            Naked mole-rat  gg-ac-c------------------------tg---cag---gggcga--ttcag
B D                Guinea pig  ag-accc------------------------tg--ccag---gggtga--tttgg
                   Chinchilla  gg-acgc------------------------tg--ccag---gggtga--ttcag
             Brush-tailed rat  gg-accc------------------------tg--ccag---gggtga--ttcag
B D                    Rabbit  gg-accac------------ttcc-----aggggtccaa---ggaaga--atcag
B D                      Pika  gt-accat------------tcct-----tggggtccaa---ggaaga--tccag
B D                       Pig  gg-acccc------------tccc--ccagggt--ccag---gggaaa--aatca
B D                    Alpaca  gg-acccc------------tccc--caggaga--ccag---gaaaaa--aatca
               Bactrian camel  gg-acccc------------tccc--caggaga--ccag---gaaaaa--aatca
B D                   Dolphin  gg-acccc------------tccc--caagggt--ccagggtgaaaaa--a--tc
                 Killer whale  gg-acccc------------tccc--caagggt--ccagggtgaaaaa--aatca
B D                     Horse  gg-acccc------------tccc--caggggt--ccag---aaaaaa--aatca
B D          White rhinoceros  gg-actcc------------tccc--caggggt--ccagaa-aaaaaa--aatca
B D                       Cat  ga-accct------------gtcc--ca-gggt--tcag---gaagaa--gatca
B D                       Dog  gg-accct------------gtcc--ca-gggt--acag---gaagaa--gacca
B D                   Ferret   gg-accct------------gtcc--ca-gggt--gcag---aaagaa--ggtca
B D                     Panda  gg-accct------------gtcc--ca-gggt--gcag---gaagaa--ggtca
               Pacific walrus  gg-accct------------gtcc--ca-gggt--gcag---gaagaa--ggtca
                 Weddell seal  gg-accct------------gtcc--ca-gggt--gcag------gaa--ggtca
             Black flying-fox  gg-attcc------------tccc--caggggt--ccag---aaaaaa---atc-
B D                   Megabat  gg-atccc------------tccc--caggggt--ccag---aaaaaa---atc-
                Big brown bat  gg-atccc------------tccc--cgagagt--ccag---gaaaaa--catca
         David's myotis (bat)  gg-acccc------------tccc--caagagt--ccag---gaaaaa--catca
B D                  Microbat  gg-acccc------------tccc--caagagt--ccag---gaaaaa--catca
B D                  Elephant  ga-gctcccatactcccccccccc--caggagt--ccag---gaaaga--atcaa
          Cape elephant shrew  ga-accctta----------cccc--ttggagt--caca---gaaaga--a-caa
B D                   Manatee  ga-gcccc--------------------------------------------cac
             Cape golden mole  ga-acccctctgc-------ccat--caagaat--t-ag---gaaaca--atcaa
B D                    Tenrec  ga-aacaccctgt-------ctct--ccaaagt--tcag---gaaaga--acgaa
                     Aardvark  ga-acctc-ctat-------ctcc--tggaagt--ccag---gaaaga--atcaa
B D                 Armadillo  ga-gggtgggcgc-------ggct--cggaggt--gggg---gg--------ctg
             Star-nosed mole  =======================================================
B D                  Hedgehog  =======================================================
B D                    Turkey  =======================================================
      Lesser Egyptian jerboa  =======================================================
               Domestic goat  =======================================================
B D                     Sheep  =======================================================
B D                       Cow  =======================================================
            Tibetan antelope  =======================================================
  D          Peregrine falcon  =======================================================
B D                    Lizard  =======================================================
          Tibetan ground jay  =======================================================
  D              Mallard duck  =======================================================
B D       Medium ground finch  =======================================================
  D    White-throated sparrow  =======================================================
  D             Scarlet macaw  =======================================================
  D       Collared flycatcher  =======================================================
  D              Saker falcon  =======================================================
B D                Budgerigar  =======================================================
B D           Tasmanian devil  =======================================================
B D                  Platypus  =======================================================
B D               Zebra finch  =======================================================
  D           Green seaturtle  =======================================================
B D                   Chicken  =======================================================
B D        American alligator  =======================================================
B D             X. tropicalis  =======================================================
  D               Rock pigeon  =======================================================
B D                   Opossum  =======================================================
  D  Chinese softshell turtle  =======================================================
  D            Painted turtle  =======================================================

Inserts between block 30 and 31 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 31 of 199 in window, 11577363 - 11577384, 22 bps 
B D                     Human  agatggatggatg----gg-------------------tgtgttc
B D                     Chimp  a----gatggatg----gg-------------------tgtgttc
B D                   Gorilla  a----gatggatg----gg-------------------tgtgttc
B D                 Orangutan  a----gatggatg----cg-------------------tgtgttc
B D                    Gibbon  a----gatggatg----gg-------------------tgtgttc
B D                    Rhesus  a----gatggatg----tg-------------------tgtgttt
B D       Crab-eating macaque  a----gatggatg----tg-------------------tgtgttt
B D                    Baboon  a----gatggatg----cg-------------------tgtgttt
B D              Green monkey  a----gatggatg----tg-------------------tgtgttc
B D                  Marmoset  a----gatggatg----gg-------------------tgtg-tc
B D           Squirrel monkey  a----gatggatg----gg-------------------tgtg-tc
B D                  Bushbaby  a----aaggggtg----ggtgaaaatgaagaggggtgatgtgtca
           Chinese tree shrew  a----ggtgggtg----ggt------------------tatggt-
B D                  Squirrel  ------agg---------g-------------------tgggcat
                 Prairie vole  ------aagataa----gg-------------------tgggcat
B D           Chinese hamster  ------ggggcaa----tg-------------------tacacat
               Golden hamster  ------agggtga----tg-------------------tacacat
B D                     Mouse  ------agggtag----gg-------------------tgggtat
B D                       Rat  ------agggctg----gg-------------------tgggcat
B D            Naked mole-rat  ------aggggctcagagg-------------------ggtgagc
B D                Guinea pig  ------aatggtc----ag-------------------tgtgtac
                   Chinchilla  ------ggtggtc----ag-------------------tgtgtac
             Brush-tailed rat  ------agcagtt----gg-------------------tgtgtcc
B D                    Rabbit  -------aggtgg----gg-------------------tgt-tat
B D                       Pig  -----------------ag--------------------------
B D                    Alpaca  -----------------ag--------------------------
               Bactrian camel  -----------------ag--------------------------
B D                   Dolphin  -----------------ag--------------------------
                 Killer whale  -----------------ag--------------------------
B D                     Horse  -----------------ag--------------------------
B D          White rhinoceros  -----------------ag--------------------------
B D                       Cat  -----------------ag--------------------------
B D                       Dog  -----------------tg--------------------------
B D                   Ferret   -----------------ag--------------------------
B D                     Panda  -----------------ag--------------------------
               Pacific walrus  -----------------ag--------------------------
                 Weddell seal  -----------------ag--------------------------
             Black flying-fox  -----------------aa--------------------------
B D                   Megabat  -----------------ag--------------------------
                Big brown bat  -----------------ag--------------------------
         David's myotis (bat)  -----------------ag--------------------------
B D                  Microbat  -----------------ag--------------------------
B D                  Elephant  ---agagggattg----gg-------------------tatatca
          Cape elephant shrew  ---aaacaagtta----tg-------------------tatatgg
B D                   Manatee  ---agagggattg----gg-------------------tatatca
             Cape golden mole  ---ag-agggttg----ga-------------------tacatca
B D                    Tenrec  ---agaagggttg----gg-------------------tatatca
                     Aardvark  ---agagggatta----gg-------------------aatatca
B D                 Armadillo  ---ggaggg--------gg-------------------cgtgtca
             Star-nosed mole  =============================================
B D                  Hedgehog  =============================================
B D                    Turkey  =============================================
      Lesser Egyptian jerboa  =============================================
               Domestic goat  =============================================
B D                      Pika  ---------------------------------------------
B D                     Sheep  =============================================
B D                       Cow  =============================================
            Tibetan antelope  =============================================
  D          Peregrine falcon  =============================================
B D                    Lizard  =============================================
          Tibetan ground jay  =============================================
  D              Mallard duck  =============================================
B D       Medium ground finch  =============================================
  D    White-throated sparrow  =============================================
  D             Scarlet macaw  =============================================
  D       Collared flycatcher  =============================================
  D              Saker falcon  =============================================
B D                Budgerigar  =============================================
B D           Tasmanian devil  =============================================
B D                  Platypus  =============================================
B D               Zebra finch  =============================================
  D           Green seaturtle  =============================================
B D                   Chicken  =============================================
B D        American alligator  =============================================
B D             X. tropicalis  =============================================
  D               Rock pigeon  =============================================
B D                   Opossum  =============================================
  D  Chinese softshell turtle  =============================================
  D            Painted turtle  =============================================

Inserts between block 31 and 32 in window
B D                 Squirrel 424bp
                Prairie vole 4bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                    Mouse 4bp
B D                      Rat 4bp

Alignment block 32 of 199 in window, 11577385 - 11577394, 10 bps 
B D                     Human  cccaggagtg
B D                     Chimp  cccaggagtg
B D                   Gorilla  cccaggagtg
B D                 Orangutan  cccaggagtg
B D                    Gibbon  cccaggagtg
B D                    Rhesus  ccccggagta
B D       Crab-eating macaque  ccccggagtg
B D                    Baboon  ccccggagtg
B D              Green monkey  cccaggagtg
B D                  Marmoset  cccaggagtg
B D           Squirrel monkey  ctcaggagtg
B D                  Bushbaby  ctgaggagtg
           Chinese tree shrew  ----agagta
                 Prairie vole  ccgaggagg-
B D           Chinese hamster  ctgaggagg-
               Golden hamster  ctgaggagg-
B D                     Mouse  ctgaggagg-
B D                       Rat  ccgaggagg-
B D            Naked mole-rat  -caagcagg-
B D                Guinea pig  -agaggggg-
                   Chinchilla  -tgaggcgg-
             Brush-tailed rat  -tgaagggg-
B D                    Rabbit  ---gggggg-
B D                       Pig  ---agcagtg
B D                    Alpaca  ---cgtggtg
               Bactrian camel  ---cgcggtg
B D                   Dolphin  ---agcagtg
                 Killer whale  ---agcagtg
B D                     Horse  ---agc----
B D          White rhinoceros  ---agcagtg
B D                       Cat  ---agtggtg
B D                       Dog  ---agtagta
B D                   Ferret   ---agtggcg
B D                     Panda  ---agtggtg
               Pacific walrus  ---agtggtg
                 Weddell seal  ---agtggtg
             Black flying-fox  ---aatggtg
B D                   Megabat  ---agtggtg
                Big brown bat  ---agtggtg
         David's myotis (bat)  ---agtggcg
B D                  Microbat  ---agtggtg
B D                  Elephant  cgaaggagtg
          Cape elephant shrew  tggaggagga
B D                   Manatee  tgaaggagtg
             Cape golden mole  tagaggaatg
B D                    Tenrec  cggaagaatg
                     Aardvark  tggaggaatg
B D                 Armadillo  tgagggggtg
             Star-nosed mole  ==========
B D                  Hedgehog  ==========
B D                    Turkey  ==========
      Lesser Egyptian jerboa  ==========
B D                  Squirrel  ==========
               Domestic goat  ==========
B D                      Pika  ----------
B D                     Sheep  ==========
B D                       Cow  ==========
            Tibetan antelope  ==========
  D          Peregrine falcon  ==========
B D                    Lizard  ==========
          Tibetan ground jay  ==========
  D              Mallard duck  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
  D             Scarlet macaw  ==========
  D       Collared flycatcher  ==========
  D              Saker falcon  ==========
B D                Budgerigar  ==========
B D           Tasmanian devil  ==========
B D                  Platypus  ==========
B D               Zebra finch  ==========
  D           Green seaturtle  ==========
B D                   Chicken  ==========
B D        American alligator  ==========
B D             X. tropicalis  ==========
  D               Rock pigeon  ==========
B D                   Opossum  ==========
  D  Chinese softshell turtle  ==========
  D            Painted turtle  ==========

Inserts between block 32 and 33 in window
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                   Rabbit 1bp
B D                Armadillo 11bp

Alignment block 33 of 199 in window, 11577395 - 11577398, 4 bps 
B D                     Human  agtg
B D                     Chimp  agtg
B D                   Gorilla  agtg
B D                 Orangutan  agtg
B D                    Gibbon  agtg
B D                    Rhesus  ggtg
B D       Crab-eating macaque  ggtg
B D                    Baboon  ggtg
B