Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 593 in window, 160876540 - 160876551, 12 bps 
B D                     Human  ttgagtcaatat
B D                     Chimp  ttgagtcaatat
B D                   Gorilla  ttgagtcaatat
B D                 Orangutan  ttgagtcaatat
B D                    Gibbon  ttgagtcaatat
B D                    Rhesus  ttgagtcaatat
B D       Crab-eating macaque  ttgagtcaatat
B D                    Baboon  ttgagtcaatat
B D              Green monkey  ttgagtcaatat
B D                  Marmoset  ttgaatcaatat
B D           Squirrel monkey  ttgaatcaatat
B D                  Bushbaby  ctgaatccatat
           Chinese tree shrew  ttgagtc-attt
B D                  Squirrel  ctgaattactat
B D                     Mouse  tgcaaggaacat
B D                       Rat  ttcaatgaacat
B D            Naked mole-rat  ttgaatgaaaat
B D                Guinea pig  tga-atgagtat
                   Chinchilla  ttgaatgagtat
             Brush-tailed rat  ttg-atgaatac
B D                    Rabbit  aaaaattgatgt
B D                      Pika  ataagttgatgc
             Tibetan antelope  acaaagtgatgt
B D                       Cow  ttgaacgcatgg
B D                     Sheep  ttgaatccatga
                Domestic goat  ttgaacccatga
B D                     Horse  ttgaattaatgt
B D          White rhinoceros  ttgaatccatgg
B D                     Shrew  a-gggcagatgc
              Star-nosed mole  acaagtggatgt
B D                  Elephant  ctgaatttacat
          Cape elephant shrew  ttgaattcacaa
B D                   Manatee  ttgaatttacgt
             Cape golden mole  atttgttgatgc
B D                    Tenrec  actcatcgaggt
                     Aardvark  ttgaatttacat
B D                 Armadillo  ------------
B D                   Opossum  gtggtttaatgg
B D           Tasmanian devil  atgtttcaatag
B D                   Wallaby  atgatttaatgg
B D        American alligator  ctgagtctaa--
  D            Painted turtle  cccagcccac--
  D  Chinese softshell turtle  tccagcccac--
  D    Spiny softshell turtle  tcctgcccac--
B D                 Zebrafish  ttcattcaatgt
     Mexican tetra (cavefish)  -----taagagt
      Lesser Egyptian jerboa  ============
                Weddell seal  ============
B D                   Dolphin  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D                       Cat  ============
B D                   Ferret   ============
              Bactrian camel  ============
B D                    Alpaca  ============
              Pacific walrus  ============
B D                     Panda  ============
                Killer whale  ============
B D                       Dog  ============

Alignment block 2 of 593 in window, 160876552 - 160876568, 17 bps 
B D                     Human  gat-ttattgttttct--ct--------------------------
B D                     Chimp  gat-ttattgttttct--ct--------------------------
B D                   Gorilla  gat-ttattattttct--ct--------------------------
B D                 Orangutan  gac-ttattattttct--ct--------------------------
B D                    Gibbon  gat-ttattattttct--ct--------------------------
B D                    Rhesus  gat-ttattagtttct--ct--------------------------
B D       Crab-eating macaque  gat-ttattagtttct--ct--------------------------
B D                    Baboon  gat-ttattagtttct--ct--------------------------
B D              Green monkey  gat-ttattagtttct--ct--------------------------
B D                  Marmoset  gat-ttattcttttct--ct--------------------------
B D           Squirrel monkey  gat-ttattcttttct--ct--------------------------
B D                  Bushbaby  gat-ttattctcttc-------------------------------
           Chinese tree shrew  gat-ttatt-tcctct--cc--------------------------
B D                  Squirrel  gat-ttattcttctttcctc--------------------------
B D                     Mouse  gat-ttatcctgcttt--at--------------------------
B D                       Rat  gat-ttattccgcttt--tc--------------------------
B D            Naked mole-rat  gat-ttatttcccttt--cc--------------------------
B D                Guinea pig  gct-ttattcattttc--cc--------------------------
                   Chinchilla  gat-ttattcttcttt--cc--------------------------
             Brush-tailed rat  gat-ttattcttcttt--cc--------------------------
B D                    Rabbit  act-ttattattttcc--tc--------------------------
B D                      Pika  act-ttattgttcttt--tc--------------------------
B D                       Pig  ggt-ttattctcctct--cc--------------------------
             Tibetan antelope  -aatttattcccttcc--cc--------------------------
B D                       Cow  -ca-tgactcttgtgt--cc--------------------------
B D                     Sheep  -ca-tgactcttgtct--cc--------------------------
                Domestic goat  -ca-ttactcttgtct--cc--------------------------
B D                     Horse  gat-ttattttcctat--cc--------------------------
B D          White rhinoceros  gat-ttcttcttctat--ct--------------------------
B D                     Shrew  aat-ttatt-gtctgg--tg--------------------------
              Star-nosed mole  aat-ttattcacctca--ac--------------------------
B D                  Elephant  gtt-ttattcccctct--cc--------------------------
          Cape elephant shrew  agt-ttattctcctct--cc--------------------------
B D                   Manatee  gat-ttatt---ctct--cc--------------------------
             Cape golden mole  aat-gtattatcctct--ca--------------------------
B D                    Tenrec  gat-ttctcacgttgt--cc--------------------------
                     Aardvark  gat-ttattttcctct--cc--------------------------
B D                 Armadillo  aat-ttattgtccttg--cc--------------------------
B D                   Opossum  gat-ttattattctct--cc--------------------------
B D           Tasmanian devil  aat-ttattatgctct--at--------------------------
B D                   Wallaby  gat-ttattattctct--tt--------------------------
B D        American alligator  --t-ggagattcttta--tt--------------------------
  D            Painted turtle  --t-ttactttcttta--tt--------------------------
  D  Chinese softshell turtle  --t-tcaatttcttta--tt--------------------------
  D    Spiny softshell turtle  --t-tcaatttcttta--tt--------------------------
B D                 Zebrafish  -----cattagctcat--tttttggccgaaatggtgtttagcggct
     Mexican tetra (cavefish)  -----tactgtttctt--attt----agaaatgatctt--------
      Lesser Egyptian jerboa  ==============================================
                Weddell seal  ==============================================
B D                   Dolphin  ==============================================
         Pundamilia nyererei  ==============================================
                 Zebra mbuna  ==============================================
       Burton's mouthbreeder  ==============================================
         Princess of Burundi  ==============================================
B D                       Cat  ==============================================
B D                   Ferret   ==============================================
              Bactrian camel  ==============================================
B D                    Alpaca  ==============================================
              Pacific walrus  ==============================================
B D                     Panda  ==============================================
                Killer whale  ==============================================
B D                       Dog  ==============================================

Inserts between block 2 and 3 in window
B D                  Opossum 6bp
B D          Tasmanian devil 4bp
B D                  Wallaby 26bp

Alignment block 3 of 593 in window, 160876569 - 160876579, 11 bps 
B D                     Human  tctgccat---------------------------------------------taa
B D                     Chimp  tctgccat---------------------------------------------taa
B D                   Gorilla  tctgccat---------------------------------------------taa
B D                 Orangutan  tctgccat---------------------------------------------taa
B D                    Gibbon  tctgccat---------------------------------------------taa
B D                    Rhesus  tctgcca----------------------------------------------taa
B D       Crab-eating macaque  tctgcca----------------------------------------------taa
B D                    Baboon  tctgcca----------------------------------------------taa
B D              Green monkey  tctgcca----------------------------------------------taa
B D                  Marmoset  tctcccat---------------------------------------------taa
B D           Squirrel monkey  tctgccat---------------------------------------------tga
B D                  Bushbaby  tctgccat---------------------------------------------tag
           Chinese tree shrew  attgccat---------------------------------------------tat
B D                  Squirrel  tgct---------------------------------------------------a
B D                     Mouse  tgct-cat---------------------------------------------tag
B D                       Rat  tggt-cat---------------------------------------------tag
B D            Naked mole-rat  tcagcca-------------------------------------------------
B D                Guinea pig  tgtgccat---------------------------------------------tag
                   Chinchilla  tgtggcat---------------------------------------------tag
             Brush-tailed rat  tgtcccat---------------------------------------------tag
B D                    Rabbit  ttct-tat---------------------------------------------ttc
B D                      Pika  tcct-tat---------------------------------------------tat
B D                       Pig  t-------------------------------------------------------
             Tibetan antelope  tc------------------------------------------------------
B D                       Cow  tcaaccaa---------------------------------------------taa
B D                     Sheep  tcaaccag---------------------------------------------taa
                Domestic goat  tcaaccag---------------------------------------------taa
B D                     Horse  tctgccaa---------------------------------------------taa
B D          White rhinoceros  tctgccat---------------------------------------------taa
B D                     Shrew  cg------------------------------------------------------
              Star-nosed mole  tc------------------------------------------------------
B D                  Elephant  tttgccatcacctacagcataaagtccaaaatcacaggcaaaatcaatgccac---
          Cape elephant shrew  tctcccattacatacttcataaactccaaaatcattggtaaaagtgatgccac-ag
B D                   Manatee  tctgccatcgcctgcagcataaagtccaaaatcactggcaaaatcaatgctgttaa
             Cape golden mole  tctttgtt----------------------------------------------ag
B D                    Tenrec  ccagtggt----------------------------------------------ag
                     Aardvark  tctgccat---------cataaagtacaaagttattggtagaatacatgtcattag
B D                 Armadillo  tttttctt----------------------------------------------ag
B D                   Opossum  -----------------------------------------------catgcccag
B D           Tasmanian devil  -----------------------------------------------tatggccag
B D        American alligator  tc--tcat---------------------------------------------tac
  D            Painted turtle  tccttcac---------------------------------------------aga
  D  Chinese softshell turtle  tgcatcac---------------------------------------------aga
  D    Spiny softshell turtle  tgctacac---------------------------------------------aga
B D                 Zebrafish  tttgcaat---------------------------------------------taa
      Lesser Egyptian jerboa  ========================================================
                Weddell seal  ========================================================
B D                   Dolphin  ========================================================
    Mexican tetra (cavefish)  --------------------------------------------------------
         Pundamilia nyererei  ========================================================
                 Zebra mbuna  ========================================================
       Burton's mouthbreeder  ========================================================
         Princess of Burundi  ========================================================
B D                   Wallaby  ========================================================
B D                       Cat  ========================================================
B D                   Ferret   ========================================================
              Bactrian camel  ========================================================
B D                    Alpaca  ========================================================
              Pacific walrus  ========================================================
B D                     Panda  ========================================================
                Killer whale  ========================================================
B D                       Dog  ========================================================

Inserts between block 3 and 4 in window
B D                  Opossum 11bp
B D          Tasmanian devil 11bp

Alignment block 4 of 593 in window, 160876580 - 160876597, 18 bps 
B D                     Human  -------catt-ct-ag--ctact----gggta
B D                     Chimp  -------catt-ct-ag--ctact----gggta
B D                   Gorilla  -------catt-ct-ag--ctact----gggca
B D                 Orangutan  -------catt-ct-ag--ctact----gggta
B D                    Gibbon  -------catt-ct-ag--ctact----gggta
B D                    Rhesus  -------catt-gt-ag--ctact----gggta
B D       Crab-eating macaque  -------catt-gt-ag--ctact----gggta
B D                    Baboon  -------catt-gt-ag--ctact----gggta
B D              Green monkey  -------catt-gt-ag--ctact----gggta
B D                  Marmoset  -------catt-ct-ag--ctgtt----gggta
B D           Squirrel monkey  -------catt-ct-ag--ctatt----gggta
B D                  Bushbaby  -------caat-ct-ag--at--------ggaa
           Chinese tree shrew  -------caca-ct-ag--ttact----gggta
B D                  Squirrel  -------catt-ct-ag--ctact----ggcca
B D                     Mouse  -------catt-cc-ag--ttact----aagtc
B D                       Rat  -------catt-ct-ag--ttact----aggtc
B D                Guinea pig  -------ctat-ct-ag--ttcct----aggta
                   Chinchilla  -------caat-cc-ag--ttact----aggta
             Brush-tailed rat  -------caat-gt-ag--ttact----aggtc
B D                    Rabbit  -------tgcc-cc-aa--tt------------
B D                      Pika  -------ttct-tt-ag--tt------------
B D                       Pig  ------------ct-tg--ttagc----a----
             Tibetan antelope  ------------ct-gg--ttagc----a----
B D                       Cow  -------catt-ct-ag--ttagt----aggtg
B D                     Sheep  -------cgtt-ct-ag--ttagt----aggtg
                Domestic goat  -------catt-ct-ag--ttagt----aggtg
B D                     Horse  -------catt-ct-ac--ttact----aggta
B D          White rhinoceros  -------catg-ct-tc--ttact----aggtg
B D                     Shrew  ------------tc-tg--ttaac----a----
              Star-nosed mole  ------------ct-tg--ttaac----a----
B D                  Elephant  ----------t-ct-ct--ttact----gggtg
          Cape elephant shrew  -------catt-ct-ca--tca-----------
B D                   Manatee  -------catt-ct-ca--ttact----gggtg
             Cape golden mole  -------tatt-tc-ca----------------
B D                    Tenrec  -------catt-cc-gg----------------
                     Aardvark  -------catt-tt-ca--ttact----ggatg
B D                 Armadillo  -------cact-ct-ag----------------
B D                   Opossum  -------caca-tt-gg--ttcttgaggagaag
B D           Tasmanian devil  -------catg-tt-gg--ttcttgaagagaag
B D                   Wallaby  -------catg-tc-ag--ttctt------aag
B D        American alligator  -------tggc-tg-agtcccgag----gg---
  D            Painted turtle  -------tgtc-tacag--ctgag----gc---
  D  Chinese softshell turtle  -------tgtc-ca-ag--ctgag----gc---
  D    Spiny softshell turtle  -------tgtc-ca-ag--ctgag----gc---
B D                 Zebrafish  aaaactctcca-cc-tg--tt------------
     Mexican tetra (cavefish)  ---actgtatattc-gg--tt------------
      Lesser Egyptian jerboa  =================================
                Weddell seal  =================================
B D                   Dolphin  =================================
         Pundamilia nyererei  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D            Naked mole-rat  ---------------------------------
B D                       Cat  =================================
B D                   Ferret   =================================
              Bactrian camel  =================================
B D                    Alpaca  =================================
              Pacific walrus  =================================
B D                     Panda  =================================
                Killer whale  =================================
B D                       Dog  =================================

Alignment block 5 of 593 in window, 160876598 - 160876602, 5 bps 
B D                     Human  agttg
B D                     Chimp  agttg
B D                   Gorilla  agttg
B D                 Orangutan  agttg
B D                    Gibbon  agttg
B D                    Rhesus  agttg
B D       Crab-eating macaque  agttg
B D                    Baboon  agttg
B D              Green monkey  agttg
B D                  Marmoset  agttg
B D           Squirrel monkey  agttg
B D                  Bushbaby  agttg
           Chinese tree shrew  aatta
B D                  Squirrel  agtgg
B D                     Mouse  agtgt
B D                       Rat  attgt
B D                Guinea pig  aggtg
                   Chinchilla  agatg
             Brush-tailed rat  aggtg
B D                       Cow  ggttg
B D                     Sheep  ggttg
                Domestic goat  ggttg
B D                     Horse  agttg
B D          White rhinoceros  agttg
B D                  Elephant  agttg
          Cape elephant shrew  --ttg
B D                   Manatee  atttg
             Cape golden mole  ----g
B D                    Tenrec  ----g
                     Aardvark  agatg
B D                 Armadillo  ----g
B D                   Opossum  ggaag
B D           Tasmanian devil  ggagg
B D                   Wallaby  gaagg
B D        American alligator  agagt
  D            Painted turtle  catac
  D  Chinese softshell turtle  gatat
  D    Spiny softshell turtle  cataa
B D                 Zebrafish  aaatg
     Mexican tetra (cavefish)  aaatg
      Lesser Egyptian jerboa  =====
B D                      Pika  -----
                Weddell seal  =====
B D                     Shrew  -----
B D                       Pig  -----
B D                    Rabbit  -----
B D                   Dolphin  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D            Naked mole-rat  -----
B D                       Cat  =====
B D                   Ferret   =====
             Star-nosed mole  -----
            Tibetan antelope  -----
              Bactrian camel  =====
B D                    Alpaca  =====
              Pacific walrus  =====
B D                     Panda  =====
                Killer whale  =====
B D                       Dog  =====

Inserts between block 5 and 6 in window
B D                Zebrafish 1bp
    Mexican tetra (cavefish) 45bp

Alignment block 6 of 593 in window, 160876603 - 160876642, 40 bps 
B D                     Human  ttctccatccttggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D                     Chimp  ttctccatcctcggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D                   Gorilla  ttctccatctttggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D                 Orangutan  ttctccatccttggg-------a--tctc-atg-gttggg----agga--g--agtt---ct
B D                    Gibbon  ttctccatccttggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D                    Rhesus  ttctccatccctggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D       Crab-eating macaque  ttctccatccctggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D                    Baboon  ttctccatccctggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D              Green monkey  ttctccatccctggg-------a--tctc-atg-gttggg----agga--g--aggt---ct
B D                  Marmoset  ttctccatccttgga-------a--cccc-atg-gttggg----ggga--g--aggt---tt
B D           Squirrel monkey  ttctccctccttggg-------a--cccc-atg-gttggg----ggga--g--aggt---ct
B D                  Bushbaby  ttctccatccttcgg-------a--tacc-ttg-tttggg----agaa--g--aggg---tt
           Chinese tree shrew  ctctccatccttggg-------a--cctc-atg-gttgag----agtg--g--aggt---ct
B D                  Squirrel  ttctccatccttagg-------a--ctgc-atg-attaag----agaa--g--agct---ct
B D                     Mouse  ttct-catgccttgg-------a--gccc-aca-a--tgg----agaa--g-----t---ca
B D                       Rat  gtctccatgcctggg-------a--gcct-gca-gattgg----agaa--g-----t---ct
B D            Naked mole-rat  ----------ctggg-------a--tctg-ata-gttggg----agaa--t--aagg---ca
B D                Guinea pig  ttctccatcactggg-------a--tccc-ata-gttgga----agaa--g--aagc---ct
                   Chinchilla  ctgtccatcactggg-------a--tccc-ata-gttgag----aata--g--agac---ct
             Brush-tailed rat  ttccacatccctggg-------a--tccc-aga-gttggg----agaa--g--gggt---ct
B D                    Rabbit  -tttccttcccagag-------a--gt----gg-agttgg----agac--a--aggt---cc
B D                      Pika  -tccctgtctctgac-------a--ttct-ggg-ttttga----atgc--a--gagt---ac
B D                       Pig  --ttctgtgt-ttcc-------atctctg-agg-acctggggttaggactg--ggct---cc
             Tibetan antelope  --ttccattt-ttcc-------atttctc-agg-gtctgggcttagga--gctggct---tc
B D                       Cow  ttctccatcc-tgga-------a--tccc-ata-atcggg----agga--g--agct---ct
B D                     Sheep  ttctccatcc-tgga-------a--tccc-ata-atcagg----agga--g--agct---ct
                Domestic goat  ttctccatcc-tgga-------a--tccc-ata-atcagg----agga--g--agct---ct
B D                     Horse  ttccccatccttggg-------a--tccc-atg-gttggg----agaa--g--acgt---ct
B D          White rhinoceros  ttctccatccttggg-------a--tccc-atg-gttcgg----agaa--g--aggt---ct
B D                     Shrew  --cacagcag-ctgg-------t--tctctgtg-gccagg----atgc-----agctcagcg
              Star-nosed mole  --ctcagttt-tccc-------t--tctctgagcactggg----gtga--g-gagctgggtt
B D                  Elephant  ttccccatccttgga-------a--tccc-agg-tttggg----agaa--g--agtt---ct
          Cape elephant shrew  ttctccatttgtgga-------g--tccc-agg-ttt-gg----agaa--g--catt---ct
B D                   Manatee  ttccccatctttggg-------c--tccc-agg-tttggg----agaa--g--agtt---ct
             Cape golden mole  ttttgtgtctccaag-------t--accc-agg-agt--g----tgac--------------
B D                    Tenrec  ttttctgaattcagg-----------cct-ggg-agtcag----ttgc--g--gg-------
                     Aardvark  ttccccatccttggg-------a--tcca-agc-tttggg----agaa--g--agtt---ct
B D                 Armadillo  ttttctctcccagtg-----------tcc-agg-gttggg----agct--g--agtt---tg
B D                   Opossum  ttatccattcctgaatctgcaaa--tggc-tgg-ttccag----aatg--t--caaa---gt
B D           Tasmanian devil  ttatccatccatgaaactgacaa--tttc-tag-tttcag----aatg--a--cacc---at
B D                   Wallaby  ttacccatttctgaatctgccaa--tatc-tgt-ttctag----aatg--g--caca---ct
B D        American alligator  ctctctctccaggga-------g--tggc-ctt-ggcagg----tgtg--a--agtc-----
  D            Painted turtle  ttctcctcccaggga-------g--tagc-tcc-ggcagg----agcg--a--agca-----
  D  Chinese softshell turtle  ttctcctcccaggga-------g--cagg-ccg-ggctgg----aagg--g--agca-----
  D    Spiny softshell turtle  gtctcctgccaggga-------g--cagc-tct-ggctgg----aagg--a--ggca-----
B D                 Zebrafish  ------taaactgtg-------a--ttac-aac-aaagga----aaga--a--aggt---tt
      Lesser Egyptian jerboa  ==============================================================
                Weddell seal  ==============================================================
B D                   Dolphin  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
         Pundamilia nyererei  ==============================================================
                 Zebra mbuna  ==============================================================
       Burton's mouthbreeder  ==============================================================
         Princess of Burundi  ==============================================================
B D                       Cat  ==============================================================
B D                   Ferret   ==============================================================
              Bactrian camel  ==============================================================
B D                    Alpaca  ==============================================================
              Pacific walrus  ==============================================================
B D                     Panda  ==============================================================
                Killer whale  ==============================================================
B D                       Dog  ==============================================================

Alignment block 7 of 593 in window, 160876643 - 160876644, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  gg
           Chinese tree shrew  gg
B D                  Squirrel  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  gc
B D                Guinea pig  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  tg
B D                      Pika  tg
B D                       Pig  ac
             Tibetan antelope  ct
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                     Shrew  ag
              Star-nosed mole  gg
B D                  Elephant  gt
          Cape elephant shrew  at
B D                   Manatee  gc
                     Aardvark  ct
B D                 Armadillo  gg
B D                   Opossum  gg
B D           Tasmanian devil  gg
B D                   Wallaby  tg
B D                  Platypus  gg
B D        American alligator  at
  D            Painted turtle  gc
  D  Chinese softshell turtle  gt
  D    Spiny softshell turtle  gc
B D                 Zebrafish  g-
      Lesser Egyptian jerboa  ==
                Weddell seal  ==
            Cape golden mole  --
B D                   Dolphin  ==
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Tenrec  --
B D                       Cat  ==
B D                   Ferret   ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==

Alignment block 8 of 593 in window, 160876645 - 160876653, 9 bps 
B D                     Human  gttccctcc
B D                     Chimp  gttccctcc
B D                   Gorilla  gttccctcc
B D                 Orangutan  gttccctcc
B D                    Gibbon  gttccctct
B D                    Rhesus  gttccctcc
B D       Crab-eating macaque  gttccctcc
B D                    Baboon  gttccctcc
B D              Green monkey  gttccctcc
B D                  Marmoset  ctattctac
B D           Squirrel monkey  ctgttctac
B D                  Bushbaby  g--ccccac
           Chinese tree shrew  atcctcttc
B D                  Squirrel  gtcccgtcg
B D                     Mouse  g-ccaatcc
B D                       Rat  g-tccaccc
B D            Naked mole-rat  atgtcatag
B D                Guinea pig  at-ccatag
                   Chinchilla  gtcccatag
             Brush-tailed rat  gtcccatag
B D                    Rabbit  gtcccacag
B D                      Pika  gtctcacac
B D                       Pig  gtctcccac
             Tibetan antelope  gtctcacac
B D                       Cow  atctcatat
B D                     Sheep  gtctcatat
                Domestic goat  gtctcatat
B D                     Horse  gtcccatgc
B D          White rhinoceros  gtctcagtc
B D                     Shrew  gacaccagg
              Star-nosed mole  gtctcccag
B D                  Elephant  accccatac
          Cape elephant shrew  gattttcac
B D                   Manatee  accccatac
             Cape golden mole  -----acac
B D                    Tenrec  --cctgcac
                     Aardvark  g-cccatac
B D                 Armadillo  gttccacac
B D                  Platypus  gcctcttcc
B D        American alligator  gttatctca
  D            Painted turtle  gtcgttcac
  D  Chinese softshell turtle  gttctttac
  D    Spiny softshell turtle  gtccttcac
                  Spotted gar  gtcctcgcc
      Lesser Egyptian jerboa  =========
                Weddell seal  =========
B D                   Dolphin  =========
B D           Tasmanian devil  ---------
    Mexican tetra (cavefish)  =========
B D                 Zebrafish  ---------
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D                   Opossum  ---------
B D                   Wallaby  ---------
B D                       Cat  =========
B D                   Ferret   =========
              Bactrian camel  =========
B D                    Alpaca  =========
              Pacific walrus  =========
B D                     Panda  =========
                Killer whale  =========
B D                       Dog  =========

Alignment block 9 of 593 in window, 160876654 - 160876658, 5 bps 
B D                     Human  caca---a
B D                     Chimp  caca---a
B D                   Gorilla  caca---a
B D                 Orangutan  caca---a
B D                    Gibbon  caca---a
B D                    Rhesus  caca---a
B D       Crab-eating macaque  caca---a
B D                    Baboon  caca---a
B D              Green monkey  caca---a
B D                  Marmoset  caca---a
B D           Squirrel monkey  caca---a
B D                  Bushbaby  ccca---g
           Chinese tree shrew  caca---a
B D                  Squirrel  tctg---a
B D                     Mouse  cgca---g
B D                       Rat  caca---g
B D            Naked mole-rat  caag---a
B D                Guinea pig  tgca---a
                   Chinchilla  caca---a
             Brush-tailed rat  caca---a
B D                    Rabbit  caca---g
B D                      Pika  tgca---g
B D                       Pig  cacc---c
             Tibetan antelope  caca---c
B D                       Cow  caca---a
B D                     Sheep  caca---a
                Domestic goat  caca---a
B D                     Horse  cgag---g
B D          White rhinoceros  catg---a
B D                     Shrew  agtggccg
              Star-nosed mole  cacg---g
B D                  Elephant  catg---a
          Cape elephant shrew  catg---a
B D                   Manatee  caca---a
             Cape golden mole  caca---g
B D                    Tenrec  caga---c
                     Aardvark  agtg---a
B D                 Armadillo  tggc---g
B D                  Platypus  caag---a
B D        American alligator  tcgg---g
  D            Painted turtle  tgga---g
  D  Chinese softshell turtle  tgcg---g
  D    Spiny softshell turtle  tggg---g
B D              Nile tilapia  caca---a
          Princess of Burundi  caca---a
        Burton's mouthbreeder  caca---a
                  Spotted gar  tgca----
      Lesser Egyptian jerboa  ========
                Weddell seal  ========
B D                   Dolphin  ========
B D           Tasmanian devil  --------
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  --------
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
B D                   Opossum  --------
B D                   Wallaby  --------
B D                       Cat  ========
B D                   Ferret   ========
              Bactrian camel  ========
B D                    Alpaca  ========
              Pacific walrus  ========
B D                     Panda  ========
                Killer whale  ========
B D                       Dog  ========

Alignment block 10 of 593 in window, 160876659 - 160876662, 4 bps 
B D                     Human  aa--------------ct
B D                     Chimp  aa--------------ct
B D                   Gorilla  aa--------------ct
B D                 Orangutan  ag--------------ct
B D                    Gibbon  ag--------------ct
B D                    Rhesus  ag--------------ct
B D       Crab-eating macaque  ag--------------ct
B D                    Baboon  ag--------------ct
B D              Green monkey  ag--------------ct
B D                  Marmoset  ag--------------ct
B D           Squirrel monkey  ag--------------ct
B D                  Bushbaby  ca--------------ct
           Chinese tree shrew  ag--------------ct
B D                  Squirrel  ag--------------tt
B D                     Mouse  ag--------------tt
B D                       Rat  ag--------------tt
B D            Naked mole-rat  ag--------------gt
B D                Guinea pig  at--------------gt
                   Chinchilla  ag--------------gt
             Brush-tailed rat  ag--------------gc
B D                    Rabbit  ag--------------ct
B D                      Pika  ag--------------ct
B D                       Pig  ag--------------ct
             Tibetan antelope  ag--------------ct
B D                       Cow  gg--------------ct
B D                     Sheep  gg--------------ct
                Domestic goat  gg--------------ct
B D                     Horse  ag--------------ct
B D          White rhinoceros  ag--------------ct
B D                     Shrew  gg--------------cg
              Star-nosed mole  gg--------------cc
B D                  Elephant  ag----------------
          Cape elephant shrew  ag--------------ca
B D                   Manatee  at--------------ct
             Cape golden mole  ac--------------ct
B D                    Tenrec  aa--------------ct
                     Aardvark  ag--------------ct
B D                 Armadillo  ag--------------ct
B D                  Platypus  aggggaagctgggccgcc
B D        American alligator  ga--------------cg
  D            Painted turtle  aa--------------cg
  D  Chinese softshell turtle  ca--------------cg
  D    Spiny softshell turtle  ta--------------cg
B D              Nile tilapia  at--------------cc
          Princess of Burundi  at--------------cc
        Burton's mouthbreeder  at--------------cc
B D                 Zebrafish  at--------------ct
     Mexican tetra (cavefish)  ga--------------at
                  Spotted gar  ----------------c-
      Lesser Egyptian jerboa  ==================
                Weddell seal  ==================
B D                   Dolphin  ==================
B D           Tasmanian devil  ------------------
         Pundamilia nyererei  ==================
                 Zebra mbuna  ==================
B D                   Opossum  ------------------
B D                   Wallaby  ------------------
B D                       Cat  ==================
B D                   Ferret   ==================
              Bactrian camel  ==================
B D                    Alpaca  ==================
              Pacific walrus  ==================
B D                     Panda  ==================
                Killer whale  ==================
B D                       Dog  ==================

Inserts between block 10 and 11 in window
B D       American alligator 14bp
  D           Painted turtle 14bp
  D Chinese softshell turtle 14bp
  D   Spiny softshell turtle 14bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp

Alignment block 11 of 593 in window, 160876663 - 160876663, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                     Shrew  t
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                  Platypus  c
B D        American alligator  t
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
           Southern platyfish  c
B D                 Zebrafish  g
     Mexican tetra (cavefish)  t
                  Spotted gar  t
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                   Dolphin  =
B D           Tasmanian devil  -
         Pundamilia nyererei  =
                 Zebra mbuna  =
B D                   Opossum  -
B D                   Wallaby  -
B D                       Cat  =
B D                   Ferret   =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =

Alignment block 12 of 593 in window, 160876664 - 160876823, 160 bps 
B D                     Human  tcaacgatagaatagaagcacagctgcct-cagttatctcacggctgctgctgtaaccaacatgagttcc
B D                     Chimp  tcaacgatagaatagaagcacagctgcct-cagttatctcacggctgctgctggaaccaacatgagttcc
B D                   Gorilla  tcaacgatagaatagaagcacagctgcct-cagttatctcacggctgctgctgtaaccaacatgagttcc
B D                 Orangutan  tcaacgatagaatagaagcacagctgcct-cagttatctcacggctgctgctgtaaccaacatgagttcc
B D                    Gibbon  tcaacgatagaatagaagcacagctgcct-cagttatctcacggctgctgctgtaaccaacatgagttcc
B D                    Rhesus  tcaatgatagaatagaagcacagctgcct-cagttatctcccggctgctgctgtaaccaacatgagttcc
B D       Crab-eating macaque  tcaatgatagaatagaagcacagctgcct-cagttatctcccggctgctgctgtaaccaacatgagttcc
B D                    Baboon  tcaatgatagaatagaagcacagctgcct-cagttatctcccggctgctgctgtaaccaacatgagttcc
B D              Green monkey  tcaatgatagaatagaagcacagctgcct-cagttatctcccggctgctgctgtaaccaacatgagttcc
B D                  Marmoset  tcaacggtagaatagaagcacagctgcct-ccgttatcacccggctgctgctgcaaccaacatgagttcc
B D           Squirrel monkey  tcaacggtagaatagaagcacagctgcct-ctgttatctcccggctgctgctgaaaccaacatgagttcc
B D                  Bushbaby  tcaatggtagaatagaagcacagatgcct-ccgttatctcccggttgttgctggcactaacatgagttcc
           Chinese tree shrew  tcaacggtagaataaaagtacggctgcct-cagttatctcccgactattgctagaatctgtttgagctcc
B D                  Squirrel  tcaacgatagaagagaagcacagctgcct-ctgttatctccctgctgctgctgtaagaagcatgagatcc
B D                     Mouse  tcagcgataaaacagaagcacagctgctt-cagttatcttccggctactgctgtacccattgtgagttcc
B D                       Rat  tcagcgatagaacagaagcacggctgctt-cagttatcgcccggctactgctgtacccagtgtgagttcc
B D            Naked mole-rat  tcagcgatagaacaaaagtacagctgcct-ctgttatctcttggctgctcctcaatccaatatgagttcc
B D                Guinea pig  tcagcgatagaatagaagcacagctgctt-cagttatctcccgactgctactccaatgagcatgagctcc
                   Chinchilla  tcagcgatagaacagaagcacagctgctt-cagttatctcccggctgctactccaaccagtatgagttcc
             Brush-tailed rat  tcagcgatagaacagaaacacggccgcct-ccgtgatctcccgactgcagctccagccactgtgagcagc
B D                    Rabbit  tcatttgtagaacaacagcacagcagcct-cagtgatctcccggctactactgtagccctcatgagttcc
B D                      Pika  tcatctgtagaacaggagcacagctgcct-cggtgatctcccggctgctgctgtagccctgatgggttcc
B D                       Pig  tcagcggtagaacaggagcacagcagcct-cagttatctcccggctggagctgtaagcaacgtgtcttcc
             Tibetan antelope  tcagcggtagaacaggagcacagctgcct-cagtgatctcccggctggagctgtaaccccagtgagctcc
B D                       Cow  tcaacaatagaa-acaagcatagctgcct-cacttatccccaaggtgttgctgaaattagtttgagttgc
B D                     Sheep  tcaataatagaa-acaagcatagctgcct-cagttatccccaagctattgctgaaattagtttgaattgc
                Domestic goat  tcaataatagaa-acaagcatagctgcct-cagttatccccaagctgttgctgaaattaatttgagttgc
B D                     Horse  tcactgatagatgaaaagcacagctgcct-cagttgtctccagcctgttgctaaaactagcatgagttct
B D          White rhinoceros  tcacaggcagaacaaatgcacagctgcctccagttatctcccagcttttgcagaaagtagcatgagttcc
B D                     Shrew  tcagcggtagaagagcagcacggccgcct-cggtgatggcgcggctgttgctgccttcagtgtgagtccc
              Star-nosed mole  tcactggtagaacaggagcacagccgcct-ctgttat-gctccgctgttactccaatgaacgtgggctcc
B D                  Elephant  tcatttgtagaacaggagcacagctgcct-cggttacctccgggctactgctaaaaccaacctgagttcc
          Cape elephant shrew  tcatctgtagaacaggagcacagttgatt-cggttatatcccgactattgctataaccaatatgcgttcc
B D                   Manatee  tcatttgtagaacaggagcaccgttgcct--ggttatctcccggctactgctaaaactaaccccagttcc
             Cape golden mole  tcatcggtagaacaggagaacggctgcct-ccgttatctccttgctgctgctgtagtggctgtgagttcc
B D                    Tenrec  tcatccatagaaccgaa--------gcct-ccattatc-ccccgctgtggctgcacaaccagtgaattcc
                     Aardvark  tcatttgtagaacaggagcactgttgcct-cggttatctcccagctactgctgtgaccaatgggagctcc
B D                 Armadillo  tcatttatagaacaagagcacagctgcct-cggttatctcccggctggagctgtaaccactgtgagttcc
B D                   Opossum  tcatctatagaacaggagcacagcagcct-ctattatctcccgactgctgctataaccagtatgagttcc
B D           Tasmanian devil  tcatctgtagaagaggagcacagcagcct-ctgtgatctcccgactgttgctataagcattatgagttcc
B D                   Wallaby  tcatttgtagaacaggagcacagcagcct-ctgttatctcccaactgctgctatagccaacatgagttcc
B D                  Platypus  tcagcggtagaacaggagcacggccgcct-cggtgatatcccggctggcgctgtagcccctgtgggtccc
B D        American alligator  tcagcggtagaacagcagcaccgcagact-ctgccatctctttggacacgctccagctctcatgggttgc
  D           Green seaturtle  tcagcggtagaacagcagcacggcggatt-caatcatctccttggatacgctccagtgctgatgggttcc
  D            Painted turtle  tcagcggtagaacagcagcacggcggatt-caatcatctccttggatacgctccagtgccgatggattcc
  D  Chinese softshell turtle  tcagcggtagaagagcagcactgcggatt-caagcatctccttggatacgctccagccccgatgggttcc
  D    Spiny softshell turtle  tcagcggtagaagagcagcactgcggatt-caagcatctccttggatacgctatagccccgatgagttcc
B D             X. tropicalis  ttaacggtataagagcagcacagctgcct-cggtaatctctttgcttgcactccatcctgcgtgtgtccc
B D              Nile tilapia  tcagcggtaaaacagtaagacagcagcct-cggtcatctctctggaggcgctccagccttgctccctgcc
          Princess of Burundi  tcagcggtaaaacagtaagacagcagcat-cggtcatctctctggaggcgctccagccttgctccctgcc
        Burton's mouthbreeder  tcagcggtaaaacagtaagacagcagcct-cagtcatctctctggaggtgctccagccttgcatcccacc
           Southern platyfish  tcagcggtaaaacagaaggactgcagact-ccgtcatctccttggaggcactccagccttgatctcttcc
B D                 Zebrafish  tcagcgataaaagagaagcaccgctgctt-cagttatctctctggaagcactccaatctgcattagtgcc
     Mexican tetra (cavefish)  tcagcggtaaaatagaaacacagcagcct-cagtgatcgttttggaggcactccaatctgcatttgtccc
                  Spotted gar  tcagcggtagaaaagcagcattgcggact-ccgtcatctctctagaggcactccagccttggtgagtccc
      Lesser Egyptian jerboa  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
B D                       Cat  ======================================================================
B D                   Ferret   ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
                Killer whale  ======================================================================
B D                       Dog  ======================================================================

                        Human  atatccactccaatcaaaaccagaaaaatctccac---actgctggggactggcctctggaaagtatcct
                        Chimp  atatccactccaatcaaaaccagaaaaatctccac---actgccggggactagactctggaaagtatcct
                      Gorilla  atatccactccaatcaaaaccagaaaaatctccac---actgccggggactggactctggaaagtatcct
                    Orangutan  atatccactccaatcaaaaccagaaaaatctccac---actgccagggaccagactctggaaagcatcct
                       Gibbon  atatccactccaatcaaaaccagaaaaatctccac---actgagagggactagactctggaaagtatcca
                       Rhesus  atatccactccaatcaaaactagaaaaatctccac---actgccggggactagactctggaaagtatcct
          Crab-eating macaque  atatccactccaatcaaaaccagaaaaatctccac---actgccggggactagactctggaaaatatcct
                       Baboon  atatccactccaatcaaaactagaaaaatctccac---actgccggggactagcctctggaaagtatcct
                 Green monkey  atatccactccaatcaaaactagaaaaatctccac---actgccggggactagcctctggaaagtatcct
                     Marmoset  atatccatcccaatcaaaactagaaaaatctccac---actgccgggggttagcctctgggaagaatcct
              Squirrel monkey  atatccattccaatcaaaaccagaaaaatctccac---actgccaggggctagactctgggaagaatcct
                     Bushbaby  atattccttccagtcaaaggcagagaaacccctac---actgcctggaatgggcctctggga---accct
           Chinese tree shrew  atatccatcccaatcaaaagcagagaaatccccac---actgtcggggattgccctgggggaagaatcct
                     Squirrel  atatccattccagtcgaaagcagagaagtctccac---actgatagggatcactctctgggaagtaccct
                        Mouse  atatccatcccaatcaaatgacgcaaagtctccac---actgcacggggttaccttctgggaagaatcct
                          Rat  gtatccgttccaatcaaacgccccgaagtctccac---actgcctggggttaccttctggaaagaatcct
               Naked mole-rat  ataaccattccaatcaaaggcagagaagtctccac---actgcacaggatttccctgtgggaagtatcct
                   Guinea pig  atatccattccagtcaaaggaagaaaaatcgccac---actgcaatggattgccttctgggaagaatcct
                   Chinchilla  atatccattccaatcaaaggaggaaaaatctccac---actgtaaaggactgccttctgggaagaatcct
             Brush-tailed rat  gtatccattccagtcaaaggcagaaaagtctccac---actgcacaggatggccttctgggaagtatcct
                       Rabbit  atgtccattccagtcaagagaggagaaatccccac---actgcctgggattgccctctgggatgaatcct
                         Pika  atatccactgtagtcaaaggcagagaaatctccac---attccaagggactgctctcagggaagtatcct
                          Pig  atatccgttccagtcaaaggcggagaaatccccac---actgcgcaggtttgcgctctgggaagaatcct
             Tibetan antelope  gtatccattccaatcaaaggaggagaaatccccac---actgcactggattgccctctgggaagaatcct
                          Cow  acatctatgccaaccaaaaccagagaaacccccac---tctgcaaggggttagactctgggaagattact
                        Sheep  acatccatgccaaccaaaaccagagaaccccccac---tctgcaaggggttagactttgggaagattact
                Domestic goat  acatccatgccaaccaaaaccagagaaccccccac---tctgcaaggggttagactttgggaagattact
                        Horse  gtatctatgccaatcaaaaccacagaaatccccccaaaactgcaaggggtcag-ctctggggagaatcct
             White rhinoceros  atatctattccaat-gaaaccacagaaatcctcccaaaactgcaaggggttagactcaggggagaaccct
                        Shrew  gtacccatcccagtcaaaaccggagaagtccccgc---actgctttgggtcaccctgcgggaagtagcca
              Star-nosed mole  acatccattccaatcataggcggagaaatccccac---actgccagggttgaaactcaggaaagaatcct
                     Elephant  atacacattccagtcaaaaccagcaaaatcctcac---gctgccagggattggagtctggggagtatctt
          Cape elephant shrew  atatccactcccatcaaagctagagaaatcgccac---actccctgggattggcttctgggaagtatcct
                      Manatee  atacccattccagtcaaaaccagggaaatctccac---actgccagaggtcggactccgggaagtatcct
             Cape golden mole  atatccattccagtcaaaggaagagaaatctccgc---actgccggggatttccctctgggaaaaatcct
                       Tenrec  atatccatcccaatccgaagcagagagttccccac---cctgcctgggattgtcctctgaaaagaatcca
                     Aardvark  atatccattccagtcgaaaccagagaaatccccac---actgccagggactggactctgtgaagtatcgt
                    Armadillo  gtatccattccagtcataggaggagaagtccccac---actgcacaggattgccctctgcgaagaatcct
                      Opossum  atagccattccagtcaaaggcagagaaatctccac---attgcctgggagccccttctggaaagtatcca
              Tasmanian devil  ataaccattccagtcgaaggcagagaaatccccac---attgcctgggagatccttctgggaagaatcct
                      Wallaby  atagccattccagtcaaaggaagagaaatccccac---actgcttgggattcccttctgggatgaatcct
                     Platypus  gaacccgtcccagtcgaaggaggagaagtctccgc---actgtctgggggctgcttccgggaagtgcccc
           American alligator  atagccagtccagttgaaggcggggaaatcaccac---actgtcttgggtttgcttctgggaagaaacct
              Green seaturtle  gtagccgttccagtcaaaggcagggaaatcgccgc---actgaatcgggttcccttctgggaagaaccct
               Painted turtle  atagccgtcccaggcaaaggcaggaaaatcgctgc---actgaaccgggttcccttctgcgaagaaccct
     Chinese softshell turtle  gtagccgtcccaggcaaaggcagtgaaatctccgc---actgagctgggttcccttctgggaagaaccct
       Spiny softshell turtle  gtagccatcccaggcaaaggcagtgaaatcgccgc---actgcactgggttcccttccgggaagaaccct
                X. tropicalis  atagccatcccaatcaaaggctgaaaagtctccac---actgtctggggcttccttcggggaagtaacca
                 Nile tilapia  cagtctgtcgtagtcaaatgatgggaagtccccac---actggtcagg---------atggaaatatcct
          Princess of Burundi  cagtctgtcgtagtcaaatgatgggaagtccccac---actggtcagg---------gtggaaatatcct
        Burton's mouthbreeder  cagtctgtcgtagtcaaatgatgggaagtccccac---actgctcagg---------gtggaaatatcct
           Southern platyfish  cagcctgtcccagtcaaaagatggaaaatctccac---attggtctgg---------gtggaaatatcct
                    Zebrafish  atagccactccagtcaaaacttgtaaaatctccac---attgtctagg---agattcaggaaagtgtcca
     Mexican tetra (cavefish)  gtagccgttccagtcaaaaccggcaaaatctccac---actgtttaggtgccgcttccgggaaatgccct
                  Spotted gar  atagccatcccagtcaagtcctgtaaaatctccac---actgccttccaccaccttccgcaaaatatcct
       Lesser Egyptian jerboa  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
                          Cat  ======================================================================
                      Ferret   ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
                        Panda  ======================================================================
                 Killer whale  ======================================================================
                          Dog  ======================================================================

                        Human  cctccaccaatgcagtgctgggaa
                        Chimp  cctccaccaatgcagtgctgggaa
                      Gorilla  cctccaccaatgcagtgctgggaa
                    Orangutan  cctccaccaatgcagtgctgggaa
                       Gibbon  cctccaccaatgcagtgctgggaa
                       Rhesus  cctccaccaatgcagtgctgggaa
          Crab-eating macaque  cctccaccaatgcagtgctgggaa
                       Baboon  cctccaccaatgcagtgctgggaa
                 Green monkey  cctccaccaatgcagtgctgggaa
                     Marmoset  cctccaccaatgcagtgctaagaa
              Squirrel monkey  cctccaccaatgcagtgctaagaa
                     Bushbaby  cctccaccgatgcagtgctgggaa
           Chinese tree shrew  cctccaccaatgcagtgctgggaa
                     Squirrel  cctccaccgatgcagtgctaggaa
                        Mouse  cctccaccgatgcagtgctggaaa
                          Rat  cctccaccgatgcagtgctggaaa
               Naked mole-rat  cctccaccaatgcagtgctacaaa
                   Guinea pig  cctccaccaatgcagtgctaggaa
                   Chinchilla  cctccaccaatgcagtgctaggag
             Brush-tailed rat  cctccaccaatgcagtgctaggaa
                       Rabbit  cctccaccaatgcagtgctggaaa
                         Pika  cctccaccaatgcagtgctgg-ga
                          Pig  cctccaccaatgcagtgct-ggga
             Tibetan antelope  cctccaccgatgcagtgctggggg
                          Cow  cctgcactgatccagtgcttagaa
                        Sheep  cctgcagtgacccagtgcttagaa
                Domestic goat  cctgaagtgacccagtgcttagaa
                        Horse  cctccaccaatgcagtgctgggaa
             White rhinoceros  cctccaccaatgccatactgggaa
                        Shrew  cctcctccgatgcagttct-ggaa
              Star-nosed mole  cctccactgatacaatgctgggaa
                     Elephant  cctccaccaatgcaatgctgaaaa
          Cape elephant shrew  cctccaccaatgcaatgctgaaat
                      Manatee  cctccaccaatgcaatgctgaaaa
             Cape golden mole  cctcctcctatacagtgctagata
                       Tenrec  cctccttcaacacagagctgggca
                     Aardvark  cctccaccaatgcaacgttgaaac
                    Armadillo  cctccaccaatgcagtgctgacag
                      Opossum  cctccaccaatgcagtgctgcaaa
              Tasmanian devil  cctccaccaatgcagtgctacaaa
                      Wallaby  cctccaccaatgcaatgctgcaaa
                     Platypus  ccaccgccgatgcagtgctggagg
           American alligator  ctgccgcctatgcagtgctggaag
              Green seaturtle  cctccacccacgcagtgctgggga
               Painted turtle  cctccacccaggcagtgctgggga
     Chinese softshell turtle  cctccacctatgcagtactgggga
       Spiny softshell turtle  cctccacctatgcagtgctgggga
                X. tropicalis  cctcctccaatgcagtgctgaaaa
                 Nile tilapia  cctcctcctatacagtactgcaaa
          Princess of Burundi  cctcctcctatacagtactgcaa-
        Burton's mouthbreeder  cctcctcctatacagtactgcaaa
           Southern platyfish  cctcctcctatgcagtactggaca
                    Zebrafish  cctccaccaatacagaac------
     Mexican tetra (cavefish)  cctcccccgatacagtactgcaac
                  Spotted gar  cctcctccaacgcagaactgcaat
       Lesser Egyptian jerboa  ========================
                 Weddell seal  ========================
                      Dolphin  ========================
          Pundamilia nyererei  ========================
                  Zebra mbuna  ========================
                          Cat  ========================
                      Ferret   ========================
               Bactrian camel  ========================
                       Alpaca  ========================
               Pacific walrus  ========================
                        Panda  ========================
                 Killer whale  ========================
                          Dog  ========================

Inserts between block 12 and 13 in window
B D             Nile tilapia 1424bp
       Burton's mouthbreeder 2288bp
          Southern platyfish 1bp

Alignment block 13 of 593 in window, 160876824 - 160876827, 4 bps 
B D                     Human  aca-a
B D                     Chimp  aca-a
B D                   Gorilla  aca-a
B D                 Orangutan  aca-a
B D                    Gibbon  aca-a
B D                    Rhesus  aca-a
B D       Crab-eating macaque  aca-a
B D                    Baboon  aca-a
B D              Green monkey  aca-a
B D                  Marmoset  aca-a
B D           Squirrel monkey  aca-a
B D                  Bushbaby  aca-a
           Chinese tree shrew  ata-a
B D                  Squirrel  aca-a
B D                     Mouse  aca-t
B D                       Rat  aca-c
B D            Naked mole-rat  aga-a
B D                Guinea pig  aca-a
                   Chinchilla  tgg-a
             Brush-tailed rat  aca-a
B D                    Rabbit  aca-c
B D                      Pika  aca-c
B D                       Pig  gca-g
             Tibetan antelope  gca-g
B D                       Cow  aca-a
B D                     Sheep  aca-a
                Domestic goat  aca-a
B D                     Horse  ata-a
B D          White rhinoceros  ata-a
B D                     Shrew  gca-g
              Star-nosed mole  gca-g
B D                  Elephant  ata-a
          Cape elephant shrew  ata-a
B D                   Manatee  ata-a
             Cape golden mole  tca-a
B D                    Tenrec  aca-a
                     Aardvark  aga-a
B D                 Armadillo  gga-g
B D                   Opossum  gga-g
B D           Tasmanian devil  gaa-g
B D                   Wallaby  gta-g
B D                  Platypus  agc-a
B D        American alligator  gaatc
  D           Green seaturtle  gag-a
  D            Painted turtle  aaa-a
  D  Chinese softshell turtle  gag-a
  D    Spiny softshell turtle  gag-a
B D             X. tropicalis  atg-g
          Princess of Burundi  aca-c
           Southern platyfish  aca-a
B D                 Zebrafish  ----t
     Mexican tetra (cavefish)  aca-t
                  Spotted gar  tca-a
      Lesser Egyptian jerboa  =====
                Weddell seal  =====
B D                   Dolphin  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
B D              Nile tilapia  =====
B D                       Cat  =====
B D                   Ferret   =====
              Bactrian camel  =====
B D                    Alpaca  =====
              Pacific walrus  =====
B D                     Panda  =====
                Killer whale  =====
B D                       Dog  =====

Inserts between block 13 and 14 in window
                 Spotted gar 417bp

Alignment block 14 of 593 in window, 160876828 - 160876828, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
B D                     Mouse  g
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  t
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  g
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D             X. tropicalis  a
          Princess of Burundi  a
           Southern platyfish  a
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                   Dolphin  =
                 Spotted gar  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
B D              Nile tilapia  =
B D                       Cat  =
B D                   Ferret   =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =

Inserts between block 14 and 15 in window
B D                  Wallaby 4304bp

Alignment block 15 of 593 in window, 160876829 - 160876830, 2 bps 
B D                     Human  g----a
B D                     Chimp  g----a
B D                   Gorilla  g----a
B D                 Orangutan  g----a
B D                    Gibbon  g----a
B D                    Rhesus  g----a
B D       Crab-eating macaque  g----a
B D                    Baboon  g----a
B D              Green monkey  g----a
B D                  Marmoset  g----a
B D           Squirrel monkey  g----a
B D                  Bushbaby  g----a
           Chinese tree shrew  g----a
B D                  Squirrel  g----a
B D                     Mouse  g----a
B D                       Rat  g----g
B D            Naked mole-rat  g----a
B D                Guinea pig  a----a
                   Chinchilla  g----a
             Brush-tailed rat  g----a
B D                    Rabbit  a----a
B D                      Pika  a----a
B D                       Pig  g----a
             Tibetan antelope  g----a
B D                       Cow  g----a
B D                     Sheep  g----a
                Domestic goat  g----a
B D                     Horse  g----a
B D          White rhinoceros  g----a
B D                     Shrew  g----a
              Star-nosed mole  a----a
B D                  Elephant  a----a
          Cape elephant shrew  g----a
B D                   Manatee  g----a
             Cape golden mole  g----a
B D                    Tenrec  gaacaa
                     Aardvark  g----a
B D                 Armadillo  a----a
B D                  Platypus  g----a
B D        American alligator  ----ca
  D           Green seaturtle  ----ca
  D            Painted turtle  ----ca
  D  Chinese softshell turtle  ----ca
  D    Spiny softshell turtle  ----ca
          Princess of Burundi  ----ca
           Southern platyfish  ----aa
B D                 Zebrafish  ----aa
     Mexican tetra (cavefish)  ----ac
      Lesser Egyptian jerboa  ======
                Weddell seal  ======
B D                   Dolphin  ======
B D             X. tropicalis  ------
                 Spotted gar  ======
B D           Tasmanian devil  ------
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
B D              Nile tilapia  ======
B D                   Opossum  ------
B D                   Wallaby  ======
B D                       Cat  ======
B D                   Ferret   ======
              Bactrian camel  ======
B D                    Alpaca  ======
              Pacific walrus  ======
B D                     Panda  ======
                Killer whale  ======
B D                       Dog  ======

Inserts between block 15 and 16 in window
          Southern platyfish 433bp
B D                Zebrafish 2bp
    Mexican tetra (cavefish) 2bp

Alignment block 16 of 593 in window, 160876831 - 160876832, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  gg
           Chinese tree shrew  ac
B D                  Squirrel  gt
B D                     Mouse  ga
B D                       Rat  aa
B D            Naked mole-rat  aa
B D                Guinea pig  gt
                   Chinchilla  g-
             Brush-tailed rat  gg
B D                    Rabbit  ga
B D                       Pig  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  ga
B D          White rhinoceros  ga
B D                     Shrew  gg
              Star-nosed mole  aa
B D                  Elephant  ca
          Cape elephant shrew  ca
B D                   Manatee  ca
             Cape golden mole  ga
B D                    Tenrec  gg
                     Aardvark  ca
B D                 Armadillo  gg
B D                  Platypus  ga
B D        American alligator  ga
  D           Green seaturtle  ga
  D            Painted turtle  gg
  D  Chinese softshell turtle  ga
  D    Spiny softshell turtle  ga
B D             X. tropicalis  aa
          Princess of Burundi  ga
B D                 Zebrafish  ga
     Mexican tetra (cavefish)  aa
      Lesser Egyptian jerboa  ==
B D                      Pika  --
                Weddell seal  ==
B D                   Dolphin  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D           Tasmanian devil  --
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
B D              Nile tilapia  ==
B D                   Opossum  --
B D                   Wallaby  ==
B D                       Cat  ==
B D                   Ferret   ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==

Inserts between block 16 and 17 in window
B D                   Rabbit 25bp
B D                 Platypus 1bp
B D            X. tropicalis 2bp
         Princess of Burundi 1368bp

Alignment block 17 of 593 in window, 160876833 - 160876834, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  ag
B D                  Squirrel  gg
B D                     Mouse  ag
B D                       Rat  aa
B D            Naked mole-rat  ag
B D                Guinea pig  ag
             Brush-tailed rat  gc
B D                      Pika  -g
             Tibetan antelope  ag
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gc
B D          White rhinoceros  gg
B D                     Shrew  ga
              Star-nosed mole  ga
B D                  Elephant  gg
          Cape elephant shrew  ga
B D                   Manatee  gg
             Cape golden mole  ag
B D                    Tenrec  gg
                     Aardvark  ag
B D                 Armadillo  ag
B D                  Platypus  gg
B D        American alligator  at
  D           Green seaturtle  gg
  D            Painted turtle  gg
  D  Chinese softshell turtle  gg
  D    Spiny softshell turtle  gg
B D             X. tropicalis  gg
B D                 Zebrafish  aa
     Mexican tetra (cavefish)  aa
      Lesser Egyptian jerboa  ==
                Weddell seal  ==
B D                       Pig  --
B D                    Rabbit  ==
B D                   Dolphin  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D           Tasmanian devil  --
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D                   Opossum  --
                  Chinchilla  --
B D                   Wallaby  ==
B D                       Cat  ==
B D                   Ferret   ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==

Inserts between block 17 and 18 in window
  D           Painted turtle 1bp
B D            X. tropicalis 257bp

Alignment block 18 of 593 in window, 160876835 - 160876835, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  g
B D                     Mouse  c
B D                       Rat  g
B D            Naked mole-rat  a
B D                Guinea pig  a
             Brush-tailed rat  a
B D                      Pika  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D        American alligator  c
  D           Green seaturtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  g
B D             X. tropicalis  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                       Pig  -
B D                    Rabbit  =
B D                   Dolphin  =
                 Spotted gar  =
          Southern platyfish  =
B D           Tasmanian devil  -
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                   Opossum  -
                  Chinchilla  -
B D                  Platypus  -
B D                   Wallaby  =
B D                       Cat  =
B D                   Ferret   =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =

Inserts between block 18 and 19 in window
B D                    Shrew 3bp
             Star-nosed mole 7bp
B D       American alligator 2bp
  D          Green seaturtle 2bp
  D Chinese softshell turtle 2bp
  D   Spiny softshell turtle 2bp

Alignment block 19 of 593 in window, 160876836 - 160876836, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  t
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  g
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  g
B D                Guinea pig  g
             Brush-tailed rat  g
B D                      Pika  a
B D                  Elephant  a
B D                   Manatee  a
B D                  Platypus  a
B D        American alligator  a
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D             X. tropicalis  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                     Shrew  =
B D                       Pig  -
B D                    Rabbit  =
            Cape golden mole  -
                    Aardvark  -
B D                   Dolphin  =
                 Spotted gar  =
          Southern platyfish  =
B D           Tasmanian devil  -
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D                   Opossum  -
                  Chinchilla  -
         Cape elephant shrew  -
B D                   Wallaby  =
B D                    Tenrec  -
B D                       Cat  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D          White rhinoceros  -
B D                     Horse  -
B D                 Armadillo  -
B D                       Cow  -

Inserts between block 19 and 20 in window
B D            X. tropicalis 1385bp

Alignment block 20 of 593 in window, 160876837 - 160876839, 3 bps 
B D                     Human  gag-
B D                     Chimp  gag-
B D                   Gorilla  gag-
B D                 Orangutan  gag-
B D                    Gibbon  gag-
B D                    Rhesus  ggg-
B D       Crab-eating macaque  ggg-
B D                    Baboon  ggg-
B D              Green monkey  ggg-
B D                  Marmoset  gag-
B D           Squirrel monkey  gag-
           Chinese tree shrew  ggc-
B D                  Squirrel  gg--
B D                     Mouse  ag--
B D                       Rat  ag--
B D            Naked mole-rat  gaa-
B D                Guinea pig  gag-
             Brush-tailed rat  aac-
B D                      Pika  gaa-
B D                       Pig  --a-
B D                       Cow  --a-
B D                     Sheep  --a-
                Domestic goat  --a-
B D                     Horse  --a-
B D          White rhinoceros  --a-
B D                     Shrew  --a-
              Star-nosed mole  --g-
B D                  Elephant  gtg-
B D                   Manatee  gaa-
             Cape golden mole  gaa-
B D                    Tenrec  gga-
                     Aardvark  --g-
B D                 Armadillo  aga-
B D                   Opossum  -aa-
B D           Tasmanian devil  -aa-
B D                  Platypus  ggg-
B D        American alligator  g---
  D           Green seaturtle  g---
  D            Painted turtle  g---
  D  Chinese softshell turtle  g---
  D    Spiny softshell turtle  g---
B D                 Zebrafish  -agg
     Mexican tetra (cavefish)  -aaa
      Lesser Egyptian jerboa  ====
                Weddell seal  ====
B D                    Rabbit  ====
B D                   Dolphin  ====
B D             X. tropicalis  ====
                 Spotted gar  ====
          Southern platyfish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
                  Chinchilla  ----
         Cape elephant shrew  ----
B D                   Wallaby  ====
B D                       Cat  ====
B D                  Bushbaby  ----
B D                   Ferret   ====
            Tibetan antelope  ====
              Bactrian camel  ====
B D                    Alpaca  ====
              Pacific walrus  ====
B D                     Panda  ====
                Killer whale  ====
B D                       Dog  ====

Inserts between block 20 and 21 in window
B D                 Squirrel 7bp
B D                    Mouse 6987bp
B D       American alligator 946bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 21 of 593 in window, 160876840 - 160876840, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  a
B D                       Pig  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                  Platypus  g
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                    Rabbit  =
  D    Spiny softshell turtle  =
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                   Wallaby  =
B D                       Cat  =
B D                  Bushbaby  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                  Squirrel  =

Inserts between block 21 and 22 in window
B D                      Pig 2bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                    Shrew 1121bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                 Platypus 869bp

Alignment block 22 of 593 in window, 160876841 - 160876841, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  t
B D            Naked mole-rat  a
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                      Pika  c
              Star-nosed mole  c
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  t
B D                 Armadillo  g
B D                   Opossum  t
B D           Tasmanian devil  t
  D           Green seaturtle  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D                 Zebrafish  c
     Mexican tetra (cavefish)  c
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                     Shrew  =
B D                       Pig  =
B D                    Rabbit  =
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  =
B D                  Bushbaby  -
B D                   Ferret   =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                       Cow  =

Alignment block 23 of 593 in window, 160876842 - 160876842, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  t
B D                       Pig  a
B D                       Cow  t
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  t
B D          White rhinoceros  t
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  c
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  c
B D                   Opossum  g
B D           Tasmanian devil  g
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D             X. tropicalis  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                     Shrew  =
B D                    Rabbit  =
B D                   Dolphin  =
                 Spotted gar  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  =
B D                  Bushbaby  -
B D                   Ferret   =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                  Squirrel  =

Inserts between block 23 and 24 in window
B D                      Pig 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
             Star-nosed mole 1357bp
B D            X. tropicalis 1bp
B D                Zebrafish 8bp
    Mexican tetra (cavefish) 4bp

Alignment block 24 of 593 in window, 160876843 - 160876843, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  a
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  g
B D                       Pig  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  t
B D                 Armadillo  a
B D                   Opossum  g
B D           Tasmanian devil  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  g
B D                 Zebrafish  g
     Mexican tetra (cavefish)  g
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                     Shrew  =
B D                    Rabbit  =
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  =
B D                  Bushbaby  -
B D                   Ferret   =
             Star-nosed mole  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                  Squirrel  =

Inserts between block 24 and 25 in window
  D Chinese softshell turtle 1315bp

Alignment block 25 of 593 in window, 160876844 - 160876845, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  tc
           Chinese tree shrew  cc
B D                  Squirrel  ca
B D            Naked mole-rat  tg
B D                Guinea pig  aa
                   Chinchilla  ta
             Brush-tailed rat  cg
B D                      Pika  tc
B D                       Pig  ta
B D                       Cow  ca
B D                     Sheep  ca
                Domestic goat  ca
B D                     Horse  tc
B D          White rhinoceros  ta
B D                  Elephant  ta
          Cape elephant shrew  aa
B D                   Manatee  ta
             Cape golden mole  ca
B D                    Tenrec  ca
                     Aardvark  ta
B D                 Armadillo  ca
B D                   Opossum  ca
B D           Tasmanian devil  aa
  D           Green seaturtle  ac
  D            Painted turtle  gc
  D    Spiny softshell turtle  ag
B D             X. tropicalis  at
B D                 Zebrafish  ta
     Mexican tetra (cavefish)  ta
B D                       Rat  --
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
                Weddell seal  ==
B D                     Shrew  ==
B D                    Rabbit  ==
B D                   Dolphin  ==
                 Spotted gar  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D        American alligator  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                       Cat  ==
B D                  Bushbaby  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
             Star-nosed mole  ==
            Tibetan antelope  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==

Inserts between block 25 and 26 in window
    Mexican tetra (cavefish) 164bp

Alignment block 26 of 593 in window, 160876846 - 160876850, 5 bps 
B D                     Human  atgag
B D                     Chimp  atgag
B D                   Gorilla  atgag
B D                 Orangutan  atggg
B D                    Gibbon  atgag
B D                    Rhesus  atgag
B D       Crab-eating macaque  atgag
B D                    Baboon  atgag
B D              Green monkey  atgag
B D                  Marmoset  atgag
B D           Squirrel monkey  atgag
B D                  Bushbaby  --gag
           Chinese tree shrew  -tgag
B D                  Squirrel  ttgag
B D                       Rat  --ggg
B D            Naked mole-rat  atgag
B D                Guinea pig  atgag
                   Chinchilla  atgag
             Brush-tailed rat  atgag
B D                      Pika  atgga
B D                       Pig  gagag
B D                       Cow  atgag
B D                     Sheep  acgag
                Domestic goat  acgag
B D                     Horse  atgag
B D          White rhinoceros  aggag
B D                  Elephant  atgag
          Cape elephant shrew  atgag
B D                   Manatee  atgag
             Cape golden mole  atgag
B D                    Tenrec  gtgag
                     Aardvark  atgag
B D                 Armadillo  atggg
B D                   Opossum  atgaa
B D           Tasmanian devil  atgaa
  D           Green seaturtle  cggag
  D            Painted turtle  aggaa
  D    Spiny softshell turtle  aagag
B D             X. tropicalis  atgag
B D                 Zebrafish  actaa
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
                Weddell seal  =====
B D                     Shrew  =====
B D                    Rabbit  =====
B D                   Dolphin  =====
                 Spotted gar  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D        American alligator  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                       Cat  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
             Star-nosed mole  =====
            Tibetan antelope  =====
              Bactrian camel  =====
B D                    Alpaca  =====
              Pacific walrus  =====
B D                     Panda  =====
                Killer whale  =====
B D                       Dog  =====

Inserts between block 26 and 27 in window
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
B D            X. tropicalis 4bp

Alignment block 27 of 593 in window, 160876851 - 160876856, 6 bps 
B D                     Human  agatct
B D                     Chimp  agatct
B D                   Gorilla  agatct
B D                 Orangutan  agatct
B D                    Gibbon  agatct
B D                    Rhesus  agatct
B D       Crab-eating macaque  agacct
B D                    Baboon  agatct
B D              Green monkey  agatct
B D                  Marmoset  ggatct
B D           Squirrel monkey  ggatct
B D                  Bushbaby  aggtct
           Chinese tree shrew  agatct
B D                  Squirrel  aggtct
B D                       Rat  aggtca
B D            Naked mole-rat  agttca
B D                Guinea pig  agtccc
                   Chinchilla  aggtct
             Brush-tailed rat  aggtct
B D                      Pika  atgca-
B D                       Pig  gggtgt
B D                       Cow  acatct
B D                     Sheep  acatct
                Domestic goat  acatct
B D                     Horse  aggtct
B D          White rhinoceros  agttct
B D                  Elephant  agatct
          Cape elephant shrew  agaact
B D                   Manatee  agagct
                     Aardvark  aaatct
B D                 Armadillo  aggtat
B D                   Opossum  agaacc
B D           Tasmanian devil  agaacc
  D           Green seaturtle  agagc-
  D            Painted turtle  agagc-
  D    Spiny softshell turtle  agagc-
B D             X. tropicalis  ag----
B D                 Zebrafish  atatct
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
                Weddell seal  ======
B D                     Shrew  ======
B D                    Rabbit  ======
            Cape golden mole  ------
B D                   Dolphin  ======
                 Spotted gar  ======
          Southern platyfish  ======
    Mexican tetra (cavefish)  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
B D        American alligator  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                    Tenrec  ------
B D                       Cat  ======
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
             Star-nosed mole  ======
            Tibetan antelope  ======
              Bactrian camel  ======
B D                    Alpaca  ======
              Pacific walrus  ======
B D                     Panda  ======
                Killer whale  ======
B D                       Dog  ======

Alignment block 28 of 593 in window, 160876857 - 160876858, 2 bps 
B D                     Human  gc
B D                     Chimp  ga
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  gc
           Chinese tree shrew  ga
B D                  Squirrel  gc
B D                     Mouse  gc
B D                       Rat  gc
B D            Naked mole-rat  gc
B D                Guinea pig  ac
                   Chinchilla  gc
             Brush-tailed rat  gc
B D                      Pika  gc
B D                       Pig  gc
B D                       Cow  gc
B D                     Sheep  gc
                Domestic goat  gc
B D                     Horse  gt
B D          White rhinoceros  gc
B D                  Elephant  gc
          Cape elephant shrew  gc
B D                   Manatee  gt
                     Aardvark  ag
B D                 Armadillo  gg
B D                 Zebrafish  tc
      Lesser Egyptian jerboa  ==
                Weddell seal  ==
B D                     Shrew  ==
B D                    Rabbit  ==
            Cape golden mole  --
  D    Spiny softshell turtle  --
B D                   Dolphin  ==
B D             X. tropicalis  --
                 Spotted gar  ==
          Southern platyfish  ==
B D           Tasmanian devil  --
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  --
  D           Green seaturtle  --
B D        American alligator  ==
B D                   Opossum  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D                    Tenrec  --
B D                       Cat  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
             Star-nosed mole  ==
            Tibetan antelope  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==

Inserts between block 28 and 29 in window
B D                Zebrafish 6118bp

Alignment block 29 of 593 in window, 160876859 - 160876864, 6 bps 
B D                     Human  cagtga------
B D                     Chimp  cagtaa------
B D                   Gorilla  cagtga------
B D                 Orangutan  cagtga------
B D                    Gibbon  cagtga------
B D                    Rhesus  cggtga------
B D       Crab-eating macaque  cagtga------
B D                    Baboon  cggtga------
B D              Green monkey  cggtga------
B D                  Marmoset  c-ggga------
B D           Squirrel monkey  cgggga------
B D                  Bushbaby  tggtga------
           Chinese tree shrew  gggtga------
B D                  Squirrel  tgatga------
B D                     Mouse  taatga------
B D                       Rat  tggtga------
B D            Naked mole-rat  tggtga------
B D                Guinea pig  tagtga------
                   Chinchilla  tcatga------
             Brush-tailed rat  tgccga------
B D                      Pika  cagtga------
B D                       Pig  tgggga------
B D                       Cow  tgctgt------
B D                     Sheep  tgctgc------
                Domestic goat  agctgc------
B D                     Horse  cagtga------
B D          White rhinoceros  tggtga------
B D                  Elephant  tggtga------
          Cape elephant shrew  ttgtga------
B D                   Manatee  tggtga------
             Cape golden mole  --gtga------
B D                    Tenrec  --atga------
                     Aardvark  tagtga------
B D                 Armadillo  aggtgg------
B D                   Opossum  --atgg------
B D           Tasmanian devil  --atgg------
  D           Green seaturtle  ---tgg------
  D            Painted turtle  ---agg------
  D    Spiny softshell turtle  ---agg------
B D             X. tropicalis  ----gaagttca
      Lesser Egyptian jerboa  ============
                Weddell seal  ============
B D                     Shrew  ============
B D                    Rabbit  ============
B D                   Dolphin  ============
                 Spotted gar  ============
          Southern platyfish  ============
    Mexican tetra (cavefish)  ============
B D                 Zebrafish  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
B D        American alligator  ============
B D                  Platypus  ============
B D                   Wallaby  ============
B D                       Cat  ============
  D  Chinese softshell turtle  ============
B D                   Ferret   ============
             Star-nosed mole  ============
            Tibetan antelope  ============
              Bactrian camel  ============
B D                    Alpaca  ============
              Pacific walrus  ============
B D                     Panda  ============
                Killer whale  ============
B D                       Dog  ============

Inserts between block 29 and 30 in window
B D                     Pika 65997bp

Alignment block 30 of 593 in window, 160876865 - 160876867, 3 bps 
B D                     Human  ggc
B D                     Chimp  ggc
B D                   Gorilla  ggc
B D                 Orangutan  ggc
B D                    Gibbon  ggc
B D                    Rhesus  ggc
B D       Crab-eating macaque  ggc
B D                    Baboon  ggc
B D              Green monkey  ggt
B D                  Marmoset  ggc
B D           Squirrel monkey  ggc
B D                  Bushbaby  ggc
           Chinese tree shrew  ggc
B D                  Squirrel  -gc
B D                     Mouse  -gt
B D                       Rat  -ga
B D            Naked mole-rat  -ag
B D                Guinea pig  -cc
                   Chinchilla  -gc
             Brush-tailed rat  -gc
B D                      Pika  -gg
B D                       Pig  cac
B D                       Cow  ggc
B D                     Sheep  ggc
                Domestic goat  ggc
B D                     Horse  ggc
B D          White rhinoceros  ggc
B D                  Elephant  ggt
          Cape elephant shrew  agt
B D                   Manatee  ggt
             Cape golden mole  tgc
B D                    Tenrec  ccc
                     Aardvark  ggt
B D                 Armadillo  ta-
B D                   Opossum  gaa
B D           Tasmanian devil  ggt
  D           Green seaturtle  ggc
  D            Painted turtle  ggc
  D    Spiny softshell turtle  ggc
B D             X. tropicalis  gat
      Lesser Egyptian jerboa  ===
                Weddell seal  ===
B D                     Shrew  ===
B D                    Rabbit  ===
B D                   Dolphin  ===
                 Spotted gar  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D        American alligator  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                       Cat  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
             Star-nosed mole  ===
            Tibetan antelope  ===
              Bactrian camel  ===
B D                    Alpaca  ===
              Pacific walrus  ===
B D                     Panda  ===
                Killer whale  ===
B D                       Dog  ===

Inserts between block 30 and 31 in window
B D                 Squirrel 1bp
B D                    Mouse 1bp
B D                      Rat 795bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                     Pika 2bp
B D                  Opossum 9bp
B D          Tasmanian devil 9bp

Alignment block 31 of 593 in window, 160876868 - 160876872, 5 bps 
B D                     Human  -caatg
B D                     Chimp  -caatg
B D                   Gorilla  -caatg
B D                 Orangutan  -caatg
B D                    Gibbon  -caatg
B D                    Rhesus  -caatg
B D       Crab-eating macaque  -cagtg
B D                    Baboon  -taatg
B D              Green monkey  -caatg
B D                  Marmoset  -caatg
B D           Squirrel monkey  -caatg
B D                  Bushbaby  -caagg
           Chinese tree shrew  -caa--
B D                  Squirrel  -caaag
B D                     Mouse  -taaag
B D            Naked mole-rat  -taaag
B D                Guinea pig  -ggaag
                   Chinchilla  -ggaag
             Brush-tailed rat  -ggaag
B D                      Pika  -accag
B D                       Pig  -cactg
B D                       Cow  -caatg
B D                     Sheep  -caatg
                Domestic goat  -caatg
B D                     Horse  -caacg
B D          White rhinoceros  -caacg
B D                  Elephant  -caatg
          Cape elephant shrew  -caatg
B D                   Manatee  -caatg
             Cape golden mole  -aagta
B D                    Tenrec  -cagtc
                     Aardvark  -cattg
B D                 Armadillo  -caatg
B D                   Opossum  -tactg
B D           Tasmanian devil  -ttgtg
  D           Green seaturtle  -ccatc
  D            Painted turtle  -ccatc
  D    Spiny softshell turtle  -ccatc
B D             X. tropicalis  taaac-
B D                       Rat  ======
      Lesser Egyptian jerboa  ======
                Weddell seal  ======
B D                     Shrew  ======
B D                    Rabbit  ======
B D                   Dolphin  ======
                 Spotted gar  ======
          Southern platyfish  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
B D        American alligator  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                       Cat  ======
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
             Star-nosed mole  ======
            Tibetan antelope  ======
              Bactrian camel  ======
B D                    Alpaca  ======
              Pacific walrus  ======
B D                     Panda  ======
                Killer whale  ======
B D                       Dog  ======

Inserts between block 31 and 32 in window
B D                  Opossum 12bp
B D          Tasmanian devil 12bp
  D          Green seaturtle 6bp
  D           Painted turtle 6bp
  D   Spiny softshell turtle 2bp

Alignment block 32 of 593 in window, 160876873 - 160876873, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  a
B D                     Mouse  a
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  g
B D                 Armadillo  a
  D           Green seaturtle  c
  D            Painted turtle  t
  D    Spiny softshell turtle  c
B D             X. tropicalis  c
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  =
B D                     Shrew  =
B D                    Rabbit  =
B D                   Dolphin  =
                 Spotted gar  =
          Southern platyfish  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D                   Opossum  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                  Squirrel  -

Inserts between block 32 and 33 in window
B D            X. tropicalis 2bp

Alignment block 33 of 593 in window, 160876874 - 160876880, 7 bps 
B D                     Human  catctta
B D                     Chimp  catctta
B D                   Gorilla  catctta
B D                 Orangutan  catctta
B D                    Gibbon  catctta
B D                    Rhesus  catctta
B D       Crab-eating macaque  catctta
B D                    Baboon  catctta
B D              Green monkey  catctta
B D                  Marmoset  catctta
B D           Squirrel monkey  catctta
B D                  Bushbaby  catccta
           Chinese tree shrew  catctta
B D                  Squirrel  -acctta
B D                     Mouse  cactata
B D                       Rat  cacgtta
B D            Naked mole-rat  tatttta
B D                Guinea pig  catatta
                   Chinchilla  catgcta
             Brush-tailed rat  cgcgtta
B D                      Pika  caggctc
B D                       Cow  catctaa
B D                     Sheep  catccaa
                Domestic goat  catccaa
B D                     Horse  catctta
B D          White rhinoceros  catcttt
B D                  Elephant  catatta
          Cape elephant shrew  catgtta
B D                   Manatee  catatta
             Cape golden mole  gcta-ta
B D                    Tenrec  actctta
                     Aardvark  catataa
B D                 Armadillo  cccctta
B D                   Opossum  aat----
B D           Tasmanian devil  cag----
  D           Green seaturtle  tctcctg
  D            Painted turtle  tctcctc
  D    Spiny softshell turtle  tctacca
B D             X. tropicalis  catttaa
      Lesser Egyptian jerboa  =======
                Weddell seal  =======
B D                     Shrew  =======
B D                    Rabbit  =======
B D                   Dolphin  =======
                 Spotted gar  =======
          Southern platyfish  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
B D        American alligator  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D                       Cat  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   =======
             Star-nosed mole  =======
            Tibetan antelope  =======
              Bactrian camel  =======
B D                    Alpaca  =======
              Pacific walrus  =======
B D                     Panda  =======
                Killer whale  =======
B D                       Dog  =======

Inserts between block 33 and 34 in window
B D                     Pika 3bp
  D          Green seaturtle 4bp
  D           Painted turtle 4bp
  D   Spiny softshell turtle 4bp

Alignment block 34 of 593 in window, 160876881 - 160876915, 35 bps 
B D                     Human  acagctga----atccagtgatttctttggtc----------ctcatca
B D                     Chimp  acagctga----atccagtgatttctttggtc----------ctcatca
B D                   Gorilla  acagctga----atccagtgatttctttggtc----------ctcatca
B D                 Orangutan  acagctga----atcgagtgatttctttggtc----------ctcatca
B D                    Gibbon  acagccaa----atctagtgatttctttggtc----------ctcatca
B D                    Rhesus  acagccga----atccagtcatttctgtggtc----------ctcatca
B D       Crab-eating macaque  acagccga----atccagtcatttctgtggtc----------ctcatca
B D                    Baboon  acagccga----aaccagtcatttctgtggtc----------ctcatca
B D              Green monkey  acagccga----atccagtcatttctgtggtc----------ctcatca
B D                  Marmoset  acagccca----atctagtgatttcttcagtc----------tttatca
B D           Squirrel monkey  gcagccca----atctcgtgatttcttcggtc----------cttatca
B D                  Bushbaby  atggtgac----atccagtggagtctttggtc----------ctcatca
           Chinese tree shrew  atgaccaaatgcatccagtggaatct---atc----------ttcatca
B D                  Squirrel  atggccaa----atccaaaggaatctttgcta----------ctcatca
B D                     Mouse  atagccaa----attcagtgaactctttgtac----------ctcagca
B D                       Rat  atagccaa----attcagtggactc--tgtcc----------ctcacca
B D            Naked mole-rat  atggcaaa----gtct----------ttattc----------ctcatgg
B D                Guinea pig  atggccaa----aactgagggagta-ttattt----------ctcttga
                   Chinchilla  atggccaa----agccagtggagtc-ttactt----------ctcttga
             Brush-tailed rat  gtggccaa----agccagctcagtc-ttattt----------ctcttga
B D                    Rabbit  gctgctga----caccagtgggctttttattccttgggatctttgacca
B D                      Pika  atggtcaa----ctcccatggaatctttgttc----------ttaatct
B D                       Cow  gtggccaa----atcgagtggacattttggca----------ctcatta
B D                     Sheep  gtggccaa----atcgagtggacattttggtc----------cttgtta
                Domestic goat  gcggccaa----atcgagtggactttttggtc----------ctcgtta
B D                     Horse  gtg----------------ggactctctggtc----------ctcatca
B D          White rhinoceros  gtg----------------ggaatctctggtc----------ct-atca
B D                  Elephant  atggccaa----atccagtggaatctttgatt----------ctcatcc
          Cape elephant shrew  atgaccaa----attcagtagactctttggtt----------ttcattc
B D                   Manatee  atggtcaa----atccagtggaatctttggtt----------ctcttcc
             Cape golden mole  atggtcaa----aaatcctggactctttggtc----------ctcattc
B D                    Tenrec  atggtcat----atgccctggaatctttggtc----------tttgatc
                     Aardvark  atagccaa----atacagtgggattttgggtt----------ctaatcc
B D                 Armadillo  atacccta----atcctctggaatctttagtc----------ctcatcc
B D                   Opossum  gtagggaa----atgca-tggaatcccttgac----------cccatca
B D           Tasmanian devil  ggaaggaa----atgca-tggaatcccttggt----------ctcctca
  D           Green seaturtle  caggccag----tgccagctgcttcagaggaa----------accgcaa
  D            Painted turtle  caggccag----tgccagatgcttcagaggaa----------ggtgcaa
  D    Spiny softshell turtle  caggccag----tgccagttacttcacgggaa----------ggtgcaa
B D             X. tropicalis  -----taa----aactatttcaatgaatgatc----------cacccaa
      Lesser Egyptian jerboa  =================================================
                Weddell seal  =================================================
B D                     Shrew  =================================================
B D                   Dolphin  =================================================
                 Spotted gar  =================================================
          Southern platyfish  =================================================
    Mexican tetra (cavefish)  =================================================
B D                 Zebrafish  =================================================
         Pundamilia nyererei  =================================================
                 Zebra mbuna  =================================================
       Burton's mouthbreeder  =================================================
         Princess of Burundi  =================================================
B D              Nile tilapia  =================================================
B D        American alligator  =================================================
B D                  Platypus  =================================================
B D                   Wallaby  =================================================
B D                       Cat  =================================================
  D  Chinese softshell turtle  =================================================
B D                   Ferret   =================================================
             Star-nosed mole  =================================================
            Tibetan antelope  =================================================
              Bactrian camel  =================================================
B D                    Alpaca  =================================================
              Pacific walrus  =================================================
B D                     Panda  =================================================
                Killer whale  =================================================
B D                       Dog  =================================================

Inserts between block 34 and 35 in window
B D                      Cow 3148bp
B D                    Sheep 3504bp
               Domestic goat 3269bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D   Spiny softshell turtle 2bp

Alignment block 35 of 593 in window, 160876916 - 160876916, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  a
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                      Pika  a
B D                     Horse  g
B D          White rhinoceros  g
B D                   Opossum  a
B D           Tasmanian devil  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D    Spiny softshell turtle  a
B D             X. tropicalis  g
      Lesser Egyptian jerboa  =
                Weddell seal  =
B D                     Shrew  =
            Cape golden mole  -
                    Aardvark  -
B D                   Dolphin  =
                 Spotted gar  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
         Cape elephant shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  -
B D                  Elephant  -
B D                    Tenrec  -
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                 Armadillo  -
B D                       Cow  =

Inserts between block 35 and 36 in window
B D                  Opossum 20bp
B D          Tasmanian devil 4729bp

Alignment block 36 of 593 in window, 160876917 - 160876922, 6 bps 
B D                     Human  -actctc
B D                     Chimp  -actctc
B D                   Gorilla  -actctc
B D                 Orangutan  -actctc
B D                    Gibbon  -actctc
B D                    Rhesus  -actctc
B D       Crab-eating macaque  -actctc
B D                    Baboon  -actctc
B D              Green monkey  -actctc
B D                  Marmoset  -actctc
B D           Squirrel monkey  -actctt
B D                  Bushbaby  -gtgttc
           Chinese tree shrew  -attctt
B D                  Squirrel  --ttctc
B D                     Mouse  -cctctc
B D                       Rat  -cctctc
B D            Naked mole-rat  -aatttc
B D                Guinea pig  -aatttc
                   Chinchilla  -aatttc
             Brush-tailed rat  -aatttc
B D                    Rabbit  -aatctt
B D                      Pika  -cttctc
B D                     Horse  -actttc
B D          White rhinoceros  -actttc
B D                  Elephant  --aactt
          Cape elephant shrew  --cattt
B D                   Manatee  --aactt
             Cape golden mole  --tacta
B D                    Tenrec  --tactt
                     Aardvark  --aactt
B D                 Armadillo  --tgctt
B D                   Opossum  -atgct-
  D           Green seaturtle  -accctg
  D            Painted turtle  -accctg
  D    Spiny softshell turtle  -actctg
B D             X. tropicalis  aacttt-
      Lesser Egyptian jerboa  =======
                Weddell seal  =======
B D                     Shrew  =======
B D                   Dolphin  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
B D        American alligator  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D                       Cat  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   =======
             Star-nosed mole  =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
              Bactrian camel  =======
B D                    Alpaca  =======
              Pacific walrus  =======
B D                     Panda  =======
                Killer whale  =======
B D                       Dog  =======
B D                       Cow  =======

Inserts between block 36 and 37 in window
B D                     Pika 27469bp
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 15bp
                    Aardvark 2bp
B D                Armadillo 2bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 37 of 593 in window, 160876923 - 160876935, 13 bps 
B D                     Human  cattgacagtgtt
B D                     Chimp  cattgacagtgtt
B D                   Gorilla  cattgacagtgtt
B D                 Orangutan  cattgacagtgtt
B D                    Gibbon  cattgacagtgtt
B D                    Rhesus  cattgacagtgtt
B D       Crab-eating macaque  cattgacagtgtt
B D                    Baboon  cattgacagtgtt
B D              Green monkey  cattgacagtgtt
B D                  Marmoset  ccttggcagtgtt
B D           Squirrel monkey  catcgacagtatt
B D                  Bushbaby  cacagggagtgct
           Chinese tree shrew  tattagcagtatt
B D                  Squirrel  gatgtgcagtgtt
B D                     Mouse  cactggtagcatt
B D                       Rat  cactggcagcctt
B D            Naked mole-rat  tatt---------
B D                Guinea pig  cattgatgatatt
                   Chinchilla  cattggtgatatt
             Brush-tailed rat  cattggtgatatt
B D                    Rabbit  ----------act
B D                     Horse  cactggcagcgtt
B D          White rhinoceros  cagtggcagtgtg
B D                  Elephant  ------cattgcc
          Cape elephant shrew  ------tagtgcc
B D                   Manatee  ------cattgcc
             Cape golden mole  ------ctttgcc
                     Aardvark  ------catcacc
B D                 Armadillo  ------ctttgcc
B D                   Opossum  agctgtcaccac-
  D           Green seaturtle  aatggccagtt--
  D            Painted turtle  tatagccagtt--
  D    Spiny softshell turtle  aatggccagtt--
B D             X. tropicalis  tatttaaaatgta
      Lesser Egyptian jerboa  =============
B D                      Pika  =============
                Weddell seal  =============
B D                     Shrew  =============
B D                   Dolphin  =============
                 Spotted gar  =============
          Southern platyfish  =============
B D           Tasmanian devil  =============
    Mexican tetra (cavefish)  =============
B D                 Zebrafish  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D              Nile tilapia  =============
B D        American alligator  =============
B D                  Platypus  =============
B D                   Wallaby  =============
B D                    Tenrec  =============
B D                       Cat  =============
  D  Chinese softshell turtle  =============
B D                   Ferret   =============
             Star-nosed mole  =============
               Domestic goat  =============
B D                     Sheep  =============
            Tibetan antelope  =============
              Bactrian camel  =============
B D                    Alpaca  =============
              Pacific walrus  =============
B D                     Panda  =============
                Killer whale  =============
B D                       Dog  =============
B D                       Cow  =============

Inserts between block 37 and 38 in window
B D                 Elephant 18bp
         Cape elephant shrew 38bp
B D                  Manatee 18bp
            Cape golden mole 18bp
                    Aardvark 18bp
B D                Armadillo 18bp
  D          Green seaturtle 7bp
  D           Painted turtle 7bp
  D   Spiny softshell turtle 8bp

Alignment block 38 of 593 in window, 160876936 - 160876941, 6 bps 
B D                     Human  ga--tcta
B D                     Chimp  ga--tcta
B D                   Gorilla  ga--tcta
B D                 Orangutan  ga--tcta
B D                    Gibbon  ga--tcta
B D                    Rhesus  ga--tcta
B D       Crab-eating macaque  ga--tcta
B D                    Baboon  ga--tcta
B D              Green monkey  ga--tcta
B D                  Marmoset  ga--tcta
B D           Squirrel monkey  ga--tcta
B D                  Bushbaby  ga--tcaa
           Chinese tree shrew  ga--tcta
B D                  Squirrel  ga--tcta
B D                     Mouse  ga--tcta
B D                       Rat  ga--tcta
B D            Naked mole-rat  -------a
B D                Guinea pig  aa--tcga
                   Chinchilla  ca--tcga
             Brush-tailed rat  ca--tcga
B D                    Rabbit  ta--gcct
B D                     Horse  ga--tcga
B D          White rhinoceros  ga--tcca
B D                  Elephant  ga--tctc
B D                   Manatee  ga--tctc
             Cape golden mole  ag--acct
B D                    Tenrec  ggtcccct
                     Aardvark  gg--cctc
B D                 Armadillo  ga--ccat
B D                   Opossum  -a--ccta
  D           Green seaturtle  aa--tctg
  D            Painted turtle  aa--tctg
  D    Spiny softshell turtle  aa--tctg
B D             X. tropicalis  --tttcta
      Lesser Egyptian jerboa  ========
B D                      Pika  ========
                Weddell seal  ========
B D                     Shrew  ========
B D                   Dolphin  ========
                 Spotted gar  ========
          Southern platyfish  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
B D        American alligator  ========
         Cape elephant shrew  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D                       Cat  ========
  D  Chinese softshell turtle  ========
B D                   Ferret   ========
             Star-nosed mole  ========
               Domestic goat  ========
B D                     Sheep  ========
            Tibetan antelope  ========
              Bactrian camel  ========
B D                    Alpaca  ========
              Pacific walrus  ========
B D                     Panda  ========
                Killer whale  ========
B D                       Dog  ========
B D                       Cow  ========

Inserts between block 38 and 39 in window
B D            X. tropicalis 4911bp

Alignment block 39 of 593 in window, 160876942 - 160876951, 10 bps 
B D                     Human  ttctt------cccat
B D                     Chimp  ttctt------cccat
B D                   Gorilla  ttctt------cccat
B D                 Orangutan  tccta------cccat
B D                    Gibbon  tcctt------cccat
B D                    Rhesus  tcctt------cccat
B D       Crab-eating macaque  tcctt------cccat
B D                    Baboon  tcctt------cccat
B D              Green monkey  tcctt------cccat
B D                  Marmoset  tcctt------cccat
B D           Squirrel monkey  tcctt------cccat
B D                  Bushbaby  ttcct------cccat
           Chinese tree shrew  ttctt------cccac
B D                  Squirrel  tgtct------cccat
B D                     Mouse  tttga------tccat
B D                       Rat  cttga------tctat
B D            Naked mole-rat  ttaca------cccat
B D                Guinea pig  ttaca------cttat
                   Chinchilla  ttaca------cacat
             Brush-tailed rat  ttaca------ctcag
B D                    Rabbit  ttccagtacctcccat
B D                     Horse  ttcct------cacgt
B D          White rhinoceros  ttcct------cacat
B D                  Elephant  ttcct------cccat
B D                   Manatee  ttcct------cccat
             Cape golden mole  taatt------ctttt
B D                    Tenrec  ttact------cccat
                     Aardvark  ttcct------cccat
B D                 Armadillo  tccat------cccat
B D                   Opossum  tagtg------cccat
  D           Green seaturtle  tccac-----------
  D            Painted turtle  cccac-----------
  D    Spiny softshell turtle  cccac-----------
      Lesser Egyptian jerboa  ================
B D                      Pika  ================
                Weddell seal  ================
B D                     Shrew  ================
B D                   Dolphin  ================
B D             X. tropicalis  ================
                 Spotted gar  ================
          Southern platyfish  ================
B D           Tasmanian devil  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
B D        American alligator  ================
         Cape elephant shrew  ================
B D                  Platypus  ================
B D                   Wallaby  ================
B D                       Cat  ================
  D  Chinese softshell turtle  ================
B D                   Ferret   ================
             Star-nosed mole  ================
               Domestic goat  ================
B D                     Sheep  ================
            Tibetan antelope  ================
              Bactrian camel  ================
B D                    Alpaca  ================
              Pacific walrus  ================
B D                     Panda  ================
                Killer whale  ================
B D                       Dog  ================
B D                       Cow  ================

Alignment block 40 of 593 in window, 160876952 - 160876961, 10 bps 
B D                     Human  --aa-aaac----ctct
B D                     Chimp  --aa-aaacctctctct
B D                   Gorilla  --aa-aaac----ctct
B D                 Orangutan  ---a-aaac----ctct
B D                    Gibbon  --aa-aaac----ctct
B D                    Rhesus  --aa-aaatctctctct
B D       Crab-eating macaque  --aa-aaatctctctct
B D                    Baboon  --aa-aaatctctctct
B D              Green monkey  --aa-aaatctctctct
B D                  Marmoset  --aa-aaac----ctct
B D           Squirrel monkey  --aa-aaac----ctct
B D                  Bushbaby  --ac-aaac----ctct
           Chinese tree shrew  --ag-aact----ctct
B D                  Squirrel  --aa-aaac----ttct
B D                     Mouse  -----aaac----gccc
B D            Naked mole-rat  --ga-aaac----ctct
B D                Guinea pig  --ga-atac----atgt
                   Chinchilla  --ga-aaac----tccc
             Brush-tailed rat  --ga-aaac----tcct
B D                    Rabbit  ---a-aaac----ctct
B D                     Horse  --aa-aaac----ctct
B D          White rhinoceros  --aa-aaac----ctct
B D                  Elephant  --aa-agct----ctct
B D                   Manatee  --aa-aact----ctct
             Cape golden mole  --aa-aacc----ctcc
B D                    Tenrec  --aa-aacc----ttgc
                     Aardvark  --at-aact----ctct
B D                 Armadillo  --aa-gtct----tttc
B D                   Opossum  -----------ttctct
  D           Green seaturtle  agag-aaag----tt--
  D            Painted turtle  agag-aaag----tt--
  D    Spiny softshell turtle  cgagaaaag----tt--
B D                       Rat  -----------------
      Lesser Egyptian jerboa  =================
B D                      Pika  =================
                Weddell seal  =================
B D                     Shrew  =================
B D                   Dolphin  =================
B D             X. tropicalis  =================
                 Spotted gar  =================
          Southern platyfish  =================
B D           Tasmanian devil  =================
    Mexican tetra (cavefish)  =================
B D                 Zebrafish  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D              Nile tilapia  =================
B D        American alligator  =================
         Cape elephant shrew  =================
B D                  Platypus  =================
B D                   Wallaby  =================
B D                       Cat  =================
  D  Chinese softshell turtle  =================
B D                   Ferret   =================
             Star-nosed mole  =================
               Domestic goat  =================
B D                     Sheep  =================
            Tibetan antelope  =================
              Bactrian camel  =================
B D                    Alpaca  =================
              Pacific walrus  =================
B D                     Panda  =================
                Killer whale  =================
B D                       Dog  =================
B D                       Cow  =================

Inserts between block 40 and 41 in window
B D                    Mouse 2bp

Alignment block 41 of 593 in window, 160876962 - 160876965, 4 bps 
B D                     Human  -cttc
B D                     Chimp  -cttc
B D                   Gorilla  -cttc
B D                 Orangutan  -cttc
B D                    Gibbon  -cttc
B D                    Rhesus  -cttc
B D       Crab-eating macaque  -cttc
B D                    Baboon  -cttc
B D              Green monkey  -cttc
B D                  Marmoset  -cttc
B D           Squirrel monkey  -cttc
B D                  Bushbaby  -acac
           Chinese tree shrew  -cttc
B D                  Squirrel  -ctac
B D            Naked mole-rat  -gctc
B D                Guinea pig  -tt--
                   Chinchilla  -cttc
             Brush-tailed rat  -ctcc
B D                    Rabbit  -cctc
B D                     Horse  -cttc
B D          White rhinoceros  -cttt
B D                  Elephant  -cttc
B D                   Manatee  -cttc
             Cape golden mole  -cctc
                     Aardvark  -cttc
B D                 Armadillo  -c---
B D                   Opossum  -attc
  D           Green seaturtle  acct-
  D            Painted turtle  acct-
  D    Spiny softshell turtle  accg-
B D                       Rat  -----
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
B D                      Pika  =====
                Weddell seal  =====
B D                     Shrew  =====
B D                   Dolphin  =====
B D             X. tropicalis  =====
                 Spotted gar  =====
          Southern platyfish  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D        American alligator  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                    Tenrec  -----
B D                       Cat  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
             Star-nosed mole  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
              Bactrian camel  =====
B D                    Alpaca  =====
              Pacific walrus  =====
B D                     Panda  =====
                Killer whale  =====
B D                       Dog  =====
B D                       Cow  =====

Inserts between block 41 and 42 in window
B D           Naked mole-rat 95bp

Alignment block 42 of 593 in window, 160876966 - 160876966, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                     Horse  c
B D          White rhinoceros  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                   Opossum  c
  D           Green seaturtle  c
  D            Painted turtle  c
  D    Spiny softshell turtle  c
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  =
B D                     Shrew  =
B D                Guinea pig  -
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D            Naked mole-rat  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                    Tenrec  -
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                 Armadillo  -
B D                       Cow  =

Inserts between block 42 and 43 in window
B D                 Squirrel 2bp
B D                   Rabbit 22bp
            Cape golden mole 2283bp

Alignment block 43 of 593 in window, 160876967 - 160876967, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                  Elephant  t
B D                   Manatee  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
  D           Green seaturtle  c
  D            Painted turtle  c
  D    Spiny softshell turtle  c
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  =
B D                     Shrew  =
B D                Guinea pig  -
B D                    Rabbit  =
            Cape golden mole  =
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D            Naked mole-rat  =
         Cape elephant shrew  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  =
B D                  Bushbaby  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                  Squirrel  =
B D                       Cow  =

Inserts between block 43 and 44 in window
            Brush-tailed rat 1bp
B D                Armadillo 1752bp

Alignment block 44 of 593 in window, 160876968 - 160876968, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                     Horse  t
B D          White rhinoceros  t
B D                  Elephant  t
B D                   Manatee  t
B D                    Tenrec  t
                     Aardvark  t
B D                   Opossum  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D    Spiny softshell turtle  t
B D                       Rat  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  =
B D                     Shrew  =
B D                Guinea pig  -
B D                    Rabbit  =
            Cape golden mole  =
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D        American alligator  =
B D            Naked mole-rat  =
            Brush-tailed rat  =
                  Chinchilla  -
         Cape elephant shrew  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  =
B D                  Bushbaby  -
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
B D                  Squirrel  =
B D                 Armadillo  =
B D                       Cow  =

Inserts between block 44 and 45 in window
B D                 Elephant 941bp

Alignment block 45 of 593 in window, 160876969 - 160876970, 2 bps 
B D                     Human  gg
B D                     Chimp  ag
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                    Tenrec  gg
B D                   Opossum  ga
  D           Green seaturtle  ga
  D            Painted turtle  ga
  D    Spiny softshell turtle  ga
B D                       Rat  --
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
                Weddell seal  ==
B D                     Shrew  ==
B D                Guinea pig  --
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  --
B D                   Dolphin  ==
B D             X. tropicalis  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D        American alligator  ==
B D            Naked mole-rat  ==
            Brush-tailed rat  ==
                  Chinchilla  --
         Cape elephant shrew  ==
          Chinese tree shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D                   Manatee  --
B D                  Elephant  ==
B D                       Cat  ==
B D                  Bushbaby  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
             Star-nosed mole  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==
B D          White rhinoceros  --
B D                     Horse  --
B D                  Squirrel  ==
B D                 Armadillo  ==
B D                       Cow  ==

Inserts between block 45 and 46 in window
B D                   Tenrec 13347bp

Alignment block 46 of 593 in window, 160876971 - 160876972, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  tt
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                   Opossum  tt
  D           Green seaturtle  cc
  D            Painted turtle  cc
  D    Spiny softshell turtle  cc
B D                       Rat  --
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
                Weddell seal  ==
B D                     Shrew  ==
B D                Guinea pig  --
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  --
B D                   Dolphin  ==
B D             X. tropicalis  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D        American alligator  ==
B D            Naked mole-rat  ==
            Brush-tailed rat  ==
                  Chinchilla  --
         Cape elephant shrew  ==
          Chinese tree shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D                   Manatee  --
B D                  Elephant  ==
B D                    Tenrec  ==
B D                       Cat  ==
B D                  Bushbaby  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
             Star-nosed mole  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==
B D          White rhinoceros  --
B D                     Horse  --
B D                  Squirrel  ==
B D                 Armadillo  ==
B