Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 44 in window, 88794106 - 88794165, 60 bps 
B D                     Human  taa--ctt----taaaaa--------tgtt----ttttttattt---aag---tagcacaa---------
B D                     Chimp  taa--ctt----taaaaa--------tgtt-ttcttttttattt---aag---tagcacaa---------
B D                   Gorilla  taa--ctt----taaaaa--------tgtt-ttcttttttattt---aag---tagcacaa---------
B D                 Orangutan  taa--ctt----taaaaa--------tgtt-ttcttttttattt---aag---tagcacaa---------
B D                    Gibbon  taa--ctt----taaaaa--------tgtt-ttcttttttattt---aag---tagcacaa---------
B D                    Rhesus  taa--ctt----taagaa--------tgtt-ttcttctttattt---aag---tagcacaa---------
B D       Crab-eating macaque  taa--ctt----taagaa--------tgtt-ttcttctttattt---aag---tagcacaa---------
B D                    Baboon  taa--ctt----taagaa--------tgtt-ttcttctttattt---aag---tagcacaa---------
B D              Green monkey  taa--ctt----taagaa--------tgtt-ttcttctttattt---aag---tagcacaa---------
B D                  Marmoset  taa--ctt----taaaat--------tgtt-ttctttc---------aag---tagtgcaa---------
B D           Squirrel monkey  taa--ctt----taaaaa--------tatt-ttctttc-tattt---aag---tagcacaa---------
B D                  Bushbaby  taa--ctt----tagaaa--------tatt-ttccttt-tattc---aag---tagcacat---------
           Chinese tree shrew  taa--ctt----tagaaa--------tatc-taccttt-cattt---aag---tagcatac---------
B D                  Squirrel  aaa--ttc----tagaaa--------ta-t--tttcccctttatttaaag---tagcacaa---------
       Lesser Egyptian jerboa  taa--ctt----tagaaa---------------tattatttttattgatg---tagggcaa---------
                 Prairie vole  taa--ctt----tagaaa----------------ttctttgtttctaaag---tagtacaa---------
B D           Chinese hamster  taa--ctt----tagata---------------tttctttgtttttaaag---tagcacaa---------
               Golden hamster  taa--cat----tagata-------------------tttgtttttaaaa---tagcacaa---------
B D                     Mouse  taa--gtt----tatata--------------tttcctttgtttctaaaa---tagtacaa---------
B D                       Rat  -aa--gtt----tagata--------------tttcctttgtttctaaag---tagtaaaaaaaaaac--
B D            Naked mole-rat  taa--tgt----tagaaa--------tagt--ttccttttattt---agg---tagcacaa---------
B D                Guinea pig  taa--tgt----tagaaa--------tagt-------tttattt--------------------------
                   Chinchilla  gag--taa----tggtaaaataaaggtagt--tttcctttattt---agc---tagcacac---------
             Brush-tailed rat  gaa--tat----cagaaa--------cagt-------tttattt---att---cagcatgc---------
B D                    Rabbit  taa--ctt----tagaat------------------------ttgaaaagacatcgttgaa---------
B D                      Pika  taa--ctt----tggaat------------------------ttacaaaggc-cagtttaagaagcatgt
B D                       Pig  taa--ctt----gagaaa--------tatt--ttccttttattt---aag---gaccataa---------
B D                    Alpaca  taa--ctt----tagaaa--------tatt--ttccttttattt---aag---tagcataa---------
               Bactrian camel  taa--ctt----tagaaa--------tatt--ttccttttattt---aag---tagcataa---------
B D                   Dolphin  taa--ctt----tagaaa--------tact--ttccttttattt---aag---tagcatac---------
                 Killer whale  taa--ctt----tagaaa--------tatt--ttccttttattt---aag---tagcatac---------
             Tibetan antelope  -aa--ctt----taggca--------tatt--ttccttttattt---aag---tagcatac---------
B D                       Cow  -aa--c-t----taggca--------tatt--ttccttttattt---aaa---tagcatgc---------
B D                     Sheep  -aa--ttt----taggca--------tatt--ttccttttattt---aag---tagcatac---------
                Domestic goat  -aa--ctt----taggca--------tatt--ttccttttattt---aag---cagcatac---------
B D                     Horse  taa--ctt----tagaaa--------tatt--ttccttttattt---aag---tagcaaac---------
B D          White rhinoceros  taa--ctt----tagaga--------tatt--ttccttttatct---aag---cagcataa---------
B D                       Cat  tcc--cct----cagaag--------tgtt--ttctttttattt---aag---tagcatca---------
B D                       Dog  tag--ctt----tagaaa--------tact--ttccttttcttt---aag---tagcatca---------
B D                   Ferret   taa--ctt----tagaaa--------ttcc--ttccttttattt---aag---tagcatca---------
B D                     Panda  taa--ctt----tagaaa--------tact--ttccttttattt---aag---tagcatta---------
               Pacific walrus  tta--ctt----tagaaa--------tcct--gttcttttattt---tag---tagcacca---------
                 Weddell seal  tta--ctt----tagaaa--------tcct--gttcttttcttt---aag---tagcactg---------
             Black flying-fox  tat--ctt----tagaaa--------tatt--ttccttttattt---atg---tagcataa---------
B D                   Megabat  tat--ctt----tagaaa--------tatt--ttccttttattt---atg---tagcataa---------
                Big brown bat  taa--ctttaaatagaaa--------tatg--tcctttttattg---aag---tagcacag---------
         David's myotis (bat)  taa--ctt----tagaaa--------tcct--ttctttttattg---aag---tagcaccg---------
B D                  Microbat  taa--ctt----tagaaa--------tctt--ttctttttattg---aag---tagcaccg---------
B D                  Hedgehog  taa--att----tgagtt--------tata--tttctcttactt---aag---aagattaa---------
B D                     Shrew  -------g----tagaaa--------tatt--ttctatttgttt---aag---tagcatta---------
              Star-nosed mole  tca--agg----taaaca--------tagt--tt-tctttattt---aag---taaca--a---------
B D                  Elephant  caa--ctt----taggaa--------tatt--ttccttttatt----aag---tagcataa---------
          Cape elephant shrew  cag--cat----tagaaa--------tatt--ttctttttatt----aag---tatcataa---------
B D                   Manatee  -----ctt----tagaaa--------tatt--ttccttttatt----aag---tagcataa---------
             Cape golden mole  tag--ctt----tagtta--------tctt--ttccttttatt----aag---ta--acaa---------
B D                    Tenrec  aaa--att----taaaca--------------tttattttcat----atg---ta--acaa---------
                     Aardvark  aaa--ttc----tagaaa--------tatt--ttccttttctt----aaa---tagcatag---------
B D                 Armadillo  tat--ctt----tagaaa--------tatt--ttccttttatt----aag---tagcatca---------
B D                   Opossum  aaatgccc----tagtta--------tattgttttaccatgtca---atg---tggca------------
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  actccttaagagac---atgggcac---------a----------------------------
                        Chimp  actccttaagagac---atgggcac---------a----------------------------
                      Gorilla  actccttaacagac---atgggcac---------a----------------------------
                    Orangutan  actccttaagagac---gtgggcac---------a----------------------------
                       Gibbon  actccttaagagac---atgggcac---------a----------------------------
                       Rhesus  attccttaagagac---atgagcac---------a----------------------------
          Crab-eating macaque  attccttaagagac---atgagcac---------a----------------------------
                       Baboon  attccttaagagac---atgagcac---------a----------------------------
                 Green monkey  attccttaagagac---atgagcac---------a----------------------------
                     Marmoset  attccttaagtgac---atgagcac---------g----------------------------
              Squirrel monkey  attccttaagagac---atgagcac---------g----------------------------
                     Bushbaby  attccttaagagac---atgagcat---------a----------------------------
           Chinese tree shrew  atttcttaagagcg---atgacca---------------------------------------
                     Squirrel  catcctcaagagat---cagaccac---------a----------------------------
       Lesser Egyptian jerboa  atttcttaagagat---cttatcat---------a----------------------------
                 Prairie vole  aatctttatgaggt---gtacaaac---------a----------------------------
              Chinese hamster  aaccttgagatgat---atgcacac---------g----------------------------
               Golden hamster  aaccttgaggagat---atgcacac---------a----------------------------
                        Mouse  aaacttgatgagac---agacccaa---------a----------------------------
                          Rat  aaact---tttgac---agacccaa---------a----------------------------
               Naked mole-rat  attccttaagagat---ctgaccac---------a----------------------------
                   Guinea pig  ---ccttaagagaa---ctgactgg---------a----------------------------
                   Chinchilla  ctctcttaa-agat---cagactgc---------a----------------------------
             Brush-tailed rat  attccttaagacat---caaactcc---------a----------------------------
                       Rabbit  tttcctgag-agac---aggagcac---------a----------------------------
                         Pika  gttcctgaacagat---aggagcac---------g----------------------------
                          Pig  attccttgagagat---ttgatcccattgaccaca----------------------------
                       Alpaca  attccttaagagat---ttga-----------aca----------------------------
               Bactrian camel  attccttaagagat---ttga-----------aca----------------------------
                      Dolphin  attccttaagagat---ttgactacactgaacaca----------------------------
                 Killer whale  attccttaagagat---ttgactacactgaccaca----------------------------
             Tibetan antelope  attccgtaagagat---ttgaccacactgaccaca----------------------------
                          Cow  attccttaagagat---ttgaccacattgaccaca----------------------------
                        Sheep  attccgtaagagat---ttgaccacattgaccaca----------------------------
                Domestic goat  attccgtaagagat---ttgaccacattgaccaca----------------------------
                        Horse  atttcttaagagat---ttgaccacatcgaccaca----------------------------
             White rhinoceros  atttcttaagagat---ttgaccacatcgaccaca----------------------------
                          Cat  attccttgagagat---tggaccacattaaccaca----------------------------
                          Dog  attccttgagagat---tggaccacatcgaccaca----------------------------
                      Ferret   attccttgagagat---cagaccccacccaccaca----------------------------
                        Panda  attccaggagagat---tggaccccatccaccaca----------------------------
               Pacific walrus  attccttgagagat---tgcaccccaccccccaca----------------------------
                 Weddell seal  attccttgagagat---tgcaccctatccaccaca----------------------------
             Black flying-fox  attccttgagagat---ttgaccacatcgaccaca----------------------------
                      Megabat  atttcttgagagat---ttgaccacatcgaccaca----------------------------
                Big brown bat  attccttaggagat---ttgaccacatctctcacatctgcttttagtctccttcagcttcttt
         David's myotis (bat)  actccttaggagat---ttgaccacatctcccaca----------------------------
                     Microbat  attccttaggagat---ttgagcacatctctcaca----------------------------
                     Hedgehog  attccgtaagagat---ttgacatca---gcctaa----------------------------
                        Shrew  atcccttaaaacag---ttgaatac---------a----------------------------
              Star-nosed mole  gttccttgggagat---ttgaccac---------a----------------------------
                     Elephant  attccttaagagac---acaaccac---------a----------------------------
          Cape elephant shrew  attcttttagaagtatgatgaccac---------a----------------------------
                      Manatee  attccttaagagat---atgaccac---------a----------------------------
             Cape golden mole  attcctcaaaagat-----gaccac---------a----------------------------
                       Tenrec  attcctgaagtgat---aggactac---------a----------------------------
                     Aardvark  gttccttaagagct---acggccac---------a----------------------------
                    Armadillo  attcctttagaaat----gggtcac---------a----------------------------
                      Opossum  atgcttgaagagaa---ctaaaata---------a----------------------------
                 Mallard duck  ===============================================================
           Tibetan ground jay  ===============================================================
                  Zebra finch  ===============================================================
       White-throated sparrow  ===============================================================
          Medium ground finch  ===============================================================
           American alligator  ===============================================================
                       Turkey  ===============================================================
                      Chicken  ===============================================================
             Peregrine falcon  ===============================================================
                 Saker falcon  ===============================================================
                  Rock pigeon  ===============================================================
                   Budgerigar  ===============================================================
          Collared flycatcher  ===============================================================
     Chinese softshell turtle  ===============================================================
               Painted turtle  ===============================================================
                      Wallaby  ===============================================================
              Tasmanian devil  ===============================================================
              Green seaturtle  ===============================================================

Alignment block 2 of 44 in window, 88794166 - 88794167, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  gt
B D                  Squirrel  tc
       Lesser Egyptian jerboa  gc
                 Prairie vole  ta
B D           Chinese hamster  tt
               Golden hamster  tt
B D                     Mouse  tc
B D                       Rat  tc
B D            Naked mole-rat  gt
B D                Guinea pig  gt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  ct
B D                      Pika  ta
B D                       Pig  tc
B D                    Alpaca  tc
               Bactrian camel  tc
B D                   Dolphin  tc
                 Killer whale  tc
             Tibetan antelope  tc
B D                       Cow  tc
B D                     Sheep  tc
                Domestic goat  tc
B D                     Horse  tc
B D          White rhinoceros  tc
B D                       Cat  t-
B D                       Dog  t-
B D                   Ferret   c-
B D                     Panda  t-
               Pacific walrus  t-
                 Weddell seal  t-
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  cc
         David's myotis (bat)  tc
B D                  Microbat  cc
B D                  Hedgehog  tt
B D                     Shrew  tc
              Star-nosed mole  tc
B D                  Elephant  tc
          Cape elephant shrew  tc
B D                   Manatee  tc
             Cape golden mole  tc
B D                    Tenrec  tc
                     Aardvark  tc
B D                 Armadillo  tc
B D                   Opossum  tc
  D           Green seaturtle  tc
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
B D        American alligator  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                Budgerigar  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
          Chinese tree shrew  --

Inserts between block 2 and 3 in window
B D                  Opossum 8bp

Alignment block 3 of 44 in window, 88794168 - 88794170, 3 bps 
B D                     Human  atc
B D                     Chimp  atc
B D                   Gorilla  atc
B D                 Orangutan  atc
B D                    Gibbon  atc
B D                    Rhesus  atc
B D       Crab-eating macaque  atc
B D                    Baboon  atc
B D              Green monkey  atc
B D                  Marmoset  atc
B D           Squirrel monkey  atc
B D                  Bushbaby  gtc
           Chinese tree shrew  -tt
B D                  Squirrel  gta
       Lesser Egyptian jerboa  atc
                 Prairie vole  atc
B D           Chinese hamster  agc
               Golden hamster  atc
B D                     Mouse  aac
B D                       Rat  atc
B D            Naked mole-rat  atc
B D                Guinea pig  agc
                   Chinchilla  ttc
             Brush-tailed rat  atc
B D                    Rabbit  gtc
B D                      Pika  gtc
B D                       Pig  att
B D                    Alpaca  atc
               Bactrian camel  atc
B D                   Dolphin  atc
                 Killer whale  atc
             Tibetan antelope  atc
B D                       Cow  atc
B D                     Sheep  atc
                Domestic goat  atc
B D                     Horse  atc
B D          White rhinoceros  acc
B D                       Cat  --c
B D                       Dog  --c
B D                   Ferret   --c
B D                     Panda  --g
               Pacific walrus  --c
                 Weddell seal  --c
             Black flying-fox  atc
B D                   Megabat  atc
                Big brown bat  atc
         David's myotis (bat)  atc
B D                  Microbat  atc
B D                  Hedgehog  gtt
B D                     Shrew  att
              Star-nosed mole  atc
B D                  Elephant  aac
          Cape elephant shrew  atc
B D                   Manatee  atc
             Cape golden mole  atc
B D                    Tenrec  a--
                     Aardvark  atc
B D                 Armadillo  ttc
B D                   Opossum  acc
B D           Tasmanian devil  atc
B D                   Wallaby  atc
  D           Green seaturtle  atc
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
B D        American alligator  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                Budgerigar  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===

Alignment block 4 of 44 in window, 88794171 - 88794199, 29 bps 
B D                     Human  cctctcaat---cctagaaacgtgaaggagca
B D                     Chimp  cctctcaat---cctagaaacgtgaaggagca
B D                   Gorilla  cctctcaat---cctagaaacgtgaaggagca
B D                 Orangutan  cctctcaat---cctagaaacgtgaaggagca
B D                    Gibbon  cctctgaat---cctagaaacatgaaggagca
B D                    Rhesus  cctctcaat---cctagaaacgtgaaggagca
B D       Crab-eating macaque  cctctcaat---cctagaaacgtgaaggagca
B D                    Baboon  cctctcaat---cctagaaacgtgaaggagca
B D              Green monkey  cctctcaat---cctagaaatgtgaaggagca
B D                  Marmoset  cctctcaat---cctagaaatgtgaaggagca
B D           Squirrel monkey  cctcttaat---cctagaaacgtgaaggagca
B D                  Bushbaby  tctattaat---tttagaaacgggaaggagca
           Chinese tree shrew  gctctctct---cctaaaaatagcaaggagcg
B D                  Squirrel  tctctcagc---tgtagaaacgggaaggagca
       Lesser Egyptian jerboa  ttt--ctat---cctagaaacgagaaggggca
                 Prairie vole  cctccccat---cctagaaacgggaaggagct
B D           Chinese hamster  tctccccat---cctagaaacgggaaggagct
               Golden hamster  tctccccat---cctagaaacgggaaggagct
B D                     Mouse  tctccccat---tctagaaacgggaaggagct
B D                       Rat  tctccccat---cctagaaacgggaaggagcc
B D            Naked mole-rat  tctttcaat---gctagagcctggaaagagca
B D                Guinea pig  tgtctcagt---cctagaatctggaaggaaca
                   Chinchilla  tctctcagt---cctagaatttggaaggagct
             Brush-tailed rat  tttctcagt---cctagaatttagaaggaaca
B D                    Rabbit  actctcaca---cctagaagtaggaaggagca
B D                      Pika  tttttcagg---cctagaaataagaaggagca
B D                       Pig  tctcttaat---cctagaaacgggaaggagcg
B D                    Alpaca  tctcttcat---cctagaaacggaaagtagcg
               Bactrian camel  cctcttcat---cctagaaacgggaagtagcg
B D                   Dolphin  tctcttcat---cctagaagctggaaggagtg
                 Killer whale  tctcttcat---cctagaagctggaaggagtg
             Tibetan antelope  tctcttcat---cctagaaacgggaaggagcg
B D                       Cow  tctcttcat---cctagaaacgggaaggagcg
B D                     Sheep  tctcttcat---cctagaaacaggaaggagca
                Domestic goat  tctcttcat---cctagaaacgggaaggagcg
B D                     Horse  actcttaat---cctagaaacgggagggagcg
B D          White rhinoceros  actcttaat---cctagaaatgggagggagcg
B D                       Cat  tctctcaat---cctagaaatgggaaggagca
B D                       Dog  tctctcaat---cctagaaataggtgggagca
B D                   Ferret   tctctcagt---cctagaaataagtcggagca
B D                     Panda  cctctcact---tctagaaataggtaggagca
               Pacific walrus  tctctcaat---cctagaaataggtgggagcg
                 Weddell seal  tctctcaat---cttagaaataggtaggagta
             Black flying-fox  tctctcagt---cctagaaacgggaaggtgca
B D                   Megabat  tctctcagt---cctagaaacgggaaggtgca
                Big brown bat  acttccagt---tctagaaacgggaaggggca
         David's myotis (bat)  acttccagt---tctagaaacgggaaggagca
B D                  Microbat  acttccagt---tctagaaacgggaaggagca
B D                  Hedgehog  ttagtcagt---cttaaaagcgagaaggagca
B D                     Shrew  gctgtcatt---cctagaatcgggtcggagca
              Star-nosed mole  tctatcaag---tctaaaaacgggaaggagcg
B D                  Elephant  tctttcaat---cctagaaacgggtaggagcg
          Cape elephant shrew  tc-ttcaag---cctagaaacgggtaggagca
B D                   Manatee  tctttcaat---cctagaaacgggtaggagca
             Cape golden mole  tctttcaaa---cctagaagtgggtaggagca
B D                    Tenrec  cctttcaca---cgtagaaacgtgtaggcgct
                     Aardvark  tctttcaat---cctagaaatggtcaggagca
B D                 Armadillo  tc--tgaat---cctaaaaacgggaaggagct
B D                   Opossum  cattttcat---cctagaggggt--tgaggtg
B D           Tasmanian devil  catcttcat---cctaaagaggtacgggggca
B D                   Wallaby  ctttttcat---cttaaagaggtgtgggggct
B D                  Platypus  cccatctgg---tctacagactggcagggatg
  D           Green seaturtle  ccaaccaattgccttgtaaaactgcagaagta
  D              Mallard duck  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
  D    White-throated sparrow  ================================
B D       Medium ground finch  ================================
B D        American alligator  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D               Rock pigeon  ================================
B D                Budgerigar  ================================
  D       Collared flycatcher  ================================
  D  Chinese softshell turtle  ================================
  D            Painted turtle  ================================

Alignment block 5 of 44 in window, 88794200 - 88794212, 13 bps 
B D                     Human  ggccataccacct
B D                     Chimp  ggccataccacct
B D                   Gorilla  ggccataccacct
B D                 Orangutan  ggccataccacct
B D                    Gibbon  ggccataccacct
B D                    Rhesus  ggccataccacct
B D       Crab-eating macaque  ggccataccacct
B D                    Baboon  ggccataccacct
B D              Green monkey  ggccataccacct
B D                  Marmoset  ggccacaccacct
B D           Squirrel monkey  ggccacaccacct
B D                  Bushbaby  ggccataccacct
           Chinese tree shrew  ggccatactacct
B D                  Squirrel  ggccagaccacct
       Lesser Egyptian jerboa  ggccataccactt
                 Prairie vole  ggccacacaatct
B D           Chinese hamster  ggccacacaatct
               Golden hamster  ggccacacagtct
B D                     Mouse  ggccacacaatat
B D                       Rat  ggccacacaatat
B D            Naked mole-rat  ggccataccacct
B D                Guinea pig  ggccacaccacct
                   Chinchilla  ggccacaccacct
             Brush-tailed rat  ggccacaccacct
B D                    Rabbit  ggccatactatct
B D                      Pika  ggccatactacct
B D                       Pig  ggccacaccacct
B D                    Alpaca  ggccacactacct
               Bactrian camel  ggccacactacct
B D                   Dolphin  ggccataccacct
                 Killer whale  ggccataccacct
             Tibetan antelope  ggccataccacct
B D                       Cow  ggccataccacct
B D                     Sheep  ggccataccacct
                Domestic goat  ggccataccacct
B D                     Horse  ggccataccacct
B D          White rhinoceros  ggccataccacct
B D                       Cat  ggccataccacct
B D                       Dog  ggccatatcacat
B D                   Ferret   ggccatatcacct
B D                     Panda  ggccagatcacct
               Pacific walrus  ggccatatcacct
                 Weddell seal  ggccatatcacct
             Black flying-fox  ggccataccacct
B D                   Megabat  ggccataccacct
                Big brown bat  ggccataccactt
         David's myotis (bat)  ggccatacaacct
B D                  Microbat  ggccatacaacct
B D                  Hedgehog  ggccataccactt
B D                     Shrew  ggccatacaatct
              Star-nosed mole  ggccatacaacct
B D                  Elephant  ggccataccacct
          Cape elephant shrew  ggccataccacct
B D                   Manatee  ggccataccacct
             Cape golden mole  ggccatactacct
B D                    Tenrec  ggccatactactt
                     Aardvark  ggccataccactt
B D                 Armadillo  ggccataccacct
B D                   Opossum  ggccacacaactt
B D           Tasmanian devil  ggccacacaattt
B D                   Wallaby  ggccacacaactt
B D                  Platypus  ggccagacgctct
B D        American alligator  ggtgataatgtac
  D           Green seaturtle  ------------c
  D              Mallard duck  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
  D    White-throated sparrow  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
B D                   Chicken  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D               Rock pigeon  =============
B D                Budgerigar  =============
  D       Collared flycatcher  =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============

Alignment block 6 of 44 in window, 88794213 - 88794261, 49 bps 
B D                     Human  cagaatccagagtgatgtgtatgggtctattatacatgtttataaatgt
B D                     Chimp  cagaatccagagtgatgtgtatgggtctattatacatgtttataaatgt
B D                   Gorilla  cagaatccagagtgatgtgtatgggtctattatacatgtttataaatgt
B D                 Orangutan  cagaatccagagtgatgtgtatgggtctattatacatgtttataaatgt
B D                    Gibbon  cagaatccagagtgatgtgtatgggtctatcatacatgtttataaatgt
B D                    Rhesus  cagaatccagaatgatgtgtatgggtctattatacatgtttataaatgt
B D       Crab-eating macaque  cagaatccagaatgatgtgtatgggtctattatacatgtttataaatgt
B D                    Baboon  cagaatccagaatgatgtgtatgggtctattatacatgtttataaatgt
B D              Green monkey  cagaatccagaatgatgtgtatgggtctattatacatgtttataaatgt
B D                  Marmoset  cagaatccagagtgatgtgtatgggtctattatacatgtttataaatgt
B D           Squirrel monkey  cagaatccagagtgatgtgtatgggtctgttatacatgtttataaatgt
B D                  Bushbaby  cggaatcaaaggtgatatatacgggtttattgtacatatttatgaatgt
           Chinese tree shrew  cagaatccaaagtgatatgtatgggcttattatacatgtctatgaatac
B D                  Squirrel  cagaatccatggtaacgtgaataggtttattatacatgttcatgaatgt
       Lesser Egyptian jerboa  cagaatccaaggtgacatctatcggtctattatacatgcttaaaaatgt
                 Prairie vole  cagaatccagggtaacatgtatgggtctgttatacatgcttaagaatgt
B D           Chinese hamster  cagaatccagggtaacatgtatgggtttgttatacatgcttaagaatgt
               Golden hamster  cagaatccagggtaacatgtatgggtctgttatacatgtttaagaatgt
B D                     Mouse  cggaatccagggtaacgtgtatgggtctgttatacatgctcaagaaaga
B D                       Rat  cagaatccatggtaatgtgtatgggtctgttatacatgcttaagaatga
B D            Naked mole-rat  cggaatccaagactatatctatggatttattatacatgcttatgaaagt
B D                Guinea pig  cagaatccaaggtggtatctaagggtttattatacatgctcaggaaggt
                   Chinchilla  cagaatccaaggtgacatctatgggtttgttatacatgcttaggaaagt
             Brush-tailed rat  cagaatccaggatgatgtctatgggcttattatacatgcttaggaaagt
B D                    Rabbit  cagaatccaaagtgatgtggatgggtttgttgtacatgttcatgaattc
B D                      Pika  cagaatcagaggtcacatggatgggcttattatacatattcatgaattc
B D                       Pig  cagaatccaaggtgacatgtatgggtttattatataagtttatgaaagt
B D                    Alpaca  cagaatccaaggtaacatgtatgggtttattatacatgtttatgaaagt
               Bactrian camel  cagaatccaaggtaacatgtatgggtttattatacatgtttatgaaagt
B D                   Dolphin  cagaatccaaggtgacatgtatgggtttattatacatgtttatgaaagt
                 Killer whale  cagaatccaaggtgacatgtatgggtttattatacatgtttatgaaagt
             Tibetan antelope  cagaatctaaggtgacatgtatgggtttattgtacatgtttataaaacc
B D                       Cow  cagaatctaaggtgacatgtatgggtttattgtacatgtttataaaacc
B D                     Sheep  cagaatctaggatgacatgtatgggtttattgtacatgtttataaaacc
                Domestic goat  cagaatctaggatgacatgtatgggtttattgtacatgtttataaaacc
B D                     Horse  cagaatccaaagtgatatgtatgggtttattatacatgtttatgaaagt
B D          White rhinoceros  cagaatctgaagtgatatgtatgggtttattatacatgtttatgaaagt
B D                       Cat  cagaatccaaagtgatatgtatgggtttattatacatgtttaggaaagc
B D                       Dog  cagaatccaaagtgacatgtatgggcttattatacatgtctatgaaagt
B D                   Ferret   cggaatccaaagtgacatgtatgggtttgttatatgtgtttatgaaagt
B D                     Panda  cggaatccaaagtgacgtgtataggtttgttatatatgtttatgaaagt
               Pacific walrus  cggaatccaaagtgacgtgtatgggtttgttgtatatgtttagaaaagt
                 Weddell seal  cggaatccaaagtgacatgtatgggtttgttgtatatgtttaggaaagt
             Black flying-fox  cggaatccaaggtgatatgtattggtttattaaacatgtttaggaacgt
B D                   Megabat  cggaatccaaggtgatatgtattggtttattaaacatgtttaggaacgt
                Big brown bat  cagtatcaaaagtgatgtgaatgggtctattatacatgtttatgaaagt
         David's myotis (bat)  ccgtatccaaagtgacgtgaatgggtctattatacatgtttatgaaagt
B D                  Microbat  cagtatccaaagtgacgtgaatgggtctattatacatgtttatgaaagt
B D                  Hedgehog  cagaatccaagatgatatgcaggggtttattgtacatgtttatgaatgt
B D                     Shrew  cagaatctgagatgatatgaatgggattattgtacatgtttatgaaagt
              Star-nosed mole  cagaatccagtgtgacatgtgtaggcttattatacatgtttatgaaagt
B D                  Elephant  cagaatccaaagtgacatgtacgggattactatacatttgtatgaatgc
          Cape elephant shrew  cagaatccaaagtgatgtgtaagggattgttatacttttctatgaatgc
B D                   Manatee  cagaatccaaagtgacatgtatgggattattatacatttgtatgaatgt
             Cape golden mole  cagaatccaaactgatgtgtatgggaccgctatacatttttataaaggt
B D                    Tenrec  cagaatccagagtgatgtgtatggggttattatacatttttatgaatgt
                     Aardvark  cagaatccaaagtgacatatatgggattattatacatttttatgaatgt
B D                 Armadillo  cagaatccaaagtgacatgtatgggcttattatacatttttaggaatgt
B D                   Opossum  ctgcatccaatatcacatgaatgggcttgttatacattgataaaaacaa
B D           Tasmanian devil  ctgaatctagcgttacatgaataggcttattatacatacttaaaaactc
B D                   Wallaby  ctgcatccagtgtcacatgaacaggcttgttatacattcttaaaaactc
B D                  Platypus  ctgagtccatgtggatgtatatgggattgctgtacatttccagaaactg
B D        American alligator  ctgagtccatggctggctgtaaagggtccttatacattttcaggaactc
  D           Green seaturtle  ctgaagccatggcaggctgtaaaggattgttatacattttcagaaatgc
  D            Painted turtle  ctgaagccatggcaggctgtaaaggattgttatacattttcagaaatgc
  D              Mallard duck  =================================================
          Tibetan ground jay  =================================================
B D               Zebra finch  =================================================
  D    White-throated sparrow  =================================================
B D       Medium ground finch  =================================================
B D                    Turkey  =================================================
B D                   Chicken  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D               Rock pigeon  =================================================
B D                Budgerigar  =================================================
  D       Collared flycatcher  =================================================
  D  Chinese softshell turtle  =================================================

Alignment block 7 of 44 in window, 88794262 - 88794358, 97 bps 
B D                     Human  tgccgggtccatgaattcttcggatttgcacaagtactttatgatttgttctg-----ggaggagtaggt
B D                     Chimp  tgccgggtccatgaattcttcggatttgcacaagtactttatgatttgttctg-----ggaggagtaggt
B D                   Gorilla  tgccgggtccatgaattctttggatttgcacaagtactttatgatttcttctg-----agaggagtaggt
B D                 Orangutan  tgccgggtccattaattctttggatttgcacaagtactttatgatttgttctg-----ggaggagtaggt
B D                    Gibbon  tgccgggtccatgaattctttggatttgcacaagtactttatgatttgttctg-----ggaggagtaggt
B D                    Rhesus  tgctgggtccatgaattcttcagatttgcacaagtactttatgatttgttctg-----ggaggagcaggt
B D       Crab-eating macaque  tgctgggtccatgaattcttcagatttgcacaagtactttatgatttgttctg-----ggaggagcaggt
B D                    Baboon  tgctgggtccatgaattcttcagatttgcacaagtactttatgatttgttctg-----gaaggagcaggt
B D              Green monkey  tgctgggtccattaattcttcggatttgcacaagtactttatgatttgttctg-----ggaggagtaggt
B D                  Marmoset  tgctgggtccatgaattcttcggatttgcataggtaatttatgatttgttctg-----ggaggagtaggt
B D           Squirrel monkey  tgctgggtccatgaattcttttgatttacataggtactttatgatttgttctg-----ggaggagtaggt
B D                  Bushbaby  tgctgggtccatgaattctttgcatttgcacaagtactttatgatttgttctg-----gaaggagtaggt
           Chinese tree shrew  tttggggtccatgaattcttcggtgttacataaatactttatgatttgttccg-----ggaggagtaggt
B D                  Squirrel  ttgtgggtccataaattgttcacatttcaacagatactttatgatttgttctg-----gaaggagtagct
       Lesser Egyptian jerboa  tgatgggtccatgaattcttcagcattgcacaagcactttataatttgttctg-----ggaggaggaggt
                 Prairie vole  tgctgggtccaagaattcatcagctttgcacaagtattggatagtttgttctg-----ggaggagtagct
B D           Chinese hamster  tactggatccaagaattcatcagctttacataagtactggatagtttgttctg-----ggaggaggaggt
               Golden hamster  ttctggatccatgaattcttcagctttgcataaatactggatagtttgttctg-----ggaggaggaggt
B D                     Mouse  cgctgggtccatgaattcttcagctttgcataaatacttgataatttgttctg-----gaagaatgagtt
B D                       Rat  tgctgggtccatgaattctgtggctttgcataagtacttgatagttttttctg-----ggagaatgagtt
B D            Naked mole-rat  tgctgggcccatgagttcttcagaattacataaatactttaagatttgttctg-----aagggagcaggt
B D                Guinea pig  tgctggatctgtgagttcttcagaattacataaatactttatgatttgttctg-----gggggaacaggt
                   Chinchilla  ttctgggtctgtgagttcttcagatttacataaatactttatgatttgttctg-----aggggagcagat
             Brush-tailed rat  ggctgggtctgggagttcctcagagttacataagtactttatgatttgttctg-----ggaggagcaggc
B D                    Rabbit  tgctgggttcatgaattccttagatttgcacaagtactttatgatttgctcag-----gggggagtaggt
B D                      Pika  tgcagggctcatgaattcgttagatgtgcacaagtactttataatttgctcag-----gggggagtaggt
B D                       Pig  ttctgggtccataaattcttcagaattgcataagtattttattatttgttctg-----gaaggagtaagt
B D                    Alpaca  tttggggtccatgaattctgctgaattgcataagtactttattatttgttctg-----ggaggagtaatt
               Bactrian camel  tttggggtccatgaattctgctgaattgcataagtactttattatttgttctg-----ggaggagtaatt
B D                   Dolphin  ttctgggtccattaattctgcagaattgcatatgtactttattatttgttctg-----gaaggagtaatt
                 Killer whale  ttctgggtccattaattctgcagaattgcatatgtactttattatttgttctg-----gaaggagtaatt
             Tibetan antelope  ttctgggtccattagttctgcagagttgcacaagtactttattatttgttctg-----ggaggagtaatt
B D                       Cow  ttccgggcccattaattctgcagagttgcacaagtactttattatttgttctg-----ggaggagtaatt
B D                     Sheep  ttctgggtccattaattctgcagagttgcacaagtactttattatttgttctg-----ggagcagtaatt
                Domestic goat  ttctgggtccattaattctgcagagttgcacaagtactttattatttgttctg-----ggaggagtaatt
B D                     Horse  ttctgggtccatgaattcctcagatttgcacaaatactttattatttgttctg-----ggaggagtaatt
B D          White rhinoceros  ctctgtgtccatgaattcttcagatttgcataagtactttattatttgttctg-----ggaggagtaatt
B D                       Cat  ttctggatccatgaattcttcagatttgcacaagtacttgattatttgttctg-----ggatgagcaatt
B D                       Dog  ttctggatccatgaattgttcagatttgcacaagtactttattatttgttcag-----ggatgagcagtt
B D                   Ferret   ttctggatccatgaattcttcagatttgtataagtactttattatttgttctg-----ggatgagcagtt
B D                     Panda  ttccggatccaggaattcttcagatttgcacaagtactttattatttgttctg-----ggatgagcagtt
               Pacific walrus  ttctggatccatgaactcttcggatttgcacaagtactttatcatttgttctg-----ggatgagcagtt
                 Weddell seal  ttctggatccatgaactcttcagatttgcacaagtactttattatttgttctg-----ggatgagcagtt
             Black flying-fox  ttctgggttcaggaattcttcagatttgcacaagtactttattatttgttctg-----ggaggagtaatt
B D                   Megabat  ttctgggttcaggaattcttcagatttgcacaagtactttattatttgttctg-----ggaggagtaatt
                Big brown bat  ttctgggtcaatgaattcttcagattcgtataaatacttaattatttgttctg-----ggaggagtaatt
         David's myotis (bat)  ttctggttccatgaattcttcagatttgtataaatacttaatgatttgttctg-----ggaggagtaatt
B D                  Microbat  ttctggttccatgaattcttcagatctgtataaatacttaattatttgttctt-----ggaggagtaatt
B D                  Hedgehog  tttggggtccaggaattcttcagatttgcacaagtactttactatttgctctg-----ggagaagtaatt
B D                     Shrew  ttctggatccatgaaatctttagatttgtacaaatacattattacttgctctg-----ggaggagtaatt
              Star-nosed mole  ttctggatccatgaattcctcatatttgcacaggtactttattatttgttctg-----ggagaattaatt
B D                  Elephant  tgctgggtccaggaattcttcagagttgcacaaatactttattatttgttctg-----ggagtagtaggt
          Cape elephant shrew  tgctgggtccaggaattcttcagttttgcacaagtattttattatttgttctg-----agagtagtagtt
B D                   Manatee  tgctgggtccaggaattcttcagatttgcacaaatactttattatttgttctg-----ggagtagcagtt
             Cape golden mole  tgctgggtccaggaatctctcagctttgcacaagtactttattatttgttctg-----ggagtagtagtt
B D                    Tenrec  ttctgggtccagaaattcttcagctttccccaagcactttattatttgttctg-----ggattaatagtt
                     Aardvark  tgctgggtccaggaattcttcacatttgcacaagtactttattatttgttctg-----ggaggagtagtt
B D                 Armadillo  ttctgggtccagaaattcttcagatttacacaagtacattattatttgttctg-----gaagtagtaatt
B D                   Opossum  tgctgggctcaagaagccttcagctctacaaaggtactttatgatttcttcag-----ggagtagaagtt
B D           Tasmanian devil  tgctggggtcaagaagtcttcatctttgcacagatactttatgatttcttcag-----gaagcagaagtt
B D                   Wallaby  tgcaggggtcaggaagccttcagctctacacagatactttatgatttcttcag-----ggaggagaaggt
B D                  Platypus  tcccggagtcatgaagagttcacacttggacaggtacttgatggtctcttctg-----ggatgaggagct
B D                    Turkey  ctccagaatc------ctctgagcgt----------gctgatggactctgcggctgctgaatggtgcggg
B D        American alligator  ctctggactcaaacagtccttggcattacacaagtagttaatggtctctgctg-----ggattaggaggt
  D           Green seaturtle  ttctggactcataaattcttttgccttgcacaaatagttaattgtttctgctg-----ggattagaagtt
  D            Painted turtle  ttctggactcataaattcttttgccttgaacaagtagttaattgtttctgctg-----ggattagaagtt
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  caggtgcaacttgg----------tgtaagttatc---gcctggt
                        Chimp  caggtgcaacttgg----------tgtaagttatc---gcctggt
                      Gorilla  caggtgcaacttgg----------tgtaagttatc---gcctggt
                    Orangutan  caggtgcaacttgg----------tgtaagttatc---acctggt
                       Gibbon  caggtgcaacttgg----------tgtaagttatc---gcctggt
                       Rhesus  caggtgcaacttgg----------tgtaagttatc---acctggt
          Crab-eating macaque  caggtgcaacttgg----------tgtaagttatc---acctggt
                       Baboon  caggtgcaacttgg----------tgtaagttatc---acctggt
                 Green monkey  caggtgcaacttgg----------tgtaagttatc---acctggt
                     Marmoset  cagctgcagcttgg----------tgtaagttatc---acctggt
              Squirrel monkey  cagctgcagtttgg----------tgtaagttatc---acctggt
                     Bushbaby  caggtgcaatttgg----------tgcaagttatc---gcctggt
           Chinese tree shrew  caggtgcaagttga----------tgcaaattatc---acctggt
                     Squirrel  caggtgcaacttgg----------tgcaaattatc---ccctggt
       Lesser Egyptian jerboa  caggtgcaacttgg----------tgcaagttatc---tcctggt
                 Prairie vole  caggggcaacttgg----------tgcaaggtgtc---acctggc
              Chinese hamster  caggggcaatttgg----------tgcaagttgtc---acctggc
               Golden hamster  caggggcagcttgg----------tgcaaggtgtc---acctggc
                        Mouse  caggggcaagttgg----------tgtaagttgtc---acctgga
                          Rat  ctggggcaagttgg----------tgtaggttgtc---acctggc
               Naked mole-rat  gaggtgcagcatgg----------tgcaagttatc---atctagt
                   Guinea pig  caggtgaagtgttt----------tgcaggttatcattatctaat
                   Chinchilla  caggtgcagcttgg----------tgcaaattatc---atctagt
             Brush-tailed rat  taggtgcagcattc----------tgcaagttatc---atctagt
                       Rabbit  caggtacaatttgg----------tgcaaattatc---acctaat
                         Pika  cagggataacttgg----------tgcaaattatc---acctagc
                          Pig  caggtgcaatttgg----------tgcaaattatc---acctggt
                       Alpaca  caggtgcaacttgg----------tgcaaattatc---acctggt
               Bactrian camel  caggtgcaacttgg----------tgcaaattatc---gcctggt
                      Dolphin  caggtgcaacttgg----------tgcaaattatc---gcctggt
                 Killer whale  caggtgcaacttgg----------tgcaaattatc---gcctggt
             Tibetan antelope  cgggtgcagcttgg----------tgcaaactgtc---tcctggg
                          Cow  caggtgcagcttgg----------tgcaaactgtc---tcctggt
                        Sheep  cgggtgcagcttgg----------tgcaaactgtc---tcctggg
                Domestic goat  cgggtgcagcttgg----------tgcaaactgtc---tcctggg
                        Horse  ccggtgcaacctgg----------tgcaagttatc---gcctggt
             White rhinoceros  ccggtacagcctgg----------tgcaagttatc---gcctggt
                          Cat  caggtgctagttgg----------tgcaagttatc---ccctggt
                          Dog  caggtgcaatttgg----------tgcaagttatc---ccctggt
                      Ferret   caggtgcaagttgg----------tgcagattatc---tcccggt
                        Panda  caggtgcaagttgg----------tgcaagttatc---ccccggt
               Pacific walrus  caggtgcaagttgg----------tgcaagttatc---ccctggt
                 Weddell seal  caggtgcaagttgg----------tgcaagttatc---ccctggt
             Black flying-fox  cgggtacgagttgg----------tgcaagttatc---gcctggt
                      Megabat  caggtacgagttgg----------tgcaagttatc---gcctggt
                Big brown bat  caggtgcaggttgg----------tgcaagttctc---gctgggt
         David's myotis (bat)  caggtgcaggttgg----------tgcaagctctc---gcccggt
                     Microbat  caggtgcaggttgg----------tgcaagctctc---gcccggt
                     Hedgehog  caggggtaacttgg----------tgcaagttgtc---tcctggg
                        Shrew  caggtacagttttg----------tgcaagtcat------ctggc
              Star-nosed mole  caggtataagttgg----------tgcaagttatc---tcctggc
                     Elephant  cgggagcaacttgg----------tgcaagttatc---acctggc
          Cape elephant shrew  ctggtacaagttgg----------tgcaagttgtc---acctggc
                      Manatee  caggagcaacttgg----------tgcaagttgtc---gcctggc
             Cape golden mole  caggtgaaacttgt----------tgtaagttatc---acctggc
                       Tenrec  caggtgcaatttgg----------tgcaagttatc---acctggc
                     Aardvark  caggtacagcctgg----------tgcaagttatc---acctggc
                    Armadillo  caggtacaagctgg----------tgcaagttatc---acctggt
                      Opossum  caggtacaagactg----------tgaaggttatc---tcctggt
              Tasmanian devil  caggcacaagattg----------tgaaggttgtc---tcctggt
                      Wallaby  caggcacaagcttg----------tgcaggttatc---tcctggt
                     Platypus  cgggaaccagttgg----------tggaggttggc---cccgggg
                       Turkey  ggagtgcagggcgggggggaaaactgtgaacttta---cctcagc
           American alligator  tgggtacaagtgtg----------tgtaggttgtt---gcccaat
              Green seaturtle  ctggaacaagggtg----------tgtagattgtc---accgagt
               Painted turtle  ctggaacaagggtg----------tgtagattgtc---acccagt
                 Mallard duck  =============================================
           Tibetan ground jay  =============================================
                  Zebra finch  =============================================
       White-throated sparrow  =============================================
          Medium ground finch  =============================================
                      Chicken  =============================================
             Peregrine falcon  =============================================
                 Saker falcon  =============================================
                  Rock pigeon  =============================================
                   Budgerigar  =============================================
          Collared flycatcher  =============================================
     Chinese softshell turtle  =============================================

Inserts between block 7 and 8 in window
B D                   Turkey 2bp
B D       American alligator 484bp

Alignment block 8 of 44 in window, 88794359 - 88794370, 12 bps 
B D                     Human  cctttagtgcct
B D                     Chimp  cctttagtgcct
B D                   Gorilla  cctttagtgcct
B D                 Orangutan  cctttagtgcct
B D                    Gibbon  cctttagtgcct
B D                    Rhesus  cctttagtgcct
B D       Crab-eating macaque  cctttagtgcct
B D                    Baboon  cctttagtgcct
B D              Green monkey  cctttagtgcct
B D                  Marmoset  cctttcgtgccc
B D           Squirrel monkey  cctttagtgccc
B D                  Bushbaby  cctttactgccc
           Chinese tree shrew  cctttcacaccc
B D                  Squirrel  cccttagcaccc
       Lesser Egyptian jerboa  cctttagtcccc
                 Prairie vole  cctttcgtaccg
B D           Chinese hamster  cctttcataccc
               Golden hamster  cctttcgtaccc
B D                     Mouse  cctttcgcgccc
B D                       Rat  cctttaccaccc
B D            Naked mole-rat  ccttttgttccc
B D                Guinea pig  ccttgagtaccc
                   Chinchilla  cctttagtaccc
             Brush-tailed rat  cctttggttttc
B D                    Rabbit  cctttcgtaccc
B D                      Pika  cctttagtgccc
B D                       Pig  cctttagtgccc
B D                    Alpaca  cctttagtgccc
               Bactrian camel  cctttagtgccc
B D                   Dolphin  cctttagtgccc
                 Killer whale  cctttagtgccc
             Tibetan antelope  cctttagggctc
B D                       Cow  cctttagggctc
B D                     Sheep  cctttcgggctc
                Domestic goat  cctttcgggctc
B D                     Horse  cctttagtgccc
B D          White rhinoceros  cctttggtgccc
B D                       Cat  cctttagcactc
B D                       Dog  cctttagcaccc
B D                   Ferret   cctttagcaccc
B D                     Panda  cctttagcaccc
               Pacific walrus  cctttagcgccc
                 Weddell seal  cctttagcgccc
             Black flying-fox  cctttagtgccc
B D                   Megabat  cctttagtgccc
                Big brown bat  ccctttgcaccc
         David's myotis (bat)  ccctttacgccc
B D                  Microbat  ccctttacgccc
B D                  Hedgehog  cctttactactc
B D                     Shrew  acgttattgccc
              Star-nosed mole  cctttagtgccc
B D                  Elephant  cctttggtgccc
          Cape elephant shrew  cctttagtaccc
B D                   Manatee  cctttggtgccc
             Cape golden mole  cctttagtgccc
B D                    Tenrec  cctttagcgccc
                     Aardvark  cctttagtgccc
B D                 Armadillo  cctttagtcccc
B D                   Opossum  cctttagtgccc
B D           Tasmanian devil  cctttagtgccc
B D                   Wallaby  cctttagttcct
B D                  Platypus  aacctggtgccc
B D        American alligator  catttaaatgtc
  D           Green seaturtle  cccttactgctc
  D            Painted turtle  cccttactgctc
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
B D       Medium ground finch  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D               Rock pigeon  ============
B D                Budgerigar  ============
  D       Collared flycatcher  ============
  D  Chinese softshell turtle  ============

Inserts between block 8 and 9 in window
  D          Green seaturtle 529bp
  D           Painted turtle 480bp

Alignment block 9 of 44 in window, 88794371 - 88794571, 201 bps 
B D                     Human  actttcatagtctggcaaaggtagagtgacagtttatgagtttgtgtgagaaaatctgtgatgacctcct
B D                     Chimp  actttcatagtcttgcaaaggtagagtgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                   Gorilla  actttcatagtcttgcaaaggtagagtgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                 Orangutan  actttcatagtcttgcaaaggtagagtgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                    Gibbon  actttcagagtcttgcaaatgtagagtgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                    Rhesus  actttcatagtcttgcaaagatagactgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D       Crab-eating macaque  actttcatagtcttgcaaagatagactgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                    Baboon  actttcatagtcttgcaaagatagactgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D              Green monkey  actttcatagtcttgcaaagatagactgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                  Marmoset  actttaatagtcttacaaaggtgaattgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D           Squirrel monkey  actttaacagtcttacaaaggtgaattgacagtttatgagtttgtgtgagaaaatctgtgatgacctctt
B D                  Bushbaby  actttaatagtcttaaaaaggaagaatgacagtttatggatgtgggtgataaactctgtggtgacctctt
           Chinese tree shrew  acttttatagtcttaaaaagatggagtgctagtttatgaatttgggtgagaaagtctgtgataacctctt
B D                  Squirrel  gctttcatagccttaaacaggtgaagtgctagtttatgagtctgggtgaggaaatctgtgatgacctcat
       Lesser Egyptian jerboa  actttaacacttttaaaaaggtgtagtgccagtttatgagtctgggagagaaagtctgtggtgatttctg
                 Prairie vole  actttcacggtcttaaaaaggtgaaatgccagtttgtgagtcatggtgagaaaatctgtggtgacttccg
B D           Chinese hamster  actttgatagtcttaaaaaggtgcagtgacagtttgtgagtcatggtgagaaaatctgtggtgacttctg
               Golden hamster  actttgatggtcttaaaaaggtggagtgccagtttgtgagtcatggtgagaaaatctgtgatgacttctg
B D                     Mouse  aatttcactgtcttgtaaagttggagtgccagtttgtgagtcatggtgaggaattctgtggtgacttcct
B D                       Rat  agttttaccgtcttgtaaagatggagtgccagtttgtgagtcaaggtgaggaaatctgtggtgacttcct
B D            Naked mole-rat  actttaagagtcttaaaaaggtgcatagccagtttatgcatccgggtaagaaaatctgtgacaatctcct
B D                Guinea pig  actttaagggtcctataaaggcgcagagccagttggtgagtccgggtaaaaaaatctgtgatgatctcct
                   Chinchilla  cctttaagggtcttgaaaaggtgaagtgccagtttatgagtccgggtaagaaaatctgtgatgatctcct
             Brush-tailed rat  actttaggggtcttgaaaagatgcagtgccagtttatgagtgcgggtgagaaaatctgtgacgatctcct
B D                    Rabbit  accttgatagtcttgaagaggtagagtcctagtttgtgagtgtgagtgagaaactccgtgatcacctctt
B D                      Pika  accttaatagtcttaaaaaggtacagtccaagtttatgagtctgcctgaggaactctgtgacgacctctc
B D                       Pig  actttaacagtcttaaaaatgtggagtgctagtttatgagtttggatgagaaattctgtgatgacctctt
B D                    Alpaca  actttgacagtcttaaaaaggtagagtgctaatttatgagtttggatgagaaattctgtgatgacctctt
               Bactrian camel  actttgacagtcttaaaaaggtagagtgctaatttatgagtttggatgagaaattctatgatgacctctt
B D                   Dolphin  actttcacagtcttaaaaagatggagtactagtttatgggtttggatgagaaattctgtcatgacctctt
                 Killer whale  actttcacagtcttaaaaagatggagtactagtttatgggtttggatgagaaattctgtcatgacctctt
             Tibetan antelope  actttcacagtcttaaacaggtgaagggctagtttgtgtgtctggatgaggaattctgtcatgacctctt
B D                       Cow  actttcacagtcttaaaaaggtgaagtgctagcttgtgtgtttggatgagaaattccgtcatgacctctt
B D                     Sheep  actttcacagtcttgaacaggtgaagagctagtttgtgtgtctggatgaggaattctgtcatgacctctt
                Domestic goat  actttcacagtcttgaacaggtgaagagctagtttgtgtgtctggatgaggaattctgtcatgacctctt
B D                     Horse  actttgacggtcttaaaaagatggagtgccagtttatgagtttgaatgagaaattctgttatgacctctt
B D          White rhinoceros  actttaacagtcttaaaaagatggagtgccagtttatgagtttgggtgagaaactctgtgatgacctctt
B D                       Cat  actttcacagtctttaaaaggtgaattgccagtttgtgagtctgggtgagaaactcggtgaggacctctt
B D                       Dog  actttaacagtctttaaaaggtggagtgccagtttatgagtctgagtgagaaactctgtgatgacctcct
B D                   Ferret   actttaactgtctttaaaagatggagtgccagtttatgagtctgagtgagaaattctgtgatgacctctt
B D                     Panda  actttaaccgtctttaaaaggtgcagtgccagcttatgagtctgagtgagaaactctgtgacgacctctt
               Pacific walrus  actttaaccatctttaaaagatggagtgctagcttatgggtctgagtgagaaactctgtgatgacctctt
                 Weddell seal  actttaaccgtctttaaaagatggggtgctagcttatgggtctgagtgagaaactctgtgatgacctctt
             Black flying-fox  actttaactgtcttaaaaatgtagagtgctagtttatgagtttgggtgagaaactctgtgacgacctcct
B D                   Megabat  actttaactgtcttaaaaatgtagagtgctagtttatgagtttgggtgagaaactctgtgacgacctcct
                Big brown bat  actttaagagtcttgaaaaagtagagtgctagtttatgagtttgggtgagaaactctgtgatgacctctc
         David's myotis (bat)  actttaagagtcttaaaaaagtagagtgctagtttatgcgtctgggtgagaaactcagtgatgacctctt
B D                  Microbat  actttaagagtcttgaaaaagtagagtgctaatttatgggtctgggtgagaaactcagtgatgacctctt
B D                  Hedgehog  attttaacagtcttgaaaatatgatgtgccagcatatgagtttgtgtgagaaattctatgatgacctcct
B D                     Shrew  actttaatggtgttaaaaatgtagactgccagtttatgaatttgtttaagaaactctttgacaacttcct
              Star-nosed mole  actttaacagtcttaaaaagataaagtgccagtttatgagtttgggtgagaaactctgtcatcacctcct
B D                  Elephant  actttaacagtcttaaaaaggtgaagtcctagtttatgaatttgggtgagaaactctgtgacgacctctt
          Cape elephant shrew  actttaacagtctttaaaaagtggagtccaagtttgtgagtttgggtgaggaactccgagatgacctcat
B D                   Manatee  actttaacagtcttaaaaaggtggagtcctagtttatgagtttgggtgagaaactctgtgatgacctctt
             Cape golden mole  actttaacagccttaaaaaggttgagtcctagtttgtgggtttggatgagaaactctgtgatgacttctt
B D                    Tenrec  actttaacagacttaaaaaggtggagtcccagtttatgaatttgggtgagaaattctgtgacgacctctt
                     Aardvark  actttaacagtcttgaaaagatacgctcctagtttatgagtttgggtgagaaattctgtgatgacctctt
B D                 Armadillo  accttaacagtcttataaaggtggagtgccagtttatgagtttgagtgaggaattctgagatgagttctt
B D                   Opossum  actttcacattttttaaaaggtacatgccaagtttgagtaccaaggtcagacactcagtgaccacctcat
B D           Tasmanian devil  actttaacattctttaaaaggtacatgcccagcttgagcaccagagtgaggcattctgtgatcacctctg
B D                   Wallaby  actttaacattcctgaaaagatacatgcccagcttgagcaccagggtgaagcattcagtaaccacctctt
B D                  Platypus  accttgatggtcttcaggaggaacacgcccagtttgagcaccagggtgaggcattcggtgaacacctctt
B D                    Turkey  ----------attttagcacagagtctgccacactgatcaggagtgtaagacactctgcgaccacctctt
B D        American alligator  accttaaatgtctttgaaatgtaggcgcccagtttcagcaggagagtaaggcactcggtgacaacctctt
  D           Green seaturtle  accttaaaagtctttgaaaggtatgttcccagtttgaggaggagtgtaagacattcagtgaccacctctt
  D            Painted turtle  accttgaaagtctttgaaaggtatgttcccagtttgaggaggagcgtaagacattcagtgaccacctctt
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ttagggactgtgactgtgtcacatcgtcgagatacataactggaacttttatcactgaaacatgccattg
                        Chimp  ttagggactgtgactgtgtcacatcgtcgagatacataactggaacttttatcactgaaacatgccattg
                      Gorilla  ttagggactgtgactgtgtcacatcatcgagatacatatctggaacttttatcactgaaacatgccattg
                    Orangutan  ttagggactgtgactgtgtcacatcatcgagatacataactggaacttttatcactgaaacatgccattg
                       Gibbon  ttagggactgtgactgtgtcacatcatcgagatacataactggaacttttatcactgaaacatgccattg
                       Rhesus  ttagggactgtgattgtgtcacatcatcgagatacataactggcacttttatcactgaaacatgccattg
          Crab-eating macaque  ttagggactgtgattgtgtcacatcatcgagatacataactggcacttttatcactgaaacatgccattg
                       Baboon  ttagggactgtgattgtgtcacatcatcgagatacataactggcacttttatcactgaaacatgccattg
                 Green monkey  ttagggactgtgattgtgtcacatcatcgagatacataactggcacttttatcactgaaacatgccattg
                     Marmoset  ttacggtctgtgactgtgtcacatcgtcgagatacataactggcacttttatcactgaaacatgccattg
              Squirrel monkey  ttagggtctgtgactgtgtcacatcatcgagatacataactggcacttttatcactgaaacatgccattg
                     Bushbaby  ttagggactgggattgtgtcacgtcatcaagatacataactggcacttttattactgaaacataccattg
           Chinese tree shrew  ctagggattgtgattgtgtcacatcatcaagatacataactggtgcttttatgaccgaaacatgccattg
                     Squirrel  ttaaggactgtgactgtgtcacatcatcaagatacataactggcactttgatgactgaaacgtgccattg
       Lesser Egyptian jerboa  ccagggactgtgactgtgtcacatcatcaagatacataactggcactttgatgactgagacatgccactg
                 Prairie vole  atagagactgtgactgtgtcacatcatctagatacagaactgggaccttgatgacagaaacatgccattg
              Chinese hamster  ctagagactgtgactgtgtcacatcttctaaatacaaaacagggactttgatgacagaaatgtgccactg
               Golden hamster  ctagagactgtgactgcgtcacatcatctaaatacaaaacagggactttgatgacagagacatgccactg
                        Mouse  ctatagacggagactgtgattcgtcatctaggtacaaaacggggactttgattgcagagatatgccactg
                          Rat  ctacggactgcgactgcgtgtcgtcatctaggtacaaaaccgggactttgatgatagagatgtgccactg
               Naked mole-rat  gcagggactgtgactgtgtcacatccttgaggcacatagttggcactctgactactgaaacatgccactg
                   Guinea pig  ccagagactgagactgtgtcatgtcatccagatacatgatgggcattcttactactgaaaaatgccattg
                   Chinchilla  tcagggactgggattgggtcatgtcatcaagatacataatcggcactcttactgctgaaacatgccactg
             Brush-tailed rat  tcagggactgggattgggtcacatcatcgagatacataattggtgctcttactactgaagtgtgccactg
                       Rabbit  ccagggtctgtgactgtgtcacatcatcgagatacaggactgggacctttatgagggagatgtgccattg
                         Pika  ccagggtctccgactgcgtcatgtcgttgaggtacatgactgggaccttgatgagtgagacgtgccactg
                          Pig  gtaaggactgtgactgtgtcacatcatcaagatacatgactggtgcttttattactgaaatataccattg
                       Alpaca  ctagggactgtgactgtgtcacatcatcgagatacatgactggcacttttattactgaaacatgccattg
               Bactrian camel  ctagggactgcgactgtgtcacatcatcgagatacatgactggcacttttattactgaaacatgccattg
                      Dolphin  gtagggacagtgactgtgtcacatcatcaagatacataactggcgcttttattactgaaacatgccattg
                 Killer whale  gtagggacagtgactgtgtcacatcatcaagatacataactggcgcttttattactgaaacatgccattg
             Tibetan antelope  gcagggactgtgtctgtgtcacgtcatctagatacatgaccggtgcttttattactgaaacatgccactg
                          Cow  gtagggactgtgtctgtgtcacatcatctagatacatgaccggcgcttttattactgaaacatgccactg
                        Sheep  gcagggactgtgtctgtgtcacgtcatctaggtacatgaccggcgcttttattactgaaacatgccactg
                Domestic goat  gcagggactgtgtctgtgtcacgtcatctaggtacatgaccggtgcttttattactgaaacatgccactg
                        Horse  ctagggactgtgactgtgtcacatcatcaagatacatgactggcacttttattactgaaacatgccattg
             White rhinoceros  ctagggactgtgactgtgtcacgtcatcgagatatatgactggcacttttattactgaaacatgccattg
                          Cat  ctagggactgtgtctgtgtgacatcatcgagatacatgactggagcttttatttctgatacatgccattg
                          Dog  ctagggactgtgtctgtgtcacatcatcaagatacatgactggaactttcatcactgaaacatgccattg
                      Ferret   ccacggattgtgtctgtgtcacatcatcgagatacatgactggaacttttattactgaaatatgccattg
                        Panda  ccacggactgtgtctgtgtcatatcatcaaggtacatgacaggaacttttattactgaaatatgccattg
               Pacific walrus  tggtggactgtgtctgtgtcacatcatcaagatacatgactggaacttttatcactgaaacatgccattg
                 Weddell seal  tggtggactgtgtctgtgtcacatcatcgagatacatgactggaacttttatcactgaaacatgccattg
             Black flying-fox  ctagggactgcgactgtgtcacgtcatcgagatacatgacaggcacttttattactgaaacataccattg
                      Megabat  ctagggactgtgactgtgtcacgtcatcgagatacatgacaggcacttttattactgaaacataccattg
                Big brown bat  tcagggactgtgactgtgtcacatcatcaagatacatgaccggcacttttatgacgatgacatgccattg
         David's myotis (bat)  tcaggggctgtgactgtgtcacatcgtccagatacatgactggcactttgatgaccacaacatgccattg
                     Microbat  ccagggactgtgactgtgtcacatcatccagatacatgactggcactttgatgaccacaacatgccattg
                     Hedgehog  caagggattgagattgtgttacatcatcaagatacaggactggcactttaattacagaaacatgccactg
                        Shrew  ctaaagactgtgattgtgttacatcaccgagatacattaccggcacatttattaatgaagtataccattg
              Star-nosed mole  caagggactgtgattgtgtcacatcatcaagatacatgactggcgcatttattactgaaatgtgccattg
                     Elephant  ctagggactgtgactgtgttacatcatcgaggtacataactggcacttttattaccgagacctgccattg
          Cape elephant shrew  ctagagacagtgactgagttacatcatcaaggtacatgacaggcacttttatgacagagacgtaccactg
                      Manatee  ctagggactgtgactgcgtcacatcatcgaggtacataacgggcacttttattaccgagacgtgccattg
             Cape golden mole  ctagggtctgtgactgtgtcacatcgtcgaggtacgtaactggtacatttattacggacacctgccattg
                       Tenrec  ctatggactgggactgtgtcacatcatcgagatacataacaggcacatttattactgagacatgccattg
                     Aardvark  ctagtgactgggactgtgtcacatcgtcaagatacataactggcacttttattaccgagacctgccactg
                    Armadillo  ctagggactgtgactgtgtgacgtcattgagatacataacaggcacttttattactgacacatgccattg
                      Opossum  ctttggactgtgactgggtgacatcttccagatacatcacgggtgctttgattacagagttgtaccattg
              Tasmanian devil  ttttagattgtgattgtgtgatatcttccaggtacatcactggtacagtgaccacagaggtgtaccattg
                      Wallaby  ctttagattgagattgagtgaaatcttccaggtacatcactggcatattgaccattgaggtataccactg
                     Platypus  cgggcgactgagattgagtgacgtcctccaggtacatgacggggacggtgatgacggagacgtgccactg
                       Turkey  ctatagactgtgattgcgttgagtcctctggatgtgtcacaggagacgtcaccactaccacatcccacct
           American alligator  ctgtagactgcgattgtgtcacatcttccaggtatgtcacaggcggagtcaccatggtgacataccactg
              Green seaturtle  ctgtagactctgattgtgtcacatcttccaggtatgtcacaggcagtatcatcattgtgacataccactg
               Painted turtle  ctgcagactgcgactgtgtcacatcttctaggtaggtcacaggcagtgtcaccattgtgacataccactg
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
          Medium ground finch  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                        Chimp  cataaaaagcctcattggaatgttatgagaaataactataattttcatttgttgaataaaa
                      Gorilla  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                    Orangutan  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                       Gibbon  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                       Rhesus  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
          Crab-eating macaque  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                       Baboon  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                 Green monkey  cataaaaagcctcattggaatgttatgagaaatgactataattttcatttgttgaataaaa
                     Marmoset  cataaaaagcctcattgggatgtcatgagaaatgactataattttcattttttgaataaaa
              Squirrel monkey  cataaaaagcctcgttgggatgttatgagaaatgactataattttcatgttttgaataaaa
                     Bushbaby  catgaagagcctggttgggatgttatgagaaatgactataattttcatttcttgtgcaaaa
           Chinese tree shrew  catgaagatcctggttgggatgttatgggagataactataattttcagttcttggatcaga
                     Squirrel  catgaagaatctcgttgggatgttatgagaaatgactataattttcatgttttggacgaaa
       Lesser Egyptian jerboa  cataaagagcctcgtggggatgttatgagaaacaactataattttcagtttttcaatcata
                 Prairie vole  catgaacaaccttgtggggatgttatgagaagcaactataattttgacgttttggatgaca
              Chinese hamster  catgaagagccgcgtggggatgttatgagaagcaactataattttcatgttgtagatcata
               Golden hamster  catgaagagccgtgtggggatgttatgagaggtaactataattttcatgttttggaccata
                        Mouse  catgaacagcctcgtggggatgttgtgagaagcaacgacgattttcatgttttggagcata
                          Rat  catgaacagcctcgtggggatgttatgagaagcaacgatgattttcatgttttggatcata
               Naked mole-rat  cataaagagtcttgttgggatgttgtgagaaatgactataattttcattttttgaacccaa
                   Guinea pig  tgtgaagagccttgttgggatgttatgagaaatgacgacaattttcattttttgaatccag
                   Chinchilla  catgaagagccttgttgggatgttatgagaaatgacgacaattttgattttttgaatccaa
             Brush-tailed rat  catgaagacccgtgtcgggatgttatgagaaatgacgacaattttcagtttttgaatccaa
                       Rabbit  catgaagagcctcgaagggatgttatgggagatggctatgattttcatgtccttgatcatg
                         Pika  catgaagagtcgtgacgggatgttgtgggaaatggcaataatcttcatctcttggatcata
                          Pig  cataaagagccttgttgggatattgtgggatgtgactataattttcattccttggataaaa
                       Alpaca  cataaagagcctcgttgggatattgtgggacgtgactataattttcattccttggatgaaa
               Bactrian camel  cataaagagcctcgttgggatattgtgggacgtgactataattttcattccttggataaaa
                      Dolphin  cataaagagccttgttggtatattgtgtactgtgactataattttcattccttggataaaa
                 Killer whale  cataaagagccttgttggtatattgtgtactgtgactataattttcattccttggataaaa
             Tibetan antelope  cataaagagccttgttgggatattgtgggacatgactataatcttcattccttgaataaaa
                          Cow  cataaagagccttgttgggatattgtgggacatgacgataatcttcattccttggataaaa
                        Sheep  cataaagagccttgttgggatattgtgggacatgactataatcttcattccttgaataaaa
                Domestic goat  cataaagagccttgttgggatattgtgggacatgactataatcttcattccttgaataaaa
                        Horse  catgaagagccttgctgggatgttatgagacacgactataattttcattccttggataaaa
             White rhinoceros  catgaagagccttgttgggatgttatgggacacgactataattttcattccttggataaaa
                          Cat  catgaagagtcttgtcgggatgttatgggacacaactataattttcatcccatggataaaa
                          Dog  catgaaaagtcttgttgggatgttatgggatgcaactataattttcattcgttggataaaa
                      Ferret   catgaagagcctggttgggatgttatgggacacaacgataattctcatccctcggataaag
                        Panda  catgaagagcctggttgggatgttatgggacacaactataattttcatcccatggataaag
               Pacific walrus  catgaagagcctggttgggatgttatgggacacaacgataattttcatcccttggataaaa
                 Weddell seal  catgaagagcctagttgggatgttatgggacacaacgataattttcatcccttggataaaa
             Black flying-fox  catgaagatccttgtagggatgttatgggacatgactataattttcattccttggataaaa
                      Megabat  catgaagatccttgtagggatgttatgggacatgactataattttcatcccttggataaaa
                Big brown bat  catgaagatcctggttgggatgttatgggacatgacgataattttcattccttggataaaa
         David's myotis (bat)  catgaagatccttgttgggatgttatgggacacgactataattttcatcccttggataaaa
                     Microbat  catgaagatccttgttgggatgttatgggacacgactataattttcatcccttggataaaa
                     Hedgehog  aatgaagagtcttgttgggatgttgtgggacacaactacgattttcatgcttttgataaaa
                        Shrew  cacaaaaatccttgttgggatattgtgggacacaactataactttcattccttggataaaa
              Star-nosed mole  catgaagaaccttgtcgggatgttatgagatactactataattttcattctttggataaaa
                     Elephant  caaaaacagcctcgctgggatgttatgggacatgactataattttcattccttgaattaaa
          Cape elephant shrew  cagaaagagcctggctgggatattatgggatactactataattttcattccttgcattaag
                      Manatee  cataaagagcctcgttgggatgttatgggacacgactataattttcattccttggattaaa
             Cape golden mole  cagaaagagcctggatgggatattatgagacatgactataattttcattccttgaattaaa
                       Tenrec  cataaagagtcgcgatgggatgttatgagacatgactatgattttcaatccttggattaaa
                     Aardvark  catgaagagcctcgatgggatgttatgggacacaactactattttcattccttggattaaa
                    Armadillo  catgaagagcctcgttgggatgttatgggacacggctataattttcatttcttggatcata
                      Opossum  catgaagagtctcgttgggatgttgtgggatacaaccaaaattttaagatcatggagcaaa
              Tasmanian devil  catgaagagtctcgttggaatgttatgagagataactataattttaagatcttggagaaaa
                      Wallaby  catgaagagtctcgttggaatattatgagatataactaaaattttaagatcatggagcaaa
                     Platypus  caggaagagccgcgccgggatgtcatgggacaccaccaggatctttgtgccctgcagcagg
                       Turkey  cgggaacagcctgctcgggatgttgtgtgccaccaccaggactttgatttcctggagaaga
           American alligator  caggaacagcttggttgggatgttatgtgacaccactaaaatcttaatttcctgtagcaaa
              Green seaturtle  caggaagagcctggttgggatgttatgtgacaccactaaaatcttaatttcctgtaaca--
               Painted turtle  caggaagagcctggttgggatgttgtgggacaccactaaaatcttaatttcctgtaaca--
                 Mallard duck  =============================================================
           Tibetan ground jay  =============================================================
                  Zebra finch  =============================================================
       White-throated sparrow  =============================================================
          Medium ground finch  =============================================================
                      Chicken  =============================================================
             Peregrine falcon  =============================================================
                 Saker falcon  =============================================================
                  Rock pigeon  =============================================================
                   Budgerigar  =============================================================
          Collared flycatcher  =============================================================
     Chinese softshell turtle  =============================================================

Inserts between block 9 and 10 in window
B D                   Turkey 903bp
B D       American alligator 1239bp
  D          Green seaturtle 3564bp
  D           Painted turtle 1bp

Alignment block 10 of 44 in window, 88794572 - 88794578, 7 bps 
B D                     Human  aat---actg
B D                     Chimp  aat---actg
B D                   Gorilla  aat---actg
B D                 Orangutan  aat---actg
B D                    Gibbon  aat---actg
B D                    Rhesus  aat---tctg
B D       Crab-eating macaque  aat---tctg
B D                    Baboon  aat---tctg
B D              Green monkey  aat---tctg
B D                  Marmoset  aat---tttg
B D           Squirrel monkey  aaa---tttc
B D                  Bushbaby  tat---tgtg
           Chinese tree shrew  aat---tctg
B D                  Squirrel  tag---tctg
       Lesser Egyptian jerboa  aag---tctc
                 Prairie vole  aat---tctt
B D           Chinese hamster  aat---tcat
               Golden hamster  aat---tctt
B D                     Mouse  aat---tctg
B D                       Rat  aat---tctc
B D            Naked mole-rat  aat---tctg
B D                Guinea pig  aat---tccg
                   Chinchilla  aat---tcgg
             Brush-tailed rat  aat---tctt
B D                    Rabbit  aa--------
B D                      Pika  aat---tctg
B D                       Pig  aat---tcaa
B D                    Alpaca  aat---tcca
               Bactrian camel  aat---tcca
B D                   Dolphin  aat---tctg
                 Killer whale  aat---tctg
             Tibetan antelope  aac---tccg
B D                       Cow  aat---tcca
B D                     Sheep  aat---tcca
                Domestic goat  aat---tcca
B D                     Horse  aat---tctg
B D          White rhinoceros  aat---tctg
B D                       Cat  aat---tcta
B D                       Dog  aat---tctg
B D                   Ferret   aat---tctg
B D                     Panda  aat---tctg
               Pacific walrus  aat---tctg
                 Weddell seal  aac---tctg
             Black flying-fox  aat---tctc
B D                   Megabat  aat---tctc
                Big brown bat  tag---tttc
         David's myotis (bat)  tat---tctc
B D                  Microbat  tat---tctc
B D                  Hedgehog  aag---tcag
B D                     Shrew  taa---tctg
              Star-nosed mole  aaa---ttgt
B D                  Elephant  aat---tcat
          Cape elephant shrew  aat---tcat
B D                   Manatee  aat---tcat
             Cape golden mole  aat---tctt
B D                    Tenrec  aat---tcgc
                     Aardvark  aac---tcat
B D                 Armadillo  aat---tctg
B D                   Opossum  aaa---tcag
B D           Tasmanian devil  aac---tctt
B D                   Wallaby  aat---ctag
B D                  Platypus  gcggcatctc
  D            Painted turtle  agc---actg
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D       Medium ground finch  ==========
B D        American alligator  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D                Budgerigar  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========

Inserts between block 10 and 11 in window
  D           Painted turtle 2713bp

Alignment block 11 of 44 in window, 88794579 - 88794612, 34 bps 
B D                     Human  tttcatcttt---gacatggccaatataatct-aaaag
B D                     Chimp  tttcatcttt---gtcatggccaatataatct-aaaag
B D                   Gorilla  tttcatcttt---gtcatggccaatataatct-aaaag
B D                 Orangutan  tttcgtcttt---gtcatggccaatataatct-aaaag
B D                    Gibbon  tttcatcttt---gtcacggccaatataatct-aaaag
B D                    Rhesus  tttcatcttt---gtcatggccagtataatct-aaaag
B D       Crab-eating macaque  tttcatcttt---gtcatggccagtataatct-aaaag
B D                    Baboon  tttcatcttt---gtcatggccagtataatct-aaaag
B D              Green monkey  tttcatcttt---gtcatggccagtataatct-aaaag
B D                  Marmoset  tttcatcttt---ttcatggccaatataatct-aaaag
B D           Squirrel monkey  tttcttcttt---tttatggccaatatgatct-agcag
B D                  Bushbaby  g---atcgtt---ttcatgggccaggtaatct-aaaag
           Chinese tree shrew  tcccactctt---ttcttgcttaaggtaatct-aacag
B D                  Squirrel  tttcctttct---ttcatggtctagataatct-aaaag
       Lesser Egyptian jerboa  tttcattgtc---tctacgggcaacataatct-agaag
                 Prairie vole  tgtcttcttt---ctcatgggcaacataatct-aaaag
B D           Chinese hamster  tttcttcctt---ctcatgggcaacataatct-aaaag
               Golden hamster  tttcttcctt---ctcatgggcaacataatct-aaaag
B D                     Mouse  tttcactctt---ttcatgggcaacataatct-agaag
B D                       Rat  tttcgctctt---ttcatgggcaacgtaatct-agaag
B D            Naked mole-rat  tttccttcct---ttcatggctaagataatct-gaaag
B D                Guinea pig  tttcattcct---ttcatggcgaacataatct-aagag
                   Chinchilla  tttcctccct---ttcatggctgagaaaatct-aaaag
             Brush-tailed rat  tttctttctt---ttcctggctaagaaaatct-aagag
B D                    Rabbit  -ttcttcgtt---ttggtggctcagatattcc-tcaag
B D                      Pika  tttcttcatc---ttggtggctcaggtgctcc-tggag
B D                       Pig  cttcatcctt---ttcatggttaagatagtct-gaaag
B D                    Alpaca  tttcatcctt---ttcatggttaagatagtct-aaaag
               Bactrian camel  tttcatcctt---ttcatggttaagatagtct-aaaag
B D                   Dolphin  tttcatcctt---ttcatggctaagataatcc-aaaag
                 Killer whale  tttcatcctt---ttcatggctaagataatcc-aaaag
             Tibetan antelope  tgtcatcgtt---ttcatggctcaggtaatct-aaaag
B D                       Cow  tttcatcctt---tttatggctcaggtaatct-aagag
B D                     Sheep  tgtcatcctt---tttatggctcaggtaatct-aaaag
                Domestic goat  tgtcatcctt---tttatggctcaggtaatct-aaaag
B D                     Horse  tttcattctt---tcctctgttaatataatct-aggag
B D          White rhinoceros  tttcattctt---ttcacggttaagataatct-gagag
B D                       Cat  tgtcattctt---tttctggtcaagatgatct-aaaag
B D                       Dog  tttcattctg---tttatggttaagataatcc-aaaag
B D                   Ferret   tttcactctt---ttgatgactcagataatct-aaaag
B D                     Panda  cttcactctt---tcgatggttaagataatct-aacag
               Pacific walrus  cttcactctt---ttgatggttaagataatct-aaaag
                 Weddell seal  cttcactctt---ttgatggttaagataatct-agaag
             Black flying-fox  tttcattctt---ttcacggttgacataatct-aaaag
B D                   Megabat  tttcattctt---ttcacggttgacataatctaaaaag
                Big brown bat  ctcccttctt---tttatggttaatataatct-gaaag
         David's myotis (bat)  ctctattctt---tttatggttaatataatct-aaaag
B D                  Microbat  ctctattctt---tctatggttaatataatct-aaaag
B D                  Hedgehog  tgtcattctc---ttcgtggttaatataatct-aaaag
B D                     Shrew  ttttattctt---tttaacttcaacataatct-gaaag
              Star-nosed mole  cttccttctt---cttatgtttaagatactct-aaaag
B D                  Elephant  tttcattctt---ttcatggtcaagataatct-aaaag
          Cape elephant shrew  cttcactctg---gtcatgggcaatataatct-agaag
B D                   Manatee  tttcattcct---ttcacggtcaagataatct-aaaag
             Cape golden mole  tgtcattctt---ttcatggttaacataatct-aaaag
B D                    Tenrec  tttcaccctt---tttatggtcaagataatct-aaaag
                     Aardvark  catcattctt---ttcacggtcaatgtaatct-agaag
B D                 Armadillo  tttcactcttttcttcatggtcgacataatct-acaag
B D                   Opossum  gttcagtcgt---ttcatgagaaacgtagtca-gtcag
B D           Tasmanian devil  ctttattttc---ttcatgagaaacatagtct-tgaag
B D                   Wallaby  gttcatcttc---ttcatgagaaaagtagtct-tgaag
B D                  Platypus  ggccgggctc---cggaggccggtcgagctcc-tggag
  D              Mallard duck  ======================================
          Tibetan ground jay  ======================================
B D               Zebra finch  ======================================
  D    White-throated sparrow  ======================================
B D       Medium ground finch  ======================================
B D        American alligator  ======================================
B D                    Turkey  ======================================
B D                   Chicken  ======================================
  D          Peregrine falcon  ======================================
  D              Saker falcon  ======================================
  D               Rock pigeon  ======================================
B D                Budgerigar  ======================================
  D       Collared flycatcher  ======================================
  D  Chinese softshell turtle  ======================================
  D            Painted turtle  ======================================
  D           Green seaturtle  ======================================

Alignment block 12 of 44 in window, 88794613 - 88794639, 27 bps 
B D                     Human  aactt-tgtagagagtgtcgctggagga
B D                     Chimp  aactt-ggtagagagtgtcgctggagga
B D                   Gorilla  aactt-ggtagagagtgtcgctggagga
B D                 Orangutan  aactt-ggtagagagtgtcactggagga
B D                    Gibbon  aactt-ggtagagagtgtcgctggagga
B D                    Rhesus  cactt-ggtagagagtgtcgctggagga
B D       Crab-eating macaque  cactt-ggtagagagtgtcgctggagga
B D                    Baboon  cactt-ggtagagagtgtcgctggagga
B D              Green monkey  cactt-ggtagagagtgtcgctggagga
B D                  Marmoset  aacct-ggtagagagtgccactggagga
B D           Squirrel monkey  aactt-ggtagagtgtgccactggagga
B D                  Bushbaby  aattt-ggaaaagagttccgttagagga
           Chinese tree shrew  aatcc-ggtacagagtaccattggagga
B D                  Squirrel  aattt-ggtagagggtatcactggaaga
       Lesser Egyptian jerboa  aattc-ggtaaagcgtgccactggaggt
                 Prairie vole  gattc-ggaaaagcatgccattggaggt
B D           Chinese hamster  gattc-ggaaaaatgtgccattggaggt
               Golden hamster  aattc-ggaaaagtgtgccattggaggt
B D                     Mouse  aatcc-ggaagagtgtgccattggaact
B D                       Rat  aatcc-ggaacagtgtgccattggagct
B D            Naked mole-rat  aattt-gctgaagagtaccattggagga
B D                Guinea pig  gactt-gctgaagagtttcatgggagga
                   Chinchilla  aattt-gctgaagagtcccattggagga
             Brush-tailed rat  aattt-gctggagagtactgctggagga
B D                    Rabbit  aattt-ggtagagggtcccggtggacga
B D                      Pika  gatct-ggtagagagtccccgtggagga
B D                       Pig  aattt-gataaagagtatcattggagga
B D                    Alpaca  aattt-ggtagagggtactactggagga
               Bactrian camel  aattt-ggtagagggtactactggagga
B D                   Dolphin  aattt-ggtaaagagtaccattggagga
                 Killer whale  aattt-ggtaaagagtaccattggagga
             Tibetan antelope  aattt-ggtacaaagtaccactggagga
B D                       Cow  aattt-ggtaaaaagtaccactggagga
B D                     Sheep  aattt-ggtacaaagtaccactggagga
                Domestic goat  aattt-ggtacaaagtaccactggagga
B D                     Horse  aattc-ggtaaagagtaccattgcagga
B D          White rhinoceros  aattc-ggtaaagagtaccattgcagga
B D                       Cat  aattt-ggtaaagcgtatcactggagga
B D                       Dog  aattc-ggtaaagggtaccactggaggt
B D                   Ferret   aattc-gataaagtgtaccgctggagct
B D                     Panda  aattt-ggtaaagggtaccattggagct
               Pacific walrus  aattc-ggtaaagcgtaccattggagct
                 Weddell seal  aattc-ggtaaagcgtaccattggaact
             Black flying-fox  aatcc-ggtaaagagtaccagaggaaga
B D                   Megabat  aatccgggtaaagagtaccagaggaaga
                Big brown bat  aatac-gataaagagtaccactggagga
         David's myotis (bat)  aatac-gataaagactaccactggaaga
B D                  Microbat  aatac-gataaagagtaccactggaaga
B D                  Hedgehog  aattc-tgaaaagagtgtcattggagga
B D                     Shrew  aatat-ttagaagattatcattggagga
              Star-nosed mole  aattc-ggtaaaatgtaccactggacgt
B D                  Elephant  aattc-ggaaaagagtaccactggaaga
          Cape elephant shrew  aattt-ggaaaagagtaccattggaaga
B D                   Manatee  aattc-ggaaaagagtaccattggaaga
             Cape golden mole  gattt-tgaagagagttccactggaaga
B D                    Tenrec  aattc-ggaacagtgtaccactggacga
                     Aardvark  aattc-tgagaagagtgccactggaaga
B D                 Armadillo  aattt-ggaaaagagtcccattggagga
B D                   Opossum  aattc-tgtaaatggtccccacagagct
B D           Tasmanian devil  aattc-ggtaaagtgtcccagtggaact
B D                   Wallaby  aattc-ggtaaagagtaccagtggagct
B D                  Platypus  gactc-tgtacaggctcccgctggagga
  D           Green seaturtle  aagct-tatagaatgtattacccaagga
  D            Painted turtle  aagct-tacagaatttatcactcaagga
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
B D               Zebra finch  ============================
  D    White-throated sparrow  ============================
B D       Medium ground finch  ============================
B D        American alligator  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D               Rock pigeon  ============================
B D                Budgerigar  ============================
  D       Collared flycatcher  ============================
  D  Chinese softshell turtle  ============================

Inserts between block 12 and 13 in window
  D          Green seaturtle 16bp
  D           Painted turtle 16bp

Alignment block 13 of 44 in window, 88794640 - 88794646, 7 bps 
B D                     Human  ctcga-gg
B D                     Chimp  ctcga-gg
B D                   Gorilla  ctcga-gg
B D                 Orangutan  ctcga-gg
B D                    Gibbon  ctcga-gg
B D                    Rhesus  ctcga-gg
B D       Crab-eating macaque  ctcga-gg
B D                    Baboon  ctcga-gg
B D              Green monkey  ctcga-gg
B D                  Marmoset  ctcga-gg
B D           Squirrel monkey  ctcaa-gg
B D                  Bushbaby  ctcaa-gg
           Chinese tree shrew  ctcaa-gg
B D                  Squirrel  ctcaa-gg
       Lesser Egyptian jerboa  ctcaa-gg
                 Prairie vole  ctcaa-gg
B D           Chinese hamster  ctcca-tg
               Golden hamster  ctcaa-gg
B D                     Mouse  ctcaa-ga
B D                       Rat  ctcca-gg
B D            Naked mole-rat  ctcga-tg
B D                Guinea pig  ttcga-gg
                   Chinchilla  ttcaa-gg
             Brush-tailed rat  ttcaa-ga
B D                    Rabbit  ctcaa-ga
B D                      Pika  ctcca-gg
B D                       Pig  ctcaa-gg
B D                    Alpaca  ctcaa-gg
               Bactrian camel  ctcaa-gg
B D                   Dolphin  ctcca-gg
                 Killer whale  ctcca-gg
             Tibetan antelope  ctcca-gg
B D                       Cow  ctcca-gg
B D                     Sheep  ctcca-gg
                Domestic goat  ctcca-gg
B D                     Horse  ctcaa-gg
B D          White rhinoceros  ctcaa-gg
B D                       Cat  ctcaa-ga
B D                       Dog  ctcaa-gg
B D                   Ferret   ctcaa-gg
B D                     Panda  ctcaa-gg
               Pacific walrus  ctcaa-gg
                 Weddell seal  ctcaa-gg
             Black flying-fox  ctcaa-gg
B D                   Megabat  ctcaaggg
                Big brown bat  ctcaa-gg
         David's myotis (bat)  ctcaa-gg
B D                  Microbat  ctcaa-gg
B D                  Hedgehog  ctcaa-gg
B D                     Shrew  ctcta-at
              Star-nosed mole  ctcaa-gg
B D                  Elephant  ctcaa-gg
          Cape elephant shrew  ttcaa-gg
B D                   Manatee  ctcaa-gg
             Cape golden mole  ctcaa-gg
B D                    Tenrec  ctcca-gg
                     Aardvark  ctcaa-gg
B D                 Armadillo  ctcga-gg
B D                   Opossum  ctcaa-ga
B D           Tasmanian devil  ttcaa-gg
B D                   Wallaby  ctcaa-tg
B D                  Platypus  ctcca-gc
B D        American alligator  ctcta-cg
  D           Green seaturtle  ctcta-gt
  D            Painted turtle  ctcta-gt
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D                Budgerigar  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========

Alignment block 14 of 44 in window, 88794647 - 88794744, 98 bps 
B D                     Human  atatgcagaatggaagtgggatagatgagcagcaatcctgtcactgcttctcctaggtgatgtttcaaaa
B D                     Chimp  atatgcagaatggaagtgggatagatgagcagcaatcctgtcactgcttctcctaggtgatgtttcaaaa
B D                   Gorilla  atatgcagaatggaagtgggatagatgagcagcaatcctgtcactgcttctcctaggtgatgtttcaaaa
B D                 Orangutan  atatgcagaatggaagtgggatagatgagcagcaatcctgtcactgcttctcctaggttatgtttcaaaa
B D                    Gibbon  atatgcagaatggaagtgggatagatgagcagcaatcctgtcactgcttctcctaggtgatgtttcaaaa
B D                    Rhesus  atatgcagaatggaagtaggatagatgagcagcaatcctgtcactgtttctcccaggtgatgtttcaaaa
B D       Crab-eating macaque  atatgcagaatggaagtaggatagatgagcagcaatcctgtcactgtttctcccaggtgatgtttcaaaa
B D                    Baboon  atatgcagaatggaagtaggatagatgagcagcaatcctgtcactgtttctcccaggtgatgtttcaaaa
B D              Green monkey  atatgcagaatggaagtaggatagatgagcagcaatcctgtcactgtttctcccaggtgatgtttcaaaa
B D                  Marmoset  atatgcagaatggaagtaggatacatgagcagtaatcctgtcactgcttctcctaggtgatgtttcaaaa
B D           Squirrel monkey  atatgcagaatggaagtaggatatatgagcagtaatcctgtcactgcttctcctaggtggtgtttcaaca
B D                  Bushbaby  atatgcagaagggacgtggggtatatgagcagaactcctgtcactgcttcttctagatgctgtttcagga
           Chinese tree shrew  atgtgcaggatggaagtcgggtagatgagcaatagtcctgtcactgcttctcccaggtgatgtttcagaa
B D                  Squirrel  atatgcagaagggacgtggggtatatgagcaataatcctgtcactgcttctcctgggtgatgtttcaaaa
       Lesser Egyptian jerboa  atgtgcagaatggacatggggtacatgagcaacaaccctgtcactgcttctcctaggtgacgtttcaaaa
                 Prairie vole  atatgcagaaaagtgcttgagtatatgagcaataagcccgtaactgtctctcctaagtgatgcttcagaa
B D           Chinese hamster  atgtgcaggaaggtacttgagtatatgagcaatattcctgtaaccgcttctcctaagtgatgtttcagaa
               Golden hamster  atgtgcagaaaggtacttgagtatatgagcagtaatcctgtaactgcttctcctaggtgatgcttcagaa
B D                     Mouse  atgtgcagaaaagtacttgggtatatgagcatgagacctgtcactgattcgcctaaatgatgtttcagaa
B D                       Rat  atgtgcagaaacgaacttgggtatataaggaagagtcctgtcactacttcacctaaatggtgtttcagaa
B D            Naked mole-rat  atgtgtagcatggaagtggggtagatgagcagtaaccctgtcactgtttctcctgggtgatgtttcagaa
B D                Guinea pig  atatgcagcatggaagtggagtaaatgagcagtagccctgtcaatgcttctcctgggtgatattttaaaa
                   Chinchilla  atgagcagcatagaggtggggtagatgagcaataaccctgtcactgcttccactggatgattttttaaaa
             Brush-tailed rat  atgtgtagcatggaagtgggataaatgagcaatagcccagtcactgcttctcctgggttatgttttagaa
B D                    Rabbit  atgtgcagcatggaagtggggtagacgagcagcagtcccgtcactgcttctcccaggtggtgtttcagaa
B D                      Pika  atgtgcagcatcgaagttgggtagatgagcagcagccctgtcacggcttctcccaggtggcgtctcataa
B D                       Pig  atatgcaggatggaagtaggatatatgagcagtaatcctgtcactgcttctcctaggtgacgtttcaaaa
B D                    Alpaca  atatgcagaatggaagtaggatatatgaacaataatcccgtcacggcttctcctaggtgatgtctcaaaa
               Bactrian camel  atatgcagaatggaagtaggatatatgaacaataatcccgtcactgcttctcctaggtgatgtctcaaaa
B D                   Dolphin  atatgcacaatggaattaggatatatgagcaataatcctgtcactgcttctcctgggtgatgtttcaaaa
                 Killer whale  atatgcacaatggaattaggatatatgagcaataatcctgtcactgcttctcctgggtgatgtttcaaaa
             Tibetan antelope  atatgcagaatggaagtaggatatatgagcaacaatcctgtcactgcttctcctaggtgtcgtttcaaaa
B D                       Cow  atatgcagaatggaagtaggatatatgagcaacagtcctgtcactgcttctcccaggtgacgtttcaaaa
B D                     Sheep  atatgcagaatcgaagtaggatatatgagcaacaatcctgtcactgcttctcctaggtgtcgtttcaaaa
                Domestic goat  atatgcagaatggaagtaggatatatgagcaacaatcctgtcactgcttctcctaggtgtcgtttcaaaa
B D                     Horse  atatgcaaaatggaggtaggatataggagtaataatcctgtcactgcttctcctaggtgacgcttcaaaa
B D          White rhinoceros  atatgcaaaatggaagtgggatataggagcaataatcctgtcactgcttctcctaggtgatgtttcaaaa
B D                       Cat  atatgcagaatagaagtaggatagatgagcaaaaaccccgtcactgcttctcctttgtgaagttttaaag
B D                       Dog  atatgcagaatagaagtaggatatacgagcaaaaaccctgtcactgcttctcctaggtgatgttttaaaa
B D                   Ferret   atatgcagaatagaagtaggatataccagcaaaaaccctgtcactgtttctcctaggtgatgttttaaaa
B D                     Panda  acatgcagaatggaagtaggatataccagcaaaaaccctgtcactgcctcttcttggtgatgttttaaaa
               Pacific walrus  atatgcaggatagaagtaggatataccagcagaaaccctgtcactgcttctcctaggtgatgttttaaaa
                 Weddell seal  atatgcagaatagaagtaggatataccagcagaaaccctgtcactgcttctcctaggtgatgttttaaaa
             Black flying-fox  atatgcagaatagaagtaggatatatgagcaataatcctgtcactgtttctcctaggtgatactttaaaa
B D                   Megabat  atatgcagaatacaagtaggatatatgagcaataatcctgtcactgtttcacctaagtgatactttaaaa
                Big brown bat  atatgcagaatgaaagtacgatatatgagcagtaatcctgttactgcttcgcttgcgtacggttttgcaa
         David's myotis (bat)  atatgcagaatgaaagtacgatatatgagcagcaatcctgttactgcttctcctgtgtgcggttttgcaa
B D                  Microbat  atatgcacaatgaaagtacgatacatgagcagcaatcctgttactggttctcctatgtgaggttttgcaa
B D                  Hedgehog  atatgaagaatagaagttggatatacaagcaataatcctgtcactgattctcccaggtgacgtttcgaaa
B D                     Shrew  atgtgtagaagagtagtaggatagattagcaataatcctgtcacagcttctccaatgtgatgttttgaaa
              Star-nosed mole  atatgcagaatagaactaggatataggagcaatattcctgtcactaattctcctaggcgacgttttgaaa
B D                  Elephant  atatgaagaatggaagtgggatatatgagcaacaagcctgtcaccgcttctcctaggtgacgtttcaaaa
          Cape elephant shrew  atgtgaagaatggaagttggatatatgagcaataatcccgttacattctctcctaggtgatgttttaaaa
B D                   Manatee  atatgaagaatggaagtggggtatatgagcaacaatcctgtcaccatttctcctaggtgatgtttcaaaa
             Cape golden mole  atatgaagaatgacagttggatatatgagcagtaatcctgtcaccgtttctcctatgtgctgtctcataa
B D                    Tenrec  atatgaagaatggaggtgggatatatgagcaataatcctgtcaccgtttctcccaggtgatgtttcgaaa
                     Aardvark  atgtggagaatggaggtgggatacatgagcagtaatcctgtcaccagttctcctaggtgatgtttcacaa
B D                 Armadillo  atatgcagaatggaagtggggtatatgagtaatagccctgtcactgcttcttctaggtgacgtttcaaaa
B D                   Opossum  acatggagaatggttgtaggatagataaggacaatcccagtcacactttctcccaggtgactcttgagta
B D           Tasmanian devil  atgtgtagaatggtggtagggtacataaggaagatcccagtaacatgttctcccaggtgaaccttgagta
B D                   Wallaby  acatggagaatagttgtaggatagattaggatcatcccagtaacgttttctcccatgtgaaacttgagta
B D                  Platypus  acgaccaggacggagctcgggtacagcagggcgatgcccgtcaccggctcccccaggtgctgtttcagag
B D                    Turkey  acatgaagaacatgtctggaactgagaagcagcagccctgaaactcgttctcttgtgtggtattctgatg
B D        American alligator  atatgaagaatggagttggggtaaagcagcagcagacccgagacgggctctccgaggtggtatttcaata
  D           Green seaturtle  atatgaagaatggagctgggatagaggagaagtagacctgagactggttctccgaggtggtattttaata
  D            Painted turtle  atatgaagaatggagctgggatagaggagaagtagacctgagactggttctcctaggtggtattttaata
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ctgactgaa-acatttgt-tcatagtagtc
                        Chimp  ctgactgaa-acatttgt-tcatagtagtc
                      Gorilla  ctgactgaa-acatttgt-tcatagtagtc
                    Orangutan  ctgagttaa-acatttgt-tcatagtagtc
                       Gibbon  ctgactgaa-acatttgt-tcatagtagtc
                       Rhesus  ctgactgaa-acacttgt-tcatagtagtc
          Crab-eating macaque  ctgactgaa-acacttgt-tcatagtagtc
                       Baboon  ctgactgaa-acacttgt-tcatagtagtc
                 Green monkey  ctgactgaa-acacttgt-tcatagtagtc
                     Marmoset  ctgactgaa-acacttgc-tcatagtagtc
              Squirrel monkey  ctgactgaa-acacttgc-tcatagtagtc
                     Bushbaby  ttgattgaa-acacttgc-tcatagtattc
           Chinese tree shrew  tggactgaa-acagttgt-tcatagtattc
                     Squirrel  tcgactgaa-atacttgt-tcatagtattc
       Lesser Egyptian jerboa  tcatctgaa-acagtttt-tcataatattc
                 Prairie vole  ttgactgga-agaggtgc-tcgtagtattc
              Chinese hamster  ttgactgaa-acagttgc-tcataatattc
               Golden hamster  ttgtctgaa-atagtttt-tcatagtattc
                        Mouse  ttgactgaa-acagttgc-tcatagtactc
                          Rat  ttgactgaa-acagttgc-tcatagtattc
               Naked mole-rat  ttgactgaa-atgcttga-tcatagtattc
                   Guinea pig  tagactgaa-atgcttgg-tcatagtattc
                   Chinchilla  tggactgaa-agacttgg-tcatagtattc
             Brush-tailed rat  ttgactgaa-atgtttgc-tcatagtgctc
                       Rabbit  tcgactgga-acgcttgt-tcgtagtactc
                         Pika  tcgagtgga-acccatgt-tcgtagtactc
                          Pig  tcgactgaa-acacttgt-tcatagtattc
                       Alpaca  ttgactgaa-acagttct-tcatagtattc
               Bactrian camel  ttgactgaa-acagttct-tcatagtattc
                      Dolphin  ttgactgaa-acaattgt-tcatagtattc
                 Killer whale  ttgactgaa-acaattgt-tcatagtattc
             Tibetan antelope  ttgactgaa-acagttgt-tcatagtagtc
                          Cow  ttgactgaa-acaattgt-tcgtagtagtc
                        Sheep  ttgactgaa-acagttgt-tcatagtagtc
                Domestic goat  ttgactgaa-acagttgt-tcatagtagtc
                        Horse  ttgactgaa-acacttga-tcatagtattc
             White rhinoceros  ttgactgaa-acacttgt-tcatagtattc
                          Cat  ttgactgaa-gcacttgt-tcatagtagtc
                          Dog  ttgactgaa-acacttgc-tcataatagtc
                      Ferret   ttgactgaa-acacttgt-tcatagtagtc
                        Panda  tcgactgaa-acgcttgt-tcatagtagtc
               Pacific walrus  tcgactgga-atgcttgt-tcatagtagtc
                 Weddell seal  tcgactgga-atgcttgt-tcatagtagtc
             Black flying-fox  ttgactgga-atgcttgt-tcatagtattc
                      Megabat  ttgactgggcatgcttgtatcatagaattc
                Big brown bat  ttgactgaa-acaattgt-tcatagtattc
         David's myotis (bat)  ttgactgaa-acacttgc-tcatagtattc
                     Microbat  tcgactgaa-acacttgc-tcatagtattc
                     Hedgehog  ttgactgaa-atacttga-tcatagtattc
                        Shrew  ttgactgaa-acagttgt-tcataatagtc
              Star-nosed mole  ttagctgaa-atatttgt-tcaaagtaatc
                     Elephant  ttgactgaa-acgtttgt-tcatagtattc
          Cape elephant shrew  ttgactgaa-acacctgc-tcatagtaatc
                      Manatee  ttgactgaa-acacttgt-tcatagtattc
             Cape golden mole  tggattgaa-atgtgtgt-tcataatattc
                       Tenrec  ttaactgga-acacgttt-tcatagtaatc
                     Aardvark  ttgactgaa-acacctgt-tcatagtattc
                    Armadillo  tggactgaa-acacttgt-tcataatattc
                      Opossum  tgaattgaa-agagctgc-tcatagtaatc
              Tasmanian devil  tacattgat-atagctgc-tcatagtattc
                      Wallaby  tgtgttggt-acagttgt-tcatagtactc
                     Platypus  cgttctgga-atatcctc-tccaggaaagt
                       Turkey  catcttcaa-acaattct-ttgtgataacc
           American alligator  tgttctgaa-acagcctt-tcatggtaacc
              Green seaturtle  tgttctgaa-acagtctt-tcatggtaacc
               Painted turtle  tgttctgaa-acagtctt-tcatggtaacc
                 Mallard duck  ==============================
           Tibetan ground jay  ==============================
                  Zebra finch  ==============================
       White-throated sparrow  ==============================
          Medium ground finch  ==============================
                      Chicken  ==============================
             Peregrine falcon  ==============================
                 Saker falcon  ==============================
                  Rock pigeon  ==============================
                   Budgerigar  ==============================
          Collared flycatcher  ==============================
     Chinese softshell turtle  ==============================

Alignment block 15 of 44 in window, 88794745 - 88794810, 66 bps 
B D                     Human  agcaacatct-tttctttctacatttgcttgt-atcttggccac-tagaaacat-cctatcaagaaggaa
B D                     Chimp  agcaacatct-tttctttctacatttgcttgt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D                   Gorilla  agcaacatct-tttctttctacatttgcttgt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D                 Orangutan  agcaacatct-tttctttctacatttgcttgt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D                    Gibbon  agcaacatct-tttctttctacatttgctttt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D                    Rhesus  agcaacatct-tttctttctacctttgtttgt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D       Crab-eating macaque  agcaacatct-tttctttctacctttgtttgt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D                    Baboon  agcaacatct-tttctttctacctttgtttgt-atcttggccac-tagaaacat-cctgtgaagaaggaa
B D              Green monkey  agcaacatct-tttctttctacctttgcttgt-atcttggccac-tagaaacat-cctatgaagaaggaa
B D                  Marmoset  agcaatatct-tttttgtctacatttgcttgt-atcttggccac-tagaaacat-tctatgaagaaggaa
B D           Squirrel monkey  agcaatatct-tttttgtctacattttcttgt-atgttggccac-tagaaacat-cctgtgaagaaggaa
B D                  Bushbaby  agcaatatct-tttttttcaacatttgcttgt-atcttggccac-gagaaacat-cctatgaaggaggaa
           Chinese tree shrew  agaaatgtat-tttttttcaatgtttgctggt-atgttggccac-tagaaacat-cctgtgaaggaggaa
B D                  Squirrel  agcaatttct-tttttctccaggtttgcttgt-gtgttggccac-tagaaacat-cctatgaaggaggaa
       Lesser Egyptian jerboa  cgaaatgttt-tttttctctgtgtttgcttgt-atctgtcccac-taggaacat-cctatgaaggaggaa
                 Prairie vole  agtaatctgc-tttttctccacattggcttgt-aggtggcccac-aagaaacat-cctgtgaaggaggaa
B D           Chinese hamster  agaaatctcc-tttttctctacattttcttgt-atgtggcccac-aagaaacat-cctgtgaaggaggaa
               Golden hamster  agaaatctcc-tttttctctacattggcttgt-aagtggcccac-aagaaacat-cctgtgaaggaggaa
B D                     Mouse  agagatgtcc-tttttctccgtgttgccttgt-atgtagcccac-tagaaacat-cctgtgaaggaggaa
B D                       Rat  agaaatttcc-tttttctctgtgttggcttgt-atgtagcccac-tagaaacaa-cctgtgaaggaggaa
B D            Naked mole-rat  aacaattt-t-tttttctccatttttggccat-atgttggccac-tagaaacgt-cctatgaaggaggaa
B D                Guinea pig  agcaatttta-tttttctccatgtctgcttgt-atgttggccac-tagaaacat-cctatggatgaggaa
                   Chinchilla  agcaatttgt-tttttctccatgtttcctttt-atgttggccac-tagaaatgt-cctatgaaggtggaa
             Brush-tailed rat  ggcaatttct-ttttggtccatgtttggatgt-gtgttggccac-tagaaacat-cctatgcaggaggca
B D                    Rabbit  agcgacgtct-gtcttctctgtgttttcttga-atgctggccac-gacgaacat-cctgtggaggaggaa
B D                      Pika  tgcaatgtcc-ttcttgtctgcgttttcctgt-atgctggccac-tagaaacat-cctatttaggaggaa
B D                       Pig  agcaatatct-tttttttccatgtttgctgtt-atcttggccac-gaggaatat-cctatgaagaaggaa
B D                    Alpaca  agcaatatct-tttttttctatgttcgctgtt-atcttggccac-taggaacat-cctattaagaaggaa
               Bactrian camel  agcaatatct-tttttttctatgtttgctgat-atcttggccac-taggaacat-cctattaagagggaa
B D                   Dolphin  agcaatatct-tttttttctatgtttgctgtt-accctggccac-taggaacat-cctatgaagaaggaa
                 Killer whale  agcaatatct-tttttttctatgtttgctgtt-accctggccac-taggaacat-cctatgaagaaggaa
             Tibetan antelope  agcaatatct-tttttttctatgtttgctgtt-atcctggccac-taggaacat-cctatgaagaaggaa
B D                       Cow  agcaatatct-tttttttctatgtttgctgtt-atcctggccac-taggaacat-cctatgaagaaggaa
B D                     Sheep  agcaatatct-tttttttctatgtttgctgtt-atcctggccac-gaggaacat-cctatgaagaaggaa
                Domestic goat  agcaatatct-tttttttctatgtttgctgtt-atcctggccac-gaggaacat-cctatgaagaaggaa
B D                     Horse  agcaatatct-tttctttctgtgtttgctgtt-atcttggccac-tagaaacat-cctatggagaaggaa
B D          White rhinoceros  agcaatatgt-tttttttctgtgtctgctgtt-atcttggccac-tagaaacat-cctatggagaaggaa
B D                       Cat  agcaataatt-ttcttttctgtgtttgctgtt-atcttggccac-aagaaacat-cctatgaagaaggaa
B D                       Dog  agaaatatct-tttttttctgtattcggtgtt-attgtggccac-tagaaacat-cctatgaagaaggaa
B D                   Ferret   agcgatatct-tttttttctgtgtttgctgtt-agctcggccac-tagaaacat-cctatgaagaaggaa
B D                     Panda  agcaatatct-tttttttctgtgtttgctgtt-atctctgccac-tagaaacat-cctatgaagaaggaa
               Pacific walrus  agcaatatct-tttttttctgtgtttgctgtt-atctcggccac-tagaaacat-cctatgaagaaggaa
                 Weddell seal  agcaatatct-tttttttctgtgtttgctgtt-atatcggccac-tagaaacat-cctatgaagaaggaa
             Black flying-fox  ggtaatatct-tttttttctgtgttggctgtc-gtcttggccac-tagaaacat-cctatgaagaagtaa
B D                   Megabat  ggaattatctattttttcctgtgtggcctgttggtcttgggcacttagaaacatccctaggaagaa----
                Big brown bat  agtgacatct-ttcttttctacgttgtctttt-gtcttggccac-taggaacat-cctatcaagaaggaa
         David's myotis (bat)  agtgacatct-tttttttctatgttgtctctt-gtcatggccac-taggaacat-cctatcaagaaggaa
B D                  Microbat  agtgacatct-tttttttctatgttgtctctt-gtcatggccac-taggaacat-cctatcaagaaggaa
B D                  Hedgehog  agcgatatct-tttttttctgtgttggctgtt-aactcggccac-tagaaaaat-tctatcaaggagaag
B D                     Shrew  agaaatgtct-tttgtttctgtgttttctgat-atccgagccac-cagaaacat-cctatggagaataaa
              Star-nosed mole  agatacaact-tttttttctgtgtttgctgct-atctccgccac-tacaaacat-cctatgaataaggaa
B D                  Elephant  agcaatatct-tttttttctgtgtgtgctaga-atcttggccac-tagaaacat-cctatgaaggaggaa
          Cape elephant shrew  agaaatgtct-ttcttctccgtgtgtgctggg-atcttggctac-tagaaacat-cctatggatgaggaa
B D                   Manatee  agcaatgtct-tttttgtctgtgtgtgctgga-atcttggccac-tagaaacat-cctatgaaggaggaa
             Cape golden mole  agcaatgtct-tttcttgtggtgtttgctgga-atgttggccac-tagaaatat-cctatcaataagaaa
B D                    Tenrec  agcaatgtcc-tttttttctgtatgtgcttgt-atattgccgat-tagaaacat-cctattcatgaggaa
                     Aardvark  agaaatgtct-cttttttccgtgtttgctgga-atcttggccac-taaaaacat-cctatgaatgaggaa
B D                 Armadillo  agtgatatct-tttttttctgtctttgctggt-atcttggccac-gagaaacat-cctgtgaaggaggaa
B D                   Opossum  agtaatactt-ttcttttccacgttttctgat-atttgggccac-aaaaaatat-tctgtggaggaggaa
B D           Tasmanian devil  agtaatcatt-ttcttatccacttctcctgat-atcttgcccac-aagaaataa-tctgtggaggaggaa
B D                   Wallaby  agtaatactt-ttcttttccacatttggggat-atcttggccac-aaaaaacat-tctgtggaggaggaa
B D                  Platypus  ggggacctcc-tgcacctc------gcccggc-accatggcgac-aagaaacat-gcggtgcagcaggaa
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================

Alignment block 16 of 44 in window, 88794811 - 88794844, 34 bps 
B D                     Human  tttctttaggtgtagtcgttgtttctcttcttga
B D                     Chimp  tttctttaggtgtagtcgttgtttctcttcttga
B D                   Gorilla  tttctttaggtgtagtcgttgtttgtcttcttga
B D                 Orangutan  tttctttaggtgtagtcgttgtttctcttcttga
B D                    Gibbon  tttctttaggtgtagtcgttgtttctcttcttga
B D                    Rhesus  tttctttaggtgtagtcgttgtttctcctcttga
B D       Crab-eating macaque  tttctttaggtgtagtcgttgtttctcctcttga
B D                    Baboon  tttctttaggtgtagtcgttgtttctcctcttga
B D              Green monkey  tttctttaggtgtagtcgttgtttctcctcttga
B D                  Marmoset  tttcttgaggtgcagtcgttgtttctcctcttga
B D           Squirrel monkey  tttcttgaggtgtactcgttgtttctcctcttga
B D                  Bushbaby  tttcttaaactgcagtctttgcttgtcctcctga
           Chinese tree shrew  tttctttagctgtagtctttgtttctcctccaga
B D                  Squirrel  tttctttagctgtagtctttgtttctcttccaga
       Lesser Egyptian jerboa  tttcttcagctggagtctttgcttctcttcctga
                 Prairie vole  tttctttagctgtagcctgtgtttctcttcctga
B D           Chinese hamster  tttctttagctgtagcctgtgcttctcttcttga
               Golden hamster  tttctttagctgtagcctgtgcttctcttcctga
B D                     Mouse  tttctttagctgtagtctgtgcttctcttcctga
B D                       Rat  tttcttcagctgtagcctgtgcttctcttcctgg
B D            Naked mole-rat  tttgtttagctgcagtttttatttctcttccagt
B D                Guinea pig  tttcttgagctgcagtgtttgtttcttttccaga
                   Chinchilla  tttctttagcttcagtctctgtttctcttccaga
             Brush-tailed rat  tttctttagctgtagtctttggttttcttccaga
B D                    Rabbit  cttctttagctgcagtctttgtttctcctcctga
B D                      Pika  tttcttcatctgtagtctttgtttctcttcctga
B D                       Pig  tttctttagttgtagtctttgcttttcttcctgt
B D                    Alpaca  tttctttagctgtagtcttagcttttcttcctga
               Bactrian camel  tttctttagctgtagtcttagcttttcttcctga
B D                   Dolphin  tttctttagttgtagtttttgcttttcttcctga
                 Killer whale  tttctttagttgtagtttttgcttttcttcctga
             Tibetan antelope  tttctttagttgtagtctctgcttttcttcctga
B D                       Cow  tttctttagttgtagtctttgcttttcttcctga
B D                     Sheep  tttctttagttgtagtctttgcttttcttcctga
                Domestic goat  tttctttagttgtagtctttgcttttcttcctga
B D                     Horse  tttttttagctgtagtctttgcttctcttcctga
B D          White rhinoceros  ttttttcagctgtagtctttgcttctcttcctga
B D                       Cat  tttcttgagctgtagtctttgcttctcttcctga
B D                       Dog  tttctttagctgtagtctttgcttctcttcctga
B D                   Ferret   tttctttagctgtagtctttgtttctcctcctga
B D                     Panda  tttctttagctgtagtctttgcttctcttcctga
               Pacific walrus  tttctttagctgtagtctttgcttctcttcctga
                 Weddell seal  tttctttagctgtagtctttgcttctcttcctga
             Black flying-fox  tttctttagctgtagtcttagcttctcctcctga
                Big brown bat  tttctttagctggagtttttgcttttcttccaga
         David's myotis (bat)  tttctttaactggagtcttagcttttcttcctga
B D                  Microbat  tttctttaactggagtctttgcttttcttcctga
B D                  Hedgehog  tttcttcagctgtaacctttgcttctcttcctga
B D                     Shrew  tttctttagttgtattctgtgcttttcttctagc
              Star-nosed mole  tttcttcaggtgtagtctttgcttctcttcaagt
B D                  Elephant  tttctttagttgtagtctttgcttctcttcctga
          Cape elephant shrew  tttctttagatgtagcctttgcttctcttcttgc
B D                   Manatee  tttctttagttgtagtctttgcttttcttcctga
             Cape golden mole  tttctttagatgtagtctttgtttctctttctga
B D                    Tenrec  tttctttagctgcagcctttgtttttcctcctga
                     Aardvark  tttctttagatggagtctttgcttctcttcctga
B D                 Armadillo  tttctttagctgtagtctttgtttctcctcctga
B D                   Opossum  tttcttgaactgcagtcttcgtttctcttctaaa
B D           Tasmanian devil  ttttttaaattgtagtcttcgtttctcttccaga
B D                   Wallaby  tttcttgaactgtagccttcgtttttcttccaga
B D                  Platypus  ctttttcatctggaccctgggcttgtcctccaga
  D              Mallard duck  ==================================
          Tibetan ground jay  ==================================
B D               Zebra finch  ==================================
  D    White-throated sparrow  ==================================
B D       Medium ground finch  ==================================
B D        American alligator  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
  D               Rock pigeon  ==================================
B D                Budgerigar  ==================================
  D       Collared flycatcher  ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 17 of 44 in window, 88794845 - 88794873, 29 bps 
B D                     Human  aagtgcaggtaattgctacgtgggacttg
B D                     Chimp  aagtgcaggtaattgctacgtgggacttg
B D                   Gorilla  aagtgcaggtaattgctacgtgggacttg
B D                 Orangutan  aagtgcaggtaattgctacgtgggacttg
B D                    Gibbon  aagtgcaggtaattgctacgtgggacttg
B D                    Rhesus  aagtgcaggtaattgctacgtgggacttg
B D       Crab-eating macaque  aagtgcaggtaattgctacgtgggacttg
B D                    Baboon  aagtgcaggtaattgctacgtgggacttg
B D              Green monkey  aagtgcaggtaattgctacgtgggacttg
B D                  Marmoset  aagtgcaggtaattgctacgtggaacttg
B D           Squirrel monkey  aagtgcaggtagttgctacgtggaacttg
B D                  Bushbaby  acgtgcaagtaattgccacgtggaacttg
           Chinese tree shrew  aagtacaagtaattgcttcgtggaacttg
B D                  Squirrel  aggtgcaaatagttgccgcggggtacttg
       Lesser Egyptian jerboa  aggtgcaagtaattggtacggggaacttt
                 Prairie vole  aggtgcatgtaattgattcgaggaacttt
B D           Chinese hamster  aggtgcatgtaattgattcgaggaacttt
               Golden hamster  aggtgcatgtaattggttcgaggaacttt
B D                     Mouse  aggtgcaggtaattggtacgaggaacctt
B D                       Rat  atgtgcaagtaattgatacgaggaacctt
B D            Naked mole-rat  aggtgcaaataatcaccacaggccacctt
B D                Guinea pig  aggtgcaagtaattatcacggggcacctg
                   Chinchilla  agttgcaagtaatttccatggggcacttg
             Brush-tailed rat  aggtgcaagtaattgccacggggcacttg
B D                    Rabbit  aggttcaagtaattgccacgtgggacttg
B D                      Pika  aggtgcaagtaattaccacgaggaacttg
B D                       Pig  aaatgcaaataattactgcgtggaacttg
B D                    Alpaca  aaatgtaagtaattactacgtggaacttg
               Bactrian camel  aaatgtaagtaattactacgtggaacttg
B D                   Dolphin  aaatgcaagtaattactacgtggaacttg
                 Killer whale  aaatgcaagtaattactacgtggaacttg
             Tibetan antelope  aattgcaagtaattgctacgtggcacttg
B D                       Cow  aattgcaagtaattgctacgtggaacttg
B D                     Sheep  aattgcaagtaattgctacgtggaacttg
                Domestic goat  aattgcaagtaattgctacgtggaacttg
B D                     Horse  aaatgtaagtagttgctacgtggaacttg
B D          White rhinoceros  aaatgcaagtaattgctacgtggcacttg
B D                       Cat  agatgcaagtaattgccacgtggaacttg
B D                       Dog  agatgaaagtaattgccacgtggaatttg
B D                   Ferret   agatgtaagaaattgccacgtggaatttg
B D                     Panda  agatgataataattgccacgtggaatttg
               Pacific walrus  agatgaaagtaattgccacgcggaatttg
                 Weddell seal  agatgaaagtaattgccacgtggaatttg
             Black flying-fox  aaatgcaagtaattgctacgtggaacttg
B D                   Megabat  aaatgcaagtaattgctacgtg--act--
                Big brown bat  aaatgcaagtaattgtttcgtagaacttg
         David's myotis (bat)  aaatgcaagtaattgtttcgtggaacttg
B D                  Microbat  aaatgcaagtaattgtttcgtggaacttg
B D                  Hedgehog  aaatgtaagtagtttccacgtggaacttg
B D                     Shrew  agatgcaagtaattgttccgtggtacttg
              Star-nosed mole  aaatgcaagtaattgccacgtggaacttg
B D                  Elephant  aagtgcaagtaattgctacgtggaacttg
          Cape elephant shrew  aagtgtaagtaattgctccgtggaacttg
B D                   Manatee  aagtgcaagtaattgctacgtggaacttg
             Cape golden mole  aagtgcaagtaattgtttcgtggaacttg
B D                    Tenrec  gtgtgcaagtagttgctgcgtggcacctg
                     Aardvark  aagtgtaagtaattgtttcgtggaacttg
B D                 Armadillo  aagtgcaagtaattgccacgtggaacttg
B D                   Opossum  tgttgtaggtaattttttcgtgggatctg
B D           Tasmanian devil  atatgtaggtaactttttcgtggaacttg
B D                   Wallaby  aaatgtaagtaattttttcgtggaacttg
B D                  Platypus  acgctcaggtagttgaggcggggcacctg
  D              Mallard duck  =============================
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
  D    White-throated sparrow  =============================
B D       Medium ground finch  =============================
B D        American alligator  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D               Rock pigeon  =============================
B D                Budgerigar  =============================
  D       Collared flycatcher  =============================
  D  Chinese softshell turtle  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================

Alignment block 18 of 44 in window, 88794874 - 88794891, 18 bps 
B D                     Human  gagaaaaagaagaggttc
B D                     Chimp  gagaaaaagaagaggttc
B D                   Gorilla  gagaaaaagaagaggttc
B D                 Orangutan  gagaaaaagaagaggttc
B D                    Gibbon  gagaaaaagaagaggctc
B D                    Rhesus  gagcaaaagatgaggccc
B D       Crab-eating macaque  gagcaaaacatgaggccc
B D                    Baboon  gagcaaaagatgaggccc
B D              Green monkey  gagcaaaagatgaggccc
B D                  Marmoset  gggcaaaagaagaggctc
B D           Squirrel monkey  gggcaaaagaagaggctc
B D                  Bushbaby  tggcactagcagggattc
           Chinese tree shrew  gggcaataaaagtgactc
B D                  Squirrel  tggcatt---agagcttg
       Lesser Egyptian jerboa  gggcattaggagagactc
                 Prairie vole  gggcatcagtagagggtc
B D           Chinese hamster  gggcattagaagaggatc
               Golden hamster  gggcattagaagaggatc
B D                     Mouse  gggcagaagaagaggatc
B D                       Rat  gggcataagtagaggatc
B D            Naked mole-rat  tggcattggaagagtttc
B D                Guinea pig  tgtcagtaaaggagtatc
                   Chinchilla  tggcaccagaagagtttc
             Brush-tailed rat  tggtattagaggagcttc
B D                    Rabbit  gggcactaaaagagattc
B D                      Pika  tggaactgcaagtgattc
B D                       Pig  tggcattagaatagattc
B D                    Alpaca  tggcattagaagagattc
               Bactrian camel  tggtattagaagagattc
B D                   Dolphin  tggcattagaagacattc
                 Killer whale  tggcattagaagacattc
             Tibetan antelope  tggcattagag---attc
B D                       Cow  tggcattagag---attc
B D                     Sheep  tggcattagag---cttc
                Domestic goat  tggcattagag---actc
B D                     Horse  tggcattagaagagattc
B D          White rhinoceros  tggcattagtagagattc
B D                       Cat  gggcattagaacagattc
B D                       Dog  tggcattagaagcgattc
B D                   Ferret   tggcattagaggagattc
B D                     Panda  tggcattagaggagattc
               Pacific walrus  tggcattagaggaggttc
                 Weddell seal  tggcattagaggagattc
             Black flying-fox  aggcgatagaagagcctc
B D                   Megabat  gagtgatagaagagcctc
                Big brown bat  tgggggcataatattttc
         David's myotis (bat)  tggtggcataagattttc
B D                  Microbat  tggctgcataagattttc
B D                  Hedgehog  tggtactaaaagagattc
B D                     Shrew  tggtataaaaagagattc
              Star-nosed mole  tggtagtagaggacattc
B D                  Elephant  tggcattataaggggttc
          Cape elephant shrew  tggcattagaaaggattc
B D                   Manatee  tggcattagaagggattc
             Cape golden mole  tggcattagaagggattc
B D                    Tenrec  gggcagcagcgtggactc
                     Aardvark  tggcatcagaagggattc
B D                 Armadillo  tggtatcagaagtgattc
B D                   Opossum  tggcaccagta--ttttc
B D           Tasmanian devil  gggaactacta--ttttc
B D                  Platypus  gggggcagacagcgactc
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
  D    White-throated sparrow  ==================
B D       Medium ground finch  ==================
B D        American alligator  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D               Rock pigeon  ==================
B D                Budgerigar  ==================
  D       Collared flycatcher  ==================
  D  Chinese softshell turtle  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================

Alignment block 19 of 44 in window, 88794892 - 88795078, 187 bps 
B D                     Human  c-agtggcaaaggccttt----tgctgcccttctggt---tatg---------------gaccgaa---a
B D                     Chimp  c-agtggcaaaggccttt----tgctgcccttctggt---tatg---------------gaccgaa---a
B D                   Gorilla  c-agtggcaaaggccttt----tgctgcccttctggt---tatg---------------gaccgaa---a
B D                 Orangutan  c-agtggcaaaggccttt----tgctgcccttctggt---tatg---------------gaccgaa---a
B D                    Gibbon  c-agtggcaaaggccttt----tgctgcccttctggt---tatg---------------gaccgaa---a
B D                    Rhesus  c-agtggcaaaggccttt----tgctgcccttctggt---tacg---------------gactgaa---a
B D       Crab-eating macaque  c-agtggcaaaggccttt----tgctgcccttctggt---tacg---------------gactgaa---a
B D                    Baboon  c-agtggcaaaggccttt----tgctgcctttctggt---tacg---------------gaccgaa---a
B D              Green monkey  c-agtggcaaaggccttt----tgctgcccttctggt---tacg---------------gaccgaa---a
B D                  Marmoset  c-agtggcaaaggccttt----tgctgcccttctgct---tatg---------------gacggaa---a
B D           Squirrel monkey  c-aggggcaaaggtcttt----tgcttcccttctggt---tatg---------------gatggga---a
B D                  Bushbaby  c-aagggaaaaggctttt----ttttggcctttggct---c------------------------a---a
           Chinese tree shrew  c-aatggtaatggccttt----tgctgttcttccgga---catg---------------gcttatg---a
B D                  Squirrel  t-aagggtaaagtccttt----tgcggcccttctgac---tgtg---------------ggccagg---t
       Lesser Egyptian jerboa  c-aaatgcaaaggtcttt----tgctggttttccgat---tatg---------------gatgagg---a
                 Prairie vole  c-acctgaaaatgctttt----tgctgcccttccgat---tatg---------------gaccatg---a
B D           Chinese hamster  c-acgtgataatgctttt----tgctgcccttccgag---tatg---------------gaccatg---a
               Golden hamster  c-acctgaaaatgctttt----tgctgctcttctgat---tatg---------------gaccatg---a
B D                     Mouse  c-acttgaaattgctttt----tgctgcccttccgat---tatg---------------gaccatg---a
B D                       Rat  c-acttgaaattgctttt----tgctgctcctccgat---tatg---------------gacgatg---a
B D            Naked mole-rat  c-agtggaaaaggtcctt----tgctgttcttccgat---tgtg---------------ggccatg---a
B D                Guinea pig  c-agttgaccaagccttt----tgctcttcttttcgt---tttg---------------ggccatg---a
                   Chinchilla  c-agtgcccctggccttt----tgctgttcttctggt---tatg---------------agccatg---a
             Brush-tailed rat  t-ggtgcagctggctttt----tgctgttcttctggt---tatg---------------ggccatg---a
B D                    Rabbit  c-atcggcagcggctttt----ggctcgtcttccgtg---ggtg---------------gctcaag---g
B D                      Pika  t-atcggaggaggctttt----ggctgatcttccgta---catg---------------ggccatg---g
B D                       Pig  c-aatggagaattctttt----tgttggtctttcggg---tatg---------------ggcagaa---a
B D                    Alpaca  c-aatggaaaattctttt----tggtgctctttcggg---tatg---------------gactgat---a
               Bactrian camel  c-aatggaaaattctttt----tggtgctctttcggg---tatg---------------aactgag---a
B D                   Dolphin  c-agtggaagattctttt----tgttggtctttcggg---tacg---------------ggctgag---a
                 Killer whale  c-agtggaaaattctttt----tgttggtctttcggg---tacg---------------ggctgag---a
             Tibetan antelope  c-agtggcaaattctttt----tgttggtctttcggg---gatg---------------gcttccg---a
B D                       Cow  c-agcggcaaattctttt----tgttggtctttcggg---gatg---------------ggttccg---a
B D                     Sheep  c-agtggcaaattctttt----tgttggtctttcggg---gatg---------------gcttccg---a
                Domestic goat  c-agtggcaaattctttt----tgttggtctttcggg---gatg---------------gcttcca---a
B D                     Horse  c-aatggaaaaggtcttt----tgctagtctttcgag---gatg---------------gactgag---a
B D          White rhinoceros  c-aatggaaaagttcttc----tgctcgtctttcgag---tgtg---------------gactggg---a
B D                       Cat  c-attggaaaagtccttt----tgctggtcttttggg---catg---------------gcctgag---a
B D                       Dog  c-actggaaaagtccttt----tgttggtcttttgga---tatg---------------gcctggg---a
B D                   Ferret   c-actggaaaagcccttt----tgttgggctttctga---tatg---------------gcctggg---a
B D                     Panda  c-actggaaaagtccttt----tgctggtctttccaa---catg---------------gcctggg---a
               Pacific walrus  c-actggaaaagtccttt----tgttggtctttccca---tacg---------------gcctggg---a
                 Weddell seal  c-actggaaaagtccttt----tgttggtctttccca---tatg---------------gcctggg---a
             Black flying-fox  caattgg-aaaggtcttt----tgcttgccttttggg---tatg---------------gcctgag---a
B D                   Megabat  c-actgg-aaaggtc-tt----tgattgccttttggg---tatg---------------gcctgag--aa
                Big brown bat  c-attggaaaaggtcttt----tgctgctttttgggg---gatg---------------gcctgag---a
         David's myotis (bat)  c-agtggcaaaggtcttt----tggtgctcttttggg---tatg---------------gcttgag---a
B D                  Microbat  c-attggcaacggtcttt----tgctgctcttttggg---tatg---------------ggttgag---a
B D                  Hedgehog  c-aatggaaaaggttttt----tgtttaacttcctgg---tatg---------------agct-------
B D                     Shrew  t-aatggaaaatgatttt----tgatgacatttcgct---tatg---------------gcctgtg---t
              Star-nosed mole  c-gatggacaaggctttt----tgctgctcttttggc---aatg---------------gactaag---c
B D                  Elephant  c-aatggaatagttcgtt----tgctggcttttctggcttgacg---------------gcctgag----
          Cape elephant shrew  t-ggtcggtaagattttt----tgctgttttttcgggcccggtg---------------gactgggacta
B D                   Manatee  c-aatggaaaaggtcgtt----tgctggccttttggacatgatg---------------gcctgag---a
             Cape golden mole  c-agtggattagttcgtt----tgttggccttttgggcatgatg---------------atctacg---c
B D                    Tenrec  c-agcgg---cggttttt----tgccggtcttgggggcgcggtg---------------gtccatg---g
                     Aardvark  c-aatggaaaagtccgtt----tgctggtttttcggacatgatg---------------gcctatg---g
B D                 Armadillo  c-aatggaaaagtccttt----tgctgttctttctgg---gatg---------------ccctgtg---a
B D                   Opossum  t-gatcgtgctttccaccaatgtgccttccatgtggc---tatg-----------agttattattc---c
B D           Tasmanian devil  t-gatcctgtcgtcctcca---tgctttgcatggggg---tgtgttgaccgtcgtcggaagtcttg---g
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  aggacatgaggagtc---------ttatt-------------tatttttccagat-----------gatt
                        Chimp  aggacatgaggagtc---------ttatt-------------tatttttccagat-----------gatt
                      Gorilla  aggacatgaggagtc---------ttatt-------------tatttttccagat-----------gatt
                    Orangutan  aggacatgaggagtc---------ttatt-------------tatttttccagat-----------gatt
                       Gibbon  aggacatgaggagcc---------ttatt-------------tatttttccagat-----------gatt
                       Rhesus  aggacatgatgagtc---------ttatt-------------tattttaccagat-----------gatt
          Crab-eating macaque  aggacatgatgagtc---------ttatt-------------tattttaccagat-----------gatt
                       Baboon  aggacatgatgagtc---------ttatt-------------tattttaccagat-----------gatt
                 Green monkey  aggacatgatgagtc---------ttatt-------------tattttaccagat-----------gatt
                     Marmoset  aggacatgatgagtcttatttattttatt-------------tatttttccagat-----------gagt
              Squirrel monkey  gggacatgatgagtc---------ttatt-------------tatttttccagat-----------gatt
                     Bushbaby  aggtcatgatgactc---------ttact-------------cttctt----gat-----------gatt
           Chinese tree shrew  aggacatgatgagtc---------ttctt-------------tattttcatggat-----------gact
                     Squirrel  tggccatgatgaatt---------ctatt-------------tattcttctagat-----------gatt
       Lesser Egyptian jerboa  aggacatgatggatc---------tta-----------------ttctttaggat-----------gatt
                 Prairie vole  aagacatgatgaatc---------ttatt-------------ttttcttctaggt-----------gatt
              Chinese hamster  aagacatgatgagtc---------tta----------------tttcttctagat-----------gatt
               Golden hamster  aagacatgttgagtc---------tta----------------tttcttctagat-----------gatt
                        Mouse  aagacatgatgaatc---------ttatt-------------tcttttt-tagat-----------gatt
                          Rat  aagacatgatgaatc---------ttatt-------------tctttttctagat-----------gatt
               Naked mole-rat  aggccatgccaag------------tctt-------------tattcctctagat-----------tctt
                   Guinea pig  aggccaggccagagc---------ttctt-------------ta-gcttccagat-----------gatt
                   Chinchilla  aggccaggtggagtc---------ttctt-------------tatgcttccagag-----------aatt
             Brush-tailed rat  aaggcaggccaagtt---------gtctt-------------tatgcttgtagat-----------gatt
                       Rabbit  cagtcatgatgtctt---------ct--t-------------gatccttccagat-----------gatg
                         Pika  tagacatgatgagta---------tt-----------------attcttctagat-----------gatc
                          Pig  tggacatgatgtgtc---------ctatt-------------tattcttctagat-----------gact
                       Alpaca  aggacatgatgagtc---------ctgtt-------------tattccggtagat-----------gatt
               Bactrian camel  aggacatgatgagtc---------ctgtt-------------tatttcggtagat-----------gatt
                      Dolphin  aggacatgatgagtc---------ctatt-------------tattcttctagat-----------gatt
                 Killer whale  aggacatgatgagtc---------ctatt-------------tattcttctagat-----------gatt
             Tibetan antelope  aggacatggtgagtc---------ttatt-------------tattctgccagat-----------gatt
                          Cow  aggacatgatgagtc---------ttatt-------------tattctgccagat-----------gatt
                        Sheep  aggacatggtgagtc---------ttatt-------------tattctgccagat-----------gatt
                Domestic goat  aggacatggtgagtc---------ttatt-------------tattccgccagat-----------gatt
                        Horse  aggacatgatgagtc---------ctagt-------------tattcttctgggt-----------gatt
             White rhinoceros  aggacatgatgagtc---------ctagt-------------tattctgctagat-----------gatt
                          Cat  aggacatgatgggtc-------------t-------------tattcttctagat-----------ggtt
                          Dog  aagccatgatgggtc---------ctatt-------------tgttcttccagat-----------gact
                      Ferret   aagtcatgatggacc---------ctatt-------------tgttcttccagat-----------gatt
                        Panda  aagtcatgatgggcc---------ctatt-------------tgttcttccagat-----------gatt
               Pacific walrus  atgtcatgatgggtc---------ctgtt-------------tgttcttgcagat-----------gatt
                 Weddell seal  atgtcatgatgggtc---------ctatt-------------tgttcttgcagat-----------gatc
             Black flying-fox  aggacatcatgagtc---------ctaat-------------tattcttgtagat---------------
                      Megabat  aggacatcatgagtc---------ctaat-------------tattc-tgtagat---------------
                Big brown bat  aggacatgatgaatc---------ctaat-------------tatttttctagat-----------ggtt
         David's myotis (bat)  aggacatgatgagtc---------ctaat-------------tattcttctagat-----------gatt
                     Microbat  aggacatgatgagtc---------ctaat-------------tattcttctagat-----------gatt
                     Hedgehog  --gtcatgataagtc---------ctatt-------------tattctttcagat-----------tatt
                        Shrew  gggtcatgatgagtc---------ttatt---------------ctcttc--aat-----------gatt
              Star-nosed mole  cggacataataagta---------ctatt---------------atccttcagat-----------gact
                     Elephant  --gacatggtgaatc---------ctatt-------------tacacttcttatc-----------gatt
          Cape elephant shrew  aagccatgatgagtc---------ctatt-------------tactcctcttttt-----------attt
                      Manatee  aggacatgttgagtc---------ctatt-------------tacacttcttatt-----------gctc
             Cape golden mole  gggacataatgagtc---------ctatt------------------tatccatt-----------gatt
                       Tenrec  aggacaggacgaggg---------ctgtt----------------gcctcctgtc-----------gatt
                     Aardvark  aggacatgatcagtt---------ctgtt-------------tactcctctcact-----------gatt
                    Armadillo  aggacagaatgagtc---------ctatt-------------ta---ttctagct-----------tgtt
                      Opossum  agaaagtgatgagat---------------------------tattttgactgtga----------ggtc
              Tasmanian devil  agggtgtcatgaggt---------gttccaaaggcatcactgtattcccattgggatccacgctgtggtt
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  ccag-cttttagctt---atcataatattta----tgctgccagg-------------gtac--ctcttt
                        Chimp  ccag-tttttagctt---atcataatattta----tgctgccagg-------------gtac--ctcttt
                      Gorilla  ccag-tttttagctt---atcataatattta----tgctgccagg-------------gtac--ctcttt
                    Orangutan  ccag-tttttagctt---atcataatattta----tgcagccagg-------------gtac--ctcttt
                       Gibbon  ccag-tttttagctt---ttcataatattta----tgctgccagg-------------gtac--ctcttt
                       Rhesus  ctag-tttttagctt---ttcatgatattta----cgctgtctgg-------------gtgc--ctctgt
          Crab-eating macaque  ctag-tttttagctt---ttcatgatattta----cgctgtctgg-------------gtgc--ctctgt
                       Baboon  ctag-tttttagctt---ttcatgatattta----cgctgtcagg-------------gtgc--ctttgt
                 Green monkey  ctag-tttttagctt---ttcatgatattta----cactgtcagg-------------gtgc--ctctgt
                     Marmoset  ccag-tttttagcta---atcatgatattta----cgatgtcagg-------------gtga--ctcttt
              Squirrel monkey  ccag-tttttagcta---atcatgatattta----cgctgtcagg-------------gtac--ctcttt
                     Bushbaby  ccaa-cttttagtat---atcacaatattta----cactattatg-------------gtac--ctcctt
           Chinese tree shrew  tcag-tgtttagctt---attccagtatttg----tatgatcagg-------------atac--ttctta
                     Squirrel  tcag-attttagttt---atca-------------catcatcagg-------------agat--atcttt
       Lesser Egyptian jerboa  c---------------------------------------------------------ggctacctcctt
                 Prairie vole  ac--------------------------------------------------------aagt--ctcact
              Chinese hamster  a---------------------------------------------------------aagt--ctcact
               Golden hamster  a---------------------------------------------------------aagt--ctcact
                        Mouse  ac--------------------------------------------------------aagt--ctcaat
                          Rat  ac--------------------------------------------------------aagt--ctcact
               Naked mole-rat  ccaa-tttttagtgt---atcacaataatcattatcattatcagg-------------acag--ctcctg
                   Guinea pig  ccaa-tttttaggat---attgtgataatta----cgttattagt-------------atag--cccctg
                   Chinchilla  ccaa-cttatagtgt---atcacaataatta----cattatcagg-------------atag--ctcctg
             Brush-tailed rat  ccaa-cttttagtat---gtcacaataatta----cgttattagg-------------gtag--ctcctt
                       Rabbit  ccga-gtttcagcct---agcgg-atattta----cattatcgag-------------attc--ttcttg
                         Pika  ccag-cttttagctc---gccatcatactta----tatgatcaaa-------------a-----gtcttg
                          Pig  gcag-tttttagctt---attacaatattta----cattatcagg-------------atac--ctcttc
                       Alpaca  ccag-ttgtaagctt---cttacagtatttt----cattatgagg-------------atac--ctcttc
               Bactrian camel  ccag-ttgtaagctt---cctacagtatttt----cattatgagg-------------acac--ctcttc
                      Dolphin  ccag-tttttagctt---attacagtattta----cattattagg-------------ctac--ctcttc
                 Killer whale  ccag-tttttagctt---attacagtattta----cattattagg-------------ctac--ctcttc
             Tibetan antelope  ccgt-tttttagctt---attacaatagtta----cattaccagg-------------ctac--ttcttt
                          Cow  ccag-tttttagctt---attaaaatagtta----cattaccagg-------------ctac--ttcttt
                        Sheep  ccgt-tttttagctt---attgcaatagtta----cattaccagg-------------ctac--ttcttt
                Domestic goat  tcgt-tttttagctt---attacagtagtga----cattaccagg-------------ctac--ttcttt
                        Horse  ccag-tttttagctt---atcacaatattta----cattatcagg-------------acac--ctcttc
             White rhinoceros  ccag-tttttagctt---atcacaatattta----cattatcagg-------------atac--ctcttc
                          Cat  ccag-tttttagctt---atcacaatgttta----cattatcagg-------------atac--ctcttc
                          Dog  tcag--ttttagcct---atcacaatgttta----cattataagg-------------acat--ctcttc
                      Ferret   ccag-gtttcagcct---accacgatgttta----cattatcagg-------------atac--ctcttc
                        Panda  ccag-tttttagcct---atcacgatgtttg----cattatgggg-------------atac--ctcttc
               Pacific walrus  ccag-tttttagcct---agcacagtgttta----cattatcgag-------------atac--ctcttc
                 Weddell seal  ccag-tttttagcct---agcacagtgttta----cattatcggg-------------atac--ctcttc
             Black flying-fox  ----------agctt---attgcaata--aa----gatcatcaag-------------atat--ctcttc
                      Megabat  ----------agctt---attgcaata--aa----gatcatcaag-------------atat--ctcttc
                Big brown bat  ctaa-ttttcagctt---atttcaatatgta----catcatcagg-------------gtac--atcttc
         David's myotis (bat)  ctaa-tgtttagctt---atttcaatattta----caccctcagg-------------gtac--atcttc
                     Microbat  ctaa-tgtttagctt---atttcaatattta----gaccatcagg-------------gtac--atcttc
                     Hedgehog  tcac-tttttagttt---atcacaacattta----gactttcagg-------------agac--ctctt-
                        Shrew  ctag-cttttagttt---atcgttgtatgta----tgtttgctgg-------------ttac--ctcttc
              Star-nosed mole  ccag-tttttagttt---tccacaatattaa----tattttcagg-------------atat--ctcttc
                     Elephant  ccag-gtttaagctt---gtcac---gttta----tagtatcaggttataatatcaggatac--cgcttc
          Cape elephant shrew  ctaa-gtttaagttt---atcacaatgttta----tagtatcagg---------------aa--cttttc
                      Manatee  cctg-ttttaagctt---attacaatattta----taatatcaggttataatatcaggatac--cgcttc
             Cape golden mole  ccag-ttttaagcaa---atcacaacattta----tattattaga-------------atac--ctcttc
                       Tenrec  ccag-gtgtcagcct---ctcacagtgctta----ta-tatccgg-------------gtat--cacttc
                     Aardvark  ccag-ttttaagttt---atcac-atattta----tattatcagg--------------tac--ctctcc
                    Armadillo  ctag-gttttaacct---ttaaccatagtta----tattatcagg-------------atac--ctcctc
                      Opossum  ctaaacttacggcccct-gttggcacattca----tcttgtcagg-------------ttat--ctcctc
              Tasmanian devil  ttga----gtagcttttcctttgaatactca----tctcatcagg-------------ttac--cttctc
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  --act-----gatg-aactc----gtgttttt---a-tttcttctgac-------------a--------
                        Chimp  --act-----gatg-aactc----gtgttttt---a-tttcttctgac----------------------
                      Gorilla  --act-----gatg-aactc----gtgttttt---a-tttcttctgac------------aa--------
                    Orangutan  --agt-----gatg-aactc----gtgttttt---a-tttcttctgac----------------------
                       Gibbon  --agt-----gatg-acgtc----gtgttttt---a-tttcttctgac-----------aaa--------
                       Rhesus  --agt-----gatg-aactc----ttgttttc---a-tttcttctgac-----------aag--------
          Crab-eating macaque  --agt-----gatg-aactc----ttgttttc---a-tttcttctgac-----------aag-------a
                       Baboon  --agt-----gatg-aactc----ttgttttc---a-tttcttctgac-----------aag------aa
                 Green monkey  --agt-----gatg-aattc----ttgttttc---a-tttcttctgac-----------caaaaaaaaaa
                     Marmoset  --agc-----gatg-aactc----ttgttttt---a-tttcttctgac----------------------
              Squirrel monkey  --agt-----gatg-aaccc----ttgttttt---a-tttcttctgac-----------aaa-----aaa
                     Bushbaby  ---gt-----ggta-gattc----ttatttct---a-tttattctgtc-----------aag--------
           Chinese tree shrew  agaga-----gatg-aattc----ttactttt---a-tttctttagac-----------caa--------
                     Squirrel  --agt-----gatg-aactc----ttactttt---a-tttcttctgac-----------caa--------
       Lesser Egyptian jerboa  --tgt-----gatg-aactg------attttt---a-tttcttctgac-----------aaa--------
                 Prairie vole  --ggt-----gatg-aactc----ttattttt---a-tttcttctgac-----------aaa--------
              Chinese hamster  --ggt-----gatg-aactc---tttattttt---a-tttcttctaac-----------aaa--------
               Golden hamster  --ggt-----gatg-aactc----ttgttttt---a-tatcttctagc-----------aaa--------
                        Mouse  --ggt-----agtg-aattc----ttattttt---a-tttcttatgat-----------caa--------
                          Rat  --ggt-----gaca-gactg----ttactttt---a-tttcttatggc-----------aaa--------
               Naked mole-rat  --agt-----gatg-aactc----tta-tttt---a-tcctttctgat----------------------
                   Guinea pig  --agt-----gatg-acgtc----t---tttt---g-ttctttctgac-----------aga--------
                   Chinchilla  --agt-----gatg-aagtc----t---tttt---a-----ttctgat-----------gag--------
             Brush-tailed rat  ---gt-----gata-aagtc----t---tttt--------------ct-----------gac--------
                       Rabbit  --cat-----gatg-ggctc----taattgtt---a-cctattctgac-----------a----------
                         Pika  --gat-----gatg-gagct----aagttttt---a-cttacttggac-----------aga--------
                          Pig  --aat-----gatt-aattc----ttagtttt---g-ctg-ttctgac----------------------
                       Alpaca  --agt-----gatg-gactc----ttattttt---g-tttcttctgac----------------------
               Bactrian camel  --agt-----gatg-gactc----ttattttt---g-tttcttctgac----------------------
                      Dolphin  --agt-----gatg-aactc-----------t---g-tttctt-----------------ca--------
                 Killer whale  --agt-----gatg-aactc-----------t---g-tttctt-----------------ca--------
             Tibetan antelope  --ggt-----gaga-aactc------attttt---g-tttcttgtgac--------cataaa--------
                          Cow  --ggt-----gata-aactc------attttt---g-tttcttgtgac-----------aaa--------
                        Sheep  --ggt-----gata-aactc------attttt---g-tttcttgtgac--------cataaa--------
                Domestic goat  --ggt-----gata-aactc------attttt---g-tttcttgtgac--------cataaa--------
                        Horse  --agt-----gatg-aactc----tagtttcc---a-tttcttctg------------------------
             White rhinoceros  --agt-----gatg-aactc----taattttc---a-tttcttctg------------------------
                          Cat  --agt-----gatg-aattt--------ttttttaa-tttcttctgac-------caaacaa--------
                          Dog  --agg-----ggtg-aactc--------ttgt---a-tttcttcttac----------aaaa--------
                      Ferret   --agtgaagaggtg-aactg--------tttt---a-tttcttcttaccaaaaaaaaaaaaa--------
                        Panda  --agt-----ggta-aactc--------tttc---a-tttcttcttac------------aa--------
               Pacific walrus  --agt-----ggtg-aactc--------tttt---a-tttcttctcac-----------gaa--------
                 Weddell seal  --agt-----ggtg-aactc--------tttt---a-tttcttctcac------------aa--------
             Black flying-fox  --agt-----ggtg-aactc----ttattttt---a-tttcttctgac----------------------
                      Megabat  --agt-----ggtg-aactc----ttattttt---a-tttcttctgac----------------------
                Big brown bat  --agt-----gatg-aactc----ttattttt---a-tttattctgac----------------------
         David's myotis (bat)  --agt-----gagg-atctc----ttattttt---a-tttattctgac----------------------
                     Microbat  --aat-----gagg-atctc----ttattttt---a-tttattctgac----------------------
                     Hedgehog  ----------------tatc----ttcata-------tttcatct-------------------------
                        Shrew  --aat-----gatg--aatc----tgactatt---a-tttcttctgat--------gaaaaa--------
              Star-nosed mole  --agt-----gatg-aaatc----ttactttc---attttcttct-------------------------
                     Elephant  --agt-----gatg-aacgc----t--ttttt---t-tttgtcctgac----------------------
          Cape elephant shrew  --a-------agtg-acagt----t--ttttc---c-cctgactaaaa----------------------
                      Manatee  --agt-----gatg-aacgt----t--ttttt---t-tttttcctgac----------------------
             Cape golden mole  --agt-----gatg-atcaa----t--ttttt---c-ctgaccaaaaa----------------------
                       Tenrec  --cga-----gaggcatgcaggttt--ttttt---c-ttgtttctgac----------------------
                     Aardvark  --a-c-----gatg-aatat----t--ttttt---c-cttttgatgaa----------------------
                    Armadillo  --aat-----gagg-aactc----ttattttt---g-tttcttttgac----------------------
                      Opossum  --agt-----tagg-gtttc-----aggtttg---a-ttctgtctg--------------aa--------
              Tasmanian devil  --agt-----tagg-aactc-----aagtttg---t-cacggtctgac-----------aaa--------
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  aaaaaaa---a--------------aag------ag-ta-a----atcacgg-------------tt-t
                        Chimp  -aaaaaa---a--------------aag------ag-ta-a----accacag-------------tt-t
                      Gorilla  aaaaaaa---a--------------aag------ag-ta-a----atcacag-------------tt-t
                    Orangutan  -aaaaaa---a--------------aag------ag-ta-a----atcacag-------------tt-t
                       Gibbon  aaaaaaa---a--------------aag------ag-ta-a----atcacag-------------tt-t
                       Rhesus  aaaaaaa---a--------------aaa------ag-ta-a----atcacag-------------tt-t
          Crab-eating macaque  aaaaaaa---a--------------aaa------ag-ta-a----atcacag-------------tt-t
                       Baboon  aaaaaaa---a--------------aag------aa-ta-a----atcacag-------------tt-t
                 Green monkey  aaaaaaa---a--------------aag------ag-ta-a----atcacag-------------tt-t
                     Marmoset  aaaaaaa---a--------------aag------aa-ga-a----atcacat-------------tt-t
              Squirrel monkey  aaaaaaa---a--------------aag------aa-ta-a----atcacat-------------tt-t
                     Bushbaby  -aaaaga---a--------------aag------at-ta-a----atca--g-------------tt-a
           Chinese tree shrew  aaaaaaa---a--------------aaa------ag-ta-a----atca-ag-------------tg-g
                     Squirrel  aaaaaa----a--------------aaa------aa-aa-a----agagtaa--ttgtttttcaaat-g
       Lesser Egyptian jerboa  a---------a--------------ata------a---c-a----acaattc--agagttaagagtt-t
                 Prairie vole  acagcaac--a--------------aca------aa-gc-a----acacaaa--------atg-----t
              Chinese hamster  ac--------a--------------aca------aa-ca-a----acatgca--ggcgttaac-----t
               Golden hamster  acagcaaacaa--------------aca------aa-ca-a----acacata--ggagttaac-----t
                        Mouse  aaacaaaacaatacaaaagaaacaaaca------aa-ca-a----acaaaaaaaggagttaacagtt-t
                          Rat  aataaaaataa----------------a------aa-ca-a----acaaaaaaatgggttaacattt-t
               Naked mole-rat  aaa-------a--------------aag------ag-ta-t----ataacag-------------tt-t
                   Guinea pig  aaa-------a--------------aag------ag-ta-t----acaacat-----------------
                   Chinchilla  aaa-------g--------------aag------ag-ta-t----gtgacga-----------------
             Brush-tailed rat  aaa-------a--------------aag------ag-ta-t----ataacag-----------------
                       Rabbit  ----------a----------------a------aa-ta-a----atcacaa-------------tt-t
                         Pika  ag--------a----------------a------aa-aa-a----atctcat-------------tt-t
                          Pig  --aaaag---a--------------aaa------aa-gt-t----tactcag-------------tt-t
                       Alpaca  --aaaaa---a--------------aaa------aa-gt-t----tacccat-------------tt-g
               Bactrian camel  -----aa---a--------------aaa------aa-gt-t----tacccag-------------tt-g
                      Dolphin  ggaaaaa---a--------------aaa------aa-gt-t----tactcag-------------tt-g
                 Killer whale  ggaaaaa---a--------------aaa------aa-gt-t----tactcag-------------tt-g
             Tibetan antelope  aaacaaa---c--------------aaa------ca-aa-aaaaaaacacct-------------ta-g
                          Cow  aaaaaaa---a--------------aaa------aa-aa------aatttag-------------tt-g
                        Sheep  aaaaaaa---a--------------aaa------aa-aa-c---aaacttag-------------tt-g
                Domestic goat  aaaaaaa---a--------------aaa------ca-aa-c----aacttag-------------tt-g
                        Horse  -----aa---a--------------aaa------ga-gt-t----tactcag-------------tt-c
             White rhinoceros  ----aaa---a--------------aaa------ga-gt-t----tactca--------------tt-t
                          Cat  acaaata---a--------------ata------aa-gttt----ccccca--------------tt-t
                          Dog  aaaaaaa---a--------------aaa------aa-gt-------tacta--------------tttt
                      Ferret   aaaaaaa---a--------------aaa------aa-gt-c----ttatta--------------tt-t
                        Panda  aaaaaag---a--------------gaa------aa-gt---------tta--------------tcat
               Pacific walrus  aaaaaaa---a--------------aaa------aa-gt------ttatta--------------tt-t
                 Weddell seal  aaaaaaa---a--------------aaa------aa-gt---------tta--------------tt-t
             Black flying-fox  aaaaaga---a--------------aaaaaaaagga-gt-t----tatttag-------------tt-t
                      Megabat  acaaaga---a--------------aaaaaaaagga-gt-t----tacttag-------------tt-t
                Big brown bat  aaaaaga---a--------------aaa------ta-gt-t----tactcag-------------tt-t
         David's myotis (bat)  aaaaaga---a--------------aaa------ta-gt-t----tactcag-------------tt-t
                     Microbat  aaaaaga---a--------------aaa------ta-gt-t----tactcag-------------tt-t
                     Hedgehog  --ggtaa---a--------------taa------ta-gc-t----tattcag-------------aa-t
                        Shrew  tatgaga---g--------------aaa------ag-aa-t----ttatcat-------------tt-t
              Star-nosed mole  --tgaaa---a--------------aaa------aa-aa-a----tacccg---------------t-t
                     Elephant  aaagaaa---g--------------aa----------tg-a----atcacag-------------tc-t
          Cape elephant shrew  aaagaaa---g--------------a--------------a----agttcag-------------tt-t
                      Manatee  aaaaaaa---g--------------ag----------tg-a----atcacag-------------tt-t
             Cape golden mole  aaaaaat---g--------------aaa------aattg-a----gtcacag-------------tt-t
                       Tenrec  aaaaaac---a--------------aaa---------ta-a----actacag-------------tt-t
                     Aardvark  aacaaaa---a--------------aaa------ag-cg-a----atcacag-------------tt-t
                    Armadillo  agaaaaa---t--------------ga----------gt-c----attacgg-------------tt-t
                      Opossum  aaaagga---a--------------gga------ag-ca-c----tgttt-------------------
              Tasmanian devil  aaaaata---a--------------gga------at-ca-c----agaac-------------------
                 Mallard duck  =====================================================================
           Tibetan ground jay  =====================================================================
                  Zebra finch  =====================================================================
       White-throated sparrow  =====================================================================
          Medium ground finch  =====================================================================
           American alligator  =====================================================================
                       Turkey  =====================================================================
                      Chicken  =====================================================================
             Peregrine falcon  =====================================================================
                 Saker falcon  =====================================================================
                  Rock pigeon  =====================================================================
                   Budgerigar  =====================================================================
          Collared flycatcher  =====================================================================
     Chinese softshell turtle  =====================================================================
               Painted turtle  =====================================================================
              Green seaturtle  =====================================================================

Inserts between block 19 and 20 in window
B D                  Opossum 30122bp

Alignment block 20 of 44 in window, 88795079 - 88795166, 88 bps 
B D                     Human  gtcaaat-gtt-----------actaaa-----tagt----aaaatcccaatcttttgccagttttatca
B D                     Chimp  gtcaaat-gtt-----------actaaa-----tagt----aaaatcccaatcttttgccagttttatca
B D                   Gorilla  gtcaaat-gtt-----------actaaa-----tagt----aaaatcccaatcttttgccagttttatca
B D                 Orangutan  gtcaaat-gtt-----------actaaa-----tagt----aaaatcccaattttttgccagttttatca
B D                    Gibbon  gtcaaat-gtt-----------actaaa-----tagt----aaaatcccaatcttttgccagttttatca
B D                    Rhesus  gtcaaat-gtt-----------actaaa-----tagc----aaaatcccaatcttttaccagttttatca
B D       Crab-eating macaque  gtcaaat-gtt-----------actaaa-----tagc----aaaatcccaatcttttaccagttttatca
B D                    Baboon  gtcaaat-gtt-----------actaaa-----tagc----aaaatcccaatcttttaccagttttatca
B D              Green monkey  gtcaaat-gtt-----------actaaa-----tagc----aaaatcccaatcttttactggttttatca
B D                  Marmoset  gtcaaat-gtt-----------actgaa-----tagc----aaaatcctaatcttttaccagtttcataa
B D           Squirrel monkey  gtcaaac-gtt-----------gctgaa-----tagc----aaaatcttaatcttttaccagttttatca
B D                  Bushbaby  gttaaat-gtt-----------actgat-----tagc----aaaagccc------tttctagtgttactg
           Chinese tree shrew  gtcaaat-gtt-----------actgaa-----ttgc----aaaa-----atctctttccagtgttatta
B D                  Squirrel  ttcaaat-gtt-----------actgaa-----taga----ataatccc------ttcccagggctatca
       Lesser Egyptian jerboa  gtcaagt-gtt-----------actgaa-----tagc----aaaattcc------ttcccagtgctgtca
                 Prairie vole  gtcaggt-gtt-----------aacgaa-----taac----aatatccc------tactcaatgcta---
B D           Chinese hamster  ggcaggt-gtt-----------aatgag-----tagc----aatatctc------tactcagtgct----
               Golden hamster  gttaggt-gtt-----------aatgag-----tagc----aatatctc------tgctcagtgct----
B D                     Mouse  gtcggat-gtt-----------agtgaa-----taac-----aaattcc------cactctgtgctg---
B D                       Rat  gtcagat-gtt-----------agtgaa-----taactaacaaaatccc------tactctgtgctg---
B D            Naked mole-rat  gccaaat-att-----------actgaa-----tagt---gaaaacccc------ttctcagtattatca
B D                Guinea pig  ---aaat-gtt-----------actgaa-----cagt---gaaaatctc------ttcccaatactatca
                   Chinchilla  ---aaat-gtt-----------actgag-----tagc---aaaagtcct------tttccagtattatca
             Brush-tailed rat  ---aaatagac-----------actgaa-----caga---gagaattgc------tttccagtattatca
B D                    Rabbit  ggtaaat-gtt-----------actgga-----tagt----aaataccc------ttcccagtatta---
B D                      Pika  gacaaac-gtt-----------actgga-----tagc----agatgccc------tttccaatatta---
B D                       Pig  atcagat-gct-----------actgaa-----ttac----aaaatccc------ttcccagtgttatca
B D                    Alpaca  gtcaaat-gat-----------actgaa-----tagc----aaaatccc------ttcccagtgttatca
               Bactrian camel  gtcaaat-gat-----------actgaa-----tagc----aaaatccc------ttcccagtgttatca
B D                   Dolphin  atcaaat-g---------------------------------------c------tttccagtgttatca
                 Killer whale  atcaaat-g---------------------------------------c------tttccagtgttatca
             Tibetan antelope  ttcaaat-g---------------------------------------c------ttccaagtgttatca
B D                       Cow  ttcaaat-g---------------------------------------c------ttccaagtgttatca
B D                     Sheep  ttcaaat-g---------------------------------------c------ttccaagtgttatca
                Domestic goat  ttcaaat-g---------------------------------------c------ttccaagtgttatca
B D                     Horse  gtcacat-gct-----------actaaa-----tagc----aaaatccc------ttccctgtgttatca
B D          White rhinoceros  gtcaaat-gct-----------actgaa-----tagc----aaaatccc------ttcccagtattatca
B D                       Cat  gtcaaat-gct-----------aatgta-----tagc----aaaatccc------ttcccagtgttatca
B D                       Dog  gtcaaat-gct-----------agtgaatagcctagc----aaaatccc------ttcccagtattatca
B D                   Ferret   gtcaaat-gct-----------agcaaa-----tagc----agaatccc------ttcccagtattatca
B D                     Panda  gtc---------------------------------------aaatccc------tccccagtattatca
               Pacific walrus  gtcaaat-gct-----------agtgaa-----tagc----aaaatccc------ttcccagtattatcg
                 Weddell seal  gtcaaat-gct-----------agtgaa-----tagc----aaaatccc------ttcccagtattatcg
             Black flying-fox  gtcaaat-gct-----------actgca-----cagc----aaaatccc------ttcccaggggtatca
B D                   Megabat  gtcaaat-gct-----------actgca-----cagc----acaatctc------ttcccagaggtatca
                Big brown bat  gtcaaat-act-----------actgaa-----tagc----aaaatccc------tccccagtgttatca
         David's myotis (bat)  gtcaaat-act-----------actgaa-----tagc----aaaatccc------ttcccagtgttatca
B D                  Microbat  gtcaaat-act-----------actgaa-----tagc----aaaatccc------ttcccagtattatca
B D                  Hedgehog  ttcagat-g-c-----------tataaa-----tagc----aataggca------ttttcagcattatca
B D                     Shrew  tactgaa-t-a-----------acaaaa-----tcgt----ctc--------------cctgtgttatca
              Star-nosed mole  tacttag-t------------------------ttgc----cacacgc---------tactgtattatc-
B D                  Elephant  gccaaat-gtc-----------attgaa-----ttgc----aaaatcct------tcctgagaa-tattg
          Cape elephant shrew  gttaaat-ggc-----------attgaa-----tttc----aaaatcct------ttctcaatg-cattg
B D                   Manatee  gtcaaat-gcc-----------attgaa-----ttgc----aaaatcct------tccacagta-tattg
             Cape golden mole  gtcaaat-gcc-----------attgag-----ttat----aaaatcct------ttcccagta-tattg
B D                    Tenrec  gacaaat-cccat---------attgag-----ttac----aaaatcct------tctccgttg-tactg
                     Aardvark  ttcaaat-gtc-----------attgaa-----ttac----aatatctt------tttctagta-tatca
B D                 Armadillo  gtcaaat-gct-----------acttaa------agc----aaaatcct------ttcccagtg-catcc
B D           Tasmanian devil  tccagat-gttttatcaaaatcgttaca-----tggt----aaggattt------taactgtaatgactg
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Opossum  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  g-gaaacaat---g----tatttg-aaatgaaag-acaatgttaaaaca
                        Chimp  g-gaaacaat---g----tatttg-aaatgaaag-acaatgttaaaaca
                      Gorilla  g-gcaacaat---g----tatttg-aaatgaaag-acaatgttaaaaca
                    Orangutan  g-gaaacaat---g----tatttg-aaatgaaag-ataatgttaaaaca
                       Gibbon  g-gaaacaat---g----tatttg-aaatgaaag-ataatgttaaaaca
                       Rhesus  g-gaaacaat---a----tctttg-aaatgaaag-ataatgttaaaaca
          Crab-eating macaque  g-gaaacaat---a----tctttg-aaatgaaag-ataatgttaaaaca
                       Baboon  g-gaaacaat---a----tctttg-aaatgaaag-ataatgttaaaaca
                 Green monkey  g-gaaacaat---a----tctttg-aaatgaaag-ataatgttaaaaca
                     Marmoset  g-gaaacaaa---g----tctttg-aaatgaaag-ata--gttaaagca
              Squirrel monkey  g-aaaacaaa---g----tctttg-aaatgaaag-gtaatgttaaagca
                     Bushbaby  a-taaacaat---g----cctttg-g---gaaa----------aaaaca
           Chinese tree shrew  a-caaatagt---g----tgtttt-aaatgaaag-agaatattagaaca
                     Squirrel  a-ttaagaat---g----tctttg-aaatgaaag-agaaagtcag---g
       Lesser Egyptian jerboa  a-tgagcaat---g----ccattg-aaatggaag-agaatgttgaatca
                 Prairie vole  --cagacaat---g----tctttg-aaaacgaag-ag-atgtaacaacg
              Chinese hamster  -----acaat---g----tctttg-aaatgg-------atatgcaaagg
               Golden hamster  -----acaat---g----tctttg-acatggaag-ctaatgtgaaaatg
                        Mouse  --tgaacaat---g----tcatag-acatggaag-tagatgtgaaa---
                          Rat  --tgaccaa----g----tcttag-aaatggaag-caggggtgagaatg
               Naked mole-rat  a-taaataat---g----tctttg-aaatga-------atgttaaaaca
                   Guinea pig  a-taaataat---g----tctttc-aattga-------attttaagaca
                   Chinchilla  a-taaataat---g----tctttg-aattga-------atgttaaaaaa
             Brush-tailed rat  g-taagtgat---g----acactg-aattga-------atgctaaaata
                       Rabbit  --ccaacaag---gaacatctttg-aaag----------tgttcaaaca
                         Pika  --tcaacaat---g----tctttg-aaagaaa------atgctagaact
                          Pig  a-taaaaaat---a---ttttttg-aagttaaag-agattgttgaaata
                       Alpaca  a-tgaacagt---g----tctttg-aaattaaag-aaaatgttaaagca
               Bactrian camel  a-tgaacagt---g----tctttg-aaattaaag-aaaatgttaaagca
                      Dolphin  a-taaacaat---g----tctttg-aaattaaag-agaatgttgaaaca
                 Killer whale  a-taaacaat---g----tctttg-aaattaaag-agaatgttgaaaca
             Tibetan antelope  a-taaatagt---g----tctttg-aaataaaag-agattgttgaaaca
                          Cow  a-taaatagt---g----gctttg-aaataaaag-agactgttgaaaca
                        Sheep  a-taaatagt---a----tctttg-aaataaaag-agactgttgaaaca
                Domestic goat  a-taaatagt---a----tctttg-aaataaaag-agactgttgaaaca
                        Horse  a-taaacaat---g----tctttg-aaatgaaag-agaatgttaaaaca
             White rhinoceros  a-taaataat---g----tctttg-aaatgaaag-agaatgttaaaaca
                          Cat  a-c-aatact---g----tctctg-aaataaaac-agaatgttaaaaca
                          Dog  a-c-aatacc---a----tctttg-aaatacaag-agaatgctaaaaca
                      Ferret   a-c-aatacc---a----tctttg-aaataaaag-ataacgttaaaacc
                        Panda  a-c-aatact---g----tctttg-cagtaaagg-agaatgtttaaaca
               Pacific walrus  a-c-aatacc---a----tctttg-aaataaaag-agaatgttaaaaca
                 Weddell seal  a-c-aatacc---a----tctttg-aaacaaaag-agaatgttaaaaca
             Black flying-fox  a-tgaacagt---g----tctttg-aaatgaaag-agaatattaaaaca
                      Megabat  a-tgaacagt---g----tctttg-aaatgaaag-agaatattaaaaca
                Big brown bat  attaaaccat---g----ccctat-acatgaaag-agaatattaaaact
         David's myotis (bat)  a-taaacaat---g----acctgg-aaatgaaag-agattattaaaact
                     Microbat  a-taaacaat---g----ccctgg-aaatgaaag-agaatattaaaact
                     Hedgehog  a-caactgta---a----cctttg-aaatgaaag-aaaacattaaaata
                        Shrew  a-tatacaag---a----tgtgtt-aa--gaaag-ataat-ttaaaact
              Star-nosed mole  a-taaacaat---g----tctttg-aaatgaaag-agaatgctcaaaga
                     Elephant  a-taagcaac---t----actttg-aaatgaaac-ataatggtaaaaca
          Cape elephant shrew  c-caagcaac---t----actttg-aaatgaatt-tttatttcaaaaca
                      Manatee  a-taagcaac---t----actttg-aaatgaaac-ataatgttaaaaca
             Cape golden mole  a-ttagcaac---t----acttta-aaatgaaac-ataatgttaaaaca
                       Tenrec  a-ttagcaac---t----atttag-aaatgatac---aatgttaaaaca
                     Aardvark  a-taagcaattagt----acttgg-aattgaaac-ataaagtcaaaaca
                    Armadillo  a-taagcaac---t----tctttg-aaatggaagggtatggttaaaaca
              Tasmanian devil  a-caattgat---t----acttgataaatgagag-gaaa--ctaaaata
                 Mallard duck  =================================================
           Tibetan ground jay  =================================================
                  Zebra finch  =================================================
       White-throated sparrow  =================================================
          Medium ground finch  =================================================
           American alligator  =================================================
                       Turkey  =================================================
                      Chicken  =================================================
             Peregrine falcon  =================================================
                 Saker falcon  =================================================
                  Rock pigeon  =================================================
                   Budgerigar  =================================================
          Collared flycatcher  =================================================
     Chinese softshell turtle  =================================================
               Painted turtle  =================================================
                      Opossum  =================================================
              Green seaturtle  =================================================

Inserts between block 20 and 21 in window
B D          Tasmanian devil 28569bp

Alignment block 21 of 44 in window, 88795167 - 88795189, 23 bps 
B D                     Human  atactcaaa------------------ctatag--------a------c--------------tt---t-
B D                     Chimp  atactcaaa------------------ctatag--------a------c--------------tt---t-
B D                   Gorilla  atactcaaa------------------ctatag--------a------c--------------tt---t-
B D                 Orangutan  atactcaaa------------------ctatag--------ag-----t--------------tt---t-
B D                    Gibbon  atactcaaa------------------ctatag--------a------g--------------tt---t-
B D                    Rhesus  atactcaaa------------------ctatag--------agtttttt--------------ttttgt-
B D       Crab-eating macaque  atactcaaa------------------ctatag--------agtttttt--------------tt---t-
B D                    Baboon  atactcaaa------------------ctatag--------aggttttt--------------tt---t-
B D              Green monkey  atactcaaa------------------ctatag--------agtttttt--------------tt---t-
B D                  Marmoset  atactcaag------------------ctacag--------a------t--------------tt---t-
B D           Squirrel monkey  agactcaag------------------ctacag--------a-----tt--------------tt---t-
B D                  Bushbaby  agactcaaa------------------ttatag--------a------g--------------tt---t-
           Chinese tree shrew  atactcaaa------------------ctatag--------a-----ta--------------tt---t-
B D                  Squirrel  agacttaca------------------ctttag--------a-----ga--------------tt---g-
       Lesser Egyptian jerboa  tggttcaaa------------------ctataa--------a-----ga--------------tt---a-
                 Prairie vole  agactgaaa------------------gcccag--------a-----ga--------------tg---g-
B D           Chinese hamster  agattggaa------------------gtacag--------t-----ga--------------tg---g-
               Golden hamster  agattggaa------------------gaaaag--------t-----ga--------------tg---g-
B D                     Mouse  ------caa------------------atgcag--------c-----ca--------------tt---g-
B D                       Rat  agaatgcaa------------------atacag--------c-----ca--------------tt---g-
B D            Naked mole-rat  agac--aaac-----------------ctaaag--------g-----ga--------------tt---g-
B D                Guinea pig  -------aa------------------ctaaag--------a-----ga--------------tt---a-
                   Chinchilla  -----------------------------aaag--------a-----gg--------------ct---g-
             Brush-tailed rat  agac--caa------------------ctaaag--------a-----ga--------------ta---g-
B D                    Rabbit  aaactgaa-------------------atgcta--------a-----cg--------------t----g-
B D                      Pika  aagctacatatatgtatatatgtatatatacac--------a-----ca--------------t----a-
B D                       Pig  ggaatcaaa------------------gcatag--------a-----gc--------------ct---t-
B D                    Alpaca  agaatcaaa------------------tcatag--------agg---gt--------------tt---t-
               Bactrian camel  agaatcaaa------------------tcatgg--------agattttt--------------tt---t-
B D                   Dolphin  agaatcaat------------------ttatag--------a-----gt--------------tt---t-
                 Killer whale  agaatcaat------------------ttatag--------a-----gt--------------tt---t-
             Tibetan antelope  agaatcaaa------------------ttatag--------a-----at--------------tt---t-
B D                       Cow  agaatcaaa------------------ttatac--------a-----at--------------tt---t-
B D                     Sheep  agaatcaaa------------------ttatag--------a-----at--------------tt---t-
                Domestic goat  agaatcaaa------------------ttatag--------a-----at--------------tt---t-
B D                     Horse  agactcaaa------------------ttgtag--------a-----ct--------------tt---t-
B D          White rhinoceros  agactcaaa------------------ttatag--------a-----gt--------------tt---t-
B D                       Cat  agattcaaa------------------ttatag--------a-----ga--------------tt---t-
B D                       Dog  tgattcaaa------------------ttatag--------a-----ga---------------t---t-
B D                   Ferret   agatgcaaa------------------ttatag--------a-----ga---------------t---t-
B D                     Panda  aaacgcaaa------------------ttatgg--------a-----ga---------------t---t-
               Pacific walrus  agatgtaaa------------------ttatag--------a-----ga---------------t---t-
                 Weddell seal  agatgtaaa------------------ttatag--------a-----ga---------------t---t-
             Black flying-fox  agactcaaa------------------ttatgg--------a-----ga--------------tt---t-
B D                   Megabat  agactcaaa------------------ttatag--------a-----ga--------------tt---t-
                Big brown bat  agactcaaa------------------ttgtgg--------a-----ga--------------tt---t-
         David's myotis (bat)  agactcaaa------------------ttatgg--------a-----ga--------------tt---t-
B D                  Microbat  agactcaaa------------------ctatgg--------a-----ga--------------tt---t-
B D                  Hedgehog  atgttcaat------------------tagtag--------a-----aa--------------ct---t-
B D                     Shrew  aggctcaaa------------------ttacagatgaaaaaa-----ta--------------tt---ta
              Star-nosed mole  agggttgga------------------ttacagagg-----g-----ta--------------tt---t-
B D                  Elephant  atactcaaa------------------ttgtag--------a-----gt---------ttttctt---t-
          Cape elephant shrew  aga-ttaaa------------------ttata---------a-----ga---------tggtcat---t-
B D                   Manatee  agactcaaa------------------ttgtag--------a-----gttttgttttgttttttt---t-
             Cape golden mole  agactcaaa------------------ttacag--------a-----aa--------------at---t-
B D                    Tenrec  tgattcaaa------------------tgatga--------c-----tt--------------tt---t-
                     Aardvark  agactcaaa------------------ttatgt--------a-----at------------tttt---t-
B D                 Armadillo  agt-tcaaa------------------ttagag--------a-----ag--------gcttttgt---t-
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ----t-------tt
                        Chimp  ----t-------aa
                      Gorilla  ----t-------tt
                    Orangutan  ----t-------tt
                       Gibbon  ----t-------tt
                       Rhesus  ----t-------tt
          Crab-eating macaque  ----t-------tt
                       Baboon  ----t---------
                 Green monkey  ----t--------t
                     Marmoset  ----t-------tt
              Squirrel monkey  ----t-------tt
                     Bushbaby  ----t-------aa
           Chinese tree shrew  ----t-------tt
                     Squirrel  ----g-------tt
       Lesser Egyptian jerboa  ----t-------tt
                 Prairie vole  ----t-------tt
              Chinese hamster  ----t-------tt
               Golden hamster  ----t-------tt
                        Mouse  ----c-------tt
                          Rat  ----c-------tt
               Naked mole-rat  ----t-------tt
                   Guinea pig  ----t-------tt
                   Chinchilla  ----t-------tt
             Brush-tailed rat  ----t-------tt
                       Rabbit  ----t-------tt
                         Pika  ----tatatgtatt
                          Pig  ----t-------t-
                       Alpaca  ----t-------t-
               Bactrian camel  ----t-------t-
                      Dolphin  ----g-------t-
                 Killer whale  ----g-------t-
             Tibetan antelope  ----g-------t-
                          Cow  ----g-------t-
                        Sheep  ----g-------t-
                Domestic goat  ----g-------t-
                        Horse  ----t-------t-
             White rhinoceros  ----t-------t-
                          Cat  ----t-------t-
                          Dog  ----g-------t-
                      Ferret   ----g-------t-
                        Panda  ----g-------t-
               Pacific walrus  ----g-------t-
                 Weddell seal  ----g-------t-
             Black flying-fox  ----t-------t-
                      Megabat  ----t-------a-
                Big brown bat  ----t-------t-
         David's myotis (bat)  ----t-------t-
                     Microbat  ----t-------t-
                     Hedgehog  --------------
                        Shrew  cagt----------
              Star-nosed mole  --------------
                     Elephant  ----t---------
          Cape elephant shrew  ----t---------
                      Manatee  ----t---------
             Cape golden mole  ----t---------
                       Tenrec  ----t---------
                     Aardvark  ----g---------
                    Armadillo  ----t---------
                 Mallard duck  ==============
           Tibetan ground jay  ==============
                  Zebra finch  ==============
       White-throated sparrow  ==============
          Medium ground finch  ==============
           American alligator  ==============
                       Turkey  ==============
                      Chicken  ==============
             Peregrine falcon  ==============
                 Saker falcon  ==============
                  Rock pigeon  ==============
                   Budgerigar  ==============
          Collared flycatcher  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
                      Opossum  ==============
              Tasmanian devil  ==============
              Green seaturtle  ==============

Inserts between block 21 and 22 in window
B D                      Pig 502bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp

Alignment block 22 of 44 in window, 88795190 - 88795206, 17 bps 
B D                     Human  aaaa-----gttta--c-a-acgaaa
B D                     Chimp  aaaa-----gttta--c-a-acaaaa
B D                   Gorilla  aaaa-----gttta--c-a-acgaaa
B D                 Orangutan  agaa-----gttta--c-a-atgaaa
B D                    Gibbon  aaaa-----gttta--c-a-atgaaa
B D                    Rhesus  taaa-----gttta--c-a-atgaaa
B D       Crab-eating macaque  taaa-----gttta--c-a-atgaaa
B D                    Baboon  ---a-----attta--c-a-atgaaa
B D              Green monkey  taaa-----gttta--c-a-atgaaa
B D                  Marmoset  aaaa-----gttta--c-a-atgaaa
B D           Squirrel monkey  taaa-----gctta--c-a-atgaaa
B D                  Bushbaby  aaaa-----tttta--c-a-gtaaaa
           Chinese tree shrew  aaaa-----attta--t-a-atgaaa
B D                  Squirrel  ttaa-----gtttg--c-a-atgaaa
       Lesser Egyptian jerboa  ttaa-----gttt---t-a-atgaaa
                 Prairie vole  ctga-----gttca--c-a-gtggaa
B D           Chinese hamster  ctga-----gttca--c-a-gcaaaa
               Golden hamster  ctga-----gttca--c-a-gtgaaa
B D                     Mouse  ctga-----gttca--c-a-aggaaa
B D                       Rat  ctga-----ggtca--c-g-aggaaa
B D            Naked mole-rat  ttag-----gttta--c-a-atgaaa
B D                Guinea pig  taac-----attta--caa-gtgaaa
                   Chinchilla  ttag-----gttta--c-a-atgaaa
             Brush-tailed rat  ttag-----gttta--c-a-gtggaa
B D                    Rabbit  tcaa-----gttta--c-a-atgaca
B D                      Pika  aaaa-----tttta--c-a-ttaaag
B D                    Alpaca  ttaa-----gttga--c-a-ataaag
               Bactrian camel  ttaa-----gttga--c-a-acaaag
B D                   Dolphin  taaa-----gttta--c-a-atgaaa
                 Killer whale  taaa-----gttta--c-a-atgaaa
             Tibetan antelope  taaa-----attta--c-a-atgaga
B D                       Cow  taaa-----attta--c-a-atgaga
B D                     Sheep  taaa-----attta--c-a-atgaga
                Domestic goat  taaa-----attta--c-a-atgaga
B D                     Horse  ttaa-----gttta--c-a-cggaaa
B D          White rhinoceros  ttag-----gttta--c-a-aggaaa
B D                       Cat  ttaa-----gttta--t-a-atgaaa
B D                       Dog  aaaa-----gttta--c-a-acaaaa
B D                   Ferret   aaaa-----gttta--c-a-atgaaa
B D                     Panda  aaaa-----gttta--c-c-atgaaa
               Pacific walrus  aaaa-----gttta--c-g-gtgaaa
                 Weddell seal  aaaa-----gttta--c-a-gtgaaa
             Black flying-fox  aaaa-----gttta--c-a-actaaa
B D                   Megabat  aaaa-----gttta--c-a-actaaa
                Big brown bat  aaaa-----gttta--c-a-gttaaa
         David's myotis (bat)  aaaa-----gttta--c-a-gttaca
B D                  Microbat  aaaa-----gttta--c-a-gttaaa
B D                  Hedgehog  -----------------------aaa
B D                     Shrew  -gaa-----ataat--t-a-caatac
              Star-nosed mole  ----------tttt--t-a-agttaa
B D                  Elephant  ttaa-----gtttt--c-a-aggaca
          Cape elephant shrew  taaa-----gtgtttac-a-agaaaa
B D                   Manatee  taaa-----gctta--c-a-aggaaa
             Cape golden mole  taaaaaaagatttt--c-a-aggaaa
B D                    Tenrec  ttca-----atttt--a-ataagaaa
                     Aardvark  ttaa-----gttta--c-a-aggaaa
B D                 Armadillo  gttt-----gctta--c-a-atgaag
  D              Mallard duck  ==========================
          Tibetan ground jay  ==========================
B D               Zebra finch  ==========================
  D    White-throated sparrow  ==========================
B D       Medium ground finch  ==========================
B D        American alligator  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
  D               Rock pigeon  ==========================
B D                Budgerigar  ==========================
  D       Collared flycatcher  ==========================
  D  Chinese softshell turtle  ==========================
  D            Painted turtle  ==========================
B D                   Opossum  ==========================
B D           Tasmanian devil  ==========================
  D           Green seaturtle  ==========================
B D                       Pig  ==========================

Inserts between block 22 and 23 in window
B D                 Elephant 68bp
         Cape elephant shrew 934bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 23 of 44 in window, 88795207 - 88795213, 7 bps 
B D                     Human  gagttaa--
B D                     Chimp  gagttaa--
B D                   Gorilla  gagttaa--
B D                 Orangutan  gagttaa--
B D                    Gibbon  gagctaa--
B D                    Rhesus  gagctaa--
B D       Crab-eating macaque  gagctaa--
B D                    Baboon  gagctaa--
B D              Green monkey  gagctaa--
B D                  Marmoset  gagctta--
B D           Squirrel monkey  gagctta--
B D                  Bushbaby  tagt--a--
           Chinese tree shrew  taactaa--
B D                  Squirrel  tagctat--
       Lesser Egyptian jerboa  ttgataa--
                 Prairie vole  taactct--
B D           Chinese hamster  taactat--
               Golden hamster  taactat--
B D                     Mouse  taactat--
B D                       Rat  taactac--
B D            Naked mole-rat  ttactaa--
B D                Guinea pig  ttactaa--
                   Chinchilla  ttactaa--
             Brush-tailed rat  ctaataa--
B D                    Rabbit  caactaa--
B D                      Pika  ccactca--
B D                    Alpaca  taactaa--
               Bactrian camel  taactaa--
B D                   Dolphin  taactaa--
                 Killer whale  taactaa--
             Tibetan antelope  taactag--
B D                       Cow  taactaa--
B D                     Sheep  taactag--
                Domestic goat  taactag--
B D                     Horse  taactaa--
B D          White rhinoceros  taactaa--
B D                       Cat  taactaa--
B D                       Dog  ----taa--
B D                   Ferret   ----caa--
B D                     Panda  ----taa--
               Pacific walrus  ----taa--
                 Weddell seal  ----taa--
             Black flying-fox  taactaa--
B D                   Megabat  taactat--
                Big brown bat  taactaa--
         David's myotis (bat)  taactaa--
B D                  Microbat  taactaa--
B D                  Hedgehog  aaactac--
B D                     Shrew  aaactga--
              Star-nosed mole  aaaatga--
B D                  Elephant  --agagaaa
B D                   Manatee  --tataata
             Cape golden mole  --catagca
B D                    Tenrec  --taggaca
                     Aardvark  --tgtaata
B D                 Armadillo  --actaatg
         Cape elephant shrew  =========
  D              Mallard duck  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
  D    White-throated sparrow  =========
B D       Medium ground finch  =========
B D        American alligator  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D                Budgerigar  =========
  D       Collared flycatcher  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========
B D                   Opossum  =========
B D           Tasmanian devil  =========
  D           Green seaturtle  =========
B D                       Pig  =========

Inserts between block 23 and 24 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
               Big brown bat 2bp
        David's myotis (bat) 144bp
B D                 Microbat 180bp
B D                 Hedgehog 8bp
B D                    Shrew 20bp
             Star-nosed mole 7bp

Alignment block 24 of 44 in window, 88795214 - 88795222, 9 bps 
B D                     Human  ataa----ta----tcc
B D                     Chimp  atca----ta----tcc
B D                   Gorilla  atca----ta----tcc
B D                 Orangutan  atca----ca----tcc
B D                    Gibbon  atca----ta----tcc
B D                    Rhesus  atca----ta----tcc
B D       Crab-eating macaque  atca----ta----tcc
B D                    Baboon  atca----ta----tcc
B D              Green monkey  atca----ta----tcc
B D                  Marmoset  atca----ca----tcc
B D           Squirrel monkey  atca----ta----tcc
B D                  Bushbaby  agca----ta-----cc
           Chinese tree shrew  --ta----ag----ttc
B D                  Squirrel  --ta----tatatccta
       Lesser Egyptian jerboa  --ta----at----tta
                 Prairie vole  --ta----cg-----tt
B D           Chinese hamster  --ca----tg----ctc
               Golden hamster  --ca----tg----ctc
B D                     Mouse  --ca----tg----ctt
B D                       Rat  --ca----tg----ctt
B D            Naked mole-rat  --ca----ta----tcc
B D                Guinea pig  --ca----ta----tcc
                   Chinchilla  --ca----ta----tcc
             Brush-tailed rat  --ca----ta----tcc
B D                    Rabbit  --cagtcgta----tcc
B D                      Pika  --taagctta----tcc
B D                    Alpaca  ----c----a----tct
               Bactrian camel  ----c----a----tct
B D                   Dolphin  ----ctcaca----tcc
                 Killer whale  ----ctcaca----tcc
             Tibetan antelope  ----ctcata----tca
B D                       Cow  ----ctcata----tcc
B D                     Sheep  ----ctcata----tca
                Domestic goat  ----ctcata----tca
B D                     Horse  --------ca----ctc
B D          White rhinoceros  --------ca----ctc
B D                       Cat  --------ca----ttc
B D                       Dog  --------ca----ttc
B D                   Ferret   --------ca----ttc
B D                     Panda  --------ca----ttc
               Pacific walrus  --------ca----ttc
                 Weddell seal  --------ca----ttt
             Black flying-fox  --------ca----cac
B D                   Megabat  --------ca----cac
                Big brown bat  --------ct----tgc
         David's myotis (bat)  ------atca----tac
B D                  Hedgehog  ----aacaca----tct
B D                     Shrew  ----aaggtg----ttc
              Star-nosed mole  ----aataca----tac
B D                  Elephant  att--------------
B D                   Manatee  atta----ca----tcc
             Cape golden mole  atca----ca----tcc
B D                    Tenrec  atca----tg----tct
                     Aardvark  atca----aa----tcc
B D                 Armadillo  atca----ca----tcc
         Cape elephant shrew  =================
B D                  Microbat  =================
  D              Mallard duck  =================
          Tibetan ground jay  =================
B D               Zebra finch  =================
  D    White-throated sparrow  =================
B D       Medium ground finch  =================
B D        American alligator  =================
B D                    Turkey  =================
B D                   Chicken  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
  D               Rock pigeon  =================
B D                Budgerigar  =================
  D       Collared flycatcher  =================
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
B D                   Opossum  =================
B D           Tasmanian devil  =================
  D           Green seaturtle  =================
B D                       Pig  =================

Inserts between block 24 and 25 in window
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                      Dog 21bp
B D                  Ferret  6bp
B D                    Panda 6bp
              Pacific walrus 6bp
                Weddell seal 6bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
        David's myotis (bat) 27bp
B D                 Elephant 8bp

Alignment block 25 of 44 in window, 88795223 - 88795226, 4 bps 
B D                     Human  tag-g
B D                     Chimp  tag-g
B D                   Gorilla  tag-g
B D                 Orangutan  tag-g
B D                    Gibbon  tag-g
B D                    Rhesus  tag-g
B D       Crab-eating macaque  tag-g
B D                    Baboon  tag-g
B D              Green monkey  tag-g
B D                  Marmoset  tag-a
B D           Squirrel monkey  tag-g
B D                  Bushbaby  tag-g
           Chinese tree shrew  taa-t
B D                  Squirrel  aga-a
       Lesser Egyptian jerboa  gag-g
                 Prairie vole  tag-t
B D           Chinese hamster  tag-g
               Golden hamster  tag-g
B D                     Mouse  tag-t
B D                       Rat  tag-t
B D            Naked mole-rat  tgg-g
B D                Guinea pig  tagta
                   Chinchilla  tag-g
             Brush-tailed rat  tag-g
B D                    Rabbit  cag-g
B D                      Pika  tag-g
B D                    Alpaca  tag-g
               Bactrian camel  tag-g
B D                   Dolphin  tag-g
                 Killer whale  tag-g
             Tibetan antelope  cac-g
B D                       Cow  tag-g
B D                     Sheep  cag-g
                Domestic goat  cag-g
B D                     Horse  tag-g
B D          White rhinoceros  tag-g
B D                       Cat  tag-g
B D                       Dog  gaa-g
B D                   Ferret   tag-g
B D                     Panda  tag-g
               Pacific walrus  tag-g
                 Weddell seal  tag-g
             Black flying-fox  tag-g
B D                   Megabat  tag-g
                Big brown bat  taa-g
         David's myotis (bat)  tag-g
B D                  Microbat  tag-g
B D                  Hedgehog  tag-g
B D                     Shrew  agg-a
              Star-nosed mole  tag-a
B D                   Manatee  tgg-c
             Cape golden mole  tgg-g
B D                    Tenrec  tag-g
                     Aardvark  tgt-t
B D                 Armadillo  aag-g
         Cape elephant shrew  =====
B D                  Elephant  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D       Medium ground finch  =====
B D        American alligator  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D                Budgerigar  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
B D                   Opossum  =====
B D           Tasmanian devil  =====
  D           Green seaturtle  =====
B D                       Pig  =====

Inserts between block 25 and 26 in window
              Bactrian camel 1bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                  Manatee 46bp
            Cape golden mole 2153bp
B D                   Tenrec 45bp
                    Aardvark 11bp

Alignment block 26 of 44 in window, 88795227 - 88795232, 6 bps 
B D                     Human  aaa--aaa
B D                     Chimp  aaa--aaa
B D                   Gorilla  aaa--aaa
B D                 Orangutan  aaa--aaa
B D                    Gibbon  aaa--aaa
B D                    Rhesus  aaa--aaa
B D       Crab-eating macaque  aaa--aaa
B D                    Baboon  aaa--aaa
B D              Green monkey  aaa--aaa
B D                  Marmoset  -aa--aaa
B D           Squirrel monkey  -aa--aca
B D                  Bushbaby  aaa--aat
           Chinese tree shrew  cta--ata
B D                  Squirrel  -ga--aaa
       Lesser Egyptian jerboa  -ga--aaa
                 Prairie vole  -aa--cag
B D           Chinese hamster  -aa--aag
               Golden hamster  -aa--aag
B D                     Mouse  -aa--aag
B D                       Rat  -aa--aag
B D            Naked mole-rat  -aa--aaa
B D                Guinea pig  -aa--aaa
                   Chinchilla  -aa--aaa
             Brush-tailed rat  -aa--aaa
B D                    Rabbit  -aaagaaa
B D                      Pika  -aaggaaa
B D                    Alpaca  aaa--aaa
               Bactrian camel  aaa--aaa
B D                   Dolphin  aaa--aaa
                 Killer whale  aaa--aaa
             Tibetan antelope  aag--aaa
B D                       Cow  aag--aaa
B D                     Sheep  aag--gaa
                Domestic goat  aag--aaa
B D                     Horse  gaa--aaa
B D          White rhinoceros  aaa--aaa
B D                       Cat  gaa--aaa
B D                       Dog  aaa--gaa
B D                   Ferret   aaa--aaa
B D                     Panda  aaa--aaa
               Pacific walrus  aaa--gaa
                 Weddell seal  aaa--gaa
             Black flying-fox  aaa--aac
B D                   Megabat  aga--aac
                Big brown bat  aaa--aac
         David's myotis (bat)  aaa--aaa
B D                  Microbat  aaa--aaa
B D                  Hedgehog  aaa--aaa
B D                     Shrew  aag--aga
              Star-nosed mole  aaa--aaa
B D                  Elephant  agt--aaa
B D                   Manatee  aaa--gaa
B D                    Tenrec  aga--gaa
                     Aardvark  -ag--gaa
B D                 Armadillo  gaa--aaa
         Cape elephant shrew  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D       Medium ground finch  ========
B D        American alligator  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D                Budgerigar  ========
  D       Collared flycatcher  ========
            Cape golden mole  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
B D                   Opossum  ========
B D           Tasmanian devil  ========
  D           Green seaturtle  ========
B D                       Pig  ========

Inserts between block 26 and 27 in window
               Big brown bat 1bp
B D                 Hedgehog 2bp
B D                Armadillo 140bp

Alignment block 27 of 44 in window, 88795233 - 88795233, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  a
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  a
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  t
B D                   Manatee  t
B D                    Tenrec  t
                     Aardvark  c
B D                 Armadillo  c
         Cape elephant shrew  =
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D        American alligator  =
B D                    Turkey  =
B D                   Chicken  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                Budgerigar  =
  D       Collared flycatcher  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Opossum  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
B D                       Pig  =

Inserts between block 27 and 28 in window
B D                 Elephant 93bp
B D                  Manatee 187bp
B D                   Tenrec 6bp
                    Aardvark 1bp

Alignment block 28 of 44 in window, 88795234 - 88795234, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  g
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  t
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  t
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  c
B D                       Dog  a
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
B D                   Manatee  t
B D                    Tenrec  g
                     Aardvark  t
B D                 Armadillo  t
         Cape elephant shrew  =
        David's myotis (bat)  -
               Big brown bat  =
B D                  Microbat  -
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D        American alligator  =
B D                    Turkey  =
B D                   Chicken  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                Budgerigar  =
  D       Collared flycatcher  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Opossum  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
B D                       Pig  =

Inserts between block 28 and 29 in window
B D                      Cat 63bp
B D                      Dog 20bp
B D                  Ferret  59bp
B D                    Panda 230bp
              Pacific walrus 60bp
                Weddell seal 60bp
            Black flying-fox 54bp
B D                  Megabat 54bp

Alignment block 29 of 44 in window, 88795235 - 88795236, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  ct
           Chinese tree shrew  ct
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
                 Prairie vole  ct
B D           Chinese hamster  ct
               Golden hamster  ct
B D                     Mouse  ct
B D                       Rat  ct
B D            Naked mole-rat  ct
B D                Guinea pig  ct
                   Chinchilla  ct
             Brush-tailed rat  ct
B D                    Rabbit  ct
B D                      Pika  tt
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ct
B D                       Cow  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  ct
B D          White rhinoceros  ct
B D                       Cat  tt
B D                       Dog  ct
B D                   Ferret   tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  ct
B D                   Megabat  ct
                Big brown bat  ct
B D                  Hedgehog  ca
B D                     Shrew  tt
              Star-nosed mole  ct
B D                  Elephant  at
B D                   Manatee  at
B D                    Tenrec  at
                     Aardvark  ct
B D                 Armadillo  at
         Cape elephant shrew  ==
B D                     Panda  ==
        David's myotis (bat)  --
B D                  Microbat  --
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
B D        American alligator  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                Budgerigar  ==
  D       Collared flycatcher  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
  D           Green seaturtle  ==
B D                       Pig  ==

Inserts between block 29 and 30 in window
B D                    Horse 234bp
B D         White rhinoceros 43bp

Alignment block 30 of 44 in window, 88795237 - 88795238, 2 bps 
B D                     Human  gt-
B D                     Chimp  gt-
B D                   Gorilla  gt-
B D                 Orangutan  gt-
B D                    Gibbon  gt-
B D                    Rhesus  gt-
B D       Crab-eating macaque  gt-
B D                    Baboon  gt-
B D              Green monkey  gt-
B D                  Marmoset  gt-
B D           Squirrel monkey  gt-
B D                  Bushbaby  tc-
           Chinese tree shrew  ct-
B D                  Squirrel  gc-
       Lesser Egyptian jerboa  ta-
                 Prairie vole  cg-
B D           Chinese hamster  ct-
               Golden hamster  cc-
B D                     Mouse  ct-
B D                       Rat  ct-
B D            Naked mole-rat  tc-
B D                Guinea pig  tc-
                   Chinchilla  tc-
             Brush-tailed rat  tc-
B D                    Rabbit  cc-
B D                      Pika  ac-
B D                    Alpaca  -c-
               Bactrian camel  -c-
B D                   Dolphin  -t-
                 Killer whale  -t-
             Tibetan antelope  -c-
B D                       Cow  -c-
B D                     Sheep  -c-
                Domestic goat  -c-
B D                     Horse  gt-
B D          White rhinoceros  gt-
B D                       Cat  gt-
B D                       Dog  gt-
B D                   Ferret   gt-
               Pacific walrus  gt-
                 Weddell seal  gt-
             Black flying-fox  gt-
B D                   Megabat  gt-
                Big brown bat  gc-
         David's myotis (bat)  gt-
B D                  Microbat  gc-
B D                  Hedgehog  at-
B D                     Shrew  ag-
              Star-nosed mole  at-
B D                  Elephant  -ta
B D                   Manatee  -ta
B D                    Tenrec  -ta
                     Aardvark  -cc
B D                 Armadillo  -gt
         Cape elephant shrew  ===
B D                     Panda  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
B D        American alligator  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                Budgerigar  ===
  D       Collared flycatcher  ===
            Cape golden mole  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
  D           Green seaturtle  ===
B D                       Pig  ===

Inserts between block 30 and 31 in window
B D                   Alpaca 210bp
              Bactrian camel 258bp
B D                  Dolphin 200bp
                Killer whale 201bp
            Tibetan antelope 1bp
B D                      Cow 186bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Cat 146bp
B D                      Dog 176bp
B D                  Ferret  149bp
              Pacific walrus 156bp
                Weddell seal 154bp
            Black flying-fox 159bp
B D                  Megabat 193bp
B D                    Shrew 6bp
             Star-nosed mole 228bp

Alignment block 31 of 44 in window, 88795239 - 88795239, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  t
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  a
         Cape elephant shrew  =
B D                     Panda  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D        American alligator  =
B D                    Turkey  =
B D                   Chicken  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                Budgerigar  =
  D       Collared flycatcher  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Opossum  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
B D                       Pig  =

Inserts between block 31 and 32 in window
               Big brown bat 590bp
        David's myotis (bat) 39bp
B D                 Microbat 4bp

Alignment block 32 of 44 in window, 88795240 - 88795240, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  c
           Chinese tree shrew  a
       Lesser Egyptian jerboa  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
B D                    Rabbit  g
B D                      Pika  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  a
B D                     Shrew  g
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  g
B D                    Tenrec  t
                     Aardvark  a
B D                 Armadillo  t
         Cape elephant shrew  =
B D                     Panda  =
              Golden hamster  -
                Prairie vole  -
B D                       Rat  -
B D                     Mouse  -
B D           Chinese hamster  -
               Big brown bat  =
B D                  Squirrel  -
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D        American alligator  =
B D                    Turkey  =
B D                   Chicken  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                Budgerigar  =
  D       Collared flycatcher  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Opossum  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
            Brush-tailed rat  -
B D                       Pig  =

Inserts between block 32 and 33 in window
            Tibetan antelope 418bp
B D                    Sheep 424bp
               Domestic goat 417bp

Alignment block 33 of 44 in window, 88795241 - 88795242, 2 bps 
B D                     Human  at
B D                     Chimp  at
B D                   Gorilla  at
B D                 Orangutan  at
B D                    Gibbon  at
B D                    Rhesus  at
B D       Crab-eating macaque  at
B D                    Baboon  at
B D              Green monkey  at
B D                  Marmoset  at
B D           Squirrel monkey  at
B D                  Bushbaby  ag
           Chinese tree shrew  at
B D            Naked mole-rat  at
B D                Guinea pig  at
                   Chinchilla  at
B D                    Rabbit  at
B D                      Pika  at
B D                    Alpaca  gt
               Bactrian camel  gt
B D                   Dolphin  at
                 Killer whale  at
B D                       Cow  at
B D                     Horse  aa
B D          White rhinoceros  gt
B D                       Cat  at
B D                       Dog  at
B D                   Ferret   at
               Pacific walrus  at
                 Weddell seal  at
             Black flying-fox  at
B D                   Megabat  at
         David's myotis (bat)  at
B D                  Microbat  at
B D                  Hedgehog  at
B D                     Shrew  tt
              Star-nosed mole  at
B D                  Elephant  at
B D                   Manatee  at
B D                    Tenrec  aa
                     Aardvark  ag
B D                 Armadillo  at
         Cape elephant shrew  ==
B D                     Panda  ==
              Golden hamster  --
                Prairie vole  --
B D                       Rat  --
B D                     Mouse  --
B D           Chinese hamster  --
      Lesser Egyptian jerboa  --
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
               Big brown bat  ==
B D                  Squirrel  --
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
B D        American alligator  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                Budgerigar  ==
  D       Collared flycatcher  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
  D           Green seaturtle  ==
            Brush-tailed rat  --
B D                       Pig  ==

Inserts between block 33 and 34 in window
B D                    Horse 10bp
B D         White rhinoceros 187bp

Alignment block 34 of 44 in window, 88795243 - 88795243, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  a
B D            Naked mole-rat  t
B D                Guinea pig  a
                   Chinchilla  g
B D                    Rabbit  g
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                       Cow  g
B D                       Cat  t
B D                       Dog  g
B D                   Ferret   g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  t
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  a
B D                   Manatee  g
B D                    Tenrec  a
                     Aardvark  g
B D                 Armadillo  g
         Cape elephant shrew  =
B D          White rhinoceros  =
B D                     Panda  =
              Golden hamster  -
                Prairie vole  -
B D                       Rat  -
B D                     Mouse  -
B D           Chinese hamster  -
      Lesser Egyptian jerboa  -
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =