Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1111 in window, 149102786 - 149102788, 3 bps 
B D                     Human  tta--
B D                     Chimp  tta--
B D                 Orangutan  tta--
B D                    Gibbon  tta--
B D                    Rhesus  tta--
B D       Crab-eating macaque  tta--
B D                    Baboon  tta--
B D              Green monkey  tta--
B D                  Marmoset  tta--
B D           Squirrel monkey  tta--
B D                  Bushbaby  tta--
B D            Naked mole-rat  ttg--
B D                    Rabbit  tta--
B D                    Alpaca  tta--
               Bactrian camel  tta--
B D                     Horse  tta--
B D          White rhinoceros  tta--
B D                       Cat  tta--
B D                       Dog  tta--
B D                   Ferret   tta--
B D                     Panda  tta--
               Pacific walrus  tta--
                 Weddell seal  tta--
                Big brown bat  tta--
B D                  Microbat  tta--
              Star-nosed mole  tta--
B D                 Armadillo  tta--
B D           Tasmanian devil  cta--
  D       Collared flycatcher  cta--
B D        American alligator  tta--
  D  Chinese softshell turtle  caa--
B D                    Lizard  taa--
        Burton's mouthbreeder  ----a
B D               Stickleback  ttgga
              Golden hamster  =====
                Prairie vole  -----
B D                       Rat  -----
B D                     Mouse  =====
B D           Chinese hamster  =====
      Lesser Egyptian jerboa  =====
               Domestic goat  -----
B D                       Cow  -----
B D                     Sheep  =====
            Tibetan antelope  =====
        David's myotis (bat)  =====
                Killer whale  =====
                 Zebra mbuna  =====
         Pundamilia nyererei  =====
B D              Nile tilapia  =====
          Southern platyfish  =====
         Princess of Burundi  =====
B D              Atlantic cod  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  -----
B D                    Medaka  =====
B D                 Tetraodon  -----
                 Spotted gar  =====
B D                   Lamprey  =====
B D                 Zebrafish  =====
B D                  Squirrel  -----
            Black flying-fox  -----
B D                   Manatee  -----
B D                  Elephant  -----
  D              Mallard duck  -----
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D       Medium ground finch  =====
B D                   Chicken  =====
  D             Scarlet macaw  -----
  D                    Parrot  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  -----
B D                Budgerigar  =====
B D                  Platypus  =====
            Cape golden mole  -----
  D    Spiny softshell turtle  =====
  D            Painted turtle  =====
                    Aardvark  =====
B D                   Wallaby  -----
B D                   Opossum  =====
B D                Coelacanth  =====
  D           Green seaturtle  =====
            Brush-tailed rat  =====
          Chinese tree shrew  -----
                  Chinchilla  =====
B D                       Pig  =====
B D             X. tropicalis  =====
    Mexican tetra (cavefish)  =====
B D                   Dolphin  =====
B D                Guinea pig  -----
B D                   Gorilla  -----

Inserts between block 1 and 2 in window
  D      Collared flycatcher 3bp
  D Chinese softshell turtle 2bp

Alignment block 2 of 1111 in window, 149102789 - 149102831, 43 bps 
B D                     Human  acaaatg--agatagtgg---------aa---gac---attta-t-tttt-----a-g-----caa-tat
B D                     Chimp  acaaagg--agatagtgg---------aa---gac---attta-t-tttt-----a-g-----caa-tat
B D                 Orangutan  acaaatg--agatagtggt--------aa---gaca--atttc-t-tttt-----agg-----caattat
B D                    Gibbon  acaagtg--agatagtgg---------aa---gac---attta-t-gttt-----a-g-----caa-tat
B D                    Rhesus  acaaacg--agatagtgg---------aa---gac---attta-t-tttt-----a-g-----cat-tat
B D       Crab-eating macaque  acaaacg--agatagtgg---------aa---gac---attta-t-tttt-----a-g-----cat-tat
B D                    Baboon  acaaaca--agatagtgg---------aa---gac---attta-t-tttt-----a-g-----cat-tat
B D              Green monkey  acaaacg--agatagtgg---------aa---gac---attta-t-tttt-----a-g-----cat-tat
B D                  Marmoset  acaaacg--agattgtgg---------aa---gac---attta-t-tttt-----a-g-----caa-tat
B D           Squirrel monkey  acaaacg--agattgtgg---------aa---gac---attta-t-tttt-----a-g-----caa-tat
B D                  Bushbaby  acaagtg--agat-gtga---------aacacaac---atttagt-tttt-----a-a-----cta-tag
B D            Naked mole-rat  ataaatg--agatg------------------aac---attta-t-tttt-----a-g-----tta-tac
B D                    Rabbit  acaaatg--ggttgatga---------ac---aac---attta-t-tttc-----a-g-----caa-cac
B D                    Alpaca  ataaatg--aggtggtag---------at---gac---attta-t-tttt-----a-a-----tag-tgt
               Bactrian camel  ataaata--aggtggtag---------at---gacaatattta-t-tttt-----a-a-----tag-tgc
B D                     Horse  ccaaata--agatggcag---------ac---gac---attta-t-tttt-----t-g-----caa-tat
B D          White rhinoceros  acaaatg--agatggcag---------at---gac---attta-t-tttt-----c-g-----caa-tat
B D                       Cat  acaaagg--agatggtag---------ac---aac---actta-t-tttt-----g-g-----taa-tat
B D                       Dog  acaaaag--agatgggag---------ac---aac---gttta-t-tttt-----g-g-----caa-cag
B D                   Ferret   acgaagg--agatgggag---------at---gac---attta-t-tttt-----g-g-----caa-tag
B D                     Panda  acaaagg--agatggtag---------at---gac---attta-t-tttt-----g-g-----caa-cag
               Pacific walrus  acaaagg--agatggtag---------at---gac---attta-t-tttt-----g-g-----caa-tag
                 Weddell seal  acaaagg--agatggtag---------at---gac---gttta-t-tttt-----g-g-----caa-tag
                Big brown bat  acaaatg--agacagtaa---------at---tac---attta-t-tttg-----a-g-----caa-tac
B D                  Microbat  acaaatg--agacagtaa---------at---tac---attta-t-tttg-----a-g-----caa-tat
              Star-nosed mole  acaaaag--aggaaacag--------------------attta-tacttt-----t-g-----cag-gat
B D                 Armadillo  acaaatg--agatggtt----------ac---aac---attta-c-tttt-----a-g-----caa-tat
B D           Tasmanian devil  aaatcta--agatg-------------at---gtc---attac-t-tttttaaaaa-a-----taa-caa
  D       Collared flycatcher  gctatca--ttctagtt----------at---gat---tttca-t-aggt-----a-a-----caa-tat
           Tibetan ground jay  acccatg--ttttagttc---------aa---tgt---cttta-t-tttt-----a-c-----cca-aat
B D        American alligator  -ccaaaggagactag------------aa---gag---cttgg-c-tttt-----a-aagcagcaa-aa-
  D  Chinese softshell turtle  actatta--tgaaactgt---------aa---gaa---ctggg-g-acag-----a-t-----aaa-agt
B D                    Lizard  --taaga--taagactgtccaactctgaa---tac---cttta-t-actc-----a-a-----gta-ta-
        Burton's mouthbreeder  ttaaacc--agattgatc---------aa---agc---ctcaa-t-ttca-----a-a-----caa-tat
B D               Stickleback  ttaaaaa--aa------c---------aa---tac---atcca-t-ccga-----c-a-----caa-tgt
              Golden hamster  ======================================================================
                Prairie vole  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ----------------------------------------------------------------------
B D                    Medaka  ======================================================================
B D                 Tetraodon  ----------------------------------------------------------------------
                 Spotted gar  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Zebrafish  ======================================================================
B D                  Squirrel  ----------------------------------------------------------------------
            Black flying-fox  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
B D                  Platypus  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ----------------------------------------------------------------------
B D                   Opossum  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Dolphin  ======================================================================
B D                Guinea pig  ----------------------------------------------------------------------
B D                   Gorilla  ----------------------------------------------------------------------

                        Human  -g--------------gaa
                        Chimp  -g--------------gaa
                    Orangutan  gg--------------gaa
                       Gibbon  -g--------------gaa
                       Rhesus  -g--------------gaa
          Crab-eating macaque  -g--------------gaa
                       Baboon  -g--------------gaa
                 Green monkey  -g--------------gaa
                     Marmoset  -g--------------gaa
              Squirrel monkey  -g--------------gaa
                     Bushbaby  -a--------------cag
               Naked mole-rat  -a--------------gag
                       Rabbit  -a--------------gag
                       Alpaca  -a--------------gag
               Bactrian camel  -a--------------gag
                        Horse  -g--------------gag
             White rhinoceros  -a--------------gag
                          Cat  -a--------------gag
                          Dog  -a--------------gag
                      Ferret   -a--------------gag
                        Panda  -a--------------gag
               Pacific walrus  -a--------------gag
                 Weddell seal  -a--------------gag
                Big brown bat  -a--------------gag
                     Microbat  -a--------------gaa
              Star-nosed mole  -g--------------gag
                    Armadillo  -a--------------cag
              Tasmanian devil  -a--------------tag
          Collared flycatcher  -g--------------gaa
           Tibetan ground jay  -g-------------ttgg
           American alligator  ----------------gga
     Chinese softshell turtle  -agatttctccccagtaga
                       Lizard  ----------------agc
        Burton's mouthbreeder  -c--------------gca
                  Stickleback  -t--------------ggg
               Golden hamster  ===================
                 Prairie vole  -------------------
                          Rat  -------------------
                        Mouse  ===================
              Chinese hamster  ===================
       Lesser Egyptian jerboa  ===================
                Domestic goat  -------------------
                          Cow  -------------------
                        Sheep  ===================
             Tibetan antelope  ===================
         David's myotis (bat)  ===================
                 Killer whale  ===================
                  Zebra mbuna  ===================
          Pundamilia nyererei  ===================
                 Nile tilapia  ===================
           Southern platyfish  ===================
          Princess of Burundi  ===================
                 Atlantic cod  ===================
       Yellowbelly pufferfish  ===================
                         Fugu  -------------------
                       Medaka  ===================
                    Tetraodon  -------------------
                  Spotted gar  ===================
                      Lamprey  ===================
                    Zebrafish  ===================
                     Squirrel  -------------------
             Black flying-fox  -------------------
                      Manatee  -------------------
                     Elephant  -------------------
                 Mallard duck  -------------------
                  Zebra finch  ===================
       White-throated sparrow  ===================
          Medium ground finch  ===================
                      Chicken  ===================
                Scarlet macaw  -------------------
                       Parrot  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
                  Rock pigeon  -------------------
                   Budgerigar  ===================
                     Platypus  ===================
             Cape golden mole  -------------------
       Spiny softshell turtle  ===================
               Painted turtle  ===================
                     Aardvark  ===================
                      Wallaby  -------------------
                      Opossum  ===================
                   Coelacanth  ===================
              Green seaturtle  ===================
             Brush-tailed rat  ===================
           Chinese tree shrew  -------------------
                   Chinchilla  ===================
                          Pig  ===================
                X. tropicalis  ===================
     Mexican tetra (cavefish)  ===================
                      Dolphin  ===================
                   Guinea pig  -------------------
                      Gorilla  -------------------

Inserts between block 2 and 3 in window
B D              Stickleback 13bp

Alignment block 3 of 1111 in window, 149102832 - 149102840, 9 bps 
B D                     Human  aca-tt---ccaa
B D                     Chimp  aca-tt---ccaa
B D                 Orangutan  aca-tt---ccaa
B D                    Gibbon  aca-tt---ccaa
B D                    Rhesus  aca-tt---ccaa
B D       Crab-eating macaque  aca-tt---ccaa
B D                    Baboon  aca-tt---ccaa
B D              Green monkey  aca-tt---ccaa
B D                  Marmoset  a-a-tt---tcaa
B D           Squirrel monkey  a-a-tt---tcaa
B D                  Bushbaby  aaa-ttctgccta
B D            Naked mole-rat  aaacttcccccaa
B D                    Rabbit  aaa-ttcccccaa
B D                    Alpaca  aaa-tttccccca
               Bactrian camel  aaa-ttgccccca
B D                     Horse  aaa-gtcctccaa
B D          White rhinoceros  aaa-gtcctccga
B D                       Cat  aaa-ttcccccgc
B D                       Dog  aaa-ttctcctga
B D                   Ferret   aaa-tcctgccta
B D                     Panda  aaa-ttctcccga
               Pacific walrus  aaa-tcctcccga
                 Weddell seal  aaa-tcctcccga
                Big brown bat  aaa-ttcccacaa
B D                  Microbat  aaa-ctcccacaa
              Star-nosed mole  gaa-gtcctggga
B D                 Armadillo  aaa-ttcccacaa
B D           Tasmanian devil  aac-tttctttca
  D       Collared flycatcher  aca-tt---ccaa
           Tibetan ground jay  ata-tt---ttaa
B D        American alligator  agg-ct---cgga
  D  Chinese softshell turtle  aag-tc---ccca
B D                    Lizard  cga-cc---tgaa
        Burton's mouthbreeder  aca-ttcatt---
              Golden hamster  =============
                Prairie vole  -------------
B D                       Rat  -------------
B D                     Mouse  =============
B D           Chinese hamster  =============
      Lesser Egyptian jerboa  =============
               Domestic goat  -------------
B D                       Cow  -------------
B D                     Sheep  =============
            Tibetan antelope  =============
        David's myotis (bat)  =============
                Killer whale  =============
                 Zebra mbuna  =============
         Pundamilia nyererei  =============
B D              Nile tilapia  =============
          Southern platyfish  =============
         Princess of Burundi  =============
B D              Atlantic cod  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  -------------
B D                    Medaka  =============
B D                 Tetraodon  -------------
                 Spotted gar  =============
B D                   Lamprey  =============
B D                 Zebrafish  =============
B D               Stickleback  =============
B D                  Squirrel  -------------
            Black flying-fox  -------------
B D                   Manatee  -------------
B D                  Elephant  -------------
  D              Mallard duck  -------------
B D               Zebra finch  =============
  D    White-throated sparrow  =============
B D       Medium ground finch  =============
B D                   Chicken  =============
  D             Scarlet macaw  -------------
  D                    Parrot  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D               Rock pigeon  -------------
B D                Budgerigar  =============
B D                  Platypus  =============
            Cape golden mole  -------------
  D    Spiny softshell turtle  =============
  D            Painted turtle  =============
                    Aardvark  =============
B D                   Wallaby  -------------
B D                   Opossum  =============
B D                Coelacanth  =============
  D           Green seaturtle  =============
            Brush-tailed rat  =============
          Chinese tree shrew  -------------
                  Chinchilla  =============
B D                       Pig  =============
B D             X. tropicalis  =============
    Mexican tetra (cavefish)  =============
B D                   Dolphin  =============
B D                Guinea pig  -------------
B D                   Gorilla  -------------

Inserts between block 3 and 4 in window
          Tibetan ground jay 1bp
B D       American alligator 1bp
  D Chinese softshell turtle 4bp
B D                   Lizard 2bp

Alignment block 4 of 1111 in window, 149102841 - 149102853, 13 bps 
B D                     Human  g--aaacagaagc------------cc
B D                     Chimp  g--aaacagaagc------------cc
B D                 Orangutan  ggaaaacagaagc------------cc
B D                    Gibbon  g--aaacagaagc------------cc
B D                    Rhesus  g--aagcagatgc------------cc
B D       Crab-eating macaque  g--aagcagatgc------------cc
B D                    Baboon  g--aagcagatgc------------cc
B D              Green monkey  g--aagcagatgc------------cc
B D                  Marmoset  g--aaacagatgc------------tc
B D           Squirrel monkey  g---aacagatgc------------tg
B D                  Bushbaby  g--gaataggtgt------------tc
B D            Naked mole-rat  g--aaacagatgc------------tg
B D                    Rabbit  g--aaacagatgc------------ta
B D                    Alpaca  a--acacagatgc------------tc
               Bactrian camel  a--acacagatgc------------cc
B D                     Horse  ---acagagatgc------------cc
B D          White rhinoceros  ---acacagatgc------------cc
B D                       Cat  a--acacagatg--------------c
B D                       Dog  g--acacagatgt------------tc
B D                   Ferret   a--acacagatgc------------tc
B D                     Panda  g--acacaggtgc------------tc
               Pacific walrus  g--acacagatgc------------tc
                 Weddell seal  g--acgcagatgc------------tc
                Big brown bat  g--acacagatgt------------cc
B D                  Microbat  g--acacagatgt------------cc
              Star-nosed mole  g--ac-cctataa------------ac
B D                 Armadillo  g--aatcagatac------------cc
B D           Tasmanian devil  g--gaatctgttc------------cc
B D        American alligator  ------aggatgtgattgctgtcta--
        Burton's mouthbreeder  --tggacagcagc------------ag
              Golden hamster  ===========================
                Prairie vole  ---------------------------
B D                       Rat  ---------------------------
B D                     Mouse  ===========================
B D           Chinese hamster  ===========================
      Lesser Egyptian jerboa  ===========================
               Domestic goat  ---------------------------
B D                       Cow  ---------------------------
B D                     Sheep  ===========================
            Tibetan antelope  ===========================
        David's myotis (bat)  ===========================
                Killer whale  ===========================
                 Zebra mbuna  ===========================
         Pundamilia nyererei  ===========================
B D              Nile tilapia  ===========================
          Southern platyfish  ===========================
         Princess of Burundi  ===========================
B D              Atlantic cod  ===========================
B D                    Lizard  ===========================
      Yellowbelly pufferfish  ===========================
B D                      Fugu  ---------------------------
B D                    Medaka  ===========================
B D                 Tetraodon  ---------------------------
                 Spotted gar  ===========================
B D                   Lamprey  ===========================
B D                 Zebrafish  ===========================
B D               Stickleback  ===========================
B D                  Squirrel  ---------------------------
            Black flying-fox  ---------------------------
B D                   Manatee  ---------------------------
B D                  Elephant  ---------------------------
  D              Mallard duck  ---------------------------
          Tibetan ground jay  ===========================
B D               Zebra finch  ===========================
  D    White-throated sparrow  ===========================
B D       Medium ground finch  ===========================
B D                   Chicken  ===========================
  D             Scarlet macaw  ---------------------------
  D                    Parrot  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
  D               Rock pigeon  ---------------------------
B D                Budgerigar  ===========================
B D                  Platypus  ===========================
  D       Collared flycatcher  ===========================
            Cape golden mole  ---------------------------
  D    Spiny softshell turtle  ===========================
  D  Chinese softshell turtle  ===========================
  D            Painted turtle  ===========================
                    Aardvark  ===========================
B D                   Wallaby  ---------------------------
B D                   Opossum  ===========================
B D                Coelacanth  ===========================
  D           Green seaturtle  ===========================
            Brush-tailed rat  ===========================
          Chinese tree shrew  ---------------------------
                  Chinchilla  ===========================
B D                       Pig  ===========================
B D             X. tropicalis  ===========================
    Mexican tetra (cavefish)  ===========================
B D                   Dolphin  ===========================
B D                Guinea pig  ---------------------------
B D                   Gorilla  ---------------------------

Inserts between block 4 and 5 in window
B D                Orangutan 2bp
       Burton's mouthbreeder 10bp

Alignment block 5 of 1111 in window, 149102854 - 149102859, 6 bps 
B D                     Human  tctcac
B D                     Chimp  tctcac
B D                 Orangutan  cttcac
B D                    Gibbon  tctcac
B D                    Rhesus  tctcac
B D       Crab-eating macaque  tctcac
B D                    Baboon  tctcac
B D              Green monkey  tctcac
B D                  Marmoset  tctcac
B D           Squirrel monkey  tctcac
B D                  Bushbaby  tctcac
B D            Naked mole-rat  tctcac
B D                    Rabbit  tctcac
B D                    Alpaca  tccgac
               Bactrian camel  tccgac
B D                     Horse  tctcac
B D          White rhinoceros  tctcac
B D                       Cat  tctcac
B D                       Dog  tctcag
B D                   Ferret   tctcag
B D                     Panda  tctcac
               Pacific walrus  tctcac
                 Weddell seal  tctcac
                Big brown bat  tctcac
B D                  Microbat  tctcac
              Star-nosed mole  tcca--
B D                 Armadillo  aatcac
        Burton's mouthbreeder  ---ttt
B D               Stickleback  ccttgc
              Golden hamster  ======
                Prairie vole  ------
B D                       Rat  ------
B D                     Mouse  ======
B D           Chinese hamster  ======
      Lesser Egyptian jerboa  ======
               Domestic goat  ------
B D                       Cow  ------
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
                Killer whale  ======
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
B D              Nile tilapia  ======
          Southern platyfish  ======
         Princess of Burundi  ======
B D              Atlantic cod  ======
B D                    Lizard  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ------
B D                    Medaka  ======
B D                 Tetraodon  ------
                 Spotted gar  ======
B D                   Lamprey  ======
B D                 Zebrafish  ======
B D                  Squirrel  ------
            Black flying-fox  ------
B D                   Manatee  ------
B D                  Elephant  ------
  D              Mallard duck  ------
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D       Medium ground finch  ======
B D        American alligator  ------
B D                   Chicken  ======
  D             Scarlet macaw  ------
  D                    Parrot  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ------
B D                Budgerigar  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
            Cape golden mole  ------
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
                    Aardvark  ======
B D                   Wallaby  ------
B D                   Opossum  ======
B D           Tasmanian devil  ------
B D                Coelacanth  ======
  D           Green seaturtle  ======
            Brush-tailed rat  ======
          Chinese tree shrew  ------
                  Chinchilla  ======
B D                       Pig  ======
B D             X. tropicalis  ======
    Mexican tetra (cavefish)  ======
B D                   Dolphin  ======
B D                Guinea pig  ------
B D                   Gorilla  ------

Alignment block 6 of 1111 in window, 149102860 - 149102862, 3 bps 
B D                     Human  cat
B D                     Chimp  cat
B D                 Orangutan  cat
B D                    Gibbon  cat
B D                    Rhesus  cat
B D       Crab-eating macaque  cat
B D                    Baboon  cat
B D              Green monkey  cat
B D                  Marmoset  cac
B D           Squirrel monkey  cac
B D                  Bushbaby  cat
B D            Naked mole-rat  cat
B D                    Rabbit  cat
B D                    Alpaca  cac
               Bactrian camel  cac
B D                     Horse  cat
B D          White rhinoceros  cat
B D                       Cat  cat
B D                       Dog  cat
B D                   Ferret   cac
B D                     Panda  cat
               Pacific walrus  cac
                 Weddell seal  cac
B D                   Megabat  cat
                Big brown bat  cat
B D                  Microbat  cat
              Star-nosed mole  caa
B D                 Armadillo  cat
B D           Tasmanian devil  tat
B D        American alligator  tat
        Burton's mouthbreeder  aat
B D               Stickleback  cat
              Golden hamster  ===
                Prairie vole  ---
B D                       Rat  ---
B D                     Mouse  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
               Domestic goat  ---
B D                       Cow  ---
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
                Killer whale  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
B D              Nile tilapia  ===
          Southern platyfish  ===
         Princess of Burundi  ===
B D              Atlantic cod  ===
B D                    Lizard  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ---
B D                    Medaka  ===
B D                 Tetraodon  ---
                 Spotted gar  ===
B D                   Lamprey  ===
B D                 Zebrafish  ===
B D                  Squirrel  ---
            Black flying-fox  ---
B D                   Manatee  ---
B D                  Elephant  ---
  D              Mallard duck  ---
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
B D                   Chicken  ===
  D             Scarlet macaw  ---
  D                    Parrot  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ---
B D                Budgerigar  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
            Cape golden mole  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
                    Aardvark  ===
B D                   Wallaby  ---
B D                   Opossum  ===
B D                Coelacanth  ===
  D           Green seaturtle  ===
            Brush-tailed rat  ===
          Chinese tree shrew  ---
                  Chinchilla  ===
B D                       Pig  ===
B D             X. tropicalis  ===
    Mexican tetra (cavefish)  ===
B D                   Dolphin  ===
B D                Guinea pig  ---
B D                   Gorilla  ---

Inserts between block 6 and 7 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 3bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp

Alignment block 7 of 1111 in window, 149102863 - 149102863, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
B D            Naked mole-rat  t
B D                    Rabbit  t
              Star-nosed mole  t
B D                 Armadillo  t
B D           Tasmanian devil  t
B D        American alligator  c
        Burton's mouthbreeder  t
B D               Stickleback  a
B D          White rhinoceros  =
B D                     Panda  =
              Golden hamster  =
                Prairie vole  -
B D                       Rat  -
B D                     Mouse  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
               Domestic goat  -
B D                       Cow  -
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
               Big brown bat  =
                Killer whale  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  =
B D                    Lizard  =
      Yellowbelly pufferfish  =
B D                      Fugu  -
B D                    Medaka  =
B D                 Tetraodon  -
                 Spotted gar  =
B D                   Lamprey  =
B D                 Zebrafish  =
B D                    Alpaca  =
B D                  Microbat  =
B D                   Ferret   =
B D                     Horse  =
B D                  Squirrel  -
            Black flying-fox  -
B D                       Cat  =
B D                   Manatee  -
B D                  Elephant  -
              Bactrian camel  =
  D              Mallard duck  -
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D                   Chicken  =
  D             Scarlet macaw  -
  D                    Parrot  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  -
B D                Budgerigar  =
B D                  Platypus  =
  D       Collared flycatcher  =
            Cape golden mole  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
                    Aardvark  =
B D                   Wallaby  -
B D                   Opossum  =
B D                Coelacanth  =
  D           Green seaturtle  =
B D                       Dog  =
              Pacific walrus  =
            Brush-tailed rat  =
          Chinese tree shrew  -
                  Chinchilla  =
B D                       Pig  =
B D             X. tropicalis  =
    Mexican tetra (cavefish)  =
                Weddell seal  =
B D                   Dolphin  =
B D                   Megabat  =
B D                Guinea pig  -
B D                   Gorilla  -

Alignment block 8 of 1111 in window, 149102864 - 149102865, 2 bps 
B D                     Human  -tg
B D                     Chimp  -tg
B D                 Orangutan  -tg
B D                    Gibbon  -tg
B D                    Rhesus  -tg
B D       Crab-eating macaque  -tg
B D                    Baboon  -tg
B D              Green monkey  -tg
B D                  Marmoset  -tg
B D           Squirrel monkey  -tg
B D                  Bushbaby  -tg
B D            Naked mole-rat  -tg
B D                    Rabbit  -tg
B D                    Alpaca  -tg
               Bactrian camel  -tg
B D                   Dolphin  -tt
B D                     Horse  -tg
B D          White rhinoceros  -tg
B D                       Cat  -tg
B D                   Ferret   -cg
B D                     Panda  -tg
               Pacific walrus  -tg
                 Weddell seal  -tg
B D                   Megabat  -tt
                Big brown bat  -tg
B D                  Microbat  -tg
              Star-nosed mole  -tg
B D                 Armadillo  -tg
B D        American alligator  -ca
        Burton's mouthbreeder  tt-
B D               Stickleback  tt-
              Golden hamster  ===
                Prairie vole  ---
B D                       Rat  ---
B D                     Mouse  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
               Domestic goat  ---
B D                       Cow  ---
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
                Killer whale  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
B D              Nile tilapia  ===
          Southern platyfish  ===
         Princess of Burundi  ===
B D              Atlantic cod  ===
B D                    Lizard  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ---
B D                    Medaka  ===
B D                 Tetraodon  ---
                 Spotted gar  ===
B D                   Lamprey  ===
B D                 Zebrafish  ===
B D                  Squirrel  ---
            Black flying-fox  ---
B D                   Manatee  ---
B D                  Elephant  ---
  D              Mallard duck  ---
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
B D                   Chicken  ===
  D             Scarlet macaw  ---
  D                    Parrot  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ---
B D                Budgerigar  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
            Cape golden mole  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
                    Aardvark  ===
B D                   Wallaby  ---
B D                   Opossum  ===
B D           Tasmanian devil  ---
B D                Coelacanth  ===
  D           Green seaturtle  ===
B D                       Dog  ===
            Brush-tailed rat  ===
          Chinese tree shrew  ---
                  Chinchilla  ===
B D                       Pig  ===
B D             X. tropicalis  ===
    Mexican tetra (cavefish)  ===
B D                Guinea pig  ---
B D                   Gorilla  ---

Alignment block 9 of 1111 in window, 149102866 - 149102869, 4 bps 
B D                     Human  agag
B D                     Chimp  agag
B D                 Orangutan  agag
B D                    Gibbon  agag
B D                    Rhesus  agag
B D       Crab-eating macaque  agag
B D                    Baboon  agag
B D              Green monkey  acag
B D                  Marmoset  agag
B D           Squirrel monkey  agag
B D                  Bushbaby  agaa
B D            Naked mole-rat  agaa
B D                    Rabbit  agag
B D                    Alpaca  agag
               Bactrian camel  agag
B D                   Dolphin  agtg
B D                     Horse  agaa
B D          White rhinoceros  agag
B D                       Cat  agag
B D                       Dog  agag
B D                   Ferret   ggag
B D                     Panda  ggag
               Pacific walrus  agag
                 Weddell seal  agag
B D                   Megabat  agtg
                Big brown bat  agag
B D                  Microbat  agaa
              Star-nosed mole  agag
B D                 Armadillo  at--
           Tibetan ground jay  -ggg
B D        American alligator  tgaa
  D  Chinese softshell turtle  -gaa
B D                    Lizard  -gaa
B D               Stickleback  tgag
              Golden hamster  ====
                Prairie vole  ----
B D                       Rat  ----
B D                     Mouse  ====
B D           Chinese hamster  ====
      Lesser Egyptian jerboa  ====
               Domestic goat  ----
B D                       Cow  ----
B D                     Sheep  ====
            Tibetan antelope  ====
        David's myotis (bat)  ====
                Killer whale  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ----
         Pundamilia nyererei  ====
B D              Nile tilapia  ====
          Southern platyfish  ====
         Princess of Burundi  ====
B D              Atlantic cod  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ----
B D                    Medaka  ====
B D                 Tetraodon  ----
                 Spotted gar  ====
B D                   Lamprey  ====
B D                 Zebrafish  ====
B D                  Squirrel  ----
            Black flying-fox  ----
B D                   Manatee  ----
B D                  Elephant  ----
  D              Mallard duck  ----
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D       Medium ground finch  ====
B D                   Chicken  ====
  D             Scarlet macaw  ----
  D                    Parrot  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ----
B D                Budgerigar  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
            Cape golden mole  ----
  D    Spiny softshell turtle  ====
  D            Painted turtle  ====
                    Aardvark  ====
B D                   Wallaby  ----
B D                   Opossum  ====
B D           Tasmanian devil  ----
B D                Coelacanth  ====
  D           Green seaturtle  ====
            Brush-tailed rat  ====
          Chinese tree shrew  ----
                  Chinchilla  ====
B D                       Pig  ====
B D             X. tropicalis  ====
    Mexican tetra (cavefish)  ====
B D                Guinea pig  ----
B D                   Gorilla  ----

Alignment block 10 of 1111 in window, 149102870 - 149102897, 28 bps 
B D                     Human  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D                     Chimp  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D                 Orangutan  aaaaatgaaaaa----at---ccac---------taat--gagagaaaaacc
B D                    Gibbon  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D                    Rhesus  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D       Crab-eating macaque  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D                    Baboon  aaaa---tgaaa----at---ccac---------t-at--gagggaaaa--c
B D              Green monkey  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D                  Marmoset  aaaa---ttaaa----at---ccac---------t-at--gagaaaaaa--c
B D           Squirrel monkey  aaaa---ctaaa----at---ccac---------t-at--gagaaaaaa--c
B D                  Bushbaby  aaaa---tgaaa----at---ccac---------t-at--gagagaaaa--c
B D            Naked mole-rat  a-aa---tgaaa----at---ccac---------t-ct--gagagagaa--a
B D                    Rabbit  gtaa---tgaaa----at---ctac---------t-ct--gagagcaaa--c
B D                       Pig  aaaa---tgaaa----ag---tcac---------t-at--gagaggaaa--t
B D                    Alpaca  agaa---taaaa----at---tcac---------t-at--gagagaaaa--c
               Bactrian camel  agaa---taaaa----at---tcac---------t-at--gagagaaaa--c
B D                   Dolphin  aaaa---tgaaa----at---tcac---------t-at--gagagaaaa--t
B D          White rhinoceros  aaaa---t-aaa----at---tcac---------t-at--------------
B D                       Cat  aaaa---tgaaa----at---tcac---------t-atatgagaaaaaa--c
B D                       Dog  aaaa---cgaaa----at---tcgc---------t-ct--gagagaaaa--c
B D                   Ferret   aaaa-----------------------------------------aaca--c
B D                     Panda  aaaa---tgaaa----at---tcac---------t-at----gagaaaa--t
               Pacific walrus  aaaa---tgaaa----at---tcac---------t-at----gagaaaa--c
                 Weddell seal  aaaa---tgaaa----at---tcac---------t-at----gagaaaa--c
B D                   Megabat  aaag---taaaa----at---tcag---------t-at--gagagaaaa--t
                Big brown bat  aaaa---t-gaa----at---tcac---------t-gt--gtgagaaaa--c
B D                  Microbat  aaaa---t-gaa----at---tcac---------t-at--gtgagaaaa--t
              Star-nosed mole  -------tggta----at---tcgc---------t-ta----gacaaaa--c
B D                 Armadillo  ----------------ct---tcat---------g-at--aggagaaaa--c
B D           Tasmanian devil  -aaa---caatt----at---taat---------t-ta--tag---------
           Tibetan ground jay  acaa---agaga----aa---tta---------------------aaag--c
B D        American alligator  gaaa---ggggg----ga---gcac---------t-gg--ggagggagg--c
  D  Chinese softshell turtle  ataa---tgggataatga---gctc---------t-cc--agttaaaaa--c
B D                    Lizard  gccg---gccag----gaccctcac---------t-cg--agtataagc--c
        Burton's mouthbreeder  -----------a----at---taaa---------t-aa--tcgcaagt----
B D               Stickleback  ----------aa----at---tgaacacatgattt-at--tggaaaac----
              Golden hamster  ====================================================
                Prairie vole  ----------------------------------------------------
B D                       Rat  ----------------------------------------------------
B D                     Mouse  ====================================================
B D           Chinese hamster  ====================================================
      Lesser Egyptian jerboa  ====================================================
               Domestic goat  ----------------------------------------------------
B D                       Cow  ----------------------------------------------------
B D                     Sheep  ====================================================
            Tibetan antelope  ====================================================
        David's myotis (bat)  ====================================================
                Killer whale  ====================================================
                 Zebra mbuna  ====================================================
         Pundamilia nyererei  ====================================================
B D              Nile tilapia  ====================================================
          Southern platyfish  ====================================================
         Princess of Burundi  ====================================================
B D              Atlantic cod  ====================================================
      Yellowbelly pufferfish  ====================================================
B D                      Fugu  ----------------------------------------------------
B D                    Medaka  ====================================================
B D                 Tetraodon  ----------------------------------------------------
                 Spotted gar  ====================================================
B D                   Lamprey  ====================================================
B D                 Zebrafish  ====================================================
B D                     Horse  ----------------------------------------------------
B D                  Squirrel  ----------------------------------------------------
            Black flying-fox  ----------------------------------------------------
B D                   Manatee  ----------------------------------------------------
B D                  Elephant  ----------------------------------------------------
  D              Mallard duck  ----------------------------------------------------
B D               Zebra finch  ====================================================
  D    White-throated sparrow  ====================================================
B D       Medium ground finch  ====================================================
B D                   Chicken  ====================================================
  D             Scarlet macaw  ----------------------------------------------------
  D                    Parrot  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
  D               Rock pigeon  ----------------------------------------------------
B D                Budgerigar  ====================================================
B D                  Platypus  ====================================================
  D       Collared flycatcher  ====================================================
            Cape golden mole  ----------------------------------------------------
  D    Spiny softshell turtle  ====================================================
  D            Painted turtle  ====================================================
                    Aardvark  ====================================================
B D                   Wallaby  ----------------------------------------------------
B D                   Opossum  ====================================================
B D                Coelacanth  ====================================================
  D           Green seaturtle  ====================================================
            Brush-tailed rat  ====================================================
          Chinese tree shrew  ----------------------------------------------------
                  Chinchilla  ====================================================
B D             X. tropicalis  ====================================================
    Mexican tetra (cavefish)  ====================================================
B D                Guinea pig  ----------------------------------------------------
B D                   Gorilla  ----------------------------------------------------

Inserts between block 10 and 11 in window
B D           Naked mole-rat 4bp

Alignment block 11 of 1111 in window, 149102898 - 149102903, 6 bps 
B D                     Human  tg---aaga
B D                     Chimp  tg---aaga
B D                 Orangutan  ga---aaga
B D                    Gibbon  tg---aaga
B D                    Rhesus  tg---aagg
B D       Crab-eating macaque  tg---aagg
B D                    Baboon  tg---aagg
B D              Green monkey  tg---aagg
B D                  Marmoset  tg---aagg
B D           Squirrel monkey  tg---aagg
B D                  Bushbaby  tc---aaga
B D            Naked mole-rat  tg---aaga
B D                Guinea pig  tg---aaga
B D                    Rabbit  tg---gaga
B D                       Pig  gg----aac
B D                    Alpaca  tg---aaac
               Bactrian camel  tg---aaac
B D                   Dolphin  tg----aac
B D          White rhinoceros  -g---agaa
B D                       Cat  tg---aaag
B D                       Dog  tg---ataa
B D                   Ferret   tg---aaaa
B D                     Panda  cg---aaaa
               Pacific walrus  tg---aaaa
                 Weddell seal  tg---aaaa
B D                   Megabat  tg---aaaa
                Big brown bat  ag---aaaa
B D                  Microbat  gg---aaaa
              Star-nosed mole  cg---aaaa
B D                 Armadillo  tg---aaaa
B D           Tasmanian devil  -g---aaag
           Tibetan ground jay  ------aaa
B D        American alligator  ------atg
  D  Chinese softshell turtle  ------aaa
B D                    Lizard  ------aag
        Burton's mouthbreeder  tcacaacaa
B D               Stickleback  tc---aaaa
              Golden hamster  =========
                Prairie vole  ---------
B D                       Rat  ---------
B D                     Mouse  =========
B D           Chinese hamster  =========
      Lesser Egyptian jerboa  =========
               Domestic goat  ---------
B D                       Cow  ---------
B D                     Sheep  =========
            Tibetan antelope  =========
        David's myotis (bat)  =========
                Killer whale  =========
                 Zebra mbuna  =========
         Pundamilia nyererei  =========
B D              Nile tilapia  =========
          Southern platyfish  =========
         Princess of Burundi  =========
B D              Atlantic cod  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  ---------
B D                    Medaka  =========
B D                 Tetraodon  ---------
                 Spotted gar  =========
B D                   Lamprey  =========
B D                 Zebrafish  =========
B D                     Horse  ---------
B D                  Squirrel  ---------
            Black flying-fox  ---------
B D                   Manatee  ---------
B D                  Elephant  ---------
  D              Mallard duck  ---------
B D               Zebra finch  =========
  D    White-throated sparrow  =========
B D       Medium ground finch  =========
B D                   Chicken  =========
  D             Scarlet macaw  ---------
  D                    Parrot  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  ---------
B D                Budgerigar  =========
B D                  Platypus  =========
  D       Collared flycatcher  =========
            Cape golden mole  ---------
  D    Spiny softshell turtle  =========
  D            Painted turtle  =========
                    Aardvark  =========
B D                   Wallaby  ---------
B D                   Opossum  =========
B D                Coelacanth  =========
  D           Green seaturtle  =========
            Brush-tailed rat  =========
          Chinese tree shrew  ---------
                  Chinchilla  =========
B D             X. tropicalis  =========
    Mexican tetra (cavefish)  =========
B D                   Gorilla  ---------

Inserts between block 11 and 12 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
B D          Tasmanian devil 1bp
B D       American alligator 3bp
B D                   Lizard 8bp

Alignment block 12 of 1111 in window, 149102904 - 149102915, 12 bps 
B D                     Human  ctt-taatacag-a
B D                     Chimp  ctt-taatacag-a
B D                 Orangutan  cttctaatacagaa
B D                    Gibbon  ctt-taatacag-a
B D                    Rhesus  ctt-taatacag-a
B D       Crab-eating macaque  ctt-taatacag-a
B D                    Baboon  ctt-taatacag-a
B D              Green monkey  ctt-taatacag-a
B D                  Marmoset  ctt-taatgcaa-a
B D           Squirrel monkey  ctt-taatgcaa-a
B D                  Bushbaby  ttt-caatagac-a
B D            Naked mole-rat  ttt-taagacaa-a
B D                Guinea pig  ctt-taatacat-t
B D                    Rabbit  gtc-caacacaa-a
B D                       Pig  cct-caacacaa-a
B D                    Alpaca  ttc-ccacacaa-a
               Bactrian camel  ttc-ccacacaa-a
B D                   Dolphin  ttt-caatacac-a
B D                     Horse  -----aatacaa-a
B D          White rhinoceros  ttt-caatacaa-a
B D                       Cat  tct-cagtacaa-a
B D                       Dog  tgt-aaaca-aa-a
B D                   Ferret   tct-caacacaa-a
B D                     Panda  tct-caatacaa-a
               Pacific walrus  tct-caacacaa-a
                 Weddell seal  tct-caatacaa-a
B D                   Megabat  ttt-caatacac-a
                Big brown bat  cct-caa-------
B D                  Microbat  cct-caa-------
              Star-nosed mole  ----tggtattt-g
B D                 Armadillo  tgt-caatagaa-a
B D           Tasmanian devil  --t-cctgctaa-a
           Tibetan ground jay  -tc-aaggccaa-a
B D        American alligator  ttt-aagg--aa-c
  D  Chinese softshell turtle  --------acaa-a
B D                    Lizard  ttt-cagcccta-a
        Burton's mouthbreeder  cag-tcaaccaa-a
B D               Stickleback  ctt-tcaaataa-a
              Golden hamster  ==============
                Prairie vole  --------------
B D                       Rat  --------------
B D                     Mouse  ==============
B D           Chinese hamster  ==============
      Lesser Egyptian jerboa  ==============
               Domestic goat  --------------
B D                       Cow  --------------
B D                     Sheep  ==============
            Tibetan antelope  ==============
        David's myotis (bat)  ==============
                Killer whale  ==============
                 Zebra mbuna  ==============
         Pundamilia nyererei  ==============
B D              Nile tilapia  ==============
          Southern platyfish  ==============
         Princess of Burundi  ==============
B D              Atlantic cod  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  --------------
B D                    Medaka  ==============
B D                 Tetraodon  --------------
                 Spotted gar  ==============
B D                   Lamprey  ==============
B D                 Zebrafish  ==============
B D                  Squirrel  --------------
            Black flying-fox  --------------
B D                   Manatee  --------------
B D                  Elephant  --------------
  D              Mallard duck  --------------
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
B D       Medium ground finch  ==============
B D                   Chicken  ==============
  D             Scarlet macaw  --------------
  D                    Parrot  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  --------------
B D                Budgerigar  ==============
B D                  Platypus  ==============
  D       Collared flycatcher  ==============
            Cape golden mole  --------------
  D    Spiny softshell turtle  ==============
  D            Painted turtle  ==============
                    Aardvark  ==============
B D                   Wallaby  --------------
B D                   Opossum  ==============
B D                Coelacanth  ==============
  D           Green seaturtle  ==============
            Brush-tailed rat  ==============
          Chinese tree shrew  --------------
                  Chinchilla  ==============
B D             X. tropicalis  ==============
    Mexican tetra (cavefish)  ==============
B D                   Gorilla  --------------

Inserts between block 12 and 13 in window
B D                Armadillo 2bp
       Burton's mouthbreeder 7bp

Alignment block 13 of 1111 in window, 149102916 - 149102927, 12 bps 
B D                     Human  ttt-aagt--aaaat
B D                     Chimp  ttt-aagt--aaaat
B D                 Orangutan  ttt-aaggtaaaaat
B D                    Gibbon  ttt-aagt--aaaat
B D                    Rhesus  ttt-aagt--aaaat
B D       Crab-eating macaque  ttt-aagt--aaaat
B D                    Baboon  ttt-aagt--aaaat
B D              Green monkey  ttt-aagt--aaaat
B D                  Marmoset  ttt-cagt--aaagt
B D           Squirrel monkey  ttt-cagt--aaagt
B D                  Bushbaby  ttt-aaat--aagga
B D            Naked mole-rat  ttt-aaac--agcaa
B D                Guinea pig  tta-aaat--aaaat
B D                    Rabbit  ttt-aaat--aaaga
B D                       Pig  ttt-aaat--aagga
B D                    Alpaca  ttt-aaat--aagaa
               Bactrian camel  ttt-aaat--aagga
B D                   Dolphin  ttt-aagg--aggcc
B D                     Horse  ttc-aaat--aagga
B D          White rhinoceros  ttt-aaat--aagga
B D                       Cat  ttt-aaat--aagga
B D                       Dog  ttt-aaat--acgga
B D                   Ferret   ctt-aagt--aagga
B D                     Panda  ttt-aaat--aagga
               Pacific walrus  ttt-aaat--aagga
                 Weddell seal  ttt-aaat--aagga
B D                   Megabat  gtt-aaat--aagga
                Big brown bat  -tt-aaat--aaggc
B D                  Microbat  -tt-aaat--aaggc
              Star-nosed mole  tttccaat--aaagt
B D                 Armadillo  ttt-aagt--gaaaa
B D           Tasmanian devil  ttt-aatc--aaaga
           Tibetan ground jay  aca-aaag-------
B D        American alligator  atg-acag-------
  D  Chinese softshell turtle  atc-caag-------
B D                    Lizard  a---aaag-------
        Burton's mouthbreeder  -t-------------
              Golden hamster  ===============
                Prairie vole  ---------------
B D                       Rat  ---------------
B D                     Mouse  ===============
B D           Chinese hamster  ===============
      Lesser Egyptian jerboa  ===============
               Domestic goat  ---------------
B D                       Cow  ---------------
B D                     Sheep  ===============
            Tibetan antelope  ===============
        David's myotis (bat)  ===============
                Killer whale  ===============
                 Zebra mbuna  ===============
         Pundamilia nyererei  ===============
B D              Nile tilapia  ===============
          Southern platyfish  ===============
         Princess of Burundi  ===============
B D              Atlantic cod  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ---------------
B D                    Medaka  ===============
B D                 Tetraodon  ---------------
                 Spotted gar  ===============
B D                   Lamprey  ===============
B D                 Zebrafish  ===============
B D               Stickleback  ===============
B D                  Squirrel  ---------------
            Black flying-fox  ---------------
B D                   Manatee  ---------------
B D                  Elephant  ---------------
  D              Mallard duck  ---------------
B D               Zebra finch  ===============
  D    White-throated sparrow  ===============
B D       Medium ground finch  ===============
B D                   Chicken  ===============
  D             Scarlet macaw  ---------------
  D                    Parrot  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ---------------
B D                Budgerigar  ===============
B D                  Platypus  ===============
  D       Collared flycatcher  ===============
            Cape golden mole  ---------------
  D    Spiny softshell turtle  ===============
  D            Painted turtle  ===============
                    Aardvark  ===============
B D                   Wallaby  ---------------
B D                   Opossum  ===============
B D                Coelacanth  ===============
  D           Green seaturtle  ===============
            Brush-tailed rat  ===============
          Chinese tree shrew  ---------------
                  Chinchilla  ===============
B D             X. tropicalis  ===============
    Mexican tetra (cavefish)  ===============
B D                   Gorilla  ---------------

Inserts between block 13 and 14 in window
B D               Guinea pig 2575bp

Alignment block 14 of 1111 in window, 149102928 - 149102930, 3 bps 
B D                     Human  gg---c
B D                     Chimp  gg---c
B D                 Orangutan  ggc--c
B D                    Gibbon  gg---c
B D                    Rhesus  gg---t
B D       Crab-eating macaque  gg---c
B D                    Baboon  gg---c
B D              Green monkey  gg---c
B D                  Marmoset  ag---c
B D           Squirrel monkey  gg---c
B D                  Bushbaby  gg---c
B D            Naked mole-rat  gg---c
B D                    Rabbit  gg---c
B D                       Pig  gg---c
B D                    Alpaca  gg---t
               Bactrian camel  gg---c
B D                   Dolphin  ta---c
B D                     Horse  gg---c
B D          White rhinoceros  gg---c
B D                       Cat  gg---c
B D                       Dog  gg---c
B D                   Ferret   gg---c
B D                     Panda  gg---c
               Pacific walrus  gg---c
                 Weddell seal  gg---c
B D                   Megabat  gg---c
                Big brown bat  ag---c
B D                  Microbat  ag---c
              Star-nosed mole  gg---g
B D                 Armadillo  tg---a
B D           Tasmanian devil  --attc
           Tibetan ground jay  ga---t
B D        American alligator  ca---c
  D  Chinese softshell turtle  ag---t
B D                    Lizard  ga---c
        Burton's mouthbreeder  ga---c
              Golden hamster  ======
                Prairie vole  ------
B D                       Rat  ------
B D                     Mouse  ======
B D           Chinese hamster  ======
      Lesser Egyptian jerboa  ======
               Domestic goat  ------
B D                       Cow  ------
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
                Killer whale  ======
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
B D              Nile tilapia  ======
          Southern platyfish  ======
         Princess of Burundi  ======
B D              Atlantic cod  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ------
B D                    Medaka  ======
B D                 Tetraodon  ------
                 Spotted gar  ======
B D                   Lamprey  ======
B D                 Zebrafish  ======
B D               Stickleback  ======
B D                  Squirrel  ------
            Black flying-fox  ------
B D                   Manatee  ------
B D                  Elephant  ------
  D              Mallard duck  ------
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D       Medium ground finch  ======
B D                   Chicken  ======
  D             Scarlet macaw  ------
  D                    Parrot  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ------
B D                Budgerigar  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
            Cape golden mole  ------
  D    Spiny softshell turtle  ======
  D            Painted turtle  ======
                    Aardvark  ======
B D                   Wallaby  ------
B D                   Opossum  ======
B D                Coelacanth  ======
  D           Green seaturtle  ======
            Brush-tailed rat  ======
          Chinese tree shrew  ------
                  Chinchilla  ======
B D             X. tropicalis  ======
    Mexican tetra (cavefish)  ======
B D                Guinea pig  ======
B D                   Gorilla  ------

Inserts between block 14 and 15 in window
          Tibetan ground jay 27bp
B D       American alligator 25bp
  D Chinese softshell turtle 38bp
B D                   Lizard 15bp

Alignment block 15 of 1111 in window, 149102931 - 149102943, 13 bps 
B D                     Human  ctggt--aatgg-aa-a
B D                     Chimp  ctggt--aatgg-aa-a
B D                 Orangutan  ctggttaaatgg-aa-a
B D                    Gibbon  ctggt--aatgg-aa-a
B D                    Rhesus  gtggt--aatgg-aa-a
B D       Crab-eating macaque  gtggt--aatgg-aa-a
B D                    Baboon  gtggt--aatgg-aa-a
B D              Green monkey  ctggt--aatgg-aa-a
B D                  Marmoset  ctg----gatgg-aa-a
B D           Squirrel monkey  ctg----gatgg-aa-a
B D                  Bushbaby  ctggt--ca-gg-aa-a
B D            Naked mole-rat  cgagc--agtgg-ca-a
B D                    Rabbit  ctggt--aatgg-aa-a
B D                       Pig  ctggt--catgg-aa--
B D                    Alpaca  ccagt--aatgg-aa--
               Bactrian camel  tcagt--aatgg-aa--
B D                   Dolphin  ctagt--aatggaaa--
B D                     Horse  ctggt--aatgg-aa--
B D          White rhinoceros  ttggt--aatgg-aa--
B D                       Cat  ctgat--aatag-aaa-
B D                       Dog  ctggt--aacag-ga--
B D                   Ferret   ctggg--aacag-aaa-
B D                     Panda  ctggt--aatat-ga--
               Pacific walrus  ctggt--aatag-gaa-
                 Weddell seal  ctggt--aatag-----
B D                   Megabat  ctagc--aatgg-aaa-
                Big brown bat  ccagt--aatgg-aaa-
B D                  Microbat  ccagt--aatgg-aaa-
              Star-nosed mole  ctgg---gatag-aa--
B D                 Armadillo  ctggt--aatgg-ga-a
B D           Tasmanian devil  tagaa--aaagg-ga--
           Tibetan ground jay  atgtg--ct--------
B D        American alligator  aggaa--ca--------
  D           Green seaturtle  aggta--aa--------
  D  Chinese softshell turtle  gtgtt--aa--------
B D                    Lizard  atact--cg--------
        Burton's mouthbreeder  ccgac--aataataa--
              Golden hamster  =================
                Prairie vole  -----------------
B D                       Rat  -----------------
B D                     Mouse  =================
B D           Chinese hamster  =================
      Lesser Egyptian jerboa  =================
               Domestic goat  -----------------
B D                       Cow  -----------------
B D                     Sheep  =================
            Tibetan antelope  =================
        David's myotis (bat)  =================
                Killer whale  =================
                 Zebra mbuna  =================
         Pundamilia nyererei  =================
B D              Nile tilapia  =================
          Southern platyfish  =================
         Princess of Burundi  =================
B D              Atlantic cod  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  -----------------
B D                    Medaka  =================
B D                 Tetraodon  -----------------
                 Spotted gar  =================
B D                   Lamprey  =================
B D                 Zebrafish  =================
B D               Stickleback  =================
B D                  Squirrel  -----------------
            Black flying-fox  -----------------
B D                   Manatee  -----------------
B D                  Elephant  -----------------
  D              Mallard duck  -----------------
B D               Zebra finch  =================
  D    White-throated sparrow  =================
B D       Medium ground finch  =================
B D                   Chicken  =================
  D             Scarlet macaw  -----------------
  D                    Parrot  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
  D               Rock pigeon  -----------------
B D                Budgerigar  =================
B D                  Platypus  =================
  D       Collared flycatcher  =================
            Cape golden mole  -----------------
  D    Spiny softshell turtle  =================
  D            Painted turtle  =================
                    Aardvark  =================
B D                   Wallaby  -----------------
B D                   Opossum  =================
B D                Coelacanth  =================
            Brush-tailed rat  =================
          Chinese tree shrew  -----------------
                  Chinchilla  =================
B D             X. tropicalis  =================
    Mexican tetra (cavefish)  =================
B D                Guinea pig  =================
B D                   Gorilla  -----------------

Inserts between block 15 and 16 in window
                Weddell seal 2bp

Alignment block 16 of 1111 in window, 149102944 - 149102945, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ag
B D            Naked mole-rat  aa
B D                    Rabbit  ag
B D                       Pig  gg
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  -g
B D                       Dog  ag
B D                   Ferret   -g
B D                     Panda  ag
                 Weddell seal  ag
B D                   Megabat  -a
                Big brown bat  -g
B D                  Microbat  -g
              Star-nosed mole  ag
B D                 Armadillo  aa
B D           Tasmanian devil  aa
           Tibetan ground jay  tg
B D        American alligator  ag
  D           Green seaturtle  gg
  D  Chinese softshell turtle  tg
B D                    Lizard  ag
        Burton's mouthbreeder  at
              Golden hamster  ==
                Prairie vole  --
B D                       Rat  --
B D                     Mouse  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
               Domestic goat  --
B D                       Cow  --
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
                Killer whale  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D              Nile tilapia  ==
          Southern platyfish  ==
         Princess of Burundi  ==
B D              Atlantic cod  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  --
B D                    Medaka  ==
B D                 Tetraodon  --
                 Spotted gar  ==
B D                   Lamprey  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
B D                  Squirrel  --
            Black flying-fox  --
B D                   Manatee  --
B D                  Elephant  --
  D              Mallard duck  --
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
B D                   Chicken  ==
  D             Scarlet macaw  --
  D                    Parrot  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  --
B D                Budgerigar  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
            Cape golden mole  --
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
                    Aardvark  ==
B D                   Wallaby  --
B D                   Opossum  ==
B D                Coelacanth  ==
              Pacific walrus  --
            Brush-tailed rat  ==
          Chinese tree shrew  --
                  Chinchilla  ==
B D             X. tropicalis  ==
    Mexican tetra (cavefish)  ==
B D                Guinea pig  ==
B D                   Gorilla  --

Alignment block 17 of 1111 in window, 149102946 - 149102953, 8 bps 
B D                     Human  ct-------------gactga
B D                     Chimp  ct-------------gactga
B D                 Orangutan  ct-------------gactga
B D                    Gibbon  ct-------------gactga
B D                    Rhesus  ct-------------gactga
B D       Crab-eating macaque  ct-------------gactga
B D                    Baboon  ct-------------gactga
B D              Green monkey  ct-------------gactga
B D                  Marmoset  ct-------------gactga
B D           Squirrel monkey  ct-------------gactga
B D                  Bushbaby  ct-------------gactaa
B D            Naked mole-rat  ct-------------ggc--a
B D                    Rabbit  ct-------------ggtgga
B D                       Pig  ca-------------gactgg
B D                    Alpaca  ct-------------gactga
               Bactrian camel  ct-------------gactga
B D                   Dolphin  ca-------------gactaa
B D                     Horse  ca-------------gactga
B D          White rhinoceros  ca-------------gactga
B D                       Cat  cagactgaggcgtctgagggg
B D                       Dog  ca-------------gaagga
B D                     Panda  ca-------------gaaaga
                 Weddell seal  ca-------------------
                Big brown bat  ca-------------cactga
B D                  Microbat  ca-------------cactga
              Star-nosed mole  -------------tggattga
B D                 Armadillo  ca-------------aactca
B D           Tasmanian devil  -----------ttgagactgc
           Tibetan ground jay  -------------gttgggag
B D        American alligator  -------------tgcaggcg
  D           Green seaturtle  -------------gaagctga
  D  Chinese softshell turtle  -------------ggaggtca
B D                    Lizard  -------------tatataca
        Burton's mouthbreeder  ct-------------gattgt
              Golden hamster  =====================
                Prairie vole  ---------------------
B D                       Rat  ---------------------
B D                     Mouse  =====================
B D           Chinese hamster  =====================
      Lesser Egyptian jerboa  =====================
               Domestic goat  ---------------------
B D                       Cow  ---------------------
B D                     Sheep  =====================
            Tibetan antelope  =====================
        David's myotis (bat)  =====================
                Killer whale  =====================
                 Zebra mbuna  =====================
         Pundamilia nyererei  =====================
B D              Nile tilapia  =====================
          Southern platyfish  =====================
         Princess of Burundi  =====================
B D              Atlantic cod  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  ---------------------
B D                    Medaka  =====================
B D                 Tetraodon  ---------------------
                 Spotted gar  =====================
B D                   Lamprey  =====================
B D                 Zebrafish  =====================
B D               Stickleback  =====================
B D                   Ferret   ---------------------
B D                  Squirrel  ---------------------
            Black flying-fox  ---------------------
B D                   Manatee  ---------------------
B D                  Elephant  ---------------------
  D              Mallard duck  ---------------------
B D               Zebra finch  =====================
  D    White-throated sparrow  =====================
B D       Medium ground finch  =====================
B D                   Chicken  =====================
  D             Scarlet macaw  ---------------------
  D                    Parrot  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  ---------------------
B D                Budgerigar  =====================
B D                  Platypus  =====================
  D       Collared flycatcher  =====================
            Cape golden mole  ---------------------
  D    Spiny softshell turtle  =====================
  D            Painted turtle  =====================
                    Aardvark  =====================
B D                   Wallaby  ---------------------
B D                   Opossum  =====================
B D                Coelacanth  =====================
              Pacific walrus  ---------------------
            Brush-tailed rat  =====================
          Chinese tree shrew  ---------------------
                  Chinchilla  =====================
B D             X. tropicalis  =====================
    Mexican tetra (cavefish)  =====================
B D                Guinea pig  =====================
B D                   Gorilla  ---------------------

Inserts between block 17 and 18 in window
B D                      Pig 13bp
B D                   Alpaca 13bp
              Bactrian camel 13bp
B D          Tasmanian devil 10bp

Alignment block 18 of 1111 in window, 149102954 - 149102957, 4 bps 
B D                     Human  ---ggaa
B D                     Chimp  ---ggaa
B D                 Orangutan  ---ggaa
B D                    Gibbon  ---ggaa
B D                    Rhesus  ---ggag
B D       Crab-eating macaque  ---ggag
B D                    Baboon  ---ggag
B D              Green monkey  ---ggag
B D                  Marmoset  ---ggag
B D           Squirrel monkey  ---ggag
B D                  Bushbaby  ---ggaa
B D            Naked mole-rat  ---ggtg
B D                    Rabbit  ---ggtg
B D                       Pig  ---aa--
B D                    Alpaca  ---aa--
               Bactrian camel  ---aa--
B D                     Horse  ---gg--
B D          White rhinoceros  ---gg--
B D                       Cat  ---aa--
B D                       Dog  ---aa--
B D                     Panda  ---aa--
                Big brown bat  ---gg--
B D                  Microbat  ---gg--
              Star-nosed mole  ---gg--
B D                 Armadillo  -----gg
B D           Tasmanian devil  ---ggga
           Tibetan ground jay  -----gg
B D        American alligator  -----ga
  D           Green seaturtle  -----cg
  D  Chinese softshell turtle  -----gg
B D                    Lizard  -----gt
        Burton's mouthbreeder  tgca---
              Golden hamster  =======
                Prairie vole  -------
B D                       Rat  -------
B D                     Mouse  =======
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  =======
               Domestic goat  -------
B D                       Cow  -------
B D                     Sheep  =======
            Tibetan antelope  =======
        David's myotis (bat)  =======
                Killer whale  =======
                 Zebra mbuna  =======
         Pundamilia nyererei  =======
B D              Nile tilapia  =======
          Southern platyfish  =======
         Princess of Burundi  =======
B D              Atlantic cod  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  -------
B D                    Medaka  =======
B D                 Tetraodon  -------
                 Spotted gar  =======
B D                   Lamprey  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
B D                   Ferret   -------
B D                  Squirrel  -------
            Black flying-fox  -------
B D                   Manatee  -------
B D                  Elephant  -------
  D              Mallard duck  -------
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D       Medium ground finch  =======
B D                   Chicken  =======
  D             Scarlet macaw  -------
  D                    Parrot  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  -------
B D                Budgerigar  =======
B D                  Platypus  =======
  D       Collared flycatcher  =======
            Cape golden mole  -------
  D    Spiny softshell turtle  =======
  D            Painted turtle  =======
                    Aardvark  =======
B D                   Wallaby  -------
B D                   Opossum  =======
B D                Coelacanth  =======
              Pacific walrus  -------
            Brush-tailed rat  =======
          Chinese tree shrew  -------
                  Chinchilla  =======
B D             X. tropicalis  =======
    Mexican tetra (cavefish)  =======
                Weddell seal  -------
B D                   Dolphin  =======
B D                Guinea pig  =======
B D                   Gorilla  -------

Inserts between block 18 and 19 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                    Panda 3bp
               Big brown bat 17bp
             Star-nosed mole 2bp
          Tibetan ground jay 6bp
B D       American alligator 6bp
  D          Green seaturtle 7bp
B D                   Lizard 2bp

Alignment block 19 of 1111 in window, 149102958 - 149102958, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D            Naked mole-rat  t
B D                    Rabbit  g
B D                 Armadillo  t
B D           Tasmanian devil  c
        Burton's mouthbreeder  c
B D          White rhinoceros  =
B D                     Panda  =
              Golden hamster  =
                Prairie vole  -
B D                       Rat  -
B D                     Mouse  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
               Domestic goat  -
B D                       Cow  -
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
               Big brown bat  =
                Killer whale  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  =
B D                    Lizard  =
      Yellowbelly pufferfish  =
B D                      Fugu  -
B D                    Medaka  =
B D                 Tetraodon  -
                 Spotted gar  =
B D                   Lamprey  =
B D                 Zebrafish  =
B D                    Alpaca  =
B D               Stickleback  =
             Star-nosed mole  =
B D                   Ferret   -
B D                     Horse  =
B D                  Squirrel  -
            Black flying-fox  -
B D                       Cat  =
B D                   Manatee  -
B D                  Elephant  -
              Bactrian camel  =
  D              Mallard duck  -
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D        American alligator  =
B D                   Chicken  =
  D             Scarlet macaw  -
  D                    Parrot  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  -
B D                Budgerigar  =
B D                  Platypus  =
  D       Collared flycatcher  =
            Cape golden mole  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
                    Aardvark  =
B D                   Wallaby  -
B D                   Opossum  =
B D                Coelacanth  =
  D           Green seaturtle  =
B D                       Dog  =
              Pacific walrus  -
            Brush-tailed rat  =
          Chinese tree shrew  -
                  Chinchilla  =
B D                       Pig  =
B D             X. tropicalis  =
    Mexican tetra (cavefish)  =
                Weddell seal  -
B D                   Dolphin  =
B D                Guinea pig  =
B D                   Gorilla  -

Inserts between block 19 and 20 in window
B D                Armadillo 2bp

Alignment block 20 of 1111 in window, 149102959 - 149102959, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D            Naked mole-rat  a
B D                    Rabbit  a
B D                 Armadillo  a
B D           Tasmanian devil  a
           Tibetan ground jay  g
B D        American alligator  g
  D           Green seaturtle  g
B D                    Lizard  a
        Burton's mouthbreeder  a
B D          White rhinoceros  =
B D                     Panda  =
              Golden hamster  =
                Prairie vole  -
B D                       Rat  -
B D                     Mouse  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
               Domestic goat  -
B D                       Cow  -
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
               Big brown bat  =
                Killer whale  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D              Nile tilapia  =
          Southern platyfish  =
         Princess of Burundi  =
B D              Atlantic cod  =
      Yellowbelly pufferfish  =
B D                      Fugu  -
B D                    Medaka  =
B D                 Tetraodon  -
                 Spotted gar  =
B D                   Lamprey  =
B D                 Zebrafish  =
B D                    Alpaca  =
B D               Stickleback  =
             Star-nosed mole  =
B D                   Ferret   -
B D                     Horse  =
B D                  Squirrel  -
            Black flying-fox  -
B D                       Cat  =
B D                   Manatee  -
B D                  Elephant  -
              Bactrian camel  =
  D              Mallard duck  -
B D               Zebra finch  =
  D    White-throated sparrow  =
B D       Medium ground finch  =
B D                   Chicken  =
  D             Scarlet macaw  -
  D                    Parrot  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  -
B D                Budgerigar  =
B D                  Platypus  =
  D       Collared flycatcher  =
            Cape golden mole  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
                    Aardvark  =
B D                   Wallaby  -
B D                   Opossum  =
B D                Coelacanth  =
B D                       Dog  =
              Pacific walrus  -
            Brush-tailed rat  =
          Chinese tree shrew  -
                  Chinchilla  =
B D                       Pig  =
B D             X. tropicalis  =
    Mexican tetra (cavefish)  =
                Weddell seal  -
B D                   Dolphin  =
B D                Guinea pig  =
B D                   Gorilla  -

Inserts between block 20 and 21 in window
B D                Armadillo 223bp
B D          Tasmanian devil 1bp

Alignment block 21 of 1111 in window, 149102960 - 149102961, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
B D            Naked mole-rat  tg
B D                    Rabbit  tg
           Tibetan ground jay  tg
B D        American alligator  ag
  D           Green seaturtle  cg
B D                    Lizard  tg
        Burton's mouthbreeder  ca
B D                 Armadillo  ==
B D          White rhinoceros  ==
B D                     Panda  ==
              Golden hamster  ==
                Prairie vole  --
B D                       Rat  --
B D                     Mouse  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
               Domestic goat  --
B D                       Cow  --
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
               Big brown bat  ==
                Killer whale  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D              Nile tilapia  ==
          Southern platyfish  ==
         Princess of Burundi  ==
B D              Atlantic cod  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  --
B D                    Medaka  ==
B D                 Tetraodon  --
                 Spotted gar  ==
B D                   Lamprey  ==
B D                 Zebrafish  ==
B D                    Alpaca  ==
B D               Stickleback  ==
             Star-nosed mole  ==
B D                   Ferret   --
B D                     Horse  ==
B D                  Squirrel  --
            Black flying-fox  --
B D                       Cat  ==
B D                   Manatee  --
B D                  Elephant  --
              Bactrian camel  ==
  D              Mallard duck  --
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
B D                   Chicken  ==
  D             Scarlet macaw  --
  D                    Parrot  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  --
B D                Budgerigar  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
            Cape golden mole  --
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
                    Aardvark  ==
B D                   Wallaby  --
B D                   Opossum  ==
B D           Tasmanian devil  ==
B D                Coelacanth  ==
B D                       Dog  ==
              Pacific walrus  --
            Brush-tailed rat  ==
          Chinese tree shrew  --
                  Chinchilla  ==
B D                       Pig  ==
B D             X. tropicalis  ==
    Mexican tetra (cavefish)  ==
                Weddell seal  --
B D                   Dolphin  ==
B D                Guinea pig  ==
B D                   Gorilla  --

Inserts between block 21 and 22 in window
B D                Orangutan 1bp
B D                 Marmoset 8bp
B D          Squirrel monkey 8bp
B D                 Bushbaby 9bp
B D           Naked mole-rat 10bp
B D                   Rabbit 10bp
          Tibetan ground jay 25bp
B D       American alligator 6bp
  D          Green seaturtle 23bp
B D                   Lizard 1bp

Alignment block 22 of 1111 in window, 149102962 - 149102966, 5 bps 
B D                     Human  ------ttcct
B D                     Chimp  ------ttcct
B D                 Orangutan  ------ttcct
B D                    Gibbon  ------ttcct
B D                    Rhesus  ------ttcct
B D       Crab-eating macaque  ------ttcct
B D                    Baboon  ------ttcct
B D              Green monkey  ------ttcct
B D                  Marmoset  ------ctcct
B D           Squirrel monkey  ------ctcct
B D                  Bushbaby  ------tttct
B D            Naked mole-rat  ------ttcta
B D                    Rabbit  ------ttcta
B D                       Pig  ------ttca-
B D                    Alpaca  ------ttca-
               Bactrian camel  ------ttca-
B D                     Horse  ------tttg-
B D          White rhinoceros  ------tttg-
B D                       Cat  ------tttc-
B D                       Dog  ------ttcc-
B D                     Panda  ------ttcc-
                Big brown bat  ------ttcc-
              Star-nosed mole  ------ctct-
B D           Tasmanian devil  ------tttca
           Tibetan ground jay  ------ctcc-
B D                   Chicken  ------ttct-
B D        American alligator  ------ttct-
  D           Green seaturtle  ------ctct-
B D                    Lizard  ------tttt-
        Burton's mouthbreeder  ctacaagtcc-
B D                 Armadillo  ===========
              Golden hamster  ===========
                Prairie vole  -----------
B D                       Rat  -----------
B D                     Mouse  ===========
B D           Chinese hamster  ===========
      Lesser Egyptian jerboa  ===========
               Domestic goat  -----------
B D                       Cow  -----------
B D                     Sheep  ===========
            Tibetan antelope  ===========
        David's myotis (bat)  ===========
                Killer whale  ===========
                 Zebra mbuna  ===========
         Pundamilia nyererei  ===========
B D              Nile tilapia  ===========
          Southern platyfish  ===========
         Princess of Burundi  ===========
B D              Atlantic cod  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  -----------
B D                    Medaka  ===========
B D                 Tetraodon  -----------
                 Spotted gar  ===========
B D                   Lamprey  ===========
B D                 Zebrafish  ===========
B D               Stickleback  ===========
B D                   Ferret   -----------
B D                  Squirrel  -----------
            Black flying-fox  -----------
B D                   Manatee  -----------
B D                  Elephant  -----------
  D              Mallard duck  -----------
B D               Zebra finch  ===========
  D    White-throated sparrow  ===========
B D       Medium ground finch  ===========
  D             Scarlet macaw  -----------
  D                    Parrot  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  -----------
B D                Budgerigar  ===========
B D                  Platypus  ===========
  D       Collared flycatcher  ===========
            Cape golden mole  -----------
  D    Spiny softshell turtle  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
                    Aardvark  ===========
B D                   Wallaby  -----------
B D                   Opossum  ===========
B D                Coelacanth  ===========
              Pacific walrus  -----------
            Brush-tailed rat  ===========
          Chinese tree shrew  -----------
                  Chinchilla  ===========
B D             X. tropicalis  ===========
    Mexican tetra (cavefish)  ===========
                Weddell seal  -----------
B D                   Dolphin  ===========
B D                Guinea pig  ===========
B D                   Gorilla  -----------

Inserts between block 22 and 23 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                    Panda 2bp
B D          Tasmanian devil 1bp
          Tibetan ground jay 1bp
B D                  Chicken 1bp
B D       American alligator 1bp
  D          Green seaturtle 1bp
B D                   Lizard 1bp

Alignment block 23 of 1111 in window, 149102967 - 149102968, 2 bps 
B D                     Human  -gg
B D                     Chimp  -gg
B D                 Orangutan  -gg
B D                    Gibbon  -gc
B D                    Rhesus  -gc
B D       Crab-eating macaque  -gc
B D                    Baboon  -gc
B D              Green monkey  -gc
B D                  Marmoset  -gc
B D           Squirrel monkey  -gc
B D                  Bushbaby  -gt
B D            Naked mole-rat  -gt
B D                    Rabbit  -gc
B D                       Pig  -g-
B D                    Alpaca  -g-
               Bactrian camel  -g-
B D                     Horse  -g-
B D          White rhinoceros  -a-
B D                       Cat  -g-
B D                     Panda  -g-
                Big brown bat  -a-
              Star-nosed mole  -g-
B D           Tasmanian devil  --c
           Tibetan ground jay  -a-
B D                   Chicken  -a-
B D        American alligator  -a-
  D           Green seaturtle  -a-
B D                    Lizard  -g-
        Burton's mouthbreeder  tg-
B D                 Armadillo  ===
              Golden hamster  ===
                Prairie vole  ---
B D                       Rat  ---
B D                     Mouse  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
               Domestic goat  ---
B D                       Cow  ---
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
                Killer whale  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
B D              Nile tilapia  ===
          Southern platyfish  ===
         Princess of Burundi  ===
B D              Atlantic cod  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ---
B D                    Medaka  ===
B D                 Tetraodon  ---
                 Spotted gar  ===
B D                   Lamprey  ===
B D                 Zebrafish  ===
B D               Stickleback  ===
B D                   Ferret   ---
B D                  Squirrel  ---
            Black flying-fox  ---
B D                   Manatee  ---
B D                  Elephant  ---
  D              Mallard duck  ---
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
  D             Scarlet macaw  ---
  D                    Parrot  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ---
B D                Budgerigar  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
            Cape golden mole  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
                    Aardvark  ===
B D                   Wallaby  ---
B D                   Opossum  ===
B D                Coelacanth  ===
B D                       Dog  ===
              Pacific walrus  ---
            Brush-tailed rat  ===
          Chinese tree shrew  ---
                  Chinchilla  ===
B D             X. tropicalis  ===
    Mexican tetra (cavefish)  ===
                Weddell seal  ---
B D                   Dolphin  ===
B D                Guinea pig  ===
B D                   Gorilla  ---

Inserts between block 23 and 24 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                      Cat 1bp
               Big brown bat 1bp
B D          Tasmanian devil 1bp

Alignment block 24 of 1111 in window, 149102969 - 149103001, 33 bps 
B D                     Human  ctgtaacatttcttcactcaggctgt-------agtt-tct--------
B D                     Chimp  ctgtaacatttcttcactcaggctgt-------agtt-tct--------
B D                 Orangutan  ctgtaacatttcttcactcaggctat-------agtt-tct--------
B D                    Gibbon  ctgtaacattccttcactcaggctgt-------agtt-tct--------
B D                    Rhesus  ctgtaacatttcttcactcaggctgt-------ggtt-tct--------
B D       Crab-eating macaque  ctgtaacatttcttcactcaggctgt-------ggtt-tct--------
B D                    Baboon  ctgtaacatttgttcactcaggctgt-------ggtt-tct--------
B D              Green monkey  ctgtaacatatcttcgctcaggctgt-------agtt-tct--------
B D                  Marmoset  ctgtaacacttcttcactcaggctgt-------agtt-tct--------
B D           Squirrel monkey  ctgtaacacttcttcactaaggctgt-------agtt-tct--------
B D                  Bushbaby  ctctaacatttgttcactgaggctgt-------ggtc-tct--------
B D            Naked mole-rat  atgtcaca----ttttttcgggccat-------ggtt-tcc--------
B D                    Rabbit  ttgtaacacttctttgttcaggccac-------agtt-gcc--------
B D                       Pig  ctgtaacatttcttccatcggtctgt-------ggtt-tca--------
B D                    Alpaca  tggtaacatttcttccatcaggctgt-------gctt-tca--------
               Bactrian camel  cggtaacatttcttccatcaggttgt-------gctt-tca--------
B D                     Horse  gagaaacatttcttcaatcagcctgt-------ggtt-tca--------
B D          White rhinoceros  agaaa---------caatcaggctgt-------ggtt-tca--------
B D                       Cat  ctgtaacatttcttcaatcgagctgt-------ggtt-tcg--------
                Big brown bat  ctgtaacatttcttcactcaggctgt-------ggtt-tca--------
              Star-nosed mole  cgggagcacttcatc---tggggtgtttcctaggatg-tca--------
B D           Tasmanian devil  ccttcatatgtcctcattcatggtct-------tttt-ttt--------
           Tibetan ground jay  ---------------------------------aatc-tt---------
B D                   Chicken  --------------------------------------tt---------
B D        American alligator  -----ccag--------------tgc-------agca-gt---------
  D           Green seaturtle  -----------------------tga-------agcctct---------
B D                    Lizard  -----gcaattac-------aactgc-------aatt-tc---------
        Burton's mouthbreeder  cagtaacacttgtgcatgcagacctt-------tttc-ttgaacattta
B D                 Armadillo  =================================================
B D                     Panda  -------------------------------------------------
              Golden hamster  =================================================
                Prairie vole  -------------------------------------------------
B D                       Rat  -------------------------------------------------
B D                     Mouse  =================================================
B D           Chinese hamster  =================================================
      Lesser Egyptian jerboa  =================================================
               Domestic goat  -------------------------------------------------
B D                       Cow  -------------------------------------------------
B D                     Sheep  =================================================
            Tibetan antelope  =================================================
        David's myotis (bat)  =================================================
                Killer whale  =================================================
                 Zebra mbuna  =================================================
         Pundamilia nyererei  =================================================
B D              Nile tilapia  =================================================
          Southern platyfish  =================================================
         Princess of Burundi  =================================================
B D              Atlantic cod  =================================================
      Yellowbelly pufferfish  =================================================
B D                      Fugu  -------------------------------------------------
B D                    Medaka  =================================================
B D                 Tetraodon  -------------------------------------------------
                 Spotted gar  =================================================
B D                   Lamprey  =================================================
B D                 Zebrafish  =================================================
B D               Stickleback  =================================================
B D                   Ferret   -------------------------------------------------
B D                  Squirrel  -------------------------------------------------
            Black flying-fox  -------------------------------------------------
B D                   Manatee  -------------------------------------------------
B D                  Elephant  -------------------------------------------------
  D              Mallard duck  -------------------------------------------------
B D               Zebra finch  =================================================
  D    White-throated sparrow  =================================================
B D       Medium ground finch  =================================================
  D             Scarlet macaw  -------------------------------------------------
  D                    Parrot  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D               Rock pigeon  -------------------------------------------------
B D                Budgerigar  =================================================
B D                  Platypus  =================================================
  D       Collared flycatcher  =================================================
            Cape golden mole  -------------------------------------------------
  D    Spiny softshell turtle  =================================================
  D  Chinese softshell turtle  =================================================
  D            Painted turtle  =================================================
                    Aardvark  =================================================
B D                   Wallaby  -------------------------------------------------
B D                   Opossum  =================================================
B D                Coelacanth  =================================================
B D                       Dog  =================================================
              Pacific walrus  -------------------------------------------------
            Brush-tailed rat  =================================================
          Chinese tree shrew  -------------------------------------------------
                  Chinchilla  =================================================
B D             X. tropicalis  =================================================
    Mexican tetra (cavefish)  =================================================
                Weddell seal  -------------------------------------------------
B D                   Dolphin  =================================================
B D                Guinea pig  =================================================
B D                   Gorilla  -------------------------------------------------

Inserts between block 24 and 25 in window
B D                      Cat 200bp
B D          Tasmanian devil 54bp

Alignment block 25 of 1111 in window, 149103002 - 149103005, 4 bps 
B D                     Human  gaat-
B D                     Chimp  gaat-
B D                 Orangutan  gaat-
B D                    Gibbon  ga---
B D                    Rhesus  gaat-
B D       Crab-eating macaque  gaat-
B D                    Baboon  gaat-
B D              Green monkey  gaat-
B D                  Marmoset  gaat-
B D           Squirrel monkey  gaat-
B D                  Bushbaby  gaat-
B D            Naked mole-rat  taat-
B D                    Rabbit  -aat-
B D                       Pig  gaat-
B D                    Alpaca  gaat-
               Bactrian camel  gaat-
B D                     Horse  gaat-
B D          White rhinoceros  gaat-
B D                       Cat  gaat-
                Big brown bat  gaat-
              Star-nosed mole  caat-
B D           Tasmanian devil  ggat-
           Tibetan ground jay  gatc-
B D                   Chicken  gaaa-
B D        American alligator  gagg-
  D           Green seaturtle  gaag-
B D                    Lizard  aact-
        Burton's mouthbreeder  -aagc
B D                 Armadillo  =====
B D                     Panda  -----
              Golden hamster  =====
                Prairie vole  -----
B D                       Rat  -----
B D                     Mouse  =====
B D           Chinese hamster  =====
      Lesser Egyptian jerboa  =====
               Domestic goat  -----
B D                       Cow  -----
B D                     Sheep  =====
            Tibetan antelope  =====
        David's myotis (bat)  =====
                Killer whale  =====
                 Zebra mbuna  =====
         Pundamilia nyererei  =====
B D              Nile tilapia  =====
          Southern platyfish  =====
         Princess of Burundi  =====
B D              Atlantic cod  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  -----
B D                    Medaka  =====
B D                 Tetraodon  -----
                 Spotted gar  =====
B D                   Lamprey  =====
B D                 Zebrafish  =====
B D               Stickleback  =====
B D                   Ferret   -----
B D                  Squirrel  -----
            Black flying-fox  -----
B D                   Manatee  -----
B D                  Elephant  -----
  D              Mallard duck  -----
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D       Medium ground finch  =====
  D             Scarlet macaw  -----
  D                    Parrot  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  -----
B D                Budgerigar  =====
B D                  Platypus  =====
  D       Collared flycatcher  =====
            Cape golden mole  -----
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
                    Aardvark  =====
B D                   Wallaby  -----
B D                   Opossum  =====
B D                Coelacanth  =====
B D                       Dog  =====
              Pacific walrus  -----
            Brush-tailed rat  =====
          Chinese tree shrew  -----
                  Chinchilla  =====
B D             X. tropicalis  =====
    Mexican tetra (cavefish)  =====
                Weddell seal  -----
B D                   Dolphin  =====
B D                Guinea pig  =====
B D                   Gorilla  -----

Inserts between block 25 and 26 in window
          Tibetan ground jay 25bp
B D                  Chicken 19bp
B D       American alligator 24bp
  D          Green seaturtle 19bp

Alignment block 26 of 1111 in window, 149103006 - 149103026, 21 bps 
B D                     Human  ttaatg---aa-gggatta-----------ttggat
B D                     Chimp  ttaatg---aa-gggatta-----------ttggat
B D                 Orangutan  ttaatg---aaggggatta-----------ttggat
B D                    Gibbon  ------------------a-----------ttggat
B D                    Rhesus  ttaatg---aa-gggatta-----------gtggat
B D       Crab-eating macaque  ttaatg---aa-gggatta-----------gtggat
B D                    Baboon  ttaatg---aa-gggatta-----------ttggat
B D              Green monkey  ttaatg---aa-gggatta-----------tcggat
B D                  Marmoset  ttaatg---aa-gggattattactacgttcttggat
B D           Squirrel monkey  ttaatg---aa-gggattattactacgttcttggat
B D                  Bushbaby  ttaatg---aa-gggatta---ttatgctcttaaat
B D            Naked mole-rat  ttaatg---aa-gggactg---tcatacgctttggt
B D                    Rabbit  ttagta---ac-aagaata---tcacaggcttccat
B D                       Pig  ttaaga---aa-cggatca---ccatgctcttggac
B D                    Alpaca  ttaatg---aa-gggacca---ccatgctcttggat
               Bactrian camel  ttaatg---aa-gggacca---ccatgctcttggat
B D                     Horse  ttaatg---aa-gggatta---tcccactcttggat
B D          White rhinoceros  ttaatg---aa-gggatta---ctatgctcttggat
B D                       Cat  ttaata---ca-ggtatta---ccgtgctcttggat
                Big brown bat  tgaatg---aa-ggaatta---ccatgcttttggat
              Star-nosed mole  ttaaca---gc-ggcgcca--------cactcgggt
B D           Tasmanian devil  caaatgggtaa-aggattg--ttcacacctttagaa
           Tibetan ground jay  ctgagg---aa-ggcaccc-----------ttgggc
  D                    Parrot  catgta---aa-gtttctg-----------acaggc
B D                   Chicken  --aggg---ga-atatccg-----------ttcacc
B D        American alligator  tgagca---ac-atgcatg-----------gtcgta
  D           Green seaturtle  tggatg---ac-gctcttg-----------tcactg
B D                    Lizard  ttaacg---aa-acaacca-----------tcctct
        Burton's mouthbreeder  tgaatg---tg-agagttt-----------gccggt
B D                 Armadillo  ====================================
B D                     Panda  ------------------------------------
              Golden hamster  ====================================
                Prairie vole  ------------------------------------
B D                       Rat  ------------------------------------
B D                     Mouse  ====================================
B D           Chinese hamster  ====================================
      Lesser Egyptian jerboa  ====================================
               Domestic goat  ------------------------------------
B D                       Cow  ------------------------------------
B D                     Sheep  ====================================
            Tibetan antelope  ====================================
        David's myotis (bat)  ====================================
                Killer whale  ====================================
                 Zebra mbuna  ====================================
         Pundamilia nyererei  ====================================
B D              Nile tilapia  ====================================
          Southern platyfish  ====================================
         Princess of Burundi  ====================================
B D              Atlantic cod  ====================================
      Yellowbelly pufferfish  ====================================
B D                      Fugu  ------------------------------------
B D                    Medaka  ====================================
B D                 Tetraodon  ------------------------------------
                 Spotted gar  ====================================
B D                   Lamprey  ====================================
B D                 Zebrafish  ====================================
B D               Stickleback  ====================================
B D                   Ferret   ------------------------------------
B D                  Squirrel  ------------------------------------
            Black flying-fox  ------------------------------------
B D                   Manatee  ------------------------------------
B D                  Elephant  ------------------------------------
  D              Mallard duck  ------------------------------------
B D               Zebra finch  ====================================
  D    White-throated sparrow  ====================================
B D       Medium ground finch  ====================================
  D             Scarlet macaw  ------------------------------------
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D               Rock pigeon  ------------------------------------
B D                Budgerigar  ====================================
B D                  Platypus  ====================================
  D       Collared flycatcher  ====================================
            Cape golden mole  ------------------------------------
  D    Spiny softshell turtle  ====================================
  D  Chinese softshell turtle  ====================================
  D            Painted turtle  ====================================
                    Aardvark  ====================================
B D                   Wallaby  ------------------------------------
B D                   Opossum  ====================================
B D                Coelacanth  ====================================
B D                       Dog  ====================================
              Pacific walrus  ------------------------------------
            Brush-tailed rat  ====================================
          Chinese tree shrew  ------------------------------------
                  Chinchilla  ====================================
B D             X. tropicalis  ====================================
    Mexican tetra (cavefish)  ====================================
                Weddell seal  ------------------------------------
B D                   Dolphin  ====================================
B D                Guinea pig  ====================================
B D                   Gorilla  ------------------------------------

Alignment block 27 of 1111 in window, 149103027 - 149103044, 18 bps 
B D                     Human  ------------------------------------gacactg-----aa-gagatc-gtt
B D                     Chimp  ------------------------------------gacactg-----aa-gagatc-gtt
B D                 Orangutan  ------------------------------------gacactg-----aa-gagatc-gtt
B D                    Gibbon  ------------------------------------gacactg-----aa-gagatc-att
B D                    Rhesus  ------------------------------------gacactg-----aa-gggatctgtt
B D       Crab-eating macaque  ------------------------------------gacactg-----aa-gagatctgtt
B D                    Baboon  ------------------------------------gacactg-----aa-gagatctgct
B D              Green monkey  ------------------------------------gacactg-----aa-gagatctgtt
B D                  Marmoset  ------------------------------------gacaccg-----aa-gagatctgtt
B D           Squirrel monkey  ------------------------------------gacacca-----aa-gagatctgtt
B D                  Bushbaby  ------------------------------------ggcattg-----ga-aaaatctttt
B D            Naked mole-rat  ------------------------------------ggcatag-----aa-a----ctct-
B D                    Rabbit  ------------------------------------ggcactg-----aa-aa-atctttt
B D                       Pig  ------------------------------------gacactg-----aa-aaaaactcat
B D                    Alpaca  ------------------------------------gacactg------a-aaaaacccac
               Bactrian camel  ------------------------------------gacactg------a-aaaaacccac
B D                     Horse  ------------------------------------gacagtg------a-aaaaactgat
B D          White rhinoceros  ------------------------------------gacactg------a-aaaaactgat
B D                       Cat  ------------------------------------gacgctg------ctaaaaactgcc
B D                   Ferret   ------------------------------------------------------------t
                Big brown bat  ------------------------------------aacac----------aacagtggat
              Star-nosed mole  ------------------------------------gac--tg------a-gaaaactgat
B D                   Opossum  ------------------------------------ggccctc-----ag-ggaattggt-
B D           Tasmanian devil  ------------------------------------ggcacta-----aa-ggaatcaata
           Tibetan ground jay  ------------------------------------------------------------c
  D                    Parrot  ------------------------------------------------------------t
B D                   Chicken  ------------------------------------------------------------t
B D        American alligator  ------------------------------------------------------------a
  D           Green seaturtle  ------------------------------------------------------------t
B D                    Lizard  ------------------------------------------------------------g
        Burton's mouthbreeder  gaatacatttatatgatccacataaatgtccttcctggcgctttattaaa-aggaacact-
B D                 Armadillo  =============================================================
B D                     Panda  -------------------------------------------------------------
              Golden hamster  =============================================================
                Prairie vole  -------------------------------------------------------------
B D                       Rat  -------------------------------------------------------------
B D                     Mouse  =============================================================
B D           Chinese hamster  =============================================================
      Lesser Egyptian jerboa  =============================================================
               Domestic goat  -------------------------------------------------------------
B D                       Cow  -------------------------------------------------------------
B D                     Sheep  =============================================================
            Tibetan antelope  =============================================================
        David's myotis (bat)  =============================================================
                Killer whale  =============================================================
                 Zebra mbuna  =============================================================
         Pundamilia nyererei  =============================================================
B D              Nile tilapia  =============================================================
          Southern platyfish  =============================================================
         Princess of Burundi  =============================================================
B D              Atlantic cod  =============================================================
      Yellowbelly pufferfish  =============================================================
B D                      Fugu  -------------------------------------------------------------
B D                    Medaka  =============================================================
B D                 Tetraodon  -------------------------------------------------------------
                 Spotted gar  =============================================================
B D                   Lamprey  =============================================================
B D                 Zebrafish  =============================================================
B D               Stickleback  =============================================================
B D                  Squirrel  -------------------------------------------------------------
            Black flying-fox  -------------------------------------------------------------
B D                   Manatee  -------------------------------------------------------------
B D                  Elephant  -------------------------------------------------------------
  D              Mallard duck  -------------------------------------------------------------
B D               Zebra finch  =============================================================
  D    White-throated sparrow  =============================================================
B D       Medium ground finch  =============================================================
  D             Scarlet macaw  -------------------------------------------------------------
  D          Peregrine falcon  =============================================================
  D              Saker falcon  =============================================================
  D               Rock pigeon  -------------------------------------------------------------
B D                Budgerigar  =============================================================
B D                  Platypus  =============================================================
  D       Collared flycatcher  =============================================================
            Cape golden mole  -------------------------------------------------------------
  D    Spiny softshell turtle  =============================================================
  D  Chinese softshell turtle  =============================================================
  D            Painted turtle  =============================================================
                    Aardvark  =============================================================
B D                   Wallaby  -------------------------------------------------------------
B D                Coelacanth  =============================================================
B D                       Dog  =============================================================
              Pacific walrus  -------------------------------------------------------------
            Brush-tailed rat  =============================================================
          Chinese tree shrew  -------------------------------------------------------------
                  Chinchilla  =============================================================
B D             X. tropicalis  =============================================================
    Mexican tetra (cavefish)  =============================================================
                Weddell seal  -------------------------------------------------------------
B D                   Dolphin  =============================================================
B D                Guinea pig  =============================================================
B D                   Gorilla  -------------------------------------------------------------

Inserts between block 27 and 28 in window
          Tibetan ground jay 14bp
  D                   Parrot 21bp
B D                  Chicken 14bp
B D       American alligator 17bp
B D                   Lizard 21bp

Alignment block 28 of 1111 in window, 149103045 - 149103050, 6 bps 
B D                     Human  ggacta
B D                     Chimp  ggacta
B D                 Orangutan  ggacta
B D                    Gibbon  ggacta
B D                    Rhesus  ggacta
B D       Crab-eating macaque  ggacta
B D                    Baboon  ggacta
B D              Green monkey  ggacta
B D                  Marmoset  ggacca
B D           Squirrel monkey  ggacta
B D                  Bushbaby  ggatga
B D            Naked mole-rat  ---cta
B D                    Rabbit  atacta
B D                       Pig  gaaata
B D                    Alpaca  gaaata
               Bactrian camel  gaaata
B D                     Horse  gaaatc
B D          White rhinoceros  gaaatc
B D                       Cat  ggaatg
B D                   Ferret   ggagag
                 Weddell seal  -gaaag
                Big brown bat  gaaata
              Star-nosed mole  gaagtg
B D                   Opossum  atagta
B D           Tasmanian devil  agagca
           Tibetan ground jay  tcatca
  D                    Parrot  tcacta
B D                   Chicken  tgttga
B D        American alligator  tgatga
        Burton's mouthbreeder  gcatct
B D                 Armadillo  ======
B D                     Panda  ------
              Golden hamster  ======
                Prairie vole  ------
B D                       Rat  ------
B D                     Mouse  ======
B D           Chinese hamster  ======
      Lesser Egyptian jerboa  ======
               Domestic goat  ------
B D                       Cow  ------
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
                Killer whale  ======
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
B D              Nile tilapia  ======
          Southern platyfish  ======
         Princess of Burundi  ======
B D              Atlantic cod  ======
B D                    Lizard  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ------
B D                    Medaka  ======
B D                 Tetraodon  ------
                 Spotted gar  ======
B D                   Lamprey  ======
B D                 Zebrafish  ======
B D               Stickleback  ======
B D                  Squirrel  ------
            Black flying-fox  ------
B D                   Manatee  ------
B D                  Elephant  ------
  D              Mallard duck  ------
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D       Medium ground finch  ======
  D             Scarlet macaw  ------
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ------
B D                Budgerigar  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
            Cape golden mole  ------
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
                    Aardvark  ======
B D                   Wallaby  ------
B D                Coelacanth  ======
  D           Green seaturtle  ======
B D                       Dog  ======
              Pacific walrus  ------
            Brush-tailed rat  ======
          Chinese tree shrew  ------
                  Chinchilla  ======
B D             X. tropicalis  ======
    Mexican tetra (cavefish)  ======
B D                   Dolphin  ======
B D                Guinea pig  ======
B D                   Gorilla  ------

Inserts between block 28 and 29 in window
B D                  Ferret  1bp
                Weddell seal 2bp
          Tibetan ground jay 2bp
  D                   Parrot 1bp
B D                  Chicken 6bp
B D       American alligator 2bp

Alignment block 29 of 1111 in window, 149103051 - 149103072, 22 bps 
B D                     Human  gc----agatcagtgtga--------------------atgtttcc-----
B D                     Chimp  gc----agatcagtgtga----------------------gttccc-----
B D                 Orangutan  gc----agatcagtgtga--------------------atgtttcc-----
B D                    Gibbon  gc----agatcagtatga--------------------atgtttcc-----
B D                    Rhesus  gc----agatcagtataa--------------------atgtttcc-----
B D       Crab-eating macaque  gc----agatcagtataa--------------------atgtttcc-----
B D                    Baboon  gc----agatcagtataa--------------------atgtttcc-----
B D              Green monkey  gc----agatcagtataa--------------------atgtttcc-----
B D                  Marmoset  gc----agatcagtagaa------------a-------atgtgtcc-----
B D           Squirrel monkey  gc----agatcagtagaa------------a-------atgtttcc-----
B D                  Bushbaby  gc----agatcagtatac------------a-------atgtttct-----
B D            Naked mole-rat  gc----agatcagtgtaa------------a-------atgcttct-----
B D                    Rabbit  gc----agatgggtatac------------a-------atgtttct-----
B D                       Pig  ag----agaacagaatga------------a-------atgtttcc-----
B D                    Alpaca  ac----agaacagaataa------------a-------atgctcct-----
               Bactrian camel  ac------aacagaataa------------a-------atgttcct-----
B D                     Horse  ac----agaacaaa--ac------------a-------atgtt-ct-----
B D          White rhinoceros  ac----agaacgaagtag------------a-------atgttcct-----
B D                       Cat  gc----gg--cagagtcg------------a-------gtgtttct-----
B D                   Ferret   -----------------a------------a-------atgctcct-----
               Pacific walrus  gc----ag---agag-aa------------a-------atgttcct-----
                 Weddell seal  ------------------------------a-------atgttcct-----
                Big brown bat  gc----agaacagaataa------------a-------atgttcct-----
              Star-nosed mole  gc----ggaggagcacca------------g-------aagctcc------
B D                   Opossum  at----agtccattgtgc------------a-------actcttg------
B D           Tasmanian devil  atgtgaactcaaatgaaa------------a-------attattg------
           Tibetan ground jay  tt----acagaggttgga------------a-------aagacct------
  D                    Parrot  -c----aggtggttctgg------------a-------tcctcct------
B D                   Chicken  tt----tcttggatgtgg------------a-------t--ttct------
B D        American alligator  ------agggtgatgtga------------a-------agggttg------
B D                    Lizard  gt----ggcatgtcttggcagttcaaagaca-------tggttct------
        Burton's mouthbreeder  ------ggaaaaaagtgg------------atatgaggatgtacttttttg
B D                 Armadillo  ===================================================
B D                     Panda  ---------------------------------------------------
              Golden hamster  ===================================================
                Prairie vole  ---------------------------------------------------
B D                       Rat  ---------------------------------------------------
B D                     Mouse  ===================================================
B D           Chinese hamster  ===================================================
      Lesser Egyptian jerboa  ===================================================
               Domestic goat  ---------------------------------------------------
B D                       Cow  ---------------------------------------------------
B D                     Sheep  ===================================================
            Tibetan antelope  ===================================================
        David's myotis (bat)  ===================================================
                Killer whale  ===================================================
                 Zebra mbuna  ===================================================
         Pundamilia nyererei  ===================================================
B D              Nile tilapia  ===================================================
          Southern platyfish  ===================================================
         Princess of Burundi  ===================================================
B D              Atlantic cod  ===================================================
      Yellowbelly pufferfish  ===================================================
B D                      Fugu  ---------------------------------------------------
B D                    Medaka  ===================================================
B D                 Tetraodon  ---------------------------------------------------
                 Spotted gar  ===================================================
B D                   Lamprey  ===================================================
B D                 Zebrafish  ===================================================
B D               Stickleback  ===================================================
B D                  Squirrel  ---------------------------------------------------
            Black flying-fox  ---------------------------------------------------
B D                   Manatee  ---------------------------------------------------
B D                  Elephant  ---------------------------------------------------
  D              Mallard duck  ---------------------------------------------------
B D               Zebra finch  ===================================================
  D    White-throated sparrow  ===================================================
B D       Medium ground finch  ===================================================
  D             Scarlet macaw  ---------------------------------------------------
  D          Peregrine falcon  ===================================================
  D              Saker falcon  ===================================================
  D               Rock pigeon  ---------------------------------------------------
B D                Budgerigar  ===================================================
B D                  Platypus  ===================================================
  D       Collared flycatcher  ===================================================
            Cape golden mole  ---------------------------------------------------
  D    Spiny softshell turtle  ===================================================
  D  Chinese softshell turtle  ===================================================
  D            Painted turtle  ===================================================
                    Aardvark  ===================================================
B D                   Wallaby  ---------------------------------------------------
B D                Coelacanth  ===================================================
  D           Green seaturtle  ===================================================
B D                       Dog  ===================================================
            Brush-tailed rat  ===================================================
          Chinese tree shrew  ---------------------------------------------------
                  Chinchilla  ===================================================
B D             X. tropicalis  ===================================================
    Mexican tetra (cavefish)  ===================================================
B D                   Dolphin  ===================================================
B D                Guinea pig  ===================================================
B D                   Gorilla  ---------------------------------------------------

Inserts between block 29 and 30 in window
B D                  Opossum 14bp
B D          Tasmanian devil 1bp

Alignment block 30 of 1111 in window, 149103073 - 149103074, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  tc
B D            Naked mole-rat  tt
B D                    Rabbit  tc
B D                       Pig  cc
B D                    Alpaca  tc
               Bactrian camel  tc
B D                     Horse  tc
B D          White rhinoceros  tc
B D                       Cat  tc
B D                       Dog  tc
B D                   Ferret   tc
               Pacific walrus  tc
                 Weddell seal  tc
                Big brown bat  tc
              Star-nosed mole  tc
B D                   Opossum  t-
B D           Tasmanian devil  t-
           Tibetan ground jay  cc
  D                    Parrot  tc
B D                   Chicken  cc
B D        American alligator  ct
B D                    Lizard  tc
        Burton's mouthbreeder  tt
B D                 Armadillo  ==
B D                     Panda  --
              Golden hamster  ==
                Prairie vole  --
B D                       Rat  --
B D                     Mouse  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
               Domestic goat  --
B D                       Cow  --
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
                Killer whale  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D              Nile tilapia  ==
          Southern platyfish  ==
         Princess of Burundi  ==
B D              Atlantic cod  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  --
B D                    Medaka  ==
B D                 Tetraodon  --
                 Spotted gar  ==
B D                   Lamprey  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
B D                  Squirrel  --
            Black flying-fox  --
B D                   Manatee  --
B D                  Elephant  --
  D              Mallard duck  --
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
  D             Scarlet macaw  --
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  --
B D                Budgerigar  ==
B D                  Platypus  ==
  D       Collared flycatcher  ==
            Cape golden mole  --
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
                    Aardvark  ==
B D                   Wallaby  --
B D                Coelacanth  ==
  D           Green seaturtle  ==
            Brush-tailed rat  ==
          Chinese tree shrew  --
                  Chinchilla  ==
B D             X. tropicalis  ==
    Mexican tetra (cavefish)  ==
B D                   Dolphin  ==
B D                Guinea pig  ==
B D                   Gorilla  --

Inserts between block 30 and 31 in window
B D           Naked mole-rat 43bp
B D                  Opossum 7bp
B D          Tasmanian devil 7bp
          Tibetan ground jay 1bp
  D                   Parrot 1bp
B D                  Chicken 2bp
B D       American alligator 2bp
B D                   Lizard 1bp

Alignment block 31 of 1111 in window, 149103075 - 149103095, 21 bps 
B D                     Human  cacaactggcacgtc-------------tttcct
B D                     Chimp  cacaactggcatgtc-------------tttcct
B D                 Orangutan  cacaactggcaggtc-------------tttcct
B D                    Gibbon  cacaactggcaggtc-------------tttcct
B D                    Rhesus  catgactggcaggtc-------------tttccg
B D       Crab-eating macaque  catgactggcaggtc-------------tttccg
B D                    Baboon  catgactggcaggtc-------------tttcct
B D              Green monkey  catgactggcaggtc-------------tttcct
B D                  Marmoset  cacaactgggaggtt-------------tttcct
B D           Squirrel monkey  cacaactggaaggtt-------------tttcct
B D                  Bushbaby  taagtctggcaggcc-------------aggtct
B D            Naked mole-rat  catgacttgcag----------------------
B D                    Rabbit  catgaccggcag----------------------
B D                       Pig  tgtgactggcaagac-------------ttgccc
B D                    Alpaca  catgattggcaagac-------------atgccc
               Bactrian camel  catcattcgcaagac-------------atgccc
B D                     Horse  catgattgaccggcc-------------ttgccc
B D          White rhinoceros  catgactgacaggcc-------------ttgccc
B D                       Cat  cagaaccggcaggcg-------------tggtcc
B D                       Dog  cgtgatgggcagctc-------------ttgcct
B D                   Ferret   cctgactggcaggcc-------------tggccc
B D                     Panda  catgactggcaggcc-------------ctgccc
               Pacific walrus  catgactggcaaacc-------------ttgccc
                 Weddell seal  catgaccggcaggcc-------------ttgccc
                Big brown bat  catgactggcaggcc-------------ttgcct
              Star-nosed mole  --------------c-------------ttgccc
B D                   Opossum  gacaattagcaggtg-------------gtttt-
B D           Tasmanian devil  ggca---aagagagg-------------cttca-
           Tibetan ground jay  ----------aaact-------------atcc--
  D                    Parrot  ------------------------------cc--
B D                   Chicken  gttctctggtatccc-------------ctct--
B D        American alligator  taatagcaggggccg-------------gact--
B D                    Lizard  gtataacagctgagt-------------tacc--
        Burton's mouthbreeder  cacacctgtcagattcatgtgaaacatatttcca
B D                 Armadillo  ==================================
              Golden hamster  ==================================
                Prairie vole  ----------------------------------
B D                       Rat  ----------------------------------
B D                     Mouse  ==================================
B D           Chinese hamster  ==================================
      Lesser Egyptian jerboa  ==================================
               Domestic goat  ----------------------------------
B D                       Cow  ----------------------------------
B D                     Sheep  ==================================
            Tibetan antelope  ==================================
        David's myotis (bat)  ==================================
                Killer whale  ==================================
                 Zebra mbuna  ==================================
         Pundamilia nyererei  ==================================
B D              Nile tilapia  ==================================
          Southern platyfish  ==================================
         Princess of Burundi  ==================================
B D              Atlantic cod  ==================================
      Yellowbelly pufferfish  ==================================
B D                      Fugu  ----------------------------------
B D                    Medaka  ==================================
B D                 Tetraodon  ----------------------------------
                 Spotted gar  ==================================
B D                   Lamprey  ==================================
B D                 Zebrafish  ==================================
B D               Stickleback  ==================================
B D                  Squirrel  ----------------------------------
            Black flying-fox  ----------------------------------
B D                   Manatee  ----------------------------------
B D                  Elephant  ----------------------------------
  D              Mallard duck  ----------------------------------
B D               Zebra finch  ==================================
  D    White-throated sparrow  ==================================
B D       Medium ground finch  ==================================
  D             Scarlet macaw  ----------------------------------
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
  D               Rock pigeon  ----------------------------------
B D                Budgerigar  ==================================
B D                  Platypus  ==================================
  D       Collared flycatcher  ==================================
            Cape golden mole  ----------------------------------
  D    Spiny softshell turtle  ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================
                    Aardvark  ==================================
B D                   Wallaby  ----------------------------------
B D                Coelacanth  ==================================
  D           Green seaturtle  ==================================
            Brush-tailed rat  ==================================
          Chinese tree shrew  ----------------------------------
                  Chinchilla  ==================================
B D             X. tropicalis  ==================================
    Mexican tetra (cavefish)  ==================================
B D                   Dolphin  ==================================
B D                Guinea pig  ==================================
B D                   Gorilla  ----------------------------------

Alignment block 32 of 1111 in window, 149103096 - 149103102, 7 bps 
B D                     Human  -atgacga
B D                     Chimp  -atgacga
B D                 Orangutan  -atgacga
B D                    Gibbon  -aggacga
B D                    Rhesus  -atgagca
B D       Crab-eating macaque  -atgagca
B D                    Baboon  -atgagga
B D              Green monkey  -atgagga
B D                  Marmoset  -atgagga
B D           Squirrel monkey  -atgagga
B D                  Bushbaby  -atgaaga
B D                       Pig  -atgagca
B D                    Alpaca  -atgagat
               Bactrian camel  -atgagat
B D                     Horse  -atgagga
B D          White rhinoceros  -atgagga
B D                       Cat  -acgggaa
B D                       Dog  -gtgggaa
B D                   Ferret   -atgggga
B D                     Panda  -atgggga
               Pacific walrus  -atgggga
                 Weddell seal  -atgggga
                Big brown bat  -gtgacga
              Star-nosed mole  -gtcaggg
B D                 Armadillo  -atgaaga
B D                   Opossum  -atgtctg
B D           Tasmanian devil  -atgtaag
           Tibetan ground jay  --agtatt
  D                    Parrot  --tgggtt
B D                   Chicken  --ttggtg
B D        American alligator  --tgggag
B D                    Lizard  --tgtgtg
        Burton's mouthbreeder  cctgcac-
B D                    Rabbit  --------
              Golden hamster  ========
                Prairie vole  --------
B D                       Rat  --------
B D                     Mouse  ========
B D           Chinese hamster  ========
      Lesser Egyptian jerboa  ========
               Domestic goat  --------
B D                       Cow  --------
B D                     Sheep  ========
            Tibetan antelope  ========
        David's myotis (bat)  ========
                Killer whale  ========
                 Zebra mbuna  ========
         Pundamilia nyererei  ========
B D              Nile tilapia  ========
          Southern platyfish  ========
         Princess of Burundi  ========
B D              Atlantic cod  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  --------
B D                    Medaka  ========
B D                 Tetraodon  --------
                 Spotted gar  ========
B D                   Lamprey  ========
B D                 Zebrafish  ========
B D               Stickleback  ========
B D                  Squirrel  --------
            Black flying-fox  --------
B D                   Manatee  --------
B D                  Elephant  --------
  D              Mallard duck  --------
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D       Medium ground finch  ========
  D             Scarlet macaw  --------
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  --------
B D                Budgerigar  ========
B D                  Platypus  ========
  D       Collared flycatcher  ========
            Cape golden mole  --------
  D    Spiny softshell turtle  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
                    Aardvark  ========
B D                   Wallaby  --------
B D                Coelacanth  ========
  D           Green seaturtle  ========
            Brush-tailed rat  ========
          Chinese tree shrew  --------
                  Chinchilla  ========
B D             X. tropicalis  ========
    Mexican tetra (cavefish)  ========
B D                   Dolphin  ========
B D                Guinea pig  ========
B D            Naked mole-rat  --------
B D                   Gorilla  --------

Inserts between block 32 and 33 in window
          Tibetan ground jay 32bp
  D                   Parrot 12bp
B D                  Chicken 10bp
B D       American alligator 1bp
B D                   Lizard 15bp

Alignment block 33 of 1111 in window, 149103103 - 149103126, 24 bps 
B D                     Human  ----ttattg-agggagatgtctctttga
B D                     Chimp  ----ctattg-agggagatgtctctttga
B D                 Orangutan  ----ttattg-agggagat-tgtctttgc
B D                    Gibbon  ----ttattg-agggagatgtctctttga
B D                    Rhesus  ----ttattg-agggagatgtctctttga
B D       Crab-eating macaque  ----ttattg-agggagatgtctctttga
B D                    Baboon  ----ttattg-agggagatgtctctttga
B D              Green monkey  ----ttattg-agggagatgtctctttga
B D                  Marmoset  ----ttattgaagggtgatgtctctttga
B D           Squirrel monkey  ----ttattgaagggtgatgtctctt---
B D                  Bushbaby  ----ttaccagaggaaaatgcctccttga
B D            Naked mole-rat  ------------------tctgtctttgt
B D                    Rabbit  ------------------tatttcttcca
B D                       Pig  ----t--tagaggggaggtgtctctttgc
B D                    Alpaca  ----t-atagaggggagaggcctctttgt
               Bactrian camel  ----t-atagaggggagaggcctctttgt
B D                     Horse  ----ctacagaggggagatgcccctttga
B D          White rhinoceros  ----ctatagaggggagatgcccctttga
B D                       Cat  ----tcacaga-----gacgcctc-----
B D                       Dog  ----tcacagagggtagatgcctcttc--
B D                   Ferret   ----ttgcggagcggggatg---------
B D                     Panda  ----ttccagaggagagatgccccttt--
               Pacific walrus  ----ttacagaggggagatgcctcttt--
                 Weddell seal  ----ctacagaggggagatgcctcttt--
                Big brown bat  ----ttacagaggagagatgccta-----
              Star-nosed mole  ----ctgtggc-gggagaggcctccttgc
B D                 Armadillo  ----tcacaggggggagattcctctttga
B D                   Opossum  ----tccct-------gggttctctttgg
B D           Tasmanian devil  ----gctttagaaggaaggtactttacgg
B D        American alligator  ------------------ttgttcccagt
B D                    Lizard  -------------------------ttgt
        Burton's mouthbreeder  tttttaataaataggacatcaagc-----
              Golden hamster  =============================
                Prairie vole  -----------------------------
B D                       Rat  -----------------------------
B D                     Mouse  =============================
B D           Chinese hamster  =============================
      Lesser Egyptian jerboa  =============================
               Domestic goat  -----------------------------
B D                       Cow  -----------------------------
B D                     Sheep  =============================
            Tibetan antelope  =============================
        David's myotis (bat)  =============================
                Killer whale  =============================
                 Zebra mbuna  =============================
         Pundamilia nyererei  =============================
B D              Nile tilapia  =============================
          Southern platyfish  =============================
         Princess of Burundi  =============================
B D              Atlantic cod  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  -----------------------------
B D                    Medaka  =============================
B D                 Tetraodon  -----------------------------
                 Spotted gar  =============================
B D                   Lamprey  =============================
B D                 Zebrafish  =============================
B D               Stickleback  =============================
B D                  Squirrel  -----------------------------
            Black flying-fox  -----------------------------
B D                   Manatee  -----------------------------
B D                  Elephant  -----------------------------
  D              Mallard duck  -----------------------------
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
  D    White-throated sparrow  =============================
B D       Medium ground finch  =============================
B D                   Chicken  =============================
  D             Scarlet macaw  -----------------------------
  D                    Parrot  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D               Rock pigeon  -----------------------------
B D                Budgerigar  =============================
B D                  Platypus  =============================
  D       Collared flycatcher  =============================
            Cape golden mole  -----------------------------
  D    Spiny softshell turtle  =============================
  D  Chinese softshell turtle  =============================
  D            Painted turtle  =============================
                    Aardvark  =============================
B D                   Wallaby  -----------------------------
B D                Coelacanth  =============================