Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 163 in window, 46962768 - 46962768, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
           Chinese tree shrew  t
B D            Naked mole-rat  t
B D                    Alpaca  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
              Star-nosed mole  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  c
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
           Tibetan ground jay  t
  D                    Parrot  t
  D             Scarlet macaw  t
B D                    Turkey  c
B D        American alligator  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
B D                    Lizard  t
B D             X. tropicalis  c
B D                Coelacanth  t
B D                 Tetraodon  t
B D                    Medaka  t
           Southern platyfish  c
     Mexican tetra (cavefish)  t
                  Spotted gar  t
B D                  Hedgehog  =
              Golden hamster  =
         Cape elephant shrew  -
                Prairie vole  =
B D                     Panda  =
B D                      Pika  =
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                   Ferret   =
B D                       Dog  =
B D                       Cat  =
            Brush-tailed rat  =
B D                       Rat  =
B D                     Mouse  =
B D                 Armadillo  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Microbat  =
        David's myotis (bat)  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  -
                  Chinchilla  =
B D                Guinea pig  =
              Pacific walrus  =
              Bactrian camel  -
            Black flying-fox  =
B D                  Bushbaby  =
B D                   Dolphin  =
  D              Saker falcon  =
  D          Peregrine falcon  =
B D                Budgerigar  =
B D                   Chicken  =
B D           Squirrel monkey  =
            Cape golden mole  =
  D              Mallard duck  =
B D                   Megabat  =
                    Aardvark  =
                Weddell seal  =
B D               Zebra finch  =
  D               Rock pigeon  =
B D                  Platypus  =

Inserts between block 1 and 2 in window
    Mexican tetra (cavefish) 3bp
                 Spotted gar 3bp

Alignment block 2 of 163 in window, 46962769 - 46962829, 61 bps 
B D                     Human  tatcgtcgggagaatcttcccttgtagtctcgaattgccttggccatcagcggggcca-ct----t
B D                     Chimp  tatcgtcgggagaatcttcccttgtagtctcgaattgccttggccatcagcggggcca-ct----t
B D                   Gorilla  tatcgtcgggagaatcttcccttgtagtttcgaattgccttggccatcagcggggcca-ct----t
B D                 Orangutan  tatcgtcgggagaatcttctcttgtagtctcgaactgccttggccatcagcggggcca-ct----t
B D                    Gibbon  taccgtcgggagaatcttctcttgtagtctcgaactgccttggccatcagcggggcca-ct----t
B D                    Rhesus  gatcgttgggacaatctcctcttgtagtctggaattgccttggccatcagtggggcca-ct----t
B D       Crab-eating macaque  gatcgttgggacaatctcctcttgtagtctggaattgccttggccatcagtggggcca-ct----t
B D                    Baboon  gatcgttgggacaatttcctcttctagtctggaattgccttggccatcagtggggcca-ct----t
B D              Green monkey  tatcttcgggacaatctcctcttgtagtctcgaattcccttgaccatcagcggggccg-tt----t
B D                  Marmoset  tatcgtcgggagaatcttctcttgtagtctcgaatggccttggccatcagcggggcca-ct----t
           Chinese tree shrew  tatcttcgggagatactgttcttgaaatccctgattgtcttggccatcagcggggcaa-ct----t
B D            Naked mole-rat  cattttccggaga---ttttcttgtaatcttgcaaggtcttggccatcagagaggcga-tt----t
B D                    Alpaca  tatcatcgggagaatctgttcttgaaatctttaatggccttggccatcattggggcaa-tt----t
                 Killer whale  tactctcgggagaacctgttcttgaaatctttaattgtcttggccatcatgggggtga-tt----t
B D                     Horse  tatcgtcgggagaatctcttcttgaaatctttgattgtcttggccatcaatggggcaa-tt----t
B D          White rhinoceros  tatcgtcgagagaatcttttcttgaaatctttaattgtcttggccatcaacggggcaa-tt----t
              Star-nosed mole  taccttcggaagaatctgttcttgaagtctttaattgacttagccattagtggtgcag-tt----t
B D                   Opossum  tttcagcgggagaatctatttttgaaagccttgatggttttggccatcattggggcaa-ct----t
B D           Tasmanian devil  tatctccgggagaatctgttcttgaacg-cttgatcattgtggccatcattggggcaattt----t
B D                   Wallaby  tatcagtggaagaatcgatttttgaatgccttgacagttttggccatcattggggcag-gt----t
  D       Collared flycatcher  tatctccgagagaacctgtttttgaaagctttgatagtctttgccatcattggtgcaa-tt----t
  D    White-throated sparrow  tatctccgagagaacctgttcttgaaagctttgatagtctttgccatcattggtgcaa-tt----t
B D       Medium ground finch  tatctccgagagaacctgtttttgaaagctttgatagtctttgccatcattggtgcaa-tt----t
           Tibetan ground jay  tatctccgagagaacctgtttttgaaagctttgatagtctttgccatcattggtgcaa-tt----t
  D                    Parrot  tatctccgagagaacctgttcttgaaagctttgatagtctttgccatcatgggtgcaa-tt----t
  D             Scarlet macaw  tatctccgagagaacctgttcttgaaagctttgatagtctttgccatcatgggtgcaa-tt----t
B D                    Turkey  tatctcctggagaacctgtttttgaaagctttgatagtctttgccatcatgggtgcaa-tt----t
B D        American alligator  tatctccgagagaacctgtttttgaaagctttgatcgtctttgccatcatgggtgcaa-tt----t
  D           Green seaturtle  tatcttcgagagaacctgtttttgaatgctttgatagtcttcgccatcatgggtgcaa-tt----t
  D            Painted turtle  tatcttcgagagaacctgtttttgaatgctttgatagtctttgccatcatgggtgcaa-tt----t
  D  Chinese softshell turtle  tatcttcgagagaacctgtttttgaatgctttgatcgtctttgccatcatgggtgcga-tt----t
B D                    Lizard  tatctccgagaaaatctgttcttgaaggctttaatagtcttcgccatcattggtgcga-tt----t
B D             X. tropicalis  tatcgcctgaagaatctgtttttgaaagctttgatagttttggccatcattggtgcaa-ct----t
B D                Coelacanth  caccttcgggaaaagcggttcttaaatgccttgatcgtcttcgccatcatcggagcga-tt----t
B D                 Tetraodon  tatcggcgtgaaaatctgttcttgaatgccttgatagttttggccatcatagggccaa-tt-----
B D              Nile tilapia  taccggcgggagaatctgttcttgaatgctttgatagttttggccatcatgggggcga-tt-----
          Princess of Burundi  taccggcgggagaatctgttcttgaatgctttgatagttttggccatcatgggggcga-tt-----
        Burton's mouthbreeder  taccggcgggagaatctgttcttgaatgctttgatagttttggccatcatgggggcga-tt-----
                  Zebra mbuna  taccggcgggagaatctgttcttgaatgctttgatagttttggccatcatgggggcga-tt-----
          Pundamilia nyererei  taccggcgggagaatctgttcttgaatgctttgatagttttggccatcatgggggcga-tt-----
B D                    Medaka  taccggcgggagaatctgttcttgaacgctttgatggttttggccatcataggggcga-ttt----
           Southern platyfish  taccggcgggagaatcggttcttgaacgctttgatggttttcgccatcatgggggcaa-ttt----
B D               Stickleback  tatcggcgggagaatctgttcttgaaagctttgatagttttggccatcattggggcga-tt-t---
     Mexican tetra (cavefish)  taccgtcgagagaatctgttcttaaatgctttgatagttttagccatcataggggcaa-tt--t--
                  Spotted gar  tatcgtctggagaacctgttcttgaaagctttgatagttttggccatcatgggggcga-tc---t-
B D                  Hedgehog  ==================================================================
              Golden hamster  ==================================================================
         Cape elephant shrew  ------------------------------------------------------------------
                Prairie vole  ==================================================================
B D                     Panda  ==================================================================
B D                      Pika  ==================================================================
B D                    Rabbit  ==================================================================
      Lesser Egyptian jerboa  ==================================================================
B D                   Ferret   ==================================================================
B D                       Dog  ==================================================================
B D                       Cat  ==================================================================
            Brush-tailed rat  ==================================================================
B D                       Rat  ==================================================================
B D                     Mouse  ==================================================================
B D                 Armadillo  ==================================================================
B D                    Tenrec  ==================================================================
B D                   Manatee  ==================================================================
B D                  Elephant  ==================================================================
B D                  Microbat  ==================================================================
        David's myotis (bat)  ==================================================================
               Domestic goat  ------------------------------------------------------------------
B D                     Sheep  ------------------------------------------------------------------
B D                       Cow  ==================================================================
            Tibetan antelope  ------------------------------------------------------------------
                  Chinchilla  ==================================================================
B D                Guinea pig  ==================================================================
              Pacific walrus  ==================================================================
              Bactrian camel  ------------------------------------------------------------------
            Black flying-fox  ==================================================================
B D                  Bushbaby  ==================================================================
B D                   Dolphin  ==================================================================
  D              Saker falcon  ==================================================================
  D          Peregrine falcon  ==================================================================
B D                Budgerigar  ==================================================================
B D                   Chicken  ==================================================================
B D           Squirrel monkey  ==================================================================
            Cape golden mole  ==================================================================
  D              Mallard duck  ==================================================================
B D                   Megabat  ==================================================================
                    Aardvark  ==================================================================
                Weddell seal  ==================================================================
B D               Zebra finch  ==================================================================
  D               Rock pigeon  ==================================================================
B D                  Platypus  ==================================================================

Inserts between block 2 and 3 in window
  D      Collared flycatcher 1085bp
  D   White-throated sparrow 820bp
B D      Medium ground finch 936bp
          Tibetan ground jay 914bp
B D                   Turkey 1445bp
B D       American alligator 2495bp
  D          Green seaturtle 2337bp
  D           Painted turtle 3248bp
  D Chinese softshell turtle 5117bp
B D                   Lizard 2373bp
B D            X. tropicalis 2432bp
B D               Coelacanth 6114bp
B D                   Medaka 2221bp
    Mexican tetra (cavefish) 926bp
                 Spotted gar 3972bp

Alignment block 3 of 163 in window, 46962830 - 46962832, 3 bps 
B D                     Human  tct
B D                     Chimp  tcg
B D                   Gorilla  tct
B D                 Orangutan  tct
B D                    Gibbon  tct
B D                    Rhesus  tct
B D       Crab-eating macaque  tct
B D                    Baboon  tct
B D              Green monkey  tct
B D                  Marmoset  tct
           Chinese tree shrew  tct
B D            Naked mole-rat  tct
B D                    Alpaca  ttt
                 Killer whale  tct
B D                     Horse  tct
B D          White rhinoceros  tct
              Star-nosed mole  tct
B D                   Opossum  ttt
B D           Tasmanian devil  ttt
B D                   Wallaby  ggt
  D                    Parrot  ctg
  D             Scarlet macaw  ctg
B D                 Tetraodon  tct
B D              Nile tilapia  tct
          Princess of Burundi  tct
        Burton's mouthbreeder  tct
                  Zebra mbuna  tct
          Pundamilia nyererei  tct
           Southern platyfish  -ct
B D               Stickleback  -ct
B D                  Hedgehog  ===
              Golden hamster  ===
         Cape elephant shrew  ---
                Prairie vole  ===
B D                     Panda  ===
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                   Ferret   ===
B D                       Dog  ===
B D                       Cat  ===
            Brush-tailed rat  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                 Armadillo  ===
B D                    Tenrec  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
            Tibetan antelope  ---
                  Chinchilla  ===
B D                Guinea pig  ===
              Pacific walrus  ===
              Bactrian camel  ---
            Black flying-fox  ===
B D                  Bushbaby  ===
B D                   Dolphin  ===
B D                    Medaka  ===
  D              Saker falcon  ===
B D                Coelacanth  ===
                 Spotted gar  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
  D           Green seaturtle  ===
  D       Collared flycatcher  ===
B D             X. tropicalis  ===
B D                Budgerigar  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                    Turkey  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ===
          Tibetan ground jay  ===
            Cape golden mole  ===
  D              Mallard duck  ===
B D                   Megabat  ===
                    Aardvark  ===
                Weddell seal  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===
B D        American alligator  ===
B D                  Platypus  ===

Inserts between block 3 and 4 in window
B D                Tetraodon 8118bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
          Southern platyfish 1bp
B D              Stickleback 1bp

Alignment block 4 of 163 in window, 46962833 - 46962835, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tga
B D                 Orangutan  tgg
B D                    Gibbon  tgg
B D                    Rhesus  tgg
B D       Crab-eating macaque  tgg
B D                    Baboon  tgg
B D              Green monkey  tgg
B D                  Marmoset  ttg
           Chinese tree shrew  tcg
B D            Naked mole-rat  tgg
B D                    Alpaca  tcg
                 Killer whale  ttg
B D                     Horse  tcc
B D          White rhinoceros  tcg
              Star-nosed mole  tta
B D                   Opossum  ttg
B D           Tasmanian devil  tta
B D                   Wallaby  ttg
  D                    Parrot  caa
  D             Scarlet macaw  caa
B D              Nile tilapia  tag
          Princess of Burundi  tgg
        Burton's mouthbreeder  tgg
                  Zebra mbuna  tgg
          Pundamilia nyererei  tgg
           Southern platyfish  caa
B D               Stickleback  cag
B D                  Hedgehog  ===
              Golden hamster  ===
         Cape elephant shrew  ---
                Prairie vole  ===
B D                     Panda  ===
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                   Ferret   ===
B D                       Dog  ===
B D                       Cat  ===
            Brush-tailed rat  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                 Armadillo  ===
B D                    Tenrec  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
            Tibetan antelope  ---
                  Chinchilla  ===
B D                Guinea pig  ===
              Pacific walrus  ===
              Bactrian camel  ---
            Black flying-fox  ===
B D                  Bushbaby  ===
B D                   Dolphin  ===
B D                    Medaka  ===
  D              Saker falcon  ===
B D                 Tetraodon  ===
B D                Coelacanth  ===
                 Spotted gar  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
  D           Green seaturtle  ===
  D       Collared flycatcher  ===
B D             X. tropicalis  ===
B D                Budgerigar  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                    Turkey  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ===
          Tibetan ground jay  ===
            Cape golden mole  ===
  D              Mallard duck  ===
B D                   Megabat  ===
                    Aardvark  ===
                Weddell seal  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===
B D        American alligator  ===
B D                  Platypus  ===

Inserts between block 4 and 5 in window
B D             Nile tilapia 495bp
         Princess of Burundi 660bp
       Burton's mouthbreeder 652bp
                 Zebra mbuna 649bp
         Pundamilia nyererei 455bp

Alignment block 5 of 163 in window, 46962836 - 46962838, 3 bps 
B D                     Human  cag
B D                     Chimp  cag
B D                   Gorilla  cag
B D                 Orangutan  cag
B D                    Gibbon  cag
B D                    Rhesus  cag
B D       Crab-eating macaque  cag
B D                    Baboon  cag
B D              Green monkey  cag
B D                  Marmoset  cag
           Chinese tree shrew  cag
B D            Naked mole-rat  ctg
B D                    Alpaca  cag
                 Killer whale  cag
B D                     Horse  cag
B D          White rhinoceros  cag
              Star-nosed mole  cag
B D                   Opossum  cag
B D           Tasmanian devil  tgg
B D                   Wallaby  caa
  D                    Parrot  cag
  D             Scarlet macaw  cag
           Southern platyfish  cag
B D               Stickleback  gag
B D                  Hedgehog  ===
              Golden hamster  ===
         Cape elephant shrew  ---
                Prairie vole  ===
B D                     Panda  ===
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                   Ferret   ===
B D                       Dog  ===
B D                       Cat  ===
            Brush-tailed rat  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                 Armadillo  ===
B D                    Tenrec  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
            Tibetan antelope  ---
                  Chinchilla  ===
B D                Guinea pig  ===
              Pacific walrus  ===
              Bactrian camel  ---
            Black flying-fox  ===
B D                  Bushbaby  ===
B D                   Dolphin  ===
B D                    Medaka  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D              Saker falcon  ===
B D                 Tetraodon  ===
                 Zebra mbuna  ===
B D                Coelacanth  ===
                 Spotted gar  ===
    Mexican tetra (cavefish)  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
  D          Peregrine falcon  ===
  D           Green seaturtle  ===
  D       Collared flycatcher  ===
B D             X. tropicalis  ===
B D                Budgerigar  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                    Turkey  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ===
          Tibetan ground jay  ===
            Cape golden mole  ===
  D              Mallard duck  ===
B D                   Megabat  ===
                    Aardvark  ===
                Weddell seal  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===
B D        American alligator  ===
B D                  Platypus  ===

Inserts between block 5 and 6 in window
  D                   Parrot 885bp
  D            Scarlet macaw 1371bp
          Southern platyfish 668bp
B D              Stickleback 752bp

Alignment block 6 of 163 in window, 46962839 - 46962847, 9 bps 
B D                     Human  cctgttttc
B D                     Chimp  cctgttttc
B D                   Gorilla  cctgttttc
B D                 Orangutan  cctgtttcc
B D                    Gibbon  cctgtttcc
B D                    Rhesus  cccgtttct
B D       Crab-eating macaque  cccgtttct
B D                    Baboon  cccatttct
B D              Green monkey  ccggtttcc
B D                  Marmoset  cctgtttcc
           Chinese tree shrew  ctggtttcc
B D            Naked mole-rat  tgggtttcc
B D                    Alpaca  ---gttttc
                 Killer whale  ---gtttcc
B D                     Horse  ---gtttcc
B D          White rhinoceros  ---gtttcc
              Star-nosed mole  ---gcttct
B D                   Opossum  gggttctt-
B D           Tasmanian devil  gtggtttc-
B D                   Wallaby  ctgttttt-
B D                  Hedgehog  =========
              Golden hamster  =========
         Cape elephant shrew  ---------
                Prairie vole  =========
B D                     Panda  =========
B D                      Pika  =========
B D                    Rabbit  =========
      Lesser Egyptian jerboa  =========
B D                   Ferret   =========
B D                       Dog  =========
B D                       Cat  =========
            Brush-tailed rat  =========
B D                       Rat  =========
B D                     Mouse  =========
B D                 Armadillo  =========
B D                    Tenrec  =========
B D                   Manatee  =========
B D                  Elephant  =========
B D                  Microbat  =========
        David's myotis (bat)  =========
               Domestic goat  ---------
B D                     Sheep  ---------
B D                       Cow  =========
            Tibetan antelope  ---------
                  Chinchilla  =========
B D                Guinea pig  =========
              Pacific walrus  =========
              Bactrian camel  ---------
            Black flying-fox  =========
B D                  Bushbaby  =========
B D                   Dolphin  =========
B D                    Medaka  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
  D              Saker falcon  =========
B D                 Tetraodon  =========
                 Zebra mbuna  =========
B D                Coelacanth  =========
                 Spotted gar  =========
B D               Stickleback  =========
    Mexican tetra (cavefish)  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
  D          Peregrine falcon  =========
  D           Green seaturtle  =========
  D       Collared flycatcher  =========
          Southern platyfish  =========
B D             X. tropicalis  =========
B D                Budgerigar  =========
B D                   Chicken  =========
  D             Scarlet macaw  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
B D                    Turkey  =========
B D                    Lizard  =========
  D  Chinese softshell turtle  =========
B D           Squirrel monkey  =========
          Tibetan ground jay  =========
  D                    Parrot  =========
            Cape golden mole  =========
  D              Mallard duck  =========
B D                   Megabat  =========
                    Aardvark  =========
                Weddell seal  =========
  D            Painted turtle  =========
B D               Zebra finch  =========
  D               Rock pigeon  =========
B D        American alligator  =========
B D                  Platypus  =========

Inserts between block 6 and 7 in window
B D                  Opossum 19bp
B D          Tasmanian devil 19bp
B D                  Wallaby 115bp

Alignment block 7 of 163 in window, 46962848 - 46962854, 7 bps 
B D                     Human  gggtttt
B D                     Chimp  gggtttt
B D                   Gorilla  gggtttt
B D                 Orangutan  gggtctt
B D                    Gibbon  gggtgtt
B D                    Rhesus  gggtttt
B D       Crab-eating macaque  gggtttt
B D                    Baboon  gggtttt
B D              Green monkey  gtgtttt
B D                  Marmoset  ggatttt
           Chinese tree shrew  tggt---
B D            Naked mole-rat  tgatgtt
B D                    Alpaca  tgctgct
                 Killer whale  tgctgca
B D                     Horse  tgctgct
B D          White rhinoceros  tgttgct
              Star-nosed mole  tgctgct
B D                   Opossum  tgctact
B D           Tasmanian devil  tgcttct
B D                  Hedgehog  =======
              Golden hamster  =======
         Cape elephant shrew  -------
                Prairie vole  =======
B D                     Panda  =======
B D                      Pika  =======
B D                    Rabbit  =======
      Lesser Egyptian jerboa  =======
B D                   Ferret   =======
B D                       Dog  =======
B D                       Cat  =======
            Brush-tailed rat  =======
B D                       Rat  =======
B D                     Mouse  =======
B D                 Armadillo  =======
B D                    Tenrec  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
               Domestic goat  -------
B D                     Sheep  -------
B D                       Cow  =======
            Tibetan antelope  -------
                  Chinchilla  =======
B D                Guinea pig  =======
              Pacific walrus  =======
              Bactrian camel  -------
            Black flying-fox  =======
B D                  Bushbaby  =======
B D                   Dolphin  =======
B D                    Medaka  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D              Saker falcon  =======
B D                 Tetraodon  =======
                 Zebra mbuna  =======
B D                Coelacanth  =======
                 Spotted gar  =======
B D               Stickleback  =======
    Mexican tetra (cavefish)  =======
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
  D          Peregrine falcon  =======
  D           Green seaturtle  =======
  D       Collared flycatcher  =======
          Southern platyfish  =======
B D             X. tropicalis  =======
B D                Budgerigar  =======
B D                   Chicken  =======
  D             Scarlet macaw  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
B D                    Turkey  =======
B D                    Lizard  =======
  D  Chinese softshell turtle  =======
B D           Squirrel monkey  =======
          Tibetan ground jay  =======
  D                    Parrot  =======
B D                   Wallaby  =======
            Cape golden mole  =======
  D              Mallard duck  =======
B D                   Megabat  =======
                    Aardvark  =======
                Weddell seal  =======
  D            Painted turtle  =======
B D               Zebra finch  =======
  D               Rock pigeon  =======
B D        American alligator  =======
B D                  Platypus  =======

Inserts between block 7 and 8 in window
B D                   Rhesus 173bp

Alignment block 8 of 163 in window, 46962855 - 46962856, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gg
B D                    Gibbon  gg
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  gg
B D                  Marmoset  gg
B D            Naked mole-rat  gt
B D                    Alpaca  ga
                 Killer whale  ga
B D                     Horse  ga
B D          White rhinoceros  ga
              Star-nosed mole  gg
B D                   Opossum  gg
B D           Tasmanian devil  ga
B D                  Hedgehog  ==
              Golden hamster  ==
         Cape elephant shrew  --
                Prairie vole  ==
B D                     Panda  ==
B D                      Pika  ==
B D                    Rabbit  ==
      Lesser Egyptian jerboa  ==
B D                   Ferret   ==
B D                       Dog  ==
B D                       Cat  ==
          Chinese tree shrew  --
            Brush-tailed rat  ==
B D                       Rat  ==
B D                     Mouse  ==
B D                 Armadillo  ==
B D                    Tenrec  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
            Tibetan antelope  --
                  Chinchilla  ==
B D                Guinea pig  ==
              Pacific walrus  ==
              Bactrian camel  --
            Black flying-fox  ==
B D                  Bushbaby  ==
B D                   Dolphin  ==
B D                    Medaka  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D              Saker falcon  ==
B D                 Tetraodon  ==
                 Zebra mbuna  ==
B D                Coelacanth  ==
                 Spotted gar  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
  D          Peregrine falcon  ==
  D           Green seaturtle  ==
  D       Collared flycatcher  ==
          Southern platyfish  ==
B D             X. tropicalis  ==
B D                Budgerigar  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                    Turkey  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  ==
          Tibetan ground jay  ==
  D                    Parrot  ==
B D                   Wallaby  ==
            Cape golden mole  ==
  D              Mallard duck  ==
B D                   Megabat  ==
                    Aardvark  ==
                Weddell seal  ==
B D                    Rhesus  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D               Rock pigeon  ==
B D        American alligator  ==
B D                  Platypus  ==

Inserts between block 8 and 9 in window
B D           Naked mole-rat 416bp

Alignment block 9 of 163 in window, 46962857 - 46962868, 12 bps 
B D                     Human  ccg------------------------cg---ggcgccg
B D                     Chimp  ccg------------------------cg---ggcgccg
B D                   Gorilla  ccg------------------------cg---ggcgccg
B D                 Orangutan  ccg------------------------cg---ggcgccg
B D                    Gibbon  ccg------------------------cg---ggcgccc
B D       Crab-eating macaque  cgggcgcctgagctcattgctgctgctca---ggcagcg
B D                    Baboon  cgggcgcctgagctcattgctgctgctca---ggcagcg
B D              Green monkey  cgg------------------------cg---ggcaccg
B D                  Marmoset  cct------------------------ca---ggtgtcg
           Chinese tree shrew  -------------------------cacc---tgtgccg
B D                    Alpaca  cca------------------------ca---cgcatca
                 Killer whale  cta------------------------cc---cgcggca
B D                     Horse  cca------------------------cc---tgcacca
B D          White rhinoceros  cca------------------------cc---ttcacca
              Star-nosed mole  caa------------------------cc---tgcaccc
B D                   Opossum  ---------------------------ct---gatgctg
B D           Tasmanian devil  ---------------------------ctgcaggggccg
B D                  Hedgehog  =======================================
              Golden hamster  =======================================
         Cape elephant shrew  ---------------------------------------
                Prairie vole  =======================================
B D                     Panda  =======================================
B D                      Pika  =======================================
B D                    Rabbit  =======================================
B D            Naked mole-rat  =======================================
      Lesser Egyptian jerboa  =======================================
B D                   Ferret   =======================================
B D                       Dog  =======================================
B D                       Cat  =======================================
            Brush-tailed rat  =======================================
B D                       Rat  =======================================
B D                     Mouse  =======================================
B D                 Armadillo  =======================================
B D                    Tenrec  =======================================
B D                   Manatee  =======================================
B D                  Elephant  =======================================
B D                  Microbat  =======================================
        David's myotis (bat)  =======================================
               Domestic goat  ---------------------------------------
B D                     Sheep  ---------------------------------------
B D                       Cow  =======================================
            Tibetan antelope  ---------------------------------------
                  Chinchilla  =======================================
B D                Guinea pig  =======================================
              Pacific walrus  =======================================
              Bactrian camel  ---------------------------------------
            Black flying-fox  =======================================
B D                  Bushbaby  =======================================
B D                   Dolphin  =======================================
B D                    Medaka  =======================================
         Princess of Burundi  =======================================
B D              Nile tilapia  =======================================
  D              Saker falcon  =======================================
B D                 Tetraodon  =======================================
                 Zebra mbuna  =======================================
B D                Coelacanth  =======================================
                 Spotted gar  =======================================
B D               Stickleback  =======================================
    Mexican tetra (cavefish)  =======================================
         Pundamilia nyererei  =======================================
       Burton's mouthbreeder  =======================================
  D          Peregrine falcon  =======================================
  D           Green seaturtle  =======================================
  D       Collared flycatcher  =======================================
          Southern platyfish  =======================================
B D             X. tropicalis  =======================================
B D                Budgerigar  =======================================
B D                   Chicken  =======================================
  D             Scarlet macaw  =======================================
B D       Medium ground finch  =======================================
  D    White-throated sparrow  =======================================
B D                    Turkey  =======================================
B D                    Lizard  =======================================
  D  Chinese softshell turtle  =======================================
B D           Squirrel monkey  =======================================
          Tibetan ground jay  =======================================
  D                    Parrot  =======================================
B D                   Wallaby  =======================================
            Cape golden mole  =======================================
  D              Mallard duck  =======================================
B D                   Megabat  =======================================
                    Aardvark  =======================================
                Weddell seal  =======================================
B D                    Rhesus  =======================================
  D            Painted turtle  =======================================
B D               Zebra finch  =======================================
  D               Rock pigeon  =======================================
B D        American alligator  =======================================
B D                  Platypus  =======================================

Inserts between block 9 and 10 in window
B D      Crab-eating macaque 42bp
B D                   Baboon 42bp
B D             Green monkey 3167bp

Alignment block 10 of 163 in window, 46962869 - 46962876, 8 bps 
B D                     Human  cgtgccgg-
B D                     Chimp  cgtgctga-
B D                   Gorilla  catgctcg-
B D                 Orangutan  cgtgctca-
B D                    Gibbon  cgtcctca-
B D       Crab-eating macaque  cctgctgc-
B D                    Baboon  cgtgctgc-
B D                  Marmoset  cctgcgca-
           Chinese tree shrew  ggtgagca-
B D                    Alpaca  aatgggta-
                 Killer whale  agtgggta-
B D                     Horse  gctgggca-
B D          White rhinoceros  agtgggca-
              Star-nosed mole  actgggaa-
B D                   Opossum  -attgaaaa
B D           Tasmanian devil  -ttgtaggg
B D                  Hedgehog  =========
              Golden hamster  =========
         Cape elephant shrew  ---------
                Prairie vole  =========
B D                     Panda  =========
B D                      Pika  =========
B D                    Rabbit  =========
B D            Naked mole-rat  =========
      Lesser Egyptian jerboa  =========
B D                   Ferret   =========
B D                       Dog  =========
B D                       Cat  =========
            Brush-tailed rat  =========
B D                       Rat  =========
B D                     Mouse  =========
B D                 Armadillo  =========
B D                    Tenrec  =========
B D                   Manatee  =========
B D                  Elephant  =========
B D                  Microbat  =========
        David's myotis (bat)  =========
               Domestic goat  ---------
B D                     Sheep  ---------
B D                       Cow  =========
            Tibetan antelope  ---------
                  Chinchilla  =========
B D                Guinea pig  =========
              Pacific walrus  =========
              Bactrian camel  ---------
            Black flying-fox  =========
B D                  Bushbaby  =========
B D                   Dolphin  =========
B D                    Medaka  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
  D              Saker falcon  =========
B D                 Tetraodon  =========
                 Zebra mbuna  =========
B D                Coelacanth  =========
                 Spotted gar  =========
B D               Stickleback  =========
    Mexican tetra (cavefish)  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
  D          Peregrine falcon  =========
  D           Green seaturtle  =========
  D       Collared flycatcher  =========
          Southern platyfish  =========
B D             X. tropicalis  =========
B D                Budgerigar  =========
B D                   Chicken  =========
  D             Scarlet macaw  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
B D                    Turkey  =========
B D                    Lizard  =========
  D  Chinese softshell turtle  =========
B D           Squirrel monkey  =========
          Tibetan ground jay  =========
  D                    Parrot  =========
B D                   Wallaby  =========
            Cape golden mole  =========
  D              Mallard duck  =========
B D                   Megabat  =========
B D              Green monkey  =========
                    Aardvark  =========
                Weddell seal  =========
B D                    Rhesus  =========
  D            Painted turtle  =========
B D               Zebra finch  =========
  D               Rock pigeon  =========
B D        American alligator  =========
B D                  Platypus  =========

Inserts between block 10 and 11 in window
B D                  Gorilla 1778bp
B D                   Gibbon 45bp
B D      Crab-eating macaque 5bp
B D                   Baboon 5bp

Alignment block 11 of 163 in window, 46962877 - 46962877, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D       Crab-eating macaque  c
B D                    Baboon  c
B D                  Marmoset  t
           Chinese tree shrew  c
B D                    Alpaca  c
                 Killer whale  c
B D                     Horse  c
B D          White rhinoceros  c
              Star-nosed mole  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                  Hedgehog  =
              Golden hamster  =
         Cape elephant shrew  -
                Prairie vole  =
B D                     Panda  =
B D                      Pika  =
B D                    Rabbit  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                   Ferret   =
B D                       Dog  =
B D                       Cat  =
            Brush-tailed rat  =
B D                       Rat  =
B D                     Mouse  =
B D                 Armadillo  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Microbat  =
        David's myotis (bat)  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  -
                  Chinchilla  =
B D                Guinea pig  =
              Pacific walrus  =
              Bactrian camel  -
            Black flying-fox  =
B D                  Bushbaby  =
B D                   Dolphin  =
B D                    Medaka  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D              Saker falcon  =
B D                 Tetraodon  =
                 Zebra mbuna  =
B D                Coelacanth  =
                 Spotted gar  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
  D          Peregrine falcon  =
  D           Green seaturtle  =
  D       Collared flycatcher  =
          Southern platyfish  =
B D             X. tropicalis  =
B D                Budgerigar  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
          Tibetan ground jay  =
  D                    Parrot  =
B D                   Wallaby  =
            Cape golden mole  =
  D              Mallard duck  =
B D                   Megabat  =
B D              Green monkey  =
                    Aardvark  =
                Weddell seal  =
B D                    Rhesus  =
  D            Painted turtle  =
B D               Zebra finch  =
  D               Rock pigeon  =
B D        American alligator  =
B D                  Platypus  =

Inserts between block 11 and 12 in window
B D                   Gibbon 1537bp

Alignment block 12 of 163 in window, 46962878 - 46962887, 10 bps 
B D                     Human  tgctgct---------------------------------------------gcc
B D                     Chimp  tgctgct------------------------------------------------
B D                   Gorilla  tgctgct------------------------------------------------
B D                 Orangutan  tgctgctgctcaggcaggggttggcccgcttctcagggagcccgtgaaggacgct
B D                    Gibbon  tgctgct---------------------------------------------gct
B D       Crab-eating macaque  tgctact---------------------------------------------gcc
B D                    Baboon  tgctact---------------------------------------------gcc
B D                  Marmoset  tgctgca---------------------------------------------gct
           Chinese tree shrew  tgctggg---------------------------------------------att
B D                    Alpaca  tagtggt---------------------------------------------gct
                 Killer whale  tggtggt---------------------------------------------gct
B D                     Horse  tggtggt---------------------------------------------gcc
B D          White rhinoceros  tgctggt---------------------------------------------gcc
              Star-nosed mole  tgctggt---------------------------------------------gcc
B D                   Opossum  cgccagt---------------------------------------------gtt
B D           Tasmanian devil  tgccctt---------------------------------------------cct
B D                  Hedgehog  =======================================================
              Golden hamster  =======================================================
         Cape elephant shrew  -------------------------------------------------------
                Prairie vole  =======================================================
B D                     Panda  =======================================================
B D                      Pika  =======================================================
B D                    Rabbit  =======================================================
B D            Naked mole-rat  =======================================================
      Lesser Egyptian jerboa  =======================================================
B D                   Ferret   =======================================================
B D                       Dog  =======================================================
B D                       Cat  =======================================================
            Brush-tailed rat  =======================================================
B D                       Rat  =======================================================
B D                     Mouse  =======================================================
B D                 Armadillo  =======================================================
B D                    Tenrec  =======================================================
B D                   Manatee  =======================================================
B D                  Elephant  =======================================================
B D                  Microbat  =======================================================
        David's myotis (bat)  =======================================================
               Domestic goat  -------------------------------------------------------
B D                     Sheep  -------------------------------------------------------
B D                       Cow  =======================================================
            Tibetan antelope  -------------------------------------------------------
                  Chinchilla  =======================================================
B D                Guinea pig  =======================================================
              Pacific walrus  =======================================================
              Bactrian camel  -------------------------------------------------------
            Black flying-fox  =======================================================
B D                  Bushbaby  =======================================================
B D                   Dolphin  =======================================================
B D                    Medaka  =======================================================
         Princess of Burundi  =======================================================
B D              Nile tilapia  =======================================================
  D              Saker falcon  =======================================================
B D                 Tetraodon  =======================================================
                 Zebra mbuna  =======================================================
B D                Coelacanth  =======================================================
                 Spotted gar  =======================================================
B D               Stickleback  =======================================================
    Mexican tetra (cavefish)  =======================================================
         Pundamilia nyererei  =======================================================
       Burton's mouthbreeder  =======================================================
  D          Peregrine falcon  =======================================================
  D           Green seaturtle  =======================================================
  D       Collared flycatcher  =======================================================
          Southern platyfish  =======================================================
B D             X. tropicalis  =======================================================
B D                Budgerigar  =======================================================
B D                   Chicken  =======================================================
  D             Scarlet macaw  =======================================================
B D       Medium ground finch  =======================================================
  D    White-throated sparrow  =======================================================
B D                    Turkey  =======================================================
B D                    Lizard  =======================================================
  D  Chinese softshell turtle  =======================================================
B D           Squirrel monkey  =======================================================
          Tibetan ground jay  =======================================================
  D                    Parrot  =======================================================
B D                   Wallaby  =======================================================
            Cape golden mole  =======================================================
  D              Mallard duck  =======================================================
B D                   Megabat  =======================================================
B D              Green monkey  =======================================================
                    Aardvark  =======================================================
                Weddell seal  =======================================================
B D                    Rhesus  =======================================================
  D            Painted turtle  =======================================================
B D               Zebra finch  =======================================================
  D               Rock pigeon  =======================================================
B D        American alligator  =======================================================
B D                  Platypus  =======================================================

Alignment block 13 of 163 in window, 46962888 - 46962913, 26 bps 
B D                     Human  gccgccgctc------------------------------acgctgccgccgtcgc
B D                     Chimp  gccgccgcta------------------------------atgctgccgccgtcgc
B D                   Gorilla  gccgccgcta------------------------------atgctgccgccgccgc
B D                 Orangutan  gctgctgctg------------------------------cctctgccaccgctgc
B D                    Gibbon  gccgccgctaatg---------------------------acgccgcccccgccgc
B D       Crab-eating macaque  actaccactgagggccgacccctc----------------aggctgccaccgcccc
B D                    Baboon  actgccactgagggccgacccctc----------------aggctgccaccgcccc
B D                  Marmoset  caggcaggcataggcacgcttctcagggagcctgggaaggccgctgtcggcgctgc
           Chinese tree shrew  tgggcagtcaaaggctggcttctcaggggtggggtta---agtctgctactgctgc
B D                    Alpaca  tgggcaggcataggccggcttctcgtggatgaggtca---aggctatagttgtt--
                 Killer whale  tgagcaggctctggctggctcctcatgggtgaggtta---aggctgtttctgct--
B D                     Horse  tgggcagtcagagcccagcttctcagagatgaggtta---atgctgttgctgctgg
B D          White rhinoceros  tgggcagtcagaggccggcttctcagggacgaggtta---ccgctgttgctgctgg
              Star-nosed mole  tg------------------------aggtgggctca---atgctgcagccactgt
B D                   Opossum  tgggccagcatgtggctggacagc------------------actgtgaccatagt
B D           Tasmanian devil  tgg-------cgctgctgcacccc----------------ctgctgcagatgtagc
B D        American alligator  ---gccaccacccagacagcaatc----------------acgtggtagc------
B D                  Hedgehog  ========================================================
              Golden hamster  ========================================================
         Cape elephant shrew  --------------------------------------------------------
                Prairie vole  ========================================================
B D                     Panda  ========================================================
B D                      Pika  ========================================================
B D                    Rabbit  ========================================================
B D            Naked mole-rat  ========================================================
      Lesser Egyptian jerboa  ========================================================
B D                   Ferret   ========================================================
B D                       Dog  ========================================================
B D                       Cat  ========================================================
            Brush-tailed rat  ========================================================
B D                       Rat  ========================================================
B D                     Mouse  ========================================================
B D                 Armadillo  ========================================================
B D                    Tenrec  ========================================================
B D                   Manatee  ========================================================
B D                  Elephant  ========================================================
B D                  Microbat  ========================================================
        David's myotis (bat)  ========================================================
               Domestic goat  --------------------------------------------------------
B D                     Sheep  --------------------------------------------------------
B D                       Cow  ========================================================
            Tibetan antelope  --------------------------------------------------------
                  Chinchilla  ========================================================
B D                Guinea pig  ========================================================
              Pacific walrus  ========================================================
              Bactrian camel  --------------------------------------------------------
            Black flying-fox  ========================================================
B D                  Bushbaby  ========================================================
B D                   Dolphin  ========================================================
B D                    Medaka  ========================================================
         Princess of Burundi  ========================================================
B D              Nile tilapia  ========================================================
  D              Saker falcon  ========================================================
B D                 Tetraodon  ========================================================
                 Zebra mbuna  ========================================================
B D                Coelacanth  ========================================================
                 Spotted gar  ========================================================
B D               Stickleback  ========================================================
    Mexican tetra (cavefish)  ========================================================
         Pundamilia nyererei  ========================================================
       Burton's mouthbreeder  ========================================================
  D          Peregrine falcon  ========================================================
  D           Green seaturtle  ========================================================
  D       Collared flycatcher  ========================================================
          Southern platyfish  ========================================================
B D             X. tropicalis  ========================================================
B D                Budgerigar  ========================================================
B D                   Chicken  ========================================================
  D             Scarlet macaw  ========================================================
B D       Medium ground finch  ========================================================
  D    White-throated sparrow  ========================================================
B D                    Turkey  ========================================================
B D                    Lizard  ========================================================
  D  Chinese softshell turtle  ========================================================
B D           Squirrel monkey  ========================================================
          Tibetan ground jay  ========================================================
  D                    Parrot  ========================================================
B D                   Wallaby  ========================================================
            Cape golden mole  ========================================================
  D              Mallard duck  ========================================================
B D                   Megabat  ========================================================
B D              Green monkey  ========================================================
                    Aardvark  ========================================================
                Weddell seal  ========================================================
B D                    Rhesus  ========================================================
  D            Painted turtle  ========================================================
B D               Zebra finch  ========================================================
  D               Rock pigeon  ========================================================
B D                  Platypus  ========================================================

Inserts between block 13 and 14 in window
B D       American alligator 1bp

Alignment block 14 of 163 in window, 46962914 - 46962922, 9 bps 
B D                     Human  -cgtccccga
B D                     Chimp  -cgtccccga
B D                   Gorilla  -cttccccga
B D                 Orangutan  -tgctgccct
B D                    Gibbon  -cgtccccga
B D       Crab-eating macaque  -tatcaccac
B D                    Baboon  -tatcaccac
B D                  Marmoset  -cgccccca-
           Chinese tree shrew  -tg-------
B D                     Horse  -cac------
B D          White rhinoceros  -cac------
              Star-nosed mole  -cac------
B D                   Opossum  -gggtggttg
B D           Tasmanian devil  -tattgctgg
  D    White-throated sparrow  cctctcctg-
B D        American alligator  cccatccca-
B D                  Hedgehog  ==========
              Golden hamster  ==========
         Cape elephant shrew  ----------
                Prairie vole  ==========
B D                     Panda  ==========
B D                      Pika  ==========
B D                    Rabbit  ==========
B D            Naked mole-rat  ==========
      Lesser Egyptian jerboa  ==========
B D                   Ferret   ==========
B D                       Dog  ==========
B D                       Cat  ==========
            Brush-tailed rat  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
B D                 Armadillo  ==========
B D                    Tenrec  ==========
B D                   Manatee  ==========
B D                  Elephant  ==========
B D                  Microbat  ==========
        David's myotis (bat)  ==========
               Domestic goat  ----------
B D                     Sheep  ----------
B D                       Cow  ==========
            Tibetan antelope  ----------
                  Chinchilla  ==========
B D                Guinea pig  ==========
              Pacific walrus  ==========
              Bactrian camel  ----------
B D                    Alpaca  ----------
                Killer whale  ----------
            Black flying-fox  ==========
B D                  Bushbaby  ==========
B D                   Dolphin  ==========
B D                    Medaka  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
  D              Saker falcon  ==========
B D                 Tetraodon  ==========
                 Zebra mbuna  ==========
B D                Coelacanth  ==========
                 Spotted gar  ==========
B D               Stickleback  ==========
    Mexican tetra (cavefish)  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
  D          Peregrine falcon  ==========
  D           Green seaturtle  ==========
  D       Collared flycatcher  ==========
          Southern platyfish  ==========
B D             X. tropicalis  ==========
B D                Budgerigar  ==========
B D                   Chicken  ==========
  D             Scarlet macaw  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
B D                    Lizard  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  ==========
          Tibetan ground jay  ==========
  D                    Parrot  ==========
B D                   Wallaby  ==========
            Cape golden mole  ==========
  D              Mallard duck  ==========
B D                   Megabat  ==========
B D              Green monkey  ==========
                    Aardvark  ==========
                Weddell seal  ==========
B D                    Rhesus  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
  D               Rock pigeon  ==========
B D                  Platypus  ==========

Inserts between block 14 and 15 in window
B D                   Gibbon 15bp

Alignment block 15 of 163 in window, 46962923 - 46962927, 5 bps 
B D                     Human  ggccg
B D                     Chimp  ggccg
B D                   Gorilla  ggccg
B D                 Orangutan  ggctg
B D                    Gibbon  ggctg
B D       Crab-eating macaque  ggccc
B D                    Baboon  tgccc
B D              Green monkey  ggctg
B D                  Marmoset  --ttg
           Chinese tree shrew  --ctg
B D                    Alpaca  ----g
                 Killer whale  ----g
B D                     Horse  tgtgg
B D          White rhinoceros  agctg
              Star-nosed mole  tgctg
B D                   Opossum  gggtg
B D           Tasmanian devil  aggtg
  D    White-throated sparrow  agctt
B D        American alligator  ggctg
B D                  Hedgehog  =====
              Golden hamster  =====
         Cape elephant shrew  -----
                Prairie vole  =====
B D                     Panda  =====
B D                      Pika  =====
B D                    Rabbit  =====
B D            Naked mole-rat  =====
      Lesser Egyptian jerboa  =====
B D                   Ferret   =====
B D                       Dog  =====
B D                       Cat  =====
            Brush-tailed rat  =====
B D                       Rat  =====
B D                     Mouse  =====
B D                 Armadillo  =====
B D                    Tenrec  =====
B D                   Manatee  =====
B D                  Elephant  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
               Domestic goat  -----
B D                     Sheep  -----
B D                       Cow  =====
            Tibetan antelope  -----
                  Chinchilla  =====
B D                Guinea pig  =====
              Pacific walrus  =====
              Bactrian camel  -----
            Black flying-fox  =====
B D                  Bushbaby  =====
B D                   Dolphin  =====
B D                    Medaka  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D              Saker falcon  =====
B D                 Tetraodon  =====
                 Zebra mbuna  =====
B D                Coelacanth  =====
                 Spotted gar  =====
B D               Stickleback  =====
    Mexican tetra (cavefish)  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
  D          Peregrine falcon  =====
  D           Green seaturtle  =====
  D       Collared flycatcher  =====
          Southern platyfish  =====
B D             X. tropicalis  =====
B D                Budgerigar  =====
B D                   Chicken  =====
  D             Scarlet macaw  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
B D                    Lizard  =====
  D  Chinese softshell turtle  =====
B D           Squirrel monkey  =====
          Tibetan ground jay  =====
  D                    Parrot  =====
B D                   Wallaby  =====
            Cape golden mole  =====
  D              Mallard duck  =====
B D                   Megabat  =====
                    Aardvark  =====
                Weddell seal  =====
B D                    Rhesus  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D               Rock pigeon  =====
B D                  Platypus  =====

Inserts between block 15 and 16 in window
B D      Crab-eating macaque 15bp
B D                   Baboon 15bp

Alignment block 16 of 163 in window, 46962928 - 46962928, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
           Chinese tree shrew  g
B D                    Alpaca  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
              Star-nosed mole  g
  D    White-throated sparrow  c
B D        American alligator  g
B D                  Hedgehog  =
              Golden hamster  =
         Cape elephant shrew  -
                Prairie vole  =
B D                     Panda  =
B D                      Pika  =
B D                    Rabbit  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                   Ferret   =
B D                       Dog  =
B D                       Cat  =
            Brush-tailed rat  =
B D                       Rat  =
B D                     Mouse  =
B D                 Armadillo  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Microbat  =
        David's myotis (bat)  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  -
                  Chinchilla  =
B D                Guinea pig  =
              Pacific walrus  =
              Bactrian camel  -
            Black flying-fox  =
B D                  Bushbaby  =
B D                   Dolphin  =
B D                    Medaka  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D              Saker falcon  =
B D                 Tetraodon  =
                 Zebra mbuna  =
B D                Coelacanth  =
                 Spotted gar  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
  D          Peregrine falcon  =
  D           Green seaturtle  =
  D       Collared flycatcher  =
          Southern platyfish  =
B D             X. tropicalis  =
B D                Budgerigar  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D       Medium ground finch  =
B D                    Turkey  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
          Tibetan ground jay  =
  D                    Parrot  =
B D           Tasmanian devil  -
B D                   Wallaby  =
B D                   Opossum  -
            Cape golden mole  =
  D              Mallard duck  =
B D                   Megabat  =
                    Aardvark  =
                Weddell seal  =
  D            Painted turtle  =
B D               Zebra finch  =
  D               Rock pigeon  =
B D                  Platypus  =

Inserts between block 16 and 17 in window
B D       American alligator 15bp

Alignment block 17 of 163 in window, 46962929 - 46962948, 20 bps 
B D                     Human  agggagcc--tggctgcttcct
B D                     Chimp  agggagcc--tggctgcttcct
B D                   Gorilla  agggagcc--tggctgcttcct
B D                 Orangutan  attgagtg--tggctgcttccc
B D                    Gibbon  agggagcc--tggctgcttcct
B D                    Rhesus  agggaacg--tggctgcttcct
B D       Crab-eating macaque  agggaacg--tggccgcttcct
B D                    Baboon  agggaacg--tggctgtttcct
B D              Green monkey  agggaacg--tggctgctgccc
B D                  Marmoset  agggaggg--tggctgcttttc
           Chinese tree shrew  agggagca--tggctgcttcct
B D                    Alpaca  agggagca--tggctgcctcct
                 Killer whale  agggaata--tggatggttcct
B D                     Horse  agggcgca--gggctgcttcct
B D          White rhinoceros  agggagca--gggctgcttctt
              Star-nosed mole  agggggta--gcactgtttcct
  D    White-throated sparrow  agggggccctgagtg-------
  D             Scarlet macaw  agagagcc--aagcagctcct-
B D        American alligator  agggagg---gagttgcgcct-
B D                  Hedgehog  ======================
              Golden hamster  ======================
         Cape elephant shrew  ----------------------
                Prairie vole  ======================
B D                     Panda  ======================
B D                      Pika  ======================
B D                    Rabbit  ======================
B D            Naked mole-rat  ======================
      Lesser Egyptian jerboa  ======================
B D                   Ferret   ======================
B D                       Dog  ======================
B D                       Cat  ======================
            Brush-tailed rat  ======================
B D                       Rat  ======================
B D                     Mouse  ======================
B D                 Armadillo  ======================
B D                    Tenrec  ======================
B D                   Manatee  ======================
B D                  Elephant  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
               Domestic goat  ----------------------
B D                     Sheep  ----------------------
B D                       Cow  ======================
            Tibetan antelope  ----------------------
                  Chinchilla  ======================
B D                Guinea pig  ======================
              Pacific walrus  ======================
              Bactrian camel  ----------------------
            Black flying-fox  ======================
B D                  Bushbaby  ======================
B D                   Dolphin  ======================
B D                    Medaka  ======================
         Princess of Burundi  ======================
B D              Nile tilapia  ======================
  D              Saker falcon  ======================
B D                 Tetraodon  ======================
                 Zebra mbuna  ======================
B D                Coelacanth  ======================
                 Spotted gar  ======================
B D               Stickleback  ======================
    Mexican tetra (cavefish)  ======================
         Pundamilia nyererei  ======================
       Burton's mouthbreeder  ======================
  D          Peregrine falcon  ======================
  D           Green seaturtle  ======================
  D       Collared flycatcher  ======================
          Southern platyfish  ======================
B D             X. tropicalis  ======================
B D                Budgerigar  ======================
B D                   Chicken  ======================
B D       Medium ground finch  ======================
B D                    Turkey  ======================
B D                    Lizard  ======================
  D  Chinese softshell turtle  ======================
B D           Squirrel monkey  ======================
          Tibetan ground jay  ======================
  D                    Parrot  ======================
B D           Tasmanian devil  ----------------------
B D                   Wallaby  ======================
B D                   Opossum  ----------------------
            Cape golden mole  ======================
  D              Mallard duck  ======================
B D                   Megabat  ======================
                    Aardvark  ======================
                Weddell seal  ======================
  D            Painted turtle  ======================
B D               Zebra finch  ======================
  D               Rock pigeon  ======================
B D                  Platypus  ======================

Alignment block 18 of 163 in window, 46962949 - 46962958, 10 bps 
B D                     Human  gcgggcttgg
B D                     Chimp  gtgggcttgg
B D                   Gorilla  gcgggcttgg
B D                 Orangutan  cctggcttag
B D                    Gibbon  gcgggcttgg
B D                    Rhesus  gcgagcttgg
B D       Crab-eating macaque  gcgagcttgg
B D                    Baboon  gcgagcttgg
B D              Green monkey  gcgggtttgg
B D                  Marmoset  gtgggctggt
           Chinese tree shrew  gtggggtgtg
B D                    Alpaca  gtggggtatg
                 Killer whale  gtggggtaca
B D                     Horse  gtggtgtctg
B D          White rhinoceros  gtggggtatg
              Star-nosed mole  gtagggtagc
B D                   Opossum  ------tata
B D           Tasmanian devil  ------tagg
  D    White-throated sparrow  -----ctaca
  D             Scarlet macaw  -----ctatt
B D        American alligator  -----cttc-
B D                  Hedgehog  ==========
              Golden hamster  ==========
         Cape elephant shrew  ----------
                Prairie vole  ==========
B D                     Panda  ==========
B D                      Pika  ==========
B D                    Rabbit  ==========
B D            Naked mole-rat  ==========
      Lesser Egyptian jerboa  ==========
B D                   Ferret   ==========
B D                       Dog  ==========
B D                       Cat  ==========
            Brush-tailed rat  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
B D                 Armadillo  ==========
B D                    Tenrec  ==========
B D                   Manatee  ==========
B D                  Elephant  ==========
B D                  Microbat  ==========
        David's myotis (bat)  ==========
               Domestic goat  ----------
B D                     Sheep  ----------
B D                       Cow  ==========
            Tibetan antelope  ----------
                  Chinchilla  ==========
B D                Guinea pig  ==========
              Pacific walrus  ==========
              Bactrian camel  ----------
            Black flying-fox  ==========
B D                  Bushbaby  ==========
B D                   Dolphin  ==========
B D                    Medaka  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
  D              Saker falcon  ==========
B D                 Tetraodon  ==========
                 Zebra mbuna  ==========
B D                Coelacanth  ==========
                 Spotted gar  ==========
B D               Stickleback  ==========
    Mexican tetra (cavefish)  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
  D          Peregrine falcon  ==========
  D           Green seaturtle  ==========
  D       Collared flycatcher  ==========
          Southern platyfish  ==========
B D             X. tropicalis  ==========
B D                Budgerigar  ==========
B D                   Chicken  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
B D                    Lizard  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  ==========
          Tibetan ground jay  ==========
  D                    Parrot  ==========
B D                   Wallaby  ==========
            Cape golden mole  ==========
  D              Mallard duck  ==========
B D                   Megabat  ==========
                    Aardvark  ==========
                Weddell seal  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
  D               Rock pigeon  ==========
B D                  Platypus  ==========

Alignment block 19 of 163 in window, 46962959 - 46962968, 10 bps 
B D                     Human  gggc-----tggctc
B D                     Chimp  gggc-----tggctg
B D                   Gorilla  gggc-----tggctc
B D                 Orangutan  agga-----tggatt
B D                    Gibbon  gggc-----tggctt
B D                    Rhesus  gggc-----tggctc
B D       Crab-eating macaque  gggc-----tggctt
B D                    Baboon  ggaa-----tggctt
B D              Green monkey  gggc-----tggctt
B D                  Marmoset  agtg-----tgggtt
           Chinese tree shrew  gggc-----tgactt
B D                    Alpaca  gggc-----tggctt
                 Killer whale  gggc-----tggttt
B D                     Horse  gggc-----tggctt
B D          White rhinoceros  ggac-----tggctt
              Star-nosed mole  tggc-----aggctt
B D                   Opossum  aggc-----agg---
B D           Tasmanian devil  gggt-----gggttt
B D                   Wallaby  gggc-----aggctt
  D    White-throated sparrow  gaga-----aacact
  D             Scarlet macaw  ggac-----tagatt
  D           Green seaturtle  gggaggtttaagact
B D                  Hedgehog  ===============
              Golden hamster  ===============
         Cape elephant shrew  ---------------
                Prairie vole  ===============
B D                     Panda  ===============
B D                      Pika  ===============
B D                    Rabbit  ===============
B D            Naked mole-rat  ===============
      Lesser Egyptian jerboa  ===============
B D                   Ferret   ===============
B D                       Dog  ===============
B D                       Cat  ===============
            Brush-tailed rat  ===============
B D                       Rat  ===============
B D                     Mouse  ===============
B D                 Armadillo  ===============
B D                    Tenrec  ===============
B D                   Manatee  ===============
B D                  Elephant  ===============
B D                  Microbat  ===============
        David's myotis (bat)  ===============
               Domestic goat  ---------------
B D                     Sheep  ---------------
B D                       Cow  ===============
            Tibetan antelope  ---------------
                  Chinchilla  ===============
B D                Guinea pig  ===============
              Pacific walrus  ===============
              Bactrian camel  ---------------
            Black flying-fox  ===============
B D                  Bushbaby  ===============
B D                   Dolphin  ===============
B D                    Medaka  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
  D              Saker falcon  ===============
B D                 Tetraodon  ===============
                 Zebra mbuna  ===============
B D                Coelacanth  ===============
                 Spotted gar  ===============
B D               Stickleback  ===============
    Mexican tetra (cavefish)  ===============
         Pundamilia nyererei  ===============
       Burton's mouthbreeder  ===============
  D          Peregrine falcon  ===============
  D       Collared flycatcher  ===============
          Southern platyfish  ===============
B D             X. tropicalis  ===============
B D                Budgerigar  ===============
B D                   Chicken  ===============
B D       Medium ground finch  ===============
B D                    Turkey  ===============
B D                    Lizard  ===============
  D  Chinese softshell turtle  ===============
B D           Squirrel monkey  ===============
          Tibetan ground jay  ===============
  D                    Parrot  ===============
            Cape golden mole  ===============
  D              Mallard duck  ===============
B D                   Megabat  ===============
                    Aardvark  ===============
                Weddell seal  ===============
  D            Painted turtle  ===============
B D               Zebra finch  ===============
  D               Rock pigeon  ===============
B D        American alligator  ---------------
B D                  Platypus  ===============

Inserts between block 19 and 20 in window
  D          Green seaturtle 5bp

Alignment block 20 of 163 in window, 46962969 - 46962970, 2 bps 
B D                     Human  ca
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ta
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
           Chinese tree shrew  gt
B D                    Alpaca  ga
                 Killer whale  ga
B D                     Horse  ga
B D          White rhinoceros  ta
              Star-nosed mole  ga
B D           Tasmanian devil  ga
B D                   Wallaby  ga
  D    White-throated sparrow  ca
B D                Budgerigar  ca
  D                    Parrot  ca
  D             Scarlet macaw  ca
  D              Mallard duck  ca
B D                  Hedgehog  ==
              Golden hamster  ==
         Cape elephant shrew  --
                Prairie vole  ==
B D                     Panda  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                   Ferret   ==
B D                       Dog  ==
B D                       Cat  ==
            Brush-tailed rat  ==
B D                       Rat  ==
B D                     Mouse  ==
B D                 Armadillo  ==
B D                    Tenrec  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
            Tibetan antelope  --
                  Chinchilla  ==
B D                Guinea pig  ==
              Pacific walrus  ==
              Bactrian camel  --
            Black flying-fox  ==
B D                  Bushbaby  ==
B D                   Dolphin  ==
B D                    Medaka  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D              Saker falcon  ==
B D                 Tetraodon  ==
                 Zebra mbuna  ==
B D                Coelacanth  ==
                 Spotted gar  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
  D          Peregrine falcon  ==
  D           Green seaturtle  ==
  D       Collared flycatcher  ==
          Southern platyfish  ==
B D             X. tropicalis  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  ==
          Tibetan ground jay  ==
B D                   Opossum  --
            Cape golden mole  ==
B D                   Megabat  ==
                    Aardvark  ==
                Weddell seal  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D               Rock pigeon  ==
B D        American alligator  --
B D                  Platypus  ==

Alignment block 21 of 163 in window, 46962971 - 46962978, 8 bps 
B D                     Human  ---tctctcca
B D                     Chimp  ---tctctcca
B D                   Gorilla  ---tctctcca
B D                 Orangutan  ---tctctcca
B D                    Gibbon  ---tccctcca
B D                    Rhesus  ---tgtctccc
B D       Crab-eating macaque  ---tgtctccc
B D                    Baboon  ---tgtctccc
B D              Green monkey  ---tctctccc
B D                  Marmoset  ---tgttgcta
           Chinese tree shrew  ---tcttggct
B D                    Alpaca  ---tcttgact
                 Killer whale  ---tcttgact
B D                     Horse  ---tcaaggct
B D          White rhinoceros  ---tcatggct
              Star-nosed mole  ---tcttgact
B D                   Opossum  ----cctggtc
B D           Tasmanian devil  ---ccttgatc
B D                   Wallaby  ---tcttaatc
  D    White-throated sparrow  ---cttgg---
B D                Budgerigar  ---cttgg---
  D                    Parrot  ---cttgg---
  D             Scarlet macaw  ---cctca---
  D              Mallard duck  ---cttgg---
B D        American alligator  ---cctca---
  D           Green seaturtle  ------ga---
B D             X. tropicalis  tcttctca---
B D                  Hedgehog  ===========
              Golden hamster  ===========
         Cape elephant shrew  -----------
                Prairie vole  ===========
B D                     Panda  ===========
B D                      Pika  ===========
B D                    Rabbit  ===========
B D            Naked mole-rat  ===========
      Lesser Egyptian jerboa  ===========
B D                   Ferret   ===========
B D                       Dog  ===========
B D                       Cat  ===========
            Brush-tailed rat  ===========
B D                       Rat  ===========
B D                     Mouse  ===========
B D                 Armadillo  ===========
B D                    Tenrec  ===========
B D                   Manatee  ===========
B D                  Elephant  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
               Domestic goat  -----------
B D                     Sheep  -----------
B D                       Cow  ===========
            Tibetan antelope  -----------
                  Chinchilla  ===========
B D                Guinea pig  ===========
              Pacific walrus  ===========
              Bactrian camel  -----------
            Black flying-fox  ===========
B D                  Bushbaby  ===========
B D                   Dolphin  ===========
B D                    Medaka  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
  D              Saker falcon  ===========
B D                 Tetraodon  ===========
                 Zebra mbuna  ===========
B D                Coelacanth  ===========
                 Spotted gar  ===========
B D               Stickleback  ===========
    Mexican tetra (cavefish)  ===========
         Pundamilia nyererei  ===========
       Burton's mouthbreeder  ===========
  D          Peregrine falcon  ===========
  D       Collared flycatcher  ===========
          Southern platyfish  ===========
B D                   Chicken  ===========
B D       Medium ground finch  ===========
B D                    Turkey  ===========
B D                    Lizard  ===========
  D  Chinese softshell turtle  ===========
B D           Squirrel monkey  ===========
          Tibetan ground jay  ===========
            Cape golden mole  ===========
B D                   Megabat  ===========
                    Aardvark  ===========
                Weddell seal  ===========
  D            Painted turtle  ===========
B D               Zebra finch  ===========
  D               Rock pigeon  ===========
B D                  Platypus  ===========

Inserts between block 21 and 22 in window
B D                  Gorilla 5598bp

Alignment block 22 of 163 in window, 46962979 - 46962979, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
           Chinese tree shrew  t
B D                    Alpaca  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
              Star-nosed mole  t
B D                   Opossum  a
B D           Tasmanian devil  t
B D                   Wallaby  a
  D    White-throated sparrow  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  g
  D              Mallard duck  t
B D        American alligator  g
  D           Green seaturtle  t
B D             X. tropicalis  t
B D                  Hedgehog  =
              Golden hamster  =
         Cape elephant shrew  -
                Prairie vole  =
B D                     Panda  =
B D                      Pika  =
B D                    Rabbit  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                   Ferret   =
B D                       Dog  =
B D                       Cat  =
            Brush-tailed rat  =
B D                       Rat  =
B D                     Mouse  =
B D                 Armadillo  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Microbat  =
        David's myotis (bat)  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  -
                  Chinchilla  =
B D                Guinea pig  =
              Pacific walrus  =
              Bactrian camel  -
            Black flying-fox  =
B D                  Bushbaby  =
B D                   Dolphin  =
B D                    Medaka  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D              Saker falcon  =
B D                 Tetraodon  =
                 Zebra mbuna  =
B D                Coelacanth  =
                 Spotted gar  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
  D          Peregrine falcon  =
  D       Collared flycatcher  =
          Southern platyfish  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                   Megabat  =
                    Aardvark  =
                Weddell seal  =
  D            Painted turtle  =
B D               Zebra finch  =
  D               Rock pigeon  =
B D                  Platypus  =

Inserts between block 22 and 23 in window
  D   White-throated sparrow 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D       American alligator 1bp
  D          Green seaturtle 1bp

Alignment block 23 of 163 in window, 46962980 - 46962983, 4 bps 
B D                     Human  ttcc
B D                     Chimp  ttcc
B D                   Gorilla  ctcc
B D                 Orangutan  tttc
B D                    Gibbon  ctcc
B D                    Rhesus  cttc
B D       Crab-eating macaque  cttc
B D                    Baboon  tttc
B D              Green monkey  ctcc
B D                  Marmoset  tttc
           Chinese tree shrew  tttg
B D                    Alpaca  tttc
                 Killer whale  tttc
B D                     Horse  tttc
B D          White rhinoceros  tttc
              Star-nosed mole  tttc
B D                   Opossum  tttc
B D           Tasmanian devil  tttt
B D                   Wallaby  tttt
  D    White-throated sparrow  -ttc
B D                Budgerigar  -ttc
  D                    Parrot  -ttc
  D             Scarlet macaw  -tgt
  D              Mallard duck  -ttc
B D        American alligator  -tca
  D           Green seaturtle  -ttc
B D                    Lizard  -ttc
B D             X. tropicalis  tgac
B D                  Hedgehog  ====
              Golden hamster  ====
         Cape elephant shrew  ----
                Prairie vole  ====
B D                     Panda  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D            Naked mole-rat  ====
      Lesser Egyptian jerboa  ====
B D                   Ferret   ====
B D                       Dog  ====
B D                       Cat  ====
            Brush-tailed rat  ====
B D                       Rat  ====
B D                     Mouse  ====
B D                 Armadillo  ====
B D                    Tenrec  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
            Tibetan antelope  ----
                  Chinchilla  ====
B D                Guinea pig  ====
              Pacific walrus  ====
              Bactrian camel  ----
            Black flying-fox  ====
B D                  Bushbaby  ====
B D                   Dolphin  ====
B D                    Medaka  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D              Saker falcon  ====
B D                 Tetraodon  ====
                 Zebra mbuna  ====
B D                Coelacanth  ====
                 Spotted gar  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
  D          Peregrine falcon  ====
  D       Collared flycatcher  ====
          Southern platyfish  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
  D  Chinese softshell turtle  ====
B D           Squirrel monkey  ====
          Tibetan ground jay  ====
            Cape golden mole  ====
B D                   Megabat  ====
                    Aardvark  ====
                Weddell seal  ====
  D            Painted turtle  ====
B D               Zebra finch  ====
  D               Rock pigeon  ====
B D                  Platypus  ====

Inserts between block 23 and 24 in window
  D   White-throated sparrow 3bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 6bp
  D             Mallard duck 3bp
B D       American alligator 5bp
  D          Green seaturtle 3bp
B D                   Lizard 1bp

Alignment block 24 of 163 in window, 46962984 - 46962984, 1 bps 
B D                     Human  -g
B D                     Chimp  -a
B D                   Gorilla  -g
B D                 Orangutan  -c
B D                    Gibbon  -c
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
           Chinese tree shrew  -g
B D                    Alpaca  -t
                 Killer whale  -a
B D                     Horse  -c
B D          White rhinoceros  -c
              Star-nosed mole  -t
B D                   Opossum  -a
B D           Tasmanian devil  -g
B D                   Wallaby  -a
  D    White-throated sparrow  -g
B D               Zebra finch  -g
B D                Budgerigar  -g
  D                    Parrot  -g
  D              Mallard duck  -g
B D        American alligator  -a
B D             X. tropicalis  t-
B D                  Hedgehog  ==
              Golden hamster  ==
         Cape elephant shrew  --
                Prairie vole  ==
B D                     Panda  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                   Ferret   ==
B D                       Dog  ==
B D                       Cat  ==
            Brush-tailed rat  ==
B D                       Rat  ==
B D                     Mouse  ==
B D                 Armadillo  ==
B D                    Tenrec  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
            Tibetan antelope  --
                  Chinchilla  ==
B D                Guinea pig  ==
              Pacific walrus  ==
              Bactrian camel  --
            Black flying-fox  ==
B D                  Bushbaby  ==
B D                   Dolphin  ==
B D                    Medaka  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D              Saker falcon  ==
B D                 Tetraodon  ==
                 Zebra mbuna  ==
B D                Coelacanth  ==
                 Spotted gar  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
  D          Peregrine falcon  ==
  D           Green seaturtle  ==
  D       Collared flycatcher  ==
          Southern platyfish  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  ==
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                   Megabat  ==
                    Aardvark  ==
                Weddell seal  ==
  D            Painted turtle  ==
  D               Rock pigeon  ==
B D                  Platypus  ==

Inserts between block 24 and 25 in window
  D   White-throated sparrow 8bp
B D               Budgerigar 8bp
  D                   Parrot 8bp
B D       American alligator 1bp

Alignment block 25 of 163 in window, 46962985 - 46962988, 4 bps 
B D                     Human  gggt
B D                     Chimp  gggt
B D                   Gorilla  gggt
B D                 Orangutan  gggt
B D                    Gibbon  gggt
B D                    Rhesus  gggt
B D       Crab-eating macaque  gggt
B D                    Baboon  gggt
B D              Green monkey  gggt
B D                  Marmoset  agat
           Chinese tree shrew  aggg
B D                    Alpaca  ggga
                 Killer whale  gggg
B D                     Horse  caga
B D          White rhinoceros  tgga
              Star-nosed mole  ggaa
B D                   Opossum  ggag
B D           Tasmanian devil  ggaa
B D                   Wallaby  ggaa
  D       Collared flycatcher  gggc
  D    White-throated sparrow  gggc
B D       Medium ground finch  gggc
B D               Zebra finch  ggac
           Tibetan ground jay  gggc
B D                Budgerigar  gggc
  D                    Parrot  ggtc
  D             Scarlet macaw  ggac
  D              Mallard duck  gcac
B D        American alligator  gaa-
  D           Green seaturtle  -ggt
B D                    Lizard  ggaa
B D             X. tropicalis  -g--
          Pundamilia nyererei  gaac
B D                  Hedgehog  ====
              Golden hamster  ====
         Cape elephant shrew  ----
                Prairie vole  ====
B D                     Panda  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D            Naked mole-rat  ====
      Lesser Egyptian jerboa  ====
B D                   Ferret   ====
B D                       Dog  ====
B D                       Cat  ====
            Brush-tailed rat  ====
B D                       Rat  ====
B D                     Mouse  ====
B D                 Armadillo  ====
B D                    Tenrec  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
            Tibetan antelope  ----
                  Chinchilla  ====
B D                Guinea pig  ====
              Pacific walrus  ====
              Bactrian camel  ----
            Black flying-fox  ====
B D                  Bushbaby  ====
B D                   Dolphin  ====
B D                    Medaka  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D              Saker falcon  ====
B D                 Tetraodon  ====
                 Zebra mbuna  ====
B D                Coelacanth  ====
                 Spotted gar  ====
B D               Stickleback  ====
    Mexican tetra (cavefish)  ====
       Burton's mouthbreeder  ====
  D          Peregrine falcon  ====
          Southern platyfish  ====
B D                   Chicken  ====
B D                    Turkey  ====
  D  Chinese softshell turtle  ====
B D           Squirrel monkey  ====
            Cape golden mole  ====
B D                   Megabat  ====
                    Aardvark  ====
                Weddell seal  ====
  D            Painted turtle  ====
  D               Rock pigeon  ====
B D                  Platypus  ====

Inserts between block 25 and 26 in window
  D             Mallard duck 17bp
  D          Green seaturtle 1bp

Alignment block 26 of 163 in window, 46962989 - 46962999, 11 bps 
B D                     Human  ---cagcggctcct
B D                     Chimp  ---ccgcggctcct
B D                   Gorilla  ---cagcggctcct
B D                 Orangutan  ---cagagtctcct
B D                    Gibbon  ---cagctgctcct
B D                    Rhesus  ---cagcggctcct
B D       Crab-eating macaque  ---cagcggctcct
B D                    Baboon  ---cagcggctcct
B D              Green monkey  ---cagcggctcct
B D                  Marmoset  ---cagcggctcct
           Chinese tree shrew  ---aggctgcttct
B D                    Alpaca  ---cagctgctcct
                 Killer whale  ---cagctgcttct
B D                     Horse  ---cagctgctcct
B D          White rhinoceros  ---cagctgctcct
              Star-nosed mole  ---cagctg---ct
B D                   Opossum  ---tagttattctg
B D           Tasmanian devil  ---cagccgctcct
B D                   Wallaby  ---cacctactcta
  D       Collared flycatcher  ---------cccca
  D    White-throated sparrow  ---------ctcca
B D       Medium ground finch  ---------ctcca
B D               Zebra finch  ---------ctcca
           Tibetan ground jay  ---------ctcca
B D                Budgerigar  ---------ctcca
  D                    Parrot  ---------ctcca
  D             Scarlet macaw  ---------cttc-
B D                   Chicken  ---------caacc
B D                    Turkey  ---------cagcc
B D        American alligator  ---tcatgccttcc
  D           Green seaturtle  ---------cagca
B D                    Lizard  ---------cagca
B D             X. tropicalis  ---ctgctgctcct
          Pundamilia nyererei  cactggtggtt---
B D                  Hedgehog  ==============
              Golden hamster  ==============
         Cape elephant shrew  --------------
                Prairie vole  ==============
B D                     Panda  ==============
B D                      Pika  ==============
B D                    Rabbit  ==============
B D            Naked mole-rat  ==============
      Lesser Egyptian jerboa  ==============
B D                   Ferret   ==============
B D                       Dog  ==============
B D                       Cat  ==============
            Brush-tailed rat  ==============
B D                       Rat  ==============
B D                     Mouse  ==============
B D                 Armadillo  ==============
B D                    Tenrec  ==============
B D                   Manatee  ==============
B D                  Elephant  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
               Domestic goat  --------------
B D                     Sheep  --------------
B D                       Cow  ==============
            Tibetan antelope  --------------
                  Chinchilla  ==============
B D                Guinea pig  ==============
              Pacific walrus  ==============
              Bactrian camel  --------------
            Black flying-fox  ==============
B D                  Bushbaby  ==============
B D                   Dolphin  ==============
B D                    Medaka  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
  D              Saker falcon  ==============
B D                 Tetraodon  ==============
                 Zebra mbuna  ==============
B D                Coelacanth  ==============
                 Spotted gar  ==============
B D               Stickleback  ==============
    Mexican tetra (cavefish)  ==============
       Burton's mouthbreeder  ==============
  D          Peregrine falcon  ==============
          Southern platyfish  ==============
  D  Chinese softshell turtle  ==============
B D           Squirrel monkey  ==============
            Cape golden mole  ==============
  D              Mallard duck  ==============
B D                   Megabat  ==============
                    Aardvark  ==============
                Weddell seal  ==============
  D            Painted turtle  ==============
  D               Rock pigeon  ==============
B D                  Platypus  ==============

Inserts between block 26 and 27 in window
          Chinese tree shrew 3bp
B D                   Alpaca 6bp
                Killer whale 6bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
             Star-nosed mole 6bp
B D                  Opossum 6bp
B D          Tasmanian devil 6bp
B D                  Wallaby 6bp
  D            Scarlet macaw 2bp

Alignment block 27 of 163 in window, 46963000 - 46963000, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -a
           Chinese tree shrew  -c
B D                    Alpaca  -t
                 Killer whale  -t
B D                     Horse  -c
B D          White rhinoceros  -t
              Star-nosed mole  -t
B D                   Opossum  -c
B D           Tasmanian devil  -c
B D                   Wallaby  -c
  D       Collared flycatcher  -g
  D    White-throated sparrow  -g
B D       Medium ground finch  -g
B D               Zebra finch  -g
           Tibetan ground jay  -g
B D                Budgerigar  -g
  D                    Parrot  -g
B D                   Chicken  -a
B D                    Turkey  -a
B D        American alligator  -a
  D           Green seaturtle  -g
B D                    Lizard  -g
B D             X. tropicalis  -g
          Pundamilia nyererei  c-
B D                  Hedgehog  ==
              Golden hamster  ==
         Cape elephant shrew  --
                Prairie vole  ==
B D                     Panda  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                   Ferret   ==
B D                       Dog  ==
B D                       Cat  ==
            Brush-tailed rat  ==
B D                       Rat  ==
B D                     Mouse  ==
B D                 Armadillo  ==
B D                    Tenrec  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
            Tibetan antelope  --
                  Chinchilla  ==
B D                Guinea pig  ==
              Pacific walrus  ==
              Bactrian camel  --
            Black flying-fox  ==
B D                  Bushbaby  ==
B D                   Dolphin  ==
B D                    Medaka  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D              Saker falcon  ==
B D                 Tetraodon  ==
                 Zebra mbuna  ==
B D                Coelacanth  ==
                 Spotted gar  ==
B D               Stickleback  ==
    Mexican tetra (cavefish)  ==
       Burton's mouthbreeder  ==
  D          Peregrine falcon  ==
          Southern platyfish  ==
  D             Scarlet macaw  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  ==
            Cape golden mole  ==
  D              Mallard duck  ==
B D                   Megabat  ==
                    Aardvark  ==
                Weddell seal  ==
B D                    Rhesus  ==
  D            Painted turtle  ==
  D               Rock pigeon  ==
B D                  Platypus  ==

Inserts between block 27 and 28 in window
  D      Collared flycatcher 3bp
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D              Zebra finch 3bp
          Tibetan ground jay 3bp
B D               Budgerigar 3bp
  D                   Parrot 3bp
B D                  Chicken 17bp
B D                   Turkey 21bp
  D          Green seaturtle 12bp
B D                   Lizard 12bp
B D            X. tropicalis 3bp

Alignment block 28 of 163 in window, 46963001 - 46963004, 4 bps 
B D                     Human  caga
B D                     Chimp  caga
B D                   Gorilla  caga
B D                 Orangutan  caga
B D                    Gibbon  cgga
B D       Crab-eating macaque  caga
B D                    Baboon  caga
B D              Green monkey  caga
B D                  Marmoset  cagc
           Chinese tree shrew  caaa
B D                    Alpaca  caaa
                 Killer whale  caaa
B D                     Horse  caaa
B D          White rhinoceros  caaa
              Star-nosed mole  caga
B D                   Opossum  caaa
B D           Tasmanian devil  caca
B D                   Wallaby  caaa
  D               Rock pigeon  caaa
  D              Saker falcon  caaa
  D          Peregrine falcon  caaa
  D       Collared flycatcher  cgaa
  D    White-throated sparrow  caaa
B D       Medium ground finch  caaa
B D               Zebra finch  caaa
           Tibetan ground jay  cgaa
B D                Budgerigar  caaa
  D                    Parrot  caaa
  D             Scarlet macaw  caca
  D              Mallard duck  caaa
B D                   Chicken  caga
B D                    Turkey  cagg
  D           Green seaturtle  caaa
B D                    Lizard  caaa
B D             X. tropicalis  caaa
B D              Nile tilapia  caaa
        Burton's mouthbreeder  caaa
                  Zebra mbuna  caaa
          Pundamilia nyererei  caaa
B D                    Medaka  caaa
B D              Atlantic cod  cgaa
     Mexican tetra (cavefish)  caaa
B D                  Hedgehog  ====
              Golden hamster  ====
         Cape elephant shrew  ----
                Prairie vole  ====
B D                     Panda  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D            Naked mole-rat  ====
      Lesser Egyptian jerboa  ====
B D                   Ferret   ====
B D                       Dog  ====
B D                       Cat  ====
            Brush-tailed rat  ====
B D                       Rat  ====
B D                     Mouse  ====
B D                 Armadillo  ====
B D                    Tenrec  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
            Tibetan antelope  ----
                  Chinchilla  ====
B D                Guinea pig  ====
              Pacific walrus  ====
              Bactrian camel  ----
            Black flying-fox  ====
B D                  Bushbaby  ====
B D                   Dolphin  ====
         Princess of Burundi  ====
B D                 Tetraodon  ====
B D                Coelacanth  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
  D  Chinese softshell turtle  ====
B D           Squirrel monkey  ====
            Cape golden mole  ====
B D                   Megabat  ====
                    Aardvark  ====
                Weddell seal  ====
B D                    Rhesus  ====
  D            Painted turtle  ====
B D        American alligator  ----
B D                  Platypus  ====

Inserts between block 28 and 29 in window
  D          Green seaturtle 5bp
       Burton's mouthbreeder 3bp
                 Zebra mbuna 3bp

Alignment block 29 of 163 in window, 46963005 - 46963021, 17 bps 
B D                     Human  c-------ttctc---tt---gcctcctgg
B D                     Chimp  c-------ttctc---tt---gcctcctgg
B D                   Gorilla  c-------ttctc---tt---gcctcctgg
B D                 Orangutan  c-------ttctc---tt---ccctccttg
B D                    Gibbon  c-------ttccc---tt---gcctgctgg
B D       Crab-eating macaque  c-------ttctc---tt---gcctccttg
B D                    Baboon  c-------ttctc---tt---gcctccttg
B D              Green monkey  c-------ttctc---tt---gcctccttg
B D                  Marmoset  c-------ttctc---tt---gccacctcg
           Chinese tree shrew  c-------tcttc---ct---gcctcctca
B D            Naked mole-rat  c-------tcctt---ct---gcctcctgg
B D                    Alpaca  ----------ctt---ct---gcctccttt
                 Killer whale  ----------cttctcct---gcctccttc
B D                     Horse  ----------ctt---ct---gcctccttg
B D          White rhinoceros  ----------ctt---ctcccgcctccttg
              Star-nosed mole  ----------ttt---ct---gctcctttg
B D                   Opossum  t-------ttttc---ct---gcctctttc
B D           Tasmanian devil  t-------ttctc---ct---gctgtctcc
B D                   Wallaby  t-------tttac---ct---gcctctttc
  D               Rock pigeon  c-------ttctc---tt---gtctccttc
  D              Saker falcon  c-------ttctc---tt---gtctccttc
  D          Peregrine falcon  c-------ttctc---tt---gtctccttc
  D       Collared flycatcher  t-------ttctc---ct---gtctcctcc
  D    White-throated sparrow  c-------ttctc---ct---gcctcctcc
B D       Medium ground finch  c-------ttctc---ct---gtctcctcc
B D               Zebra finch  c-------ttctc---ct---gtctcctcc
           Tibetan ground jay  c-------ttctc---tt---gtctcctcc
B D                Budgerigar  c-------ttctc---tt---gtctcctcc
  D                    Parrot  c-------ttctc---tt---gtctccttc
  D             Scarlet macaw  caaagacataccc---tg---ggcagctt-
  D              Mallard duck  c-------ttctc---ct---gtcgtctcc
B D                   Chicken  c-------ttccc---cc-aggcagccttc
B D                    Turkey  c-------ttccc---cc-aggcagccttc
B D        American alligator  ---------cccc---cc---ggcccct--
  D           Green seaturtle  ------------c---tt---gtctcctcc
  D            Painted turtle  ------------c---tt---ttcattcca
  D    Spiny softshell turtle  ------------c---tt---ttcacacca
B D                    Lizard  -------tttctc---tt---gccttcgcc
B D             X. tropicalis  -------tttttc---tt---gtctccttc
B D              Nile tilapia  -------cttctc---ct---gtcggcggc
        Burton's mouthbreeder  -------cttttt---ct---tt-------
                  Zebra mbuna  -------cttttt---ct---tt-------
          Pundamilia nyererei  -------cttctc---ct---gtcggcggc
B D                    Medaka  -------cctctc---ct---gtcggcgcc
B D              Atlantic cod  -------cttctc---ct---ggcgccgcc
     Mexican tetra (cavefish)  -------cttctc---ct---gccgcctcc
B D                  Hedgehog  ==============================
              Golden hamster  ==============================
         Cape elephant shrew  ------------------------------
                Prairie vole  ==============================
B D                     Panda  ==============================
B D                      Pika  ==============================
B D                    Rabbit  ==============================
      Lesser Egyptian jerboa  ==============================
B D                   Ferret   ==============================
B D                       Dog  ==============================
B D                       Cat  ==============================
            Brush-tailed rat  ==============================
B D                       Rat  ==============================
B D                     Mouse  ==============================
B D                 Armadillo  ==============================
B D                    Tenrec  ==============================
B D                   Manatee  ==============================
B D                  Elephant  ==============================
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
               Domestic goat  ------------------------------
B D                     Sheep  ------------------------------
B D                       Cow  ==============================
            Tibetan antelope  ------------------------------
                  Chinchilla  ==============================
B D                Guinea pig  ==============================
              Pacific walrus  ==============================
              Bactrian camel  ------------------------------
            Black flying-fox  ==============================
B D                  Bushbaby  ==============================
B D                   Dolphin  ==============================
         Princess of Burundi  ==============================
B D                 Tetraodon  ==============================
B D                Coelacanth  ==============================
                 Spotted gar  ==============================
B D               Stickleback  ==============================
          Southern platyfish  ==============================
  D  Chinese softshell turtle  ==============================
B D           Squirrel monkey  ==============================
            Cape golden mole  ==============================
B D                   Megabat  ==============================
                    Aardvark  ==============================
                Weddell seal  ==============================
B D                    Rhesus  ==============================
B D                  Platypus  ==============================

Alignment block 30 of 163 in window, 46963022 - 46963033, 12 bps 
B D                     Human  aagca---------------------tcataag
B D                     Chimp  aagca---------------------tcataag
B D                   Gorilla  aagca---------------------tcataag
B D                 Orangutan  aagta---------------------tcataag
B D                    Gibbon  aagca---------------------tcctgag
B D       Crab-eating macaque  aagca---------------------tcataag
B D                    Baboon  aagca---------------------tcataag
B D              Green monkey  aagca---------------------tcataag
B D                  Marmoset  gagca---------------------tcataag
           Chinese tree shrew  gagcc---------------------tcacaag
B D            Naked mole-rat  a--------------------------------
B D                    Alpaca  gaacg---------------------tcagcag
                 Killer whale  gaacg---------------------tcagaag
B D                     Horse  gaacg---------------------ccagaag
B D          White rhinoceros  gaaca---------------------tcagaag
              Star-nosed mole  aaata---------------------tcagaag
B D                   Opossum  taata---------------------tcccgag
B D           Tasmanian devil  tgaca---------------------t-cagag
B D                   Wallaby  ttaca---------------------tcccaag
  D               Rock pigeon  gtaca---------------------tcccgag
  D              Saker falcon  gtaca---------------------tcccgag
  D          Peregrine falcon  gtaca---------------------tcccgag
  D       Collared flycatcher  gaacg---------------------tcccgag
  D    White-throated sparrow  gaacg---------------------tcccgag
B D       Medium ground finch  gaacg---------------------tcccgag
B D               Zebra finch  ggacg---------------------tcccgag
           Tibetan ground jay  gtacg---------------------tcccgag
B D                Budgerigar  gtaca---------------------tcccgag
  D                    Parrot  gtaca---------------------tcccgag
  D             Scarlet macaw  --------------------------tccc---
  D              Mallard duck  gcacg---------------------tcccgag
B D                   Chicken  ccaga-----------------------cctgt
B D                    Turkey  ccaga-----------------------cctgt
B D        American alligator  --------------------------------g
  D           Green seaturtle  gcaca---------------------tccctag
  D            Painted turtle  gcacgaagaatcacaacccaccccattcaccag
  D    Spiny softshell turtle  gcatgaaggatcacaccccctctcattcatcgg
B D                    Lizard  tcaca---------------------tccctgg
B D             X. tropicalis  ttaca---------------------tctcggg
B D              Nile tilapia  gaaca---------------------tcacggg
        Burton's mouthbreeder  gtgct---------------------ttatgtg
                  Zebra mbuna  gtgct---------------------ttatgtg
          Pundamilia nyererei  gaaca---------------------tcacggg
B D                    Medaka  gaacg---------------------tcacgtg
           Southern platyfish  aggca---------------------tcacagc
B D              Atlantic cod  ggacg---------------------tcacgcg
     Mexican tetra (cavefish)  ggaca---------------------tcacgag
B D                  Hedgehog  =================================
              Golden hamster  =================================
         Cape elephant shrew  ---------------------------------
                Prairie vole  =================================
B D                     Panda  =================================
B D                      Pika  =================================
B D                    Rabbit  =================================
      Lesser Egyptian jerboa  =================================
B D                   Ferret   =================================
B D                       Dog  =================================
B D                       Cat  =================================
            Brush-tailed rat  =================================
B D                       Rat  =================================
B D                     Mouse  =================================
B D                 Armadillo  =================================
B D                    Tenrec  =================================
B D                   Manatee  =================================
B D                  Elephant  =================================
B D                  Microbat  =================================
        David's myotis (bat)  =================================
               Domestic goat  ---------------------------------
B D                     Sheep  ---------------------------------
B D                       Cow  =================================
            Tibetan antelope  ---------------------------------
                  Chinchilla  =================================
B D                Guinea pig  =================================
              Pacific walrus  =================================
              Bactrian camel  ---------------------------------
            Black flying-fox  =================================
B D                  Bushbaby  =================================
B D                   Dolphin  =================================
         Princess of Burundi  =================================
B D                 Tetraodon  =================================
B D                Coelacanth  =================================
                 Spotted gar  =================================
B D               Stickleback  =================================
  D  Chinese softshell turtle  =================================
B D           Squirrel monkey  =================================
            Cape golden mole  =================================
B D                   Megabat  =================================
                    Aardvark  =================================
                Weddell seal  =================================
B D                    Rhesus  =================================
B D                  Platypus  =================================

Alignment block 31 of 163 in window, 46963034 - 46963036, 3 bps 
B D                     Human  gcg
B D                     Chimp  gcg
B D                   Gorilla  gcg
B D                 Orangutan  gcg
B D                    Gibbon  gcg
B D       Crab-eating macaque  gcg
B D                    Baboon  gca
B D              Green monkey  gcg
B D                  Marmoset  gcg
           Chinese tree shrew  gtg
B D                    Alpaca  gtg
                 Killer whale  gtg
B D                     Horse  gcg
B D          White rhinoceros  gcg
              Star-nosed mole  gcg
B D                   Opossum  gcg
B D           Tasmanian devil  gcg
B D                   Wallaby  gtg
  D               Rock pigeon  ggg
  D              Saker falcon  ggg
  D          Peregrine falcon  ggg
  D       Collared flycatcher  ggg
  D    White-throated sparrow  ggg
B D       Medium ground finch  ggg
B D               Zebra finch  gag
           Tibetan ground jay  ggg
B D                Budgerigar  ggg
  D                    Parrot  ggg
  D             Scarlet macaw  agc
  D              Mallard duck  gtg
B D                   Chicken  ctg
B D                    Turkey  ctg
B D        American alligator  gaa
  D           Green seaturtle  gtg
  D            Painted turtle  ac-
  D    Spiny softshell turtle  tcc
B D                    Lizard  gcg
B D             X. tropicalis  ggg
B D              Nile tilapia  gcg
        Burton's mouthbreeder  tcg
                  Zebra mbuna  tcg
          Pundamilia nyererei  gcg
B D                    Medaka  gag
           Southern platyfish  gcg
B D               Stickleback  gtg
B D              Atlantic cod  gcg
     Mexican tetra (cavefish)  ggg
B D                  Hedgehog  ===
              Golden hamster  ===
         Cape elephant shrew  ---
                Prairie vole  ===
B D                     Panda  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D            Naked mole-rat  ---
      Lesser Egyptian jerboa  ===
B D                   Ferret   ===
B D                       Dog  ===
B D                       Cat  ===
            Brush-tailed rat  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                 Armadillo  ===
B D                    Tenrec  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
            Tibetan antelope  ---
                  Chinchilla  ===
B D                Guinea pig  ===
              Pacific walrus  ===
              Bactrian camel  ---
            Black flying-fox  ===
B D                  Bushbaby  ===
B D                   Dolphin  ===
         Princess of Burundi  ===
B D                 Tetraodon  ===
B D                Coelacanth  ===
                 Spotted gar  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ===
            Cape golden mole  ===
B D                   Megabat  ===
                    Aardvark  ===
                Weddell seal  ===
B D                    Rhesus  ===
B D                  Platypus  ===

Alignment block 32 of 163 in window, 46963037 - 46963043, 7 bps 
B D                     Human  tcttggc
B D                     Chimp  tcttggc
B D                   Gorilla  tcttggc
B D                 Orangutan  tcttggc
B D                    Gibbon  tcttggc
B D       Crab-eating macaque  tcttggc
B D                    Baboon  tcttggc
B D              Green monkey  tcttggc
B D                  Marmoset  tctcggc
           Chinese tree shrew  acttggc
B D            Naked mole-rat  ----gga
B D                    Alpaca  gcctggc
                 Killer whale  gcctggc
B D                     Horse  gcttggc
B D          White rhinoceros  tcttggc
              Star-nosed mole  ggttgtt
B D                   Opossum  gtttcgc
B D           Tasmanian devil  acttggc
B D                   Wallaby  gtttgac
  D               Rock pigeon  gcttcac
  D              Saker falcon  gctttgc
  D          Peregrine falcon  gctttgc
  D       Collared flycatcher  gcttcgc
  D    White-throated sparrow  gcttggc
B D       Medium ground finch  gctttgc
B D               Zebra finch  gcttcgc
           Tibetan ground jay  gcttcgc
B D                Budgerigar  gctttgc
  D                    Parrot  gctttgc
  D             Scarlet macaw  cctttcc
  D              Mallard duck  gcttca-
B D                   Chicken  gctcct-
B D                    Turkey  gctcct-
B D        American alligator  gctttca
  D           Green seaturtle  gctttgc
  D            Painted turtle  -cttcgc
  D    Spiny softshell turtle  ctttccc
B D                    Lizard  gcttggc
B D             X. tropicalis  gcttcac
B D              Nile tilapia  -----gc
          Princess of Burundi  -----tt
        Burton's mouthbreeder  -----at
                  Zebra mbuna  -----at
          Pundamilia nyererei  -----gc
B D                    Medaka  -----gc
           Southern platyfish  -----ac
B D               Stickleback  ctgtcgc
B D              Atlantic cod  -----gc
     Mexican tetra (cavefish)  gctttgc
B D                  Hedgehog  =======
              Golden hamster  =======
         Cape elephant shrew  -------
                Prairie vole  =======
B D                     Panda  =======
B D                      Pika  =======
B D                    Rabbit  =======
      Lesser Egyptian jerboa  =======
B D                   Ferret   =======
B D                       Dog  =======
B D                       Cat  =======
            Brush-tailed rat  =======
B D                       Rat  =======
B D                     Mouse  =======
B D                 Armadillo  =======
B D                    Tenrec  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
               Domestic goat  -------
B D                     Sheep  -------
B D                       Cow  =======
            Tibetan antelope  -------
                  Chinchilla  =======
B D                Guinea pig  =======
              Pacific walrus  =======
              Bactrian camel  -------
            Black flying-fox  =======
B D                  Bushbaby  =======
B D                   Dolphin  =======
B D                 Tetraodon  =======
B D                Coelacanth  =======
                 Spotted gar  =======
  D  Chinese softshell turtle  =======
B D           Squirrel monkey  =======
            Cape golden mole  =======
B D                   Megabat  =======
                    Aardvark  =======
                Weddell seal  =======
B D                    Rhesus  =======
B D                  Platypus  =======

Inserts between block 32 and 33 in window
  D             Mallard duck 5bp
B D                  Chicken 3bp
B D                   Turkey 3bp
B D             Nile tilapia 175bp
         Princess of Burundi 5bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 177bp
B D                   Medaka 6bp
          Southern platyfish 4bp
B D              Stickleback 1bp
B D             Atlantic cod 6bp
    Mexican tetra (cavefish) 1bp

Alignment block 33 of 163 in window, 46963044 - 46963044, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
           Chinese tree shrew  c
B D            Naked mole-rat  c
B D                    Alpaca  c
                 Killer whale  c
B D                     Horse  c
B D          White rhinoceros  c
              Star-nosed mole  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
  D               Rock pigeon  t
  D              Saker falcon  t
  D          Peregrine falcon  t
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D       Medium ground finch  t
B D               Zebra finch  t
           Tibetan ground jay  t
B D                Budgerigar  t
  D                    Parrot  t
  D             Scarlet macaw  t
B D        American alligator  c
  D           Green seaturtle  t
  D            Painted turtle  c
  D    Spiny softshell turtle  t
B D                    Lizard  t
B D             X. tropicalis  a
B D                  Hedgehog  =
              Golden hamster  =
         Cape elephant shrew  -
                Prairie vole  =
B D                     Panda  =
B D                      Pika  =
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                   Ferret   =
B D                       Dog  =
B D                       Cat  =
            Brush-tailed rat  =
B D                       Rat  =
B D                     Mouse  =
B D                 Armadillo  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Microbat  =
        David's myotis (bat)  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  -
                  Chinchilla  =
B D                Guinea pig  =
              Pacific walrus  =
              Bactrian camel  -
            Black flying-fox  =
B D                  Bushbaby  =
B D                   Dolphin  =
B D                    Medaka  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D                 Tetraodon  =
                 Zebra mbuna  =
B D                Coelacanth  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
    Mexican tetra (cavefish)  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D                   Chicken  =
B D                    Turkey  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
            Cape golden mole  =
  D              Mallard duck  =
B D                   Megabat  =
                    Aardvark  =
                Weddell seal  =
B D                    Rhesus  =
B D                  Platypus  =

Alignment block 34 of 163 in window, 46963045 - 46963047, 3 bps 
B D                     Human  aca
B D                     Chimp  aca
B D                   Gorilla  aca
B D                 Orangutan  aga
B D                    Gibbon  gca
B D       Crab-eating macaque  cca
B D                    Baboon  cca
B D              Green monkey  cca
B D                  Marmoset  acc
           Chinese tree shrew  aca
B D            Naked mole-rat  gca
B D                    Alpaca  aca
                 Killer whale  aga
B D                     Horse  aca
B D          White rhinoceros  acg
              Star-nosed mole  atg
B D                   Opossum  tca
B D           Tasmanian devil  aca
B D                   Wallaby  acg
  D               Rock pigeon  gca
  D              Saker falcon  gca
  D          Peregrine falcon  gca
  D       Collared flycatcher  gca
  D    White-throated sparrow  gca
B D       Medium ground finch  gca
B D               Zebra finch  gca
           Tibetan ground jay  gca
B D                Budgerigar  gca
  D                    Parrot  gca
  D             Scarlet macaw  tca
B D        American alligator  a--
  D           Green seaturtle  gct
  D            Painted turtle  cct
  D    Spiny softshell turtle  tct
B D                    Lizard  gct
B D             X. tropicalis  gct
B D              Nile tilapia  aca
          Princess of Burundi  ctg
        Burton's mouthbreeder  aca
                  Zebra mbuna  aca
          Pundamilia nyererei  aca
B D                    Medaka  aca
B D               Stickleback  gca
B D              Atlantic cod  aca
     Mexican tetra (cavefish)  acc
B D                  Hedgehog  ===
              Golden hamster  ===
         Cape elephant shrew  ---
                Prairie vole  ===
B D                     Panda  ===
B D                      Pika  ===
B D                    Rabbit  ===
      Lesser Egyptian jerboa  ===
B D                   Ferret   ===
B D                       Dog  ===
B D                       Cat  ===
            Brush-tailed rat  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                 Armadillo  ===
B D                    Tenrec  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
            Tibetan antelope  ---
                  Chinchilla  ===
B D                Guinea pig  ===
              Pacific walrus  ===
              Bactrian camel  ---
            Black flying-fox  ===
B D                  Bushbaby  ===
B D                   Dolphin  ===
B D                 Tetraodon  ===
B D                Coelacanth  ===
                 Spotted gar  ===
          Southern platyfish  ===
B D                   Chicken  ===
B D                    Turkey  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ===
            Cape golden mole  ===
  D              Mallard duck  ===
B D                   Megabat  ===
                    Aardvark  ===
                Weddell seal  ===
B D                    Rhesus  ===
B D                  Platypus  ===

Inserts between block 34 and 35 in window
B D      Medium ground finch 409bp

Alignment block 35 of 163 in window, 46963048 - 46963048, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
           Chinese tree shrew  g
B D            Naked mole-rat  g
B D                    Alpaca  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
              Star-nosed mole  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  g
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D    Spiny softshell turtle  g
B D                    Lizard  g
B D             X. tropicalis  g
B D              Nile tilapia  a
          Princess of Burundi  t
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D                    Medaka  g
B D               Stickleback  g
B D              Atlantic cod  g
     Mexican tetra (cavefish)  g
B D                  Hedgehog  =
              Golden hamster  =
         Cape elephant shrew  -
                Prairie vole  =
B D                     Panda  =
B D                      Pika  =
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                   Ferret   =
B D                       Dog  =
B D                       Cat  =
            Brush-tailed rat  =
B D                       Rat  =
B D                     Mouse  =
B D                 Armadillo  =
B D                    Tenrec  =
B D                   Manatee  =
B D                  Elephant  =
B D