Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 584 in window, 175012958 - 175013018, 61 bps 
B D                     Human  ttgtggattagattttaatgtgaattttggaagtacacaaaatgttcaaactatagcatgt--------
B D                     Chimp  ttgtggattagattttaatgtgaattttggaagtacacaaaatgttcaaactatagcatgt--------
B D                   Gorilla  ttgtggattagattttaatgtgaattttggaagtacacaaaatgttcaaactatagcatgt--------
B D                 Orangutan  ttgtggattagatttcaatgtgaattttggaagtacacaaaatgttcaaactatagcttgt--------
B D                    Gibbon  ttgtggattagatttcaatgtgaattttggaagtacac-aaatgttcaaactatagcacgt--------
B D                    Rhesus  ttgtgaattagatagcaatgtgaattttagaagtacac-aaatgttcaaactacagcatgt--------
B D       Crab-eating macaque  ttgtgaattagatagcaatgtgaattttagaagtacac-aaatgttcaaactacagcatgt--------
B D                    Baboon  ttgtggattagatagccacgtgaattttagaagtacac-aaatgttcaaactacagcatgt--------
B D              Green monkey  ttgtggattagatagcaatgtgaattttagaagtacac-aaatgttcaaactacagcatgt--------
B D                  Marmoset  ttgtggattatatttcagtgtgaattttgggagtacac-aaatgttcaaaccatagcatat--------
B D                  Squirrel  ttga----taagt--caacatgaattttg-------------------aatgggaacatgcaaaccata
B D           Chinese hamster  ctgggcattaagtttc-atatccattctggagagac---aactatttaaataatagtatgc--------
               Golden hamster  ctgggcattaagttccaatatgcattctg-------------------aataatagtatgc--------
B D                       Rat  =====================================================================
                Prairie vole  =====================================================================
B D                     Mouse  =====================================================================
      Lesser Egyptian jerboa  =====================================================================
B D                      Pika  =====================================================================
                Weddell seal  =====================================================================
B D                  Hedgehog  =====================================================================
B D                     Shrew  =====================================================================
B D                Guinea pig  =====================================================================
B D                       Pig  =====================================================================
B D                    Rabbit  =====================================================================
            Cape golden mole  =====================================================================
                    Aardvark  =====================================================================
  D    Spiny softshell turtle  =====================================================================
B D                   Megabat  =====================================================================
B D             X. tropicalis  =====================================================================
B D                    Turkey  =====================================================================
B D                   Chicken  =====================================================================
  D              Mallard duck  =====================================================================
          Tibetan ground jay  =====================================================================
B D               Zebra finch  =====================================================================
  D    White-throated sparrow  =====================================================================
B D           Tasmanian devil  =====================================================================
  D            Painted turtle  =====================================================================
  D           Green seaturtle  =====================================================================
B D        American alligator  =====================================================================
  D             Scarlet macaw  =====================================================================
B D                Budgerigar  =====================================================================
B D                   Opossum  =====================================================================
B D            Naked mole-rat  =====================================================================
  D               Rock pigeon  =====================================================================
  D       Collared flycatcher  =====================================================================
B D       Medium ground finch  =====================================================================
B D                    Lizard  =====================================================================
  D          Peregrine falcon  =====================================================================
  D              Saker falcon  =====================================================================
  D                    Parrot  =====================================================================
            Brush-tailed rat  =====================================================================
                  Chinchilla  =====================================================================
         Cape elephant shrew  =====================================================================
          Chinese tree shrew  =====================================================================
B D                  Platypus  =====================================================================
B D                   Wallaby  =====================================================================
B D                   Manatee  =====================================================================
B D                  Elephant  =====================================================================
B D                    Tenrec  =====================================================================
B D                       Cat  =====================================================================
B D                  Bushbaby  =====================================================================
  D  Chinese softshell turtle  =====================================================================
B D                   Ferret   =====================================================================
             Star-nosed mole  =====================================================================
               Domestic goat  =====================================================================
B D                     Sheep  =====================================================================
            Tibetan antelope  =====================================================================
              Bactrian camel  =====================================================================
B D                    Alpaca  =====================================================================
              Pacific walrus  =====================================================================
B D                     Panda  =====================================================================
                Killer whale  =====================================================================
B D                       Dog  =====================================================================
            Black flying-fox  =====================================================================
B D          White rhinoceros  =====================================================================
B D                     Horse  =====================================================================
B D                 Armadillo  =====================================================================
        David's myotis (bat)  =====================================================================
               Big brown bat  =====================================================================
B D                  Microbat  =====================================================================
B D           Squirrel monkey  =====================================================================
B D                       Cow  =====================================================================

Alignment block 2 of 584 in window, 175013019 - 175013037, 19 bps 
B D                     Human  atatatatcaagttggcag
B D                     Chimp  atatatatcaagttggcag
B D                   Gorilla  atatatatcaagttggcag
B D                 Orangutan  atatatatcaagttggcag
B D                    Gibbon  atatatatcaagttggcag
B D                    Rhesus  atatacatcaagttggtag
B D       Crab-eating macaque  atatacatcaagttggtag
B D                    Baboon  atatacatcaagttggtag
B D              Green monkey  atatacatcaagttggtag
B D                  Marmoset  at--------agttggcag
B D                  Squirrel  acac---tcaagttagcag
B D           Chinese hamster  acac---tgagtttagtac
               Golden hamster  acac---tgagtttagtac
B D                       Pig  atgcatataaagttgtta-
B D                     Horse  atacgtatcaagttgtta-
B D                       Rat  ===================
                Prairie vole  ===================
B D                     Mouse  ===================
      Lesser Egyptian jerboa  ===================
B D                      Pika  ===================
                Weddell seal  ===================
B D                  Hedgehog  ===================
B D                     Shrew  ===================
B D                Guinea pig  ===================
B D                    Rabbit  ===================
            Cape golden mole  ===================
                    Aardvark  ===================
  D    Spiny softshell turtle  ===================
B D                   Megabat  ===================
B D             X. tropicalis  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
  D    White-throated sparrow  ===================
B D           Tasmanian devil  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
  D             Scarlet macaw  ===================
B D                Budgerigar  ===================
B D                   Opossum  ===================
B D            Naked mole-rat  ===================
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D       Medium ground finch  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D                    Parrot  ===================
            Brush-tailed rat  ===================
                  Chinchilla  ===================
         Cape elephant shrew  ===================
          Chinese tree shrew  ===================
B D                  Platypus  ===================
B D                   Wallaby  ===================
B D                   Manatee  ===================
B D                  Elephant  ===================
B D                    Tenrec  ===================
B D                       Cat  ===================
B D                  Bushbaby  ===================
  D  Chinese softshell turtle  ===================
B D                   Ferret   ===================
             Star-nosed mole  ===================
               Domestic goat  ===================
B D                     Sheep  ===================
            Tibetan antelope  ===================
              Bactrian camel  ===================
B D                    Alpaca  ===================
              Pacific walrus  ===================
B D                     Panda  ===================
                Killer whale  ===================
B D                       Dog  ===================
            Black flying-fox  ===================
B D          White rhinoceros  ===================
B D                 Armadillo  ===================
        David's myotis (bat)  ===================
               Big brown bat  ===================
B D                  Microbat  ===================
B D           Squirrel monkey  ===================
B D                       Cow  ===================

Inserts between block 2 and 3 in window
B D                 Squirrel 41bp

Alignment block 3 of 584 in window, 175013038 - 175013039, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D                  Squirrel  ca
B D            Naked mole-rat  tg
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  --
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
                Weddell seal  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  --
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
  D    Spiny softshell turtle  ==
B D                   Megabat  ==
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
         Cape elephant shrew  ==
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D           Chinese hamster  --
B D                    Tenrec  ==
B D                       Cat  ==
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
             Star-nosed mole  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
                Killer whale  ==
B D                       Dog  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  --
B D                 Armadillo  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                  Microbat  ==
B D           Squirrel monkey  ==
B D                       Cow  ==

Alignment block 4 of 584 in window, 175013040 - 175013063, 24 bps 
B D                     Human  taaac----tacttgcaagtaactttag
B D                     Chimp  taaac----tactttcaagtagctttag
B D                   Gorilla  taaac----tactttcaagtaactttag
B D                 Orangutan  taaac----tactttcaagtaactttag
B D                    Gibbon  taaac----tactttcaagtaactttag
B D                    Rhesus  caaac----tactttcaaataac--tag
B D       Crab-eating macaque  caaac----tactttcaaataac--tag
B D                    Baboon  caaac----tactttcaaataac--tag
B D              Green monkey  caaac----tacttccaaataac--tag
B D                  Marmoset  taaac----taatttcaagtaactttag
B D                  Squirrel  aaaat----aatcacaaaggaatcttaa
B D           Chinese hamster  -aagt----tgtcctcaagtatctttag
               Golden hamster  aaagt----tattctcaagcatctttag
B D            Naked mole-rat  ccagc----aatcaacaaatttattcta
B D                       Pig  taaacg---tactttcaagtgactttag
             Tibetan antelope  tatac----tactttcaagtgaccttag
                Domestic goat  tatac----tactttcaagtgaccttag
B D                     Horse  taaacacgttgctttcaagtgactttag
B D                       Rat  ============================
                Prairie vole  ============================
B D                     Mouse  ============================
      Lesser Egyptian jerboa  ============================
B D                      Pika  ============================
                Weddell seal  ============================
B D                  Hedgehog  ============================
B D                     Shrew  ============================
B D                Guinea pig  ============================
B D                    Rabbit  ============================
            Cape golden mole  ============================
                    Aardvark  ============================
  D    Spiny softshell turtle  ============================
B D                   Megabat  ============================
B D             X. tropicalis  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
B D               Zebra finch  ============================
  D    White-throated sparrow  ============================
B D           Tasmanian devil  ============================
  D            Painted turtle  ============================
  D           Green seaturtle  ============================
B D        American alligator  ============================
  D             Scarlet macaw  ============================
B D                Budgerigar  ============================
B D                   Opossum  ============================
  D               Rock pigeon  ============================
  D       Collared flycatcher  ============================
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
            Brush-tailed rat  ============================
                  Chinchilla  ============================
         Cape elephant shrew  ============================
          Chinese tree shrew  ============================
B D                  Platypus  ============================
B D                   Wallaby  ============================
B D                   Manatee  ============================
B D                  Elephant  ============================
B D                    Tenrec  ============================
B D                       Cat  ============================
B D                  Bushbaby  ============================
  D  Chinese softshell turtle  ============================
B D                   Ferret   ============================
             Star-nosed mole  ============================
B D                     Sheep  ============================
              Bactrian camel  ============================
B D                    Alpaca  ============================
              Pacific walrus  ============================
B D                     Panda  ============================
                Killer whale  ============================
B D                       Dog  ============================
            Black flying-fox  ============================
B D          White rhinoceros  ============================
B D                 Armadillo  ============================
        David's myotis (bat)  ============================
               Big brown bat  ============================
B D                  Microbat  ============================
B D           Squirrel monkey  ============================
B D                       Cow  ============================

Alignment block 5 of 584 in window, 175013064 - 175013067, 4 bps 
B D                     Human  aaca
B D                     Chimp  aaca
B D                   Gorilla  aaca
B D                 Orangutan  aaca
B D                    Gibbon  aaca
B D                    Rhesus  aaca
B D       Crab-eating macaque  aaca
B D                    Baboon  aaca
B D              Green monkey  aaca
B D                  Marmoset  aaca
B D                  Squirrel  actg
B D           Chinese hamster  agta
               Golden hamster  agta
B D            Naked mole-rat  ctta
B D                       Pig  aata
             Tibetan antelope  agta
                Domestic goat  aata
B D                     Horse  aata
B D                       Dog  aaca
B D                  Microbat  agca
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
      Lesser Egyptian jerboa  ====
B D                      Pika  ====
                Weddell seal  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                Guinea pig  ====
B D                    Rabbit  ====
            Cape golden mole  ====
                    Aardvark  ====
  D    Spiny softshell turtle  ====
B D                   Megabat  ====
B D             X. tropicalis  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ====
                  Chinchilla  ====
         Cape elephant shrew  ====
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D                    Tenrec  ====
B D                       Cat  ====
B D                  Bushbaby  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
             Star-nosed mole  ====
B D                     Sheep  ====
              Bactrian camel  ====
B D                    Alpaca  ====
              Pacific walrus  ====
B D                     Panda  ====
                Killer whale  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                 Armadillo  ====
        David's myotis (bat)  ====
               Big brown bat  ====
B D           Squirrel monkey  ====
B D                       Cow  ====

Alignment block 6 of 584 in window, 175013068 - 175013078, 11 bps 
B D                     Human  caagt-gt---ttgc
B D                     Chimp  caagt-gt---ttgc
B D                   Gorilla  caagt-gt---ttgc
B D                 Orangutan  caagtggt---ttgc
B D                    Gibbon  caagt-gt---ttgc
B D                    Rhesus  caagt-gt---tcac
B D       Crab-eating macaque  caagt-gt---tcac
B D                    Baboon  caagt-gt---tcgc
B D              Green monkey  caagt-gt---tcac
B D                  Marmoset  caagt-gt---ttgc
B D                  Squirrel  caacc-acgagttgt
B D           Chinese hamster  ttgtc-at---ttgt
               Golden hamster  ttgtc-at---ttgt
B D            Naked mole-rat  tgat-----------
B D                       Pig  cagtg-tt---ttgt
             Tibetan antelope  cagtg-tt---ttgt
                Domestic goat  cagtg-tt---ttgt
B D                     Horse  caata-tt---ttgc
B D                       Dog  c---a-tg---tggt
B D                  Microbat  a---a-tg---tgat
              Star-nosed mole  cagaa-gt---atgc
B D                       Rat  ===============
                Prairie vole  ===============
B D                     Mouse  ===============
      Lesser Egyptian jerboa  ===============
B D                      Pika  ===============
                Weddell seal  ===============
B D                  Hedgehog  ===============
B D                     Shrew  ===============
B D                Guinea pig  ===============
B D                    Rabbit  ===============
            Cape golden mole  ===============
                    Aardvark  ===============
  D    Spiny softshell turtle  ===============
B D                   Megabat  ===============
B D             X. tropicalis  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
  D    White-throated sparrow  ===============
B D           Tasmanian devil  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D        American alligator  ===============
  D             Scarlet macaw  ===============
B D                Budgerigar  ===============
B D                   Opossum  ===============
  D               Rock pigeon  ===============
  D       Collared flycatcher  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D                    Parrot  ===============
            Brush-tailed rat  ===============
                  Chinchilla  ===============
         Cape elephant shrew  ===============
          Chinese tree shrew  ===============
B D                  Platypus  ===============
B D                   Wallaby  ===============
B D                   Manatee  ===============
B D                  Elephant  ===============
B D                    Tenrec  ===============
B D                       Cat  ===============
B D                  Bushbaby  ===============
  D  Chinese softshell turtle  ===============
B D                   Ferret   ===============
B D                     Sheep  ===============
              Bactrian camel  ===============
B D                    Alpaca  ===============
              Pacific walrus  ===============
B D                     Panda  ===============
                Killer whale  ===============
            Black flying-fox  ===============
B D          White rhinoceros  ===============
B D                 Armadillo  ===============
        David's myotis (bat)  ===============
               Big brown bat  ===============
B D           Squirrel monkey  ===============
B D                       Cow  ===============

Inserts between block 6 and 7 in window
B D           Naked mole-rat 5bp
B D                    Horse 8bp
B D                      Dog 3bp
B D                 Microbat 3bp

Alignment block 7 of 584 in window, 175013079 - 175013083, 5 bps 
B D                     Human  ccatt
B D                     Chimp  ccatt
B D                   Gorilla  ccatt
B D                 Orangutan  ccatt
B D                    Gibbon  ccatt
B D                    Rhesus  ccatt
B D       Crab-eating macaque  ccatt
B D                    Baboon  ccatt
B D              Green monkey  ccatt
B D                  Marmoset  tcact
B D                  Squirrel  ttaca
B D           Chinese hamster  ccacc
               Golden hamster  ccacc
B D                       Pig  ccatt
B D                    Alpaca  ctatt
               Bactrian camel  ctatt
             Tibetan antelope  ccatt
                Domestic goat  ccatt
B D                     Horse  ctagt
B D                       Dog  ctagt
B D                  Microbat  ctagt
              Star-nosed mole  agatt
B D                       Rat  =====
                Prairie vole  =====
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
B D                      Pika  =====
                Weddell seal  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                Guinea pig  =====
B D                    Rabbit  =====
            Cape golden mole  =====
                    Aardvark  =====
  D    Spiny softshell turtle  =====
B D                   Megabat  =====
B D             X. tropicalis  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
B D            Naked mole-rat  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
            Brush-tailed rat  =====
                  Chinchilla  =====
         Cape elephant shrew  =====
          Chinese tree shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                   Manatee  =====
B D                  Elephant  =====
B D                    Tenrec  =====
B D                       Cat  =====
B D                  Bushbaby  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
B D                     Sheep  =====
              Pacific walrus  =====
B D                     Panda  =====
                Killer whale  =====
            Black flying-fox  =====
B D          White rhinoceros  =====
B D                 Armadillo  =====
        David's myotis (bat)  =====
               Big brown bat  =====
B D           Squirrel monkey  =====
B D                       Cow  =====

Inserts between block 7 and 8 in window
B D                      Pig 1990bp
            Tibetan antelope 4303bp
               Domestic goat 4269bp

Alignment block 8 of 584 in window, 175013084 - 175013087, 4 bps 
B D                     Human  ggta--
B D                     Chimp  ggta--
B D                   Gorilla  ggta--
B D                 Orangutan  ggta--
B D                    Gibbon  ggta--
B D                    Rhesus  ggta--
B D       Crab-eating macaque  ggta--
B D                    Baboon  ggta--
B D              Green monkey  ggta--
B D                  Marmoset  ggta--
B D                  Squirrel  caaa--
B D           Chinese hamster  acta--
               Golden hamster  acta--
B D                    Alpaca  -----g
               Bactrian camel  -----g
B D                     Horse  --ga--
B D                       Dog  --tatg
B D                  Microbat  --tata
              Star-nosed mole  ----tg
B D                       Rat  ======
                Prairie vole  ======
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                      Pika  ======
                Weddell seal  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                Guinea pig  ======
B D                       Pig  ======
B D                    Rabbit  ======
            Cape golden mole  ======
                    Aardvark  ======
  D    Spiny softshell turtle  ======
B D                   Megabat  ======
B D             X. tropicalis  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
B D            Naked mole-rat  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
            Brush-tailed rat  ======
                  Chinchilla  ======
         Cape elephant shrew  ======
          Chinese tree shrew  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D                    Tenrec  ======
B D                       Cat  ======
B D                  Bushbaby  ======
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
              Pacific walrus  ======
B D                     Panda  ======
                Killer whale  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                 Armadillo  ======
        David's myotis (bat)  ======
               Big brown bat  ======
B D           Squirrel monkey  ======
B D                       Cow  ======

Alignment block 9 of 584 in window, 175013088 - 175013093, 6 bps 
B D                     Human  gtgaga
B D                     Chimp  gtgaga
B D                   Gorilla  gtgaga
B D                 Orangutan  gtgaga
B D                    Gibbon  gtgaga
B D                    Rhesus  gtgaga
B D       Crab-eating macaque  gtgaga
B D                    Baboon  gtgaga
B D              Green monkey  gtgaga
B D                  Marmoset  gtgaga
B D                  Squirrel  attgga
B D           Chinese hamster  atgaga
               Golden hamster  atgaga
B D            Naked mole-rat  actagt
                   Chinchilla  actagt
B D                    Alpaca  atgtga
               Bactrian camel  atgtga
B D                     Horse  ----ga
B D                       Dog  atctga
B D                  Microbat  atttga
              Star-nosed mole  atgtaa
B D                       Rat  ======
                Prairie vole  ======
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                      Pika  ======
                Weddell seal  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                Guinea pig  ======
B D                       Pig  ======
B D                    Rabbit  ======
            Cape golden mole  ======
                    Aardvark  ======
  D    Spiny softshell turtle  ======
B D                   Megabat  ======
B D             X. tropicalis  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
            Brush-tailed rat  ======
         Cape elephant shrew  ======
          Chinese tree shrew  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D                    Tenrec  ======
B D                       Cat  ======
B D                  Bushbaby  ======
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
              Pacific walrus  ======
B D                     Panda  ======
                Killer whale  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                 Armadillo  ======
        David's myotis (bat)  ======
               Big brown bat  ======
B D           Squirrel monkey  ======
B D                       Cow  ======

Inserts between block 9 and 10 in window
B D                   Alpaca 7bp
              Bactrian camel 7bp
             Star-nosed mole 4bp

Alignment block 10 of 584 in window, 175013094 - 175013096, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tgg
B D                    Gibbon  tgg
B D                    Rhesus  tgg
B D       Crab-eating macaque  tgg
B D                    Baboon  tgg
B D              Green monkey  tgg
B D                  Marmoset  tgg
B D                  Squirrel  ggt
B D           Chinese hamster  tgg
               Golden hamster  tgg
B D            Naked mole-rat  ta-
                   Chinchilla  ta-
B D                    Alpaca  tg-
               Bactrian camel  tg-
B D                     Horse  tgg
B D                       Dog  tgg
                Big brown bat  tag
B D                  Microbat  tta
              Star-nosed mole  t--
B D                       Rat  ===
                Prairie vole  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
                Weddell seal  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                       Pig  ===
B D                    Rabbit  ===
            Cape golden mole  ===
                    Aardvark  ===
  D    Spiny softshell turtle  ===
B D                   Megabat  ===
B D             X. tropicalis  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Brush-tailed rat  ===
         Cape elephant shrew  ===
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                  Bushbaby  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
              Pacific walrus  ===
B D                     Panda  ===
                Killer whale  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                 Armadillo  ===
        David's myotis (bat)  ===
B D           Squirrel monkey  ===
B D                       Cow  ===

Inserts between block 10 and 11 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Horse 1542bp
B D                      Dog 1bp
             Star-nosed mole 1bp

Alignment block 11 of 584 in window, 175013097 - 175013100, 4 bps 
B D                     Human  attc
B D                     Chimp  attc
B D                   Gorilla  attc
B D                 Orangutan  attc
B D                    Gibbon  attc
B D                    Rhesus  attc
B D       Crab-eating macaque  attc
B D                    Baboon  attc
B D              Green monkey  attc
B D                  Marmoset  attc
B D                  Squirrel  caga
B D           Chinese hamster  attc
               Golden hamster  attc
B D                    Alpaca  ttac
               Bactrian camel  ttac
B D                     Horse  ttac
B D                       Dog  ttac
                Big brown bat  tttc
B D                  Microbat  atgc
              Star-nosed mole  ttac
B D                       Rat  ====
                Prairie vole  ====
B D                     Mouse  ====
      Lesser Egyptian jerboa  ====
B D                      Pika  ====
                Weddell seal  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                Guinea pig  ====
B D                       Pig  ====
B D                    Rabbit  ====
            Cape golden mole  ====
                    Aardvark  ====
  D    Spiny softshell turtle  ====
B D                   Megabat  ====
B D             X. tropicalis  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
B D            Naked mole-rat  ----
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ====
                  Chinchilla  ----
         Cape elephant shrew  ====
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D                    Tenrec  ====
B D                       Cat  ====
B D                  Bushbaby  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
              Pacific walrus  ====
B D                     Panda  ====
                Killer whale  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                 Armadillo  ====
        David's myotis (bat)  ====
B D           Squirrel monkey  ====
B D                       Cow  ====

Alignment block 12 of 584 in window, 175013101 - 175013102, 2 bps 
B D                     Human  t-a
B D                     Chimp  t-a
B D                   Gorilla  t-a
B D                 Orangutan  t-a
B D                    Gibbon  t-a
B D                    Rhesus  t-a
B D       Crab-eating macaque  t-a
B D                    Baboon  t-a
B D              Green monkey  t-a
B D                  Marmoset  g-a
B D                  Squirrel  g-a
B D           Chinese hamster  t-a
               Golden hamster  t-a
B D            Naked mole-rat  t-a
                   Chinchilla  c-a
             Brush-tailed rat  t-a
B D                    Alpaca  t--
               Bactrian camel  t--
B D                     Horse  t--
B D                       Dog  t--
                Big brown bat  ta-
B D                  Microbat  ta-
              Star-nosed mole  t--
B D                       Rat  ===
                Prairie vole  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
                Weddell seal  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                       Pig  ===
B D                    Rabbit  ===
            Cape golden mole  ===
                    Aardvark  ===
  D    Spiny softshell turtle  ===
B D                   Megabat  ===
B D             X. tropicalis  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
         Cape elephant shrew  ===
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                  Bushbaby  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
              Pacific walrus  ===
B D                     Panda  ===
                Killer whale  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                 Armadillo  ===
        David's myotis (bat)  ===
B D           Squirrel monkey  ===
B D                       Cow  ===

Inserts between block 12 and 13 in window
B D                 Marmoset 1878bp
B D                 Microbat 6bp

Alignment block 13 of 584 in window, 175013103 - 175013103, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Squirrel  a
B D           Chinese hamster  a
               Golden hamster  a
B D            Naked mole-rat  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
B D                     Horse  a
B D                       Dog  a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Microbat  a
              Star-nosed mole  a
B D                  Elephant  a
B D                 Armadillo  a
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                    Tenrec  =
B D                       Cat  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D          White rhinoceros  =
               Big brown bat  -
B D                       Cow  =

Inserts between block 13 and 14 in window
B D                   Rhesus 1702bp
B D      Crab-eating macaque 1696bp
B D                 Squirrel 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 14 of 584 in window, 175013104 - 175013104, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  g
B D                  Elephant  g
B D                 Armadillo  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
  D    Spiny softshell turtle  =
B D       Crab-eating macaque  =
B D                    Rhesus  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D           Chinese hamster  =
B D                    Tenrec  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                  Squirrel  =
B D                       Cow  =

Inserts between block 14 and 15 in window
B D                   Baboon 1698bp
B D             Green monkey 1693bp

Alignment block 15 of 584 in window, 175013105 - 175013105, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  t
B D           Chinese hamster  t
               Golden hamster  t
B D            Naked mole-rat  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
              Star-nosed mole  t
B D                  Elephant  c
B D                 Armadillo  t
B D                       Rat  =
                Prairie vole  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                    Baboon  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
  D    Spiny softshell turtle  =
B D              Green monkey  =
B D       Crab-eating macaque  =
B D                    Rhesus  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                    Tenrec  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                       Cow  =

Inserts between block 15 and 16 in window
B D                 Squirrel 17bp
B D          Chinese hamster 1197bp
              Golden hamster 349bp

Alignment block 16 of 584 in window, 175013106 - 175013107, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                  Marmoset  ta
B D           Squirrel monkey  ta
           Chinese tree shrew  tg
B D                  Squirrel  tt
B D            Naked mole-rat  tg
                   Chinchilla  tg
             Brush-tailed rat  tg
B D                       Pig  tg
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tg
                 Killer whale  tg
B D                     Horse  tg
B D          White rhinoceros  tg
B D                       Cat  tg
B D                       Dog  cg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                   Megabat  tg
                Big brown bat  tg
         David's myotis (bat)  tg
B D                  Microbat  tg
              Star-nosed mole  ta
B D                  Elephant  tg
B D                 Armadillo  tg
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                    Baboon  ==
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
  D    Spiny softshell turtle  ==
B D              Green monkey  ==
B D       Crab-eating macaque  ==
B D                    Rhesus  ==
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                   Manatee  ==
B D           Chinese hamster  ==
B D                    Tenrec  ==
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                       Cow  ==

Alignment block 17 of 584 in window, 175013108 - 175013108, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D                  Squirrel  a
B D            Naked mole-rat  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                       Pig  g
B D                    Alpaca  a
               Bactrian camel  g
B D                   Dolphin  a
                 Killer whale  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
B D                 Armadillo  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                    Rabbit  =
            Cape golden mole  =
                    Aardvark  =
  D    Spiny softshell turtle  =
B D              Green monkey  =
B D                    Rhesus  =
B D             X. tropicalis  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
B D                    Tenrec  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                       Cow  =

Alignment block 18 of 584 in window, 175013109 - 175013110, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  gg
B D            Naked mole-rat  ga
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
B D                     Horse  aa
B D          White rhinoceros  ga
B D                       Cat  aa
B D                       Dog  ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  g-
B D                   Megabat  g-
                Big brown bat  a-
         David's myotis (bat)  g-
B D                  Microbat  g-
              Star-nosed mole  ga
B D                  Elephant  ga
B D                   Manatee  gc
B D                 Armadillo  ga
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
  D    Spiny softshell turtle  ==
B D              Green monkey  ==
B D                    Rhesus  ==
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D           Chinese hamster  ==
B D                    Tenrec  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                       Cow  ==

Alignment block 19 of 584 in window, 175013111 - 175013164, 54 bps 
B D                     Human  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                     Chimp  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                   Gorilla  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                 Orangutan  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                    Gibbon  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                    Rhesus  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D       Crab-eating macaque  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                    Baboon  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatgtttaagaaat-----
B D              Green monkey  tatt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                  Marmoset  tact-----ag--g--ta--gaacattccagtt----ggtaagctgtcatacatatttaagaaat-----
B D           Squirrel monkey  tagt-----ag--c--ta--gaacattccagtt----ggtaagttgtcatacatatttaagaaat-----
B D                  Bushbaby  tact-----aa--t--ta--aaatactctagtt----cctaaggtgtcataaa--tttaggaaat-----
           Chinese tree shrew  gatt-----agc-c--ta--gagcattctagtt----agtaggttgtcatataaatttagacaac-----
B D                  Squirrel  -----------tat--ta--gagcattctagtt----ggtaatctgtcat---aaattagaaaat-----
B D            Naked mole-rat  -----------tat--aaaagaggctatcagtt----ggtgaactgccgtatgaatttaggaaat-----
                   Chinchilla  -----------tat--ta--gaggacaccagtt----ggtgaattgccatatgaatttaggaaataaaaa
             Brush-tailed rat  -----------tac--ta-----gataccagt-------tgaattgccatacgaatttaggaaat-----
B D                       Pig  tatt-----ag--c--ta--gagcactccagtt----ggtaagttgtaataaaaatttaggaaat-----
B D                    Alpaca  gatt-----ag--c--ta--gagcacaccagtt-----gtaagttgtaatacaaattcaggaaat-----
               Bactrian camel  tatt-----ag--c--ta--gagcacaccagtt-----gtaaattgtaatacaaattcaggaaat-----
B D                   Dolphin  tgtt-----ag--c--ta--gagcatttcagtt----agtaagtcgtaatacaaatttaggaaat-----
                 Killer whale  tgtt-----ag--c--ta--gagcatttcagtt----agtaagtcgtaatacaaatttaggaaat-----
B D                     Horse  tattagctaag--c--ta--gagcattccagtt----cgtaaattggaatataaatttaggaaat-----
B D          White rhinoceros  catt-----ag--c--ta--gagcattccagttggtaagtaagttgtaatataaatttaggaaat-----
B D                       Cat  tatt-----ag--c--ta--gagcattccagtt----ggtaagttgtaataaaaacttggcaaat-----
B D                       Dog  tatt-----ag--c--ta--gagcattccagct----cgtaagctataacataaacttgggaaac-----
B D                     Panda  tatt-----ag--c--ta--gagcattccagtt----ggtaagctgtaatataaatttgggaaac-----
               Pacific walrus  tact-----ag--c--ta--gagcattccagtt----ggtaagctgtaatataaatttgggaaac-----
                 Weddell seal  tatt-----ag--c--ta--gagcattccagtt----ggtaagctgtaatataaatttgggaaac-----
             Black flying-fox  -att-----ag--c--ta--gagcattccagtt----cgtaaactgtaatataaatttaggaaat-----
B D                   Megabat  -att-----ag--c--ta--gagcattccagtt----cgtaaac--taatataaatttaggaaat-----
                Big brown bat  -att-----tg--c--ta--gagcattccagtt----tgtaaactgtaagat-----------at-----
         David's myotis (bat)  -att-----tg--c--ta--gagcattccagtt----tgtaaactggaagataaatttaggaaac-----
B D                  Microbat  -att-----tg--c--ta--gagcattccagtt----tgtaaactggaagataaatttaggaaac-----
              Star-nosed mole  tcat-----ag--c--ta--gagtactcttatt----tggaacgt----tataaatttagggact-----
B D                  Elephant  tatt-----aa--c--ta--gaacattccagtt----ggtaagctgttatataactt-------t-----
B D                   Manatee  tatt-----aa--c--ta--gaacattctagtt----ggtaagttgttatataactttatgaagt-----
B D                 Armadillo  tatt-----ag--ctgta--aagcatttgaacc----ggtaaggtgttataaaactttaggaaat-----
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                       Cow  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Chinchilla  tctgcactggggatgcagctcagtggtagagttcttgccttgtaggcactagaccctgactttgatcccc
             Brush-tailed rat  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                       Rabbit  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
              Chinese hamster  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  --------------------atga
                        Chimp  --------------------atga
                      Gorilla  --------------------atga
                    Orangutan  --------------------atga
                       Gibbon  --------------------agga
                       Rhesus  --------------------atga
          Crab-eating macaque  --------------------atga
                       Baboon  --------------------atga
                 Green monkey  --------------------atga
                     Marmoset  --------------------ataa
              Squirrel monkey  --------------------ataa
                     Bushbaby  --------------------atca
           Chinese tree shrew  --------------------acga
                     Squirrel  --------------------atga
               Naked mole-rat  --------------------acaa
                   Chinchilla  agaaccaaacacacacaaacaaaa
             Brush-tailed rat  --------------------acat
                          Pig  --------------------atgg
                       Alpaca  --------------------atga
               Bactrian camel  --------------------atga
                      Dolphin  --------------------acga
                 Killer whale  --------------------acga
                        Horse  --------------------acga
             White rhinoceros  --------------------atga
                          Cat  --------------------atga
                          Dog  --------------------atga
                        Panda  --------------------atga
               Pacific walrus  --------------------atga
                 Weddell seal  --------------------atga
             Black flying-fox  --------------------acta
                      Megabat  --------------------acta
                Big brown bat  --------------------atga
         David's myotis (bat)  --------------------atga
                     Microbat  --------------------atga
              Star-nosed mole  --------------------atga
                     Elephant  --------------------atga
                      Manatee  --------------------atga
                    Armadillo  --------------------ggga
                          Rat  ========================
                 Prairie vole  ========================
               Golden hamster  ========================
                        Mouse  ========================
       Lesser Egyptian jerboa  ========================
                         Pika  ========================
                     Hedgehog  ========================
                        Shrew  ========================
                   Guinea pig  ========================
                       Rabbit  ========================
             Cape golden mole  ========================
                     Aardvark  ========================
       Spiny softshell turtle  ========================
                X. tropicalis  ========================
                       Turkey  ========================
                      Chicken  ========================
                 Mallard duck  ========================
           Tibetan ground jay  ========================
                  Zebra finch  ========================
       White-throated sparrow  ========================
              Tasmanian devil  ========================
               Painted turtle  ========================
              Green seaturtle  ========================
           American alligator  ========================
                Scarlet macaw  ========================
                   Budgerigar  ========================
                      Opossum  ========================
                  Rock pigeon  ========================
          Collared flycatcher  ========================
          Medium ground finch  ========================
                       Lizard  ========================
             Peregrine falcon  ========================
                 Saker falcon  ========================
                       Parrot  ========================
          Cape elephant shrew  ========================
                     Platypus  ========================
                      Wallaby  ========================
              Chinese hamster  ========================
                       Tenrec  ========================
     Chinese softshell turtle  ========================
                      Ferret   ========================
                Domestic goat  ========================
                        Sheep  ========================
             Tibetan antelope  ========================
                          Cow  ========================

Inserts between block 19 and 20 in window
B D                      Pig 315bp

Alignment block 20 of 584 in window, 175013165 - 175013359, 195 bps 
B D                     Human  atccaaactag---attgtgat-------a------at-------------tccctc--ataacttcacc
B D                     Chimp  atccaaactag---attgtgat-------a------at-------------tccctc--ataacttcacc
B D                   Gorilla  atccaaactag---attgtgat-------a------gt-------------tccctc--ataacttcacc
B D                 Orangutan  atccaaactag---attgtgat-------a------at-------------tccctc--ataacttcacc
B D                    Gibbon  atccaaactag---attgtgat-------a------aa-------------tccctc--acaacttcatc
B D                    Rhesus  atccaaattag---attgtgat-------a------at-------------tccctc--ataacttcacc
B D       Crab-eating macaque  atccaaattag---attgtgat-------a------at-------------tccctc--ataacttcacc
B D                    Baboon  atccaaattag---attgtgat-------a------at-------------tccctc--ataacttcacc
B D              Green monkey  atccaaactag---attgtgat-------g------at-------------tccctc--ataacttcacc
B D                  Marmoset  atcccaactag---attgtgat-------a------at-------------tccctc--ataactccacc
B D           Squirrel monkey  atcccaactag---attgtgat-------a------at-------------tgcctc--ataacttcacc
B D                  Bushbaby  gtacaaggtat---atcataa------------------------------tccctc--acaacttaatg
           Chinese tree shrew  atttgaggtat---ttt---at-------a------at-------------tccctc--ataactccatc
B D                  Squirrel  atctaaggtat---atcacaatttcctcaa------at-------------tt-----------tcattc
B D            Naked mole-rat  atccagggtat---atcatgat-------a------at-------------tc-----------cctatc
                   Chinchilla  atccaaggtat---attgtgat-------a------at-------------cccct--------cctatc
             Brush-tailed rat  atccaaagtat---agtatgaa-------a------at-------------tcttt--------cccagc
B D                       Pig  atccaaggtat---a---tctt----gctg------at-------------ttcctctcatg-----acc
B D                    Alpaca  atccaacatat---a---tcat----gaaa------at-----------------tctcatgacttcacc
               Bactrian camel  atccaacatat---a---tcat----gaaa------at-------------tccctctcatgacttcacc
B D                   Dolphin  atccaaggtat---a---tcat-------a------at-------------tccctctcatgacctcacc
                 Killer whale  atccaaggtat---a---tcat-------a------at-------------tccctctcatgacctcacc
B D                     Horse  atccaagatatagca---tgat-------a------at-------------tccctcttactacttcacc
B D          White rhinoceros  atcgaaggtatatca---cgat-------a------at-------------tccctctcattacttcacc
B D                       Cat  atccaaggttt---g---tgct-------a------at-------------tccctcttaaggcttcacc
B D                       Dog  atccaaagttt---g---tgat-------c------at-------------tctctc--acagcttcacc
B D                     Panda  atccaaggttt---g---tgag-------a------at-------------tccctc--acagcttcacc
               Pacific walrus  atccaaggttt---a---tgag-------a------at-------------tctctc--acagcttcacc
                 Weddell seal  ctccaaggttt---g---tgag-------a------at-------------tctctc--acagcttcatc
             Black flying-fox  atccgaggtat---gt--catc-------atc----at-------------tccctataacgacttcccc
B D                   Megabat  atccgaggtat---gt--catc-------atc----at-------------tccctataacgacttcccc
                Big brown bat  atccaaggtat---ac--tgat-------a------at-------------tccctctcataactccatc
         David's myotis (bat)  atccaaggtat---ac--tgac-------a------at-------------tccctctcataacttcatc
B D                  Microbat  atccaaggtat---ac--tgac-------a------at-------------tccctctcataacttcatc
              Star-nosed mole  agtcaaggtat---at-atggt-------a------at-------------gccttctca--actttccc
B D                  Elephant  atccaaggtat---atcactgt-------a------at--------tacattaccttgtatgatttcacc
B D                   Manatee  atccaaggtgt---atcaccat-------ataaaatatacaaggtatatattcccttgtataacttcacc
B D                 Armadillo  atccaaggtat---atcac----------a------at------------tccctttttataacttcatc
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                       Cow  ======================================================================

                        Human  tc-cacctgagtttcggactc-tgctatccagctgcgtactag---tcttcatca--gatgac-acaggc
                        Chimp  tc-cacctgagtttcggactc-tgctatccagctgcgtactag---tcttcatca--gatgacaacaggc
                      Gorilla  tc-cacctgagtttcggactc-tgctatccagctgcgtactag---tcttcatca--gatgac-gcaggc
                    Orangutan  tc-cacctgagtttcggactc-tgctatccagctgtgtactag---tcttcatca--gatgac-acaggc
                       Gibbon  tc-cacctgagtttcggactc-tgctatccagctgcgtactag---tcttcatca--gatgac-acaggc
                       Rhesus  tc-cacctgagtttcagactc-tgctatccagctgcatactag---tcttcatca--gatgac-acaggc
          Crab-eating macaque  tc-cacctgagtttcagactc-tgctatccagctgcatactag---tcttcatca--gatgac-acaggc
                       Baboon  tc-cacctgagtttcagactc-tgctatccagctgcatactag---tcttcatca--gatgac-acaggc
                 Green monkey  tc-cacctgagtttcggactc-tgctatccagctgcatgctag---tcttcatca--gatgac-acaggc
                     Marmoset  tc-cacctgagtttcagactc-tgctatccagctgcatactagacttctccatca--gctgac-acaggc
              Squirrel monkey  tc-tacctgagtttcagactc-tgctatccagctgcgtactagacttctccatca--gatgac-acaggc
                     Bushbaby  tc-cacctgagttccagactc-tgccatccagtcacacattagg--tttaaatca--gatgac---gggt
           Chinese tree shrew  tc-cacctgaatcccaggctc-tgctctctagctatac-ctaggcttccccatca--aatgat---aggc
                     Squirrel  tt-aacctgagttccagacta-tggtacccag-tgtagact-----tctccatca--gatgat---cggt
               Naked mole-rat  tc-ctcctgaattccagac---tgctattcagttgcagatt-----tctccccta------------ggc
                   Chinchilla  tc-cccttgaattccagac---tgct----tgctg------------ttctacta------------ggc
             Brush-tailed rat  tc-tccttgagttccagac---tgctattaagttgaa----------ttccacct------------gga
                          Pig  t-------gatttccagacta---------------------cactttcccattgg-gatgac-acaggc
                       Alpaca  t-------gacttccagacta---------------------gatttctccatcag-gatgat-acaagc
               Bactrian camel  t-------gacttccagacta---------------------gatttctccatcag-gatgat-acaagc
                      Dolphin  t-------ggtttccagactt---------------------gactttcccatcgg-gatgac-acttgc
                 Killer whale  t-------ggtttccagactt---------------------gactttcccatcgg-gatgac-acttgc
                        Horse  tc-cacctgagttccagact----ctatccagctg--cacgagacatctccatcgg-gatg---acaggc
             White rhinoceros  tc-catctgagttccagactc-tgctatctggctgcacacgagacttctccatcgg-catgac-acaggc
                          Cat  tc-caccaaaattccagactc-tgctatccagctgcacagcaga--------cttg-gaaaac-acaggc
                          Dog  tc-caccaaaattccagactc-tgctctgcagcggcacaccagacttctccactgg-gaagac---aggc
                        Panda  tc-caccgaaattccagactc-tgctatccagctgcacaccagtcttctccactgg-gaagac-acaagc
               Pacific walrus  ac-c----aaattccggactc-tgctacccaggtgcacaccaggcctctcc-ctg----agac-acaggc
                 Weddell seal  tc-caccaaaattccaga--c-tgctacccaggtgcacaccaggcctctcc-ctgg-gaagac-a-aggc
             Black flying-fox  tc-cactggagttcc-------tgctgtccagccgtgcactagacttct---ctgtcgagggg-acaggc
                      Megabat  tc-cactggagttcc-------tgctgtccagccgtgcactagacttct---ctgtcgagggg-acaggc
                Big brown bat  tc-cacc-atgttcctgactc-tgctatccacctgcacagtagacttct---tcag-gatgat-acaggc
         David's myotis (bat)  tc-cacc-aagttcttgactcttgctatccatctgcacagtaga---ct---ttgg-gatgaa-acaggc
                     Microbat  tc-cacc-aagttcttgactc-tgctatccacctgcacagtaga---ct---tcgg-gatgaa-acaggc
              Star-nosed mole  tc-atcctgagttccagactt-------------------------------cctc----------aggc
                     Elephant  tcccacttgagtttctgactc-tgctatccaggtgaatactagacttcttcatcag-gatgac-ttaggc
                      Manatee  ttgcacttgagtttcagactc-tgccatccagctgaatatgagacttctccaacag-gatgac-tcaggc
                    Armadillo  ttgtaactgagttttaga--t-tgctatgcggttacatgctagacttttccattgg-ggtgac-tcaaa-
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                       Rabbit  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
              Chinese hamster  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  atctccaacaccgcatgact-ggaacctgaact-----cgctt-atct----tctgtttcccc-taaatt
                        Chimp  atctccaacaccgcatgact-ggaacctgaact-----cgctt-atct----tctgtttcccc-taaatt
                      Gorilla  atctccaacaccgcatgact-ggaacctgaact-----cgctt-atct----tctgtttcccc-taaatt
                    Orangutan  atctccaacaccgcatgact-ggaacctgaact-----cgctt-atct----tctgtttcccc-taaatc
                       Gibbon  atctccaacaccgcatgact-ggaacctgaact-----cgctt-atct----tctgtttcccc-taaatt
                       Rhesus  atctccaacactgcatgact-ggaacctgaact-----cactt-atct----tctgtttcccc-taaatc
          Crab-eating macaque  atctccaacactgcatgact-ggaacctgaact-----cactt-atct----tctgtttcccc-taaatc
                       Baboon  atctccaacactgcatgact-ggaacctgaact-----cgctt-atct----tctgtttcccc-taaatc
                 Green monkey  atctccaacactgcatgact-gga---tgaact-----cgctt-atct----tctgtttcccc-taaatc
                     Marmoset  atctccaacactgcatgact-ggaacctgaact-----tgtgt-atct----tctgttttctc-taaatc
              Squirrel monkey  atctccaacactgcatgact-ggaagctgaact-----cgtgt-atct----tctgttttctc-taaacc
                     Bushbaby  atcccaaacattgtaagact-gaaacccgaact-----tacct-atct----tc------ccc-taaacc
           Chinese tree shrew  atctcaaacactgcacaact-gaaatctgagct-----cac---acct----t-----tcccc-taaact
                     Squirrel  atctcaaatattgcatgact-aaaacctgaact-----ctctg-atct------gttttctcc-taaacc
               Naked mole-rat  atcccaaacattgcatgact-gaaacttctgct-----ccc---acct------tgtttctcc-tgaatc
                   Chinchilla  atcccaaacactatgcaactggaaacctcaact-----ctt---acgt------tgtttctcc-tgaatc
             Brush-tailed rat  atcccaaacac--tgccact-gaaaccttaac----------------------tgtttcttc-tgaatc
                          Pig  atctccaacattgtaaacct-gaaacctgaact-----taggt-acatatcgtgtctccccccaccaaat
                       Alpaca  atctcaagcactgtacatct-gaaacctgaact-----caagt-acgtatcttctgtttcccc-taaatc
               Bactrian camel  atctcaagcactgtacatct-gaaacctgaact-----caagt-acgtatcttctgtttcccc-taaatc
                      Dolphin  atctcaaacattgtacaact-gaaatctgaact-----caggt-acgtatcttctgttccccc-caaacc
                 Killer whale  atctcaaacattgtacaact-gaaatctgaact-----caggt-acgtatcttctgtttcccc-caaacc
                        Horse  atctcagact--gcatgaca-gaaacccgagct-----tgcatatctt------ctgttcccc-taaacc
             White rhinoceros  atctcaaact--gcacgact-gaaacctgagct-----cacgtagctt------ttgttcccc-caaacc
                          Cat  atctcaaaca--gcacaact-gaaacctaaact-----cccataacct------ggtttcttc-cacacc
                          Dog  atctcaaaca--gcacgaat-gaaacctcagcccaacccacct-gccc------cttttcctc-caaacc
                        Panda  atctcaaaca--gcaccact-gaaacctgaact-------cat-gcct------ggtttcctc-ccaact
               Pacific walrus  atctcaaaca--gcacgact-gaaacctgaact-----cacat-gccc------ggtttcctc-ccaact
                 Weddell seal  atctcaaaca--gcacaact-gaaacctgaact-----cacat-gcct------ggtttcctc-ccaact
             Black flying-fox  atctctagca-tgcatgact-gaaacttgaact-----t-gat-gtct------cgtttcccc-taaacc
                      Megabat  atctccagca-tgcatgact-gaaacttgaact-----t-gat-gtct------tgtttcccc-taaacc
                Big brown bat  ctctcaaacagtgcatgg--------ctgaact-----tagag-atc-------tatttcccc-taaacc
         David's myotis (bat)  ctctcaaacagtgcatggct-gagacctgaact-----tagag-atct------tgtttctct-taaacc
                     Microbat  ctctcaaacagtgcatggct-gagacctgaact-----tagag-atct------tgtttccct-taaacc
              Star-nosed mole  atctcaaaccttgcgtaact-gaaactggtact-----catac--------------tttttt-aaaact
                     Elephant  atctcaaacattgcattact-gaaacttgaact-----catct-ttct----actgttacccc-taaacc
                      Manatee  atctcgaacattgcacgact-gaaacttgaact------atct-ttct----gctgtttcccc-taaacc
                    Armadillo  -----agacattgcatgact-aaaacctgaatt-----cttat-atct----actatttcccc-taaatg
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                       Rabbit  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
              Chinese hamster  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  tgttc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
                        Chimp  tgttc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
                      Gorilla  tgttc-----------tt-------cc-------a--aattttctatcttg-------------------
                    Orangutan  tgttc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
                       Gibbon  tgttc--t-----t-ttt-------cc-------a--agttttctatcttg-------------------
                       Rhesus  tgttc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
          Crab-eating macaque  tgttc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
                       Baboon  tgttc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
                 Green monkey  tgtcc--t-----t-ttt-------cc-------a--aattttctatcttg-------------------
                     Marmoset  tgtta--t-----t-ttt-------tc-------a--aattttctctcttg-------------------
              Squirrel monkey  tgtta-tt-----t-ttt-------tc-------a--aattttctatcttg-------------------
                     Bushbaby  cattcctt-----t-ttt-------cc-------atttttttttttttttg-------------------
           Chinese tree shrew  tgaca--t-----tattt-------tc-------a--tacttgctatctta-------------------
                     Squirrel  tgttc--t-----t-ttc-------tc-------cattatattctgtcttg-------------------
               Naked mole-rat  tattg--t-----a-t------------------------tttttatcttg-------------------
                   Chinchilla  tcttc--t-----a-ttt-------tt-------ag-tattttttatcttg-------------------
             Brush-tailed rat  tattt--t-----t-cat-------tt-------a-----tttttatcttg-------------------
                          Pig  cattc--t-----t-ttc---cccccc-------at-aattttctactttg-------------------
                       Alpaca  cattc--t-----t-ttt---ccccgc-------a--aattttctattttg-------------------
               Bactrian camel  cattc--t-----t-ttt---cccccc-------a--aattttctattttg-------------------
                      Dolphin  cattc--t-----t-tta---tccccc-------a--aat----tattttg-------------------
                 Killer whale  cattc--t-----t-tta---tccccc-------a--aat----tattttg-------------------
                        Horse  cattc--t-----t-ccc----cccccattctttt--ttttttttttcctgaggaagactggccctgagt
             White rhinoceros  cattc--t-----t-ttt----ttccc------ca--ttttttctatcgtg-------------------
                          Cat  aattc--t-----t-ctc----ttcct-------c--tattttctgtcttg-------------------
                          Dog  aattc--t-----t-ttc----ttcct-------g--tgtttcctatcttg-------------------
                        Panda  gattg--t-----t-ttc----tgccc-------a--tattctctatcttg-------------------
               Pacific walrus  gattc--t-----t-ttc----tgccc-------a--tattttctatctgg-------------------
                 Weddell seal  gattc--t-----t-ttc----tgccc-------a--tattttctatctgg-------------------
             Black flying-fox  tgttg--t-----c-ctccccgtcccc-------a--tatttcctatcttg-------------------
                      Megabat  tgttg--t-----c-ctccccgtcccc-------a--tatttcctatcttg-------------------
                Big brown bat  cattc--t-----t-tcc-----cccc-------a--gatcttctatctgg-------------------
         David's myotis (bat)  cattc--t-----t-ttc-----cccc-------a--gctcttctatctgg-------------------
                     Microbat  cattc--t-----t-tcc-----cccc-------a--gatcttctatctgg-------------------
              Star-nosed mole  cactc--t-----t-ttc-----ctac-------a--tacttgaatgct---------------------
                     Elephant  cattc--tcccccc-tcc------ccc-------a--tgttttccatcttg-------------------
                      Manatee  cattc--t-----c-ttc------ccc-------a--tgttttctatctcg-------------------
                    Armadillo  tgtta--c-----t-ttt------ccc-------t--tattttctattttg-------------------
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                       Rabbit  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
              Chinese hamster  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  -----------------------------------gag------ttgccc------
                        Chimp  -----------------------------------gag------ttgccc------
                      Gorilla  -----------------------------------gag------ttgccc------
                    Orangutan  -----------------------------------gag------ttgccc------
                       Gibbon  -----------------------------------gag------ttgccc------
                       Rhesus  -----------------------------------gag------------------
          Crab-eating macaque  -----------------------------------gag------------------
                       Baboon  -----------------------------------gag------------------
                 Green monkey  -----------------------------------gag------------------
                     Marmoset  -----------------------------------gag------------------
              Squirrel monkey  -----------------------------------gag------------------
                     Bushbaby  -----------------------------------gag------acactc------
           Chinese tree shrew  -----------------------------------a--------------------
                     Squirrel  ------------------------------------ag------ttgccc------
               Naked mole-rat  -----------------------------------gaa------ttgccc------
                   Chinchilla  -----------------------------------gag------ttgccc------
             Brush-tailed rat  -----------------------------------aag------ttgccc------
                          Pig  -----------------------------------gat------------------
                       Alpaca  -----------------------------------gag------------------
               Bactrian camel  -----------------------------------gag------------------
                      Dolphin  -----------------------------------gag------------------
                 Killer whale  -----------------------------------gag------------------
                        Horse  taccatccatgcccatcttcctctactttatacgtgggatgcct------------
             White rhinoceros  -----------------------------------gagttgcct------------
                          Cat  -----------------------------------gtg------------------
                          Dog  -----------------------------------ggg------------------
                        Panda  -----------------------------------ggg------------------
               Pacific walrus  -----------------------------------ggg------------------
                 Weddell seal  -----------------------------------ggg------------------
             Black flying-fox  -----------------------------------gaa------------------
                      Megabat  -----------------------------------gaa------------------
                Big brown bat  -----------------------------------gag------------------
         David's myotis (bat)  -----------------------------------gag------------------
                     Microbat  -----------------------------------gag------------------
              Star-nosed mole  --------------------------------------------------------
                     Elephant  -----------------------------------gag------------ccttta
                      Manatee  -----------------------------------gag------------atgcta
                    Armadillo  -----------------------------------gtg------------ttaccc
                          Rat  ========================================================
                 Prairie vole  ========================================================
               Golden hamster  ========================================================
                        Mouse  ========================================================
       Lesser Egyptian jerboa  ========================================================
                         Pika  ========================================================
                     Hedgehog  ========================================================
                        Shrew  ========================================================
                   Guinea pig  ========================================================
                       Rabbit  ========================================================
             Cape golden mole  ========================================================
                     Aardvark  ========================================================
       Spiny softshell turtle  ========================================================
                X. tropicalis  ========================================================
                       Turkey  ========================================================
                      Chicken  ========================================================
                 Mallard duck  ========================================================
           Tibetan ground jay  ========================================================
                  Zebra finch  ========================================================
       White-throated sparrow  ========================================================
              Tasmanian devil  ========================================================
               Painted turtle  ========================================================
              Green seaturtle  ========================================================
           American alligator  ========================================================
                Scarlet macaw  ========================================================
                   Budgerigar  ========================================================
                      Opossum  ========================================================
                  Rock pigeon  ========================================================
          Collared flycatcher  ========================================================
          Medium ground finch  ========================================================
                       Lizard  ========================================================
             Peregrine falcon  ========================================================
                 Saker falcon  ========================================================
                       Parrot  ========================================================
          Cape elephant shrew  ========================================================
                     Platypus  ========================================================
                      Wallaby  ========================================================
              Chinese hamster  ========================================================
                       Tenrec  ========================================================
     Chinese softshell turtle  ========================================================
                      Ferret   ========================================================
                Domestic goat  ========================================================
                        Sheep  ========================================================
             Tibetan antelope  ========================================================
                          Cow  ========================================================

Inserts between block 20 and 21 in window
B D                    Horse 144bp
             Star-nosed mole 1bp

Alignment block 21 of 584 in window, 175013360 - 175013361, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                  Bushbaby  tc
B D                  Squirrel  tt
B D            Naked mole-rat  tc
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                     Horse  tc
B D                  Elephant  tc
B D                   Manatee  tc
B D                 Armadillo  tt
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
                Weddell seal  --
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                    Baboon  --
B D                       Pig  --
B D                    Rabbit  ==
            Cape golden mole  ==
                    Aardvark  ==
  D    Spiny softshell turtle  ==
B D                   Megabat  --
B D                   Dolphin  --
B D              Green monkey  --
B D       Crab-eating macaque  --
B D                    Rhesus  --
B D             X. tropicalis  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  ==
          Chinese tree shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D           Chinese hamster  ==
B D                    Tenrec  ==
B D                       Cat  --
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
             Star-nosed mole  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
              Bactrian camel  --
B D                    Alpaca  --
              Pacific walrus  --
B D                     Panda  --
                Killer whale  --
B D                       Dog  --
            Black flying-fox  --
B D          White rhinoceros  --
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --
B D           Squirrel monkey  --
B D                  Marmoset  --
B D                       Cow  ==

Inserts between block 21 and 22 in window
B D                 Bushbaby 3829bp

Alignment block 22 of 584 in window, 175013362 - 175013366, 5 bps 
B D                     Human  ttgga
B D                     Chimp  ttgga
B D                   Gorilla  ttgga
B D                 Orangutan  ttgga
B D                    Gibbon  ttaga
           Chinese tree shrew  ---ga
B D                  Squirrel  -t---
B D            Naked mole-rat  -t---
                   Chinchilla  -t---
             Brush-tailed rat  -t---
B D                     Horse  ---gt
B D                       Rat  =====
                Prairie vole  =====
              Golden hamster  =====
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
B D                      Pika  =====
                Weddell seal  -----
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                Guinea pig  =====
B D                    Baboon  -----
B D                       Pig  -----
B D                    Rabbit  =====
            Cape golden mole  =====
                    Aardvark  =====
  D    Spiny softshell turtle  =====
B D                   Megabat  -----
B D                   Dolphin  -----
B D              Green monkey  -----
B D       Crab-eating macaque  -----
B D                    Rhesus  -----
B D             X. tropicalis  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                   Manatee  -----
B D                  Elephant  -----
B D           Chinese hamster  =====
B D                    Tenrec  =====
B D                       Cat  -----
B D                  Bushbaby  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   =====
             Star-nosed mole  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
              Bactrian camel  -----
B D                    Alpaca  -----
              Pacific walrus  -----
B D                     Panda  -----
                Killer whale  -----
B D                       Dog  -----
            Black flying-fox  -----
B D          White rhinoceros  -----
B D                 Armadillo  -----
        David's myotis (bat)  -----
               Big brown bat  -----
B D                  Microbat  -----
B D           Squirrel monkey  -----
B D                  Marmoset  -----
B D                       Cow  =====

Inserts between block 22 and 23 in window
B D                    Horse 3bp

Alignment block 23 of 584 in window, 175013367 - 175013421, 55 bps 
B D                     Human  attgccctcta--------c-----catctatctagacacttttatcaggaaccca---gaga--acca-
B D                     Chimp  attgccctcta--------c-----catctatctagacacttttatcaggaaccca---gaga--acca-
B D                   Gorilla  attgccctcta--------c-----catctatctagacacttttatcaggaaccca---gaaa--acca-
B D                 Orangutan  attgccctcta--------c-----catctatctagacacttttatcaggaaccca---gaga--gcca-
B D                    Gibbon  attgccctcta--------c-----catctatctagacactcttatcaggaaccca---gaga--acca-
B D                    Rhesus  -ttgccctcta--------c-----catctatctagacacttttatcaggaactga---gaga--gcca-
B D       Crab-eating macaque  -ttgccctcta--------c-----catctatctagacacttttatcaggaactga---gaga--gcca-
B D                    Baboon  -ttgccctcta--------c-----catctatctagacacttttatcaggaactga---gaga--gcca-
B D              Green monkey  -ttgccctcta--------c-----catctatctagacacttttatcaggaactga---gaga--gcca-
B D                  Marmoset  -ttgccctcta--------c-----catctatctagacacttttatcaggaaccca---gaga--gcca-
B D           Squirrel monkey  -ttgccctcta--------c-----catctatctaaacacttttatcaggaaccca---gaga--gcca-
B D                  Bushbaby  attttcctcta--------c-----aatctgtctaggcactcttacca--aaccca---aagg--caca-
           Chinese tree shrew  gttgtactctg--------t-----catctctctagacacta--accaggaaccca---aagt--acct-
B D                  Squirrel  -------------------c-----catttatct---------taccaggaactca---gag-----cc-
B D            Naked mole-rat  ----------g--------ccatctcatctacct---------tagcaggaaccca---gaaa--gcca-
                   Chinchilla  ----------g--------c-----catctatct---------tagcaggaaccca---gaa--------
             Brush-tailed rat  ----------g--------c-----catctattt---------tagcaggaaccca---gaaa--gccc-
B D                       Pig  -ttaccttcta--------c-----catgtatatagtcacccttaccaggaacccaga-caaa--gctc-
B D                    Alpaca  -ttgctttcca--------c-----catccatatagttgcccttaccaggaacccagaggaaa--gttc-
               Bactrian camel  -ttgctttcta--------c-----catccatatagttgcccttaccaggaacccagaggaaa--gttc-
B D                   Dolphin  -ttgccttcta--------c-----catctatatagtagcccttaccaggaaccca---gaaa--gttct
                 Killer whale  -ttgccttcta--------c-----catctatatactagcccttaccaggaaccca---gaaa--gttct
B D                     Horse  gttcccttcta--------c-----catctacctagtcacccttaccaggaatcta---gagagcgctc-
B D          White rhinoceros  tctcccatctatctatcatc-----tatctatctagtcacccttactaggaactta---gagagccctc-
B D                       Cat  -ttgccttctc--------c-----catccttctagtcacccttaccaggaaccta---gagg--cccc-
B D                       Dog  -ttgccttcta--------c-----catccattcaatcccccttaccaggaatcca---cagg--cccc-
B D                     Panda  -ttgccttctg--------c-----catccatccagtcacccttaccagaaaccca---cagg--tccc-
               Pacific walrus  -ttgccttctg--------c-----catccatccagtcacccttaccagaaaccca---cggt--cccc-
                 Weddell seal  -ttgccttctg--------c-----catccatccagtcacccttaccagaaaccca---cagt--tccc-
             Black flying-fox  -atgccttcta--------c-----catctatctagtcaccctcaccaggcgccca---aaga--ccgc-
B D                   Megabat  -atgccttcta--------c-----catctatctagtcaccctcaccaggtgccca---aaga--cctc-
                Big brown bat  -ttgccttcta--------c-----c----atctagtcacccttaccaggaaccca---gaga--gccc-
         David's myotis (bat)  -ttgccttctg--------t-----catctatctagtcacccttaccaggaaccca---gaga--gccc-
B D                  Microbat  -ttgccttcta--------c-----catctatctagtcacccttaacaggaaccca---gaga--gccc-
              Star-nosed mole  gctgtcttcca--------------cattgttctagttgcccactgcagaaatcc----gagt--ctt--
B D                  Elephant  ---------------------------------tagtcacccttatcagaaactca---gaga--gcca-
B D                   Manatee  ---------------------------------tcgtcacccttaccaggaactca---gaga--gcca-
B D                 Armadillo  ----------------------------cactatagtcatacctaccaggaaccca---gaaa--gcca-
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                       Cow  ======================================================================

                        Human  t---------ctt
                        Chimp  t---------ctt
                      Gorilla  t---------ctt
                    Orangutan  t---------ctt
                       Gibbon  t---------ctt
                       Rhesus  t---------ctt
          Crab-eating macaque  t---------ctt
                       Baboon  t---------ctt
                 Green monkey  t---------ctt
                     Marmoset  t---------ctt
              Squirrel monkey  t---------ctt
                     Bushbaby  tacagatatgatc
           Chinese tree shrew  t---------cct
                     Squirrel  a---------tct
               Naked mole-rat  a---------cat
                   Chinchilla  -----------at
             Brush-tailed rat  a---------tat
                          Pig  t------------
                       Alpaca  t------------
               Bactrian camel  t------------
                      Dolphin  t------------
                 Killer whale  t------------
                        Horse  t---------c--
             White rhinoceros  t---------t--
                          Cat  t---------g--
                          Dog  t---------t--
                        Panda  t---------t--
               Pacific walrus  t---------t--
                 Weddell seal  t---------t--
             Black flying-fox  t---------c--
                      Megabat  t---------g--
                Big brown bat  t---------t--
         David's myotis (bat)  t---------t--
                     Microbat  t---------t--
              Star-nosed mole  -------------
                     Elephant  t---------ctt
                      Manatee  t---------ctt
                    Armadillo  t---------ctt
                          Rat  =============
                 Prairie vole  =============
               Golden hamster  =============
                        Mouse  =============
       Lesser Egyptian jerboa  =============
                         Pika  =============
                     Hedgehog  =============
                        Shrew  =============
                   Guinea pig  =============
                       Rabbit  =============
             Cape golden mole  =============
                     Aardvark  =============
       Spiny softshell turtle  =============
                X. tropicalis  =============
                       Turkey  =============
                      Chicken  =============
                 Mallard duck  =============
           Tibetan ground jay  =============
                  Zebra finch  =============
       White-throated sparrow  =============
              Tasmanian devil  =============
               Painted turtle  =============
              Green seaturtle  =============
           American alligator  =============
                Scarlet macaw  =============
                   Budgerigar  =============
                      Opossum  =============
                  Rock pigeon  =============
          Collared flycatcher  =============
          Medium ground finch  =============
                       Lizard  =============
             Peregrine falcon  =============
                 Saker falcon  =============
                       Parrot  =============
          Cape elephant shrew  =============
                     Platypus  =============
                      Wallaby  =============
              Chinese hamster  =============
                       Tenrec  =============
     Chinese softshell turtle  =============
                      Ferret   =============
                Domestic goat  =============
                        Sheep  =============
             Tibetan antelope  =============
                          Cow  =============

Inserts between block 23 and 24 in window
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 1bp
        David's myotis (bat) 228bp
B D                 Microbat 1bp

Alignment block 24 of 584 in window, 175013422 - 175013426, 5 bps 
B D                     Human  tac--ct
B D                     Chimp  tac--ct
B D                   Gorilla  tac--ct
B D                 Orangutan  tac--ct
B D                    Gibbon  tac--ct
B D                    Rhesus  tac--ct
B D       Crab-eating macaque  tac--ct
B D                    Baboon  tac--ct
B D              Green monkey  tac--ct
B D                  Marmoset  tac--ct
B D           Squirrel monkey  tac--ct
B D                  Bushbaby  tga--tg
           Chinese tree shrew  tac--ct
B D                  Squirrel  tca--ct
B D            Naked mole-rat  tac--ct
                   Chinchilla  tac----
             Brush-tailed rat  tac--ct
B D                       Pig  taaagca
B D                    Alpaca  tat--ct
               Bactrian camel  tat--ct
B D                   Dolphin  tac--ca
                 Killer whale  tac--ca
B D                     Horse  tac--cg
B D          White rhinoceros  tac--ct
B D                       Cat  tat--ct
B D                       Dog  tac--ct
B D                     Panda  cac--ct
               Pacific walrus  tac--ct
                 Weddell seal  tac--ct
             Black flying-fox  tac----
B D                   Megabat  tac----
                Big brown bat  tac--tt
         David's myotis (bat)  tac--tt
B D                  Microbat  tac--tt
              Star-nosed mole  tat--tt
B D                  Elephant  tac--ct
B D                   Manatee  tac--ct
B D                 Armadillo  tac--ct
B D                       Rat  =======
                Prairie vole  =======
              Golden hamster  =======
B D                     Mouse  =======
      Lesser Egyptian jerboa  =======
B D                      Pika  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                Guinea pig  =======
B D                    Rabbit  =======
            Cape golden mole  =======
                    Aardvark  =======
  D    Spiny softshell turtle  =======
B D             X. tropicalis  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
         Cape elephant shrew  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D           Chinese hamster  =======
B D                    Tenrec  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
B D                       Cow  =======

Alignment block 25 of 584 in window, 175013427 - 175013443, 17 bps 
B D                     Human  cttagatataatc-agtc
B D                     Chimp  cttagatataatc-agtc
B D                   Gorilla  cttagatataatc-agtc
B D                 Orangutan  cttagatataatc-agtc
B D                    Gibbon  cttagatagaatc-----
B D                    Rhesus  cttagatataatc-agtc
B D       Crab-eating macaque  cttagatataatc-agtc
B D                    Baboon  cttagatataatc-agtc
B D              Green monkey  cttagatataatc-agtc
B D                  Marmoset  cttagatataatc-agtc
B D           Squirrel monkey  cttagatataatc-ggtc
B D                  Bushbaby  atcagatatgatc---tc
           Chinese tree shrew  cttagaaattaat-catc
B D                  Squirrel  cttaa--ataata-taac
B D            Naked mole-rat  cttaa--attatt-agtc
                   Chinchilla  cttaa--attatt-aatc
             Brush-tailed rat  cttca--attatt-agtc
B D                       Pig  cttaaatataatc-agt-
B D                    Alpaca  ctt-aa--------agt-
               Bactrian camel  cttaaa--------agt-
B D                   Dolphin  attaaatataatc-agt-
                 Killer whale  attaaatataatc-agt-
B D                     Horse  cttagatataagc--gtg
B D          White rhinoceros  cttagatataagc-agtc
B D                       Cat  agtaaatatcatc-agtc
B D                       Dog  cttcaatataatg-agtc
B D                   Ferret   cctgaatctagtcaagcc
B D                     Panda  cttaaatataatc-agtc
               Pacific walrus  ----------atc-ggtc
                 Weddell seal  cttaaatataatc-agtc
             Black flying-fox  cttggatgcgagc-agtc
B D                   Megabat  cttggatgcgagc-agtc
                Big brown bat  cttaattataagc-agtc
         David's myotis (bat)  cttaaatataagc-agtc
B D                  Microbat  cttaaatattagc-agtc
              Star-nosed mole  cgtggatattttc-----
B D                  Elephant  ctcagatataacc-agtc
B D                   Manatee  ctcagatataatc-aggc
B D                 Armadillo  cataaatattatc-agtc
B D                       Rat  ==================
                Prairie vole  ==================
              Golden hamster  ==================
B D                     Mouse  ==================
      Lesser Egyptian jerboa  ==================
B D                      Pika  ==================
B D                  Hedgehog  ==================
B D                     Shrew  ==================
B D                Guinea pig  ==================
B D                    Rabbit  ==================
            Cape golden mole  ==================
                    Aardvark  ==================
  D    Spiny softshell turtle  ==================
B D             X. tropicalis  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
  D    White-throated sparrow  ==================
B D           Tasmanian devil  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D        American alligator  ==================
  D             Scarlet macaw  ==================
B D                Budgerigar  ==================
B D                   Opossum  ==================
  D               Rock pigeon  ==================
  D       Collared flycatcher  ==================
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D                    Parrot  ==================
         Cape elephant shrew  ==================
B D                  Platypus  ==================
B D                   Wallaby  ==================
B D           Chinese hamster  ==================
B D                    Tenrec  ==================
  D  Chinese softshell turtle  ==================
               Domestic goat  ==================
B D                     Sheep  ==================
            Tibetan antelope  ==================
B D                       Cow  ==================

Inserts between block 25 and 26 in window
B D                  Megabat 22bp

Alignment block 26 of 584 in window, 175013444 - 175013460, 17 bps 
B D                     Human  ttg-------------------taagt-------------cttgcccaa
B D                     Chimp  ttg-------------------taagt-------------cttgcccaa
B D                   Gorilla  ttg-------------------taagt-------------cttgcccta
B D                 Orangutan  ttg-------------------taagt-------------cttgcccaa
B D                    Gibbon  ------------------------agt-------------cttgcccaa
B D                    Rhesus  ttg-------------------taagt-------------cttgcccaa
B D       Crab-eating macaque  ttg-------------------taagt-------------cttgcccaa
B D                    Baboon  ttg-------------------taagt-------------cttgcccaa
B D              Green monkey  ttg-------------------taagt-------------cttgcccaa
B D                  Marmoset  ttg-------------------taagt-------------cttacccaa
B D           Squirrel monkey  ttg-------------------taagt-------------cttgcacaa
B D                  Bushbaby  tt--------------------taaga-------------cttgcccaa
           Chinese tree shrew  ttg---------------------agt-------------ttcacccag
B D                  Squirrel  tagtttct--------------taagt-------------cctacctaa
B D            Naked mole-rat  ct--------------------------------tgtaagcct---taa
                   Chinchilla  ttgtctttctaaaaaatacttctgagtgtgagggtgtacaccta--taa
             Brush-tailed rat  ttgtcttt----aagg------tgggtgtaaaaatacaaaccta--taa
B D                       Pig  ttc-------------------tagat-------------cttgcccaa
B D                    Alpaca  ttc-------------------taagt-------------c--------
               Bactrian camel  ttc-------------------taagt-------------c--------
B D                   Dolphin  ttc-------------------taagt-------------gttgcccaa
                 Killer whale  ttc-------------------taagt-------------gttgcccaa
B D                     Horse  -tt-------------------taagt-------------cttgcacaa
B D          White rhinoceros  -tc-------------------ttaat-------------cttgtgcga
B D                       Cat  -tc-------------------taagt-------------cttgtccaa
B D                       Dog  -tc-------------------taagt-------------cttgcctga
B D                   Ferret   -tc-------------------tcagt-------------cttgcccaa
B D                     Panda  -tc-------------------taagt-------------cttgcccaa
               Pacific walrus  -tc-------------------taagt-------------cttgcccaa
                 Weddell seal  -tc-------------------taagt-------------cttactcaa
             Black flying-fox  -cc-------------------tcggt-------------ctcgcc---
                Big brown bat  -tct------------------taagt-------------cttgcccaa
         David's myotis (bat)  -tc-------------------taagt-------------cttacccag
B D                  Microbat  -tt-------------------taagt-------------cttacccaa
              Star-nosed mole  -tt-------------------taaat-------------attacacc-
B D                  Elephant  --------------------actaaat-------------cttccccaa
B D                   Manatee  --------------------actaagt-------------cttgcccaa
B D                 Armadillo  --------------------actaagt-------------ctggttcag
B D                       Rat  =================================================
                Prairie vole  =================================================
              Golden hamster  =================================================
B D                     Mouse  =================================================
      Lesser Egyptian jerboa  =================================================
B D                      Pika  =================================================
B D                  Hedgehog  =================================================
B D                     Shrew  =================================================
B D                Guinea pig  =================================================
B D                    Rabbit  =================================================
            Cape golden mole  =================================================
                    Aardvark  =================================================
  D    Spiny softshell turtle  =================================================
B D                   Megabat  =================================================
B D             X. tropicalis  =================================================
B D                    Turkey  =================================================
B D                   Chicken  =================================================
  D              Mallard duck  =================================================
          Tibetan ground jay  =================================================
B D               Zebra finch  =================================================
  D    White-throated sparrow  =================================================
B D           Tasmanian devil  =================================================
  D            Painted turtle  =================================================
  D           Green seaturtle  =================================================
B D        American alligator  =================================================
  D             Scarlet macaw  =================================================
B D                Budgerigar  =================================================
B D                   Opossum  =================================================
  D               Rock pigeon  =================================================
  D       Collared flycatcher  =================================================
B D       Medium ground finch  =================================================
B D                    Lizard  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D                    Parrot  =================================================
         Cape elephant shrew  =================================================
B D                  Platypus  =================================================
B D                   Wallaby  =================================================
B D           Chinese hamster  =================================================
B D                    Tenrec  =================================================
  D  Chinese softshell turtle  =================================================
               Domestic goat  =================================================
B D                     Sheep  =================================================
            Tibetan antelope  =================================================
B D                       Cow  =================================================

Inserts between block 26 and 27 in window
B D           Naked mole-rat 1bp
                  Chinchilla 5bp
            Brush-tailed rat 31bp

Alignment block 27 of 584 in window, 175013461 - 175013466, 6 bps 
B D                     Human  ttttct
B D                     Chimp  ttttct
B D                   Gorilla  ttttct
B D                 Orangutan  ttttct
B D                    Gibbon  ttttct
B D                    Rhesus  ttttct
B D       Crab-eating macaque  ttttct
B D                    Baboon  ttttct
B D              Green monkey  ttttct
B D                  Marmoset  ttttgt
B D           Squirrel monkey  ttttgt
B D                  Bushbaby  ttttct
           Chinese tree shrew  ttttgc
B D                  Squirrel  ttttc-
       Lesser Egyptian jerboa  ttatc-
B D            Naked mole-rat  tttct-
                   Chinchilla  tcacc-
             Brush-tailed rat  tcacc-
B D                       Pig  ttttct
B D                    Alpaca  --ttct
               Bactrian camel  ttttct
B D                   Dolphin  ttttcc
                 Killer whale  ttttcc
B D                     Horse  ttttct
B D          White rhinoceros  ttttct
B D                       Cat  ttttct
B D                       Dog  tttt--
B D                   Ferret   tttt--
B D                     Panda  tttc--
               Pacific walrus  ttttct
                 Weddell seal  ttttct
             Black flying-fox  gtttct
                Big brown bat  ttttct
         David's myotis (bat)  ttttct
B D                  Microbat  ttttct
B D                  Elephant  ttttct
B D                   Manatee  ttttct
B D                 Armadillo  ttctct
B D                       Rat  ======
                Prairie vole  ======
              Golden hamster  ======
B D                     Mouse  ======
B D                      Pika  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                Guinea pig  ======
B D                    Rabbit  ======
            Cape golden mole  ======
                    Aardvark  ======
  D    Spiny softshell turtle  ======
B D                   Megabat  ======
B D             X. tropicalis  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
         Cape elephant shrew  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D           Chinese hamster  ======
B D                    Tenrec  ======
  D  Chinese softshell turtle  ======
             Star-nosed mole  ------
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
B D                       Cow  ======

Inserts between block 27 and 28 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
B D           Naked mole-rat 138bp
                  Chinchilla 45bp
            Brush-tailed rat 87bp
B D                      Dog 4bp
B D                  Ferret  4bp

Alignment block 28 of 584 in window, 175013467 - 175013469, 3 bps 
B D                     Human  ttc
B D                     Chimp  ttc
B D                   Gorilla  ttc
B D                 Orangutan  ttc
B D                    Gibbon  ttc
B D                    Rhesus  ttc
B D       Crab-eating macaque  ttc
B D                    Baboon  ttc
B D              Green monkey  ttc
B D                  Marmoset  ttc
B D           Squirrel monkey  ttc
B D                  Bushbaby  ctt
           Chinese tree shrew  ttc
B D                  Squirrel  ttc
       Lesser Egyptian jerboa  ttg
B D            Naked mole-rat  gtc
                   Chinchilla  gtc
             Brush-tailed rat  gtc
B D                       Pig  ttc
B D                    Alpaca  ttc
               Bactrian camel  ttc
B D                   Dolphin  ttc
                 Killer whale  ttc
B D                     Horse  ttc
B D          White rhinoceros  ttc
B D                       Cat  ttc
               Pacific walrus  tt-
                 Weddell seal  tt-
             Black flying-fox  ttc
                Big brown bat  ttc
         David's myotis (bat)  ttc
B D                  Microbat  ttc
B D                  Elephant  ctc
B D                   Manatee  ttc
B D                 Armadillo  tta
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
B D                      Pika  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                    Rabbit  ===
            Cape golden mole  ===
                    Aardvark  ===
  D    Spiny softshell turtle  ===
B D                   Megabat  ===
B D             X. tropicalis  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D           Chinese hamster  ===
B D                    Tenrec  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
             Star-nosed mole  ---
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                     Panda  ---
B D                       Dog  ===
B D                       Cow  ===

Inserts between block 28 and 29 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
B D                    Horse 1bp
B D         White rhinoceros 4bp
B D                      Cat 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
               Big brown bat 4bp
        David's myotis (bat) 4bp
B D                 Microbat 4bp

Alignment block 29 of 584 in window, 175013470 - 175013479, 10 bps 
B D                     Human  cta----aa-------------------------------------------------------------
B D                     Chimp  cta----ga-------------------------------------------------------------
B D                   Gorilla  cta----aa-------------------------------------------------------------
B D                 Orangutan  cta----aa-------------------------------------------------------------
B D                    Gibbon  cta----ta-------------------------------------------------------------
B D                    Rhesus  cta----aa-------------------------------------------------------------
B D       Crab-eating macaque  cta----aa-------------------------------------------------------------
B D                    Baboon  cta----aa-------------------------------------------------------------
B D              Green monkey  cta----aa-------------------------------------------------------------
B D                  Marmoset  cta----ga-------------------------------------------------------------
B D           Squirrel monkey  cta----ga-------------------------------------------------------------
B D                  Bushbaby  cta----aatacttgtaattacttttttttggcaggggctgggtttgaacctgccacctccagcatatgg
           Chinese tree shrew  cta----aa-------------------------------------------------------------
B D                  Squirrel  cta----ag-------------------------------------------------------------
       Lesser Egyptian jerboa  cta----aa-------------------------------------------------------------
B D            Naked mole-rat  ctg----ag-------------------------------------------------------------
                   Chinchilla  tta----ga-------------------------------------------------------------
             Brush-tailed rat  cta----ga-------------------------------------------------------------
B D                       Pig  ata----a--------------------------------------------------------------
B D                    Alpaca  aga----at-------------------------------------------------------------
               Bactrian camel  aga----at-------------------------------------------------------------
B D                   Dolphin  aca----ac-------------------------------------------------------------
                 Killer whale  aca----ac-------------------------------------------------------------
B D                     Horse  -ta-------------------------------------------------------------------
B D          White rhinoceros  ata-------------------------------------------------------------------
B D                       Cat  ata----ag-------------------------------------------------------------
B D                       Dog  gta----ag-------------------------------------------------------------
B D                   Ferret   gta----ag-------------------------------------------------------------
B D                     Panda  -ta----ag-------------------------------------------------------------
               Pacific walrus  ata----ag-------------------------------------------------------------
                 Weddell seal  ata----ag-------------------------------------------------------------
                Big brown bat  ata----at-------------------------------------------------------------
         David's myotis (bat)  ata----at-------------------------------------------------------------
B D                  Microbat  ata----at-------------------------------------------------------------
              Star-nosed mole  tta----aa-------------------------------------------------------------
B D                  Elephant  ctaaat-at-------------------------------------------------------------
B D                   Manatee  ctaaataat-------------------------------------------------------------
B D                 Armadillo  ctaagt-at-------------------------------------------------------------
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------
B D                       Cow  ======================================================================

                        Human  ------------acttt
                        Chimp  ------------acttt
                      Gorilla  ------------acttt
                    Orangutan  ------------acttt
                       Gibbon  ------------acttt
                       Rhesus  ------------acttt
          Crab-eating macaque  ------------acttt
                       Baboon  ------------acttt
                 Green monkey  ------------acttt
                     Marmoset  ------------acttt
              Squirrel monkey  ------------acttt
                     Bushbaby  ggctggtgccctacttt
           Chinese tree shrew  ------------tcttt
                     Squirrel  -----------------
       Lesser Egyptian jerboa  -----------------
               Naked mole-rat  -----------------
                   Chinchilla  -----------------
             Brush-tailed rat  -----------------
                          Pig  ------------acttt
                       Alpaca  ------------actcc
               Bactrian camel  ------------actcc
                      Dolphin  ------------acttt
                 Killer whale  ------------acttt
                        Horse  --------------ctt
             White rhinoceros  --------------ttt
                          Cat  ------------acttt
                          Dog  ------------acttc
                      Ferret   ------------acttt
                        Panda  ------------acttt
               Pacific walrus  ------------acttt
                 Weddell seal  ------------acttt
                Big brown bat  ------------actt-
         David's myotis (bat)  ------------actt-
                     Microbat  ------------actt-
              Star-nosed mole  ------------actgt
                     Elephant  ------------acttt
                      Manatee  ------------acttt
                    Armadillo  ------------acttt
                          Rat  =================
                 Prairie vole  =================
               Golden hamster  =================
                        Mouse  =================
                         Pika  =================
                     Hedgehog  =================
                        Shrew  =================
                   Guinea pig  =================
                       Rabbit  =================
             Cape golden mole  =================
                     Aardvark  =================
       Spiny softshell turtle  =================
                      Megabat  =================
                X. tropicalis  =================
                       Turkey  =================
                      Chicken  =================
                 Mallard duck  =================
           Tibetan ground jay  =================
                  Zebra finch  =================
       White-throated sparrow  =================
              Tasmanian devil  =================
               Painted turtle  =================
              Green seaturtle  =================
           American alligator  =================
                Scarlet macaw  =================
                   Budgerigar  =================
                      Opossum  =================
                  Rock pigeon  =================
          Collared flycatcher  =================
          Medium ground finch  =================
                       Lizard  =================
             Peregrine falcon  =================
                 Saker falcon  =================
                       Parrot  =================
          Cape elephant shrew  =================
                     Platypus  =================
                      Wallaby  =================
              Chinese hamster  =================
                       Tenrec  =================
     Chinese softshell turtle  =================
                Domestic goat  =================
                        Sheep  =================
             Tibetan antelope  =================
             Black flying-fox  -----------------
                          Cow  =================

Inserts between block 29 and 30 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
             Star-nosed mole 1bp

Alignment block 30 of 584 in window, 175013480 - 175013525, 46 bps 
B D                     Human  aa-----------------------------------aaa---------tctgtcctc---tctc--c--
B D                     Chimp  aa-----------------------------------aaa---------tctgtcctc---tctc--c--
B D                   Gorilla  aa-----------------------------------aaa---------tctgtcctc---tctc--c--
B D                 Orangutan  aa-----------------------------------aca---------tctgtcctc---tctc--c--
B D                    Gibbon  aa-----------------------------------aaa---------tcagtcctc---tctc--c--
B D                    Rhesus  aa-----------------------------------aaa---------tctgtcctc---tctt--c--
B D       Crab-eating macaque  aa-----------------------------------aaa---------tctgtcctc---tctt--c--
B D                    Baboon  aa-----------------------------------aaa---------tctgtcctc---tctt--c--
B D              Green monkey  aa-----------------------------------aaa---------tctgtcctc---tctt--c--
B D                  Marmoset  aa-----------------------------------aaa---------tctgtcctc---tctt--c--
B D           Squirrel monkey  aa-----------------------------------aaa---------tctgtcccc---tctt--a--
B D                  Bushbaby  gagccacaggtgccaccccttgcaattacttttaaataaa---------cctgtcttcacttctc--c--
           Chinese tree shrew  tc-------------------------------------------------------t---ttcc--c--
B D                  Squirrel  ta-----------------------------------atactttgcaaatctgtcctc---ttattgc--
       Lesser Egyptian jerboa  ta-----------------------------------tta--------------tctc---ttat--c--
B D            Naked mole-rat  ga-----------------------------------cag---------tctgtcctc---ttct--t--
                   Chinchilla  aa-----------------------------------aag-------------tcctc---ttct--t--
             Brush-tailed rat  ac-----------------------------------aag----------------tc---ttct--t--
B D                       Pig  ta-----------------------------------aaa---------tctgtcctc---ccaa--c--
B D                    Alpaca  ta-----------------------------------aaa---------tctgtcctc---ttgt--c--
               Bactrian camel  ta-----------------------------------aaa---------tctgtcctc---ttgt--c--
B D                   Dolphin  ta-----------------------------------aaa---------tttg--tcc---tcat--c--
                 Killer whale  ta-----------------------------------aaa---------tttg--tcc---tcat--c--
             Tibetan antelope  aa-----------------------------------aaa---------gttgtctcc---tttt--c--
B D                       Cow  aa-----------------------------------aaa---------gttgtctcc---tttt--c--
B D                     Sheep  aa-----------------------------------aaa---------gttgtctcc---tttt--c--
                Domestic goat  aa-----------------------------------aaa---------gttgtctcc---tttt--c--
B D                     Horse  tc-----------------------------------aaa---------tctgtgctc---tcat--c--
B D          White rhinoceros  tt-----------------------------------aaa---------tctgtcctc---tcat--c--
B D                       Cat  aa-----------------------------------aat---------ctgttcctc---ttgt--ctc
B D                       Dog  ta-----------------------------------aaa---------tctatcctc---ttgc--t--
B D                   Ferret   ta-----------------------------------caa---------cctatcct----gtgc--c--
B D                     Panda  ta-----------------------------------aaa---------tctatcctc---ttgt--c--
               Pacific walrus  ta-----------------------------------aaa---------tctatcctc---ttgt--c--
                 Weddell seal  aa-----------------------------------aaa---------tctatcctc---ttgt--c--
                Big brown bat  -------------------------------------aga---------tctgtccta---tcat--c--
         David's myotis (bat)  -------------------------------------aga---------tctgtcctg---tcat--c--
B D                  Microbat  -------------------------------------aga---------tctgtcctg---tcat--c--
              Star-nosed mole  --------------------------------------gc---------tcgtatctc---tcac--c--
B D                  Elephant  -----------------------------------ttaaa---------tgtgtcctc---tctt--c--
B D                   Manatee  -----------------------------------ttaaa---------tctgtcctc---tttt--c--
B D                 Armadillo  -----------------------------------tgaag---------tctgtcctc---tctc--c--
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------

                        Human  ---------tct---act-aatacca----caatgtt--agttcag
                        Chimp  ---------tct---act-aatacca----caatgtt--agttcag
                      Gorilla  ---------tct---act-aatacca----caatgtt--agttcag
                    Orangutan  ---------tct---act-aatacca----caatgtt--agttcag
                       Gibbon  ---------tct---act-aatacca----caatgtt--agttcag
                       Rhesus  ---------tct---agtaaatacca----caacgtt--agttcag
          Crab-eating macaque  ---------tct---agtaaatacca----caacgtt--agttcag
                       Baboon  ---------tct---agtaaatacca----caatgtt--agttcag
                 Green monkey  ---------tct---agtaaatacca----caatgtt--agttcag
                     Marmoset  ---------tct---act-aatacaa----agatgtt--agttcag
              Squirrel monkey  ---------tct---acg-aatacca----agatgtt--agttcag
                     Bushbaby  ---------ttt---act-cctaccc----ctacctt--a----ag
           Chinese tree shrew  ---------ttt---gct-aatacca----ctac-ct--acctcaa
                     Squirrel  ---------t---------aatgcca----ctatcttaaagttcag
       Lesser Egyptian jerboa  ---------t---------agtacca----ctacttt--agttcag
               Naked mole-rat  ---------t---------gctaccattcaccacctt--agttcag
                   Chinchilla  ---------t---------gctaccactacctacctt--agtttag
             Brush-tailed rat  ---------t---------gctactactgtctacctt--aattcag
                          Pig  ---------tactctgct-aattcta----ctatctt--agttcag
                       Alpaca  ---------tccttcgct-aatacc-------acctt--agttcag
               Bactrian camel  ---------tccttcgct-aatacc-------acctt--agttcag
                      Dolphin  ---------tactttgct-aatacca----ctacctt--agatcag
                 Killer whale  ---------tactttgct-aatacca----ctacctt--agatcag
             Tibetan antelope  ---------tactttgct-actacta----ctacctt--agttcag
                          Cow  ---------tactttgct-aattcta----ctacctt--agttcag
                        Sheep  ---------tactttgct-aatacta----ctacctt--agttcag
                Domestic goat  ---------tactttgct-aatacta----ctacctt--agttcag
                        Horse  ---------tcctttgct-aatccca----cttccct-aaattcag
             White rhinoceros  ---------ttc---gct-aatccca----ctacctt--agttcag
                          Cat  ctttgctaatgc---------ctgaa----ctccctt--tgtccag
                          Dog  ---------tgc---------ctcca----ctccctt--agttcag
                      Ferret   ---------tgc---------ctcaa----ctacctt--tgttcac
                        Panda  ---------tgc---------cttaa----ctccctt--tgttcag
               Pacific walrus  ---------tgc---------ctcaa----ctccctt--tgttaag
                 Weddell seal  ---------tgc---------ctcaa----ctccctt--tgttaag
                Big brown bat  ---------tcctttgtt-aatatca----ctacttc--agttcag
         David's myotis (bat)  ---------tcctttgtt-aataaca----ctactt---agttcag
                     Microbat  ---------tcctttgtt-aatatca----ctactt---agttcag
              Star-nosed mole  ---------tcc-ttttt-aacacca----caacttt-----tcaa
                     Elephant  ---------ttt---gct-aacacca----tgacttt--agttcag
                      Manatee  ---------tat---gct-aacacca----tgac-------ttcaa
                    Armadillo  ---------ttt---gct-agcacca----ctacctt--gacttag
                          Rat  ==============================================
                 Prairie vole  ==============================================
               Golden hamster  ==============================================
                        Mouse  ==============================================
                         Pika  ==============================================
                     Hedgehog  ==============================================
                        Shrew  ==============================================
                   Guinea pig  ==============================================
                       Rabbit  ==============================================
             Cape golden mole  ==============================================
                     Aardvark  ==============================================
       Spiny softshell turtle  ==============================================
                      Megabat  ==============================================
                X. tropicalis  ==============================================
                       Turkey  ==============================================
                      Chicken  ==============================================
                 Mallard duck  ==============================================
           Tibetan ground jay  ==============================================
                  Zebra finch  ==============================================
       White-throated sparrow  ==============================================
              Tasmanian devil  ==============================================
               Painted turtle  ==============================================
              Green seaturtle  ==============================================
           American alligator  ==============================================
                Scarlet macaw  ==============================================
                   Budgerigar  ==============================================
                      Opossum  ==============================================
                  Rock pigeon  ==============================================
          Collared flycatcher  ==============================================
          Medium ground finch  ==============================================
                       Lizard  ==============================================
             Peregrine falcon  ==============================================
                 Saker falcon  ==============================================
                       Parrot  ==============================================
          Cape elephant shrew  ==============================================
                     Platypus  ==============================================
                      Wallaby  ==============================================
              Chinese hamster  ==============================================
                       Tenrec  ==============================================
     Chinese softshell turtle  ==============================================
             Black flying-fox  ----------------------------------------------

Alignment block 31 of 584 in window, 175013526 - 175013530, 5 bps 
B D                     Human  gcctt
B D                     Chimp  gcctt
B D                   Gorilla  gcctt
B D                 Orangutan  gcgtt
B D                    Gibbon  gcctt
B D                    Rhesus  gcctt
B D       Crab-eating macaque  gcctt
B D                    Baboon  gcctt
B D              Green monkey  gcctt
B D                  Marmoset  gcctt
B D           Squirrel monkey  gcctt
B D                  Bushbaby  gccct
           Chinese tree shrew  gccct
B D                  Squirrel  gccct
       Lesser Egyptian jerboa  gccct
B D            Naked mole-rat  gctct
                   Chinchilla  gccct
             Brush-tailed rat  gctct
B D                    Rabbit  gcccc
B D                       Pig  gtcct
B D                    Alpaca  gccct
               Bactrian camel  gccct
B D                   Dolphin  gccct
                 Killer whale  gccct
             Tibetan antelope  gccct
B D                       Cow  gccct
B D                     Sheep  gccct
                Domestic goat  gcccc
B D                     Horse  a-cct
B D          White rhinoceros  accct
B D                       Cat  gccct
B D                       Dog  gccgt
B D                   Ferret   gccct
B D                     Panda  ---ct
               Pacific walrus  gccct
                 Weddell seal  gccct
                Big brown bat  gcact
         David's myotis (bat)  gcact
B D                  Microbat  gcact
              Star-nosed mole  ggcct
B D                  Elephant  gccct
B D                   Manatee  gccct
B D                 Armadillo  gctct
B D                       Rat  =====
                Prairie vole  =====
              Golden hamster  =====
B D                     Mouse  =====
B D                      Pika  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                Guinea pig  =====
            Cape golden mole  =====
                    Aardvark  =====
  D    Spiny softshell turtle  =====
B D                   Megabat  =====
B D             X. tropicalis  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D           Chinese hamster  =====
B D                    Tenrec  =====
  D  Chinese softshell turtle  =====
            Black flying-fox  -----

Inserts between block 31 and 32 in window
B D                   Gibbon 336bp

Alignment block 32 of 584 in window, 175013531 - 175013639, 109 bps 
B D                     Human  catcttcctcaacaactaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D                     Chimp  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D                   Gorilla  catcttcctcaacaattaaga---cac-cct-cc-t-aa------------------------c-tggtt
B D                 Orangutan  catcttcctcaacaattaaga---cat-cct-tc-t-aa------------------------c-tggtt
B D                    Gibbon  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D                    Rhesus  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D       Crab-eating macaque  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D                    Baboon  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D              Green monkey  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------c-tggtt
B D                  Marmoset  catcttcttcaacaattaaga---cat-cct-cc-t-aa------------------------t-tggtt
B D           Squirrel monkey  catcttcctcaacaattaaga---cat-cct-cc-t-aa------------------------t-tggtt
B D                  Bushbaby  catattcctgaacaattaaga---tac-ccc-ccat-aa------------------------c-tggtt
           Chinese tree shrew  tgtcttcctgaaca------t---cct-cct-cc-t-ac------------------------g-tggtt
B D                  Squirrel  -caattcctgaacaatcaaga---cat-cc-----t-cctaactggctgtctttcaaagcttta-agatt
       Lesser Egyptian jerboa  -tgattcct---taattaagc---aat-cc-----t-ac------------------------a-aaatt
B D            Naked mole-rat  -agattac----caattcaga---cat-cc-----taaa------------------------c-aggtt
                   Chinchilla  -agattca----caattcaga---cat-cc-----t-aa------------------------c-agg--
             Brush-tailed rat  -ggattca----caattcaga---cat-cc-----t-aa------------------------c-aggt-
B D                    Rabbit  -catcttc----ctgtgcagaaggcac-ct-----t-ga------------------------c-cggct
B D                       Pig  tctcttcctcaacaatt-aga---cac-cttccc-t-ag------------------------t-tgctt
B D                    Alpaca  cctcttcctgaacaattaaga---cat-cct-cc-t-ag------------------------c-tgttt
               Bactrian camel  cctcttcctgaacaattaaga---cat-cct-cc-t-ag------------------------c-tgttt
B D                   Dolphin  agtcttcctgaacaattaaga---cat-cct-cc-t-ag------------------------c-tgctt
                 Killer whale  agtcttcctgaacaattaaga---cat-cct-cc-t-ag------------------------c-tgctt
             Tibetan antelope  tgtcatcctgaacaattaaca---tat-cct-cc-t-ag------------------------c-tgttt
B D                       Cow  tgtcatcctgaacaattaaga---tat-cct-cc-t-ag------------------------c-tgtct
B D                     Sheep  tgtcatcctgaacaattaaca---tat-cct-cc-t-ag------------------------c----tt
                Domestic goat  tgtcatcctgaacaattaaca---tat-cct-cc-t-ag------------------------c-tgttt
B D                     Horse  cgtctttctgcgcaatcaaga---cat-cct-cc-t-aa------------------------c-cgg--
B D          White rhinoceros  agtcttcctg----aacaaga---cat-cct-cc-a-aa------------------------c-tggtc
B D                       Cat  ggttttccagaacaattacga---cat-tct-ct-t-gc------------------------cttggtt
B D                       Dog  ggtcttccagaacaattgtga---cac-cct-gc-t-aa------------------------c-tggtt
B D                   Ferret   ggctttgcagaacgactgcaa---cat-cct-cc-c-aa------------------------c-tggtt
B D                     Panda  ggttttccagaatgattacga---cat-cct-cc-t-aa------------------------c-tggtt
               Pacific walrus  ggttttccagaacgattatga---catccct-cc-t-aa------------------------c-tggtt
                 Weddell seal  ggttttccagaacaattatga---catccct-cc-t-aa------------------------c-tggtt
                Big brown bat  tgtctacctgaacaattaaga---cac-tgt-cc-t-ga------------------------c-ccgtt
         David's myotis (bat)  tatctacctgaacaattaaga---cat-tgt-cc-t-ga------------------------c-ccatt
B D                  Microbat  tgtctacctgaacaattaaga---cat-tgt-cc-t-ga------------------------c-ccgtt
              Star-nosed mole  caactatttc-acaattagga---cat-cct-cc-t-aa------------------------c-tgatg
B D                  Elephant  cctctttctgaacaatgaaga---cat-cct-ct-c-a-------------------------g-tgttt
B D                   Manatee  cctcttcgtgatc-atgcaga---cat-ctt-c--------------------------------tgttt
B D                 Armadillo  catatttctgaaccagtaagc---cat-cgt-tc-t-aa---ctggttctt------------g-tgctt
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant s