Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1179 in window, 47495640 - 47495676, 37 bps 
B D                     Human  tccagtgtg--------gaaa-------------------------------------------------
B D                     Chimp  tccagtgtg--------gaaa-------------------------------------------------
B D                   Gorilla  tccagtgtg--------gaaa-------------------------------------------------
B D                 Orangutan  cccagtgtg--------gaaa-------------------------------------------------
B D                    Gibbon  cccagtgtg--------gaaa-------------------------------------------------
B D                    Rhesus  ctcagtgtg--------gaaa-------------------------------------------------
B D       Crab-eating macaque  ctcagtgtg--------gaaa-------------------------------------------------
B D                    Baboon  cccagtgtg--------gaaa-------------------------------------------------
B D              Green monkey  cccagtgtg--------gaaa-------------------------------------------------
B D                  Marmoset  cccagtgtg--------gaaa-------------------------------------------------
B D           Squirrel monkey  cccaatgtg--------gaaa-------------------------------------------------
B D                  Bushbaby  ctcaatgtg--------ggaa-------------------------------------------------
           Chinese tree shrew  tcc-gtgtg--------ggaa-------------------------------------------------
B D                  Squirrel  cccaatgta--------agaa-------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  cctggtgtg--------ggaa-------------------------------------------------
B D           Chinese hamster  cccagtgtg--------agaa-------------------------------------------------
               Golden hamster  cccagtgtg--------agaa-------------------------------------------------
B D                     Mouse  cctg-tgtg--------ggaa-------------------------------------------------
B D                       Rat  cctgctgtg--------ggaa-------------------------------------------------
                   Chinchilla  cccataata--------ggca-------------------------------------------------
B D                    Rabbit  cccaatatg--------ggaa-------------------------------------------------
B D                      Pika  cttggtatg--------ggaa-------------------------------------------------
B D                       Pig  cacaaggtg--------ggaa-------------------------------------------------
B D                    Alpaca  catgaggtg--------ggaa-------------------------------------------------
               Bactrian camel  catgaggtg--------ggaa-------------------------------------------------
B D                   Dolphin  catgaggtg--------ggaa-------------------------------------------------
                 Killer whale  catgaggtg--------ggaa-------------------------------------------------
             Tibetan antelope  cacgaggtg--------ggag-------------------------------------------------
B D                       Cow  cacgaggtg--------ggag-------------------------------------------------
B D                     Sheep  cacgaggtg--------ggag-------------------------------------------------
                Domestic goat  cacgaggtg--------ggag-------------------------------------------------
B D                     Horse  cacgatgta--------ggaa-------------------------------------------------
B D          White rhinoceros  cacgaggtg--------ggac-------------------------------------------------
B D                       Cat  catgatgta--------gga--------------------------------------------------
B D                       Dog  cacgacatg--------agga-------------------------------------------------
B D                   Ferret   caagatatg--------ggg--------------------------------------------------
B D                     Panda  cacgacacg--------ggga-------------------------------------------------
               Pacific walrus  cacgatatg--------ggga-------------------------------------------------
                 Weddell seal  cacaataca--------ggga-------------------------------------------------
             Black flying-fox  ca-catgtg--------ggaa-------------------------------------------------
B D                   Megabat  ca-catgtg--------ggaa-------------------------------------------------
                Big brown bat  caggatgtggggcgcctgggg-------------------------------------------------
         David's myotis (bat)  caggatgtggggcgcctgggg-------------------------------------------------
B D                  Microbat  caggatgtggggcgcctgggg-------------------------------------------------
              Star-nosed mole  tatgatgtg--------ggaa-------------------------------------------------
B D                  Elephant  catgacgca--------ggag-------------------------------------------------
          Cape elephant shrew  ctggggccc--------ggagcagaactgccctgggggggtttctaaggctgtaagctttccaggacagg
B D                   Manatee  cacgatgcg--------ggag-------------------------------------------------
             Cape golden mole  tacgatgcg--------ggaa-------------------------------------------------
B D                    Tenrec  cgtgacgtg--------ggaa-------------------------------------------------
                     Aardvark  cacgatgtg--------agaa-------------------------------------------------
B D                 Armadillo  cgtgatgct--------tatc-------------------------------------------------
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================

                        Human  ----cttac---t-ttat------------tccagc----------------------------------
                        Chimp  ----cttac---t-ttat------------tccagc----------------------------------
                      Gorilla  ----cttac---t-ttat------------tccagc----------------------------------
                    Orangutan  ----cttac---t-ttat------------tctagc----------------------------------
                       Gibbon  ----cttac---t-ttat------------tccagt----------------------------------
                       Rhesus  ----cttac---t-ttat------------tctagc----------------------------------
          Crab-eating macaque  ----cttac---t-ttat------------tctagc----------------------------------
                       Baboon  ----cttac---t-ttat------------tctagc----------------------------------
                 Green monkey  ----cttac---t-ttat------------tctagc----------------------------------
                     Marmoset  ----cttac---t-ttat------------tccagt----------------------------------
              Squirrel monkey  ----cgtac---t-ttat------------tccagc----------------------------------
                     Bushbaby  ----tttac---t-ttat------------tctagc----------------------------------
           Chinese tree shrew  ----ctcacacgt-ttat------------tacagc----------------------------------
                     Squirrel  ----ctcac---t-ttat------------tccaac----------------------------------
       Lesser Egyptian jerboa  --------c---t-tcat------------tctggc----------------------------------
                 Prairie vole  ----ccatc---t-ttat------------tctagt----------------------------------
              Chinese hamster  ----ccttt---t-ttat------------tccagc----------------------------------
               Golden hamster  ----gcttt---t-ttat------------tccagc----------------------------------
                        Mouse  ----ccttc---t-ttat------------tctgcc----------------------------------
                          Rat  ----ccttc---t-ttat------------tccacc----------------------------------
                   Chinchilla  ----ctcac---t-ttat------------tccagc----------------------------------
                       Rabbit  ----ctcac---t-ttaa------------tgcagc----------------------------------
                         Pika  ----ttcac---t-ttat------------tccagt----------------------------------
                          Pig  ----ctcac---t-tggt------------gccggc----------------------------------
                       Alpaca  ----ctcac---t-ttat------------gccagc----------------------------------
               Bactrian camel  ----ctcac---t-ttat------------gccagc----------------------------------
                      Dolphin  ----ctcac---t-ttgt------------gccggc----------------------------------
                 Killer whale  ----ctcac---t-ttgt------------gccggc----------------------------------
             Tibetan antelope  ----ctcac---t-gtgt------------atcggc----------------------------------
                          Cow  ----ctcac---t-gtgt------------atcggc----------------------------------
                        Sheep  ----ctcac---t-gtgt------------atcggc----------------------------------
                Domestic goat  ----ctcac---t-gtgt------------atcggc----------------------------------
                        Horse  ----ctcac---t-tgat------------accagc----------------------------------
             White rhinoceros  ----ctcac---t-tgat------------actggc----------------------------------
                          Cat  ----cacac---c-ttac------------cacagc----------------------------------
                          Dog  ----ctctc---c-tcac------------ggcagc----------------------------------
                      Ferret   ----ctctc---c-tcat------------gccagc----------------------------------
                        Panda  ----ctctc---c-tcac------------gccagc----------------------------------
               Pacific walrus  ----ctctc---c-tcat------------accagc----------------------------------
                 Weddell seal  ----ctctc---c-tcat------------gccagc----------------------------------
             Black flying-fox  ----ctccc---t-tcct------------accagc----------------------------------
                      Megabat  ----ctccc---t-tcct------------accagc----------------------------------
                Big brown bat  ----cacac---t-ctat------------ggcagc----------------------------------
         David's myotis (bat)  ----cgccc---t-ctat------------ggcagc----------------------------------
                     Microbat  ----cgccc---t-ctat------------ggcagc----------------------------------
              Star-nosed mole  ----ctcac---t-ttat------------accagt----------------------------------
                     Elephant  ----ctcac---t-tttt------------gcctgt----------------------------------
          Cape elephant shrew  ctgcctcac---c-ttcttcctgaggcatggcctgtgagtcaccaaacttggtggttactggctaaacac
                      Manatee  ----ctcac---c-gtac------------accagt----------------------------------
             Cape golden mole  ----ctcac---t-ttac------------accagt----------------------------------
                       Tenrec  ----ctcac---t-ttac------------gccagc----------------------------------
                     Aardvark  ----ctcat---t-ttac------------accagt----------------------------------
                    Armadillo  ----cttgt---tgtcac------------cttgga----------------------------------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                     Hedgehog  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================

                        Human  --------------------------------------------catgatt-a
                        Chimp  --------------------------------------------catgatt-a
                      Gorilla  --------------------------------------------catgatt-a
                    Orangutan  --------------------------------------------catgatt-a
                       Gibbon  --------------------------------------------catgatt-a
                       Rhesus  --------------------------------------------catgatt-a
          Crab-eating macaque  --------------------------------------------catgatt-a
                       Baboon  --------------------------------------------catgatt-a
                 Green monkey  --------------------------------------------catgatt-a
                     Marmoset  --------------------------------------------cacgact-g
              Squirrel monkey  --------------------------------------------catgact-g
                     Bushbaby  --------------------------------------------cacgatt-a
           Chinese tree shrew  --------------------------------------------tacagtt-a
                     Squirrel  --------------------------------------------cacagtt-g
       Lesser Egyptian jerboa  --------------------------------------------cattgcg-a
                 Prairie vole  --------------------------------------------c--------
              Chinese hamster  --------------------------------------------catcact-g
               Golden hamster  --------------------------------------------cgtcatt-g
                        Mouse  ----------------------------------------------tcatt-g
                          Rat  --------------------------------------------catcatg-g
                   Chinchilla  --------------------------------------------catggcc-a
                       Rabbit  --------------------------------------------cacgatt-a
                         Pika  --------------------------------------------catgatt-a
                          Pig  --------------------------------------------caaaatt-a
                       Alpaca  --------------------------------------------cacgatt-g
               Bactrian camel  --------------------------------------------catgattag
                      Dolphin  --------------------------------------------cacgaat-a
                 Killer whale  --------------------------------------------cacgaat-a
             Tibetan antelope  --------------------------------------------cacgctt-a
                          Cow  --------------------------------------------cacactt-a
                        Sheep  --------------------------------------------cacgctt-a
                Domestic goat  --------------------------------------------cacgctt-a
                        Horse  --------------------------------------------catgact-a
             White rhinoceros  --------------------------------------------catgact-a
                          Cat  --------------------------------------------cataatt-a
                          Dog  --------------------------------------------catgatt-a
                      Ferret   --------------------------------------------cacgatt-a
                        Panda  --------------------------------------------tatgatt-a
               Pacific walrus  --------------------------------------------catgatt-a
                 Weddell seal  --------------------------------------------cttgatt-a
             Black flying-fox  --------------------------------------------cataact-g
                      Megabat  --------------------------------------------cataact-g
                Big brown bat  --------------------------------------------caggacg-a
         David's myotis (bat)  --------------------------------------------caggacg-g
                     Microbat  --------------------------------------------caggacg-g
              Star-nosed mole  --------------------------------------------cataatt-a
                     Elephant  --------------------------------------------catgatt-a
          Cape elephant shrew  tttaaccatagtgacatcaggatgagcctccactttaagccaggcacggtt-t
                      Manatee  --------------------------------------------catgatt-a
             Cape golden mole  --------------------------------------------tgtgata-a
                       Tenrec  --------------------------------------------cgtgagg-g
                     Aardvark  --------------------------------------------catcatt-a
                    Armadillo  --------------------------------------------cactgcc-a
                 Nile tilapia  =====================================================
                  Zebra mbuna  =====================================================
                    Tetraodon  =====================================================
                  Stickleback  =====================================================
                  Spotted gar  =====================================================
          Pundamilia nyererei  =====================================================
        Burton's mouthbreeder  =====================================================
          Princess of Burundi  =====================================================
                         Fugu  =====================================================
                     Hedgehog  =====================================================
                   Coelacanth  =====================================================
           Southern platyfish  =====================================================
                       Medaka  =====================================================
       Yellowbelly pufferfish  =====================================================
                X. tropicalis  =====================================================
              Tasmanian devil  =====================================================
                  Rock pigeon  =====================================================
       White-throated sparrow  =====================================================
               Painted turtle  =====================================================
                  Zebra finch  =====================================================
          Medium ground finch  =====================================================
          Collared flycatcher  =====================================================
     Chinese softshell turtle  =====================================================
                 Saker falcon  =====================================================
              Green seaturtle  =====================================================
                 Mallard duck  =====================================================
                   Budgerigar  =====================================================
                       Turkey  =====================================================
                      Chicken  =====================================================
           Tibetan ground jay  =====================================================
                      Opossum  =====================================================
             Peregrine falcon  =====================================================
             Brush-tailed rat  =====================================================
                   Guinea pig  =====================================================
               Naked mole-rat  =====================================================

Alignment block 2 of 1179 in window, 47495677 - 47495685, 9 bps 
B D                     Human  tcct-agttg
B D                     Chimp  tcct-agttg
B D                   Gorilla  tcct-aattg
B D                 Orangutan  tcct-agttg
B D                    Gibbon  tcct-agttg
B D                    Rhesus  tcct-agttg
B D       Crab-eating macaque  tcct-agttg
B D                    Baboon  tcct-agttg
B D              Green monkey  tcct-agttg
B D                  Marmoset  tcct-agttg
B D           Squirrel monkey  tccc-agttg
B D                  Bushbaby  ttct-agttg
           Chinese tree shrew  ccttcagctg
B D                  Squirrel  tcct-agttg
       Lesser Egyptian jerboa  cccc-ctttg
B D           Chinese hamster  tcct-agttg
               Golden hamster  tcct-agttg
B D                     Mouse  tcct-agctg
B D                       Rat  tcct-agccg
                   Chinchilla  tcct-ggagg
B D                    Rabbit  cact-aactg
B D                      Pika  cact-aactg
B D                       Pig  ccca-agtta
B D                    Alpaca  tcct-agctg
               Bactrian camel  tcct-agctg
B D                   Dolphin  tcct-ggttg
                 Killer whale  tcct-ggttg
             Tibetan antelope  tcct-agacg
B D                       Cow  tcct-agatg
B D                     Sheep  tcct-agatg
                Domestic goat  tcct-agatg
B D                     Horse  ccct-ggttg
B D          White rhinoceros  tcct-agttg
B D                       Cat  ccca-agttg
B D                       Dog  tcca-cagtg
B D                   Ferret   ctca-cggcg
B D                     Panda  tcca-cggca
               Pacific walrus  tcca-cggtg
                 Weddell seal  ccca-cagtg
             Black flying-fox  tcct-agctg
B D                   Megabat  tcct-agctg
                Big brown bat  cctc-gtctg
         David's myotis (bat)  cctc-ttctg
B D                  Microbat  cccc-ttctg
              Star-nosed mole  tctt-agctg
B D                  Elephant  tcc-------
          Cape elephant shrew  tca-------
B D                   Manatee  tct-------
             Cape golden mole  t-t-------
B D                    Tenrec  tgc-------
                     Aardvark  ttt-------
B D                 Armadillo  cct-------
B D       Medium ground finch  tcct-ggacc
B D              Nile tilapia  ==========
                 Zebra mbuna  ==========
B D                 Tetraodon  ==========
B D               Stickleback  ==========
                 Spotted gar  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                      Fugu  ==========
B D                  Hedgehog  ==========
B D                Coelacanth  ==========
          Southern platyfish  ==========
B D                    Medaka  ==========
      Yellowbelly pufferfish  ==========
B D             X. tropicalis  ==========
B D           Tasmanian devil  ==========
  D               Rock pigeon  ==========
  D    White-throated sparrow  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
  D              Saker falcon  ==========
  D           Green seaturtle  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
          Tibetan ground jay  ==========
B D                   Opossum  ==========
                Prairie vole  ----------
  D          Peregrine falcon  ==========
            Brush-tailed rat  ==========
B D                Guinea pig  ==========
B D            Naked mole-rat  ==========

Inserts between block 2 and 3 in window
      Lesser Egyptian jerboa 167bp

Alignment block 3 of 1179 in window, 47495686 - 47495695, 10 bps 
B D                     Human  tcaccttgca-
B D                     Chimp  tcaccttgca-
B D                   Gorilla  tcaccttgca-
B D                 Orangutan  tcaccttgca-
B D                    Gibbon  tcaccttgca-
B D                    Rhesus  tcaccttgca-
B D       Crab-eating macaque  tcaccttgca-
B D                    Baboon  tcaccttgca-
B D              Green monkey  tcactttgca-
B D                  Marmoset  tcaccttgcg-
B D           Squirrel monkey  tcaccttgca-
B D                  Bushbaby  tcaccttaga-
           Chinese tree shrew  tcaccctgga-
B D                  Squirrel  tcactctgga-
                 Prairie vole  tcagcctggg-
B D           Chinese hamster  tcagccagga-
               Golden hamster  tcagccagga-
B D                     Mouse  tcagccagga-
B D                       Rat  tcagccagta-
                   Chinchilla  ccaccctgtg-
B D                    Rabbit  tcaccctggg-
B D                      Pika  ccacgctggg-
B D                       Pig  tcaccc-----
B D                    Alpaca  ttaccctgga-
               Bactrian camel  ttaccctgga-
B D                   Dolphin  tcactttgga-
                 Killer whale  tcactttgga-
             Tibetan antelope  tcagcctgga-
B D                       Cow  tca-ccggga-
B D                     Sheep  tcaccctgga-
                Domestic goat  tcaccctgga-
B D                     Horse  tcacccggga-
B D          White rhinoceros  tcaccttgga-
B D                       Cat  tcacctcgta-
B D                       Dog  tc-ccccgga-
B D                   Ferret   tc-cctcggg-
B D                     Panda  tc-cctcggg-
               Pacific walrus  tc-cctctgg-
                 Weddell seal  tc-cctccgg-
             Black flying-fox  tctccgtgga-
B D                   Megabat  tctccttgga-
                Big brown bat  tcaccgagga-
         David's myotis (bat)  tccccgagga-
B D                  Microbat  tccccgagga-
              Star-nosed mole  tcaccctgaa-
B D       Medium ground finch  -atccctgctc
B D              Nile tilapia  ===========
                 Zebra mbuna  ===========
B D                 Tetraodon  ===========
B D               Stickleback  ===========
                 Spotted gar  ===========
         Pundamilia nyererei  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D                      Fugu  ===========
B D                  Hedgehog  ===========
B D                Coelacanth  ===========
          Southern platyfish  ===========
B D                    Medaka  ===========
      Yellowbelly pufferfish  ===========
B D             X. tropicalis  ===========
B D           Tasmanian devil  ===========
  D               Rock pigeon  ===========
  D    White-throated sparrow  ===========
  D            Painted turtle  ===========
B D               Zebra finch  ===========
  D       Collared flycatcher  ===========
  D  Chinese softshell turtle  ===========
  D              Saker falcon  ===========
  D           Green seaturtle  ===========
  D              Mallard duck  ===========
B D                Budgerigar  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
          Tibetan ground jay  ===========
B D                   Opossum  ===========
B D                    Tenrec  -----------
  D          Peregrine falcon  ===========
B D                 Armadillo  -----------
         Cape elephant shrew  -----------
                    Aardvark  -----------
            Cape golden mole  -----------
      Lesser Egyptian jerboa  ===========
            Brush-tailed rat  ===========
B D                Guinea pig  ===========
B D            Naked mole-rat  ===========
B D                   Manatee  -----------
B D                  Elephant  -----------

Alignment block 4 of 1179 in window, 47495696 - 47495697, 2 bps 
B D                     Human  c---a
B D                     Chimp  c---a
B D                   Gorilla  c---a
B D                 Orangutan  c---a
B D                    Gibbon  c---a
B D                    Rhesus  c---a
B D       Crab-eating macaque  c---a
B D                    Baboon  c---a
B D              Green monkey  c---a
B D                  Marmoset  t---a
B D           Squirrel monkey  t---a
B D                  Bushbaby  c---a
           Chinese tree shrew  t---g
B D                  Squirrel  c---a
                 Prairie vole  c---g
B D           Chinese hamster  t---g
               Golden hamster  t---g
B D                     Mouse  t---g
B D                       Rat  t---g
                   Chinchilla  g---g
B D                    Rabbit  ----c
B D                      Pika  tggac
B D                    Alpaca  c---a
               Bactrian camel  c---a
B D                   Dolphin  c---a
                 Killer whale  c---a
             Tibetan antelope  c---a
B D                       Cow  c---a
B D                     Sheep  c---a
                Domestic goat  c---a
B D                     Horse  t---g
B D          White rhinoceros  t---g
B D                       Cat  t---g
B D                       Dog  g---g
B D                   Ferret   t---g
B D                     Panda  t---g
               Pacific walrus  t---g
                 Weddell seal  g---g
             Black flying-fox  c---a
B D                   Megabat  c---a
                Big brown bat  t---g
         David's myotis (bat)  t---g
B D                  Microbat  g---g
              Star-nosed mole  t---g
  D    White-throated sparrow  c---a
B D       Medium ground finch  c---a
B D              Nile tilapia  =====
                 Zebra mbuna  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
                 Spotted gar  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                      Fugu  =====
B D                  Hedgehog  =====
B D                Coelacanth  =====
          Southern platyfish  =====
B D                    Medaka  =====
      Yellowbelly pufferfish  =====
B D             X. tropicalis  =====
B D           Tasmanian devil  =====
  D               Rock pigeon  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
  D              Saker falcon  =====
  D           Green seaturtle  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
B D                    Turkey  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D                   Opossum  =====
B D                    Tenrec  -----
  D          Peregrine falcon  =====
B D                 Armadillo  -----
         Cape elephant shrew  -----
                    Aardvark  -----
            Cape golden mole  -----
      Lesser Egyptian jerboa  =====
            Brush-tailed rat  =====
B D                Guinea pig  =====
B D            Naked mole-rat  =====
B D                   Manatee  -----
B D                  Elephant  -----
B D                       Pig  -----

Alignment block 5 of 1179 in window, 47495698 - 47495710, 13 bps 
B D                     Human  cctgccat-----ccggt
B D                     Chimp  cctgccat-----ccggt
B D                   Gorilla  cctgccat-----ctggt
B D                 Orangutan  cctgccat-----ctggt
B D                    Gibbon  cctgccat-----ctggt
B D                    Rhesus  cctgccat-----ctggt
B D       Crab-eating macaque  cctgccaa-----ctggt
B D                    Baboon  cctgccat-----ctggt
B D              Green monkey  cctgtcat-----ctggt
B D                  Marmoset  cctgccat-----ctgca
B D           Squirrel monkey  cctgccat-----ccggg
B D                  Bushbaby  cctgccat-----ccagg
           Chinese tree shrew  cccaccat-----caggg
B D                  Squirrel  cctgccat-----tcagg
                 Prairie vole  gctgccat-----tcagg
B D           Chinese hamster  gctgccat-----tcagg
               Golden hamster  actgccat-----tcagg
B D                     Mouse  gctgccat-----tcaag
B D                       Rat  gctgccat-----tc-ag
                   Chinchilla  cctgca--------ccag
B D                    Rabbit  actgccat-----ccaga
B D                      Pika  acctgccc-----ccagg
B D                       Pig  ---gccac-----ccagg
B D                    Alpaca  catgccat-----ccagg
               Bactrian camel  catgccat-----ccagg
B D                   Dolphin  cctgccat-----ccagg
                 Killer whale  cctgccat-----ccagg
             Tibetan antelope  cctgccat-----ccagg
B D                       Cow  cctgccat-----ccagg
B D                     Sheep  cctgccat-----ccagg
                Domestic goat  cctgccat-----ccagg
B D                     Horse  cctgccat-----ccagg
B D          White rhinoceros  cctgccat-----ccagg
B D                       Cat  cctgccac-----ccagg
B D                       Dog  cctgcca-----------
B D                   Ferret   cctgccac-----ccggg
B D                     Panda  cctgccac-----ccggg
               Pacific walrus  cctgccac-----ccagg
                 Weddell seal  cctgccac-----ccggg
             Black flying-fox  cctgccat-----tgagg
B D                   Megabat  cctgccat-----tgagg
                Big brown bat  cccgccatcgggacg-gg
         David's myotis (bat)  cccgccat-----tg-gt
B D                  Microbat  ccca-cac-----cg-gg
              Star-nosed mole  cctgccac-----ccag-
B D                  Elephant  ---------------ag-
          Cape elephant shrew  ---------------gt-
B D                   Manatee  ---------------gg-
             Cape golden mole  ---------------gg-
B D                    Tenrec  ---------------ag-
                     Aardvark  ---------------gg-
B D                 Armadillo  ---------------gg-
  D    White-throated sparrow  cccgctgt-----gt---
B D       Medium ground finch  cccgctgt-----gt---
B D                   Chicken  ccccctgc-----tt---
B D              Nile tilapia  ==================
                 Zebra mbuna  ==================
B D                 Tetraodon  ==================
B D               Stickleback  ==================
                 Spotted gar  ==================
         Pundamilia nyererei  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D                      Fugu  ==================
B D                  Hedgehog  ==================
B D                Coelacanth  ==================
          Southern platyfish  ==================
B D                    Medaka  ==================
      Yellowbelly pufferfish  ==================
B D             X. tropicalis  ==================
B D           Tasmanian devil  ==================
  D               Rock pigeon  ==================
  D            Painted turtle  ==================
B D               Zebra finch  ==================
  D       Collared flycatcher  ==================
  D  Chinese softshell turtle  ==================
  D              Saker falcon  ==================
  D           Green seaturtle  ==================
  D              Mallard duck  ==================
B D                Budgerigar  ==================
B D                    Turkey  ==================
          Tibetan ground jay  ==================
B D                   Opossum  ==================
  D          Peregrine falcon  ==================
      Lesser Egyptian jerboa  ==================
            Brush-tailed rat  ==================
B D                Guinea pig  ==================
B D            Naked mole-rat  ==================

Alignment block 6 of 1179 in window, 47495711 - 47495746, 36 bps 
B D                     Human  g-ccatctcctggctggc--a----cat--------------ctata---cccact--ctgg--------
B D                     Chimp  g-ccatctcctggctggc--a----cat--------------ctata---cccact--ctgg--------
B D                   Gorilla  g-ccatctcctggctggc--a----cat--------------ctata---cccact--ctgg--------
B D                 Orangutan  g-ccatctcctggctggc--a----cat--------------ctata---cccatt--ctgg--------
B D                    Gibbon  g-ctatctcctggctggc--a----cat--------------ctata---cccact--ctgg--------
B D                    Rhesus  g-ccatctcctggctggc--a----cat--------------ttata---ccctct--ctgg--------
B D       Crab-eating macaque  g-ccatctcctggctggc--a----cat--------------ttata---ccctct--ctgg--------
B D                    Baboon  g-ccatctcctggctggc--a----cat--------------ttata---ccctct--ctgg--------
B D              Green monkey  g-ccatctcctggctggc--a----cat--------------ttata---ccctct--ctgg--------
B D                  Marmoset  a-ctatttcctggctggc--a----cat--------------ttata---cccact--ttgg--------
B D           Squirrel monkey  a-ttatttcctggctggc--g----cat--------------ttata---cccact--ttgg--------
B D                  Bushbaby  a-ctatctcctggctggc--a----cat--------------tctca---cccact--ctgg--------
           Chinese tree shrew  a-caactccctggctggg--a----cat--------------tcata---ccc--t--gtgg--------
B D                  Squirrel  t-tatca-cctgatggc---a----gac--------------tg-aa---tccact--ctgg--------
                 Prairie vole  a-cagcttcctgactgc---t----cac--------------tc-ca---cctgca--gtgg--------
B D           Chinese hamster  a-caacttgctgactgct--t----cac--------------tt-ta---cc-aca--gtgg--------
               Golden hamster  a-caacgtcctgactgct--t----cac--------------tc-ta---tc-aca--gtgg--------
B D                     Mouse  a-caacctcctgatggcc--t----cct--------------tc-ta---tctaca--gtgg--------
B D                       Rat  g-caacttcctgactgcc--t----cct--------------tc-tg---cccacagtgtgg--------
                   Chinchilla  g-taacctcctgcctggcatg----ggc--------------tc-ca------agt--ctgg--------
B D                    Rabbit  a-gcatctcgtg---ggc--a----cat--------------tcatg---ctcact--ctgg--------
B D                      Pika  c-ctgtctcctggacggc--a----cat--------------tcatg---tgcact--ctgg--------
B D                       Pig  a-tagtctccaggctggc--a----cat--------------tcata---tccact---tga--------
B D                    Alpaca  a-ctgcctcctggtggga--a----cat--------------tcata---cctact--ttgg--------
               Bactrian camel  a-ctgcctcctggtgggc--a----cat--------------tcaca---cctact--ttgg--------
B D                   Dolphin  a-ctgcctc----------------------------------caca---cccatc--ctgg--------
                 Killer whale  a-ctgcctc----------------------------------caca---cccatc--ctgg--------
             Tibetan antelope  g-ctgcctcctggctggc--a----cgt--------------tcaca---cccact--ccgg--------
B D                       Cow  a-ctgcctcttggctggc--a----cgt--------------tcaca---cccact--ccgg--------
B D                     Sheep  a-ctgcctcctggctggc--a----cgt--------------tcata---cccact--ccag--------
                Domestic goat  a-ctgcctcctggctggc--a----cgt--------------tcaca---cccact--ccag--------
B D                     Horse  a-ctgtctgccggctggc--a----cat--------------tcata---cccact--gagg--------
B D          White rhinoceros  a-ctgtctcccagctggc--a----cat--------------tcata---cccact--ctgg--------
B D                       Cat  a-ctgtcccctggctggc--a----cag--------------ttata---ccttct--ctgg--------
B D                       Dog  a-ctgtctcctagctggt--a----caa--------------tcata---cccact--ctgg--------
B D                   Ferret   a-ccatctcctagctggc--a----cat--------------tcata---cccccg--ctgg--------
B D                     Panda  a-ctgtctcctagctggc--a----cgt--------------tcata---cccact--ctgg--------
               Pacific walrus  g-ctgtctcctagctggc--a----cat--------------tcata---cccact--ctgg--------
                 Weddell seal  g-ctgtctcctagctgac--a----cgt--------------tcata---cccact--ctgg--------
             Black flying-fox  a-ctgtctcctggctggc--a----cat--------------tcata---ccctct--ctgg--------
B D                   Megabat  a-ctgtctcctggctggc--a----cat--------------tcata---ccctct--ctgg--------
                Big brown bat  a-ctgtccct--gccag-----------------------------------cact--ctgg--------
         David's myotis (bat)  a-cagctcct--gccagc--g----c----------------tcaga---cccacc--ctgg--------
B D                  Microbat  a-ctgtccct--gccggc--g----c----------------tcaga---cccacc--ctgg--------
B D                  Hedgehog  c-ct--ctgcctgtcacc--c----cagacagccac------tcaca---ctcaca--ctga--------
              Star-nosed mole  a-ct--ctggtggttggc--a----ttg--------------tcaaa---tccact--ctgg--------
B D                  Elephant  g-ctgctacctggacggc--a----tac--------------tcata---accact--ctgg--------
          Cape elephant shrew  g-cagtctctgggatggc--a----cag--------------tgatagtcatcact--ctgg--------
B D                   Manatee  a-ctgcctcctggctggc--a----tat--------------tcata---atcact--ctgg--------
             Cape golden mole  g-ctgtctcctggcttgc--a----cat--------------tcata---a-tact--ctgg--------
B D                    Tenrec  a-ccgtctcctggttggc--a----cgt--------------ttctg---actact--ctgg--------
                     Aardvark  a-ctgtctcctagctgac--a-----at--------------tcata---atcact--ctgg--------
B D                 Armadillo  gcccgcctcctggctggc--agtcccac--------------tcaca---cacact--ctgg--------
  D    White-throated sparrow  -------------------------------gtcatctcctgccgtg---ccagct--ccag-----ctc
B D       Medium ground finch  -------------------------------gtcatcccctcccgtg-----------ccag-----ctc
B D                   Chicken  -------------------------------gt---------atgta---catgct--ccaagggacatc
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================

                        Human  ---
                        Chimp  ---
                      Gorilla  ---
                    Orangutan  ---
                       Gibbon  ---
                       Rhesus  ---
          Crab-eating macaque  ---
                       Baboon  ---
                 Green monkey  ---
                     Marmoset  ---
              Squirrel monkey  ---
                     Bushbaby  ---
           Chinese tree shrew  ---
                     Squirrel  ---
                 Prairie vole  ---
              Chinese hamster  ---
               Golden hamster  ---
                        Mouse  ---
                          Rat  ---
                   Chinchilla  ---
                       Rabbit  ---
                         Pika  ---
                          Pig  ---
                       Alpaca  ---
               Bactrian camel  ---
                      Dolphin  ---
                 Killer whale  ---
             Tibetan antelope  ---
                          Cow  ---
                        Sheep  ---
                Domestic goat  ---
                        Horse  ---
             White rhinoceros  ---
                          Cat  ---
                          Dog  ---
                      Ferret   ---
                        Panda  ---
               Pacific walrus  ---
                 Weddell seal  ---
             Black flying-fox  ---
                      Megabat  ---
                Big brown bat  ---
         David's myotis (bat)  ---
                     Microbat  ---
                     Hedgehog  ---
              Star-nosed mole  ---
                     Elephant  ---
          Cape elephant shrew  ---
                      Manatee  ---
             Cape golden mole  ---
                       Tenrec  ---
                     Aardvark  ---
                    Armadillo  ---
       White-throated sparrow  cag
          Medium ground finch  cag
                      Chicken  cat
                 Nile tilapia  ===
                  Zebra mbuna  ===
                    Tetraodon  ===
                  Stickleback  ===
                  Spotted gar  ===
          Pundamilia nyererei  ===
        Burton's mouthbreeder  ===
          Princess of Burundi  ===
                         Fugu  ===
                   Coelacanth  ===
           Southern platyfish  ===
                       Medaka  ===
       Yellowbelly pufferfish  ===
                X. tropicalis  ===
              Tasmanian devil  ===
                  Rock pigeon  ===
               Painted turtle  ===
                  Zebra finch  ===
          Collared flycatcher  ===
     Chinese softshell turtle  ===
                 Saker falcon  ===
              Green seaturtle  ===
                 Mallard duck  ===
                   Budgerigar  ===
                       Turkey  ===
           Tibetan ground jay  ===
                      Opossum  ===
             Peregrine falcon  ===
       Lesser Egyptian jerboa  ===
             Brush-tailed rat  ===
                   Guinea pig  ===
               Naked mole-rat  ===

Alignment block 7 of 1179 in window, 47495747 - 47495758, 12 bps 
B D                     Human  ----ctctgaaaggc-t--
B D                     Chimp  ----ctctgaaaggc-t--
B D                   Gorilla  ----ttctgaaaggc-t--
B D                 Orangutan  ----ctctgaaaggc-a--
B D                    Gibbon  ----ctctgaaaggc-a--
B D                    Rhesus  ----ctctgaaaggc-a--
B D       Crab-eating macaque  ----ctctgaaaggc-a--
B D                    Baboon  ----ctctgaaaggc-a--
B D              Green monkey  ----ctctgaaaggc-a--
B D                  Marmoset  ----ctttgaaagac-a--
B D           Squirrel monkey  ----ctttgaaatgc-a--
B D                  Bushbaby  ----ctctaaaaggc-a--
           Chinese tree shrew  ----ctctgagaggc-a--
B D                  Squirrel  ----ctctaaaagac-a--
       Lesser Egyptian jerboa  ----ccttgaaaaac-c--
                 Prairie vole  ----ctcttaaaggc-a--
B D           Chinese hamster  ----ctcttaaaggc-a--
               Golden hamster  ----ctcttaaaggc-a--
B D                     Mouse  ----ctcttaatggc-a--
B D                       Rat  ----ctctcaatgtc-a--
B D                    Rabbit  ----ctctacaagac-a--
B D                      Pika  ----ctttatgagac-a--
B D                       Pig  ----ctctgaaaggc-a--
B D                    Alpaca  ----ctctaaaaggt-a--
               Bactrian camel  ----ctcgaaaaggt-a--
B D                   Dolphin  ----ctctgaaaggc-a--
                 Killer whale  ----ctctgaaaggc-a--
             Tibetan antelope  ----ctttgaaagtc-a--
B D                       Cow  ----ctttg--agtc-a--
B D                     Sheep  ----ctttgaaagtc-a--
                Domestic goat  ----ctttgaaagtc-a--
B D                     Horse  ----ctccggaaggc-a--
B D          White rhinoceros  ----ctccggaaggc-a--
B D                       Cat  ----ctctgaaaggc-t--
B D                       Dog  ----ctgtgaaaggcga--
B D                   Ferret   ----gtggtcgaggc----
B D                     Panda  ----ctctgaaaggc-a--
               Pacific walrus  ----ctctgaaaggc-a--
                 Weddell seal  ----ctctgaaaggc-a--
             Black flying-fox  ----ctctgaaaggc-a--
B D                   Megabat  ----ctctgaaaggc-a--
                Big brown bat  ----ctcc--aaggc-a--
         David's myotis (bat)  ----ctcc--aaagc-a--
B D                  Microbat  ----ctcc--aaggc-a--
B D                  Hedgehog  ----ccctgaaaggt-g--
              Star-nosed mole  ----ccctggcacac-a--
B D                  Elephant  ----ctctgaaaggc-a--
          Cape elephant shrew  ----ctttgaaaagc-a--
             Cape golden mole  ----ctccaaaaggc-a--
B D                    Tenrec  ----ttccgcgaggc-a--
                     Aardvark  ----ctctgtaaggt-a--
B D                 Armadillo  ----ctctgaaaggc-a--
  D    White-throated sparrow  ctccctccgtgcagt-gcc
B D       Medium ground finch  ctccctccgtgcagt-gcc
B D                   Chicken  gtcagttggtgctgt-tct
B D              Nile tilapia  ===================
                 Zebra mbuna  ===================
B D                 Tetraodon  ===================
B D               Stickleback  ===================
                 Spotted gar  ===================
         Pundamilia nyererei  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D                      Fugu  ===================
B D                Coelacanth  ===================
          Southern platyfish  ===================
B D                    Medaka  ===================
      Yellowbelly pufferfish  ===================
B D             X. tropicalis  ===================
B D           Tasmanian devil  ===================
  D               Rock pigeon  ===================
  D            Painted turtle  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================
  D  Chinese softshell turtle  ===================
  D              Saker falcon  ===================
  D           Green seaturtle  ===================
  D              Mallard duck  ===================
B D                Budgerigar  ===================
B D                    Turkey  ===================
          Tibetan ground jay  ===================
B D                   Opossum  ===================
  D          Peregrine falcon  ===================
            Brush-tailed rat  ===================
B D                Guinea pig  ===================
B D            Naked mole-rat  ===================
                  Chinchilla  -------------------
B D                   Manatee  -------------------

Inserts between block 7 and 8 in window
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D                  Chicken 3bp

Alignment block 8 of 1179 in window, 47495759 - 47495815, 57 bps 
B D                     Human  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctggggctaa--
B D                     Chimp  -------------------------t-atcaaccaaa--aatg-----gg----c-agctggggctaa--
B D                   Gorilla  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctggggctaa--
B D                 Orangutan  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctggggctaa--
B D                    Gibbon  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctggggctaa--
B D                    Rhesus  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctgggactaa--
B D       Crab-eating macaque  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctgggactaa--
B D                    Baboon  -------------------------t-gtcaaccaaa--aatg-----gg----c-agctgggactaa--
B D              Green monkey  -------------------------t-gtcaaccaaa--aata-----gg----c-agctgggactaa--
B D                  Marmoset  -------------------------c-atcaaccaaa--aata-----gg----c-agctgggactaa--
B D           Squirrel monkey  -------------------------c-atcaaccaaa--aata-----gg----c-agctgggattaa--
B D                  Bushbaby  -------------------------g-aatgaccaaa--aatg-----gg----c-agttggggctaa--
           Chinese tree shrew  -----------------------------caacccaa--gctg-----ga----c-agtcgaggctag--
B D                  Squirrel  -------------------------t-aaccc---aa--aatg-----ag----c-aggtggggctat--
       Lesser Egyptian jerboa  -------------------------a-aaaaattaaa--aataaaatggg----c-a-gtgaggatgcta
                 Prairie vole  -------------------------c-agccaccaaa--aatg-----gg----c-aggtgaggctga--
B D           Chinese hamster  -------------------------c-agccaccaaa--aaga-----gg----c-aggtgagactga--
               Golden hamster  -------------------------c-agccagcaaa--aaca-----ga----c-aggtgaggctga--
B D                     Mouse  -------------------------c-aacctccaaa--aaca-----gg----c-aggtgaggctgg--
B D                       Rat  -------------------------c-aacctccaaa--aata-----gg----c-aggtaaggccga--
                   Chinchilla  ---------------------------------ctgt--gaga-----gg----c-agg--aggctaa--
B D                    Rabbit  -------------------------c-aatcacaaag--aacg-----gg----c-agttggagccag--
B D                      Pika  ---------------------------aatcgccaaa--aaca-----gg----c-agccagggacaa--
B D                       Pig  -------------------------c-aacaaccaaa--aacg-----gg----c-agttggggctga--
B D                    Alpaca  -------------------------t-gagaaccaaa--aatg-----gg----c-agttagggctaa--
               Bactrian camel  -------------------------t-gagaaccaaa--aatg-----gg----c-agttggggctaa--
B D                   Dolphin  -------------------------c-cacaaccaaa--aatg-----gg----c-agtaggggctaa--
                 Killer whale  -------------------------c-cacaaccaaa--aatg-----gg----c-agttggggctaa--
             Tibetan antelope  -------------------------c-cacaaccaaa--aatg-----gg----g-agttggcactaa--
B D                       Cow  -------------------------c-cacaaccaaa--aatg-----gg----g-agttggagctaa--
B D                     Sheep  -------------------------c-cacaaccaaa--aatg-----gg----g-agttggagctaa--
                Domestic goat  -------------------------c-cacaaccaaa--aatg-----gg----g-agttggagctaa--
B D                     Horse  -------------------------c-a-taacggga--aaca-----gg----t-agttgggactaa--
B D          White rhinoceros  -------------------------c-t-caactgga--aacg-----gg----t-agttggggctaa--
B D                       Cat  -------------------------c-aaaagccaaa--aatg-----gg----c-agttgaggctaa--
B D                       Dog  -------------------------c-agcaa----a--aatg-----gg----c-ggttgaggctga--
B D                   Ferret   ------------------------------------g--aaag-----ca----c-attt-------a--
B D                     Panda  -------------------------c-aacgaccaaa--aatg-----gg----c-agttgaggctaa--
               Pacific walrus  -------------------------c-aacagcc--a--aatg-----gg----c-agttgaggctaa--
                 Weddell seal  -------------------------c-aagagcc--a--aatg-----gg----c-agttgaggctaa--
             Black flying-fox  -------------------------c-gacca----a--aaca-----gg----c-agttgtggtaa---
B D                   Megabat  -------------------------t-gacca----a--aaca-----gg----c-agctgtggtaa---
                Big brown bat  -------------------------c-agct--------aacg-----gc----c-ggctgacgagt---
         David's myotis (bat)  -------------------------c-cgcgg----a--aacg-----gc----cgggctgacgtgt---
B D                  Microbat  -------------------------c-agcgg----a--aacg-----gc----cgggctgccgtgt---
B D                  Hedgehog  -------------------------t-ggccagtgaagcagtc-----ag----c-cgttggggctaa--
              Star-nosed mole  -------------------------c-aacaaatcaa--aatg-----gg----c-agctaggggtaa--
B D                  Elephant  -------------------------c-tttaaccaaa--aaca-----ga----c-atttgg--------
          Cape elephant shrew  -------------------------caattaaccgaa--accg-----gg----c-agctgg--------
B D                   Manatee  ---------------------------------caaa--aaca-----gg----c-agttgg--------
             Cape golden mole  -------------------------g-aacaaccaaa--aatg-----gg----c-agttgg--------
B D                    Tenrec  -------------------------c-aggaaccaga--gatg-----gg----g-agctgg--------
                     Aardvark  -------------------------c-aataatcaaa--aatg-----gg----c-agttgg--------
B D                 Armadillo  -------------------------t-aatcaccgaa--aaca-----gg----c-agctgg--------
  D    White-throated sparrow  cacc-gcctggcaccgcctgctg--g-gcccaacaca--ccgg-----aa----g-aggtgaggcaag--
B D       Medium ground finch  -----------------------------------ca--ccgg-----aa----g-aggtgaggcaag--
B D                   Chicken  --------tggccttgtgtgctg--g-g---aacagg--ctgg-----gatgaca-aagggatgcaac--
B D        American alligator  tgtcggcctggagatggcagctgccc-gccagacgta--tctg-----ca----t-ttggaattcatt--
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================

                        Human  --------g------gcatatt----taaac-aaaggct--------cca----aagg
                        Chimp  --------g------gcatatt----taaac-aaaggct--------cca----aagg
                      Gorilla  --------g------gcatatt----taaac-aaaggct--------ccg----aagg
                    Orangutan  --------g------gcatatt----taaac-aaaggct--------ccg----aagg
                       Gibbon  --------g------gcatatt----taaac-aaaggct--------ccg----aagg
                       Rhesus  --------g------gcatatt----taaac-aaaggct--------cca----aggg
          Crab-eating macaque  --------g------gcatatt----taaac-aaaggct--------cca----aggg
                       Baboon  --------g------gcatatt----taaac-aaaggct--------cca----aggg
                 Green monkey  --------g------gcatatt----taaac-aaaggct--------cca----aggg
                     Marmoset  --------g------gcatatc----taaac-aaaggct--------cca----aagg
              Squirrel monkey  --------g------gcatatt----taaac-aaaggct--------cca----aagg
                     Bushbaby  --------a------gcatatt----tatac-aaaggct--------cca----aagg
           Chinese tree shrew  --------a------gcacattcccatggag-gaaggtt--------cca----gagg
                     Squirrel  --------a------gtgtatt----tacatggaaagct--------cca----aagt
       Lesser Egyptian jerboa  aagtatata------g-----t----tacatgggaggct--------cta----aaga
                 Prairie vole  --------a------g-----t----t-------------------------------
              Chinese hamster  --------a------g-----t----cacctgggatgct--------cca----aggg
               Golden hamster  --------c------g-----t----cacgagggatgct--------cca----aggg
                        Mouse  --------a------g-----t----catgtgggatgcc--------cca----aagg
                          Rat  --------a------g-----t----cacatgggatgcc--------cca----aagg
                   Chinchilla  --------a------gtgtgtg----cacataggaggctgggctgggcca----gttg
                       Rabbit  --------a------ctgtatt----tacaaggcaagct--------tca----aagg
                         Pika  --------a------gagcatt----tacaagaaaggct--------gca----aagg
                          Pig  --------a------gtgtatt----tataaggaaggca--------cca----aagg
                       Alpaca  --------a------gcgtgtt----tataaggaaggct--------caa----aagg
               Bactrian camel  --------a------gcgtgtt----tacaaggaaggct--------cag----aagg
                      Dolphin  --------a------gcgtgtt----tacgaggaaggct--------cca----gagg
                 Killer whale  --------a------gcgtgtt----tacgaggaaggct--------cca----gagg
             Tibetan antelope  --------a------gcgtttt---gtatgaagaaagct--------cca----aagg
                          Cow  --------a------gcgtttt---gaatgaggaaggct--------cca----aagg
                        Sheep  --------a------gcgtttt---gtatgaagaagact--------cca----aagg
                Domestic goat  --------a------gcgtttt---gtatgaagaaggct--------cca----aagg
                        Horse  --------a------gcaaatc----tacatggaaagct--------cca----aagg
             White rhinoceros  --------a------gcaaatc----tacacggaaggct--------cca----aagg
                          Cat  --------a------gtgtatt----ta-atgaaaggct--------cc-----tggg
                          Dog  --------a------gcggatg----ta-atgaaaggct--------cc-----tggg
                      Ferret   --------a------gcgtatt----ta-agggaaggct--------cc-----cagc
                        Panda  --------a------gcgtgtt----ta-atgaaaggct--------cc-----cggg
               Pacific walrus  --------a------gcgtatt----ta-atgaaaggct--------cc-----tggc
                 Weddell seal  --------a------gcgtatt----ta-atgaaaggct--------cc-----cggc
             Black flying-fox  --------a------gcacctt----tacatggacagct--------cca----aagg
                      Megabat  --------a------gcacatt----tacatggacagct--------cca----aagg
                Big brown bat  --------------------------tccacgga-agct--------cca----gagg
         David's myotis (bat)  ------------------------------------------------------aagg
                     Microbat  ------------------------------------------------------aagg
                     Hedgehog  --------a------g------------cacggag-gct--------ccg----aaag
              Star-nosed mole  --------a------ggttatt----gacacagaacatt--------cca----aagg
                     Elephant  --------g------gcatatt----tatattggaag---------------------
          Cape elephant shrew  --------a------cca----------------------------------------
                      Manatee  --------g------gcatatt----tacatggaaggct--------cca----aagg
             Cape golden mole  --------g------gcgtatt----tatatgggaggct--------cca----aagg
                       Tenrec  --------t------gcacatt----cacacagaaagct--------ccaggtggagg
                     Aardvark  --------g------gcatatt----tacatggaagtct--------aca----aagg
                    Armadillo  --------gaccagagcatagt----tacac-gaaggcg--------cta----aagg
       White-throated sparrow  --------g------c------------------------------------------
          Medium ground finch  --------g------c------------------------------------------
                      Chicken  --------a------a------------------------------------------
           American alligator  --------g------a------------------------------------------
                 Nile tilapia  ==========================================================
                  Zebra mbuna  ==========================================================
                    Tetraodon  ==========================================================
                  Stickleback  ==========================================================
                  Spotted gar  ==========================================================
          Pundamilia nyererei  ==========================================================
        Burton's mouthbreeder  ==========================================================
          Princess of Burundi  ==========================================================
                         Fugu  ==========================================================
                   Coelacanth  ==========================================================
           Southern platyfish  ==========================================================
                       Medaka  ==========================================================
       Yellowbelly pufferfish  ==========================================================
                X. tropicalis  ==========================================================
              Tasmanian devil  ==========================================================
                  Rock pigeon  ==========================================================
               Painted turtle  ==========================================================
                  Zebra finch  ==========================================================
          Collared flycatcher  ==========================================================
     Chinese softshell turtle  ==========================================================
                 Saker falcon  ==========================================================
              Green seaturtle  ==========================================================
                 Mallard duck  ==========================================================
                   Budgerigar  ==========================================================
                       Turkey  ==========================================================
           Tibetan ground jay  ==========================================================
                      Opossum  ==========================================================
             Peregrine falcon  ==========================================================
             Brush-tailed rat  ==========================================================
                   Guinea pig  ==========================================================
               Naked mole-rat  ==========================================================

Inserts between block 8 and 9 in window
                  Chinchilla 1bp

Alignment block 9 of 1179 in window, 47495816 - 47495820, 5 bps 
B D                     Human  --acc---cc
B D                     Chimp  --acc---cc
B D                   Gorilla  --acc---cc
B D                 Orangutan  --acc---cc
B D                    Gibbon  --acc---cc
B D                    Rhesus  --acc---cc
B D       Crab-eating macaque  --acc---cc
B D                    Baboon  --acc---cc
B D              Green monkey  --acc---cc
B D                  Marmoset  --acc---cc
B D           Squirrel monkey  --acc---cc
B D                  Bushbaby  --a-c---cc
           Chinese tree shrew  --------ct
B D                  Squirrel  ---gc---c-
       Lesser Egyptian jerboa  ---act--cc
                 Prairie vole  ----c---ca
B D           Chinese hamster  ---ac---ca
               Golden hamster  ---ac---tg
B D                     Mouse  ---tt---gg
B D                       Rat  ---ac---cg
B D            Naked mole-rat  --------ac
                   Chinchilla  -----gccct
B D                    Rabbit  ------ctct
B D                      Pika  ------ttcc
B D                       Pig  --atc---cc
B D                    Alpaca  --acc---cc
               Bactrian camel  --acc---cc
B D                   Dolphin  --acc---ca
                 Killer whale  --acc---ca
             Tibetan antelope  --acc---cc
B D                       Cow  --acc---cc
B D                     Sheep  --acc---cc
                Domestic goat  --acc---cc
B D                     Horse  --acc---tc
B D          White rhinoceros  --acc---cc
B D                       Cat  --atg---ac
B D                       Dog  --acc---ac
B D                   Ferret   --acc---at
B D                     Panda  --acc---ac
               Pacific walrus  --acc---ac
                 Weddell seal  --acc---ac
             Black flying-fox  --aac----c
B D                   Megabat  --aac----c
                Big brown bat  --acc----c
         David's myotis (bat)  --acc----c
B D                  Microbat  --acc----c
B D                  Hedgehog  --ccc---ct
              Star-nosed mole  --acg---cc
B D                   Manatee  --------ac
             Cape golden mole  --------ac
B D                    Tenrec  --------tt
                     Aardvark  --------ac
B D                 Armadillo  --------ac
  D    White-throated sparrow  acacc-----
B D       Medium ground finch  acact-----
B D                   Chicken  gctct-----
B D        American alligator  tcact-----
B D              Nile tilapia  ==========
                 Zebra mbuna  ==========
B D                 Tetraodon  ==========
B D               Stickleback  ==========
                 Spotted gar  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                      Fugu  ==========
B D                Coelacanth  ==========
          Southern platyfish  ==========
B D                    Medaka  ==========
      Yellowbelly pufferfish  ==========
B D             X. tropicalis  ==========
B D           Tasmanian devil  ==========
  D               Rock pigeon  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
  D              Saker falcon  ==========
  D           Green seaturtle  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
B D                    Turkey  ==========
          Tibetan ground jay  ==========
B D                   Opossum  ==========
  D          Peregrine falcon  ==========
         Cape elephant shrew  ----------
            Brush-tailed rat  ==========
B D                Guinea pig  ==========
B D                  Elephant  ----------

Inserts between block 9 and 10 in window
B D         White rhinoceros 1bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp

Alignment block 10 of 1179 in window, 47495821 - 47495831, 11 bps 
B D                     Human  tttcacttggg---
B D                     Chimp  tttcacttagg---
B D                   Gorilla  tttcacttggg---
B D                 Orangutan  tttcacttggg---
B D                    Gibbon  tttcacttggg---
B D                    Rhesus  tttcacttggg---
B D       Crab-eating macaque  tttcacttggg---
B D                    Baboon  tttcacttggg---
B D              Green monkey  tttcatttggg---
B D                  Marmoset  attcgctgggg---
B D           Squirrel monkey  attcgctgggg---
B D                  Bushbaby  ttttgctgtag---
           Chinese tree shrew  ctgtgctggga---
B D                  Squirrel  ttttgctggag---
       Lesser Egyptian jerboa  ttccaatgggg---
                 Prairie vole  tcctgct--gg---
B D           Chinese hamster  ttctgctgcag---
               Golden hamster  ttctgctaggg---
B D                     Mouse  ctctgctgggg---
B D                       Rat  ctctgctgggg---
B D            Naked mole-rat  ccctgcttggg---
                   Chinchilla  ctccgcagggg---
B D                    Rabbit  ttccactagga---
B D                      Pika  tttcattggga---
B D                       Pig  tttcacccag----
B D                    Alpaca  tttcagccag----
               Bactrian camel  attcagccag----
B D                   Dolphin  tttcacccag----
                 Killer whale  tttcacccag----
B D                     Horse  tttcacctggg---
B D          White rhinoceros  tttcacccagg---
B D                       Cat  tttcacctggt---
B D                       Dog  tttcaccctgt---
B D                   Ferret   tttcacctggg---
B D                     Panda  tttc-cctggt---
               Pacific walrus  tttcacccggt---
                 Weddell seal  tttcacccggt---
             Black flying-fox  ttttgcccacg---
B D                   Megabat  tttcgcccaag---
                Big brown bat  cttcacccagc---
         David's myotis (bat)  cggctcccagc---
B D                  Microbat  cttcacccagc---
B D                  Hedgehog  --tcacc-agg---
              Star-nosed mole  --tca---ggg---
B D                  Elephant  tttcactgggg---
          Cape elephant shrew  tttcattgagg---
B D                   Manatee  tttcactgggg---
             Cape golden mole  tttcactgaca---
B D                    Tenrec  tgtcactgcgg---
                     Aardvark  tttcattgggg---
B D                 Armadillo  tctcaacagga---
  D    White-throated sparrow  ---cagcctgcagg
B D       Medium ground finch  ---cagcccgcagg
B D                   Chicken  ---cagcaagctga
B D        American alligator  ---------gcagt
B D              Nile tilapia  ==============
                 Zebra mbuna  ==============
B D                 Tetraodon  ==============
B D               Stickleback  ==============
                 Spotted gar  ==============
         Pundamilia nyererei  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D                      Fugu  ==============
B D                Coelacanth  ==============
          Southern platyfish  ==============
B D                    Medaka  ==============
      Yellowbelly pufferfish  ==============
B D             X. tropicalis  ==============
B D           Tasmanian devil  ==============
  D               Rock pigeon  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
  D  Chinese softshell turtle  ==============
  D              Saker falcon  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D                Budgerigar  ==============
B D                    Turkey  ==============
          Tibetan ground jay  ==============
B D                   Opossum  ==============
               Domestic goat  --------------
  D          Peregrine falcon  ==============
            Brush-tailed rat  ==============
B D                Guinea pig  ==============
B D                     Sheep  --------------
            Tibetan antelope  --------------
B D                       Cow  --------------

Inserts between block 10 and 11 in window
B D           Naked mole-rat 1bp
                  Chinchilla 140bp

Alignment block 11 of 1179 in window, 47495832 - 47495880, 49 bps 
B D                     Human  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcaaaggcag
B D                     Chimp  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcaaaggcag
B D                   Gorilla  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcagaggcag
B D                 Orangutan  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcagaggcag
B D                    Gibbon  tctagcatc----c--agcc-----tc--tctt--tc----------------------agcagaggcag
B D                    Rhesus  tctagcatc----c--agc-------c--tctc--tc----------------------agcagaggcag
B D       Crab-eating macaque  tctagcatc----c--agc-------c--tctc--tc----------------------agcagaggcag
B D                    Baboon  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcagaggcag
B D              Green monkey  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcagaggcag
B D                  Marmoset  tctagcatc----c--agcc-----tc--tctc--tc----------------------agcagaagtag
B D           Squirrel monkey  tctagcatc----c--agcc-----tc--tccc--tc----------------------agcagaagtag
B D                  Bushbaby  ttcaacatc----c--agcc-----tc--tctc--tc----------------------tgcaggggcag
           Chinese tree shrew  tacatcctt----t--agc-------c--ccca--tg----------------------agcagaggcag
B D                  Squirrel  ttgaatatc----c--agc-------c--tcac--tc----------------------ag---------
       Lesser Egyptian jerboa  ttcatgatc---------------------------c----------------------agtagaggcag
                 Prairie vole  ttccccg------c--agc-------c--tctc--tc----------------------agcagaag---
B D           Chinese hamster  ttcaccatg----c--agc-------c--gctc--tc----------------------agcagaag---
               Golden hamster  ttcaccatgcagcc--agc-------c--gctc--tc----------------------agcaggagcca
B D                     Mouse  ttcaccttg----c--agc-------c--tctc--tc----------------------agcataagcca
B D                       Rat  ttcaccatg----c--agt-------c--tctc--tc----------------------agcaggagcct
B D            Naked mole-rat  cccaccacc----c--agg-------c--cctc--tc----------------------agcggggtcag
                   Chinchilla  ccttacaac----a--agg-------cagcttc--cctaggatcagtgattagggcgggggcgggggcag
B D                    Rabbit  ttcaacatc----c--cgt-------c--tctc--cc----------------------agcacaggcag
B D                      Pika  ttcaacatg----t--agc-------c--tcccttcc----------------------agaacaggccg
B D                       Pig  ttcaacatg----c--agca-----tc--tctc--tc----------------------agctgaggctg
B D                    Alpaca  tttaacatg----c--agca-----tc--tctc--tc----------------------agctgaggcag
               Bactrian camel  tttaacatg----c--agca-----tc--tctc--tc----------------------agctgcagcag
B D                   Dolphin  ttcaacatg----c--agca-----------tc--tc----------------------agctgaggcag
                 Killer whale  ttcaacatg----c--agca-----------tc--tc----------------------agctgaggcag
B D                     Horse  ttccacatg----c--agcg-----t----ctc--tc----------------------agcagaggaag
B D          White rhinoceros  ttccacatg----c--agcg-----t----ctc--tc----------------------agcagaggcag
B D                       Cat  ttcaatatg----t--ggca-----tc--tctc--tc----------------------agcagaggccg
B D                       Dog  ttcagcc-----------cg-----tc--cctc--tc----------------------cacagaggcca
B D                   Ferret   ttcgacatg----t--ggca-----tc--tctc--tc----------------------tgcagaggctg
B D                     Panda  ttcaacatg----c--agcg-----tc--tctc--tc----------------------cgcagaggcca
               Pacific walrus  ttcaacatg----t--ggcg-----tc--tccc--tc----------------------cgcagaggccg
                 Weddell seal  ttcaacatg----t--ggcg-----tc--tctc--tc----------------------cgcagaggcca
             Black flying-fox  ttcaacatg----c--agcg---------tctc--tc----------------------ggcagcagcgg
B D                   Megabat  ttcaacgtg----c--agcg-----tc--tctc--tc----------------------ggcagcggcgg
                Big brown bat  tccca------------------------cgtc--tc----------------------ggca-gagcag
         David's myotis (bat)  tc---------------------------catc--tc----------------------gac--aggcag
B D                  Microbat  t-----------------------------gtc--tc----------------------ggcagaggcag
B D                  Hedgehog  ttcaacgtg----t--ggca---------actc--tc----------------------aacagaggcag
              Star-nosed mole  cccaccac----------------------------------------------------acagaggtg-
B D                  Elephant  ctcagcacc----t--agcc-----tc--cctc--tc----------------------tgcacaagcag
          Cape elephant shrew  gtcaacatc----t--taac------c--tctc--tc----------------------tgctgaaggag
B D                   Manatee  ctcagcacc----c--agcct---ctt--tctc--tc----------------------tgcagaagggg
             Cape golden mole  ctcaccatc----c--ag-c-----tc--tcac--tc----------------------tgcagaagcag
B D                    Tenrec  gtccccacg----c--agcc-----cc--tctc--tc----------------------agcagcagcag
                     Aardvark  ctcaaaatc----c--agcc-----tc--tctc--tc----------------------tgcagtagaag
B D                 Armadillo  ttcaacatc----c--agcc-----tc--tctc--cc----------------------agcagacacag
  D    White-throated sparrow  ----gcacc----ccctgcctgtattt--acat--gc----------------------tccaagggcca
B D       Medium ground finch  ----gcacc----ccctgcctgtattt--acat--gc----------------------tccaagggcca
B D                   Chicken  ----------------tgcccttgtct--gcac--gc-------------------agttcgagatgcta
B D        American alligator  ----acatt----t--tgctc---ttc--ccag--tt----------------------ccctgaggctg
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Opossum  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
  D          Peregrine falcon  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------

                        Human  -------g------at---------------t------------gt-----g-gt-ccct---t---g-t
                        Chimp  -------g------at---------------c------------gt-----g-gt-ccct---t---g-t
                      Gorilla  -------g------at---------------c------------gt-----g-gt-ccct---t---g-t
                    Orangutan  -------g------at---------------c------------gt-----g-gt-ccct---t---g-t
                       Gibbon  -------g------at---------------c------------gt-----g-gt-ccct---t---g-t
                       Rhesus  -------g------at---------------c------------gt-----g-gt-acct---tgtcg-t
          Crab-eating macaque  -------g------at---------------c------------gt-----g-gt-acct---tgtcg-t
                       Baboon  -------g------at---------------c------------gt-----g-gt-acct---tgtcg-t
                 Green monkey  -------g------at---------------c------------at-----g-gt-ccct---tgttg-t
                     Marmoset  -------g------at---------------c------------gt-----g-gt-cccttgct---g-t
              Squirrel monkey  -------g------at---------------c------------at-----g-gt-ccct---t---g-t
                     Bushbaby  -------g------gt---------------c------------at-----gcat-tcct---c---a-t
           Chinese tree shrew  -------g------gt---------------c------------ac-----gtgt-ccta---t------
                     Squirrel  -------g------gt---------------c------------at-----g-ga-tctt---c---a-c
       Lesser Egyptian jerboa  -------a------gt---------------a------------tg-----g-at-tcct---c---a-c
                 Prairie vole  -------c------g----------------------------------------------------g-c
              Chinese hamster  -------g------gt---------------g------------ta-----g-ag-tcct---c---a-c
               Golden hamster  -------c------gc---------------g------------ta-----g-at-tcct---c---a-c
                        Mouse  -------c------gt---------------g------------ca-----g--t-tcct---c---a-c
                          Rat  -------c------ac---------------g------------ca-----g--t-tcct---c---a-c
               Naked mole-rat  -------g------gc---------------ca-----------ca-----g-ac-tcct---c---c--
                   Chinchilla  -------g------gg---------------caggggcgggggcca-----g-ac-tcct---g---c--
                       Rabbit  -------g------gg---------------t------------gt-----g-gattcct---c---a-c
                         Pika  -------a------at---------------c------------ag-----g-ga-cccc---c---a-t
                          Pig  -------g------ac--------------tg------------ca-----g-at-tcct---c---a-t
                       Alpaca  -------t------gt--------------tg------------ca-----g-at-tcct---c---g-t
               Bactrian camel  -------t------gc--------------tg------------ca-----g-at-tcct---c---g-t
                      Dolphin  -------g------gc--------------tg------------ca-----g-ct-tctt---c---a-t
                 Killer whale  -------g------gc--------------tg------------ca-----g-ct-tctt---c---a-t
                        Horse  -------g------gc-------------ggg------------ca-----g-ac-tcct---c---g-c
             White rhinoceros  -------g------gc--------------tg------------ca-----g-ag-tcct---c---a-c
                          Cat  -------g------gt--------------tg------------ca-----a-tt-cctt---a-----t
                          Dog  -------g------gt--------------tg------------ca-----g-gt-cctt---c-----t
                      Ferret   -------g------gt--------------ta------------cc-----a-ct-ccct---c-----t
                        Panda  -------g------gt--------------gg------------ct-----g-tt-cctt---c-----t
               Pacific walrus  -------g------gt--------------tg------------ct-----a-tt-ccct---c-----t
                 Weddell seal  -------g------gt--------------tg------------ct-----a-tt-tcct---c------
             Black flying-fox  -------g------ct---------------g------------ca-----g-at-tcct---------c
                      Megabat  -------g------ct---------------g------------ca-----g-at-tcct---------c
                Big brown bat  -------g------gt-----------------------------g-----g-gt-tcct---g---a-c
         David's myotis (bat)  -------g------gt---------------g------------cg-----g-gt-tcct---g---a-c
                     Microbat  -------g------gt---------------g------------cg-----g-gt-tcct---g---a-c
                     Hedgehog  -------a------ac--------------tg------------ca-----g-gc-tcct---c---gct
              Star-nosed mole  -------------------------------g------------ca-----g-ac-tcct---c---agt
                     Elephant  -------g------gt--------------gg------------ca-----g-gt-gcct---c---a-t
          Cape elephant shrew  -------g------gt--------------ca------------ca-----g-at-tccg---c---c-c
                      Manatee  -------g------gt--------------ca------------tg-----g-gt-tact---c---g-t
             Cape golden mole  -------g------gt--------------ca------------ca-----g-at-tctt---c---a-t
                       Tenrec  cagcagca------gt--------------ag------------caggaagg-ag-gctt---c---c-c
                     Aardvark  -------g------ct--------------tg------------tg-----g-at-tcct---c---a-t
                    Armadillo  -------c------gc--------------tg------------c------g-ct-ctct---c---a-t
       White-throated sparrow  -------ttcttgcaagttcttgctccctttc------------tt-----g-gc-ctga----------
          Medium ground finch  -------ttcttgcaagttcttgctccctttc------------tt-----g-gc-ctga----------
                      Chicken  -------tt-----aa------gcttccctct------------ta-----g-gc-c--a----------
           American alligator  -------g------aa---------------c------------gc-----g-gc-ccga----------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                       Medaka  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
           Tibetan ground jay  ======================================================================
                      Opossum  ======================================================================
                Domestic goat  ----------------------------------------------------------------------
             Peregrine falcon  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
                        Sheep  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------

Inserts between block 11 and 12 in window
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 3bp
                Prairie vole 3bp
B D          Chinese hamster 3bp
              Golden hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D           Naked mole-rat 2bp
                  Chinchilla 2bp
B D                   Rabbit 3bp
B D                     Pika 3bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp
             Star-nosed mole 2bp
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp

Alignment block 12 of 1179 in window, 47495881 - 47495885, 5 bps 
B D                     Human  gtttt
B D                     Chimp  gtttt
B D                   Gorilla  gtttt
B D                 Orangutan  gtttt
B D                    Gibbon  gtttt
B D                    Rhesus  gtttt
B D       Crab-eating macaque  gtttt
B D                    Baboon  gtttt
B D              Green monkey  gtttt
B D                  Marmoset  gtttt
B D           Squirrel monkey  gtttt
B D                  Bushbaby  tgttt
B D                  Squirrel  gtttt
       Lesser Egyptian jerboa  gtttc
                 Prairie vole  gttca
B D           Chinese hamster  gttta
               Golden hamster  gttca
B D                     Mouse  gtttc
B D                       Rat  gtttc
B D            Naked mole-rat  gcctc
                   Chinchilla  gcttc
             Brush-tailed rat  gccct
B D                    Rabbit  gtttt
B D                      Pika  gcttt
B D                       Pig  atttt
B D                    Alpaca  atttt
               Bactrian camel  atttt
B D                   Dolphin  gtttt
                 Killer whale  gtttt
B D                     Horse  gtttt
B D          White rhinoceros  gtttt
B D                       Cat  gtttc
B D                       Dog  gcttt
B D                   Ferret   gtttt
B D                     Panda  gtctt
               Pacific walrus  gtttt
                 Weddell seal  gttat
             Black flying-fox  gtttt
B D                   Megabat  gtttt
                Big brown bat  gtctg
         David's myotis (bat)  gtttt
B D                  Microbat  gtttt
B D                  Hedgehog  atttt
              Star-nosed mole  gttct
B D                  Elephant  gtttt
          Cape elephant shrew  gttaa
B D                   Manatee  gtttt
             Cape golden mole  gtttt
B D                    Tenrec  gcttt
                     Aardvark  gtttt
B D                 Armadillo  gtttt
  D    White-throated sparrow  gtgtg
B D       Medium ground finch  gtgtg
B D                   Chicken  ggttg
B D        American alligator  gggca
B D              Nile tilapia  =====
                 Zebra mbuna  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
                 Spotted gar  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                      Fugu  =====
B D                Coelacanth  =====
          Southern platyfish  =====
B D                    Medaka  =====
      Yellowbelly pufferfish  =====
B D             X. tropicalis  =====
B D           Tasmanian devil  =====
  D               Rock pigeon  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
  D              Saker falcon  =====
  D           Green seaturtle  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
B D                    Turkey  =====
          Tibetan ground jay  =====
B D                   Opossum  =====
               Domestic goat  -----
  D          Peregrine falcon  =====
B D                Guinea pig  =====
B D                     Sheep  -----
            Tibetan antelope  -----
          Chinese tree shrew  -----
B D                       Cow  -----

Alignment block 13 of 1179 in window, 47495886 - 47495922, 37 bps 
B D                     Human  ctgaacag-----------ggccc-agg------gcagccaagg----catgcc----------------
B D                     Chimp  ctgaacag-----------ggccc-agg------gcagccaagg----catgct----------------
B D                   Gorilla  ctgaacag-----------ggccc-agg------gcagccaagg----catgcc----------------
B D                 Orangutan  ctgaacag-----------ggccc-agg------gcagccaagg----catgcc----------------
B D                    Gibbon  ctgaacag-----------ggccc-agg------gcagccaagt----catgcc----------------
B D                    Rhesus  ctgaacag-----------ggccc-agg------acagccaagg----catgcc----------------
B D       Crab-eating macaque  ctgaacag-----------ggccc-agg------acagccaagg----catgcc----------------
B D                    Baboon  ctgaacag-----------ggccc-agg------acagccaagg----catgtc----------------
B D              Green monkey  ctgaacag-----------ggccc-agg------acagccaagg----catgcc----------------
B D                  Marmoset  ctgaacag-----------agccc-aga------atagccaagg----tatgcc----------------
B D           Squirrel monkey  ccgaacag-----------ggccc-aga------atagccaagg----tatgcc----------------
B D                  Bushbaby  ctgaacag-----------ggccc-aga------ggagcaaaggcttacatact----------------
           Chinese tree shrew  -------------------------------------gtcagac----cacgcc----------------
B D                  Squirrel  ctgaacag-----------ggccc-aga------ggaacaaagg----caccca---------------c
       Lesser Egyptian jerboa  ctgaacaa-----------ggg----ag------ggagcaaagg----cacaca---------------c
                 Prairie vole  ctgagcag-----------agtcc-tgg------ggaacaaagg----caccca---------------c
B D           Chinese hamster  cagagcag-----------agc-c-tgg------ggaacaaagg----catcca---------------c
               Golden hamster  ctgagcag-----------agcgc-tgg------ggaacaaagg----catcca---------------c
B D                     Mouse  ctaagcag-----------agccc-tgg------aga--caaag----cgggca---------------c
B D                       Rat  ctgagcag-----------agccc-tgg------gga--caaag----caggtg----------------
B D            Naked mole-rat  ccaaccat-----------ggc-c-cag------gca--cagag----cacacc---------------a
                   Chinchilla  ccaaacag-----------ggc-c-agg------gca--cacag----cataca---------------a
             Brush-tailed rat  ctcggcag-----------ggc-c-aag------gca--cacag----tacaca---------------a
B D                    Rabbit  ctgaacag-----------ggctc-aga------agagcaaagg----cacacc----------------
B D                      Pika  ctgctcag-----------ggcac-agg------ggagcagagg----cacata----------------
B D                       Pig  ctataccg-----------ggccc-aca------ggaacaaagg----caaacc----------------
B D                    Alpaca  ctgagcag-----------ggcccgggg------ggagtgaagg----cacacc----------------
               Bactrian camel  ctgagcag-----------ggccc-ggg------ggagtgaagg----cacacc----------------
B D                   Dolphin  ctaaacag-----------ggccc-agg------ggaacaaagg----caaacc----------------
                 Killer whale  ctaaacag-----------ggccc-agg------ggaacaaagg----caaacc----------------
B D                     Horse  ctgagcag-----------ggccc-agg------ggaacaaagg----catacg----------------
B D          White rhinoceros  ctgagcag-----------ggccc-agg------ggaacaaagg----catacc----------------
B D                       Cat  tggaatag-----------ggccc-cgg------gcaacaaagg----catact----------------
B D                       Dog  ct-aacag-----------ggccc-agg------ggagcgaagg----catgcc----------------
B D                   Ferret   ctgcccag-----------ggccc-tgg------ggaacgaggg----cgt-cc----------------
B D                     Panda  ctgaacgg-----------ggccc-cgg------ggatctaggg----cgtgcc----------------
               Pacific walrus  ctgaacag--------------cc-cag------ggaactagga----cgtgcc----------------
                 Weddell seal  ccaaacag--------------cc-cag------ggaactagga----cgtgcc----------------
             Black flying-fox  ctgagcag-----------ggccc-agt------gggacaaagg----cacact----------------
B D                   Megabat  ctgagcag-----------ggccc-agt------gggacaaagg----cacact----------------
                Big brown bat  ctgaaca--------------------t------gggacaaggg----cacac-----------------
         David's myotis (bat)  ctgaaca--------------------c------gggacaaggg----cacat-----------------
B D                  Microbat  ctgaacg--------------------t------gggacaaggg----cacac-----------------
B D                  Hedgehog  ctgaa-ga-----------gggtc-cgg------ggaacaaagg----c---------------------
              Star-nosed mole  ctgaatgt-----------ggccc-cag------gaaacacagc----g---------------------
B D                  Elephant  ctgaacaa-----------ggtcc-agg------gaagcaaagg----tacacc----------------
          Cape elephant shrew  ctgaatgg-----------agctg-aag------gaagtgaagg----tataac----------------
B D                   Manatee  ctgaacag-----------agtcc-agg------gaagcaaagg----tgca------------------
             Cape golden mole  ctgaacag-----------gatcc-agg------gaagcaaagg----tacatg----------------
B D                    Tenrec  ccgagcag-----------ggccc-agg------taagtag-----------------------------
                     Aardvark  ctgaacaa-----------ggact-aag------gaagcaaagg----tacact----------------
B D                 Armadillo  ctgaacag-----------ggccc-aa-------------------------------------------
  D    White-throated sparrow  ttgggaac-----------agggt-ggg------aggacaaagg----gatgca----------------
B D       Medium ground finch  ttgggaac-----------ggggt-ggg------aggacaaagg----gacgca----------------
B D                   Chicken  ctgtacag-----------ctcct-gga------aggcaccgag----gaagcaagcaggctggttt---
B D        American alligator  gggcagag-----------ggaat-gggctt---aggctccgat----cccaca-------------ac-
  D            Painted turtle  ctgcacagagttcactgcaggttt-ggattttaaatgccactta----g---------------------
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Opossum  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
  D          Peregrine falcon  ======================================================================
B D                Guinea pig  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------

                        Human  ---atcac
                        Chimp  ---atcac
                      Gorilla  ---atcac
                    Orangutan  ---atcac
                       Gibbon  ---atcac
                       Rhesus  ---atcac
          Crab-eating macaque  ---atcac
                       Baboon  ---atcac
                 Green monkey  ---atcac
                     Marmoset  ---atcac
              Squirrel monkey  ---atcac
                     Bushbaby  ---atcat
           Chinese tree shrew  ---atcat
                     Squirrel  accatcac
       Lesser Egyptian jerboa  accgtcac
                 Prairie vole  -tcctccc
              Chinese hamster  accctcac
               Golden hamster  accttcac
                        Mouse  accctcac
                          Rat  ---ctcac
               Naked mole-rat  accactat
                   Chinchilla  accaccac
             Brush-tailed rat  gccaccac
                       Rabbit  ---atggc
                         Pika  ---ctggc
                          Pig  ---atcac
                       Alpaca  ---attgc
               Bactrian camel  ---actgc
                      Dolphin  ---atcac
                 Killer whale  ---atcac
                        Horse  ---ggccc
             White rhinoceros  ---gtcac
                          Cat  ---gtcac
                          Dog  ---atcac
                      Ferret   ---atcac
                        Panda  ---gtcac
               Pacific walrus  ---gtcac
                 Weddell seal  ---gtcac
             Black flying-fox  ---gtcat
                      Megabat  ---gtcat
                Big brown bat  --------
         David's myotis (bat)  --------
                     Microbat  --------
                     Hedgehog  --------
              Star-nosed mole  --------
                     Elephant  ---atcat
          Cape elephant shrew  ---atcac
                      Manatee  --------
             Cape golden mole  ---atcat
                       Tenrec  --------
                     Aardvark  ---atcat
                    Armadillo  --------
       White-throated sparrow  --------
          Medium ground finch  --------
                      Chicken  --------
           American alligator  --------
               Painted turtle  --------
                 Nile tilapia  ========
                  Zebra mbuna  ========
                    Tetraodon  ========
                  Stickleback  ========
                  Spotted gar  ========
          Pundamilia nyererei  ========
        Burton's mouthbreeder  ========
          Princess of Burundi  ========
                         Fugu  ========
                   Coelacanth  ========
           Southern platyfish  ========
                       Medaka  ========
       Yellowbelly pufferfish  ========
                X. tropicalis  ========
              Tasmanian devil  ========
                  Rock pigeon  ========
                  Zebra finch  ========
          Collared flycatcher  ========
     Chinese softshell turtle  ========
                 Saker falcon  ========
              Green seaturtle  ========
                 Mallard duck  ========
                   Budgerigar  ========
                       Turkey  ========
           Tibetan ground jay  ========
                      Opossum  ========
                Domestic goat  --------
             Peregrine falcon  ========
                   Guinea pig  ========
                        Sheep  --------
             Tibetan antelope  --------
                          Cow  --------

Inserts between block 13 and 14 in window
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D                  Chicken 4bp
B D       American alligator 26bp

Alignment block 14 of 1179 in window, 47495923 - 47495938, 16 bps 
B D                     Human  tgcagcactcaa-----c-cct---------
B D                     Chimp  tgcagcactcaa-----c-cct---------
B D                   Gorilla  tgcagcactcaa-----c-cct---------
B D                 Orangutan  tgcagcactcaa-----ctcca---------
B D                    Gibbon  tgcagcactcaa-----c-cct---------
B D                    Rhesus  tgcagcactcaa-----t-cct---------
B D       Crab-eating macaque  tgcagcactcaa-----t-cct---------
B D                    Baboon  tgcagcactcaa-----t-tct---------
B D              Green monkey  tgcagcactcaa-----c-cct---------
B D                  Marmoset  tgcagcattcaa-----c-tct---------
B D           Squirrel monkey  tgcagcattcaa-----c-tct---------
B D                  Bushbaby  tgcaccattcaa-----c-cct---------
           Chinese tree shrew  agcaccgttcgg-----c-cct---------
B D                  Squirrel  agcc---------------cct---------
       Lesser Egyptian jerboa  accaccattcaa-----c-cca---------
                 Prairie vole  agcaccattcaa-----t-cct---------
B D           Chinese hamster  agcaccattcca-----c-cct---------
               Golden hamster  agcaccatgcca-------cct---------
B D                     Mouse  agcgccat-----------cct---------
B D                       Rat  agcaccat-----------cgt---------
B D            Naked mole-rat  -gcaccgt-------------t---------
                   Chinchilla  agtaccat-------------t---------
             Brush-tailed rat  agtgccac-------------t---------
B D                    Rabbit  tgca-----cag-----t-cta---------
B D                      Pika  cgcacccagcaa-----c-gtg---------
B D                       Pig  agcaccgttcca-----c-cat---------
B D                    Alpaca  cacaccattcca-----c-cag---------
               Bactrian camel  cacaccattccg-----c-cag---------
B D                   Dolphin  agcaccattcca-----c-cat---------
                 Killer whale  agcaccattcca-----c-cat---------
B D                     Horse  agcaccactcgg-----c-cat---------
B D          White rhinoceros  agcaccattcga-----c-cat---------
B D                       Cat  agagccattcca-----c-ggc---------
B D                       Dog  agcacccttcct-----c-tgc---------
B D                   Ferret   ggccccattccg-----c-tgt---------
B D                     Panda  agccccattc-------c-cct---------
               Pacific walrus  agcccactttcagggccc-cgc---------
                 Weddell seal  agcccctttcca-----c-ggc---------
             Black flying-fox  agcactactcga-----c-cac---------
B D                   Megabat  agcactactcga-----c-cac---------
                Big brown bat  gccacagtccgc-----t-cat---------
         David's myotis (bat)  gccacggtccgc-----t-cct---------
B D                  Microbat  gccacagtccgc-----t-cat---------
B D                  Hedgehog  -----------------c-ca----------
              Star-nosed mole  -----------------c-cac---------
B D                  Elephant  ggcaccatgcaa-----c-cac---------
          Cape elephant shrew  tctgccactcag-----c-cat---------
B D                   Manatee  ----ccattcga-----c-cat---------
             Cape golden mole  agcaccacctga-----c-cat---------
                     Aardvark  agcaccattaga-----c-cat---------
B D                 Armadillo  --caccacccga-----c-agc---------
  D              Saker falcon  --------------tgct-cctggaagg---
  D          Peregrine falcon  --------------tgct-cctggaagg---
  D    White-throated sparrow  --------------ggcc-ccaggcaggctg
B D       Medium ground finch  --------------ggcc-ccaggcaggctg
B D                   Chicken  ---------------gca-catccaatc---
B D        American alligator  -----------------c-ccagacagatct
  D            Painted turtle  --------------tgcc-aatgcaaatt--
B D              Nile tilapia  ===============================
                 Zebra mbuna  ===============================
B D                 Tetraodon  ===============================
B D               Stickleback  ===============================
                 Spotted gar  ===============================
         Pundamilia nyererei  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D                      Fugu  ===============================
B D                Coelacanth  ===============================
          Southern platyfish  ===============================
B D                    Medaka  ===============================
      Yellowbelly pufferfish  ===============================
B D             X. tropicalis  ===============================
B D           Tasmanian devil  ===============================
  D               Rock pigeon  ===============================
B D               Zebra finch  ===============================
  D       Collared flycatcher  ===============================
  D  Chinese softshell turtle  ===============================
  D           Green seaturtle  ===============================
  D              Mallard duck  ===============================
B D                Budgerigar  ===============================
B D                    Turkey  ===============================
          Tibetan ground jay  ===============================
B D                   Opossum  ===============================
B D                    Tenrec  -------------------------------
               Domestic goat  -------------------------------
B D                Guinea pig  ===============================
B D                     Sheep  -------------------------------
            Tibetan antelope  -------------------------------
B D                       Cow  -------------------------------

Inserts between block 14 and 15 in window
B D                 Elephant 2bp

Alignment block 15 of 1179 in window, 47495939 - 47495953, 15 bps 
B D                     Human  ------c-----------tg-gtcacagtg-------gag
B D                     Chimp  ------c-----------tg-gtcacagtg-------gag
B D                   Gorilla  ------c-----------tg-gtcacagtg-------gag
B D                 Orangutan  ------c-----------tg-gtcacagtg-------gag
B D                    Gibbon  ------c-----------tg-gtcacagtg-------gag
B D                    Rhesus  ------c---------cttg-gtcacagtg-------gag
B D       Crab-eating macaque  ------c---------cttg-gtcacagtg-------gag
B D                    Baboon  ------c---------cttg-gtcacagtg-------gag
B D              Green monkey  ------c---------cttg-gtcacagtg-------gag
B D                  Marmoset  ------c---------cctg-gtcaccatg-------gag
B D           Squirrel monkey  ------c---------cctg-gtcactgtg-------gag
B D                  Bushbaby  ------c---------cctgagttacagca-------gag
           Chinese tree shrew  ------ccaccgtcccctgg-gtcccagcg-------ggg
B D                  Squirrel  ------c---------cctg-gtgacaggg-------gag
       Lesser Egyptian jerboa  ------a---------cctg-gtcatgg-g-------gag
                 Prairie vole  -----------------cgg-gccacagtg-------gag
B D           Chinese hamster  ------c---------cctg-gtcacagtg-------gag
               Golden hamster  ------c---------cctg-gtcacggtg-------gag
B D                     Mouse  ------c---------cctg-gtcacagcg-------gag
B D                       Rat  ------c---------ccgg-gtcacggct---------g
B D            Naked mole-rat  ------t---------gctg-gtca-catg-------gag
                   Chinchilla  ------c---------gctg-gtcaccgtg-------gag
             Brush-tailed rat  ------c---------actg-gccaccacg-------gag
B D                    Rabbit  ------g---------ccgg-gtcccagtg-------gag
B D                      Pika  ------g---------ccag-gtccctgtg-------gag
B D                       Pig  ------c--------cctgg-gtcacagtg-------gtg
B D                    Alpaca  ------c--------cttag-gtcacagtg-------gag
               Bactrian camel  ------c--------cctag-gtcacagtg-------ggg
B D                   Dolphin  ------c--------cctgg-gtcacagtg-------gaa
                 Killer whale  ------c--------cctgg-gtcacagtg-------gaa
B D                     Horse  ------c--------gctgg-gtcac-acg-------gag
B D          White rhinoceros  ------c--------gttgg-gtcac-gcg-------gag
B D                       Cat  ------a---------tcgg-gtcacagtg-------g--
B D                       Dog  ------c---------ccgt-gtcacagtg-------ggg
B D                   Ferret   ------c---------ccgc-accgcagca-------ggg
B D                     Panda  ------c---------ccgc-accgcggtg-------ggg
               Pacific walrus  ------c---------ccgc-cccgcagtg-------ggg
                 Weddell seal  ------c---------ccgc-cctgcagtg-------agg
             Black flying-fox  ------c--------cttgg-gtcacagtg-------g--
B D                   Megabat  ------c--------cttgg-gtcacagtg-------g--
                Big brown bat  ------c--------cctgg-gc-----------------
         David's myotis (bat)  ------c--------cctgg-gc-----------------
B D                  Microbat  ------c--------cctgg-gc-----------------
B D                  Hedgehog  ---------------aacca-gtcacagca-------aag
              Star-nosed mole  ------c--------acctg-gtcgcagtggggatgtgag
B D                  Elephant  ------t--------ggggg-gtcccagtg-------gag
          Cape elephant shrew  ------c--------agtgg-gtcccagtg-------ggc
B D                   Manatee  ------c--------ggtgg-gtcccagtg-------gag
             Cape golden mole  ------c--------actgg-gttctacgg-------gtg
B D                    Tenrec  -----------------tgg-gct----------------
                     Aardvark  ------t--------ggttg-gtctcggtg-------gag
B D                 Armadillo  ------c--------g-tgg-gtc--agag-------aag
  D              Saker falcon  ------c---------actg-gtg----------------
  D          Peregrine falcon  ------c---------actg-gtg----------------
  D    White-throated sparrow  atcccac---------gttg-gca----------------
B D       Medium ground finch  ctcccac---------gttg-gca----------------
B D                   Chicken  ------t---------atag-gta----------------
B D        American alligator  cagcagg---------gctg-agg----------------
  D           Green seaturtle  -----ct---------gctc-aca----------------
  D            Painted turtle  -----ct---------gctc-aca----------------
B D              Nile tilapia  ========================================
                 Zebra mbuna  ========================================
B D                 Tetraodon  ========================================
B D               Stickleback  ========================================
                 Spotted gar  ========================================
         Pundamilia nyererei  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D                      Fugu  ========================================
B D                Coelacanth  ========================================
          Southern platyfish  ========================================
B D                    Medaka  ========================================
      Yellowbelly pufferfish  ========================================
B D             X. tropicalis  ========================================
B D           Tasmanian devil  ========================================
  D               Rock pigeon  ========================================
B D               Zebra finch  ========================================
  D       Collared flycatcher  ========================================
  D  Chinese softshell turtle  ========================================
  D              Mallard duck  ========================================
B D                Budgerigar  ========================================
B D                    Turkey  ========================================
          Tibetan ground jay  ========================================
B D                   Opossum  ========================================
               Domestic goat  ----------------------------------------
B D                Guinea pig  ========================================
B D                     Sheep  ----------------------------------------
            Tibetan antelope  ----------------------------------------
B D                       Cow  ----------------------------------------

Alignment block 16 of 1179 in window, 47495954 - 47495960, 7 bps 
B D                     Human  t-cg----------ccgg
B D                     Chimp  t-cg----------ccag
B D                   Gorilla  t-tg----------ccgg
B D                 Orangutan  t-cg----------ccag
B D                    Gibbon  t-cg----------ccgg
B D                    Rhesus  t-ca----------gcgg
B D       Crab-eating macaque  t-ca----------gcgg
B D                    Baboon  t-ca----------gcgg
B D              Green monkey  t-ca----------gcgg
B D                  Marmoset  t-ca----------ccag
B D           Squirrel monkey  t-ca----------ccag
B D                  Bushbaby  t-tg----------ccag
           Chinese tree shrew  c-tg----------ccag
B D                  Squirrel  c-tg----------ccag
       Lesser Egyptian jerboa  c-tg----------ccag
                 Prairie vole  c-tg-----------cg-
B D           Chinese hamster  c-tg-----------cag
               Golden hamster  c-tg-----------cgg
B D                     Mouse  c-tg-----------cag
B D                       Rat  c-tg-----------tgg
B D            Naked mole-rat  c-tg-----------tgg
                   Chinchilla  c-tg-----------tag
             Brush-tailed rat  c-tg-----------cag
B D                    Rabbit  c-tg----------ccag
B D                      Pika  c-tg----------acag
B D                       Pig  c-tg----------gcag
B D                    Alpaca  c-tg----------ccag
               Bactrian camel  c-tg----------ccag
B D                   Dolphin  c-tg----------ccag
                 Killer whale  c-tg----------ccag
B D                     Horse  c-ta----------ccag
B D          White rhinoceros  c-tg----------ccag
B D                       Cat  --tg----------gcaa
B D                       Dog  c-tg----------ccgg
B D                   Ferret   c-tg----------ccgg
B D                     Panda  c-tg----------ccgg
               Pacific walrus  c-tg----------tcgg
                 Weddell seal  c-tg----------ttgg
             Black flying-fox  c-tg----------ccag
B D                   Megabat  c-tg----------ccag
                Big brown bat  --------------gcag
         David's myotis (bat)  --------------gcag
B D                  Microbat  --------------gcag
B D                  Hedgehog  c-tg----------accg
              Star-nosed mole  g-tg----------gctg
B D                  Elephant  c-tg----------ctag
          Cape elephant shrew  c-agacaa------cttg
B D                   Manatee  c-tg----------ctag
             Cape golden mole  c--g----------ccag
B D                    Tenrec  ---g----------ccag
                     Aardvark  c-tg----------ccag
B D                 Armadillo  cctg----------ccgg
B D                   Opossum  t-tg----------tctg
B D                   Wallaby  t-tg----------tctg
  D              Saker falcon  -----aagcag---ccgg
  D          Peregrine falcon  -----aagcag---ccgg
  D    White-throated sparrow  --------------ccag
B D       Medium ground finch  -----ccactt---ccag
B D                   Chicken  --------------ccaa
B D        American alligator  -----ctgcat---cagg
  D           Green seaturtle  -----ccacatttactgg
  D            Painted turtle  -----tcacatttactgg
B D              Nile tilapia  ==================
                 Zebra mbuna  ==================
B D                 Tetraodon  ==================
B D               Stickleback  ==================
                 Spotted gar  ==================
         Pundamilia nyererei  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D                      Fugu  ==================
B D                Coelacanth  ==================
          Southern platyfish  ==================
B D                    Medaka  ==================
      Yellowbelly pufferfish  ==================
B D             X. tropicalis  ==================
B D           Tasmanian devil  ==================
  D               Rock pigeon  ==================
B D               Zebra finch  ==================
  D       Collared flycatcher  ==================
  D  Chinese softshell turtle  ==================
  D              Mallard duck  ==================
B D                Budgerigar  ==================
B D                    Turkey  ==================
          Tibetan ground jay  ==================
               Domestic goat  ------------------
B D                Guinea pig  ==================
B D                     Sheep  ------------------
            Tibetan antelope  ------------------
B D                       Cow  ------------------

Alignment block 17 of 1179 in window, 47495961 - 47495989, 29 bps 
B D                     Human  tccagcctgaaa-------tat--tac-t-a-cagagga-g-a
B D                     Chimp  tccagcctgaaa-------tat--tac-t-a-cagagga-g-a
B D                   Gorilla  tccagcctgaaa-------tat--tac-t-a-cagaaga-g-a
B D                 Orangutan  tccagcctgaaa-------tat--tac-t-a-cagagga-g-a
B D                    Gibbon  tctagcctgaaa-------tat--tac-t-a-cagagga-g-a
B D                    Rhesus  tccagcctgaaa-------tac--tac-t-a-cagagga-g-a
B D       Crab-eating macaque  tccagcctgaaa-------tac--tac-t-a-cagagga-g-a
B D                    Baboon  tccagcctgaaa-------tac--tac-t-a-cagagga-g-a
B D              Green monkey  tccagcctgaaa-------tac--tac-t-g-cagagga-g-a
B D                  Marmoset  tccagcccgaaa-------tac--tac-t-a-cagagga-g-a
B D           Squirrel monkey  tccagcccgaaa-------tac--tac-t-a-cagaaga-g-a
B D                  Bushbaby  ctcagcctgaaa-------tac--tac-t-a-caaaggt-gtc
           Chinese tree shrew  tctggcctgcaa-------cac--ccc-t-a-cgaaggc-a-c
B D                  Squirrel  tccaacctgaaa-------cag--tat-g-a-caaaggc-a-g
       Lesser Egyptian jerboa  gccagcctgaca-------tac--tac-c-a-caaagat-a-c
                 Prairie vole  --cagcataaag-------agc--ttg-t-c-aaagg-c-c-c
B D           Chinese hamster  tccagcgtgaag-------cgt--ggg-c-c-caaggtc-t-g
               Golden hamster  tccagcctgaag-------tat--ggg-c-c-caagg-c-t-g
B D                     Mouse  tcaagcctgacg-------agt--g------------------
B D                       Rat  tgaagcctgaag-------agt--gag-t-c-aaaggtc-t-g
B D            Naked mole-rat  tctggcctgaaa-------tgc--tgc-t-a-cccagac-a-c
                   Chinchilla  ccccaccgaaaa-------tgc--tgc-t-a-cctagga-a-c
             Brush-tailed rat  tccagcctgcgc-------tgc--tgc-t-a-cccaggc-a-c
B D                    Rabbit  cccagcctgaaa-------cag--cac-caa-caaagacgt-a
B D                      Pika  cccagcctgaaa-------tat--cag-c-a-tgaaggtgt-g
B D                       Pig  tcc----------------------ac-t-g-caaaggt-g-t
B D                    Alpaca  cct----------------------gc-t-a-caaaggt-g-t
               Bactrian camel  act----------------------gc-t-a-caaaggt-g-t
B D                   Dolphin  tcc----------------------ac-a-a-caaaggt-g-t
                 Killer whale  tcc----------------------ac-a-a-caaaggt-g-t
B D                     Horse  tccagcctgaga-------tac--tac-t-a-caaaggt-g-c
B D          White rhinoceros  tccagcctgaga-------tac--tac-t-a-caaaggt-g-t
B D                       Cat  tccaggctgaaa-------tac--cac-t-t-caaaggt-g-t
B D                       Dog  tccaggctgaga-------tgc--cac-a-t-caaaggt-g-t
B D                   Ferret   tccaggctgaaa-------tgc--cac-t-t-caaaggt-g-t
B D                     Panda  cccaggctgaaa-------tgc--cac-t-t-caaacgc-g-t
               Pacific walrus  tccaggctgaaa-------tgc--cac-t-t-caaagct-g-t
                 Weddell seal  tccaggctgaaa-------tgc--cac-t-t-caaaggt-g-t
             Black flying-fox  tcccacctgaaa-------tac--cac-t-a-agaaggt-g-t
B D                   Megabat  tcccacctgaaa-------tac--cac-t-a-agaaggt-g-t
                Big brown bat  tccagccgggaa-------cac--ggc-t-g-cgaaggc-g-g
         David's myotis (bat)  tccagctgggga-------cac--ggc-t-g-cgaaggc-g-g
B D                  Microbat  tccagctgggaa-------cac--ggc-t-g-cgaaggc-g-g
B D                  Hedgehog  agtgacccatga-------tg---cgc-t-g-cgagggg-g-t
              Star-nosed mole  agctac------------------agc-c-a-ctatggt-g-a
B D                  Elephant  -----------t-------gac--tacgt-a-tgaagac-g-t
          Cape elephant shrew  -----------a-------aacagtac-t-g-ccaagat-g-t
B D                   Manatee  -----------tctgtctgaaatacac-c-a-caaaggc-a-t
             Cape golden mole  tcaa-ccttaaa-------tac--tat-t-a-caaaggc-c-t
B D                    Tenrec  -----------g-------tac--cac-c-a-ggagggt-g-g
                     Aardvark  tcaa-cctgaaa-------tac--tat-t-a-caaaggt-g-t
B D                 Armadillo  tcca-gcctgaa-------tac---cc-c-g-ccaaggc-g-t
B D                   Opossum  atcagcctaaga-------caa--agc-t--------gg-g-a
B D           Tasmanian devil  aagagcttaaca-------caa--agc-t--------gg-g-g
B D                   Wallaby  attagcttaaga-------caa--tgc-t--------gg-g-g
  D              Saker falcon  --------------------gc--tgg-t-t-tggtggc-a-t
  D          Peregrine falcon  --------------------gc--tgg-t-t-tggtggc-a-t
  D    White-throated sparrow  --------------------gt--gtg-t-c-tgagctt-c-c
B D       Medium ground finch  --------------------gt--gtg-t-c-tgagctt-c-c
B D                   Chicken  --------------------tc------t-a-taggttc-c-a
B D        American alligator  --------------------at----g-t-t-tgggggc-a--
  D           Green seaturtle  --------------------at--tag-c-cctggaaac-t-g
  D            Painted turtle  --------------------at--tgg-t-cgtggaaag-t-g
B D              Nile tilapia  ===========================================
                 Zebra mbuna  ===========================================
B D                 Tetraodon  ===========================================
B D               Stickleback  ===========================================
                 Spotted gar  ===========================================
         Pundamilia nyererei  ===========================================
       Burton's mouthbreeder  ===========================================
         Princess of Burundi  ===========================================
B D                      Fugu  ===========================================
B D                Coelacanth  ===========================================
          Southern platyfish  ===========================================
B D                    Medaka  ===========================================
      Yellowbelly pufferfish  ===========================================
B D             X. tropicalis  ===========================================
  D               Rock pigeon  ===========================================
B D               Zebra finch  ===========================================
  D       Collared flycatcher  ===========================================
  D  Chinese softshell turtle  ===========================================
  D              Mallard duck  ===========================================
B D                Budgerigar  ===========================================
B D                    Turkey  ===========================================
          Tibetan ground jay  ===========================================
               Domestic goat  -------------------------------------------
B D                Guinea pig  ===========================================
B D                     Sheep  -------------------------------------------
            Tibetan antelope  -------------------------------------------
B D                       Cow  -------------------------------------------

Alignment block 18 of 1179 in window, 47495990 - 47495991, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  a-
B D                  Bushbaby  aa
           Chinese tree shrew  ag
B D                  Squirrel  aa
       Lesser Egyptian jerboa  ga
                 Prairie vole  ga
B D           Chinese hamster  ca
               Golden hamster  aa
B D                       Rat  ag
B D            Naked mole-rat  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  aa
B D                      Pika  aa
B D                       Pig  aa
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  aa
                 Killer whale  aa
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  gc
B D                       Dog  ac
B D                   Ferret   ac
B D                     Panda  ac
               Pacific walrus  ac
                 Weddell seal  ac
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ga
              Star-nosed mole  aa
B D                  Elephant  aa
          Cape elephant shrew  aa
B D                   Manatee  aa
             Cape golden mole  aa
B D                    Tenrec  ga
                     Aardvark  aa
B D                 Armadillo  aa
B D                   Opossum  aa
B D           Tasmanian devil  aa
B D                   Wallaby  aa
  D              Saker falcon  at
  D          Peregrine falcon  at
  D    White-throated sparrow  ct
B D       Medium ground finch  ct
B D                   Chicken  at
B D        American alligator  gt
  D           Green seaturtle  ct
  D            Painted turtle  ct
B D                 Tetraodon  aa
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D               Stickleback  ==
                 Spotted gar  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  ==
B D                Coelacanth  ==
          Southern platyfish  ==
B D                    Medaka  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D               Rock pigeon  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
B D                    Turkey  ==
          Tibetan ground jay  ==
               Domestic goat  --
B D                     Mouse  --
B D                Guinea pig  ==
B D                     Sheep  --
            Tibetan antelope  --
B D                       Cow  --

Inserts between block 18 and 19 in window
  D             Saker falcon 14bp
  D         Peregrine falcon 14bp
  D   White-throated sparrow 12bp
B D      Medium ground finch 12bp
B D                  Chicken 12bp
B D       American alligator 12bp
  D          Green seaturtle 8bp
  D           Painted turtle 8bp

Alignment block 19 of 1179 in window, 47495992 - 47495992, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D                  Bushbaby  -g
           Chinese tree shrew  -a
B D                  Squirrel  -g
       Lesser Egyptian jerboa  -a
                 Prairie vole  -t
B D           Chinese hamster  -g
               Golden hamster  -g
B D                       Rat  -g
B D            Naked mole-rat  -g
                   Chinchilla  -g
             Brush-tailed rat  -g
B D                    Rabbit  -g
B D                      Pika  -g
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Hedgehog  -t
              Star-nosed mole  -a
B D                  Elephant  -a
          Cape elephant shrew  -a
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -a
                     Aardvark  -a
B D                 Armadillo  -a
B D                   Opossum  -g
B D           Tasmanian devil  -g
B D                   Wallaby  -a
B D                  Platypus  -g
B D                    Lizard  -g
B D                 Tetraodon  c-
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D               Stickleback  ==
                 Spotted gar  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  ==
B D                Coelacanth  ==
          Southern platyfish  ==
B D                    Medaka  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D        American alligator  ==
               Domestic goat  --
  D          Peregrine falcon  ==
B D                     Mouse  --
B D                Guinea pig  ==
B D                     Sheep  --
            Tibetan antelope  --
B D                       Cow  --
B D           Squirrel monkey  --

Alignment block 20 of 1179 in window, 47495993 - 47495993, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                       Rat  g
B D            Naked mole-rat  g
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
B D                  Hedgehog  g
              Star-nosed mole  g
B D                  Elephant  t
          Cape elephant shrew  g
B D                   Manatee  t
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  a
B D                  Platypus  a
  D              Saker falcon  a
  D          Peregrine falcon  a
B D                    Turkey  a
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
B D                    Lizard  a
B D                 Tetraodon  a
B D              Nile tilapia  =
                 Zebra mbuna  =
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                Coelacanth  =
          Southern platyfish  =
B D                    Medaka  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
               Big brown bat  -
B D                  Microbat  -
        David's myotis (bat)  -
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                   Chicken  =
          Tibetan ground jay  =
               Domestic goat  -
B D                     Mouse  -
B D                Guinea pig  =
B D                     Sheep  -
            Tibetan antelope  -
B D                       Cow  -
B D           Squirrel monkey  -

Inserts between block 20 and 21 in window
  D             Saker falcon 8bp
  D         Peregrine falcon 8bp

Alignment block 21 of 1179 in window, 47495994 - 47495996, 3 bps 
B D                     Human  ccc
B D                     Chimp  ccc
B D                   Gorilla  ccc
B D                 Orangutan  ccc
B D                    Gibbon  ccc
B D                    Rhesus  ccc
B D       Crab-eating macaque  ccc
B D                    Baboon  ccc
B D              Green monkey  ccc
B D                  Marmoset  ccc
B D                  Bushbaby  ccc
           Chinese tree shrew  ccc
B D                  Squirrel  ccc
       Lesser Egyptian jerboa  act
                 Prairie vole  ccc
B D           Chinese hamster  ccc
               Golden hamster  ccc
B D                       Rat  cgc
B D            Naked mole-rat  ctc
                   Chinchilla  ccc
             Brush-tailed rat  ccc
B D                    Rabbit  ccc
B D                      Pika  ccc
B D                       Pig  atc
B D                    Alpaca  atc
               Bactrian camel  atc
B D                   Dolphin  atc
                 Killer whale  atc
B D                     Horse  gtc
B D          White rhinoceros  atc
B D                       Cat  atc
B D                       Dog  gtc
B D                   Ferret   gtc
B D                     Panda  gcc
               Pacific walrus  atc
                 Weddell seal  atc
             Black flying-fox  atc
B D                   Megabat  atc
B D                  Hedgehog  acc
              Star-nosed mole  acc
B D                  Elephant  atc
          Cape elephant shrew  atc
B D                   Manatee  atc
             Cape golden mole  ctc
B D                    Tenrec  gtc
                     Aardvark  atc
B D                 Armadillo  gtc
B D                   Opossum  tcc
B D           Tasmanian devil  gcc
B D                   Wallaby  tcc
B D                  Platypus  ccc
  D              Saker falcon  ccc
  D          Peregrine falcon  ccc
  D    White-throated sparrow  cac
B D       Medium ground finch  tgc
  D                    Parrot  ccc
  D             Scarlet macaw  ccc
B D                    Turkey  -cc
  D           Green seaturtle  ccc
  D            Painted turtle  ccc
B D                 Tetraodon  acc
B D              Nile tilapia  ===
                 Zebra mbuna  ===
B D               Stickleback  ===
                 Spotted gar  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                      Fugu  ===
B D                Coelacanth  ===
          Southern platyfish  ===
B D                    Medaka  ===
      Yellowbelly pufferfish  ===
B D             X. tropicalis  ===
  D               Rock pigeon  ===
               Big brown bat  ---
B D                  Microbat  ---
        David's myotis (bat)  ---
B D                    Lizard  ---
B D               Zebra finch  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D        American alligator  ---
               Domestic goat  ---
B D                     Mouse  ---
B D                Guinea pig  ===
B D                     Sheep  ---
            Tibetan antelope  ---
B D                       Cow  ---
B D           Squirrel monkey  ---

Inserts between block 21 and 22 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Hedgehog 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 22 of 1179 in window, 47495997 - 47496007, 11 bps 
B D                     Human  attctt--------------g--cta-t
B D                     Chimp  attctt--------------g--cta-t
B D                   Gorilla  attctt--------------g--cta-t
B D                 Orangutan  attcct--------------g--cta-t
B D                    Gibbon  attcct--------------g--cta-t
B D                    Rhesus  attcct--------------g--caa-g
B D       Crab-eating macaque  attcct--------------g--caa-g
B D                    Baboon  attcct--------------g--caa-g
B D              Green monkey  attcct--------------g--caa-g
B D                  Marmoset  attttt--------------g--cta-g
B D           Squirrel monkey  cctctt--------------g--cta-g
B D                  Bushbaby  attcct--------------g--cca-g
B D                  Squirrel  catcct--------------g--tgg-g
       Lesser Egyptian jerboa  gtttcc--------------a--ttc-a
                 Prairie vole  attcct--------------g--ccc-a
B D           Chinese hamster  attcct--------------g--gcc-a
               Golden hamster  attcct--------------g--ccc-g
B D                     Mouse  --ttca--------------g--cca-g
B D                       Rat  a-ttcc--------------a--cc--g
B D            Naked mole-rat  gttccc--------------a--ctt-a
                   Chinchilla  attcct--------------g--ctt-g
             Brush-tailed rat  atccct--------------g--ctt-g
B D                    Rabbit  cttcct--------------g--ctc-g
B D                      Pika  gttccc--------------g--ttc-g
B D                       Pig  atttct--------------g--ctc-a
B D                    Alpaca  actcct--------------g--ctc-a
               Bactrian camel  actcct--------------g--ctc-a
B D                   Dolphin  atttct--------------g--ctc-a
                 Killer whale  atttct--------------g--ctc-a
             Tibetan antelope  atttct--------------g--ctc-g
B D                       Cow  gtttct--------------g--ctc-a
B D                     Sheep  atttct--------------g--ctc-g
                Domestic goat  atttct--------------g--ctc-t
B D                     Horse  acttct--------------t--ttctg
B D          White rhinoceros  attcct--------------a--ctc-g
B D                       Cat  attccc--------------a--cac--
B D                       Dog  actgct--------------g--ctg--
B D                   Ferret   attctg--------------a--ccc--
B D                     Panda  attccg--------------a--ccc--
               Pacific walrus  attccg--------------accccc--
                 Weddell seal  attccg--------------a--ccc--
             Black flying-fox  acgcct--------------g--ctc-g
B D                   Megabat  acgcct--------------g--ctc-g
B D                  Hedgehog  gtccct--------------g--ctc-a
              Star-nosed mole  atttcc--------------a--ctc-a
B D                  Elephant  atttct--------------g--cta-g
          Cape elephant shrew  attttt--------------g--cta-g
B D                   Manatee  attcct--------------g--cta-g
             Cape golden mole  attcct--------------g--cta-g
B D                    Tenrec  ggttct--------------g--cag-g
                     Aardvark  attctt--------------g--ctc-g
B D                 Armadillo  attcc-----------------------
B D                   Opossum  atttat--------------g--gaa-t
B D           Tasmanian devil  atttat--------------a--gca-t
B D                   Wallaby  atttat--------------g--gca-t
B D                  Platypus  gccccc--------------a--cga-t
  D              Saker falcon  agccatgc------------t--ctg-c
  D          Peregrine falcon  agccatgc------------t--ctg-c
  D    White-throated sparrow  tgtgctgctcctgagaggtgc--tgg-t
B D       Medium ground finch  tgtgctgctcccgaggggtgc--tgg-t
  D                    Parrot  agccttgc------------t--ctg-c
  D             Scarlet macaw  agccttgctct---------t--ctg-c
B D                   Chicken  --ttctccttgt--------g--ctg-c
B D                    Turkey  agttctccttgt--------g--ctg-c
B D        American alligator  ----ctgg------------g--ctg-a
  D           Green seaturtle  ag------------------g--ctg-t
  D            Painted turtle  ag------------------g--ctg-t
B D                    Lizard  tgctctcct-----------t--ctg-c
B D                 Tetraodon  agtgtt--------------g--gt---
B D              Nile tilapia  ============================
                 Zebra mbuna  ============================
B D               Stickleback  ============================
                 Spotted gar  ============================
         Pundamilia nyererei  ============================
       Burton's mouthbreeder  ============================
         Princess of Burundi  ============================
B D                      Fugu  ============================
B D                Coelacanth  ============================
          Southern platyfish  ============================
B D                    Medaka  ============================
      Yellowbelly pufferfish  ============================
B D             X. tropicalis  ============================
  D               Rock pigeon  ============================
               Big brown bat  ----------------------------
B D                  Microbat  ----------------------------
        David's myotis (bat)  ----------------------------
B D               Zebra finch  ============================
  D       Collared flycatcher  ============================
  D  Chinese softshell turtle  ============================
  D              Mallard duck  ============================
B D                Budgerigar  ============================
          Tibetan ground jay  ============================
B D                Guinea pig  ============================
          Chinese tree shrew  ----------------------------

Alignment block 23 of 1179 in window, 47496008 - 47496035, 28 bps 
B D                     Human  gttgctc-------t----------atcttcca--c-------------gtcc-aaa-------------
B D                     Chimp  gttgctc-------t----------atcttcca--c-------------gtcc-aaa-------------
B D                   Gorilla  gttgctc-------t----------atcttcca--c-------------gtcc-aaa-------------
B D                 Orangutan  gttgctc-------t----------atcttcca--c-------------gtcc-aaa-------------
B D                    Gibbon  gttgctc-------t----------atcttcca--t-------------gtcc-aaa-------------
B D                    Rhesus  gttgctc-------t----------atcttcca--c-------------atcc-aaa-------------
B D       Crab-eating macaque  gttgctc-------t----------atcttcca--c-------------atcc-aaa-------------
B D                    Baboon  gttgctc-------t----------atcttcca--c-------------atcc-aaa-------------
B D              Green monkey  gttgttc-------t----------atcttcca--c-------------gtcc-aaa-------------
B D                  Marmoset  gttgtgt-------t----------atcttcca--c-------------atcc-aaa-------------
B D           Squirrel monkey  gttgtgc-------t----------accttcca--c-------------gtcc-aaa-------------
B D                  Bushbaby  gttgctt-------t----------atcttcta--c-------------atcc-gag-------------
           Chinese tree shrew  -----------------------------------c-------------atct-gaa-------------
B D                  Squirrel  gctgctt-------t----------gtcttcca--c-------------atcc--ca-------------
       Lesser Egyptian jerboa  gatgctttatgcttt----------atgttcca--t-------------atcc-aaa-------------
                 Prairie vole  gctgctt-------t----------gtcttcca--c-------------at-c--aa-------------
B D           Chinese hamster  tctgctt-------t----------atcttcca--c-------------acac--aa-------------
               Golden hamster  gatgctt-------t----------atcttcca--c-------------acac--aa-------------
B D                     Mouse  ggtgctt---------------------------------------------c--tt-------------
B D                       Rat  ggtgctt-------t----------atcttcca--c-------------accc--ac-------------
B D            Naked mole-rat  g--ccc--------t----------attgtcca--c-------------accc-act-------------
                   Chinchilla  g--ccca-------t----------attgtcca--c-------------agcc-aca-------------
             Brush-tailed rat  g-tcctg-------t----------attgtcca--t-------------gtc---ca-------------
B D                    Rabbit  gttgctt-------t----------atcttcca-----------------tgt-ccg-------------
B D                      Pika  gacgcgc-------c----------accttcca--c-------------ctct-ctg-------------
B D                       Pig  gttgctt-------t----------atctttgc--a-------------tcc--aaa-------------
B D                    Alpaca  gttgctt-------t----------atctttca--c-------------tcc--aaa-------------
               Bactrian camel  gttgctt-------t----------atctttca--c-------------tcc--aaa-------------
B D                   Dolphin  gttgctt-------t----------atctttca--c-------------aact-aaa-------------
                 Killer whale  gttgctt-------t----------atctttca--c-------------aact-aaa-------------
             Tibetan antelope  gttgctt-------t---------aatctttca--c-------------caccaaaa-------------
B D                       Cow  gttgctt-------g----------atctttca--c-------------caccaaaa-------------
B D                     Sheep  gttgctt-------t----------atctttca--c-------------caccaaaa-------------
                Domestic goat  gttgctt-------t----------atctttca--c-------------caccaaaa-------------
B D                     Horse  gtcgctt-------t----------atctttca--c-------------atct-g-c-------------
B D          White rhinoceros  gttgctt-------t----------atctttca--c-------------atct-gaa-------------
B D                       Cat  gttgttt-------c----------atctttca--c-------------atct-gaa-------------
B D                       Dog  gatgctt-------t----------atctttca--t-------------gtct-gaa-------------
B D                   Ferret   atcgctc-------t----------atctttca--c-------------atct-gaa-------------
B D                     Panda  gtcgctt-------t----------atcgttca--c-------------atct-gaa-------------
               Pacific walrus  gtcgctt-------t----------atctttca--c-------------atct-gaa-------------
                 Weddell seal  gtcgctt-------t----------atctttca--c-------------atct-gaa-------------
             Black flying-fox  gtcgctt-------t----------atcttccg--c-------------acct-gaa-------------
B D                   Megabat  gtcgctt-------t----------atcttccg--c-------------acct-gaa-------------
                Big brown bat  --tgctt-------c----------accctccg--t-------------g-tc-cga-------------
         David's myotis (bat)  --tgctt-------c----------accctccg--t-------------g--a-gga-------------
B D                  Microbat  --tgctt-------c----------accctccg--t-------------g--a-gga-------------
B D                  Hedgehog  gtccttt-------c----------atcttcca--c-------------atcc-ca--------------
              Star-nosed mole  gcggctt-------t----------atctttta--c-------------acct-gag-------------
B D                  Elephant  gctgctt-------t----------acctttca--t--------taaaaaaaa-aaa-------------
          Cape elephant shrew  gcagc------------------------ttca--t--------taaaaaaat-gaaaattttaaaaacc
B D                   Manatee  gttgctt-------t----------atctttca--t--------taaaaaaaa-aag-------------
             Cape golden mole  gttgcgt-------------------cctttca--taaaacaaacaaacaaac-aaa-------------
B D                    Tenrec  gctcctt-------t----------ctctttca--t-------------aaac-aca-------------
                     Aardvark  gttgttt-------t----------atctttca--t--------taaaataaa-aaa--ttttaaaaata
B D                 Armadillo  ------------------------------------------------------aaa-------------
B D                   Opossum  g--gcct-------t----------ttctccca--a---------------ct-gag-------------
B D           Tasmanian devil  g--gtct-------t----------ttcttttc--a-------------gtct-gag-------------
B D                   Wallaby  g--gctt-------t----------ttctctca--a-------------gtct-gag-------------
B D                  Platypus  gtcccgt-------t---------aagcctcca--t-------------ggcg-ggg-------------
  D              Saker falcon  attgctc-------t----------caca-----------------------------------------
  D          Peregrine falcon  attgctc-------t----------caca-----------------------------------------
  D    White-throated sparrow  ggtgctt-------c----------tgca-----------------------------------------
B D       Medium ground finch  ggtgctt-------c----------taca-----------------------------------------
  D                    Parrot  attgctg-------t----------tgca-----------------------------------------
  D             Scarlet macaw  attgctc-------t----------tgca-----------------------------------------
B D                   Chicken  ggtgctc-------t----------caca-----------------------------------------
B D                    Turkey  agtgctc-------t----------caca-----------------------------------------
B D        American alligator  gctgctg-------c----------caca-----------------------------------------
  D           Green seaturtle  attgctg-------g----------catc-----------------------------------------
  D            Painted turtle  attgctg-------g----------catc-----------------------------------------
B D                    Lizard  atttctc-------tggatgctgcgtgca-----------------------------------------
B D                 Tetraodon  gttgctc-------c----------gaagcccacgc-------------cgcc-gtc-------------
                  Spotted gar  ggtgttc-------a----------acaggcca--t-------------ttcc-agg-------------
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  --------aaca
                        Chimp  --------aaca
                      Gorilla  --------aaca
                    Orangutan  --------aaca
                       Gibbon  --------aaca
                       Rhesus  --------aaca
          Crab-eating macaque  --------aaca
                       Baboon  --------aaca
                 Green monkey  --------aaca
                     Marmoset  --------aaca
              Squirrel monkey  --------aaca
                     Bushbaby  --------aaca
           Chinese tree shrew  --------aaca
                     Squirrel  --------aaca
       Lesser Egyptian jerboa  --------aaca
                 Prairie vole  --------aacc
              Chinese hamster  --------aacc
               Golden hamster  --------aacc
                        Mouse  --------aact
                          Rat  --------agct
               Naked mole-rat  --------gagc
                   Chinchilla  --------gaga
             Brush-tailed rat  --------gtga
                       Rabbit  --------aaca
                         Pika  --------agca
                          Pig  --------aaca
                       Alpaca  --------aata
               Bactrian camel  --------aata
                      Dolphin  --------aata
                 Killer whale  --------aata
             Tibetan antelope  --------aaca
                          Cow  --------aata
                        Sheep  --------aaca
                Domestic goat  --------aaca
                        Horse  --------aata
             White rhinoceros  --------aata
                          Cat  --------aaca
                          Dog  --------aaca
                      Ferret   --------aatg
                        Panda  --------gaca
               Pacific walrus  --------aacg
                 Weddell seal  --------aacg
             Black flying-fox  --------aaca
                      Megabat  --------aaca
                Big brown bat  --------aacc
         David's myotis (bat)  --------aacc
                     Microbat  --------aacc
                     Hedgehog  --------aact
              Star-nosed mole  --------aaca
                     Elephant  --------aaca
          Cape elephant shrew  agctgtacaata
                      Manatee  -----------a
             Cape golden mole  --------aata
                       Tenrec  --------aacg
                     Aardvark  tata----aaaa
                    Armadillo  --------aata
                      Opossum  --------aaaa
              Tasmanian devil  --------a--a
                      Wallaby  --------aata
                     Platypus  --------agcg
                 Saker falcon  ------------
             Peregrine falcon  ------------
       White-throated sparrow  ------------
          Medium ground finch  ------------
                       Parrot  ------------
                Scarlet macaw  ------------
                      Chicken  ------------
                       Turkey  ------------
           American alligator  ------------
              Green seaturtle  ------------
               Painted turtle  ------------
                       Lizard  ------------
                    Tetraodon  --------ac--
                  Spotted gar  --------aa--
                 Nile tilapia  ============
                  Zebra mbuna  ============
                  Stickleback  ============
          Pundamilia nyererei  ============
        Burton's mouthbreeder  ============
          Princess of Burundi  ============
                         Fugu  ============
                   Coelacanth  ============
           Southern platyfish  ============
                       Medaka  ============
       Yellowbelly pufferfish  ============
                X. tropicalis  ============
                  Rock pigeon  ============
                  Zebra finch  ============
          Collared flycatcher  ============
     Chinese softshell turtle  ============
                 Mallard duck  ============
                   Budgerigar  ============
           Tibetan ground jay  ============
                   Guinea pig  ============

Inserts between block 23 and 24 in window
  D   White-throated sparrow 7bp
B D      Medium ground finch 7bp
B D       American alligator 33bp
  D          Green seaturtle 47bp
  D           Painted turtle 47bp
B D                   Lizard 13bp

Alignment block 24 of 1179 in window, 47496036 - 47496060, 25 bps 
B D                     Human  ---------gtc--c-ta-------tgtagcttcagctgctccg
B D                     Chimp  ---------gtc--c-ta-------tgtagcttcagctgctccg
B D                   Gorilla  ---------gtc--c-ta-------tgtagcttcagctgctccg
B D                 Orangutan  ---------gtc--c-ta-------tgtagcttcagctgctcca
B D                    Gibbon  ---------gtc--c-ta-------tgtagcttcagctgctccg
B D                    Rhesus  ---------gtc--c-ta-------catagcttcagctgctccc
B D       Crab-eating macaque  ---------gtc--c-ta-------catagcttcagctgctccc
B D                    Baboon  ---------gtc--c-ta-------cgtagcttcagctgctccc
B D              Green monkey  ---------gtc--c-ta-------cgtagctttagctgctccc
B D                  Marmoset  ---------gtc--c-ca-------tgtagctttagctgctccg
B D           Squirrel monkey  ---------gtc--c-ca-------tgtagcttcagctgctccg
B D                  Bushbaby  ---------gtc--c-aa-------ggtagcttcagct-cccct
           Chinese tree shrew  ---------gtc--c-cg-------ggtagcttcagcggcctgt
B D                  Squirrel  ---------gtc--c-aa-------agtagccttggttgcccct
       Lesser Egyptian jerboa  ---------gtt--c-aa-------agtagtgttagctgcttct
                 Prairie vole  ---------atc--c-aa-------agtcactt-agttgtcccc
B D           Chinese hamster  ---------acc--c-ca-------agtcactttagttgtctcc
               Golden hamster  ---------acc--c-aa-------agtcacttcagttgtctcc
B D                     Mouse  ---------gtc--c-aa-------agtcacttcagttgtccca
B D                       Rat  ---------gtc--c-aa-------agtcacttcggttgtccgg
B D            Naked mole-rat  ---------gtc--c-at-------cctggtttccgtggccccc
                   Chinchilla  ---------gtc--c-aa-------cacggccttagtggccccc
             Brush-tailed rat  ---------gtc--c-ag-------catagccttagtggctccc
B D                    Rabbit  ---------gtc--c-ga-------ggtagcttcagctgctcct
B D                      Pika  ---------gtc--a-ag-------ggca-caccaactatttgt
B D                       Pig  ---------acc--c-aa-------ggtaacttcagctgcccct
B D                    Alpaca  ---------gtc--c-aa-------agtggctgcagctgcctct
               Bactrian camel  ---------gtc--c-ag-------agtagctgcagctgcctct
B D                   Dolphin  ---------gtc--c-aa-------ggtagcttcagctgcccct
                 Killer whale  ---------gtc--c-aa-------ggtagcctcagctgcccct
             Tibetan antelope  ---------gtc--c-ca-------ggtagcttcaaccacccct
B D                       Cow  ---------gt---c-ca-------ggtagcttcagccgcccct
B D                     Sheep  ---------gtc--c-ca-------ggtagcttcaaccacccct
                Domestic goat  ---------gtc--c-ca-------ggtagcttcaaccacccct
B D                     Horse  ---------gtt----aa-------agtatccgcacctgcctct
B D          White rhinoceros  ---------gtc----aa-------ggtatctgcagctgcctct
B D                       Cat  ---------gtc--c-aa-------ggtagctacatttgcccct
B D                       Dog  ---------ctc--g-aa-------ggtcaccacgtttgcttct
B D                   Ferret   ---------gtc--c-aa-------ggtcactccatgtgctcct
B D                     Panda  ---------gtc--c-aa-------ggtcatgacatgggctcct
               Pacific walrus  ---------gtc--c-aa-------ggtcgctctgtgtgctcct
                 Weddell seal  ---------gtc--c-aa-------ggtcgctctgtgtgctcct
             Black flying-fox  ---------gcc--t-g--------------tcagtc-gcccct
B D                   Megabat  ---------gcc--t-g--------------tcagtc-gcccct
                Big brown bat  ---------gcc--c-gg-------gg--gctccgtctgccctt
         David's myotis (bat)  ---------gcc--cggg-------gg--gctctgcctgcccct
B D                  Microbat  ---------gcc----gg-------gg--gctccgtctgccccg
B D                  Hedgehog  ---------gtc--c-g--------------tctcagcggcctt
              Star-nosed mole  ---------gtc--c-aa-------ggtggcttccgttgtccct
B D                  Elephant  ---------gtc--c-aa-------ggtagctctcactgtccct
          Cape elephant shrew  ---------gtc--c-aa-------ggtagctgtcactgccttt
B D                   Manatee  ---------gtc--c-aa-------ggtagctctcactgcccct
             Cape golden mole  ---------gtc--c-aa-------ggtagctgtcactgccct-
B D                    Tenrec  ---------gtc--c-ca-------ggctgctggcgctggcctg
                     Aardvark  ---------gtc--c-ac-------catagttctcactacccct
B D                 Armadillo  ---------gct--c-aa-------ggtagtttcagctgcccct
B D                   Opossum  ---------gtcagg-at-------gtcactttccacagtccaa
B D           Tasmanian devil  ---------gtcagc-at-------gtcacttttcatagtccaa
B D                   Wallaby  ---------gtcagc-at-------gtcactattcacagtccaa
B D                  Platypus  ---------ggc--g-gg-------gg--gctaccggccccccg
  D              Saker falcon  ---------gcg--g-tg-------tgcagtatc-acag-----
  D          Peregrine falcon  ---------gcg--g-tg-------tgcagtatc-acag-----
  D    White-throated sparrow  ---------gga--c-tg---gcactgcaggctctgcagt----
B D       Medium ground finch  ---------gga--c-tg---tcactccaggctctgcagt----
B D                Budgerigar  ---------gca--c-tg-------tgctgtatt-gcagc----
  D                    Parrot  ---------gta--c-tg-------tgcagtatc-gcagc----
  D             Scarlet macaw  ---------gta--c-tg-------tgcagtatc-gcagc----
B D                   Chicken  ---------gct--c-tg-------tgtggtatc-actgc----
B D                    Turkey  ---------gct--c-tg-------tgtggtatc-actgc----
B D        American alligator  ---------tct--c-tg------ccccaggcct-ccaa-----
  D           Green seaturtle  ---------gtc--c-tg-------cactgaatt----------
  D            Painted turtle  ---------gtc--c-tg-------tgctgaatt----------
B D                    Lizard  ---------gcc--t-tgtcctccctgcagt-------------
B D                 Tetraodon  gtg-cagcggca--g-ga-------ggcagctgtg---------
                  Spotted gar  gtgccaggggca--a-at-------ccaagttgtg---------
B D              Nile tilapia  ============================================
                 Zebra mbuna  ============================================
B D               Stickleback  ============================================
         Pundamilia nyererei  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
B D                      Fugu  ============================================
B D                Coelacanth  ============================================
          Southern platyfish  ============================================
B D                    Medaka  ============================================
      Yellowbelly pufferfish  ============================================
B D             X. tropicalis  ============================================
  D               Rock pigeon  ============================================
B D               Zebra finch  ============================================
  D       Collared flycatcher  ============================================
  D  Chinese softshell turtle  ============================================
  D              Mallard duck  ============================================
          Tibetan ground jay  ============================================
B D                Guinea pig  ============================================

Inserts between block 24 and 25 in window
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D          Green seaturtle 8bp
  D           Painted turtle 8bp
                 Spotted gar 2bp

Alignment block 25 of 1179 in window, 47496061 - 47496064, 4 bps 
B D                     Human  aaat--
B D                     Chimp  aaat--
B D                   Gorilla  aaat--
B D                 Orangutan  aaat--
B D                    Gibbon  aaat--
B D                    Rhesus  aaat--
B D       Crab-eating macaque  aaat--
B D                    Baboon  aaat--
B D              Green monkey  aaat--
B D                  Marmoset  aaat--
B D           Squirrel monkey  aaat--
B D                  Bushbaby  aaat--
           Chinese tree shrew  aaag--
B D                  Squirrel  aaat--
       Lesser Egyptian jerboa  aaac--
                 Prairie vole  aa-c--
B D           Chinese hamster  aatc--
               Golden hamster  aaac--
B D                     Mouse  aa-t--
B D                       Rat  aa-t--
B D            Naked mole-rat  aaat--
                   Chinchilla  aaat--
             Brush-tailed rat  agct--
B D                    Rabbit  aagt--
B D                      Pika  caag--
B D                       Pig  aaat--
B D                    Alpaca  aaat--
               Bactrian camel  aaat--
B D                   Dolphin  aaat--
                 Killer whale  aaat--
             Tibetan antelope  aaat--
B D                       Cow  aaat--
B D                     Sheep  aaat--
                Domestic goat  aaat--
B D                     Horse  ac-t--
B D          White rhinoceros  aagt--
B D                       Cat  ccat--
B D                       Dog  caat--
B D                   Ferret   caat--
B D                     Panda  caat--
               Pacific walrus  caat--
                 Weddell seal  caat--
             Black flying-fox  caac--
B D                   Megabat  caac--
                Big brown bat  c-----
         David's myotis (bat)  c-----
B D                  Microbat  c-----
B D                  Hedgehog  cagt--
              Star-nosed mole  aagt--
B D                  Elephant  aaat--
          Cape elephant shrew  aaag--
B D                   Manatee  aaat--
             Cape golden mole  -taa--
B D                    Tenrec  acag--
                     Aardvark  aaat--
B D                 Armadillo  aaat--
B D                   Opossum  agat--
B D           Tasmanian devil  agat--
B D                   Wallaby  agat--
B D                  Platypus  gggc--
                  Spotted gar  --gtat
B D              Nile tilapia  ======
                 Zebra mbuna  ======
B D                 Tetraodon  ------
B D               Stickleback  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                      Fugu  ======
B D                Coelacanth  ======
          Southern platyfish  ======
B D                    Medaka  ======
      Yellowbelly pufferfish  ======
B D             X. tropicalis  ======
  D               Rock pigeon  ======
  D    White-throated sparrow  ------
  D             Scarlet macaw  ------
  D                    Parrot  ------
  D            Painted turtle  ======
B D                    Lizard  ------
B D               Zebra finch  ======
B D       Medium ground finch  ------
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
  D              Saker falcon  ======
  D           Green seaturtle  ======
  D              Mallard duck  ======
B D                Budgerigar  ------
B D                    Turkey  ------
B D                   Chicken  ------
          Tibetan ground jay  ======
B D        American alligator  ------
  D          Peregrine falcon  ======
B D                Guinea pig  ======

Alignment block 26 of 1179 in window, 47496065 - 47496067, 3 bps 
B D                     Human  --cag
B D                     Chimp  --cag
B D                   Gorilla  --cag
B D                 Orangutan  --cag
B D                    Gibbon  --cag
B D                    Rhesus  --cag
B D       Crab-eating macaque  --cag
B D                    Baboon  --cag
B D              Green monkey  --cag
B D                  Marmoset  --cag
B D           Squirrel monkey  --cag
B D                  Bushbaby  --cag
           Chinese tree shrew  --cag
B D                  Squirrel  --cag
       Lesser Egyptian jerboa  --cag
                 Prairie vole  --cag
B D           Chinese hamster  --cag
               Golden hamster  --cag
B D                     Mouse  --cag
B D                       Rat  --tag
B D            Naked mole-rat  --ctg
                   Chinchilla  --ccg
             Brush-tailed rat  --ctg
B D                    Rabbit  --cag
B D                      Pika  --caa
B D                       Pig  --cag
B D                    Alpaca  --cag
               Bactrian camel  --cag
B D                   Dolphin  --cag
                 Killer whale  --cag
             Tibetan antelope  --cag
B D                       Cow  --cag
B D                     Sheep  --cag
                Domestic goat  --cag
B D                     Horse  --gag
B D          White rhinoceros  --gag
B D                       Cat  --cag
B D                       Dog  --cag
B D                   Ferret   --cag
B D                     Panda  --cag
               Pacific walrus  --cag
                 Weddell seal  --cag
             Black flying-fox  --cag
B D                   Megabat  --cag
                Big brown bat  ---gg
         David's myotis (bat)  ---gg
B D                  Microbat  ----g
B D                  Hedgehog  --cag
              Star-nosed mole  --cag
B D                  Elephant  --tag
          Cape elephant shrew  --cag
B D                   Manatee  --cag
             Cape golden mole  --taa
B D                    Tenrec  --cgc
                     Aardvark  --cag
B D                 Armadillo  --cag
B D                   Opossum  --caa
B D           Tasmanian devil  --caa
B D                   Wallaby  --caa
B D                  Platypus  --ccg
  D               Rock pigeon  --cag
B D        American alligator  ----g
  D           Green seaturtle  ----g
  D            Painted turtle  ----g
B D                    Lizard  --cag
B D                 Tetraodon  -gcag
B D               Stickleback  ---ag
                  Spotted gar  cgcag
B D              Nile tilapia  =====
                 Zebra mbuna  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                      Fugu  =====
B D                Coelacanth  =====
          Southern platyfish  =====
B D                    Medaka  =====
      Yellowbelly pufferfish  =====
B D             X. tropicalis  =====
  D    White-throated sparrow  -----
  D             Scarlet macaw  -----
  D                    Parrot  -----
B D               Zebra finch  =====
B D       Medium ground finch  -----
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
  D              Saker falcon  =====
  D              Mallard duck  =====
B D                Budgerigar  -----
B D                    Turkey  -----
B D                   Chicken  -----
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
B D                Guinea pig  =====

Inserts between block 26 and 27 in window
  D          Green seaturtle 3bp
  D           Painted turtle 3bp
B D                Tetraodon 3bp
B D              Stickleback 5bp

Alignment block 27 of 1179 in window, 47496068 - 47496068, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  c
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  g
B D                  Platypus  g
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  g
B D                   Chicken  a
B D                    Turkey  a
B D        American alligator  a
B D                 Tetraodon  g
           Southern platyfish  g
B D               Stickleback  a
                  Spotted gar  a
B D              Nile tilapia  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                Coelacanth  =
B D                    Medaka  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D            Painted turtle  =
B D                    Lizard  -
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
B D                Guinea pig  =

Inserts between block 27 and 28 in window
B D                 Platypus 1bp
B D                Tetraodon 11bp

Alignment block 28 of 1179 in window, 47496069 - 47496072, 4 bps 
B D                     Human  tcac
B D                     Chimp  tcac
B D                   Gorilla  tcac
B D                 Orangutan  tcac
B D                    Gibbon  tcac
B D                    Rhesus  tcac
B D       Crab-eating macaque  tcac
B D                    Baboon  tcac
B D              Green monkey  tcac
B D                  Marmoset  tcac
B D           Squirrel monkey  tcac
B D                  Bushbaby  tcac
           Chinese tree shrew  tcac
B D                  Squirrel  tcac
       Lesser Egyptian jerboa  tcac
                 Prairie vole  tcac
B D           Chinese hamster  tcaa
               Golden hamster  tcac
B D                     Mouse  tcac
B D                       Rat  tcac
B D            Naked mole-rat  tcac
                   Chinchilla  tcac
             Brush-tailed rat  tcac
B D                    Rabbit  tcac
B D                      Pika  tcac
B D                       Pig  tcac
B D                    Alpaca  tcac
               Bactrian camel  tcac
B D                   Dolphin  tcac
                 Killer whale  tcac
             Tibetan antelope  tcac
B D                       Cow  tcac
B D                     Sheep  tcac
                Domestic goat  tcac
B D                     Horse  tcac
B D          White rhinoceros  tcac
B D                       Cat  tcac
B D                       Dog  tcac
B D                   Ferret   tcac
B D                     Panda  tcac
               Pacific walrus  tcac
                 Weddell seal  tcac
             Black flying-fox  tcac
B D                   Megabat  tcac
                Big brown bat  tcac
         David's myotis (bat)  tcac
B D                  Microbat  tcac
B D                  Hedgehog  tcac
              Star-nosed mole  tcac
B D                  Elephant  tcac
          Cape elephant shrew  tcag
B D                   Manatee  tcac
             Cape golden mole  tcac
B D                    Tenrec  tcac
                     Aardvark  tcac
B D                 Armadillo  tcac
B D                   Opossum  tcac
B D           Tasmanian devil  tcac
B D                   Wallaby  tcac
B D                  Platypus  tcac
  D               Rock pigeon  tcac
  D              Saker falcon  tcac
  D          Peregrine falcon  tcac
  D       Collared flycatcher  tcac
  D    White-throated sparrow  tcac
B D       Medium ground finch  tcac
B D               Zebra finch  tcac
           Tibetan ground jay  tcac
B D                Budgerigar  tcac
  D                    Parrot  tcac
  D             Scarlet macaw  tcac
  D              Mallard duck  tcac
B D                   Chicken  tcac
B D                    Turkey  tcac
B D        American alligator  tcac
  D           Green seaturtle  tcac
  D            Painted turtle  tcac
  D  Chinese softshell turtle  tcac
B D             X. tropicalis  tcag
B D                 Tetraodon  ctag
B D                      Fugu  ttag
       Yellowbelly pufferfish  ttag
           Southern platyfish  ttaa
B D               Stickleback  ctag
                  Spotted gar  tcaa
B D              Nile tilapia  ====
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                Coelacanth  ====
B D                    Medaka  ====
B D                    Lizard  ----
B D                Guinea pig  ====

Alignment block 29 of 1179 in window, 47496073 - 47496134, 62 bps 
B D                     Human  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                     Chimp  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                   Gorilla  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                 Orangutan  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                    Gibbon  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                    Rhesus  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D       Crab-eating macaque  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                    Baboon  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D              Green monkey  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttatact
B D                  Marmoset  aga--------acagcaggagacattcctttggcaaaaaatgacacgcttctgtcct-gtatcttatact
B D           Squirrel monkey  aga--------acagcaggagacattcctttggcaaaaaaggacacgcttctgtcct-gtatcttatact
B D                  Bushbaby  aga--------acagcaggagacattcctttggcgaaaaaggacacattcttgtcct-gtatcttatact
           Chinese tree shrew  aga--------atggcaggagacattcctttggcaaaaaaggtcacgctcttgtcct-gtatcttgtact
B D                  Squirrel  aga--------acagcaggagacattcctttggcaaaaaaggacacactcttatcct-gtatcttatatt
       Lesser Egyptian jerboa  aga--------atagcaggagacattcctttggcaaaaaaggacacattcttgtcct-gtatcttgtact
                 Prairie vole  aga--------atagcaggagacattcccttggcaaaaaaggacacatttttatcct-gtatcttgtatt
B D           Chinese hamster  agg--------atagcaggagacattcccttggcgaaaaaggacacattcttgtcct-gtatcttgtatt
               Golden hamster  aga--------acagcaggagacattcccttggcaaaaaaggacacattcttgtcct-gtatcttgtatt
B D                     Mouse  aga--------acagcaggagacattcctttggcaaaaaaggacacattcttgtcct-gtatcttgtatt
B D                       Rat  aga--------acagcacgagacattcctttggcaaaaaaggacacattcttatcct-gtatcttgtatt
B D            Naked mole-rat  aga--------acagcaggagaaaggcctttggcaaaaaaggatgcagtcttgtcct-gtatcttgtact
                   Chinchilla  aga--------acagcaggagacaagcctttggcaaagaaggacacagtcttgtcct-gtatcttgtact
             Brush-tailed rat  agg--------acagcaggagacaagcctttggcgaagaaggacacagtcttgtcct-gtatcttgtact
B D                    Rabbit  agg--------atggcaggagacattcctcttgcgaaaaaggacacattcttgtcct-gtatcttgtact
B D                      Pika  agc--------actgccggagacattcctttggcgaaaaataacacgttcttatcct-ggatcttgtact
B D                       Pig  agg--------acagcaggagacattcctttggcaaaaaaggacacgttcttgtcct-gtatcttgtact
B D                    Alpaca  aga--------acagcaggagacattcctttggcaaaaaaggacacgctcttgtcct-gtatcttgtact
               Bactrian camel  aga--------acagcaggagacattcctttggcaaaaaaggacacgctcttgtcct-gtatcttgtact
B D                   Dolphin  aga--------acagcaggagacattcctttggcaaaaaaggacacattcttgtcct-gtatcttgtact
                 Killer whale  aga--------acagcaggagacattcctttggcaaaaaaggacacatttttgtcct-gtatcttgtact
             Tibetan antelope  aga--------acagcaggagacattcctttggcgaaaaaggacacactcttgtcct-gtatcttgtact
B D                       Cow  aga--------acagcaggagacattcctttggcgaaaaaggatacactcttgtcct-gtatcttgtact
B D                     Sheep  aga--------acagcaggagacattcctttggcgaaaaaggacacactcttgtcct-gtatcttgtact
                Domestic goat  aga--------acagcaggagacattcctttggcgaaaaaggacacactcttgtcct-gtatcttgtact
B D                     Horse  aga--------acagcaggagacattcctttggcgaaaaaggacacactcttgtcct-gtatcttgtact
B D          White rhinoceros  aga--------acagcaggagacattcctttggcgaaaaaggacacactcttgtcct-gtatcttgtact
B D                       Cat  aga--------acagcaggagacattcctttggcaaaaaaggacacgctcttgtcct-gtatcttgtact
B D                       Dog  aga--------atagcaggagacattcctttggcaaaaaaggacacactcttgtcct-gtatcttatact
B D                   Ferret   aga--------acagcaggagacattcctttggcaaaaaaggacacacttttgtcct-gtatcttgtact
B D                     Panda  aga--------acagccggggacattcctttagcaaaaaaggacacgctcttgtcct-gtatcttgtact
               Pacific walrus  aga--------acagcaggagacattcctttggcaaaaaaggacacacttttgtcct-gtatcttgtact
                 Weddell seal  aga--------acagcaggagacatccctttggcaaaaaaggacacacttttgtcct-gtatcttgtact
             Black flying-fox  aga--------acagcaggagacattcctttggcgaagaaggacacggtcttgtcct-gtattttgtact
B D                   Megabat  aga--------acagcaggagacattcctttggcaaagaaggacacggtcttgtcct-gtatcttgtact
                Big brown bat  aga--------accgctggcgacattcctttggcgaaaaaggacacgctcttgtcct-ggatcttgtact
         David's myotis (bat)  aga--------accgcaggggacagtcctttggcgaaaaaggccacgctcttgtcct-ggatcttgtact
B D                  Microbat  aga--------accgcaggagacattcctttggcgaaaaaggacacgctcttgtcct-ggatcttgtact
B D                  Hedgehog  aga--------acagcaggagccagtcctttagcaaaaaaggacacgttcttgtcct-gtatcttgtact
              Star-nosed mole  agg--------acagcaggagacattcctttggcaaaaaaggacacgcttttgtcct-gtatcttgtact
B D                  Elephant  aga--------acagcaggagacattcctctggcaaaaaaggacacgttcttgtctt-gtatcttgtact
          Cape elephant shrew  aga--------atagcaggagacagtcctcgggcaaaaaaggacacactcttatcct-ggatcttgtact
B D                   Manatee  aga--------acagcaggggacattcctctggcaaaaaaggacacgttcttgtcct-gtatcttgtact
             Cape golden mole  aga--------acagcaggagacattcctctggcaaaaaaggacacagtcttatcct-gtatcttgtatt
B D                    Tenrec  aga--------acagcaggggacatccctctggcaaaaaaggacacgttcttgtctt-gtatcttgtact
                     Aardvark  aaa--------acagcaggagacattcctttggcaaaaaaggacacgttcttgtcct-gtatcttgtact
B D                 Armadillo  aga--------acagcaggagacattcctctggcaaaaaaggaaacgttcttgtcct-gtatcttgtact
B D                   Opossum  agc--------acagcaggagacagtcctctggcaaagaaggtcacacttttgtctt-gtattttgtatt
B D           Tasmanian devil  agc--------acagcaggagatagtcctttagcaaagaaggtcacattcttatcct-gtattttgtatt
B D                   Wallaby  agc--------acagcaggagatagtcctttagcaaagaaggtcacactcttgtcat-gtattttgtatt
B D                  Platypus  agc--------acggcggctgacttcccccgggagaacaacgagacgctcttgtcctgggattttatact
  D               Rock pigeon  agg--------acggcagctgacagccctctagcgaaaaaggtgacgttcttgtcct-ggatcttatact
  D              Saker falcon  agg--------actgcagctgacagccctctagcaaaaaaggtgacattcttgtcct-gaatcttatact
  D          Peregrine falcon  agg--------actgcagctgacagccctctagcaaaaaaggtgacattcttgtcct-gaatcttatact
  D       Collared flycatcher  agg--------actgcagccgacagcccccgcgcgaaaaaggtgacgttcctgtcct-ggatcttgtact
  D    White-throated sparrow  agtgtcacagcactgcagccgacagcccccgtgcaaagaaggtgacgttcctgtcct-ggatcttgtact
B D       Medium ground finch  agg--------actgcagccgacagccccggtgcaaagaaggtgacgttcctgtcct-ggatcttgtact
B D               Zebra finch  agg--------accgcaaccgacagcccccgtgcgaaaaaggagacgttcctgtcct-ggatcttgtact
           Tibetan ground jay  agg--------accgcagccgacagcccccgtgcgaaaaaggtgacgttcctgtcct-ggatcttgtact
B D                Budgerigar  agg--------actgcagctgacagccccctagcaaaaaaggtgacattcttgtcct-ggatcttgtact
  D                    Parrot  agg--------actgcggctgacagccccctagcaaaaaaggtgacgttcttgtcct-ggatcttgtact
  D             Scarlet macaw  agg--------actgcggctgacagccccctagcaaaaaaggtgacgttcttgtcct-ggatcttgtact
  D              Mallard duck  agc--------acggctgcagaaagccccctcgcgaagaagctgacgttcttctcct-ggatcttgtact
B D                   Chicken  agg--------acagcagctgacagccctctagcaaaaaaggtgacattcttgtcct-ggatcttgtact
B D                    Turkey  agg--------acagcagctgacagccctctagcaaaaaaggtgacattcttgtcct-ggatcttgtatt
B D        American alligator  agc--------acggccgcggacatccctctggcgaagaacgtgacattcctgtcct-gaattttgtact
  D           Green seaturtle  aac--------acagctactgacattcctctggcaaaaaatgtgacattcttgtcct-gaattttatact
  D            Painted turtle  aac--------acagctgctgacatccctctggcaaaaaatgtgacattcttgtcct-gaattttatact
  D  Chinese softshell turtle  aac--------acagctgctgacattcctctggcaaaaaatgtgacattcttgtcct-gaattttatact
B D                    Lizard  agc--------acggctgccgacatccccctggcgaagaaggagacgttcttgtcct-ggatcttgtact
B D             X. tropicalis  agc--------acagccgccgacagccctctggcgaaaaacgtgacgtgtttgtcct-ggatcttgtact
B D                 Tetraodon  aga--------acagcgctggaggtcccacgagcgaaaaaggacgctcctttgtcgt-ggaccttgtact
B D                      Fugu  aga--------acagcgctggaggtcccgcgagcaaagaaggatgcccctttatcgt-ggactttgtact
       Yellowbelly pufferfish  aga--------acagcgctggaggtcccgcgagcaaagaaggatgcccctttatcgt-ggactttgtact
B D              Nile tilapia  aga--------acagcactggatgtcccaggagcaaagaaggaagcgcctttattgt-ggaccttgtact
          Princess of Burundi  aga--------acagcactggatgtcccaggagcaaagaaggaggctcctttatcgt-ggaccttgtact
        Burton's mouthbreeder  aga--------acagcgctggatgtcccaggagcaaagaaggaggctcctttatcgt-ggaccttgtact
B D                    Medaka  aga--------acagcacgggatgtcccacgagcaaaaaaggagactcctttgtcgt-ggaccttgaact
           Southern platyfish  aga--------acagcactggatgtccctcgggcaaaaaaggatgctcctttatcat-aaactttgtatt
B D               Stickleback  aga--------acagcgctcgatgtcccgggagcaaagaaggaggctcctttgtcgt-ggactttgtact
                  Spotted gar  agg--------acagcgctggaagtgcccctggcaaaaaaggacacccctttgtcct-ggatcttgtatt
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                Coelacanth  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  g
                        Chimp  g
                      Gorilla  g
                    Orangutan  g
                       Gibbon  g
                       Rhesus  g
          Crab-eating macaque  g
                       Baboon  g
                 Green monkey  g
                     Marmoset  g
              Squirrel monkey  g
                     Bushbaby  g
           Chinese tree shrew  g
                     Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
              Chinese hamster  g
               Golden hamster  g
                        Mouse  g
                          Rat  g
               Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
                       Rabbit  g
                         Pika  g
                          Pig  g
                       Alpaca  g
               Bactrian camel  g
                      Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
                          Cow  g
                        Sheep  g
                Domestic goat  g
                        Horse  g
             White rhinoceros  g
                          Cat  g
                          Dog  g
                      Ferret   g
                        Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
                      Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
                     Microbat  g
                     Hedgehog  g
              Star-nosed mole  g
                     Elephant  g
          Cape elephant shrew  g
                      Manatee  g
             Cape golden mole  g
                       Tenrec  g
                     Aardvark  g
                    Armadillo  g
                      Opossum  g
              Tasmanian devil  g
                      Wallaby  g
                     Platypus  g
                  Rock pigeon  g
                 Saker falcon  g
             Peregrine falcon  g
          Collared flycatcher  g
       White-throated sparrow  g
          Medium ground finch  g
                  Zebra finch  g
           Tibetan ground jay  g
                   Budgerigar  g
                       Parrot  g
                Scarlet macaw  g
                 Mallard duck  g
                      Chicken  g
                       Turkey  g
           American alligator  g
              Green seaturtle  g
               Painted turtle  g
     Chinese softshell turtle  g
                       Lizard  g
                X. tropicalis  g
                    Tetraodon  g
                         Fugu  g
       Yellowbelly pufferfish  g
                 Nile tilapia  g
          Princess of Burundi  g
        Burton's mouthbreeder  g
                       Medaka  g
           Southern platyfish  g
                  Stickleback  g
                  Spotted gar  g
                  Zebra mbuna  =
          Pundamilia nyererei  =
                   Coelacanth  =
                   Guinea pig  =

Inserts between block 29 and 30 in window
B D              Stickleback 470bp

Alignment block 30 of 1179 in window, 47496135 - 47496135, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  a
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D        American alligator  g
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
B D                    Lizard  a
B D             X. tropicalis  g
B D                 Tetraodon  g
B D                      Fugu  a
       Yellowbelly pufferfish  a
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  a
B D                    Medaka  g
                  Spotted gar  g
                 Zebra mbuna  =
B D               Stickleback  =
         Pundamilia nyererei  =
B D                Coelacanth  =
          Southern platyfish  -
B D                Guinea pig  =

Inserts between block 30 and 31 in window
B D                   Medaka 650bp

Alignment block 31 of 1179 in window, 47496136 - 47496140, 5 bps 
B D                     Human  taagt
B D                     Chimp  taagt
B D                   Gorilla  taagt
B D                 Orangutan  taagt
B D                    Gibbon  taagt
B D                    Rhesus  taagt
B D       Crab-eating macaque  taagt
B D                    Baboon  taagt
B D              Green monkey  taagt
B D                  Marmoset  taagt
B D           Squirrel monkey  taagt
B D                  Bushbaby  taaat
           Chinese tree shrew  aaggt
B D                  Squirrel  taagt
       Lesser Egyptian jerboa  taaat
                 Prairie vole  taagt
B D           Chinese hamster  taagt
               Golden hamster  taagt
B D                     Mouse  taagt
B D                       Rat  taagt
B D            Naked mole-rat  taggt
                   Chinchilla  taagt
             Brush-tailed rat  taggt
B D                    Rabbit  aaagt
B D                      Pika  taggt
B D                       Pig  taagt
B D                    Alpaca  taagt
               Bactrian camel  taagt
B D                   Dolphin  taagt
                 Killer whale  taagt
             Tibetan antelope  tacgt
B D                       Cow  tacgt
B D                     Sheep  tacgt
                Domestic goat  tacgt
B D                     Horse  taggt
B D          White rhinoceros  taagt
B D                       Cat  taagt
B D                       Dog  taagt
B D                   Ferret   taagt
B D                     Panda  taagt
               Pacific walrus  taagt
                 Weddell seal  taagt
             Black flying-fox  taagt
B D                   Megabat  taagt
                Big brown bat  aaagt
         David's myotis (bat)  aacgt
B D                  Microbat  aaagt
B D                  Hedgehog  taagt
              Star-nosed mole  tacgt
B D                  Elephant  tacgt
          Cape elephant shrew  taagt
B