Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 451 in window, 131772398 - 131772707, 310 bps 
B D                     Human  ggc---t--gctgattttcttttaatttgtgattttagggcaatta-ttttatacagctgt---------
B D                     Chimp  ggc---t--gctgattttcttttaatttgtgattttagggcaatta-ttttatacagctgt---------
B D                   Gorilla  ggc---t--gctgattttcttttaatttgtgattttagggcaatta-ttttatacagctgttgagtaaca
B D                 Orangutan  ggc---t--gctgattgtctttcaatttgtgattttagggcaatta-ttttatacagctgttgagtaaca
B D                    Gibbon  ggc---t--gctgattttcttttaatttgtgattttagggcaatta-ttttatacagctgttgagtaaca
B D                    Rhesus  ggc---t--gctgattttctttgaatttgtgattttagggcagtta-ttttatgcagctgtcgagtaacg
B D       Crab-eating macaque  ggc---t--gctgattttctttgaatttgtgattttagggcagtta-ttttatacagctgtcgagtaacg
B D                    Baboon  ggc---t--gctgattttctttgaatttgtgattttagggcagtta-ttttatacagctgtcaagtaacg
B D              Green monkey  ggc---t--gctgattttcttttaatttgtgattttagggtagtta-ttttatacagctgtcgagtaacg
B D                  Marmoset  ggt---g----tgattttcttttaatgtgtgatttcagggcaatta-ttttatacagt------gtcaag
B D           Squirrel monkey  ggc---g----tgattttccttgaatgtgtgatttcagggcaatta-ttttatacagtaa--aagtaaag
B D                  Bushbaby  ggc---tcagctg------ctttattttgttctttcagagcaatta-ttttatacacttttctagtaaag
           Chinese tree shrew  gta---t--gc----attgttttattttgtgatttcaaggccgttatttttctacagctgtctagtaa-g
B D                     Horse  cac---c--cattattttcttttatttcgtgatttcagggcatttg-ttctacgcagctgtctagtaagg
B D          White rhinoceros  tac---c--tgttatttccttttgttttgtgatttgggggcattta-ttgtacacagccgtccagtaagg
B D                   Ferret   cac---c--tgctgtctcctgctccctggtgatttccgggcagtta-cctcgctccag-gtctgggaagc
B D                     Panda  cac---c--tgctctcttctcctatttggtgatttcggggcattta-tc-tccaccgc-gtctgggaagg
               Pacific walrus  cacctgc--tgctcttttctcctatttggtgattttggggcattta-tctcacaccag-gtctgggaagg
                 Weddell seal  cac---c--tgctctcttctcctatttggtgattttggggcattta-tc---------------------
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D        American alligator  ======================================================================

                        Human  tgatt--gctctgtgttagggaggaagaga---gaggccat-----------t---cgaaggaggtgccc
                        Chimp  tgatt--gctctgtgttagggaggaagaga---gaggccat-----------t---cgaaggaggtgccc
                      Gorilla  tgatt--gctctgtgttagggaggaagaga---gaggccat-----------t---caaaggaggtgccc
                    Orangutan  tgatt--gctctgtgttagcgaggaagaga---gaggccat-----------t---aaaaggaggtgccc
                       Gibbon  tgatt--gctctatgttagggaggaagaga---gaggccat-----------t---aaaaggaggtgccc
                       Rhesus  tgatt--g--ctgtgtt----aggaagaga---gaggccat-----------t---aaaaggaggtgccc
          Crab-eating macaque  tgatt--g--ctgtgtt----aggaagaga---gaggccat-----------t---aaaaggaggtgccc
                       Baboon  tgatt--g--ctgtgtt----agcaagaga---gaggccat-----------t---aaaaggaggtgccc
                 Green monkey  tgatt--g--ctgtgtt----aggaagaga---gaggccat-----------t---aaaaggaggtgccc
                     Marmoset  tgact--g--ctgtggtaggcaggaagaca---ggggccgt-----------t---acagggaggtgccc
              Squirrel monkey  tgact--g--ctgtggcaggcaagaagaga---cgggctgt-----------t---acaggaaggtgccc
                     Bushbaby  tcatc--gctctgtgattag-aggaa-aga---gaggccattcttttaaaggt---ataagaaagagccc
           Chinese tree shrew  caact--gttctgtgatgaaggagaagggacatgggggcat-----------tttaaaaaggagatgctc
                        Horse  caatctttctctg-attagggaggagtcaa---agggctgttc---------t---taaaggagatgccc
             White rhinoceros  caatctttctctg-atcagggaggagtcga---gaggccgttc---------t---caaaggagacaccc
                      Ferret   cggtg--gatctg-atcaggaaggagtcac---gaggcggctc---------t---acccggggcagctc
                        Panda  tggtc--aatccg-atcaggaaggagtcat---gaggcctctc---------c---acacgggggagctc
               Pacific walrus  cggtc--aatctg-atcaggaaggagtcac---gaggccgctc---------t---acacaggggagctc
                 Weddell seal  ------------------------------------------c---------c---acacaggggagctc
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
           American alligator  ======================================================================

                        Human  tgggtcca-gcc------------------------------------tcagccctgggca---------
                        Chimp  tgggtcca-gcc------------------------------------tcagccctgggca---------
                      Gorilla  tgggtcca-gcc------------------------------------tcagccctgggca---------
                    Orangutan  tgggtcca-gcc------------------------------------tcagccctgggca---------
                       Gibbon  tgggtcca-gcc------------------------------------tcagccctgggca---------
                       Rhesus  tcggtcca-gcc------------------------------------tcagccctgggca---------
          Crab-eating macaque  tcggtcca-gcc------------------------------------tcagccctgggca---------
                       Baboon  tcggtcca-gcc------------------------------------tcagccctgggca---------
                 Green monkey  tcggtcca-gcc------------------------------------tcagccctgggca---------
                     Marmoset  tcggtcca-gcc------------------------------------tcagcccc-ggca---------
              Squirrel monkey  tcggtcca-gcc------------------------------------tcagcccc-ggca---------
                     Bushbaby  tgggtcca-gcc------------------------------------tcgg-cctgggca---------
           Chinese tree shrew  tcagtcca-ggc------------------------------------tgaatcctgggca---------
                        Horse  ttggtcca-gcc------------------------------------tcaactgtgggcaggagggtgg
             White rhinoceros  ttggtcca-gcc------------------------------------tc-accgtgggcaggaggatgg
                      Ferret   -tggtccc-tcc----------------------------------------------------------
                        Panda  -tggtccc-gccgttcctctgtcccctccccagcagcgcaggctcagggc-cccgggagcc---------
               Pacific walrus  -tggtctc-acc------------------------------------ac-accgagggcc---------
                 Weddell seal  -tggtcccaacc------------------------------------ac-accgagggcc---------
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
           American alligator  ======================================================================

                        Human  -------gg-agggagggc-------------------------------------gtcagcctgggggt
                        Chimp  -------gg-agggagggc-------------------------------------gtcagcctgggggt
                      Gorilla  -------gg-agggagggc-------------------------------------gtcagcctgggggt
                    Orangutan  -------gg-agggagggt-------------------------------------gtcagcctgggggt
                       Gibbon  -------gg-agggagggc-------------------------------------gtcagcctggcggt
                       Rhesus  -------gg--gggaaggc-------------------------------------gtcagcctgggggt
          Crab-eating macaque  -------gg--gggagggc-------------------------------------gtcagcctgggggt
                       Baboon  -------gg--gggagggc-------------------------------------gtcagcctgggggt
                 Green monkey  -------gg--gggagggc-------------------------------------gtcagcctgggggt
                     Marmoset  -------gg-agggagggc-------------------------------------gtcagcctgagggt
              Squirrel monkey  -------gg-cgggagggc-------------------------------------gtcagcctgggggt
                     Bushbaby  -------gg-agagagggt-------------------------------------gtcagcctgcaggt
           Chinese tree shrew  -------agcaaggaagac-------------------------------------at--------ggct
                        Horse  cgtccggtg-ggtttggat-------------------------------------ctcagtgtgcaggt
             White rhinoceros  cgtccggca-ggtttggat-------------------------------------ctcagcctgcaggg
                      Ferret   --------------------------------------------------------cgccgt--------
                        Panda  -------ca-tctgagggccgctgaaagggaacagcaggaaggagtcatgaggcctctccacacg-gggg
               Pacific walrus  -------ca-ggttgggac-------------------------------------ctccgcctg-gggt
                 Weddell seal  -------ca-ggttgggac-------------------------------------ctccgcctg-gggt
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
           American alligator  ======================================================================

                        Human  ggtcag-gcatcag-aagt--c---gtc-gtttccccaggagcc----------------------ccc-
                        Chimp  ggtcag-gcatcag-aagt--c---gtc-gtttccccaggagca----------------------ccc-
                      Gorilla  ggtcag-gcatcag-aagt--c---atc-gtttccccaggagcc----------------------ccc-
                    Orangutan  gatcag-gcatcag-aagt--c---gtc-gtttccccaggagcc----------------------ccc-
                       Gibbon  ggtcag-gcatcag-aagt--c---gtc-gtttccccaggagcc----------------------ccc-
                       Rhesus  ggtcac-acatcagaaagt--a---atc-atttccccagggacc----------------------ccc-
          Crab-eating macaque  ggtcac-acatcagaaagt--a---atc-atttccccagggacc----------------------ccc-
                       Baboon  ggtcac-acatcagaaagc--c---atc-gtttccccaggaacc----------------------ccc-
                 Green monkey  ggtcac-acatcagaaagt--c---atc-gtttccccagggacc----------------------ccc-
                     Marmoset  ggtcag-acagcag-aagc--c---acc-gtctccccagaggcc-ccacagccct-gacaggagggccc-
              Squirrel monkey  ggtcag-gcagcag-aagc--c---gct-gtttccccagaggcc-ccacagccccggacaggaagaccc-
                     Bushbaby  ggccaa-gcaccaa-gagt--ctcagct-gctccccaagtagccaccaaagcctgacacaaagat-cac-
           Chinese tree shrew  gacccctacagtca-cagt--a---gtt-actctccgaggagcc----------------------ccct
                        Horse  ggc-ca-acggccc-cagtc-ctcagtc-cccttcccagcggcc----------------------cct-
             White rhinoceros  ggt-cg-atggccc-cagtc-ctccgtctctcttcccagcggcc----------------------cct-
                      Ferret   ---------------------cctcatt-cctgtaccagcagcc----------------------cag-
                        Panda  agctct-ggtcccg-ccgttcctctgtc-ccctccccagcagcg----------------------cag-
               Pacific walrus  ggc-cc-acacccg-ccat--cccagtg-ccctccccaatggcc----------------------cag-
                 Weddell seal  ggc-cc-acacccg-ccat--cccagtc-ccctccccagcggcc----------------------cag-
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
           American alligator  ======================================================================

                        Human  ----------------------acgcctggagttaaa------------a--------------------
                        Chimp  ----------------------acgcctggagttaaa------------a--------------------
                      Gorilla  ----------------------acgcctggagttaaa------------a--------------------
                    Orangutan  ----------------------acgcctggagttaaa------------a--------------------
                       Gibbon  ----------------------acgcctggagttaaa------------a--------------------
                       Rhesus  ----------------------acgcctggagttaaa------------a--------------------
          Crab-eating macaque  ----------------------acgcctggagttaaa------------a--------------------
                       Baboon  ----------------------acgcctggagttaaa------------a--------------------
                 Green monkey  ----------------------acgcctggagttaaa------------a--------------------
                     Marmoset  ----------------------acgtctgcagtgtaa------------g--------------------
              Squirrel monkey  ----------------------acgtctgcagtttaa------------g--------------------
                     Bushbaby  ----------------------atgtctgaagctgag------------g--------------------
           Chinese tree shrew  acccgcccagctggaaaccacaaggtctgaagttaaa------------g--------------------
                        Horse  ----------------------ccaccctgctct---------------acggctgcacgtcggaaacag
             White rhinoceros  ----------------------ccatgccgccctaaggaggcggatgtgaaggccacacgtgagaaacaa
                      Ferret   ----------------------ctccg-ggttccggg------------aagcccgcaggaggg------
                        Panda  ----------------------gctca-gggccccgg------------gagcccatctgaggg------
               Pacific walrus  ----------------------gcttgcggcccccgg------------gagcccatgtgaggg------
                 Weddell seal  ----------------------gctcgcggcccccag------------gagcccacgtgaggg------
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
           American alligator  ======================================================================

                        Human  -----------cagat-g-cgccatgtcaggtgccaaggctgaactttaaacag-cctcaaga-acagc-
                        Chimp  -----------cagat-g-cgccatgtcaggtgccaaggctgaactttaaacag-cctcaaga-acagc-
                      Gorilla  -----------cagat-g-cgccatgtcaggtgccaaggctgaactttaaacag-cctcaaga-acagc-
                    Orangutan  -----------cagat-g-cgccatgttagatgccaaggctgaactttaaacag-cctcaaga-acagc-
                       Gibbon  -----------cagat-g-caccatgtcagatgccaagattgaactttaaacag-cctcaaga-acagc-
                       Rhesus  -----------cagac-g-ccccatgttagatgccagggctgaactttaaagag-cctcaaga-acagc-
          Crab-eating macaque  -----------cagac-g-ccccatgttagatgccagggctgaactttaaagag-cctcaaga-acagc-
                       Baboon  -----------cagac-g-ccccacgttagatgccagggatgaactttaaagag-cctcaaga-acagc-
                 Green monkey  -----------cagac-g-ccccatgttagatgccagggctgaactttaaagag-cctcaaga-acagc-
                     Marmoset  -----------cggat-g-ccccacgttaggtgccaaggctgaactttcaacag-cctcacga-------
              Squirrel monkey  -----------cagat-g-ccccacgggaggtgccaaggctgaactttaaacag-cacggtg--------
                     Bushbaby  -----------cctgt-g-ctccacgctgggcagcaagactgaccccagcacag-cctctaaacacacc-
           Chinese tree shrew  -----------caaac-attcccctatgaaagaacaagaccaaattttaaacga-cctcaaaa-a---a-
                        Horse  aaacagacgctccagtgc-gcttgtgcgagggagcaggacagaa-tttacgcaggctcccaca-atgcag
             White rhinoceros  aagcagatgctccact-c-gcctgtgcaaggggacaggacggaa-tttacgcagcctcccaga-acacct
                      Ferret   -----------ccgct-c-ggctgtgaaagggaacaggacagga-tccaaacag--cccagaa-gcacct
                        Panda  -----------ctgct-c-gtctgtgaaagggaacaggacagca-ttcaaacag-cccccgga-acaccc
               Pacific walrus  -----------ccgct-c-ggctgtgaaaggtaacaggacggga-ttcaaacag--cccagaa-acacct
                 Weddell seal  -----------ccgct-c-ggctgtgagggg-aacaggacagga-ttcaaacag--cccagaa-acacct
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
           American alligator  ======================================================================

                        Human  acgttgaagtgcagtggtgacgtgatgtggaaactctggcatgttg
                        Chimp  acgttgaagtgcagtggtgacgtgatgtggaaactctggcacgttg
                      Gorilla  acgttgaagtgcagtggtgacgtgatgtgcaaactctggcatgttg
                    Orangutan  acgttgaagtgcagtggtgacgtgatgtgaaaactctggcatgttg
                       Gibbon  acattgaagtgcagtggtgacgtgatgtgaaaactctggcatgttg
                       Rhesus  acgttgacgtgcaggggtggcgtgatgtgaaaactctggcatgttg
          Crab-eating macaque  acattgacatgcaggggtggcatgatgtgaaaactctggcatgttg
                       Baboon  acgttgacgtgcaggggtggcgtgatgtgaaaactctggcatgttg
                 Green monkey  acgttgacgtgcagcggtggcgtgatgtgaaaactctggcatgttg
                     Marmoset  ------aagcaca----tgacactatgtgaagactctggcacgtgg
              Squirrel monkey  ------aagttcagtggtgacacgatgtgaagattctggcatgtgg
                     Bushbaby  actccaacatgcagcagcaccaggatgtg-aaacttcagcaagttg
           Chinese tree shrew  actttgaagtgaa----------gatagaagaactttggcatgttg
                        Horse  gctttgcagtccagccgtgactccatatga-aactccggcgtgttg
             White rhinoceros  gctctgcagtccagccgccactcgatgtaa-aattctggcgtgttg
                      Ferret   gcactgacgtccagccgtgactcggtgtagaagctctgggaggctg
                        Panda  gctttgaagtccagccgtgacttggtgtag--acactggcaggttg
               Pacific walrus  gcttcgacgtccagccgtgactcagtgtagaaactctggcaggttg
                 Weddell seal  gcttcgacgtccagccctgacttagtgcagaaactctggcaggttg
                Domestic goat  ==============================================
                        Sheep  ----------------------------------------------
                          Cow  ==============================================
             Tibetan antelope  ==============================================
                Big brown bat  ==============================================
                     Microbat  ==============================================
         David's myotis (bat)  ==============================================
               Bactrian camel  ==============================================
                       Alpaca  ==============================================
                        Mouse  ==============================================
                          Dog  ==============================================
                          Rat  ==============================================
                 Prairie vole  ==============================================
              Chinese hamster  ==============================================
               Golden hamster  ==============================================
                 Killer whale  ----------------------------------------------
                     Squirrel  ==============================================
                          Cat  ==============================================
               Naked mole-rat  ==============================================
                   Chinchilla  ==============================================
                   Guinea pig  ==============================================
                      Manatee  ==============================================
                     Elephant  ==============================================
                    Armadillo  ==============================================
       Lesser Egyptian jerboa  ==============================================
             Brush-tailed rat  ==============================================
             Black flying-fox  ==============================================
     Chinese softshell turtle  ==============================================
              Green seaturtle  ==============================================
               Painted turtle  ==============================================
              Tasmanian devil  ==============================================
                      Wallaby  ==============================================
                      Opossum  ==============================================
                     Aardvark  ==============================================
             Cape golden mole  ==============================================
                      Dolphin  ----------------------------------------------
           American alligator  ==============================================

Alignment block 2 of 451 in window, 131772708 - 131772721, 14 bps 
B D                     Human  aaataaaatccatc
B D                     Chimp  aaataaaatccatc
B D                   Gorilla  aaataaaatccatc
B D                 Orangutan  aaataaaatccgtc
B D                    Gibbon  aaataaaatccatc
B D                    Rhesus  aaataaaatccatc
B D       Crab-eating macaque  aaataaaatccatc
B D                    Baboon  aaataaaatccatc
B D              Green monkey  aaataaaatccgtc
B D                  Marmoset  aaataaaatccatc
B D           Squirrel monkey  aaataaaatccatc
B D                  Bushbaby  aaacgaaattagtc
           Chinese tree shrew  gtacaaaatcgatc
B D                     Horse  atgtaaaattggcc
B D          White rhinoceros  atacaaaatcggct
B D                   Ferret   atac-acatcggta
B D                     Panda  at---acatcggtc
               Pacific walrus  gt---acatcagtc
                 Weddell seal  at---acatcagtc
B D                  Elephant  aaataaaatcaatc
               Domestic goat  ==============
B D                     Sheep  --------------
B D                       Cow  ==============
            Tibetan antelope  ==============
               Big brown bat  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
              Bactrian camel  ==============
B D                    Alpaca  ==============
B D                     Mouse  ==============
B D                       Dog  ==============
B D                       Rat  ==============
                Prairie vole  ==============
B D           Chinese hamster  ==============
              Golden hamster  ==============
                Killer whale  --------------
B D                  Squirrel  ==============
B D                       Cat  ==============
B D            Naked mole-rat  ==============
                  Chinchilla  ==============
B D                Guinea pig  ==============
B D                   Manatee  ==============
B D                 Armadillo  ==============
      Lesser Egyptian jerboa  ==============
            Brush-tailed rat  ==============
            Black flying-fox  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
  D            Painted turtle  ==============
B D           Tasmanian devil  ==============
B D                   Wallaby  ==============
B D                   Opossum  ==============
                    Aardvark  ==============
            Cape golden mole  ==============
B D                   Dolphin  --------------
B D        American alligator  ==============

Inserts between block 2 and 3 in window
B D                  Ferret  195bp

Alignment block 3 of 451 in window, 131772722 - 131772751, 30 bps 
B D                     Human  tggttactg-t--aaagatcaaat----------------------------------------------
B D                     Chimp  tggttactg-t--aaagatcaaat----------------------------------------------
B D                   Gorilla  tggttactg-t--aaagatcaaat----------------------------------------------
B D                 Orangutan  tggttaccg-t--aaagatcaaat----------------------------------------------
B D                    Gibbon  tggttactg-t--aaagatcaaac----------------------------------------------
B D                    Rhesus  tggttactg-t--aaagatcaaac----------------------------------------------
B D       Crab-eating macaque  tggttactg-t--aaagatcaaac----------------------------------------------
B D                    Baboon  tggttactg-t--aaagttcaaac----------------------------------------------
B D              Green monkey  tggttactg-t--aaagatcaaac----------------------------------------------
B D                  Marmoset  ttgttactg----aaggatcaaac----------------------------------------------
B D           Squirrel monkey  ttgttactg-t--aaggatcaaac----------------------------------------------
B D                  Bushbaby  tggttactt-t--caggttcaaacactatttcttcctcttaatgattttttatcaaatcataactgtata
           Chinese tree shrew  aggttactcct--aaaagtcacat----------------------------------------------
B D                     Horse  tagttactttt--aaacgtgaaac----------------------------------------------
B D          White rhinoceros  tggttactttt--aaacgtcaaac----------------------------------------------
B D                   Ferret   tggctactttt--aaatgtcaaat----------------------------------------------
B D                     Panda  tggctactttt--aaacgtcaaat----------------------------------------------
               Pacific walrus  tggctactttt--aaacgtcaaat----------------------------------------------
                 Weddell seal  tggctactttt--aaacgtcaaat----------------------------------------------
B D                  Elephant  tggtgactt-ttaaaaagtcaaac----------------------------------------------
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D        American alligator  ======================================================================

                        Human  ----------------------------ctgagtttt
                        Chimp  ----------------------------ctgagtttt
                      Gorilla  ----------------------------ctgagtttt
                    Orangutan  ----------------------------ccgagtttt
                       Gibbon  ----------------------------ctgagtttt
                       Rhesus  ----------------------------ctgagtttt
          Crab-eating macaque  ----------------------------ctgagtttt
                       Baboon  ----------------------------ctgagtttt
                 Green monkey  ----------------------------ctgagtttt
                     Marmoset  ----------------------------ctgactttt
              Squirrel monkey  ----------------------------ctgactttt
                     Bushbaby  tgttaatgcatctgtggggtacaatgtgctgactttt
           Chinese tree shrew  ----------------------------ctcattttt
                        Horse  ----------------------------ctcgttttt
             White rhinoceros  ----------------------------ctcattttt
                      Ferret   ----------------------------cttattttt
                        Panda  ----------------------------ctcattttt
               Pacific walrus  ----------------------------ctcattttt
                 Weddell seal  ----------------------------ctcattttt
                     Elephant  ----------------------------ctcattttc
                Domestic goat  =====================================
                        Sheep  -------------------------------------
                          Cow  =====================================
             Tibetan antelope  =====================================
                Big brown bat  =====================================
                     Microbat  =====================================
         David's myotis (bat)  =====================================
               Bactrian camel  =====================================
                       Alpaca  =====================================
                        Mouse  =====================================
                          Dog  =====================================
                          Rat  =====================================
                 Prairie vole  =====================================
              Chinese hamster  =====================================
               Golden hamster  =====================================
                 Killer whale  -------------------------------------
                     Squirrel  =====================================
                          Cat  =====================================
               Naked mole-rat  =====================================
                   Chinchilla  =====================================
                   Guinea pig  =====================================
                      Manatee  =====================================
                    Armadillo  =====================================
       Lesser Egyptian jerboa  =====================================
             Brush-tailed rat  =====================================
             Black flying-fox  =====================================
     Chinese softshell turtle  =====================================
              Green seaturtle  =====================================
               Painted turtle  =====================================
              Tasmanian devil  =====================================
                      Wallaby  =====================================
                      Opossum  =====================================
                     Aardvark  =====================================
             Cape golden mole  =====================================
                      Dolphin  -------------------------------------
           American alligator  =====================================

Inserts between block 3 and 4 in window
B D                 Bushbaby 3bp
              Pacific walrus 1865bp

Alignment block 4 of 451 in window, 131772752 - 131772752, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                     Horse  a
B D          White rhinoceros  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
B D                  Elephant  a
               Domestic goat  =
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  -
B D                  Squirrel  =
B D                       Cat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                Guinea pig  =
B D                   Manatee  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                    Aardvark  =
            Cape golden mole  =
B D                   Dolphin  -
B D        American alligator  =

Alignment block 5 of 451 in window, 131772753 - 131772754, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  aa
B D                     Horse  aa
B D          White rhinoceros  aa
B D                   Ferret   aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  aa
B D                  Elephant  aa
             Cape golden mole  aa
               Domestic goat  ==
B D                     Sheep  --
B D                       Cow  ==
            Tibetan antelope  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                     Mouse  ==
B D                       Dog  ==
B D                       Rat  ==
                Prairie vole  ==
B D           Chinese hamster  ==
              Golden hamster  ==
                Killer whale  --
B D                  Squirrel  ==
B D                       Cat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                Guinea pig  ==
B D                   Manatee  ==
B D                 Armadillo  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
B D                   Opossum  ==
                    Aardvark  ==
B D                   Dolphin  --
B D        American alligator  ==

Inserts between block 5 and 6 in window
B D         White rhinoceros 222bp

Alignment block 6 of 451 in window, 131772755 - 131772836, 82 bps 
B D                     Human  aacccccttcacatttttgttcatgcg----aaggc---agaaggac-ttcaaattc-------------
B D                     Chimp  aacccccttcacatttttgttcatgcg----aaggc---agaaggac-ttcaaattc-------------
B D                   Gorilla  aacccccttcacatttttgttcatgcg----aaggc---agaaggac-ttcaaattc-------------
B D                 Orangutan  aatccccttcacatttttgttcatgcg----aaggc---aggag----ttcaaattc-------------
B D                    Gibbon  aacccccttcacatttttgttcatgtg----aaggc---agaaggac-ttcaaattc-------------
B D                    Rhesus  aatccgcttcacatgtttgttcatgct----aaggc---ggaaggac-ttcagattc-------------
B D       Crab-eating macaque  aatccgcttcacatgtttgttcatgct----aaggc---ggaaggac-ttcagattc-------------
B D                    Baboon  aatccgcttcacatgtttgttcatgct----aaggc---ggaaggac-ttcagattc-------------
B D              Green monkey  aatccccttcacatgtttgttcatgct----aaggt---agaaggac-ttcagattc-------------
B D                  Marmoset  aatcaccttcacatgttcgttcatgct----aaggc---agaagg-c-ttcagatgc-------------
B D           Squirrel monkey  actcaccttcacatgtttgttcacgct----aaggc---ggaagg-c-ttcaaatgc-------------
B D                  Bushbaby  aattacctttgcatttttgctcatgcc----aattg---taaaggac-ttccatttccatctgaatggaa
           Chinese tree shrew  aattactctcctattttcgctcacgttgataagtac---agatggtc-ttcagtttctatctgaatggga
B D                     Horse  aattaccttcccatttttgttcacgct----ggtgagcgagaaggacttttaattcctatctgaatggac
B D          White rhinoceros  acttaacttcccatttttgttcacgct----ggtgagggagaaggac-ttcagcttctatctgaatggac
B D                   Ferret   aattacc------------ttcatgct----gacacacaagtagggc-tttagtttccatcccaatgcac
B D                     Panda  aattaccttcacattttcattcatgct----gatacatgagaagggc-tttcgtttcagtccgaatggaa
               Pacific walrus  aattaccttcatattttcgttcacgct----gatacatgagaagggc-tttagtttccatccaaatggaa
                 Weddell seal  aattaccttcacattttcgttcacact----gttacatgagaagggc-tttagtttccatccgaacggaa
B D                  Elephant  aattaccctcatactttccctcacg-t----ggtttgcgagaaggac-ttcaagttcggtctgagcggac
             Cape golden mole  aatcaccttcccattttctctcacact----ggtatac---aaggac-ttcaatttccatctgagtggat
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D        American alligator  ======================================================================

                        Human  ------ttccaacctgccttacagatctccttaaggaaa
                        Chimp  ------ttccaacctgccttacagatctccttaaggaaa
                      Gorilla  ------ttccaacctgccttacagatctccttaaggaaa
                    Orangutan  ------ttccaacctgccttaaagatctccttaaggaaa
                       Gibbon  ------ttccaacctgccttaaagctctccttaaggaaa
                       Rhesus  ------ttccaacctgccttaaagatgtgctcaaggaca
          Crab-eating macaque  ------ttccaacctgccttaaagatgtcctcaaggaca
                       Baboon  ------ttccaacctgccttaaagttgtcctcaaggaca
                 Green monkey  ------ttccaacctgccttaaagatccccttaaggaca
                     Marmoset  ------tttcaacctgccttaaaaatctccttaggaaaa
              Squirrel monkey  ------tttcagcctgccttaaaaacctccttaggaaaa
                     Bushbaby  aggatttcccaacctgccttaag--tctccccaagaaaa
           Chinese tree shrew  ggaattttctaatctgcctttaaaatctccccaag-aaa
                        Horse  agga--ggctgacctgcctcgacaat---ctcaaggaaa
             White rhinoceros  gagat-tgccaacccacctcaaaaatcgcctcaaggaaa
                      Ferret   ggg-c-tgctagcctgcctttcaaactctcccacagaaa
                        Panda  gggat-cgctggcctgcctttcaaattctgccacggaaa
               Pacific walrus  gggat-tgctggcctgcctttcaaactctcccatggaaa
                 Weddell seal  gggat-tgctggcctgcctttcaaactctcgcacggaaa
                     Elephant  ggctt-ctctaaccagccttaaaaatctcctcaaggaaa
             Cape golden mole  ggttt-ctctaaccgaccttaaaaatcacctccaagaaa
                Domestic goat  =======================================
                        Sheep  ---------------------------------------
                          Cow  =======================================
             Tibetan antelope  =======================================
                Big brown bat  =======================================
                     Microbat  =======================================
         David's myotis (bat)  =======================================
               Bactrian camel  =======================================
                       Alpaca  =======================================
                        Mouse  =======================================
                          Dog  =======================================
                          Rat  =======================================
                 Prairie vole  =======================================
              Chinese hamster  =======================================
               Golden hamster  =======================================
                 Killer whale  ---------------------------------------
                     Squirrel  =======================================
                          Cat  =======================================
               Naked mole-rat  =======================================
                   Chinchilla  =======================================
                   Guinea pig  =======================================
                      Manatee  =======================================
                    Armadillo  =======================================
       Lesser Egyptian jerboa  =======================================
             Brush-tailed rat  =======================================
             Black flying-fox  =======================================
     Chinese softshell turtle  =======================================
              Green seaturtle  =======================================
               Painted turtle  =======================================
              Tasmanian devil  =======================================
                      Wallaby  =======================================
                      Opossum  =======================================
                     Aardvark  =======================================
                      Dolphin  ---------------------------------------
           American alligator  =======================================

Inserts between block 6 and 7 in window
            Cape golden mole 827bp

Alignment block 7 of 451 in window, 131772837 - 131772841, 5 bps 
B D                     Human  ---agttg
B D                     Chimp  ---agttg
B D                   Gorilla  ---agttg
B D                 Orangutan  ---agttg
B D                    Gibbon  ---agttg
B D                    Rhesus  ---agttg
B D       Crab-eating macaque  ---agttg
B D                    Baboon  ---agttg
B D              Green monkey  ---agttg
B D                  Marmoset  ---ggtta
B D           Squirrel monkey  ---agcta
B D                  Bushbaby  ---atttt
           Chinese tree shrew  ---agttc
B D                     Horse  ---ggtg-
B D          White rhinoceros  ---gtgg-
B D                   Ferret   ---ggag-
B D                     Panda  ---ggag-
               Pacific walrus  ---gggg-
                 Weddell seal  ---gggg-
B D                  Elephant  gatag---
               Domestic goat  ========
B D                     Sheep  --------
B D                       Cow  ========
            Tibetan antelope  ========
               Big brown bat  ========
B D                  Microbat  ========
        David's myotis (bat)  ========
              Bactrian camel  ========
B D                    Alpaca  ========
B D                     Mouse  ========
B D                       Dog  ========
B D                       Rat  ========
                Prairie vole  ========
B D           Chinese hamster  ========
              Golden hamster  ========
                Killer whale  --------
B D                  Squirrel  ========
B D                       Cat  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
B D                Guinea pig  ========
B D                   Manatee  ========
B D                 Armadillo  ========
      Lesser Egyptian jerboa  ========
            Brush-tailed rat  ========
            Black flying-fox  ========
  D  Chinese softshell turtle  ========
  D           Green seaturtle  ========
  D            Painted turtle  ========
B D           Tasmanian devil  ========
B D                   Wallaby  ========
B D                   Opossum  ========
                    Aardvark  ========
            Cape golden mole  ========
B D                   Dolphin  --------
B D        American alligator  ========

Alignment block 8 of 451 in window, 131772842 - 131772906, 65 bps 
B D                     Human  aagggatgtgttctttccc-tcttggtatcgtttagaagtaacaatggttgttgcctccaggactt
B D                     Chimp  aagggatgtgttctttccc-tcttggtatcatttagaagtaacaatggttgttgcctccaggactt
B D                   Gorilla  aaaggatgtgttctttccc-tcttggtatcgtttagaagtaacaatggttgttgcctccaggactt
B D                 Orangutan  aaaggatgtgttctttcccttcttggtgtcgtctagaagtaacgatggttgttgcctccaggactt
B D                    Gibbon  aaaggatgtgttctttcccttcttggtgtcgtctagaagtaacgacggttgttgcctccaggactt
B D                    Rhesus  aaaggacatgttcttgcccttctcggtgtcgtctcgaggtaacaatggttgttgccttcaggactt
B D       Crab-eating macaque  aaaggacatgttcttgcccttctcagtgtcgtctcgaggtaacaatggttgttgcctccaggactt
B D                    Baboon  aaaggacgtgttcttgcccttctcggtgtcgtctcgaggtaacaatggttgttgcctccaggactc
B D              Green monkey  aaaggatgtgttcttgcccttcttggtgtcgtctcgaggtaacaatggttgttgcctccaggactt
B D                  Marmoset  aacgggcgcattctgtcccttcttggtgtcgtctcaaagtaacgatggttgtcacctctgggactt
B D           Squirrel monkey  aagggacgcgttctttcccttcttggtgtcgtctcaaaggaacgagggttgtcacctccgggactt
B D                  Bushbaby  aaaagg-atgtttgttcccttcttggtgtcttctaaaggcaatgagtactgtcacc---------c
           Chinese tree shrew  aaaaga----ttctttctgttctt-gtgacatctggaaacaatgattcttgtcacc-ccagcaact
             Brush-tailed rat  aaaagatat-tccctttccttcttggtggcatgtccaagcaatactggtagtggataccagtgcct
B D                     Horse  gaagtgtgtgttcttgcccctcttggtggtgtctcaaggccatgactcttgtcacctctgcaact-
B D          White rhinoceros  gacatgtgtgttcttgctcctctcagcggcgtctcaaatccatgacttttgtcacctctgcaact-
B D                   Ferret   aaagcacctgtccttgtccc-cgtgctggaggctcaaagccaggacactcgtcaccccagcaacc-
B D                     Panda  aaagcacatattcgtgtccc-cgtgcttgagtctcaaagccagggcactcgtcaccccagcaact-
               Pacific walrus  aaagcgcgtgttgttgtccc-tgtgctggagtctcgaagccaggatgctcgtca-tccagcagcc-
                 Weddell seal  aaagcacgtgctcttgtccc-catgctggagtctcgaagccaggatgctcgtca-cccagcagcc-
B D                  Elephant  -ggaggagagtgctttctcttcttgg-ggggtcttacagcagcagctgtggccacccacagcgatt
               Domestic goat  ==================================================================
B D                     Sheep  ------------------------------------------------------------------
B D                       Cow  ==================================================================
            Tibetan antelope  ==================================================================
               Big brown bat  ==================================================================
B D                  Microbat  ==================================================================
        David's myotis (bat)  ==================================================================
              Bactrian camel  ==================================================================
B D                    Alpaca  ==================================================================
B D                     Mouse  ==================================================================
B D                       Dog  ==================================================================
B D                       Rat  ==================================================================
                Prairie vole  ==================================================================
B D           Chinese hamster  ==================================================================
              Golden hamster  ==================================================================
                Killer whale  ------------------------------------------------------------------
B D                  Squirrel  ==================================================================
B D                       Cat  ==================================================================
B D            Naked mole-rat  ==================================================================
                  Chinchilla  ==================================================================
B D                Guinea pig  ==================================================================
B D                   Manatee  ==================================================================
B D                 Armadillo  ==================================================================
      Lesser Egyptian jerboa  ==================================================================
            Black flying-fox  ==================================================================
  D  Chinese softshell turtle  ==================================================================
  D           Green seaturtle  ==================================================================
  D            Painted turtle  ==================================================================
B D           Tasmanian devil  ==================================================================
B D                   Wallaby  ==================================================================
B D                   Opossum  ==================================================================
                    Aardvark  ==================================================================
            Cape golden mole  ==================================================================
B D                   Dolphin  ------------------------------------------------------------------
B D        American alligator  ==================================================================

Inserts between block 8 and 9 in window
            Brush-tailed rat 33bp

Alignment block 9 of 451 in window, 131772907 - 131772938, 32 bps 
B D                     Human  cagcacgaccatagcaggtgcc-atgacctgcc
B D                     Chimp  cagcacgaccatagcaggtgcc-atgacctgcc
B D                   Gorilla  cagcatgaccatagcaggtgcc-atgacctgcc
B D                 Orangutan  cagcatgaccatagcaggtgcc-atgacctgcc
B D                    Gibbon  cagcatgaccatagcaggtgcc-atgacctgcc
B D                    Rhesus  cagcatgaccatagcaggtgcc-atgacctgcc
B D       Crab-eating macaque  cagcatgaccatagcaggtgcc-atgacctgcc
B D                    Baboon  cag------------------c-atgacctgcc
B D              Green monkey  cagcatgaccatagcaggtgcc-atgacctgcc
B D                  Marmoset  cagcatgaccgtgccgggtgcc-atggcctgcc
B D           Squirrel monkey  cagcatgaccatgctgggtgcc-acggcctgcc
B D                  Bushbaby  cagca-----------------------atgtg
           Chinese tree shrew  gggcaggacagtggcaggtgcctgtggcctgtc
B D                     Horse  cagcatgacgaagg-------ctaaggcctgac
B D          White rhinoceros  cagcatgatgttggcaggtccccgaggcctgcc
B D                   Ferret   gtgc-tgatgacggcaagtccccagaa-ccgcc
B D                     Panda  gc---------------------agag------
               Pacific walrus  gcgc-tgatgacagcaagtccctagggcccacc
                 Weddell seal  gcgc-tgatgacgacaagtccccagggcccacc
B D                  Elephant  ctgcatgacaagcgtggacacc-ctgggcagag
               Domestic goat  =================================
B D                     Sheep  ---------------------------------
B D                       Cow  =================================
            Tibetan antelope  =================================
               Big brown bat  =================================
B D                  Microbat  =================================
        David's myotis (bat)  =================================
              Bactrian camel  =================================
B D                    Alpaca  =================================
B D                     Mouse  =================================
B D                       Dog  =================================
B D                       Rat  =================================
                Prairie vole  =================================
B D           Chinese hamster  =================================
              Golden hamster  =================================
                Killer whale  ---------------------------------
B D                  Squirrel  =================================
B D                       Cat  =================================
B D            Naked mole-rat  =================================
                  Chinchilla  =================================
B D                Guinea pig  =================================
B D                   Manatee  =================================
B D                 Armadillo  =================================
      Lesser Egyptian jerboa  =================================
            Brush-tailed rat  =================================
            Black flying-fox  =================================
  D  Chinese softshell turtle  =================================
  D           Green seaturtle  =================================
  D            Painted turtle  =================================
B D           Tasmanian devil  =================================
B D                   Wallaby  =================================
B D                   Opossum  =================================
                    Aardvark  =================================
            Cape golden mole  =================================
B D                   Dolphin  ---------------------------------
B D        American alligator  =================================

Alignment block 10 of 451 in window, 131772939 - 131772979, 41 bps 
B D                     Human  t-----------ggccctgcca--cctgggtggga----------ccccag---cgcc-----c-cctaa
B D                     Chimp  t-----------ggccctgcca--cctgggtggga----------ccccag---cgcc-----c-cctaa
B D                   Gorilla  t-----------ggccctgcca--cctgggtggga----------ccccag---cgcc-----c-cctaa
B D                 Orangutan  t-----------ggccctgcca--cctgggtggga----------ccccag---tgcc-----c-cctaa
B D                    Gibbon  t-----------ggccctgcca--cctaggtggga----------ccccag---cacc-----c-cctaa
B D                    Rhesus  t-----------ggtctcgcca--cttgggtagaa----------ccccag---tgcc-----c-cctaa
B D       Crab-eating macaque  t-----------ggtctcgcca--cctgggtagaa----------ccccag---tgcc-----c-cctaa
B D                    Baboon  t-----------ggtctcgcca--cctgggtggaa----------ccccag---tgcc-----c-cctaa
B D              Green monkey  t-----------ggtcttgcta--cctgggtggaa----------ccccag---tgcc-----c-cctaa
B D                  Marmoset  t-----------ggtcctgcca--cctgggtggga----------ccccag---tacg-----c-ta-aa
B D           Squirrel monkey  t-----------ggtcctgcca--cctgggtggga----------ccccag---cacc-----c-ta-aa
B D                  Bushbaby  t-----------gg--ctggca--cccagg--gga----------tcccag-------------------
           Chinese tree shrew  tgaaggccggggggcggtggcc--ggtggcctgtc----------tcccag---ccactctggc-ctggc
B D                     Horse  t-----------ggcac----actctgggcttgcaccaggcgggaccccag---agcc-----cacc--a
B D          White rhinoceros  t-----------ggcag----accctgggctggta-gaggtgggaccccag---agcc-----cacctga
B D                   Ferret   a-----------ggcca----a--cagggctagtg---------------------cc-----c-cccga
B D                     Panda  g-----------ggccg----a--cggggttgggg---------------------ac-----cacctga
               Pacific walrus  g-----------ggctg----a--cggggctggtg---------------------cc-----cacctga
                 Weddell seal  g-----------ggctg----a--tggggctggtg---------------------cc-----cacctga
B D                  Elephant  a-----------tgggctggca--ccgggcaggca----------caagggagcagcc-----c------
B D        American alligator  t-----------ggcctgcccc--cctcaacagcc----------tcccag---tgcc-----c-cctgc
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

                        Human  ctc
                        Chimp  ctc
                      Gorilla  ctc
                    Orangutan  ctc
                       Gibbon  ctc
                       Rhesus  ctc
          Crab-eating macaque  ctc
                       Baboon  ctc
                 Green monkey  ctc
                     Marmoset  ctc
              Squirrel monkey  ctc
                     Bushbaby  ---
           Chinese tree shrew  ctc
                        Horse  cta
             White rhinoceros  ctg
                      Ferret   cga
                        Panda  cag
               Pacific walrus  cgg
                 Weddell seal  tgg
                     Elephant  ---
           American alligator  ccc
                Domestic goat  ===
                        Sheep  ---
                          Cow  ===
             Tibetan antelope  ===
                Big brown bat  ===
                     Microbat  ===
         David's myotis (bat)  ===
               Bactrian camel  ===
                       Alpaca  ===
                        Mouse  ===
                          Dog  ===
                          Rat  ===
                 Prairie vole  ===
              Chinese hamster  ===
               Golden hamster  ===
                 Killer whale  ---
                     Squirrel  ===
                          Cat  ===
               Naked mole-rat  ===
                   Chinchilla  ===
                   Guinea pig  ===
                      Manatee  ===
                    Armadillo  ===
       Lesser Egyptian jerboa  ===
             Brush-tailed rat  ===
             Black flying-fox  ===
     Chinese softshell turtle  ===
              Green seaturtle  ===
               Painted turtle  ===
              Tasmanian devil  ===
                      Wallaby  ===
                      Opossum  ===
                     Aardvark  ===
             Cape golden mole  ===
                      Dolphin  ---

Inserts between block 10 and 11 in window
B D                 Elephant 1bp

Alignment block 11 of 451 in window, 131772980 - 131772980, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
                   Chinchilla  c
B D                     Horse  c
B D          White rhinoceros  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
B D        American alligator  c
               Domestic goat  =
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  -
B D                  Squirrel  =
B D                       Cat  =
B D            Naked mole-rat  =
B D                Guinea pig  =
B D                   Manatee  =
B D                  Elephant  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
B D                  Bushbaby  -
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                    Aardvark  =
            Cape golden mole  =
B D                   Dolphin  -

Alignment block 12 of 451 in window, 131772981 - 131773001, 21 bps 
B D                     Human  cag-cccggccc-ctgaga----------cc-----tc
B D                     Chimp  cag-cccggccc-ctgaga----------cc-----tc
B D                   Gorilla  cag-cccggccc-ctgaga----------cc-----tc
B D                 Orangutan  cag-cccggccc-ctgaga----------cc-----tc
B D                    Gibbon  cag-accagccc-ctggga----------cc-----tc
B D                    Rhesus  cag-cccagccc-ctggga----------cc-----tc
B D       Crab-eating macaque  cag-cccagccc-ctggga----------cc-----tc
B D                    Baboon  cag-cccagccc-ctggga----------cc-----tc
B D              Green monkey  cag-ccgagccc-ctggga----------cc-----tc
B D                  Marmoset  cag-cctggccc-ctggga----------cc-----tc
B D           Squirrel monkey  cag-cctggccc-ctggga----------cc-----tc
B D                  Bushbaby  -----------------------------cc-----tc
           Chinese tree shrew  cag-caggatcc-ctggga----------tg-----cc
                   Chinchilla  ctg-cctgg----cagaga----------cg-----tc
B D                     Horse  cgg-cctggac--at-ggagccccagg--cc-----cc
B D          White rhinoceros  cag-cctggac--ctgggaacctcaagttcc-----cc
B D                   Ferret   ccg-cctggat--gcggga----------cc-----cc
B D                     Panda  cag-cctggat--gcggga----------cc-----cc
               Pacific walrus  cag-cctggac--gcggga----------cc-----cc
                 Weddell seal  cag-cctggac--gcggga----------cc-----cc
                Big brown bat  cagccctggaccgctgcca----------cc-----cc
         David's myotis (bat)  cagccctggaccgctgcca----------cc-----cc
B D                  Microbat  cagccctggaccactgcca----------cc-----cc
B D                  Elephant  tgg-tgaggccc-tcgtgc----------ccaaatgcc
B D        American alligator  cag-cttctcac-cctgga----------ct-----tc
               Domestic goat  ======================================
B D                     Sheep  --------------------------------------
B D                       Cow  ======================================
            Tibetan antelope  ======================================
              Bactrian camel  ======================================
B D                    Alpaca  ======================================
B D                     Mouse  ======================================
B D                       Dog  ======================================
B D                       Rat  ======================================
                Prairie vole  ======================================
B D           Chinese hamster  ======================================
              Golden hamster  ======================================
                Killer whale  --------------------------------------
B D                  Squirrel  ======================================
B D                       Cat  ======================================
B D            Naked mole-rat  ======================================
B D                Guinea pig  ======================================
B D                   Manatee  ======================================
B D                 Armadillo  ======================================
      Lesser Egyptian jerboa  ======================================
            Brush-tailed rat  ======================================
            Black flying-fox  ======================================
  D  Chinese softshell turtle  ======================================
  D           Green seaturtle  ======================================
  D            Painted turtle  ======================================
B D           Tasmanian devil  ======================================
B D                   Wallaby  ======================================
B D                   Opossum  ======================================
                    Aardvark  ======================================
            Cape golden mole  ======================================
B D                   Dolphin  --------------------------------------

Alignment block 13 of 451 in window, 131773002 - 131773019, 18 bps 
B D                     Human  agct--tg----ccatg-----agaatgg
B D                     Chimp  agct--tg----ccatg-----agaatgg
B D                   Gorilla  agct--tg----ccgtg-----agaatgg
B D                 Orangutan  acct--tg----ccatg-----agaatgg
B D                    Gibbon  acct--tg----ccatg-----agaatgg
B D                    Rhesus  acct--tg----ccatg-----agaatgg
B D       Crab-eating macaque  acct--tg----ccatg-----agaatgg
B D                    Baboon  acct--tg----ccatg-----agaatgg
B D              Green monkey  acct--tg----ccatg-----agaatgg
B D                  Marmoset  gcct--tg----ccatg-----agaatgg
B D           Squirrel monkey  gcct--tg----ccatg-----agaatgg
B D                  Bushbaby  ccct--cc----ctgtg-----agaatga
           Chinese tree shrew  -ctt--tg----gtaaa-----agaacaa
                   Chinchilla  agctgaca----ccagg-----aggc---
B D                     Horse  cggc--caccc-ccgggcttagagaatgg
B D          White rhinoceros  gggc--tgccctccgggcttggagaatgg
B D                   Ferret   cagc--------ccgag--------atgt
B D                     Panda  cagc--------ccaag--------atgg
               Pacific walrus  ctcc--------ccgag--------atgg
                 Weddell seal  gtcc--------ccgag--------atgg
                Big brown bat  agcc--------tccag----------ag
         David's myotis (bat)  agcc--------tccag----------ag
B D                  Microbat  agct--------tccag----------ag
B D                  Elephant  cacc--tc----ggagg-----agaacac
               Domestic goat  =============================
B D                     Sheep  -----------------------------
B D                       Cow  =============================
            Tibetan antelope  =============================
              Bactrian camel  =============================
B D                    Alpaca  =============================
B D                     Mouse  =============================
B D                       Dog  =============================
B D                       Rat  =============================
                Prairie vole  =============================
B D           Chinese hamster  =============================
              Golden hamster  =============================
                Killer whale  -----------------------------
B D                  Squirrel  =============================
B D                       Cat  =============================
B D            Naked mole-rat  =============================
B D                Guinea pig  =============================
B D                   Manatee  =============================
B D                 Armadillo  =============================
      Lesser Egyptian jerboa  =============================
            Brush-tailed rat  =============================
            Black flying-fox  =============================
  D  Chinese softshell turtle  =============================
  D           Green seaturtle  =============================
  D            Painted turtle  =============================
B D           Tasmanian devil  =============================
B D                   Wallaby  =============================
B D                   Opossum  =============================
                    Aardvark  =============================
            Cape golden mole  =============================
B D                   Dolphin  -----------------------------

Alignment block 14 of 451 in window, 131773020 - 131773020, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
                   Chinchilla  a
             Brush-tailed rat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Elephant  c
               Domestic goat  =
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  -
B D                  Squirrel  =
B D                       Cat  =
B D            Naked mole-rat  =
B D                Guinea pig  =
B D                   Manatee  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
B D                  Bushbaby  -
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                    Aardvark  =
            Cape golden mole  =
B D                   Dolphin  -

Alignment block 15 of 451 in window, 131773021 - 131773070, 50 bps 
B D                     Human  cctcctgcctcttccctcttctctc----cccaacac--aaaaaatccaccagacc
B D                     Chimp  cctcctgcctcttccctcttctctc----cccaacac--aaaaaatccaccagacc
B D                   Gorilla  cctcctgcctcttccctcttctctc----cccaatac--aaaaaatccaccagacc
B D                 Orangutan  cctcctgcctcttccctcctctctc----cccaacac--aaaaaatccaacagacc
B D                    Gibbon  cctcctgcctcttccctcctctctc----cccaacac--aaaaaatccactagacc
B D                    Rhesus  ccttctgtgtcttccctcctctctc----cccatcac--aaaaaatccaccagacc
B D       Crab-eating macaque  ccttctgtgtcttccctcctctctc----cccatcac--aaaaaatccaccagacc
B D                    Baboon  cctcccgcgtcttccctcctctctc----tccatcac--aaaaaatccaccagacc
B D              Green monkey  cctcctgcgtcttccctcctctctc----cccatcac--aaaaaatccaccagacc
B D                  Marmoset  cctcctgcctcttccctcctctctc----cccatcac--aaaaaatccaccagacc
B D           Squirrel monkey  cctcctgactcttccctcctctctc----cccatcac--aaaaaacccaccagacc
B D                  Bushbaby  -----------------attcaccc----ccc----------aggtccgcctccca
           Chinese tree shrew  ctccttgccccttccctcatctc-------cagtaac--aaaaaaaaaaaaaaaaa
B D            Naked mole-rat  cctcctgcttcttccctcacctctt----cttttcac--t-----tccagt-----
                   Chinchilla  cctgctgctgcttctctcact------------------------tccagc-----
             Brush-tailed rat  cctcctgcttcttttctcacc------------------------tccagc-----
B D                     Horse  cctca-gcctctcccctcacctcccaactgcagtcat--agaaaattga-------
B D          White rhinoceros  cctca-gcctctcccctcgcctcccacctccagtcac--agaaaatcaa-------
B D                   Ferret   gctcctgcctctcccaccagctctcgcgtacagtccc-----aaagcca-------
B D                     Panda  cctcctgcctctcccactggctctcacttcccacccc--caaaaaccaa-------
               Pacific walrus  cctcctgcctctcccaccggctctcacttcctgtccc-----aaaccaa-------
                 Weddell seal  cctcctgcctctcacaccggctctcactgcccgtccc-----aaaccaa-------
                Big brown bat  cttccagccccttcc-ctgcctcttacctcccatcacacaaaaaatcaa-------
         David's myotis (bat)  cttccagccccttcc-ctgcctctcacctcccatcacaaaaaaaatcaa-------
B D                  Microbat  cttccagccccttcc-ctgcctctcacctcccatcac-aaaaaaatcaa-------
B D                  Elephant  tttcatctccctgcccccaccactcacc-tccatcac-------acc---------
               Domestic goat  ========================================================
B D                     Sheep  --------------------------------------------------------
B D                       Cow  ========================================================
            Tibetan antelope  ========================================================
              Bactrian camel  ========================================================
B D                    Alpaca  ========================================================
B D                     Mouse  ========================================================
B D                       Dog  ========================================================
B D                       Rat  ========================================================
                Prairie vole  ========================================================
B D           Chinese hamster  ========================================================
              Golden hamster  ========================================================
                Killer whale  --------------------------------------------------------
B D                  Squirrel  ========================================================
B D                       Cat  ========================================================
B D                Guinea pig  ========================================================
B D                   Manatee  ========================================================
B D                 Armadillo  ========================================================
      Lesser Egyptian jerboa  ========================================================
            Black flying-fox  ========================================================
  D  Chinese softshell turtle  ========================================================
  D           Green seaturtle  ========================================================
  D            Painted turtle  ========================================================
B D           Tasmanian devil  ========================================================
B D                   Wallaby  ========================================================
B D                   Opossum  ========================================================
                    Aardvark  ========================================================
            Cape golden mole  ========================================================
B D                   Dolphin  --------------------------------------------------------

Alignment block 16 of 451 in window, 131773071 - 131773135, 65 bps 
B D                     Human  caaagatcaatgag--tcaaaacagcggca--gaggaggaaggcaaaagc-tactgtggatgcagttcct
B D                     Chimp  caaagatcaatgag--tcaaaacagcggca--gaggaggaaggcaaaagc-tactgtggatgcagttcct
B D                   Gorilla  caaagatcaatgag--tcaaaacagcggca--gaggaggaaggcaaaagc-tactgtggatgcagttccc
B D                 Orangutan  caaagatcaatgag--tcaaaacagcagca--gagaaggaaggcaaaagc-tactgtggatgcaggtcct
B D                    Gibbon  caaagatcaacgag--tcaaaacggcagca--gaggaggaaggcaaaagc-tactgtggatgcaggtcct
B D                    Rhesus  caaagatcaatgag--tccaaacggcagca--gaggaggaagccaaaagc-cactgtggatgcaggtacc
B D       Crab-eating macaque  caaagaccaatgag--tccaaacggcagca--gaggaggaagccaaaagc-cactgtggatgcaggtacc
B D                    Baboon  caaagatcaatgag--tccaaacggcggca--gaggaggaagccaaaagc-cactgtggatgcaggtacc
B D              Green monkey  caaagatcaatgag--tcaaaacagcggca--gaggaggaaggcaaaagc-cactgtggacgcagttacc
B D                  Marmoset  caaagacc-acgag--tctgagcgg-ggca--gaggaaggaggcaaaagc-tactgcagatgcggcttcg
B D           Squirrel monkey  caaagatcaatgag--tcagagcagcggca--gaggaagaaggcgaaagc-tattgcggatgtggcttca
B D                  Bushbaby  gaaagaccaccacg--tggaaacag---aa--ggagaggaaggtatatgg-cactctggacacagcttc-
           Chinese tree shrew  aaaaaaaaaaccagcttcagaacagcagaa--ga-aagaaaggtgataac-tactccagatgcaattttt
B D            Naked mole-rat  catagagcagtaa---ctaacacag----ggcgaggaggaaggtgaaagc-cagtccagatg--gatttc
B D                Guinea pig  catagagcagtaa---ccaacacag----a--gaggcagaagacaaaagc-cagtccagatg--ggtttc
                   Chinchilla  cacagagcagtaa---ccaacacag----a--gagcaggaaaacaaaagc-cagtgtagatg--ggtttc
             Brush-tailed rat  cacagagcagtaa---ccaacactg----a--gaggaggaaggcaaaaac-cagcccacatg--ggtttc
B D                     Horse  -------cggagaa-----aaacaaccaga--gagaaag-aagggaaaac-cagtctagacatggtttcc
B D          White rhinoceros  -------cagagaa-----aaacaacggga--gagaaag-aagcgaaaac-cactctggacgtagctttc
B D                   Ferret   -------acgtgga-----aagcaa--gga--gagaa---aggtcaggac-acctgcggctgtggtctct
B D                     Panda  -------cagtgaa-----aaacaa--gga--aagaa---aggtcagaat-tgctctgggtgtcatttct
               Pacific walrus  -------cagtgaa-----aaacaa--gga--gagaaaggaggttggaac-tgctctggatgtcgtttct
                 Weddell seal  -------cagtgaa-----aaacaa--gga--gacaaaggaggtcggaaa-tgctctgggtgtcgtttct
                Big brown bat  -------cagtgag-----aaacca--cgc--aagagag-agatgagaaagtgctctgggtggagc----
         David's myotis (bat)  -------cagtgag-----aaacca--tgc--aagagaa-agatgaaaaagtgctctctgtggagc----
B D                  Microbat  -------cagtgag-----aaacca--tgc--aagagaa-agatgaaaaggtgctctgtgtggagc----
B D                  Elephant  -----------------------agcaata--agtaagggaggtgggg---ctctctggacgtagtttct
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

Inserts between block 16 and 17 in window
B D                  Ferret  1026bp

Alignment block 17 of 451 in window, 131773136 - 131773140, 5 bps 
B D                     Human  tgctc
B D                     Chimp  ttctc
B D                   Gorilla  ttctc
B D                 Orangutan  ttctc
B D                    Gibbon  ttctc
B D                    Rhesus  ttctc
B D       Crab-eating macaque  ttctc
B D                    Baboon  ttctc
B D              Green monkey  ttctc
B D                  Marmoset  ttctc
B D           Squirrel monkey  ttccc
B D                  Bushbaby  -tcct
           Chinese tree shrew  tccca
B D            Naked mole-rat  ttcca
B D                Guinea pig  ttcca
                   Chinchilla  ttcca
             Brush-tailed rat  ttccg
B D                     Horse  ttccg
B D          White rhinoceros  ttccg
B D                     Panda  -ttca
               Pacific walrus  -ttca
                 Weddell seal  -tcca
                Big brown bat  tgcta
         David's myotis (bat)  tgcta
B D                  Microbat  tgcta
B D                  Elephant  tccca
               Domestic goat  =====
B D                     Sheep  -----
B D                       Cow  =====
            Tibetan antelope  =====
              Bactrian camel  =====
B D                    Alpaca  =====
B D                     Mouse  =====
B D                       Dog  =====
B D                       Rat  =====
                Prairie vole  =====
B D           Chinese hamster  =====
              Golden hamster  =====
                Killer whale  -----
B D                   Ferret   =====
B D                  Squirrel  =====
B D                       Cat  =====
B D                   Manatee  =====
B D                 Armadillo  =====
      Lesser Egyptian jerboa  =====
            Black flying-fox  =====
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====
  D            Painted turtle  =====
B D           Tasmanian devil  =====
B D                   Wallaby  =====
B D                   Opossum  =====
                    Aardvark  =====
            Cape golden mole  =====
B D                   Dolphin  -----

Alignment block 18 of 451 in window, 131773141 - 131773144, 4 bps 
B D                     Human  tgtg
B D                     Chimp  tgtg
B D                   Gorilla  tgtg
B D                 Orangutan  tgtg
B D                    Gibbon  tgtg
B D                    Rhesus  tgtg
B D       Crab-eating macaque  tgtg
B D                    Baboon  tgtg
B D              Green monkey  tgtg
B D                  Marmoset  agtg
B D           Squirrel monkey  ggtg
B D                  Bushbaby  ggcc
           Chinese tree shrew  agtt
B D            Naked mole-rat  ggtc
B D                Guinea pig  tgtc
                   Chinchilla  tgtc
             Brush-tailed rat  tgtc
B D                     Horse  tgtt
B D          White rhinoceros  tgtt
B D                     Panda  t---
               Pacific walrus  tgtt
                 Weddell seal  tgtt
                Big brown bat  tgtt
         David's myotis (bat)  cgct
B D                  Microbat  tgct
B D                  Elephant  tgtg
B D                   Manatee  tgtt
               Domestic goat  ====
B D                     Sheep  ----
B D                       Cow  ====
            Tibetan antelope  ====
              Bactrian camel  ====
B D                    Alpaca  ====
B D                     Mouse  ====
B D                       Dog  ====
B D                       Rat  ====
                Prairie vole  ====
B D           Chinese hamster  ====
              Golden hamster  ====
                Killer whale  ----
B D                   Ferret   ====
B D                  Squirrel  ====
B D                       Cat  ====
B D                 Armadillo  ====
      Lesser Egyptian jerboa  ====
            Black flying-fox  ====
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
B D                   Opossum  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                   Dolphin  ----

Inserts between block 18 and 19 in window
B D                 Elephant 399bp

Alignment block 19 of 451 in window, 131773145 - 131773145, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  c
B D           Squirrel monkey  g
B D                  Bushbaby  c
           Chinese tree shrew  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                     Horse  a
B D          White rhinoceros  a
               Pacific walrus  a
                 Weddell seal  g
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                   Manatee  a
                     Aardvark  a
               Domestic goat  =
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  =
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                     Panda  -
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  -
B D                   Ferret   =
B D                  Squirrel  =
B D                       Cat  =
B D                  Elephant  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
            Cape golden mole  =
B D                   Dolphin  -

Alignment block 20 of 451 in window, 131773146 - 131773160, 15 bps 
B D                     Human  tttggagcctc-tga-a
B D                     Chimp  tttggagcctc-tga-a
B D                   Gorilla  tttggagcctc-tga-a
B D                 Orangutan  tttggagcctc-tga-a
B D                    Gibbon  tttggagcctc-tga-a
B D                    Rhesus  tttggagcctc-tga-c
B D       Crab-eating macaque  tttggagcctc-tga-c
B D                    Baboon  tttggagcctc-tga-c
B D              Green monkey  tttggagcctc-tga-c
B D                  Marmoset  tttggagcctc-cga-a
B D           Squirrel monkey  tct-gagcctc-gga-a
B D                  Bushbaby  tcttccccttc-tga-a
           Chinese tree shrew  ttttgaccctc-tga-a
B D            Naked mole-rat  ctt-caacccc-agg-a
B D                Guinea pig  ctt-caacccc-agg-t
                   Chinchilla  ctc-caacccc-agg-a
             Brush-tailed rat  ctt-caatccc-agg-a
B D                     Horse  ttt-cagcctg-ctgaa
B D          White rhinoceros  ttt-cagccct-ctgaa
B D                     Panda  ----cagccct-cgg-g
               Pacific walrus  ttc-caaccct-ctg-a
                 Weddell seal  ttc-caaccct-ctg-a
                Big brown bat  ttt-taacctc-cga-a
         David's myotis (bat)  ttt-taacctcggga-a
B D                  Microbat  ttt-taacctc-cga-a
B D                  Elephant  ---------tt-tgg-a
B D                   Manatee  ---------tc-tga-c
                     Aardvark  ttgtgaccctc-tga-g
               Domestic goat  =================
B D                     Sheep  -----------------
B D                       Cow  =================
            Tibetan antelope  =================
              Bactrian camel  =================
B D                    Alpaca  =================
B D                     Mouse  =================
B D                       Dog  =================
B D                       Rat  =================
                Prairie vole  =================
B D           Chinese hamster  =================
              Golden hamster  =================
                Killer whale  -----------------
B D                   Ferret   =================
B D                  Squirrel  =================
B D                       Cat  =================
B D                 Armadillo  =================
      Lesser Egyptian jerboa  =================
            Black flying-fox  =================
  D  Chinese softshell turtle  =================
  D           Green seaturtle  =================
  D            Painted turtle  =================
B D           Tasmanian devil  =================
B D                   Wallaby  =================
B D                   Opossum  =================
            Cape golden mole  =================
B D                   Dolphin  -----------------

Inserts between block 20 and 21 in window
B D                 Elephant 17bp
B D                  Manatee 7bp

Alignment block 21 of 451 in window, 131773161 - 131773171, 11 bps 
B D                     Human  tgtgccatctc--
B D                     Chimp  tgtgccatctc--
B D                   Gorilla  tgtgccatctc--
B D                 Orangutan  tgtgccatctc--
B D                    Gibbon  tgtgccatctc--
B D                    Rhesus  tatgccatctc--
B D       Crab-eating macaque  tatgccatctc--
B D                    Baboon  tgtgccatctc--
B D              Green monkey  tgtgccatc----
B D                  Marmoset  tgtgccgtatc--
B D           Squirrel monkey  ggggccatttc--
B D                  Bushbaby  tgtgtc----c--
           Chinese tree shrew  tatgccatatc--
B D            Naked mole-rat  tatgctttgcc--
B D                Guinea pig  tacgctgtgcc--
                   Chinchilla  tcttctgtgtc--
             Brush-tailed rat  tacactgtccc--
B D                     Horse  tgtgccagatc--
B D          White rhinoceros  tgtgccagatt--
B D                     Panda  tgtgtcatctc--
               Pacific walrus  cgtgtcatatc--
                 Weddell seal  cgtgtcatatc--
                Big brown bat  ggtgc--------
         David's myotis (bat)  ggtgccacggg--
B D                  Microbat  ggtgccacggg--
B D                  Elephant  cccatgaa--cca
B D                   Manatee  tgcaccaaatcta
             Cape golden mole  tgtaccaaatctg
                     Aardvark  tgcaccaaatcca
               Domestic goat  =============
B D                     Sheep  -------------
B D                       Cow  =============
            Tibetan antelope  =============
              Bactrian camel  =============
B D                    Alpaca  =============
B D                     Mouse  =============
B D                       Dog  =============
B D                       Rat  =============
                Prairie vole  =============
B D           Chinese hamster  =============
              Golden hamster  =============
                Killer whale  -------------
B D                   Ferret   =============
B D                  Squirrel  =============
B D                       Cat  =============
B D                 Armadillo  =============
      Lesser Egyptian jerboa  =============
            Black flying-fox  =============
  D  Chinese softshell turtle  =============
  D           Green seaturtle  =============
  D            Painted turtle  =============
B D           Tasmanian devil  =============
B D                   Wallaby  =============
B D                   Opossum  =============
B D                   Dolphin  -------------

Inserts between block 21 and 22 in window
          Chinese tree shrew 2bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                    Panda 949bp
                Weddell seal 520bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 22 of 451 in window, 131773172 - 131773172, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                     Horse  c
B D          White rhinoceros  c
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
               Domestic goat  =
B D                     Sheep  -
B D                       Cow  =
            Tibetan antelope  =
               Big brown bat  -
              Bactrian camel  =
B D                    Alpaca  =
B D                     Mouse  =
B D                     Panda  =
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
                Killer whale  -
B D                   Ferret   =
B D                  Squirrel  =
B D                       Cat  =
              Pacific walrus  -
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                Weddell seal  =
B D                   Dolphin  -
B D              Green monkey  -

Alignment block 23 of 451 in window, 131773173 - 131773255, 83 bps 
B D                     Human  gtttatttcgtaggcttttaaaa--------tattttg-ctgccaaaatcttctatagaagatttgtaat
B D                     Chimp  gtttatttcgtaggcttttaaaa--------tattttg-ctgccaaaatcttctatagaagatttgcaat
B D                   Gorilla  gtttatttcgtaggctttttaaa------ttttttttg-ctgccaaaatcttctatagaagatttgtaat
B D                 Orangutan  gtttatttcataggttttttaaa------tttttttta-ctgctaaaatcttctatagaagatttgtaat
B D                    Gibbon  gtttatttcgcaggctttttaaa------tttttttta-ctgccaaaatcttctacagaagattcgtaat
B D                    Rhesus  gtttacttcataggcgtttttga------tttttttta-ctgccaaaatcttctacagaagatttataat
B D       Crab-eating macaque  gtttacttcataggcgtttttga------tttttttta-ctgccaaaatcttctacagaagatttataat
B D                    Baboon  gtttacttcataggcgtttttga------tttttttta-ctgccaaaatcttctacagaagatttataat
B D              Green monkey  ---tacttcataggcgtttttga------tttttttta-ctgccaaaatcttctacagaagatttataat
B D                  Marmoset  gtttatttcataagcttttttga----tttttttttaa-ctgccaaaac---ctacagaaggtttataat
B D           Squirrel monkey  gtgtatttcataagcttttttga------tgtttttaa-ctgccaaaaccttctacagaaggtttataat
B D                  Bushbaby  gttcatttcggaggctattttga------tttttttcacctgtcagaatcttctataga---tttataat
           Chinese tree shrew  gtttatttcatagactattttga------tttttttaa-ctgtcaaaatcttctacaaaaaatttatagt
B D            Naked mole-rat  gtttaattcat-ggctctttttaactttttttttttta-ctgtcaaagt----gactgaagatttataat
B D                Guinea pig  atttagtttat-ggc--------------tttttttta-ttgtcaaatc----aataaaagatttataat
                   Chinchilla  cttttgttcat-ggctcttttaa----cttttttttta-ctgtcaaaac---------aagatttatagt
             Brush-tailed rat  aagcagttcat-ggctcctttaaac--tttttttttta-ctgtcaaaac----tatagaagatttataat
B D                     Horse  ggttatttcataggctactgtga------ttctttgaa-cagta-aaatcttctacagaa---ttataat
B D          White rhinoceros  atttatttcaaaggctactgtga------tttttttaa-ctgtc-aaatcttctacagaa---ttacaat
               Pacific walrus  ----------------------------------------------------------------------
                Big brown bat  tcttatgtcataggccattttaa------ttttttcaa-ctgtcaaaatctcctacagaa---ttataac
         David's myotis (bat)  tcttatgtcataggccattttta-------tttttcaa-ctgtcaaaatctcctccagaa---tgataac
B D                  Microbat  tcttatgtcataggccattttga-------tttttcaa-ctgtcaaaacctcctccagaa---ttataac
B D                  Elephant  atttattccattgaccgttttga--------ttgttcg-ctgtcaataccttgggcagaacaattataac
B D                   Manatee  atttattcccttggcagttttga--------gggtttg-ctgtcaatatctcggacagaacagttatgac
             Cape golden mole  attcatttcattgaccgttttga--------ttgttta-ctgtgaatatattggacag-acaattataac
                     Aardvark  atccatttcattgactgtttggg--------ttgtt-a-ctgtcaacatctt--------caatgatgac
B D                 Armadillo  gtctgtttcagggactgttccca--------tagctca-ccatcaaaaccttctacagaggaactgccat
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

                        Human  tttaacacaggcccctaaatca
                        Chimp  tttaacacaggcccctaaatca
                      Gorilla  tttaacacaggcccctaaatca
                    Orangutan  tttaacacaggcccctaaatca
                       Gibbon  tttaacacaggcccctaaatca
                       Rhesus  tttaacacaggcccctaaatct
          Crab-eating macaque  tttaacacaggcccctaaatct
                       Baboon  tttaacacaggcccctaaatca
                 Green monkey  tttaacacaggcccctaaatca
                     Marmoset  tttaacaccggcgcctaaatcg
              Squirrel monkey  tttaacaccggcgcctaaatca
                     Bushbaby  attaacacaggcccctaagttg
           Chinese tree shrew  tttaacactggccactaaatta
               Naked mole-rat  cttgatactggcccc-aaatca
                   Guinea pig  tttgatattggcccc-aaatca
                   Chinchilla  tttgatactggctcc-aaatca
             Brush-tailed rat  tt--------------------
                        Horse  tttaacactgacccctaaataa
             White rhinoceros  tttaacactggcccccaaataa
               Pacific walrus  ------------------gtga
                Big brown bat  tttaaccctggcccctaaataa
         David's myotis (bat)  cttaaccctggcccctaaataa
                     Microbat  tttaaccctggcccctaaataa
                     Elephant  ttcaaccctggcccctaagtca
                      Manatee  ttccaccctggcccctaaatcg
             Cape golden mole  tttaacactgccgcctaaatca
                     Aardvark  tccagccttggtccctaaatcg
                    Armadillo  tttaaccccggcccctaggcca
                Domestic goat  ======================
                        Sheep  ----------------------
                          Cow  ======================
             Tibetan antelope  ======================
               Bactrian camel  ======================
                       Alpaca  ======================
                        Mouse  ======================
                        Panda  ======================
                          Dog  ======================
                          Rat  ======================
                 Prairie vole  ======================
              Chinese hamster  ======================
               Golden hamster  ======================
                 Killer whale  ----------------------
                      Ferret   ======================
                     Squirrel  ======================
                          Cat  ======================
       Lesser Egyptian jerboa  ======================
             Black flying-fox  ======================
     Chinese softshell turtle  ======================
              Green seaturtle  ======================
               Painted turtle  ======================
              Tasmanian devil  ======================
                      Wallaby  ======================
                      Opossum  ======================
                 Weddell seal  ======================
                      Dolphin  ----------------------

Inserts between block 23 and 24 in window
B D                Armadillo 1173bp

Alignment block 24 of 451 in window, 131773256 - 131773280, 25 bps 
B D                     Human  ttccacgtattgatcacaaagaaaa
B D                     Chimp  ttccacgtattgatcacaaagaaaa
B D                   Gorilla  ttccacgtattgatcacaaagaaaa
B D                 Orangutan  ttccacgtattgatcacaaagaaaa
B D                    Gibbon  ttccacatattgatcacaaagaaaa
B D                    Rhesus  ttccaagtattgatcacagagaaaa
B D       Crab-eating macaque  ttccaagtattgatcacagagaaaa
B D                    Baboon  ttccacatattgatcacagagaaaa
B D              Green monkey  ttccacatattgatcacagagaaaa
B D                  Marmoset  ctgcacgtactgatcaca-agaaaa
B D           Squirrel monkey  ttccacatattgatcaca-agaaaa
B D                  Bushbaby  ttctacataataaccacaaagaaag
           Chinese tree shrew  ttcaacatgttgaccacaaagaaaa
B D            Naked mole-rat  ttcaatgtaccaaccacaaagaagg
B D                Guinea pig  ttcaatgtgtcaacctcaaagaagg
                   Chinchilla  ttcagtgtatcaaccacaaggaaga
             Brush-tailed rat  ------------------------a
B D                     Horse  tcccaggtactgaccacagacaaaa
B D          White rhinoceros  ttcaatgtactgaccacagacaaaa
               Pacific walrus  ttcaaagttttgactgcagcccaga
                Big brown bat  ctcaacgtgctaaccacaaaccaaa
         David's myotis (bat)  ttcaatgtgctaaccaccaaccaaa
B D                  Microbat  ttcaa--tgctaaccaccaaccaaa
B D                  Elephant  ttaaatgtattgaccacaaaggaaa
B D                   Manatee  ttaaacttattgaccacaaaggaaa
             Cape golden mole  ttaagcctattgatcacaaaggaaa
                     Aardvark  tta--ccgactgaccacca--ggca
               Domestic goat  =========================
B D                     Sheep  -------------------------
B D                       Cow  =========================
            Tibetan antelope  =========================
              Bactrian camel  =========================
B D                    Alpaca  =========================
B D                     Mouse  =========================
B D                     Panda  =========================
B D                       Dog  =========================
B D                       Rat  =========================
                Prairie vole  =========================
B D           Chinese hamster  =========================
              Golden hamster  =========================
                Killer whale  -------------------------
B D                   Ferret   =========================
B D                  Squirrel  =========================
B D                       Cat  =========================
B D                 Armadillo  =========================
      Lesser Egyptian jerboa  =========================
            Black flying-fox  =========================
  D  Chinese softshell turtle  =========================
  D           Green seaturtle  =========================
  D            Painted turtle  =========================
B D           Tasmanian devil  =========================
B D                   Wallaby  =========================
B D                   Opossum  =========================
                Weddell seal  =========================
B D                   Dolphin  -------------------------

Alignment block 25 of 451 in window, 131773281 - 131773370, 90 bps 
B D                     Human  gcgaactgtgacatctctttggt--cacacc-tccgctggctcact------------------------
B D                     Chimp  gcgaactgtgacatctctttggt--cacatc-tccgctggctcact------------------------
B D                   Gorilla  gcgaactgtgacatctctttggt--cacacg-tccactggctcact------------------------
B D                 Orangutan  gcgaactgtgacatctctttggt--cacccc-tctgctggctcact------------------------
B D                    Gibbon  gcgagctgtgacatctctttggt--cacacc-tccgctggctcact------------------------
B D                    Rhesus  gcgaaccatggcatctctttggt--cacacc-tccgccggctcact------------------------
B D       Crab-eating macaque  gcgaaccatggcatctctttggt--cacacc-tccgccggctcact------------------------
B D                    Baboon  gggaactgtgacatctctttggt--cacacc-tccgccggctcact------------------------
B D              Green monkey  gcgaactgtggcatctctttggt--cacacc-tccgccggctcact------------------------
B D                  Marmoset  gagagctgtgacgtctctttggt--cacacc-tccactgcttcacc------------------------
B D           Squirrel monkey  gcgaactgtgacatctctttggt--cacccc-tccagtgcttcact------------------------
B D                  Bushbaby  gtgaagtgtgacatctctgtagt--cacacc-tctgctggctcccc------------------------
           Chinese tree shrew  gcaaattgtagcatgtctttggc--cacact-tttgcaggtttaat------------------------
B D            Naked mole-rat  g-aaactgtaatatctctttagc--cacact-tctgctggct-aacaatagcccaggatagggctgggga
B D                Guinea pig  g-aaactgtagtttatactttgt--cacact-tctgccagtt-aat------------------------
                   Chinchilla  g-aaactgcagtttctctctggc--cacact-tctgctggtt-aat------------------------
             Brush-tailed rat  g-acactgtagtttctctttggc--catact-tctactggtt-acc------------------------
B D                     Horse  gccaactgtgaggtctccctggt--cacgcc-tcggctgccttagc------------------------
B D          White rhinoceros  gcaagccgtgccgtctctttg----ctcttt-tccgatggtttaac------------------------
               Pacific walrus  gcggactgtgacagccccggggtcactcgct-gctggtggcccaac------------------------
             Black flying-fox  gtgaacgctgacgtcgct--ggt--cccgcc-tctgcggg-ttcac------------------------
                Big brown bat  gcaaatggtgacatctcccgggt--cacccc-tctgccag-tcagc------------------------
         David's myotis (bat)  gcaaacggtgacatctcctgggt--caccccatctgccag-tcagc------------------------
B D                  Microbat  gcaaacggtgacatctcctgggt--caccccatccgccag-tcagc------------------------
B D                  Elephant  acaag-cagggtgctcttttgat--aacacc-tc------------------------------------
B D                   Manatee  acaag-caggatgctctttgggc--cacacc-tc------------------------------------
             Cape golden mole  acaagccaagataccc--tgagt--catgcc-tc------------------------------------
                     Aardvark  gtaagccaggatgctcttctggc--ctcacc-tc------------------------------------
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
               Naked mole-rat  tttacctcagaggttctggtgcctgtggtgcaagcacaaggtaccaagttagatccacggtaccaaaaca
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ----------------------------------------------------------------------

                        Human  -cgt-aatcccggggatgcggctgttttgtaagtaaacagggag-ggagg
                        Chimp  -cgt-aatcccggggatgcggctgttttgtaagtaaacagggag-ggagg
                      Gorilla  -cat-aatcccggggacgcggctgtttcgtaagtaagcagggag-g----
                    Orangutan  -agt-aatcccggggatgtggctgttttgtaagtaaacagggag-ggagg
                       Gibbon  -cgt-aatcccggggatgcggctgttttgtaagtaaacagggag-ggaga
                       Rhesus  -agtaaatcccagggatgcagctgttttgtaggtaaacagtgag-ggacg
          Crab-eating macaque  -agt-aatcccagggatgcagctgttttgtaggtaaacagtgag-ggacg
                       Baboon  -agt-aatcccagggatgcagctgttttgtaggtaaacggggag-ggaca
                 Green monkey  -agt-aatcccagggatgcggctgttttgtaggtaaacagggag-ggacg
                     Marmoset  -agt-a-----------ggagctgttctgtaagtaaatagctag-ggagg
              Squirrel monkey  -agt-a-----------gtagctgttttataagtaaatagccag-ggagg
                     Bushbaby  -a---cagcccagg-----------------------cagtgag-ggagg
           Chinese tree shrew  -gat-a-gctcaggaatatga-gatttcataagtaaataaagag-ggaag
               Naked mole-rat  aaat-agcccaggatatcaggcagtttcacaagtgatgagggag-aaagg
                   Guinea pig  -aat-ggcccaggatatcgggcagttttataagtaaggaggaaa-aaagg
                   Chinchilla  -agt-agccaaaaatatcaggcagttttacaagtgatgaggaag-aaagg
             Brush-tailed rat  -aat-agcccaaaatgtcaggtggttttataaatggtgagaaaacaaagg
                        Horse  -aat-agcccgggacatgaggctgttgtgtaaggaaataatgag-ggagg
             White rhinoceros  -aac-agcccagaacacgaggctgttttgttaggaaataatgag-agagg
               Pacific walrus  -cgt-gt----ggccctgagaccggc-cgtaaaccaacagtgag-ggagg
             Black flying-fox  -ggt-cgtggacgg-gcgaggtt----cacg-ggacacgagggg-ggagg
                Big brown bat  -act-gccgcgctacacgaggctgcagcact-gccgatgaccag-agagg
         David's myotis (bat)  -act-gctgcactacacgaggctgcagcact-gccgatggccag-ggagg
                     Microbat  -act-gctgcactacacgaggctgcagcact-gccgatggccag-ggagg
                     Elephant  -----agcccagtacatgaaactg--tcatacgtaaataatgag-gaaga
                      Manatee  -----aggccaggacgtgagactgtctcataagtaaataacgag-gaggg
             Cape golden mole  -----agcccaggacctaagactgtcttttaagtaaacagtgag-gaagg
                     Aardvark  -----agcccaggaca-gagaccatctcataagtagataatgag-gaagg
                Domestic goat  ==================================================
                        Sheep  --------------------------------------------------
                          Cow  ==================================================
             Tibetan antelope  ==================================================
               Bactrian camel  ==================================================
                       Alpaca  ==================================================
                        Mouse  ==================================================
                        Panda  ==================================================
                          Dog  ==================================================
                          Rat  ==================================================
                 Prairie vole  ==================================================
              Chinese hamster  ==================================================
               Golden hamster  ==================================================
                 Killer whale  --------------------------------------------------
                      Ferret   ==================================================
                     Squirrel  ==================================================
                          Cat  ==================================================
                    Armadillo  ==================================================
       Lesser Egyptian jerboa  ==================================================
     Chinese softshell turtle  ==================================================
              Green seaturtle  ==================================================
               Painted turtle  ==================================================
              Tasmanian devil  ==================================================
                      Wallaby  ==================================================
                      Opossum  ==================================================
                 Weddell seal  ==================================================
                      Dolphin  --------------------------------------------------

Inserts between block 25 and 26 in window
B D                    Horse 4bp
B D         White rhinoceros 4bp
              Pacific walrus 733bp
            Black flying-fox 4bp
               Big brown bat 4bp
        David's myotis (bat) 4bp
B D                 Microbat 4bp

Alignment block 26 of 451 in window, 131773371 - 131773425, 55 bps 
B D                     Human  g------------aa------ctgactgcttggagccaggaacagcactgtccatt--taaac-------
B D                     Chimp  g--------aactaa------ctgactgctcggagccaggaacagcactgtccatt--taaaa-------
B D                   Gorilla  -----------------------gactgcttggagccaggaacagcactgtccatt--taaaa-------
B D                 Orangutan  g------------aa------ctgactgctcagagccaggaacagtactgtccatt--taaaa-------
B D                    Gibbon  g----agggagggaa------ctgactgcttggagccaggaatggcactgtccatt--taaaa-------
B D                    Rhesus  gatggagggagggaa------ctgactgctcagagccagggacagcaccgtccatt--taaaa-------
B D       Crab-eating macaque  gatggagggagggaa------ctgactgctcagagccagggacagcaccgtccatt--taaaa-------
B D                    Baboon  gagggagggagggaa------ctgactgctcagagccagggacagcaccgtccatt--taaaa-------
B D              Green monkey  gagggagggagggaa------ctgactgctcagagccagggacagcaccgtccatt--taaaa-------
B D                  Marmoset  gaaggagggagggac------ctgaccgctgggagccagggatggcacagtccatt--taaaa-------
B D           Squirrel monkey  ggaggagggagggtc------ctgactgctgggagcccgggacggcaaagtccatt--taaaa-------
B D                  Bushbaby  a--------agggga------caggccacacggcac-----accccgtgatccatt--ttaaa-------
           Chinese tree shrew  a--------agggaa------ttgactaaacagaat-----ataatatagttcatttcttaca-------
B D            Naked mole-rat  g------------aa------gtaactaacgagcat-----acagcatgatctgtt--ctaaa-------
B D                Guinea pig  g------------aa------gtgactatagggggt-----acagtatacactgtt--ctaaa-------
                   Chinchilla  g------------aa------atgactaaagagcat-----acagcataatccatt--ctaaa-------
             Brush-tailed rat  g------------aa------gtgactaaatggcat-----acagcataatccgtt--ctaaa-------
B D                     Horse  ------------gag------ttgaccaaaaagaat-----gtcatacagtccatt--ttaaa-------
B D          White rhinoceros  ------------gaa------ttgaccaagtagaat-----gcgatgtagtccatt--ttaaa-------
             Black flying-fox  -------------gaagggggtcagctaaacag-ac-----gccctgc--cccccg--tcaaaatgtcct
                Big brown bat  -------------ga------ctgaccaggcag-ac-----agggtgcagcccacg--ccgaa-------
         David's myotis (bat)  -------------ga------ctgaccaggtag-ac-----aaggtgcagcccccg--ctgaa-------
B D                  Microbat  -------------ga------ctgaccaggtag-ac-----agggtgcagccccca--ctgaa-------
B D                  Elephant  ----gaggaacggtg------tttaccagctagaggt----ggactatagcccctt--ttaag-------
B D                   Manatee  ----gaggtagggtg------ctgaccacctagagg-----gggctctagtccgtt--ttaaa-------
             Cape golden mole  ----gaga--------------tgactaactggaag-----atgctattgtccatt--ttaaa-------
                     Aardvark  ----gagcacggcag------ctgacaggccagca------acacgatagtccatt--tgaag-------
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                   Ferret   ======================================================================
B D                  Squirrel  ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

                        Human  -gat------------------------------------------------------------------
                        Chimp  -gat------------------------------------------------------------------
                      Gorilla  -gat------------------------------------------------------------------
                    Orangutan  -gat------------------------------------------------------------------
                       Gibbon  -gat------------------------------------------------------------------
                       Rhesus  -gat------------------------------------------------------------------
          Crab-eating macaque  -gat------------------------------------------------------------------
                       Baboon  -gat------------------------------------------------------------------
                 Green monkey  -gat------------------------------------------------------------------
                     Marmoset  -tat------------------------------------------------------------------
              Squirrel monkey  -tat------------------------------------------------------------------
                     Bushbaby  -cat------------------------------------------------------------------
           Chinese tree shrew  -aat------------------------------------------------------------------
               Naked mole-rat  -attctttttttttttttttttttcggtaccagggatcaaacttgggaccttgtgcttgtgagtcctaaa
                   Guinea pig  -att------------------------------------------------------------------
                   Chinchilla  -ttg------------------------------------------------------------------
             Brush-tailed rat  -ttt------------------------------------------------------------------
                        Horse  -gtatctttatcc---------------------------------------------------------
             White rhinoceros  -gtatctttatct---------------------------------------------------------
             Black flying-fox  caca------------------------------------------------------------------
                Big brown bat  -aca------------------------------------------------------------------
         David's myotis (bat)  -aca------------------------------------------------------------------
                     Microbat  -aca------------------------------------------------------------------
                     Elephant  -gta------------------------------------------------------------------
                      Manatee  -gta------------------------------------------------------------------
             Cape golden mole  -g--------------------------------------------------------------------
                     Aardvark  -ata------------------------------------------------------------------
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                      Ferret   ======================================================================
                     Squirrel  ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ----------------------------------------------------------------------

                        Human  ---catcatcc-g
                        Chimp  ---catcatcc-a
                      Gorilla  ---catcatcc-g
                    Orangutan  ---cgtcaccc-g
                       Gibbon  ---agtcat-c-g
                       Rhesus  ---catcatcc-g
          Crab-eating macaque  ---catcatcc-g
                       Baboon  ---catcatcc-g
                 Green monkey  ---catcatct-g
                     Marmoset  ---catcatct-g
              Squirrel monkey  ---catcgtct-g
                     Bushbaby  ---cttcacac-c
           Chinese tree shrew  ---t-ttgtac-c
               Naked mole-rat  atactttatacc-
                   Guinea pig  ---ctttgcata-
                   Chinchilla  ---ctttatac--
             Brush-tailed rat  ---ttttatat--
                        Horse  -------------
             White rhinoceros  -------------
             Black flying-fox  -------------
                Big brown bat  -------------
         David's myotis (bat)  -------------
                     Microbat  -------------
                     Elephant  --tctttatcc--
                      Manatee  --tctttatcc--
             Cape golden mole  -------------
                     Aardvark  --ccgttatcc--
                Domestic goat  =============
                        Sheep  -------------
                          Cow  =============
             Tibetan antelope  =============
               Bactrian camel  =============
                       Alpaca  =============
                        Mouse  =============
                        Panda  =============
                          Dog  =============
                          Rat  =============
                 Prairie vole  =============
              Chinese hamster  =============
               Golden hamster  =============
                 Killer whale  -------------
                      Ferret   =============
                     Squirrel  =============
                          Cat  =============
               Pacific walrus  =============
                    Armadillo  =============
       Lesser Egyptian jerboa  =============
     Chinese softshell turtle  =============
              Green seaturtle  =============
               Painted turtle  =============
              Tasmanian devil  =============
                      Wallaby  =============
                      Opossum  =============
                 Weddell seal  =============
                      Dolphin  -------------

Alignment block 27 of 451 in window, 131773426 - 131773579, 154 bps 
B D                     Human  tctaaagcagtgattctcagcc--aa------------agacagtt----c---ccccc---aggggaca
B D                     Chimp  tctaaagcagtgattctcagcc--aa------------agacaatt----c---ccccc---aggggaca
B D                   Gorilla  tctaaagcagtgattctcagcc--aa------------agacaatt----c---ccccc---aggggaca
B D                 Orangutan  tctaaagcagtgattctcagcc--aa------------agacaatt----c---ccccc---aagggaca
B D                    Gibbon  tgtaaagcagtgattctcagcc--aa------------agacgatt----c---tcccc---aggggaca
B D                    Rhesus  tctaaagcagtgattctcagcc--ga------------agacgatt----c---ccccc---aggggaca
B D       Crab-eating macaque  tctaaagcagtgattctcagcc--ga------------agacgatt----c---ccccc---aggggaca
B D                    Baboon  tctaaagcagtgattctcagcc--aa------------agacgatt----c---ccccc---aggggaca
B D              Green monkey  tctaaagcagtgattctcagcc--ga------------agacgatt----c---ccccc---aggggaca
B D                  Marmoset  tctaacgcggtgattctcagcc--aa------------atacgatt----t---ccccc---aggggaca
B D           Squirrel monkey  tctaaagcagtgattctcagcc--aa------------agacgatt----c---ccccc---aggggaca
B D                  Bushbaby  tccagta-agtgattctcagctggga------------agacg-cc----a---acccc---aggagaca
           Chinese tree shrew  tctgaatcagtgaggcttaacc--ag------------gaatgattgttgc---ccccc---aggggaca
B D                  Squirrel  tccgagtcagcggtccccgcct--gc------------gg--gctc----c---tgccc-ctggagtgca
B D            Naked mole-rat  cctaaatctgtggttctcaaca--gc------------agatgatt----t---taccc-ttatgggaca
B D                Guinea pig  cctaaatctacagttcttaaca--tt------------agatgatt----t---tatccattatggaaca
                   Chinchilla  cccagatctatggttcataata--cc------------agatgatt----t---tacccattaagggaca
             Brush-tailed rat  cccaaatctgtgtttcttcaaa--cc------------agatgatt----t---tacccattatgggaca
B D                     Horse  tttatatcagtggttctcagcc--ag------------ggacaatt----ttgcccccc---aggggaca
B D          White rhinoceros  tttaaatccgtggttctctacc--ag------------ggacaatt----ttgcccccc---tggggaca
             Black flying-fox  --------------cctgagtc--agccgttcccaccagggcagct----ttg-ccccc---aggggaca
                Big brown bat  --------------cctcaacc--ag------------gggcaac---------cccct---gggggaca
         David's myotis (bat)  --------------tctcaacc--ag------------ggacaac---------cccct---gggggaca
B D                  Microbat  --------------tctcaacc--ag------------ggacaac---------cccct---gggggaca
B D                  Elephant  --------------tctagacc--ag------------tggtg--c----t---caacc---a-aggaca
B D                   Manatee  --------------cctagacc--ag------------tggtg-------t---caagc---a-gggaca
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  --------------tctaggcc--ag------------ggttc-------t---taacc---a-gggaca
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

                        Human  tctggcag-------tgtctggaggacactct--gg-ttgtcacccc----------tgagg-aggg---
                        Chimp  tctggcag-------tgtctggaggacactct--gg-ttgtcatccc----------tgagg-aggg---
                      Gorilla  tctggcag-------tgtctggaggacactct--gg-ttgtcatccc----------tgagg-aggg---
                    Orangutan  tctggcag-------tgtctggaggacactct--gg-ttgtcatccc----------tgagg-aggg---
                       Gibbon  cctggcag-------cgtctggaggacgcccttcgg-ttgtcatccc----------tgagg-aggg---
                       Rhesus  tctggcag-------tgtctggaggacgccctttgg-ttgtcatccc----------tgggg-aggg---
          Crab-eating macaque  tctggcag-------tgtctggaggacgccctttgg-ttgtcatccc----------tgggg-aggg---
                       Baboon  tctggcag-------tgcctggaggacgccctttgg-ttgtcatccc----------tgggg-aggg---
                 Green monkey  tctggcag-------tgtctggaggacgccctttga-ttgtcatccc----------tgggg-aggg---
                     Marmoset  tctggcag-------cgtctggaggacgccatttgc-ttgtcatccc----------tgggg-aggg---
              Squirrel monkey  tctggcag-------tgtctggaggacgcc-tttgg-ttgtcatccc----------tggggaaggg---
                     Bushbaby  tttggcaa-------tgtctctaggaaattttttat-ttgt----cc----------tgagg-aaga---
           Chinese tree shrew  tttggcac-------tatctggaggggactttttgc-ttgtcataac----------tggac-aagg---
                     Squirrel  -cccgcca---------tctggaggaaagttttcctctcaccactgc----------tgggg-agaggt-
               Naked mole-rat  -ctggcaa-------tgtctggtggaaactttgtct-ttgtcataac----------tggga-aaag---
                   Guinea pig  -gtggcaa-------tgttgggtggaaaccttgtct-ttgtcataac----------tggga-agca---
                   Chinchilla  -ctggcga-------tatctggtggaaactttgtct-ttgtcataac----------tggag-agtg---
             Brush-tailed rat  -ttggcaa-------tgtccagtggaa------cct-ttgtcagaac----------tgga--aacg---
                        Horse  cttggtga-------tgtc---------acttttgg-ttgtcttaac----------tgggg-aggaggg
             White rhinoceros  attggcaa-------tgtc---------atttttgg-ttgtcgtaac----------tggaa-ggtgggg
             Black flying-fox  cttggcaatgacggctgac---------gtttcagg-ttgtcagaaccgttggcgggcgggg-gggc---
                Big brown bat  ccggcca--------cagc---------atttttgg-ttgtcataac----------tggag-ggg----
         David's myotis (bat)  tcagcca--------cagc---------gtttttgg-tggtcataac----------tggag-ggg----
                     Microbat  tcggcca--------cagc---------atttttgg-ttgttataac----------tgcag-ggg----
                     Elephant  cttggcta-------tgcctggagat--atctgtgg-ttgtcacagc----------t-ggg-tagg---
                      Manatee  ------------------------------ctgtgg-ttgtcccagc----------tgggg-tagg---
             Cape golden mole  cctggctg-------tggctggagac--ctttgtgg-ttgtcacaac----------tgggg-tagg---
                     Aardvark  cttggctg-------tgtctggagac--atttgggg-tcgtcataac----------taggg-tagg---
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ----------------------------------------------------------------------

                        Human  -------gg---ttgctgctggcttcgc---atgagtggaagccggcca--------------tgcagct
                        Chimp  -------gg---ttgctgctggcctcgc---atgagtggaagccggcca--------------tgcagct
                      Gorilla  -------gc---ttgctgctggcctcgc---atgagtggaagccggcca--------------tgcagct
                    Orangutan  -------gg---ttgctgctggcctcgt---gtgagtggaagccggcca--------------tgcagct
                       Gibbon  -------gg---ttgctgctggcctcac---gtgagtggaagccggcca--------------tgcagct
                       Rhesus  -------g----ttgctgctggcctcac---gtgagtggaagccggcca--------------tgccgct
          Crab-eating macaque  -------g----ttgctgctggcctcac---gtgagtggaagcgggcca--------------tgccgct
                       Baboon  -------g----ttgctgctggcctcac---atgagtggaagccggcca--------------tgctgct
                 Green monkey  -------g----ttgctgctggcctcac---gtgagtggaagccggcca--------------tgccact
                     Marmoset  -------g----ttgctcctggcatctc---aagagtggaagccagcca---------------gcagct
              Squirrel monkey  -------a----ttgctgctggcgtctc---gcgagtggaagccagccg---------------gcagct
                     Bushbaby  -------ggt--ttgctcctggcaactc---atgggtaaaggccag--g--------------tgctgct
           Chinese tree shrew  -------t----ttgctactgacatcta---gtgagtgagagccagggaggctgtgtaagcgctgccgtt
                     Squirrel  -------a----ctgctgct--------------------------------------------------
               Naked mole-rat  -------a----gtgctactggaat--tgtagtgaatagagaccaggaa--------------tgctggt
                   Guinea pig  -------a----atgctcttggcat-gt---tcaagtagagatctggga--------------ttctatt
                   Chinchilla  -------a----gtgctactggcat-gtgtggtaagtagagtcctggga--------------taagatt
             Brush-tailed rat  -------a----cagcctctagcat-gt---agaaatggaggctaggga--------------tgccatt
                        Horse  tgtggagg----gtgctaccagccccc----atgggtggcggcc-ggga--------------cactgct
             White rhinoceros  tgtggagg----gtgctactggcatctg---gtgggtggagccc-ggga--------------cgctgcc
             Black flying-fox  -------g----gcgctggtggcatcca---atcggtggtggccaaaga--------------cgccg-c
                Big brown bat  --------------------ggcatcca---gtgggtggaggccaagga--------------tgcggcc
         David's myotis (bat)  --------------------ggcatcca---gtgggtgaaggccaagga--------------tgcggcc
                     Microbat  --------------------ggcatcca---gtgggtggaggccaagga--------------tgcggcc
                     Elephant  -------gacaagtggtcccaccaccta---gggagcggaggacaggga--------------tgctgct
                      Manatee  -------aatgggtgctcctgccaccta---gtgagcagaggacaggga--------------tgctgct
             Cape golden mole  -------gatgggatctcctactgtcta---gtgagcagagga---------------------------
                     Aardvark  -------gatgggtactcctggtatcta---gcaagtggaggacaggga--------------tgccgtt
                Domestic goat  ======================================================================
                        Sheep  ----------------------------------------------------------------------
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================
                      Dolphin  ----------------------------------------------------------------------

                        Human  --caaca------ttctgc------cactgcag--
                        Chimp  --caaca------ttctgc------cactgcag--
                      Gorilla  --caaca------ttctgc------caccgcag--
                    Orangutan  --caaca------ttctgc------cactgcag--
                       Gibbon  --caaca------ttctgc------caccgcag--
                       Rhesus  --cacca------ttctgc------caccgcag--
          Crab-eating macaque  --cacca------ttctgc------caccgcag--
                       Baboon  --cacca------ttctgc------cacc-cag--
                 Green monkey  --cacca------ttctgc------caccgcag--
                     Marmoset  ggtgaca------tcctga------caccacgg--
              Squirrel monkey  --cgaca------tcctga------cgccgagg--
                     Bushbaby  --cagcg------ccctg---------cagcac--
           Chinese tree shrew  --cacagaatggtttctg-------caacaaag--
                     Squirrel  -----cc------tcgtggtgagcacagggtgg--
               Naked mole-rat  --cagca------tcctgta-------ggacag--
                   Guinea pig  --cagca------tcctagagagcacaggacaa--
                   Chinchilla  --cagca------tgctacagagcac-agacag--
             Brush-tailed rat  --cagca------tcctacagagtacaagacag--
                        Horse  --gaaca------tcccacggtgcacaggacgg--
             White rhinoceros  --taaca------tcccacagtgcacagggtgg--
             Black flying-fox  --aaaca-------ccccacccgcacagggcgg--
                Big brown bat  --gaaca-------cccatggcgcacagggcgg--
         David's myotis (bat)  --gaaca-------cccgaggagcacagggcgg--
                     Microbat  --gaaca-------cccgtggagcacagggcgg--
                     Elephant  --caaca------tcctacagtgcacaggatggag
                      Manatee  --cagca------tcctacaggacacaggatggag
             Cape golden mole  -----ca------ccctatagagcacaggatggaa
                     Aardvark  --cgata------tcccactgtgtctaggatggag
                Domestic goat  ===================================
                        Sheep  -----------------------------------
                          Cow  ===================================
             Tibetan antelope  ===================================
               Bactrian camel  ===================================
                       Alpaca  ===================================
                        Mouse  ===================================
                        Panda  ===================================
                          Dog  ===================================
                          Rat  ===================================
                 Prairie vole  ===================================
              Chinese hamster  ===================================
               Golden hamster  ===================================
                 Killer whale  -----------------------------------
                      Ferret   ===================================
                          Cat  ===================================
               Pacific walrus  ===================================
                    Armadillo  ===================================
       Lesser Egyptian jerboa  ===================================
     Chinese softshell turtle  ===================================
              Green seaturtle  ===================================
               Painted turtle  ===================================
              Tasmanian devil  ===================================
                      Wallaby  ===================================
                      Opossum  ===================================
                 Weddell seal  ===================================
                      Dolphin  -----------------------------------

Inserts between block 27 and 28 in window
B D                    Horse 16bp
B D         White rhinoceros 13bp
            Black flying-fox 11bp
               Big brown bat 28bp
        David's myotis (bat) 28bp
B D                 Microbat 28bp

Alignment block 28 of 451 in window, 131773580 - 131773630, 51 bps 
B D                     Human  cc-tggcatcccc----------------------------tgc-tgccaggaac--cacg-cag-agag
B D                     Chimp  cc-tggcatcccc----------------------------tgc-tgccaggaac--caca-cag-ggag
B D                   Gorilla  cc-tggcatcccc----------------------------tgc-tgccaggaac--cacg-cag-ggag
B D                 Orangutan  ccttggcatcccc----------------------------tgc-tgccaggaat--cacg-cgg-ggag
B D                    Gibbon  cctgggcatcccc----------------------------tgc-caccaggaac--cacg-cgg-ggag
B D                    Rhesus  cctgggcatcccc----------------------------tgc-tgccaggacc--cacg-cag-ggaa
B D       Crab-eating macaque  cctgggcatcccc----------------------------tgc-tgccaggacc--cacg-cag-ggaa
B D                    Baboon  cctgggcatcccc----------------------------tgc-tgccaggacc--catg-cag-ggaa
B D              Green monkey  cctgggcatcccc----------------------------tgc-tggcaggacg--cacg-cag-ggaa
B D                  Marmoset  cctgggcagcccc----------------------------tgc-tgctgggaac--caca-cgg--gaa
B D           Squirrel monkey  cctgcacagcctc-----------------------------ac-tgctgggaac--caca-cag--gaa
B D                  Bushbaby  acaggtcacc---------------------------------c-tgcctgaaac--agtgacagtgggg
           Chinese tree shrew  aatcggcccaagc----------------------------tat-caacagggtc--aagg-gtg-agaa
B D                  Squirrel  cc----cctcccc--a-----gagaatcgtccagccag--------gacag------------tg-ggca
B D            Naked mole-rat  gc----cctcccc--a-----aagaatcatccagccagaaatgc-caacagga-c--caat-ctg-agaa
B D                Guinea pig  tc----cctcccccca-----aaaaatcatccagccagacatgc-caacagca-c--cagt-ctg-agaa
                   Chinchilla  cc----cctcccccgc-----aaaa-tcgtccagccggaaatgc-caacagga-c--cggt-ctg-taag
             Brush-tailed rat  cc----cctctcccaa-----aaaagtcatccagggaaaaatgc-cagcagga-c--cagt-ctg--aaa
B D                    Alpaca  ----------------------------------cccgagatgtcctgcagggtt--gatg-ctg-agaa
               Bactrian camel  ----------------------------------cccgagatgtcctgcagggtt--gatg-ctg-agaa
B D                     Horse  -----------------------------gtcggccccaaatgc-cgacaggttt--gagg-ctg-agaa
B D          White rhinoceros  -----------------------------atccaccccaaatgt-ctgcaggggt--gagg-ttg-agaa
             Black flying-fox  -----------------------------caccggcccagacgt-cggcagcc----aggg-ccg-acaa
                Big brown bat  -----------------------------ctctgaatcagcggt-cgccaaccattcggac-ctc-acag
         David's myotis (bat)  -----------------------------ctctaaaccagcggt-cgccaaccttttggac-ctc-acag
B D                  Microbat  -----------------------------ctctagaccagcggt-cgccaacctttcggac-ctc-acag
B D                  Elephant  -------------ccagatcaaagaattatccagcccaaaatgc-cattagtgcc--aagg-cca-agag
B D                   Manatee  -------------ccagagcgaagaattatctggcccaaaatgc-cagtaatgcc--aagg-ccg-agag
             Cape golden mole  -------------cca-----aacaattacccagccccaactgg-c--------------------tgag
                     Aardvark  -------------cccaaacaaggaattacccagcccaaaacgt-caggagggcc--aagg-tca-agag
               Domestic goat  ======================================================================
B D                     Sheep  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------

                        Human  gc----actgctccacgtg
                        Chimp  gc----actgctccacgtg
                      Gorilla  gc----actgctccacgtg
                    Orangutan  gc----actactccacgt-
                       Gibbon  ac----actgctccacgtg
                       Rhesus  gc----actggtccaagtg
          Crab-eating macaque  gc----actggtccaagtg
                       Baboon  gc----actggtccaagtg
                 Green monkey  gc----actggtccaagtg
                     Marmoset  gc----attgctctgggtg
              Squirrel monkey  gc----actgctccgggtg
                     Bushbaby  ac----accagtgtaagtg
           Chinese tree shrew  gc----gctgctctaaata
                     Squirrel  ac----gctgcactcaaca
               Naked mole-rat  gc----accacttggagta
                   Guinea pig  gc----atcattccaagga
                   Chinchilla  gc----actgttctgagta
             Brush-tailed rat  gc----actgcactgaacg
                       Alpaca  ac----accgctctgcctg
               Bactrian camel  ac----accgctctgcctg
                        Horse  ac----gctgctccagaga
             White rhinoceros  ac----gctgctccaaaga
             Black flying-fox  ac--cctctgaacg-----
                Big brown bat  accacccgtggtccgcgga
         David's myotis (bat)  accaccactgatccatggg
                     Microbat  accaccactggtccatgga
                     Elephant  ac----cctgctctaaata
                      Manatee  ac----cctgctctgaaca
             Cape golden mole  ac----cccactct--acc
                     Aardvark  ac----cctgcctcacatg
                Domestic goat  ===================
                        Sheep  -------------------
                          Cow  ===================
             Tibetan antelope  ===================
                        Mouse  ===================
                        Panda  ===================
                          Dog  ===================
                          Rat  ===================
                 Prairie vole  ===================
              Chinese hamster  ===================
               Golden hamster  ===================
                 Killer whale  -------------------
                      Ferret   ===================
                          Cat  ===================
               Pacific walrus  ===================
                    Armadillo  ===================
       Lesser Egyptian jerboa  ===================
     Chinese softshell turtle  ===================
              Green seaturtle  ===================
               Painted turtle  ===================
              Tasmanian devil  ===================
                      Wallaby  ===================
                      Opossum  ===================
                 Weddell seal  ===================
                      Dolphin  -------------------

Inserts between block 28 and 29 in window
               Big brown bat 28bp
        David's myotis (bat) 28bp
B D                 Microbat 28bp

Alignment block 29 of 451 in window, 131773631 - 131773644, 14 bps 
B D                     Human  gaaa--cctgg-aagga
B D                     Chimp  gaaa--cctgg-aagga
B D                   Gorilla  gaaa--cctgg-aagga
B D                 Orangutan  gaaa--cctgg-aggga
B D                    Gibbon  gaaa--cctgg-aagga
B D                    Rhesus  gaaa--cttgg-aagga
B D       Crab-eating macaque  gaaa--cttgg-aagga
B D                    Baboon  gaaa--cttgg-aagga
B D              Green monkey  gaaa--cttgg-aagga
B D                  Marmoset  gaaa--catag-aagga
B D           Squirrel monkey  gaaa--cctag-aagga
B D                  Bushbaby  gaaa--cctct-cagaa
           Chinese tree shrew  agaa--tctga-aagaa
B D                  Squirrel  gaaa--cctga-aagaa
B D            Naked mole-rat  g-ga--cctga-aaggt
B D                Guinea pig  g-ga--cctga-aacaa
                   Chinchilla  g-ga--cctga-aacaa
             Brush-tailed rat  g-gg--gctga-aacga
B D                    Alpaca  -gaagcccaga-ata--
               Bactrian camel  -gaagcgcaga-tga--
B D                     Horse  -gaa--gctggcaga--
B D          White rhinoceros  -gaa-ctcgggaaga--
             Black flying-fox  -gaa--tctgg-aga--
B D                   Megabat  ggaa--cctgg-aga--
                Big brown bat  agaa--cctga-gga--
         David's myotis (bat)  agaa--cctga-gga--
B D                  Microbat  agaa--cctga-gga--
B D                  Elephant  ggat--cctga--agaa
B D                   Manatee  ggat--cctga-cagaa
             Cape golden mole  acag--cctga-gagga
                     Aardvark  gaga--cctga-acgtg
               Domestic goat  =================
B D                     Sheep  -----------------
B D                       Cow  =================
            Tibetan antelope  =================
B D                     Mouse  =================
B D                     Panda  =================
B D                       Dog  =================
B D                       Rat  =================
                Prairie vole  =================
B D           Chinese hamster  =================
              Golden hamster  =================
                Killer whale  -----------------
B D                   Ferret   =================
B D                       Cat  =================
              Pacific walrus  =================
B D                 Armadillo  =================
      Lesser Egyptian jerboa  =================
  D  Chinese softshell turtle  =================
  D           Green seaturtle  =================
  D            Painted turtle  =================
B D           Tasmanian devil  =================
B D                   Wallaby  =================
B D                   Opossum  =================
                Weddell seal  =================
B D                   Dolphin  -----------------

Inserts between block 29 and 30 in window
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 86bp

Alignment block 30 of 451 in window, 131773645 - 131773646, 2 bps 
B D                     Human  ag-
B D                     Chimp  ag-
B D                   Gorilla  ag-
B D                 Orangutan  ag-
B D                    Gibbon  ag-
B D                    Rhesus  cg-
B D       Crab-eating macaque  cg-
B D                    Baboon  cg-
B D              Green monkey  cg-
B D                  Marmoset  c--
B D           Squirrel monkey  c--
B D                  Bushbaby  a--
           Chinese tree shrew  ct-
B D                  Squirrel  -c-
B D            Naked mole-rat  tt-
B D                Guinea pig  at-
                   Chinchilla  at-
B D                    Alpaca  -a-
               Bactrian camel  -a-
B D                     Horse  -a-
B D          White rhinoceros  -a-
             Black flying-fox  -a-
B D                   Megabat  -a-
                Big brown bat  -t-
         David's myotis (bat)  -t-
B D                  Microbat  -t-
B D                  Elephant  -tg
B D                   Manatee  -cg
             Cape golden mole  -tc
                     Aardvark  -tg
               Domestic goat  ===
B D                     Sheep  ---
B D                       Cow  ===
            Tibetan antelope  ===
B D                     Mouse  ===
B D                     Panda  ===
B D                       Dog  ===
B D                       Rat  ===
                Prairie vole  ===
B D           Chinese hamster  ===
              Golden hamster  ===
                Killer whale  ---
B D                   Ferret   ===
B D                       Cat  ===
              Pacific walrus  ===
B D                 Armadillo  ===
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D           Tasmanian devil  ===
B D                   Wallaby  ===
B D                   Opossum  ===
                Weddell seal  ===
B D                   Dolphin  ---

Inserts between block 30 and 31 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp

Alignment block 31 of 451 in window, 131773647 - 131773647, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  a
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
                     Aardvark  g
B D                       Cow  =
            Tibetan antelope  =
B D                     Mouse  =
B D                     Panda  =
B D                       Dog  =
B D                       Rat  =
                Prairie vole  =
B D           Chinese hamster  =
              Golden hamster  =
B D                   Ferret   =
B D                       Cat  =
              Pacific walrus  =
B D                 Armadillo  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                   Opossum  =
                Weddell seal  =

Inserts between block 31 and 32 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp

Alignment block 32 of 451 in window, 131773648 - 131773696, 49 bps 
B D                     Human  cttcctt----------------------------------------------------------c----
B D                     Chimp  cttcctt----------------------------------------------------------c----
B D                   Gorilla  ctttctt----------------------------------------------------------c----
B D                 Orangutan  cttcctt----------------------------------------------------------c----
B D                    Gibbon  cttcctt----------------------------------------------------------c----
B D                    Rhesus  cttcctt----------------------------------------------------------c----
B D       Crab-eating macaque  cttcctt----------------------------------------------------------c----
B D                    Baboon  cttcctt----------------------------------------------------------c----
B D              Green monkey  cttcctt----------------------------------------------------------c----
B D                  Marmoset  cttcctt----------------------------------------------------------c----
B D           Squirrel monkey  cttcctt----------------------------------------------------------c----
B D                  Bushbaby  cttcc-----------------------------------------------------------------
           Chinese tree shrew  cttttat----------------------------------------------------------ctacc
B D                  Squirrel  gctccgc----------------------------------------------------------c----
B D            Naked mole-rat  tgtctgt----------------------------------------------------------c----
B D                Guinea pig  tctctgc----------------------------------------------------------c----
                   Chinchilla  tgtctgc----------------------------------------------------------c----
B D                    Alpaca  gctccta----------------------------------------------------------c----
               Bactrian camel  gctccta----------------------------------------------------------c----
B D                   Dolphin  cttcttc----------------------------------------------------------c----
                 Killer whale  cttcttc----------------------------------------------------------c----
             Tibetan antelope  cctctcc----------------------------------------------------------c----
B D                       Cow  cctcttc----------------------------------------------------------c----
B D                     Sheep  cctcttc----------------------------------------------------------c----
                Domestic goat  cctcttc----------------------------------------------------------c----
B D                     Horse  cctc-ac----------------------------------------------------------c----
B D          White rhinoceros  cttctac----------------------------------------------------------c----
             Black flying-fox  cccccgc----------------------------------------------------------c----
B D                   Megabat  cccccgc----------------------------------------------------------c----
                Big brown bat  cttctac----------------------------------------------------------c----
         David's myotis (bat)  cttccac----------------------------------------------------------c----
B D                  Microbat  cttctac----------------------------------------------------------c----
B D                  Elephant  ---cttc----------------------------------------------------------t----
B D                   Manatee  ---cttc----------------------------------------------------------t----
             Cape golden mole  ---cttc----------------------------------------------------------c----
                     Aardvark  ---cttcaaacatagcaatgcccaggctgagaggagggcaataaatggaacccagtgggatgcttc----
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================

                        Human  gtctct-cagaaacacaactcgc-tggcatcacc-------------------------ctggaaccc--
                        Chimp  gtctct-caggaacacaactcgc-tggcatcacc-------------------------ctggaaccc--
                      Gorilla  gtctct-cagaaacacaactcgc-tggcatcacc-------------------------ctggaaccc--
                    Orangutan  atctct-cagaaacacaactcgc-tggcatcgcc-------------------------ctggaaccc--
                       Gibbon  atctct-cagaaacacaactcgc-tggcatcacc-------------------------ctggaaccc--
                       Rhesus  tcctct-cagaaacacagctcac-tggcatcacc-------------------------ctggaacct--
          Crab-eating macaque  tcctct-cagaaacacagctcac-tggcatcacc-------------------------ctggaacct--
                       Baboon  ttctct-cagaaacacagctcac-tggcatcacc-------------------------ctggaacct--
                 Green monkey  tcctct-cagaaacacaactcgt-tggcatcacc-------------------------ctggaacct--
                     Marmoset  -cctct-cggaaacgcagcttgc-tggctttgcc-------------------------ctggaacct--
              Squirrel monkey  -cctct-cggaaa--cagcttgc-tggcgtcacc-------------------------ctggaacct--
                     Bushbaby  ----cg-cagaaatgcagctcat-tcctgtcact-------------------------gttgaatac--
           Chinese tree shrew  ttctct-tagaaatataattcat-ttgggccagccccatagcttaatggtgaagggaagctggatccc--
                     Squirrel  tcctcc-cagatgtgcagctcac-gtgagtgcct------------------------------------
               Naked mole-rat  ttctct-tagacatacaaccctt-ctgcacttct-------------------------cc---------
                   Guinea pig  ttctcc-aaca--tacagtcagt-ctgcatgtct-------------------------ca---------
                   Chinchilla  ttctcc-tacatgtacagcccat-ctgcgcgtct-------------------------cc---------
                       Alpaca  ttccct-tagaaacac-tcatgt---gcatttct-------------------------cttgaag----
               Bactrian camel  ttccct-tagaaacac-tcatgt---gcatttct-------------------------ctcgaag----
                      Dolphin  ccttct-tagagaaaactcacac---acatctct-------------------------cctgaat----
                 Killer whale  ccttct-tagagaaaactcacac---acatctct-------------------------cctgaat----
             Tibetan antelope  ttctctctagagacacggcacgc-tggcgtcgct-------------------------gtgggat----
                          Cow  ttctctctagagacacaacacac-ttgcctctct-------------------------gttgaat----
                        Sheep  ttctctctagagacacagcacgc-ttgcttctct-------------------------gttgaat----
                Domestic goat  ttctctccagagacacagcacgctttgcatctct-------------------------gttgaat----
                        Horse  tgcgct-tagaaacacagcccac-t-gcgtttct-------------------------cctgaat----
             White rhinoceros  ttctct-tagatatgcctctcat-t-gcattcct-------------------------cttgaat----
             Black flying-fox  -tcgca-gacaaatgcggctcat-tcacacgtct-------------------------cttgagt----
                      Megabat  -tcgca-gacaaatgcggctcat-tcacacgtct-------------------------cttgagt----
                Big brown bat  ttctca-tggaaataccgctcat-ttgcatttct-------------------------catgaat----
         David's myotis (bat)  ttctca-tggaaataccactcat-ttgcatttct-------------------------cctgaat----
                     Microbat  ttctca-tggaaataccactcca-ttgcatttct-------------------------catgaat----
                     Elephant  ttccct-tagaaatataactcat-ttgcatttct-------------------------cttgaag--tt
                      Manatee  ttccct-tagaaacacaactcat-ctccatttct-------------------------cttgaaa--gt
             Cape golden mole  ttgcct-tagaagt-cagctcat-gtgcatgtct-------------------------ctgaaaa--gt
                     Aardvark  cttcct-tagaaacacaacccat-ttgcatttct-------------------------cttgaaa--at
                        Mouse  ======================================================================
                        Panda  ======================================================================
                          Dog  ======================================================================
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
             Brush-tailed rat  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================

Inserts between block 32 and 33 in window
          Chinese tree shrew 238bp

Alignment block 33 of 451 in window, 131773697 - 131773707, 11 bps 
B D                     Human  aaaacgtgagg
B D                     Chimp  aaaacgtgagg
B D                   Gorilla  aaaacgtgagg
B D                 Orangutan  aaaacgtgagg
B D                    Gibbon  aaaacgtgagg
B D                    Rhesus  aaaacgtgagg
B D       Crab-eating macaque  aaaacgtgagg
B D                    Baboon  aaaacgtgagg
B D              Green monkey  aaaacgtgagg
B D                  Marmoset  caagtgtgagg
B D           Squirrel monkey  aaagcgtgagg
B D                  Bushbaby  atac-------
B D                  Squirrel  tgaagaggaag
B D            Naked mole-rat  taaaagtgaag
B D                Guinea pig  taaaagcaaag
                   Chinchilla  taaaagtgaag
B D                    Alpaca  -gcaaag----
               Bactrian camel  -gcaaag----
B D                   Dolphin  -gaaagt----
                 Killer whale  -gaaagt----
             Tibetan antelope  -gagagc----
B D                       Cow  -gaaaag----
B D                     Sheep  -gaaaat----
                Domestic goat  -gaaaac----
B D                     Horse  --gaggc----
B D          White rhinoceros  aaaaagt----
             Black flying-fox  -gaccgt----
B D                   Megabat  -gaccgt----
                Big brown bat  -gaaagt----
         David's myotis (bat)  -gaaagt----
B D                  Microbat  -gaaagt----
B D                  Elephant  ----agt----
B D                   Manatee  --aaagt----
             Cape golden mole  --gcact----
                     Aardvark  --aaagg----
B D                     Mouse  ===========
B D                     Panda  ===========
B D                       Dog  ===========
B D                       Rat  ===========
                Prairie vole  ===========
B D           Chinese hamster  ===========
              Golden hamster  ===========
B D                   Ferret   ===========
B D                       Cat  ===========
          Chinese tree shrew  ===========
              Pacific walrus  ===========
B D                 Armadillo  ===========
      Lesser Egyptian jerboa  ===========
            Brush-tailed rat  ===========
  D  Chinese softshell turtle  ===========
  D           Green seaturtle  ===========
  D            Painted turtle  ===========
B D           Tasmanian devil  ===========
B D                   Wallaby  ===========
B D                   Opossum  ===========
                Weddell seal  ===========

Inserts between block 33 and 34 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp

Alignment block 34 of 451 in window, 131773708 - 131773715, 8 bps 
B D                     Human  ttttt---------------------------------------------------------------g-
B D                     Chimp  ttttt---------------------------------------------------------------g-
B D                   Gorilla  ttttt---------------------------------------------------------------g-
B D                 Orangutan  ttttt---------------------------------------------------------------g-
B D                    Gibbon  ttttt---------------------------------------------------------------g-
B D                    Rhesus  ttttt---------------------------------------------------------------g-
B D       Crab-eating macaque  ttttt---------------------------------------------------------------g-
B D                    Baboon  ttttt---------------------------------------------------------------g-
B D              Green monkey  ttttt---------------------------------------------------------------g-
B D                  Marmoset  ttttt---------------------------------------------------------------g-
B D           Squirrel monkey  tttgt---------------------------------------------------------------g-
B D                  Bushbaby  tttgt---------------------------------------------------------------g-
           Chinese tree shrew  ttttt---------------------------------------------------------------ac
B D                  Squirrel  gctct---------------------------------------------------------------g-
B D            Naked mole-rat  gtttt---------------------------------------------------------------g-
B D                Guinea pig  g--tt---------------------------------------------------------------g-
                   Chinchilla  gtttt---------------------------------------------------------------g-
B D                    Alpaca  gtttc---------------------------------------------------------------t-
               Bactrian camel  gtttc---------------------------------------------------------------t-
B D                   Dolphin  gttcc---------------------------------------------------------------g-
                 Killer whale  gttcc---------------------------------------------------------------g-
             Tibetan antelope  ggttt---------------------------------------------------------------g-
B D                       Cow  gtttt---------------------------------------------------------------g-
B D                     Sheep  gtttt---------------------------------------------------------------g-
                Domestic goat  gtttt---------------------------------------------------------------g-
B D                     Horse  gtttt---------------------------------------------------------------g-
B D          White rhinoceros  gttct---------------------------------------------------------------g-
             Black flying-fox  gttct---------------------------------------------------------------g-
B D                   Megabat  gttct---------------------------------------------------------------g-
                Big brown bat  gt--------------------------------------------------------------------
         David's myotis (bat)  gtttt---------------------------------------------------------------g-
B D                  Microbat  gtttt---------------------------------------------------------------g-
B D                  Elephant  ttttt---------------------------------------------------------------g-
B D                   Manatee  ttttc---------------------------------------------------------------g-
             Cape golden mole  ttatt---------------------------------------------------------------g-
                     Aardvark  ttttttaaaagaaacatagagtgtctgctctcccacacacaagcacggatgtccacacatgcacacacg-
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================

                        Human  ---------------tt
                        Chimp  ---------------tt
                      Gorilla  ---------------tt
                    Orangutan  ---------------tt
                       Gibbon  ---------------tt
                       Rhesus  ---------------tt
          Crab-eating macaque  ---------------tt
                       Baboon  ---------------tt
                 Green monkey  ---------------tt
                     Marmoset  ---------------tt
              Squirrel monkey  ---------------tt
                     Bushbaby  ---------------tt
           Chinese tree shrew  tcttgaatgtaaagctt
                     Squirrel  ---------------tt
               Naked mole-rat  ---------------tg
                   Guinea pig  ---------------tg
                   Chinchilla  ---------------tg
                       Alpaca  ---------------gt
               Bactrian camel  ---------------tt
                      Dolphin  ---------------tc
                 Killer whale  ---------------tc
             Tibetan antelope  ---------------ct
                          Cow  ---------------ct
                        Sheep  ---------------ct
                Domestic goat  ---------------ct
                        Horse  ---------------ac
             White rhinoceros  ---------------tc
             Black flying-fox  ---------------tt
                      Megabat  ---------------tt
                Big brown bat  ---------------tt
         David's myotis (bat)  ---------------tt
                     Microbat  ---------------tt
                     Elephant  ---------------ct
                      Manatee  ---------------tt
             Cape golden mole  ---------------tt
                     Aardvark  ---------------tt
                        Mouse  =================
                        Panda  =================
                          Dog  =================
                          Rat  =================
                 Prairie vole  =================
              Chinese hamster  =================
               Golden hamster  =================
                      Ferret   =================
                          Cat  =================
               Pacific walrus  =================
                    Armadillo  =================
       Lesser Egyptian jerboa  =================
             Brush-tailed rat  =================
     Chinese softshell turtle  =================
              Green seaturtle  =================
               Painted turtle  =================
              Tasmanian devil  =================
                      Wallaby  =================
                      Opossum  =================
                 Weddell seal  =================

Alignment block 35 of 451 in window, 131773716 - 131773719, 4 bps 
B D                     Human  tagc
B D                     Chimp  tagc
B D                   Gorilla  tagc
B D                 Orangutan  tagc
B D                    Gibbon  tagc
B D                    Rhesus  cacc
B D       Crab-eating macaque  cacc
B D                    Baboon  cacc
B D              Green monkey  cacc
B D                  Marmoset  tagc
B D           Squirrel monkey  tagc
B D                  Bushbaby  taaa
           Chinese tree shrew  cact
B D                  Squirrel  tagc
B D                     Mouse  tact
B D            Naked mole-rat  gaac
B D                Guinea pig  gaac
                   Chinchilla  gaac
B D                    Alpaca  taac
               Bactrian camel  taac
B D                   Dolphin  taac
                 Killer whale  taac
             Tibetan antelope  tagc
B D                       Cow  tagc
B D                     Sheep  tagc
                Domestic goat  cagc
B D                     Horse  taac
B D          White rhinoceros  taag
             Black flying-fox  taac
B D                   Megabat  taac
                Big brown bat  taag
         David's myotis (bat)  taag
B D                  Microbat  taag
B D                  Elephant  taag
B D                   Manatee  taat
             Cape golden mole  taat
                     Aardvark  taat
B D                     Panda  ====
B D                       Dog  ====
B D                       Rat  ====
                Prairie vole  ====
B D           Chinese hamster  ====
              Golden hamster  ====
B D                   Ferret   ====
B D                       Cat  ====
              Pacific walrus  ====
B D                 Armadillo  ====
      Lesser Egyptian jerboa  ====
            Brush-tailed rat  ====
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
B D                   Opossum  ====
                Weddell seal  ====

Inserts between block 35 and 36 in window
B D                 Elephant 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
                    Aardvark 4bp

Alignment block 36 of 451 in window, 131773720 - 131773723, 4 bps 
B D                     Human  catg
B D                     Chimp  catg
B D                   Gorilla  tatg
B D                 Orangutan  catg
B D                    Gibbon  catg
B D                    Rhesus  catg
B D       Crab-eating macaque  catg
B D                    Baboon  catg
B D              Green monkey  catg
B D                  Marmoset  catg
B D           Squirrel monkey  cgtg
B D                  Bushbaby  cacg
           Chinese tree shrew  cttg
B D                  Squirrel  cacc
       Lesser Egyptian jerboa  catg
B D                     Mouse  catg
B D            Naked mole-rat  catg
B D                Guinea pig  aatg
                   Chinchilla  cgtg
B D                    Alpaca  cccg
               Bactrian camel  cccg
B D                   Dolphin  cctg
                 Killer whale  cctg
             Tibetan antelope  tctg
B D                       Cow  cctg
B D                     Sheep  cctg
                Domestic goat  cctg
B D                     Horse  cgca
B D          White rhinoceros  caca
             Black flying-fox  ggcg
B D                   Megabat  ggcg
                Big brown bat  caca
         David's myotis (bat)  caca
B D                  Microbat  caca
B D                  Elephant  cata
B D                   Manatee  cata
             Cape golden mole  cat-
                     Aardvark  ca--
B D                     Panda  ====
B D                       Dog  ====
B D                       Rat  ====
                Prairie vole  ====
B D           Chinese hamster  ====
              Golden hamster  ====
B D                   Ferret   ====
B D                       Cat  ====
              Pacific walrus  ====
B D                 Armadillo  ====
            Brush-tailed rat  ====
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
B D                   Opossum  ====
                Weddell seal  ====

Alignment block 37 of 451 in window, 131773724 - 131773738, 15 bps 
B D                     Human  aagaatg-tctgc---------------------------------------------------------
B D                     Chimp  aagaatg-cctgc---------------------------------------------------------
B D                   Gorilla  aagaatg-cctgc---------------------------------------------------------
B D                 Orangutan  aagaatg-tctgc---------------------------------------------------------
B D                    Gibbon  aagaatg-tctgc---------------------------------------------------------
B D                    Rhesus  aagaaga-tctgc---------------------------------------------------------
B D       Crab-eating macaque  aagaagg-tctgc---------------------------------------------------------
B D                    Baboon  aagaatg-tctgc---------------------------------------------------------
B D              Green monkey  aagaagg-tctgc---------------------------------------------------------
B D                  Marmoset  aagaatg-tctgct--------------------------------------------------------
B D           Squirrel monkey  aagaatg-tctgct--------------------------------------------------------
B D                  Bushbaby  aagactg-tctgct--------------------------------------------------------
           Chinese tree shrew  aagaatg-tctgctctcatgtccatgatgcacacacacttgcacactcatgtgcacacacgtgtgtactc
B D                  Squirrel  --aggtg-cgtc----------------------------------------------------------
       Lesser Egyptian jerboa  -aagatgatttgt---------------------------------------------------------
                 Prairie vole  aaagatg-tttgc---------------------------------------------------------
B D                     Mouse  aaagatg-tttgc---------------------------------------------------------
B D            Naked mole-rat  aagta----ctgc---------------------------------------------------------
B D                Guinea pig  aagaatg-tctag---------------------------------------------------------
                   Chinchilla  aagaatg-tctgc---------------------------------------------------------
B D                    Alpaca  aggaatg-tccgc---------------------------------------------------------
               Bactrian camel  aggaatg-tccac---------------------------------------------------------
B D                   Dolphin  aagaatg-tctgc---------------------------------------------------------
                 Killer whale  aagaatg-tctgc---------------------------------------------------------
             Tibetan antelope  aagcaca-ttttc---------------------------------------------------------
B D                       Cow  aagcacg-tcttc---------------------------------------------------------
B D                     Sheep  aagcaca-tcttc---------------------------------------------------------
                Domestic goat  aagcaca-tcttc---------------------------------------------------------
B D                     Horse  ----------cgc---------------------------------------------------------
B D          White rhinoceros  ----------tgc---------------------------------------------------------
             Black flying-fox  gagaatg-tctgc---------------------------------------------------------
B D                   Megabat  gagaatg-tctgc---------------------------------------------------------
                Big brown bat  aagaatg-tctgc---------------------------------------------------------
         David's myotis (bat)  aagaatg-tctgc---------------------------------------------------------
B D                  Microbat  aagaatg-tctgc---------------------------------------------------------
B D                  Elephant  gagaatg-tctgc---------------------------------------------------------
B D                   Manatee  gagaata-tctgc---------------------------------------------------------
             Cape golden mole  ----gta-tctgt---------------------------------------------------------
                     Aardvark  ----gtg-tctcc---------------------------------------------------------
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
            Brush-tailed rat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================

                        Human  ------------ttc-
                        Chimp  ------------ttc-
                      Gorilla  ------------ttc-
                    Orangutan  ------------ttc-
                       Gibbon  ------------ttc-
                       Rhesus  ---------t--ttc-
          Crab-eating macaque  ---------t--ttc-
                       Baboon  ---------t--ttc-
                 Green monkey  ---------t--ttc-
                     Marmoset  ---------t--tcc-
              Squirrel monkey  ---------t--tcc-
                     Bushbaby  ---------c--tca-
           Chinese tree shrew  atagacacgt--ctg-
                     Squirrel  ----------------
       Lesser Egyptian jerboa  ---------t--ct--
                 Prairie vole  ---------t--gt--
                        Mouse  ---------t--ct--
               Naked mole-rat  ---------t--ct--
                   Guinea pig  ---------t--gt--
                   Chinchilla  ---------c--ct--
                       Alpaca  ---------tga----
               Bactrian camel  tcacccacgtga----
                      Dolphin  ---------t------
                 Killer whale  ---------t------
             Tibetan antelope  ---------tat----
                          Cow  ---------tat----
                        Sheep  ---------tat----
                Domestic goat  ---------tat----
                        Horse  ---------a------
             White rhinoceros  ---------a------
             Black flying-fox  ---------t------
                      Megabat  ---------t------
                Big brown bat  ---------t------
         David's myotis (bat)  ---------t------
                     Microbat  ---------t------
                     Elephant  ---------t--gttt
                      Manatee  ---------t--cttt
             Cape golden mole  ---------t--ctct
                     Aardvark  ---------t--ctct
                        Panda  ================
                          Dog  ================
                          Rat  ================
              Chinese hamster  ================
               Golden hamster  ================
                      Ferret   ================
                          Cat  ================
               Pacific walrus  ================
                    Armadillo  ================
             Brush-tailed rat  ================
     Chinese softshell turtle  ================
              Green seaturtle  ================
               Painted turtle  ================
              Tasmanian devil  ================
                      Wallaby  ================
                      Opossum  ================
                 Weddell seal  ================

Inserts between block 37 and 38 in window
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D           Naked mole-rat 16bp
B D               Guinea pig 14bp
                  Chinchilla 8bp
               Domestic goat 2bp

Alignment block 38 of 451 in window, 131773739 - 131773740, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tt
           Chinese tree shrew  ta
       Lesser Egyptian jerboa  cg
                 Prairie vole  gg
               Golden hamster  tg
B D                     Mouse  ca
B D            Naked mole-rat  tg
B D                Guinea pig  ag
                   Chinchilla  tg
             Brush-tailed rat  cg
B D                  Elephant  ct
B D                   Manatee  cg
             Cape golden mole  ca
                     Aardvark  tg
               Domestic goat  ==
B D                     Sheep  --
B D                       Cow  --
            Tibetan antelope  --
               Big brown bat  --
B D                  Microbat  --
        David's myotis (bat)  --
              Bactrian camel  --
B D                    Alpaca  --
B D                     Panda  ==
B D                       Dog  ==
B D                       Rat  ==
B D           Chinese hamster  ==
                Killer whale  --
B D                   Ferret   ==
B D                  Squirrel  --
B D                       Cat  ==
              Pacific walrus  ==
B D                 Armadillo  ==
B D                     Horse  --
            Black flying-fox  --
B D          White rhinoceros  --
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
B D                   Opossum  ==
                Weddell seal  ==
B D                   Dolphin  --
B D                   Megabat  --

Inserts between block 38 and 39 in window
B D                    Mouse 2bp

Alignment block 39 of 451 in window, 131773741 - 131773744, 4 bps 
B D                     Human  caga------
B D                     Chimp  caaa------
B D                   Gorilla  caaa------
B D                 Orangutan  caaa------
B D                    Gibbon  caga------
B D                    Rhesus  caaa------
B D       Crab-eating macaque  caaa------
B D                    Baboon  caaa------
B D              Green monkey  caaa------
B D                  Marmoset  caat------
B D           Squirrel monkey  caac------
B D                  Bushbaby  caaa------
           Chinese tree shrew  caca------
       Lesser Egyptian jerboa  cgaa------
                 Prairie vole  caaa------
               Golden hamster  caca------
B D                     Mouse  caaa------
B D                       Rat  caca------
B D            Naked mole-rat  cgcg------
B D                Guinea pig  cagg------
                   Chinchilla  cacg------
             Brush-tailed rat  cagg------
B D                    Alpaca  ---g------
               Bactrian camel  ---g------
B D                  Elephant  --ca----ca
B D                   Manatee  --cacactca
             Cape golden mole  --ca---tgc
                     Aardvark  --ca------
               Domestic goat  ==========
B D                     Sheep  ----------
B D                       Cow  ----------
            Tibetan antelope  ----------
               Big brown bat  ----------
B D                  Microbat  ----------
        David's myotis (bat)  ----------
B D                     Panda  ==========
B D                       Dog  ==========
B D           Chinese hamster  ==========
                Killer whale  ----------
B D                   Ferret   ==========
B D                  Squirrel  ----------
B D                       Cat  ==========
              Pacific walrus  ==========
B D                 Armadillo  ==========
B D                     Horse  ----------
            Black flying-fox  ----------
B D          White rhinoceros  ----------
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
  D            Painted turtle  ==========
B D           Tasmanian devil  ==========
B D                   Wallaby  ==========
B D                   Opossum  ==========
                Weddell seal  ==========
B D                   Dolphin  ----------
B D                   Megabat  ----------

Inserts between block 39 and 40 in window
      Lesser Egyptian jerboa 2bp
B D                   Alpaca 8bp
              Bactrian camel 8bp

Alignment block 40 of 451 in window, 131773745 - 131773791, 47 bps 
B D                     Human  ------------------tgcccacaggca-------------------------------------gc-
B D                     Chimp  ------------------tgcacacaggca-------------------------------------gc-
B D                   Gorilla  ------------------tgcacacaggca-------------------------------------gc-
B D                 Orangutan  ------------------tgcacacaggca-------------------------------------gc-
B D                    Gibbon  ------------------tgcacacaggca-------------------------------------gc-
B D                    Rhesus  ------------------tgcacataggca-------------------------------------gc-
B D       Crab-eating macaque  ------------------tgcacataggca-------------------------------------gc-
B D                    Baboon  ------------------tgcacataggca-------------------------------------gc-
B D              Green monkey  ------------------tgcacataggca-------------------------------------gc-
B D                  Marmoset  ------------------cgcacacagaca-------------------------------------gc-
B D           Squirrel monkey  ------------------tgcacacagaca-------------------------------------gc-
B D                  Bushbaby  ------------------cacgtat------------------------------------------gc-
           Chinese tree shrew  ------------------tgcaaacaagcatgtatgtgcactcacacacacatctacacatactctcac-
B D                  Squirrel  ------------------ctctcacgtact--------------------------------------c-
       Lesser Egyptian jerboa  ------------------tgtgcacacata--------------------------------------cg
                 Prairie vole  ------------------tgtacccaaccg--------------------------------------c-
B D           Chinese hamster  ------------------tgtg-acacaca--------------------------------------c-
               Golden hamster  ------------------tgtacacacaca--------------------------------------c-
B D                     Mouse  ------------------tgtacaaatgca--------------------------------------c-
B D                       Rat  ------------------tgcacacatgca--------------------------------------c-
B D            Naked mole-rat  ------------------cacacacacaaa--------------------------------------c-
B D                Guinea pig  ------------------catgcaca------------------------------------------c-
                   Chinchilla  ------------------cacacacatgca--------------------------------------c-
             Brush-tailed rat  ------------------tgcacacatgcg--------------------------------------c-
B D                    Alpaca  ------------------cacacacacgcc--------------------------------------t-
               Bactrian camel  ------------------cacacacacgcc--------------------------------------t-
B D                   Dolphin  ------------------cacgcacaccca--------------------------------------t-
                 Killer whale  ------------------cacgcacaccca--------------------------------------t-
             Tibetan antelope  ------------------gacacacacact--------------------------------------t-
B D                       Cow  ------------------cacacacacact--------------------------------------g-
B D                     Sheep  ------------------cacacacacact--------------------------------------t-
                Domestic goat  ------------------cacacacacact--------------------------------------t-
B D                     Horse  ------------------cacaggcacac-----------------------------------------
B D          White rhinoceros  ------------------tacacacacgct--------------------------------------t-
             Black flying-fox  ------------------cgagcacacgcg--------------------------------------gc
B D                   Megabat  ------------------cgagcacacgcg--------------------------------------gc
                Big brown bat  ------------------cgagcacacaca--------------------------------------g-
         David's myotis (bat)  ------------------cga-------------------------------------------------
B D                  Microbat  ------------------tgagcacacaca--------------------------------------t-
B D                  Elephant  atcacacatatg--tgtgcacgtgcacaca--------------------------------------c-
B D                   Manatee  agcacgcatgtg--tctgcacatgcacaca--------------------------------cgcaccc-
             Cape golden mole  agcacacatgtgtatatgtacctgcacaca--------------------------------------t-
                     Aardvark  ----cacatgtg--cacacatgcacataca--------------------------------------c-
B D                     Panda  ======================================================================
B D                       Dog  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================

                        Human  -------tcacacgcacacacgcac----------------------------gtgcacagacgcc----
                        Chimp  -------tcacatgcacacacgcac----------------------------gtgcacagacgcc----
                      Gorilla  -------tcacatgcacacgcgcac----------------------------gtgcacagacacc----
                    Orangutan  -------tcacatgcacacgcgcac----------------------------gtgcacagacgcc----
                       Gibbon  -------tcacatgcacacgcacac----------------------------gtgcacagacgcc----
                       Rhesus  -------tcacaggcacaggcacac----------------------------gtgcacagacgcc----
          Crab-eating macaque  -------tcacaggcacaggcgcac----------------------------gtgcacagacgcc----
                       Baboon  -------tcacaggcacaggcgcac----------------------------gtccacagacgcc----
                 Green monkey  -------tcacaggcacaggcgcag----------------------------gtgcacagacgcc----
                     Marmoset  -------tcacatgcacatgcgtgc----------------------------gtgcacagacgcc----
              Squirrel monkey  -------tcacatgcacatgcgtgc----------------------------atgcacagatgcc----
                     Bushbaby  -------acacatgtac--------------------------------------gcacagactcc----
           Chinese tree shrew  -------tcatgtgtacacacatacacacacatgcatgtgcacacatggttctgtgtacagacttc----
                     Squirrel  -------ctgcacacacatgcacac------------------------acgggcacacagg--------
       Lesser Egyptian jerboa  -------atgctctcacatgcacaa---------------------------------------------
                 Prairie vole  -------ccccccacacacacacaa------aaaaagagagagaggcacatgcacacatgtgtatt---c
              Chinese hamster  -------acacacacacatacagagaca---gggcatggggggatgcatatgtacacacatgtgct---c
               Golden hamster  -------atgtgctcacatgcacaa---------------------------------------------
                        Mouse  -------acacacgca---gcacac-------agcacaaagg------aacacacatgcgtgtgct---c
                          Rat  -------acatgcacacatgcacac-------agcacaaagg------cacaggcacacatgtgct---c
               Naked mole-rat  -------acacacacatgcacacacattcgcgtggatgcactctcacacccacacgtgcacatgccaaac
                   Guinea pig  -------acacacttgcatgcatgcactctcacacacacaca--------------tgcacatgccaaac
                   Chinchilla  -------acacacttgcatgcatgcactcacacacacata----------------tgcatatgccagac
             Brush-tailed rat  -------gcgcgcgcacacacacacacacacacacacacact--------------tgcacatgccaaac
                       Alpaca  -------gcacacacagactttca----------------------------------------------
               Bactrian camel  -------gcacacacagactttca----------------------------------------------
                      Dolphin  -------gcgcacgc--------g----------------------------------------------
                 Killer whale  -------gcgcacgc--------g----------------------------------------------
             Tibetan antelope  -------gcacactcagactttaa----------------------------------------------
                          Cow  -------gcacactcggactttag----------------------------------------------
                        Sheep  -------gcacactcagactttaa----------------------------------------------
                Domestic goat  -------gcacactcagactttaa----------------------------------------------
                        Horse  -------gcacgcacagg----------------------------------------------------
             White rhinoceros  -------gcacatacagactttca----------------------------------------------
             Black flying-fox  acacgcggcacacgcg-gcacacg----------------------------------------------
                      Megabat  acatgcagcacacgca-gcacacg----------------------------------------------
                Big brown bat  -------gcacacacaggcaca------------------------------------------------
         David's myotis (bat)  -----------------gcacatg----------------------------------------------
                     Microbat  -------gcacacacgtgcacatg----------------------------------------------
                     Elephant  -------ctgtgcacacatgcaca----------------------------------------------
                      Manatee  -------ctgtgcacacacgcaca----------------------------------------------
             Cape golden mole  -------atgtacacacacccatg----------------------------------------------
                     Aardvark  -------ctgtgcacacatgcaca----------------------------------------------
                        Panda  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
                 Weddell seal  ======================================================================

                        Human  ---ca
                        Chimp  ---ca
                      Gorilla  ---ca
                    Orangutan  ---ca
                       Gibbon  ---ca
                       Rhesus  ---ca
          Crab-eating macaque  ---ca
                       Baboon  ---ca
                 Green monkey  ---ca
                     Marmoset  ---ca
              Squirrel monkey  ---ca
                     Bushbaby  ---ca
           Chinese tree shrew  ---tg
                     Squirrel  -----
       Lesser Egyptian jerboa  -----
                 Prairie vole  atgtg
              Chinese hamster  atgtg
               Golden hamster  -----
                        Mouse  atgca
                          Rat  aagca
               Naked mole-rat  tttca
                   Guinea pig  ttgca
                   Chinchilla  tttca
             Brush-tailed rat  tgtcg
                       Alpaca  -----
               Bactrian camel  -----
                      Dolphin  -----
                 Killer whale  -----
             Tibetan antelope  -----
                          Cow  -----
                        Sheep  -----
                Domestic goat  -----
                        Horse  -----
             White rhinoceros  -----
             Black flying-fox  -----
                      Megabat  -----
                Big brown bat  -----
         David's myotis (bat)  -----
                     Microbat  -----
                     Elephant  -----
                      Manatee  -----
             Cape golden mole  -----
                     Aardvark  -----
                        Panda  =====
                          Dog  =====
                      Ferret   =====
                          Cat  =====
               Pacific walrus  =====
                    Armadillo  =====
     Chinese softshell turtle  =====
              Green seaturtle  =====
               Painted turtle  =====
              Tasmanian devil  =====
                      Wallaby  =====
                      Opossum  =====
                 Weddell seal  =====

Inserts between block 40 and 41 in window
            Black flying-fox 35bp
B D                  Megabat 17bp
               Big brown bat 10bp
        David's myotis (bat) 219bp
B D                 Microbat 49bp

Alignment block 41 of 451 in window, 131773792 - 131773798, 7 bps 
B D                     Human  cgtgggt
B D                     Chimp  cgtgggt
B D                   Gorilla  cgtgggt
B D                 Orangutan  cacgggt
B D                    Gibbon  cgcgggt
B D                    Rhesus  cgcgggt
B D       Crab-eating macaque  tgcgggt
B D                    Baboon  cgcgggt
B D              Green monkey  cgcgggt
B D                  Marmoset  cgt-ggt
B D           Squirrel monkey  cgt-ggc
B D                  Bushbaby  t------
           Chinese tree shrew  tgtcagt
B D                  Squirrel  -----gc
       Lesser Egyptian jerboa  -----gc
                 Prairie vole  cacaagc
B D           Chinese hamster  cacaagc
               Golden hamster  -----gc
B D                     Mouse  cacaagc
B D                       Rat  cacaaac
B D            Naked mole-rat  tgtcagc
B D                Guinea pig  agtaagc
                   Chinchilla  tgtccgc
             Brush-tailed rat  tgtcagc
B D                    Alpaca  cttcggt
               Bactrian camel  cttcggt
B D                   Dolphin  tgcacgc
                 Killer whale  tgcacgc
             Tibetan antelope  tgtcagt
B D                       Cow  tgtcagt
B D                     Sheep  tgtcagt
                Domestic goat  tgtcagc
B D                     Horse  ------t
B D          White rhinoceros  cattgct
             Black flying-fox  cgccagc
B D                   Megabat  caccagc
                Big brown bat  tgtcagc
B D                  Microbat  tgtgggt
B D                  Elephant  cctgtgc
B D                   Manatee  cctgtgc
             Cape golden mole  tacatgt
                     Aardvark  cacgttt
        David's myotis (bat)  =======
B D                     Panda  =======
B D                       Dog  =======
B D                   Ferret   =======
B D                       Cat  =======
              Pacific walrus  =======
B D                 Armadillo  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
  D            Painted turtle  =======
B D           Tasmanian devil  =======
B D                   Wallaby  =======
B D                   Opossum  =======
                Weddell seal  =======

Inserts between block 41 and 42 in window
B D                 Microbat 251bp
            Cape golden mole 1073bp
                    Aardvark 10bp

Alignment block 42 of 451 in window, 131773799 - 131773800, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D                    Rhesus  gt
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D              Green monkey  gt
B D                  Marmoset  gt
B D           Squirrel monkey  gt
           Chinese tree shrew  at
B D                  Squirrel  ac
       Lesser Egyptian jerboa  ac
                 Prairie vole  ac
B D           Chinese hamster  ac
               Golden hamster  ac
B D                     Mouse  ac
B D                       Rat  ac
B D            Naked mole-rat  cc
B D                Guinea pig  ct
                   Chinchilla  cc
             Brush-tailed rat  tc
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  gc
                 Killer whale  gc
             Tibetan antelope  gc
B D                       Cow  ac
B D                     Sheep  ac
                Domestic goat  ac
B D                     Horse  gc
B D          White rhinoceros  ac
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  tc
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                     Panda  ==
B D                       Dog  ==
B D                   Ferret   ==
B D                       Cat  ==
              Pacific walrus  ==
B D                   Manatee  --
B D                  Elephant  --
B D                 Armadillo  ==
B D                  Bushbaby  --
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
B D                   Opossum  ==
                    Aardvark  ==
                Weddell seal  ==
            Cape golden mole  ==

Alignment block 43 of 451 in window, 131773801 - 131773806, 6 bps 
B D                     Human  aaacgt
B D                     Chimp  aaacgt
B D                   Gorilla  acacgt
B D                 Orangutan  aaatgt
B D                    Gibbon  aaacgt
B D                    Rhesus  aaatgt
B D       Crab-eating macaque  aaacgt
B D                    Baboon  aaacgt
B D              Green monkey  aaacgt
B D                  Marmoset  aagca-
B D           Squirrel monkey  aagca-
B D                  Bushbaby  -cacag
           Chinese tree shrew  agaaat
B D                  Squirrel  acaggg
       Lesser Egyptian jerboa  gaactt
                 Prairie vole  aaactt
B D           Chinese hamster  aaactt
               Golden hamster  aaactt
B D                     Mouse  aaactt
B D                       Rat  aaactt
B D            Naked mole-rat  agactt
B D                Guinea pig  agactt
                   Chinchilla  agactt
             Brush-tailed rat  agactt
B D                    Alpaca  agacgt
               Bactrian camel  agacgt
B D                   Dolphin  agacat
                 Killer whale  agacat
             Tibetan antelope  agacat
B D                       Cow  agacat
B D                     Sheep  agacat
                Domestic goat  agacat
B D                     Horse  aaaca-
B D          White rhinoceros  agacat
             Black flying-fox  agacat
B D                   Megabat  agacat
                Big brown bat  agatac
B D                  Elephant  acacat
B D                   Manatee  acacgt
                     Aardvark  aaagat
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                     Panda  ======
B D                       Dog  ======
B D                   Ferret   ======
B D                       Cat  ======
              Pacific walrus  ======
B D                 Armadillo  ======
  D  Chinese softshell turtle  ======
  D           Green seaturtle  ======
  D            Painted turtle  ======
B D           Tasmanian devil  ======
B D                   Wallaby  ======
B D                   Opossum  ======
                Weddell seal  ======
            Cape golden mole  ======

Inserts between block 43 and 44 in window
B D                 Elephant 590bp
B D                  Manatee 552bp

Alignment block 44 of 451 in window, 131773807 - 131773816, 10 bps 
B D                     Human  cacgcacttt
B D                     Chimp  cgtgcacttt
B D                   Gorilla  cgcgcacttt
B D                 Orangutan  cgcgcacttt
B D                    Gibbon  cgctcacttt
B D                    Rhesus  cacgcacttt
B D       Crab-eating macaque  cacgcacttt
B D                    Baboon  cacgcacttt
B D              Green monkey  cacgcacttt
B D                  Marmoset  cgcgcactgt
B D           Squirrel monkey  cg--------
B D                  Bushbaby  tgctcacgct
           Chinese tree shrew  cactcactta
B D                  Squirrel  c--------a
       Lesser Egyptian jerboa  c-------ca
                 Prairie vole  c-------ca
B D           Chinese hamster  c-------ca
               Golden hamster  c-------ca
B D                     Mouse  c-------ca
B D                       Rat  c-------ta
B D            Naked mole-rat  cactgtctta
B D                Guinea pig  cattctctta
                   Chinchilla  cacactctta
             Brush-tailed rat  --cactgtta
B D