Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 65 in window, 73853296 - 73853299, 4 bps 
B D                     Human  ac-tg-
B D                     Chimp  ac-tg-
B D                   Gorilla  ac-tg-
B D                 Orangutan  ac-tg-
B D                    Gibbon  ac-tg-
B D                    Rhesus  ac-tg-
B D       Crab-eating macaque  ac-tg-
B D                    Baboon  ac-tg-
B D              Green monkey  ac-tg-
B D                  Marmoset  ac-ta-
B D           Squirrel monkey  ac-ta-
B D                  Bushbaby  ------
           Chinese tree shrew  ga-ga-
B D                  Squirrel  gc-gaa
       Lesser Egyptian jerboa  ac-tgc
                 Prairie vole  ac-tgg
B D           Chinese hamster  ac-tgg
               Golden hamster  ac-tgg
B D                     Mouse  gc-tgg
B D                       Rat  ac-tgt
B D                    Rabbit  ac-tgg
B D                      Pika  ac-tgg
B D                       Pig  ac-tga
B D                    Alpaca  ac-tgg
               Bactrian camel  ac-tgg
B D                   Dolphin  ac-cgg
                 Killer whale  ac-cgg
             Tibetan antelope  ac-gag
B D                       Cow  ac-gag
B D                     Sheep  ac-gag
                Domestic goat  ac-gag
B D                     Horse  ac-cgc
B D          White rhinoceros  ac-cgg
B D                       Cat  ac-tgg
B D                   Ferret   ac-tgg
B D                     Panda  ac-tgg
               Pacific walrus  ac-tgg
                 Weddell seal  ac-tgg
             Black flying-fox  ac-tgg
B D                   Megabat  ac-tgg
                Big brown bat  ac-tgg
         David's myotis (bat)  ac-tgg
B D                  Microbat  ac-tgg
B D                  Hedgehog  ac-tgc
B D                     Shrew  ac-tgg
              Star-nosed mole  -----g
B D                  Elephant  ac-ttg
          Cape elephant shrew  atgtct
B D                   Manatee  ac-tag
             Cape golden mole  ac-ttg
B D                    Tenrec  ac-tag
                     Aardvark  tc-tcc
B D                 Armadillo  at-tcg
B D                   Opossum  ac-agc
            Brush-tailed rat  ------
                  Chinchilla  ------
B D                Guinea pig  ------
B D            Naked mole-rat  ------
B D                       Dog  ------
B D           Tasmanian devil  ------
  D  Chinese softshell turtle  ======

Alignment block 2 of 65 in window, 73853300 - 73853316, 17 bps 
B D                     Human  cctg----c--agaac-cc-----cagc----c
B D                     Chimp  cctg----c--agaac-ct-----cagc----c
B D                   Gorilla  cctg----c--agaac-cc-----cagc----c
B D                 Orangutan  cctg----c--agaac-cc-----cagc----c
B D                    Gibbon  cctg----c--agaac-cc-----cagc----c
B D                    Rhesus  cctg----c--agaac-cc-----cagc----c
B D       Crab-eating macaque  cctg----c--agaac-cc-----cagc----c
B D                    Baboon  cctg----c--agaac-cc-----cagc----c
B D              Green monkey  cctg----c--agaac-cc-----cagc----c
B D                  Marmoset  cctg----c--agaac-cc-----cagc----c
B D           Squirrel monkey  cctg----c--agagc-cc-----cagc----c
B D                  Bushbaby  ---g----c--ggagc-cg-----ctgt----c
           Chinese tree shrew  cctg----c--agagc-cc-----cagc----c
B D                  Squirrel  cctg-------ggaac-cc-----ttgc----c
       Lesser Egyptian jerboa  tctgtgctg--gaagc-ct-----ccaa----c
                 Prairie vole  cctgtgctt--agagc-cc-----cagg----c
B D           Chinese hamster  tctgcactt--agagc-ct-----cagg----c
               Golden hamster  tctgcactt--agagt-cc-----cagg----c
B D                     Mouse  cctgcactta-agagc-cc-----taga----c
B D                       Rat  ctggcactt--agagc-cc-----caga----c
B D                    Rabbit  ccag----c--ggagc-cc-----cagc----c
B D                      Pika  cca-----c--ggagc-cc-----aagc----c
B D                       Pig  tctg----c--ggagc-gc-----catc----c
B D                    Alpaca  tctt----c--cgagc-gc-----cagt----c
               Bactrian camel  tctt----c--cgagc-gc-----cagc----c
B D                   Dolphin  tctg----c--ggagc-gc-----cagc----c
                 Killer whale  tctg----c--ggagc-gc-----cagc----c
             Tibetan antelope  tctg----c--ggagc-cc-----cagc----c
B D                       Cow  tctg----c--ggagc-tc-----cagc----c
B D                     Sheep  tctg----c--ggagc-cc-----cagc----c
                Domestic goat  gctg----c--ggagc-cc-----cagc----c
B D                     Horse  cctg-------aggac-cc-----cagc----c
B D          White rhinoceros  cctg-------aggag-cg-----tagc----g
B D                       Cat  cctg----c--aaagc-ct-----cggc----c
B D                   Ferret   cctg----ca-gaagc-cc-----cagc----c
B D                     Panda  cctg----c--gaagt-cc-----cagc----c
               Pacific walrus  cccg----c--aaagc-cc-----cagc----t
                 Weddell seal  ccag----c--taagc-cc-----cagc----c
             Black flying-fox  tctg----c--agagc-tt-----cagc----c
B D                   Megabat  tctg----c--agagc-tt-----cagc----c
                Big brown bat  tctg----cagagagc-cc-----cagc----c
         David's myotis (bat)  tctg----c--agagc-tc-----cagc----c
B D                  Microbat  tctg----c--agagc-gc-----cggc----c
B D                  Hedgehog  cctg----t--gtagc-cc-----caggctgtc
B D                     Shrew  cttg----c--ggagt-tc-----cgag----c
              Star-nosed mole  ctta----c--agaga-cc-----tagt----c
B D                  Elephant  cctg----c--agaat-cc-----ctgc----c
          Cape elephant shrew  tctg----t--ggaaa-ct-----ctgc----c
B D                   Manatee  cctg----c--agagtccc-----ctgc----c
             Cape golden mole  cctg----c--agagc-tc-----ctgc----c
B D                    Tenrec  cctg----c--agagc-cc-----aggc----c
                     Aardvark  cctg----c--agagc-tt-----ctgc----c
B D                 Armadillo  cctg----t--ggagc-gc-----cagc----c
B D                   Opossum  acca----a--ggagc-tttggaacagt----c
B D        American alligator  cccg----a--cgcaa-gc-----cagc----c
            Brush-tailed rat  ---------------------------------
                  Chinchilla  ---------------------------------
B D                Guinea pig  ---------------------------------
B D            Naked mole-rat  ---------------------------------
B D                       Dog  ---------------------------------
B D           Tasmanian devil  ---------------------------------
  D  Chinese softshell turtle  =================================

Inserts between block 2 and 3 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                  Opossum 2bp

Alignment block 3 of 65 in window, 73853317 - 73853329, 13 bps 
B D                     Human  c------gactttccctg-----c
B D                     Chimp  a------gactttccctg-----g
B D                   Gorilla  c------aactttccctg-----c
B D                 Orangutan  c------gactttccctg-----c
B D                    Gibbon  c------gactttccctg-----c
B D                    Rhesus  c------gactttccctg-----c
B D       Crab-eating macaque  c------gactttccctg-----c
B D                    Baboon  c------gactttccctg-----c
B D              Green monkey  c------gactttccctg-----c
B D                  Marmoset  c------gactttccctg-----c
B D           Squirrel monkey  c------gactttccctg-----t
B D                  Bushbaby  ctc--cgggctctgactg-----g
           Chinese tree shrew  ct-----gac--tccctg-----t
B D                  Squirrel  c------ccacttgctctg----a
       Lesser Egyptian jerboa  c------ccatttcttctctgcct
                 Prairie vole  c------ccagtagccctgtgcga
B D           Chinese hamster  c------ccagtggccctgttcta
               Golden hamster  c------ccagttgccctgtgctc
B D                     Mouse  c------c--atttcctcaaggta
B D                       Rat  c------ccagtttccccgaggta
B D                    Rabbit  t------gccttccttcg-----c
B D                      Pika  t------gcctttccttt-----c
B D                       Pig  c------aactgcctctt-----g
B D                    Alpaca  c------agctgcccctg-----c
               Bactrian camel  c------agctgcccctg-----c
B D                   Dolphin  g------ggctgcccctg-----c
                 Killer whale  g------ggctgcccctg-----c
             Tibetan antelope  c------tgctgcccgcg-----c
B D                       Cow  c------tgcagcccctg-----c
B D                     Sheep  c------tgctgccccag-----c
B D                     Horse  c------tactgcctctg-----c
B D          White rhinoceros  c------taccgcctctg-----c
B D                       Cat  c------aactgcccttg-----c
B D                   Ferret   c------gactg-ccttg-----c
B D                     Panda  c------gactgcccttg-----c
               Pacific walrus  c------gactgcccttg-----c
                 Weddell seal  c------gactgcccttg-----c
             Black flying-fox  c------gaccgcccttg-----t
B D                   Megabat  c------gaccgcccttg-----t
                Big brown bat  g------gatcgccctgg-----t
         David's myotis (bat)  g------gattgccctgg-----t
B D                  Microbat  g------gattgccctgg-----t
B D                  Hedgehog  c------cattgctcttg------
B D                     Shrew  c------aacggttgctg------
              Star-nosed mole  c------agctgctcttg------
B D                  Elephant  -----ttgacttcccctc-----a
          Cape elephant shrew  -----ttgacttcctcg------a
B D                   Manatee  -----ttgacttcccctc-----a
             Cape golden mole  -----ttgacgacccctg-----a
B D                    Tenrec  -----ttgacttccccca-----a
                     Aardvark  -----ttgacttcccctg-----a
B D                 Armadillo  -----aggacttccact-------
B D                   Opossum  c------ctcttctctt-------
B D        American alligator  --ccacgcccttcccgtg-----c
            Brush-tailed rat  ------------------------
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNN
                  Chinchilla  ------------------------
B D                Guinea pig  ------------------------
B D            Naked mole-rat  ------------------------
B D                       Dog  ------------------------
B D           Tasmanian devil  ------------------------
  D  Chinese softshell turtle  ========================

Alignment block 4 of 65 in window, 73853330 - 73853350, 21 bps 
B D                     Human  g-------cac----tgg------g---atcctgct-ggaac
B D                     Chimp  g-------cac----tgg------g---atcctgct-ggaac
B D                   Gorilla  g-------cac----tgg------g---atcctgct-ggaac
B D                 Orangutan  t-------cac----tgg------g---atcctgct-ggaac
B D                    Gibbon  g-------cac----tgg------g---atcctgct-ggaac
B D                    Rhesus  g-------cac----tgg------g---atcctgct-ggaac
B D       Crab-eating macaque  g-------cac----tgg------g---atcctgct-ggcac
B D                    Baboon  g-------cac----tgg------g---atccttct-ggaac
B D              Green monkey  g-------cac----tcg------g---atcctgct-ggaac
B D                  Marmoset  g-------ccc----tgg------g---atcctgct-gaaac
B D           Squirrel monkey  g-------cgc----tgg------g---atcctgct-ggaac
B D                  Bushbaby  g-------cac----tta------g---atcgcgcc-tgaat
           Chinese tree shrew  g-------cac----tgc------g---attctgct-ggacc
B D                  Squirrel  g-------cac----tgg------g---atcctgct-ggaaa
       Lesser Egyptian jerboa  t-------tga----tct------g---at-ctgct-ggaac
                 Prairie vole  g-------ttc----ttg------g---at-ctggt-accaa
B D           Chinese hamster  g-------tcc----ttg------g---at-ctagt-gccac
               Golden hamster  g-------tcc----ttg------g---at-ctagt-gccac
B D                     Mouse  gaactttatct----ttg------g---gt-ccagt-ggcac
B D                       Rat  g-------ccc----ttg------g---at-ctagc-agcac
B D                    Rabbit  g-------cgc----tcc------a---tc-cggtt-gcagc
B D                      Pika  g-------ttc----tgg------a---tc-ctgct-gcaaa
B D                       Pig  g-------ctc----ctg------g---cttctgcc-ctcat
B D                    Alpaca  ---------tc----ccg------g---atcctgcc-ggcat
B D                   Dolphin  g-------ctc----tcg------g---ctcctgct-ggcat
                 Killer whale  g-------ctc----tcg------g---ctcctgct-ggcat
             Tibetan antelope  g-------ctggctctcg------a---ctccggct-ggcac
B D                       Cow  g-------ctggctctcg------g---ctccggct-ggcac
B D                     Sheep  c-------ctg----ctg------a---ctccggct-ggcac
B D                     Horse  g-------ctc----tca------g---cttctgct-ggcat
B D          White rhinoceros  g-------ctc----tcg------g---ctcctgct-ggcgc
B D                       Cat  a-------ctc----tcg------g---ctcctgct-ggcac
B D                   Ferret   a-------ctc----tcg------g---cttctgct-tgttc
B D                     Panda  a-------ctc----tgg------g---cttcagctggaaag
               Pacific walrus  a-------ctc----tcg------g---cctctgc--ggcac
                 Weddell seal  a-------cgc----tcg------g---cttctgc--ggcac
             Black flying-fox  g-------cgc----tca------t---ctcctgtc-ggcat
B D                   Megabat  g-------cgc----tca------t---ctcctgtc-ggcat
                Big brown bat  a-------ctc----tgc------t---ctcctgtt-ggcac
         David's myotis (bat)  a-------ctc----tgc------t---ctcctctt-ggcac
B D                  Microbat  a-------ctc----tgc------t---ctcctctt-ggcac
B D                  Hedgehog  ------------------------g---ttccttct-agc--
B D                     Shrew  ------------------------g---gctctctg-atc--
              Star-nosed mole  ---------------acacttgcag---actccttg-gac--
B D                  Elephant  g-------cat----tcc------c---atcccggt-gaaac
          Cape elephant shrew  a-------cgc----tct------cattattctgct-gaaat
B D                   Manatee  g-------cac----tca------g---attctggt-gaaac
             Cape golden mole  a-------cgc----gct------g---atctgact-gaaac
B D                    Tenrec  g-------cac----tcc------g---atcccgct-gaaag
                     Aardvark  g-------cgt----tct------g---atcctgct-gaaac
B D                 Armadillo  --------cgc----tca------g---atc-----------
B D                   Opossum  g-------tct----tca------g---ag-ctcca-agcac
B D        American alligator  ---------------cca------c---cgcctgct-gcgct
            Brush-tailed rat  ------------------------------------------
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Chinchilla  ------------------------------------------
B D                Guinea pig  ------------------------------------------
B D            Naked mole-rat  ------------------------------------------
B D                       Dog  ------------------------------------------
B D           Tasmanian devil  ------------------------------------------
  D  Chinese softshell turtle  ==========================================

Inserts between block 4 and 5 in window
B D                 Hedgehog 2bp
B D                    Shrew 10bp
B D                  Opossum 5bp

Alignment block 5 of 65 in window, 73853351 - 73853382, 32 bps 
B D                     Human  ctca--gct--gcaacatgag----------ct----ccgcagccaggtc
B D                     Chimp  ctcg--gct--gcaacatgag----------ct----ccgcagccaggtc
B D                   Gorilla  ctcg--gct--gcaacatgag----------ct----ccgcagccaggtc
B D                 Orangutan  ctcg--gct--gcaacatgag----------ct----ccgcagccaggtc
B D                    Gibbon  ctcg--gct--gcaacatgag----------ct----ccttagccaggtc
B D                    Rhesus  ctct--gct--acaacatgag----------ct----ccgcagccagggc
B D       Crab-eating macaque  ctct--gct--gcaacatgag----------ct----ccgcagccaggtc
B D                    Baboon  ctct--gct--gcaacatgag----------ct----ccgcagccaggtc
B D              Green monkey  ctct--gct--gcaacatgag----------ct----ccgcagccaggtc
B D                  Marmoset  ctcc--gcg--acaacatgag----------ct----ccgcagcagcgtc
B D           Squirrel monkey  ctcc--gcg--acaacatgag----------ct----ccgcagccgggcc
B D                  Bushbaby  ct-----cc--aagacatgag----------ct----tcccagcgggctc
           Chinese tree shrew  cgc---------cgacatgag----------cc----gcccagcgcgctc
B D                  Squirrel  ct-----cc--aggacatgggcctcatattgcg----ctcctgcagcctc
       Lesser Egyptian jerboa  ct-----tc--aggatatgag-----------------ccttctagcttc
                 Prairie vole  cc-----tc--ttgatatgag----------cg----ccgctgcggtgtt
B D           Chinese hamster  ct-----tc--ttaatatgag----------cg----ccgctgcagtgtg
               Golden hamster  cc-----tc--ttgatatgag----------tg----ccactgcggtatg
B D                     Mouse  cc-----tc--ttgacatgag----------cg----tcgctgcggtgtt
B D                       Rat  cc-----tc--ttgacatgag----------tg----ccgctgcggtgtt
B D                    Rabbit  cc-----cg--gcgatatgag----------ca----tcccagaggcgtc
B D                      Pika  cc-----ca--gcaacatgag----------cc----tcccagtggcctt
B D                       Pig  cc-----ca--gcgacatgag----------cc----tgtcagggaacac
B D                    Alpaca  ct-----cc--gcaacatgag----------ac----tcatagcgggtac
B D                   Dolphin  ct-----ct--gcgacatgag----------cc----tggcagctggcac
                 Killer whale  ct-----ct--gcgacatgag----------cc----tggcagctggcac
             Tibetan antelope  tc-----ctgagcgcgatgaa----------cc----cggcagtcgg---
B D                       Cow  tc-----ctgagcgcgatgaa----------cc----aggcagtcggacc
B D                     Sheep  tg-----ctgagcgcgatgaa----------tc----cggcagtcggaac
B D                     Horse  ct------c--gagacatgag----------cc----tcggagggggctc
B D          White rhinoceros  ct-----cc--gcgacatgag----------cc----tcggag-------
B D                       Cat  ct-----gc--tggacatgag----------gc----ttcgagtgggtgc
B D                   Ferret   ct-----gc--tggacatgag----------cg----tcggagcacgttc
B D                     Panda  ct-----gc--tggacatgaa----------tg----tgggagagggttc
               Pacific walrus  ct-----gc--tggacatgag----------cg----tcggagcgcgttc
                 Weddell seal  ct-----gc--tggacatgag----------cg----tcggagcgcgttc
             Black flying-fox  ct-----ct--gtgacatgag----------tc----tcggagtgggctc
B D                   Megabat  ct-----ct--gtgacatgag----------tc----tcggagtgggctc
                Big brown bat  ct-----ct--gcgacatgag----------cc----tgagagcgggctc
         David's myotis (bat)  ct-----cc--tcaacatgag----------cc----tgaaagtgggctc
B D                  Microbat  ct-----cc--acgacatgag----------cc----tgagagggggctc
B D                  Hedgehog  ct-----cc--tggacatggc----------tc----tcagagcaggttc
B D                     Shrew  ct-----ct--tggacatgag----------cc----tccga--------
B D                  Elephant  ct-----ct--gcgacatgag----------cc----tcccaaggagctc
          Cape elephant shrew  ct-----ca--gagacatgag----------ca----accacaggagctc
B D                   Manatee  ct-----cc--gcaacatgag----------cc----accaaaggagctc
             Cape golden mole  ct-----ct--gtgacatgaa----------cc----agctaaggagcac
B D                    Tenrec  ca-----cc--gcagcatggg----------ct----actcaaggatctc
                     Aardvark  ct-----cc--acgacatgaa----------cc----accaaaggagctc
B D                 Armadillo  -------ct--gtgccatgag----------cc----cgcgagtgagctc
B D                   Opossum  tc-----ct--ccaccatgag----------ccgcagtctctgccagat-
B D        American alligator  --cccagct--ccgggcccgg----------cc----tgccagcgc----
             Star-nosed mole  --------------------------------------------------
            Brush-tailed rat  --------------------------------------------------
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Chinchilla  --------------------------------------------------
B D                Guinea pig  --------------------------------------------------
B D            Naked mole-rat  --------------------------------------------------
B D                       Dog  --------------------------------------------------
B D           Tasmanian devil  --------------------------------------------------
  D  Chinese softshell turtle  ==================================================

Alignment block 6 of 65 in window, 73853383 - 73853430, 48 bps 
B D                     Human  ccgcctcacccgcgcc---a----cccg----cca------ggagatg---------------ct-gttc
B D                     Chimp  ccgcgccacccgcgcc---a----ccct----ccc------ggagatg---------------ct-gttc
B D                   Gorilla  ccgcgccacccgcgcc---t----cccg----ccc------ggagatg---------------ct-gttc
B D                 Orangutan  ccgcgccacccg--------------------ccc------ggagata---------------tt-gttc
B D                    Gibbon  ccgcgccacccg--------------------tcc------ggagatg---------------ct-attc
B D                    Rhesus  ccgcgccatcta--------------------ccc------ggagatg---------------ct-gttc
B D       Crab-eating macaque  ccgcgccatcta--------------------ccc------ggagatg---------------ct-gttc
B D                    Baboon  ccgcgccaccta--------------------ccc------ggagatg---------------ct-gttc
B D              Green monkey  ccgcgccaacct--------------------ccc------ggagatg---------------tt-gttc
B D                  Marmoset  ccgcgactccca--------------------ccc------ggggctg---------------ct-gctc
B D           Squirrel monkey  ctgcgcctcccg--------------------ccc------ggggctg---------------ct-gctc
B D                  Bushbaby  aggcatctcccgcccccggg----ccag----ccc------ctggctg---------------cc-gctc
           Chinese tree shrew  ctgcaccctctgccccagac----tcag----ccc------agtgctt---------------ct-cttc
B D                  Squirrel  t----gccccca------tc----tcta----ccc------tgggctg---------------ct-gctc
       Lesser Egyptian jerboa  tcgtggccccca------gc----tcag----------------gatg---------------ct-gctc
                 Prairie vole  tcgaggcccccg------gc----ccaa----ccc------tgggctg---------------ct-gctt
B D           Chinese hamster  tcgaggctcctg------gc----ccag----cct------tgggctg---------------ct-gctt
               Golden hamster  tcgaggcccctg------cc----ccag----gcc------tgggctg---------------ct-gctt
B D                     Mouse  tcgaggcctccg------gc----ccag----tcc------tgagctg---------------ct-gctt
B D                       Rat  tcgaggcctccg------gc----ccag----ccc------tgagctg---------------ct-tctt
B D                    Rabbit  tggtgccccccg------ac----cccg----gccaagccgcggactg---------------tt-gctc
B D                      Pika  agcaggaccccg------ac----ctcg----gcccatgcgcggtctc---------------tt-gctc
B D                       Pig  ccgcgcctcccgtccctggc----tcag----ccc------caggctg---------------ct-gctc
B D                    Alpaca  ccgcgcctcccgctgccggc----ccag----ccc------cagtctc---------------ct-gctc
B D                   Dolphin  ccgcgcccccggcccgcggc----ccag----ccc------cgggctg---------------ct-----
                 Killer whale  ccgcgcccccggcccgcggc----ccag----ccc------cgggttg---------------ct-----
             Tibetan antelope  ----gcctcccgcccgcggt----ccag----ccc------ggggctg---------------ct-gctc
B D                       Cow  ccgcgcctcccgcccgcggt----ccag----ccc------ggggctg---------------ct-gctc
B D                     Sheep  ccgcgcctcccgcccgcggt----ccag----ccc------ggggctg---------------ct-----
B D                     Horse  ccgcgcctcccgcccctggc----cccg----ccg------ggggctg---------------ct-gctc
B D          White rhinoceros  --ccgccccccgcccccggc----cccg----ccc------ggggctgctgctcctgggactcct-gctc
B D                       Cat  cggcgcccccaggcccctgc----ccag----ctc------ggggctc---------------ct-gctc
B D                   Ferret   ccgtgcccccagcccctgcc----tggg----ccg------ggggctg---------------ct-gctc
B D                     Panda  cggtgcccccagcccctggc----tggg----ccc------ccgcctg---------------ct-gctc
               Pacific walrus  ccgcgcccccagcccctggc----gggg----cgc------acggcgg---------------ct-gctc
                 Weddell seal  ccgcgcccccagcccctggc----gggg----cgc------ccggctg---------------ct-gctc
             Black flying-fox  cagcacctcccgcccatggc----gtgg----ccc------ggggctg---------------ct-gctc
B D                   Megabat  cagcacctcccgcgcatggc----gtgg----ccc------ggggctg---------------ct-gctc
                Big brown bat  ccgcgcctcccgcccctggc----ccgg----ctc------cgggctg---------------ct-gctc
         David's myotis (bat)  ccaggcctcccgcccctggc----ccag----ctc------cgggctg---------------ct-gctc
B D                  Microbat  ccgcgcctcccgcccccggc----ccag----ctc------cgggctg---------------ct-gctc
B D                  Hedgehog  cagtgcctcctgctcacagc----ccat----ctc------gggactg---------------ct-gctt
B D                     Shrew  ----gcctcctgcctccagc----ccgg----ccc------cgcggcg---------------ct-gctc
B D                  Elephant  tggcgcctggcacgctcggc----ccag----aat------gaggcca---------------ct-gctc
          Cape elephant shrew  ccgtgcctggaagggccgactctaccaa----gat----------ctg---------------ct-tctc
B D                   Manatee  tggcacctggcacgcccagc----ccag----ccc------agggctg---------------ct-gctc
             Cape golden mole  tggcacgtggcataccccgt----ctag----ttt------ggggcta---------------ct-gttc
B D                    Tenrec  tggcacgtggcacgctcagc----ccgg----ccc------agggctg---------------ct-cctg
                     Aardvark  cggcgcctggcatgctgggc----ccag----ccc------gctgctg---------------ct-gctc
B D                 Armadillo  cgctgctctcggccctcggc----ccag----ccc------agggcta---------------ct-gctc
B D                   Opossum  --------------------------------gtc------tagcctc---------------ct-cctt
B D           Tasmanian devil  ------------------------ccacctacttc------gaacctc---------------ccgccct
B D        American alligator  -cctgccccgcg------gg----gccg----ccc--------ggctg---------------ca-ggca
             Star-nosed mole  ----------------------------------------------------------------------
            Brush-tailed rat  ----------------------------------------------------------------------
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  Chinchilla  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================

                        Human  ttggcgttgct-
                        Chimp  ttggcgttgct-
                      Gorilla  ttggcattgct-
                    Orangutan  ttggcgttgct-
                       Gibbon  ttggcgttgct-
                       Rhesus  ctggcgttgct-
          Crab-eating macaque  ctggcgttgct-
                       Baboon  ctggcgttgct-
                 Green monkey  ctggcattgct-
                     Marmoset  ttggggttgct-
              Squirrel monkey  ctggggttgct-
                     Bushbaby  ctgcagctgct-
           Chinese tree shrew  ccggggctgct-
                     Squirrel  ctggggctgtt-
       Lesser Egyptian jerboa  ctggggctgct-
                 Prairie vole  ctgggcctgtt-
              Chinese hamster  ctgggcctgtt-
               Golden hamster  ctgggcctgtt-
                        Mouse  ctgggcctgtt-
                          Rat  ctgggtctgct-
                       Rabbit  ctgggactgct-
                         Pika  ctgggactgct-
                          Pig  ctagggctgat-
                       Alpaca  ctggggctgct-
                      Dolphin  ------------
                 Killer whale  ------------
             Tibetan antelope  ctggggctgct-
                          Cow  ctggggctgct-
                        Sheep  ------------
                        Horse  ctggggctgtt-
             White rhinoceros  ctgggactgct-
                          Cat  ctgggactgct-
                      Ferret   ctgggactgct-
                        Panda  ctggggctgct-
               Pacific walrus  ctggggctgct-
                 Weddell seal  ctggggctgct-
             Black flying-fox  ctggggctgct-
                      Megabat  ctggggctgct-
                Big brown bat  ctggggctgct-
         David's myotis (bat)  ctgggactgct-
                     Microbat  ctagggctgct-
                     Hedgehog  tgggggttgct-
                        Shrew  ttggggcttct-
                     Elephant  ctggggctcct-
          Cape elephant shrew  ctgggactact-
                      Manatee  ctagggctgct-
             Cape golden mole  ctggggctgct-
                       Tenrec  ctaggactcct-
                     Aardvark  ctgcagctgct-
                    Armadillo  ctgggggtgct-
                      Opossum  ctgtgtctgct-
              Tasmanian devil  atattccccac-
           American alligator  ccggggcgagcc
              Star-nosed mole  ------------
             Brush-tailed rat  ------------
                Domestic goat  NNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNN
                   Chinchilla  ------------
                   Guinea pig  ------------
               Naked mole-rat  ------------
                          Dog  ------------
     Chinese softshell turtle  ============

Inserts between block 6 and 7 in window
B D                  Opossum 6bp
B D          Tasmanian devil 6bp

Alignment block 7 of 65 in window, 73853431 - 73853436, 6 bps 
B D                     Human  gctcct
B D                     Chimp  gctcct
B D                   Gorilla  gctcct
B D                 Orangutan  gctcct
B D                    Gibbon  gctcct
B D                    Rhesus  gctcct
B D       Crab-eating macaque  gctcct
B D                    Baboon  gctcct
B D              Green monkey  gctcct
B D                  Marmoset  gctcct
B D           Squirrel monkey  gctcct
B D                  Bushbaby  gctgct
           Chinese tree shrew  gctcct
B D                  Squirrel  gctcct
       Lesser Egyptian jerboa  gcttct
                 Prairie vole  gtttct
B D           Chinese hamster  gtttct
               Golden hamster  gtttct
B D                     Mouse  gtttct
B D                       Rat  gttgct
B D                    Rabbit  gctgct
B D                      Pika  gctact
B D                       Pig  gctcct
B D                    Alpaca  gctcct
B D                   Dolphin  gctcct
                 Killer whale  gctcct
             Tibetan antelope  gctcct
B D                       Cow  gcttct
B D                     Sheep  gctcct
                Domestic goat  gctcct
B D                     Horse  gcttct
B D          White rhinoceros  gctcct
B D                       Cat  gctctt
B D                   Ferret   gctccc
B D                     Panda  gctcct
               Pacific walrus  gctcct
                 Weddell seal  gctcct
             Black flying-fox  gctgct
B D                   Megabat  gctgct
                Big brown bat  gctcct
         David's myotis (bat)  gctcct
B D                  Microbat  gctcct
B D                  Hedgehog  gttcct
B D                     Shrew  gcttct
B D                  Elephant  gctcct
          Cape elephant shrew  gctcat
B D                   Manatee  gctcct
             Cape golden mole  gctcct
B D                    Tenrec  gctgct
                     Aardvark  gctcct
B D                 Armadillo  gctcct
B D                   Opossum  gttcct
B D           Tasmanian devil  acccct
B D        American alligator  gtgccc
             Star-nosed mole  ------
            Brush-tailed rat  ------
              Bactrian camel  NNNNNN
                  Chinchilla  ------
B D                Guinea pig  ------
B D            Naked mole-rat  ------
B D                       Dog  ------
  D  Chinese softshell turtle  ======

Inserts between block 7 and 8 in window
B D                    Sheep 105bp
B D                  Opossum 6bp
B D          Tasmanian devil 6bp

Alignment block 8 of 65 in window, 73853437 - 73853447, 11 bps 
B D                     Human  gccagttg--tgg
B D                     Chimp  gcctgttg--tgg
B D                   Gorilla  gccagttg--tgg
B D                 Orangutan  gccagttg--tgg
B D                    Gibbon  gccagttg--tgg
B D                    Rhesus  gccagttg--tgg
B D       Crab-eating macaque  gccagttg--tgg
B D                    Baboon  gccagttg--tgg
B D              Green monkey  gacagttg--tgg
B D                  Marmoset  gccagctg--tgg
B D           Squirrel monkey  gccagctc--tgg
B D                  Bushbaby  gaccgctg--cac
           Chinese tree shrew  acgggcta--tgg
B D                  Squirrel  atcagctg--tgg
       Lesser Egyptian jerboa  accagctg--tgg
                 Prairie vole  gccagctg--cga
B D           Chinese hamster  tccagccg--tga
               Golden hamster  tccagccg--tga
B D                     Mouse  gccagcgg--tgg
B D                       Rat  gccagctg--tgg
B D                    Rabbit  gctgactg--tgg
B D                      Pika  gctcgctg--tgg
B D                       Pig  gccaggca-t---
B D                    Alpaca  gccggccct----
B D                   Dolphin  actagccg-----
                 Killer whale  actagccg-----
             Tibetan antelope  gccggcca-----
B D                       Cow  gccggcca-----
                Domestic goat  gccggcca-----
B D                     Horse  gccggtcg--tag
B D          White rhinoceros  gccagccg--tag
B D                       Cat  gccagctg--tgg
B D                   Ferret   gccagcgg--tgg
B D                     Panda  gccggctg--cgc
               Pacific walrus  gccagctg--ggg
                 Weddell seal  gccagcaa--ggg
             Black flying-fox  gccagctg--tgg
B D                   Megabat  gccagctg--tgg
                Big brown bat  gccggctg--tgg
         David's myotis (bat)  gccagctg--tgg
B D                  Microbat  gccggctg--tgg
B D                  Hedgehog  gtcagcct--caa
B D                     Shrew  gcctgctc--tgg
B D                  Elephant  gccagcca--tgg
          Cape elephant shrew  gctaacca--agg
B D                   Manatee  gccagccg--tgg
             Cape golden mole  gccagcta--tgg
B D                    Tenrec  gccagctc--tgg
                     Aardvark  accagccg--tgg
B D                 Armadillo  gtcaaccg--ggt
B D                   Opossum  ctcag--------
B D           Tasmanian devil  ctcag--------
B D        American alligator  -ccgggcc--ggg
             Star-nosed mole  -------------
B D                     Sheep  =============
            Brush-tailed rat  -------------
              Bactrian camel  NNNNNNNNNNNNN
                  Chinchilla  -------------
B D                Guinea pig  -------------
B D            Naked mole-rat  -------------
B D                       Dog  -------------
  D  Chinese softshell turtle  =============

Inserts between block 8 and 9 in window
B D                  Opossum 1bp
B D          Tasmanian devil 5bp

Alignment block 9 of 65 in window, 73853448 - 73853459, 12 bps 
B D                     Human  tcgcctt---------cgcc---a
B D                     Chimp  tcgcctt---------cgcc---a
B D                   Gorilla  tcgcctt---------cgcc---a
B D                 Orangutan  tcgcctt---------cgcc---a
B D                    Gibbon  tcgcctt---------cgcc---a
B D                    Rhesus  tcgcctt---------cgcc---a
B D       Crab-eating macaque  tcgcctt---------cgcc---a
B D                    Baboon  tcgcctt---------cgcc---a
B D              Green monkey  tcgcctt---------cgcc---a
B D                  Marmoset  tcgcctt---------cgcc---a
B D           Squirrel monkey  tcgcctt---------cgcc---a
B D                  Bushbaby  tcgccac---------tgcc---a
           Chinese tree shrew  taaccct---------cacc---a
B D                  Squirrel  tcacagt---------cgtcagga
       Lesser Egyptian jerboa  ttgcctt---------tgcc---a
                 Prairie vole  ttgccat---------cacc---a
B D           Chinese hamster  ttgcctt---------cacc---a
               Golden hamster  ttgcctt---------cacc---a
B D                     Mouse  ttgctgt---------cacc---a
B D                       Rat  ttgctgt---------cacc---a
B D                    Rabbit  cagccgc---------cgcc---a
B D                      Pika  taccagc---------cacc---a
B D                       Pig  -cgccct---------ggcg---c
B D                    Alpaca  -cgccct---------cgcc---c
               Bactrian camel  tcgcccg---------cgcc---c
B D                   Dolphin  tcgctct---------cgcc---c
                 Killer whale  tcgctct---------cgcc---c
             Tibetan antelope  tcgccct---------cgcc---c
B D                       Cow  tcgccct---------ggcc---c
                Domestic goat  tcgccct---------cgcc---c
B D                     Horse  tctccgt---------cgcc---a
B D          White rhinoceros  tctccct---------cgcc---a
B D                       Cat  tcgccct---------cccc---a
B D                   Ferret   tcgccct---------cccc---a
B D                     Panda  tctcgct---------cccc---a
               Pacific walrus  tcgccct---------ccgc---a
                 Weddell seal  tcgccct---------ccgc---a
             Black flying-fox  ttgccca---------cacc---a
B D                   Megabat  tcgccca---------cacc---a
                Big brown bat  tcgccca---------agtc---a
         David's myotis (bat)  tcgccca---------agtc---a
B D                  Microbat  tcgccca---------agtc---a
B D                  Hedgehog  tggcctt---------ctcc---a
B D                     Shrew  ttgtcct---------gacc---a
B D                  Elephant  tggcctt---------cgcc---a
          Cape elephant shrew  tcacctt---------cacc---a
B D                   Manatee  ttgcgtt---------tgcc---a
             Cape golden mole  tggcctc---------tgcc---a
B D                    Tenrec  tggcctt---------tgcc---a
                     Aardvark  ttgccttcagcaccagcgcc---a
B D                 Armadillo  ttacctt---------cgcc---a
B D           Tasmanian devil  ttcccca-----------------
B D        American alligator  -cg---------------------
             Star-nosed mole  ------------------------
B D                     Sheep  ========================
            Brush-tailed rat  ------------------------
                  Chinchilla  ------------------------
B D                Guinea pig  ------------------------
B D            Naked mole-rat  ------------------------
B D                       Dog  ------------------------
B D                   Opossum  ========================
  D  Chinese softshell turtle  ========================

Inserts between block 9 and 10 in window
            Tibetan antelope 4bp
B D                      Cow 4bp
               Domestic goat 4bp

Alignment block 10 of 65 in window, 73853460 - 73853469, 10 bps 
B D                     Human  ga------------------ggtgagag
B D                     Chimp  gc------------------ggtgagag
B D                   Gorilla  ga------------------ggtgagag
B D                 Orangutan  gg------------------ggtgagag
B D                    Gibbon  gc------------------ggtgagag
B D                    Rhesus  gc------------------ggtgagag
B D       Crab-eating macaque  gc------------------ggtgagag
B D                    Baboon  gc------------------ggtgagag
B D              Green monkey  gc------------------ggtgaggg
B D                  Marmoset  gc------------------ggtgagag
B D           Squirrel monkey  gc------------------ggtgagag
B D                  Bushbaby  gcgccagagaagag------ggtgagag
           Chinese tree shrew  gt------------------ggtgagag
B D                  Squirrel  gc------------------ggtgagag
       Lesser Egyptian jerboa  ct------------------ggtgagaa
                 Prairie vole  ct------------------ggtgagag
B D           Chinese hamster  gt------------------ggtgagag
               Golden hamster  gt------------------ggtgagag
B D                     Mouse  gc------------------ggtgagat
B D                       Rat  gg------------------ggtgagat
B D                    Rabbit  gt------------------ggtgagaa
B D                      Pika  gc------------------ggtgagaa
B D                       Pig  aa------------------ggtgagag
B D                    Alpaca  aa------------------ggtgagag
               Bactrian camel  aa------------------ggtgagag
B D                   Dolphin  aa------------------ggtaagag
                 Killer whale  aa------------------ggtaagaa
             Tibetan antelope  ----------------------tgagcg
B D                       Cow  ----------------------tgagcg
B D                     Sheep  ----------------------ggagcg
                Domestic goat  ----------------------tgagcg
B D                     Horse  gc------------------ggtgagaa
B D          White rhinoceros  gc------------------ggtgagaa
B D                       Cat  ga------------------ggtaagag
B D                   Ferret   ca------------------ggtgagag
B D                     Panda  ca------------------ggtgagag
               Pacific walrus  ca------------------ggtggggg
                 Weddell seal  ca------------------ggtggggg
             Black flying-fox  ag------------------ggtgagaa
B D                   Megabat  ag------------------ggtgagaa
                Big brown bat  gc------------------ggtgagaa
         David's myotis (bat)  ta------------------ggtgagaa
B D                  Microbat  gc------------------ggtgagaa
B D                  Hedgehog  ca------------------ggtgagga
B D                     Shrew  aa------------------ggtgagaa
B D                  Elephant  ------atgccagc------ggtaagag
          Cape elephant shrew  ------gcgccagt------ggtgagag
B D                   Manatee  ------gcgccagt------ggtaagaa
             Cape golden mole  ------gcgacacc------ggtgagag
B D                    Tenrec  ------gcaccagcaccggaggtacgag
                     Aardvark  ------tcaccagt------ggtaggag
B D                 Armadillo  ------ac------------ggtgagag
B D           Tasmanian devil  -----------------------aa---
B D        American alligator  -----------------gggggcgggg-
             Star-nosed mole  ----------------------------
            Brush-tailed rat  ----------------------------
                  Chinchilla  ----------------------------
B D                Guinea pig  ----------------------------
B D            Naked mole-rat  ----------------------------
B D                       Dog  ----------------------------
B D                   Opossum  ============================
  D  Chinese softshell turtle  ============================

Inserts between block 10 and 11 in window
B D                 Squirrel 9bp
B D                   Rabbit 6bp
B D                     Pika 6bp

Alignment block 11 of 65 in window, 73853470 - 73853648, 179 bps 
B D                     Human  ca----ga---aa--------ccagg-c-tggga--------------------------gggc--ca-g
B D                     Chimp  ca----ga---aa--------ccagg-c-tggga--------------------------gggc--ca-g
B D                   Gorilla  ca----ga---aa--------ccagg-c-tggga--------------------------gggc--ca-g
B D                 Orangutan  ca----ga---aa--------ccagg-c-tggga--------------------------gggc--ca-g
B D                    Gibbon  ca----ga---aa--------ccagg-c-tggga--------------------------gggc--ca-g
B D                    Rhesus  ca----ga---aa--------ccaga-c-tggaa--------------------------gggc--ca-g
B D       Crab-eating macaque  ca----ga---aa--------ccaga-c-tggaa--------------------------gggc--ca-g
B D                    Baboon  ca----ga---aa--------ccaga-c-tggaa--------------------------gggc--ca-g
B D              Green monkey  ca----ga---aa--------ccaga-c-tggaa--------------------------gggc--ca-g
B D                  Marmoset  ca----ga---ag--------ccagg-c-tgtga--------------------------gggc--cg-g
B D           Squirrel monkey  ca----ga---ag--------ccagg-c-tgtga--------------------------gggc--cg-g
B D                  Bushbaby  ca----gagggag--------agggg-c-cagga--------------------------ctgg--ga-g
           Chinese tree shrew  ca----ga---ag--------caagg-c-ggtag--------------------------ggcc--ag-g
B D                  Squirrel  ag----ag----------------------ggga--------------------------ggga--cc-g
       Lesser Egyptian jerboa  ------tg----------------------ggaa--------------------------tgga--cc-t
                 Prairie vole  ag----gg----------------------tgaa--------------------------ggga--tc-a
B D           Chinese hamster  cg----gg----------------------tgaa--------------------------ggga--tc-c
B D                     Mouse  tg----gg----------------------tgaa--------------------------ggga--tg-c
B D                       Rat  tg----gg----------------------tgaa--------------------------agga--tc-c
B D                    Rabbit  cc----gg----------------------agaag-------------------------gtgc--cg-g
B D                      Pika  tc----gg----------------------ggaa--------------------------gtgc--cg-g
B D                       Pig  cc----aa---ag--------caggg-aggggag--------------------------aggt--ct-g
B D                    Alpaca  ct----ga---ag--------caggg-tcgggaa--------------------------aggtggcg-g
               Bactrian camel  ct----ga---ag--------caggg-tcgggaa--------------------------aggtggcg-g
B D                   Dolphin  ctgaatga---ag--------cagggcctggggg--------------------------aggt--cg-g
                 Killer whale  ctgaatga---ag--------cagggcctggggg--------------------------aggt--cg-g
             Tibetan antelope  ctgacgga---ag--------caggg-cggggag--------------------------aggt--cc-c
B D                       Cow  ctgatgga---ag--------caggg-cggggag--------------------------aggt--cc-a
B D                     Sheep  aggaggga---ag--------caggg-cggggag--------------------------aggt--cc-c
                Domestic goat  ctgacgga---ag--------caggg-cggggag--------------------------aggt--cc-c
B D                     Horse  ca-----a---ag--------caagg-cggggag--------------------------gaag--cg-g
B D          White rhinoceros  ca----ga---gg--------caagg-ccgggag--------------------------ggac--cc-g
B D                       Cat  ct----aa---ag--------taagg-cgtggag--------------------------ggga--cg-g
B D                   Ferret   ct----ga---a---------taagg-cattgtg--------------------------gggt--caga
B D                     Panda  ct----ga---ag--------taagg-cgctggg--------------------------ggga--ca-g
               Pacific walrus  ct----ga---a---------taagg-cgtctgg--------------------------ggga--cacc
                 Weddell seal  ct----ga---a---------taagg-cgtccgg--------------------------ggga--cacg
             Black flying-fox  ca----ga---gg--------caaag-aggggag--------------------------ggac--ct-g
B D                   Megabat  ca----ga---gg--------caaag-aggggag--------------------------ggac--ct-g
                Big brown bat  ca----ga---ag--------cgagg-aggggag--------------------------gg----cc-g
         David's myotis (bat)  ca----ga---ag--------ccagg-agggaaa--------------------------gg----ct-g
B D                  Microbat  ca----ga---ag--------cgagg-agggaag--------------------------gg----ct-g
B D                  Hedgehog  ca----ga---gg--------tgagg-ccaggag--------------------------ggac--aa--
B D                     Shrew  ca----ga---agctaaaaatctagg-caggggg--------------------------cgac--ag-g
B D                  Elephant  ca----aa---ag--------caagg-c-gggga--------------------------ggga--tg-g
          Cape elephant shrew  ca----ac---ag--------ctagt-c-cgtga--------------------------aggg--ca-g
B D                   Manatee  ca----aa---ag--------taagg-c-gggga--------------------------ggga--cg-a
             Cape golden mole  ca----aa---ag--------caaag-a-tggga--------------------------ggga--tt-g
B D                    Tenrec  cg----aa---ag---------aagg-g-ggaga--------------------------tggc--cg-g
                     Aardvark  ca----a----ag--------caagg-c-aggga--------------------------ggga--ta-g
B D                 Armadillo  ta----aa---ac--------tgaga-c-ctggagctgcgggagtgaaggtggagcgaccgggg--ag-g
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D        American alligator  ----------------------------cgggga--------------------------aggc-----g
             Star-nosed mole  ----------------------------------------------------------------------
            Brush-tailed rat  ----------------------------------------------------------------------
                  Chinchilla  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================

                        Human  cagcggcg-------a--------------------g-------------------------ggggagtc
                        Chimp  cagcggcg-------a--------------------g-------------------------ggggagtc
                      Gorilla  cagcggcg-------a--------------------g-------------------------ggggagtc
                    Orangutan  cagcagcg-------a--------------------g-------------------------ggggagtc
                       Gibbon  cagcggcg-------a--------------------g-------------------------ggggagtc
                       Rhesus  cagcggtg-------a--------------------g------------------------gggggaatg
          Crab-eating macaque  cagcggcg-------a--------------------g------------------------gggggaatg
                       Baboon  cagcggcg-------a--------------------g------------------------aggggaatg
                 Green monkey  cagcggcg-------a--------------------g------------------------gggggaatg
                     Marmoset  cagcggcg-------a----------------------------------------------ggggggtc
              Squirrel monkey  cagcggcg-------a----------------------------------------------ggggggtc
                     Bushbaby  ctgcaggg-------a--------------------g-------------------------ggcgaccc
           Chinese tree shrew  gagcagcg-------g--------------------g------------------------gaggcagtc
                     Squirrel  accaaccagaacagtg--------------------g------------------------gaattggtt
       Lesser Egyptian jerboa  gagtgat--------g--------------------g------------------------gagagggta
                 Prairie vole  cagggcca-------g--------------------g------------------------gaaatgggt
              Chinese hamster  tagagacc-------t--------------------g------------------------gagatggtt
                        Mouse  tagggaca-------g--------------------g------------------------aagacagtt
                          Rat  ttggggca-------g--------------------c------------------------aagacagtt
                       Rabbit  gagcgatt-------g--------------------a------------------------gagcgggtc
                         Pika  gggcgatg-------a--------------------g------------------------gaggaagtc
                          Pig  gggcggg-------------gcggggagg-------g------------------------gggaagttc
                       Alpaca  gggtgggg-------gtgggatatgggga-------a------------------------gtgaca---
               Bactrian camel  gggtgggg-------gtgggatatgggga-------a------------------------gtgacagcc
                      Dolphin  gggcggtg-------g--------------------g------------------------gagagagtg
                 Killer whale  gggcggtg-------g--------------------g------------------------gagagagtg
             Tibetan antelope  aggcagc-------------------------------------------------------agagagtc
                          Cow  gggcagc-------------------------------------------------------agagagtc
                        Sheep  gggcagc-------------------------------------------------------agagagtc
                Domestic goat  gggcagc-------------------------------------------------------agagagtc
                        Horse  gg-----------------------------------------------------------gagggaccg
             White rhinoceros  gg-----------------------------------------------------------gagcgaccc
                          Cat  gggcggac-------g--------------------a------------------------caggcagtc
                      Ferret   gggaagca-------g--------------------agagagagaga--------------gagagagtc
                        Panda  gggaagca-------g--------------------a------------------------gagagagtc
               Pacific walrus  gggaagca-------g--------------------a--------gc--------------gggagagtt
                 Weddell seal  cggaagca-------g--------------------a--------gc--------------gggagagtc
             Black flying-fox  gggaggcc-------g--------------------g------------------------gagagaggc
                      Megabat  gggaggcc-------g--------------------g------------------------gagagaggc
                Big brown bat  ggaagggc-------c--------------------g------------------------gagagaggc
         David's myotis (bat)  ggaagggc-------tgggaagggctgggaagggctg------------------------gagagaggc
                     Microbat  ggaagggc-------cggagaga-------------g------------------------gagagaggc
                     Hedgehog  ----------------------------------------------------------------aggatc
                        Shrew  gcgac-------------------------------a------------------------ggcagaatc
                     Elephant  gggcggtg-------g--------------------c------------------------gaaggggtc
          Cape elephant shrew  agcagggg-------a--------------------g------------------------catggggtc
                      Manatee  gggcggtg-------g--------------------t------------------------gaaagggtc
             Cape golden mole  gagaggta-------g--------------------g------------------------gaaagggac
                       Tenrec  gaatggta-------g--------------------g------------------------gaaaggctc
                     Aardvark  gggcagtg-------g--------------------g------------------------gaaagagtc
                    Armadillo  gggtggtgc------g--------------------g------------------------gagggcgtc
                      Opossum  ---------------------------------------------gcggctagccactggtaagag---c
              Tasmanian devil  -------------------------------------atgtctgagcagccagtttcctctcggagcctc
           American alligator  gagccgcg-------g--------------------g------------------------gtactgccc
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  -c----------ggg----aa--gccctgggg----ctg--gggaggaa---------tcctc--tagga
                        Chimp  -c----------ggg----aa--gccctgggg----ctg--gggaggaa---------tcctc--tagga
                      Gorilla  -c----------ggg----aa--gccctgggg----ctg--gggaggaa---------tcctc--tagga
                    Orangutan  -c----------ggg----aa--gccctgggg----ctg--gggagaaa---------tcctc--tagga
                       Gibbon  -c----------ggg----aa--gtcctgggg----cag--gggaggaa---------tcctc--tagga
                       Rhesus  -c----------ggg----aa--gctctgggg----ctg--gggaggaa---------tcctc--tagga
          Crab-eating macaque  -c----------ggg----aa--gctctgggg----ctg--gggaggaa---------tcctc--tagga
                       Baboon  -c----------ggg----aa--gctctgggg----ctg--gggaggaa---------tcctc--tagga
                 Green monkey  -c----------ggg----aa--gctctgggg----ctg--gggaggaa---------tcctc--tagga
                     Marmoset  -c----------ggg----aa--tccctgggg----ccg--gggaggag---------tcctc--caggc
              Squirrel monkey  -c----------ggg----aa--gccctgggg----ctg--gggaggag---------tcctc--taagc
                     Bushbaby  -t----------ggg----ag--gcccctggg----ctg--gggaggaa---------gccct--gacgc
           Chinese tree shrew  -t----------ggg----aa--cccc--aag----ctg--gggaggag---------ttctt--accgc
                     Squirrel  cc----------agg----aa--cccccgggg--ggctg--aggaagtg---------tcttt--aatgt
       Lesser Egyptian jerboa  -c----------tgg----tg--cctctgagg----cca--gggaggct----------------attac
                 Prairie vole  -c----------agg----ag--ccccagggg-----tg--gggaggtg----------------aactc
              Chinese hamster  -c----------agg----ag--cctcagggg-----tg--gggaagtg----------------agctc
                        Mouse  -c----------agg----ag--cctcaggtg-----cg--gggaggtg----------------aactc
                          Rat  -c----------cga----gg--cctcaggcg-----cg--gggaggtg----------------aactc
                       Rabbit  -c----------gcg----tg--ct---gggg-----ca-agggaagag---------gcgct--aacgc
                         Pika  -t----------gcg----cc--gc---ggtg-----cacctgtaacta---------gcact--ataac
                          Pig  -c----------aga----aa--cctgcangg----cca--gggcggcc---------tctgc--agccg
                       Alpaca  ------------ggg----aa--ctccagggc----cta--gggcggag---------tctgt--aacca
               Bactrian camel  -t----------ggg----aa--ctccagggg----cta--gggcggag---------tctgt--aacca
                      Dolphin  -c----------tgg----aa--cccccgggg----ctg--gggcggag---------tctgt--acccg
                 Killer whale  -c----------tgg----aa--cccccgggg----ctg--gggcggag---------tctgt--acccg
             Tibetan antelope  -c----------ggg----aa--gtcccg---------g--gaacggag---------tccgt--attc-
                          Cow  -c----------ggg----aa--gtccca---------g--gaacggag---------tccgt--aatc-
                        Sheep  -c----------ggg----aa--gtcccg---------g--gaacggag---------tccgt--aatc-
                Domestic goat  -c----------ggg----aa--gtcccg---------g--gaacggag---------tccgt--aatc-
                        Horse  -g----------ggg---cag--cccccagga----ctt--gg---------------------------
             White rhinoceros  -g----------ggg---cag--cccccagca----ctt--tg---------------------------
                          Cat  -g----------ggg----aa--cccccaggg----ctg--gggtggaa---------ttttt--a----
                      Ferret   -g----------gggaaccaa--cccctcggg----atg--gggctgaa---------tctc--------
                        Panda  -g----------ggg----aa--ctcctaggg----ctg--gggcggaa---------tctt--------
               Pacific walrus  -g----------ggg----aa--cccctaggc----ctg--gggcagaa---------tctt--------
                 Weddell seal  -g----------ggg----aa--cccctaggc----ctg--gggcagaa---------tctt--------
             Black flying-fox  -c----------ggg----aa--ccccc-gcg----ctg--gggc--ag---------tcttt--aaccg
                      Megabat  -c----------ggg----aa--ccccc-gcg----ctg--gggcagag---------tcttt--aaccg
                Big brown bat  -c----------ggg----ga--acccggggg----ctg--tgccg-ggaaagggggccttgt--agcca
         David's myotis (bat)  -c----------ggg----ga--accctgggg----ctg--ggcca-gg---------tctgt--aaaca
                     Microbat  -g----------ggg----ga--acccc-ggg----ctg--ggcca-gg---------tctgt--aaaca
                     Hedgehog  -t----------aga----at--tccctgggg----ctg--g--agtag---------tctta--agtct
                        Shrew  -t----------gga----a---cccttgggg----cag--ggaatgag---------tcttt--a----
                     Elephant  -c----------ggg----aa--ttgctgggg----ctg--gagaggag---------tcatc--aacta
          Cape elephant shrew  -ccccagggcctggg----aa--tttccg-------------------t---------ttctt--aactg
                      Manatee  -t----------ggg----aa--ttccca-gg----ctg--gagaggag---------tcagc--a----
             Cape golden mole  -t----------ggg----aa--ttcttgggg----ttt--cagaggag---------tcatt--aacca
                       Tenrec  -t----------ggg----aa--ttcccgggg----ct-----ggcaag---------tcatt--aacca
                     Aardvark  -c----------ggg----aa--ttctggaga----ctg--gagaggag---------tcatt--aacca
                    Armadillo  -t----------ggg----aa--cccccggtg----ctg--gggaggag---------tcat---aaccg
                      Opossum  -g----------gga----ag--cacttggggacaactg--gagggagg---------ttgcctctgtag
              Tasmanian devil  -t----------ggg----tg--gacatggataaaaggg--acccgaag---------tcctcggagtgc
           American alligator  -c----------ggg----aaagccccggcgg----ccg--agctggcg---------ctggc--ggata
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  t--ca-----tgatcgc-ag--------------------ct-gctcttatt----------------gc
                        Chimp  t--ca-----tgatcgc-ag--------------------ct-acgcttatt----------------gc
                      Gorilla  t--ca-----tgatcgc-ag--------------------ct-gcacttatt----------------gc
                    Orangutan  t--ca-----tgatcgc-ag--------------------ct-acacttatt----------------gc
                       Gibbon  t--ca-----tgatcgc-ag--------------------ct-atacttatc----------------gc
                       Rhesus  t--ca-----tgatcgc-ag--------------------ct-acacttacc----------------gc
          Crab-eating macaque  t--ca-----tgatcgc-ag--------------------ct-acacttacc----------------gc
                       Baboon  t--ca-----tgatcac-ag--------------------ct-acacttacc----------------gc
                 Green monkey  t--ca-----tgatcgc-ag--------------------ct-acacttacc----------------gc
                     Marmoset  t--ac-----tgatagc-gg--------------------ct-acacttagc----------------gc
              Squirrel monkey  t--gc-----tgatcgc-gg--------------------ct-acacttagc----------------gc
                     Bushbaby  t--aa-----tgacacc-gc--------------------ctaatgtttgtc----------------cc
           Chinese tree shrew  t--aa-----agaaacc-ag--------------------ct-ccact--cc----------------ct
                     Squirrel  t--aa-----tggttcc-ag--------------------ct-ctatt--gt----------c-----ct
       Lesser Egyptian jerboa  c--aa-----taacacc-ag--------------------ca-gggat--gt----------------cc
                 Prairie vole  c--ta------gacacc-ag--------------------tc-atact--gt----------------at
              Chinese hamster  t--ta------gacacc-gg--------------------cc-attct--ga----------------at
                        Mouse  t--ga-----tgacatcggg--------------------tc-atatt--gt----------------at
                          Rat  t--ga-----cgacacc-ag--------------------tc-ctacg--gt----------------at
                       Rabbit  c--ca-----gggtccc-gc--------------------ta-ctctt--gg----------------gc
                         Pika  ctata-----aggtgct-gc--------------------tt-ctccc---g----------------gt
                          Pig  c--ctgggagggagccc-ag--------------------ctacggtttgct----------agcaagga
                       Alpaca  t--tc----gggacccc-aa--------------------ctatgatttgct----------------ga
               Bactrian camel  t--tc----gggacccc-aa--------------------ctatgatttgct----------------ga
                      Dolphin  t--ct----cggttccc-ag--------------------ctgtgattgacc----------------ga
                 Killer whale  t--ct----cggttccc-ag--------------------ctgtgattgacc----------------ga
             Tibetan antelope  ---tc----cggatccc-ag--------------------ctaggatttccc----------------aa
                          Cow  ---tc----cggatccc-ag--------------------ctaggatttccc----------------ga
                        Sheep  ---tc----cggatccc-ag--------------------ctaggatgtccc----------------aa
                Domestic goat  ---tc----cggatccc-ag--------------------ctaggatttccc----------------aa
                        Horse  --------------------------------------------------tt----------------aa
             White rhinoceros  --------------------------------------------------tt----------------ga
                          Cat  -------------------------------------------taatcttct----------------ga
                      Ferret   -------------------------------------------tcactcttt----------------ga
                        Panda  -------------------------------------------tcatctttt----------------ga
               Pacific walrus  -------------------------------------------gcatctttc----------------ga
                 Weddell seal  -------------------------------------------gcatctttc----------------ga
             Black flying-fox  c--ct----gcgaaacc--------------------------cgctacccc----------------gc
                      Megabat  c--ct----gcgaaacc--------------------------cgctacccc----------------gc
                Big brown bat  c--ca--------------------------------------cgctgtccc----------------ac
         David's myotis (bat)  c--ag--------------------------------------caatatcct----------------cc
                     Microbat  c--ag--------------------------------------cgatatcct----------------cc
                     Hedgehog  c--ct----gtaaaagc-aa--------------------c--tacactgct----------------ga
                        Shrew  --------------------------------------------accctggt----------------ga
                     Elephant  g--ta----atgataag-aa--------------------ct-gtactttat----------------tg
          Cape elephant shrew  c--ta----atggtagg------------------------t-tta-tttgt----------------tg
                      Manatee  --------------tag-aa--------------------ct-atacttcat----------------tg
             Cape golden mole  c--ta----gtgataag-aa--------------------ct-a--------------------------
                       Tenrec  g--ta----atgaactc-ta--------------------ct-t--------------------------
                     Aardvark  c--ta----atgagaag-aa--------------------tt-agagtttac----------------tg
                    Armadillo  c--ta----aagagacc-gg--------------------gt-acccctcac----------------tg
                      Opossum  t--ta-----gggctgt-tg--------------------tt-ccagctgtg------------------
              Tasmanian devil  a--ca-----aagctgg-aga----------------actct-ccacctgtgcttctactctcaaactcc
           American alligator  a--aa-----gggcggc-gggcgccgggcagggcaccgctctccgcctctcc----------------ca
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  ------------------------g----cgcgt--------------gctga--g------tctg---c
                        Chimp  ------------------------g----cgcgt--------------gctca--g------tctg---c
                      Gorilla  ------------------------g----cgcgt--------------gctga--g------tctg---c
                    Orangutan  ------------------------g----cgcgt--------------gctga--g------t-------
                       Gibbon  ------------------------g----cgcgt--------------gctga--g------tttg---c
                       Rhesus  ------------------------g----agcgt--------------gctga--g------tgtg---c
          Crab-eating macaque  ------------------------g----agcgt--------------gctga--g------tgtg---c
                       Baboon  ------------------------g----agcgt--------------gctga--g------tgtg---c
                 Green monkey  ------------------------g----agcgt--------------gctga--g------tgtg---c
                     Marmoset  ------------------------g----tgcgt--------------gccga--g------tgtg---c
              Squirrel monkey  ------------------------g----cgcgt--------------gctga--g------tgtg---c
                     Bushbaby  ------------------------g----agctt--------------gctaa--g------g--g---g
           Chinese tree shrew  ------------------------g----ggctt--------------gctca--g------c-tg---t
                     Squirrel  ------------------------g----gggtt--------------gcgaa--g------tgtg---a
       Lesser Egyptian jerboa  ------------------------t----agctt--------------gagag--g------tgtg----
                 Prairie vole  ------------------------t----ggctt--------------gccaa--c------tgtg----
              Chinese hamster  ------------------------t----ggctt--------------gccaa--c------tgca----
                        Mouse  ------------------------g----ggctt------------------------------------
                          Rat  ------------------------a----ggctt--------------gccaa--c------cgca----
                       Rabbit  ------------------------g----cacct--------------gccgc--g------agcg---t
                         Pika  ------------------------g----cacct--------------gtagc--t------agca---c
                          Pig  ------------------------g----cattt--------------gctaa--a------gtgt---c
                       Alpaca  ------------------------g----tgctt--------------gctaa--g------tgtg---c
               Bactrian camel  ------------------------g----tgctt--------------gctac--g------tgtg---c
                      Dolphin  ------------------------g----cgc-g--------------gctaa--g------agcg---c
                 Killer whale  ------------------------g----cgc-g--------------gctaa--g------agcg---c
             Tibetan antelope  ------------------------g----cgctt--------------gctag--g------tgtg---a
                          Cow  ------------------------g----cgctt--------------gctac--g------tgtg---a
                        Sheep  ------------------------g----cgctt--------------gctag--g------tgtg---a
                Domestic goat  ------------------------g----cgctt--------------gctag--g------tgtg---a
                        Horse  ------------------------g----ggctt--------------gctaa--g------tgtg---c
             White rhinoceros  ------------------------g----cgctt--------------gctaa--g------tggc---t
                          Cat  ------------------------g----ctctg--------------cctag--g------tgtg---c
                      Ferret   ------------------------g----ttctt--------------tccag---------tgtg---t
                        Panda  ------------------------g----ttccg--------------tctag--g------tgtg---c
               Pacific walrus  ------------------------g----ttctc--------------gctag--t------tgtg---c
                 Weddell seal  ------------------------g----gtctc--------------gctag--g------tgtg---c
             Black flying-fox  t-----------------------a----cgctttactgagcgtacatggtaa--g------tgtg---c
                      Megabat  t-----------------------a----cgctttactgagcgtacatgttaa--g------tgtg---c
                Big brown bat  ------------------------a----cgctttactgagcgaa---gttaggtg------tgtg---c
         David's myotis (bat)  ------------------------a----cactttactgatcaaa---gttaggtg------tgtg---c
                     Microbat  ------------------------a----tgctttactgatcaga---gttaggtg------tgtg---t
                     Hedgehog  ------------------------a----aactt--------------gtaaa---------tgtg---c
                        Shrew  ------------------------gttcttactc--------------gctaa----------ggg---c
                     Elephant  ------------------------a----ggctt--------------gccaa--g------tggg---c
          Cape elephant shrew  ------------------------a----gcttt--------------gctag--t------tgag---c
                      Manatee  ------------------------a----ggctt--------------gccaa--a------tggg---c
             Cape golden mole  ----------------------------------------------------------------aa---t
                       Tenrec  ----------------------------------------------------------------gg---c
                     Aardvark  cggcttgctaagtaggcaggcactg----ggctt--------------gctaa--g------tagg---c
                    Armadillo  c-----------------------g----cgctg--------------gctaa--g------tggg---c
                      Opossum  ------------------------g----cgcag--------------gctag--g------tgcggacc
              Tasmanian devil  ------------------------a----cgccc--------------gctaa--gttaccatgcgctct
           American alligator  ------------------------g----ccctc--------------gc-----c------cccg---c
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  gggtacagtgcc----------------ag----gcact---gcacgt----gca-c--ct-cgccac--
                        Chimp  gggtacagtgcc----------------ag----gcact---gcaagt----gca-c--ct-cgccac--
                      Gorilla  gggtacagcgcc----------------ag----gcact---gcacgt----gca-c--ct-cgccac--
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  gggtacagtgcc----------------ag----gcact---gcacgt----gca-c--ct-cgccac--
                       Rhesus  gggtacagtggc----------------ag----gcact---gcacgg----gca-c--ct-cgccac--
          Crab-eating macaque  gggtacagtggc----------------ag----gcact---gcacgg----gca-c--ct-cgccac--
                       Baboon  gggtacagtggc----------------ag----gcac----gcacgg----gca-c--ct-cgccac--
                 Green monkey  gggtacagtggc----------------ag----g--ct---gcaggg----gca-c--ct-cgccac--
                     Marmoset  gggcaccgtgcc----------------ag----gcgct---gcatgt----gca-c--ct-cgccac--
              Squirrel monkey  gggcaccgtgcc----------------ag----gcgct---gcacgt----gca-c--cg-cgccac--
                     Bushbaby  ctgcacagtgcc----------------tgcctagcaag---gca-------gct-c--ctgctgcat--
           Chinese tree shrew  gggcacggagcc----------------ca----gcgct---gaaccg----gca-g--tc-agcc----
                     Squirrel  gggcactctgct----------------aa----actct---gcacaa----gtg-c--gc-tgccac--
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  -------------------------------------ct---tca-------------------------
              Chinese hamster  -------------------------------------ct---tca-------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  -------------------------------------cc---gca-------------------------
                       Rabbit  gggcaccgcact----------------gg----g--ct---gcacgc----atg-c--tt-tacccg--
                         Pika  tagcgcccc----------------------------ct---ccgcgc----a-----------------
                          Pig  gggctctgtgcc----------------ta----gcgct---gccccg-t--gcg-c--tt-tatcac--
                       Alpaca  aggagctgtacc----------------ca----gcgct---gcccgt--------a--tt-aaccat--
               Bactrian camel  aggagctgtacc----------------ca----gcgct---gtccat--------c--tt-aatcat--
                      Dolphin  aggcgctgtgcc----------------ac----gtgct---gcccgc-t--gcg-c--tc-taccac--
                 Killer whale  aggcgctgtgcc----------------ag----gtgct---gcccgc-t--gcg-c--tc-taccac--
             Tibetan antelope  atgcgcgatgcc----------------ac----gtgct---ggccgg-t--gcg-c--tc-gatcac--
                          Cow  aggcgcggtgcc----------------ac----gtgct---ggccgg-t--gcg-c--tc-gatcac--
                        Sheep  aggcgcggtgcc----------------ac----gtgct---ggccgg-g--gcg-c--tc-gatcac--
                Domestic goat  aggcgcggtgcc----------------ac----gtgct---gg-----------------------c--
                        Horse  aggcgctgtgcc----------------ca----gcgct---gccccg-t--gcg-c--tt-cctcat--
             White rhinoceros  aggcgctgtgcc----------------aa----gcgct---gccccg-t--gcg-c--tt-taccac--
                          Cat  gggcgctgtgcc----------------at----gagct---gcccgg-t--gca-ctatt-taccat--
                      Ferret   gggggctgtgcc----------------aa----gcgct---gccagg-g--gca-c--tt-tactat--
                        Panda  gg----------------------------------------gcccgg-t--gca-c--tt-taccac--
               Pacific walrus  gggcgctgtgcc----------------aa----gcgctgccgccggg-t--gcg-c--tt-caccat--
                 Weddell seal  gggcgctgtgcc----------------aa----gcgctgccgccggg-t--gcg-c--tt-caccat--
             Black flying-fox  aggcactgtgac----------------aa----gcgct---gtcccg-t--gcg-c--tt-caccac--
                      Megabat  aggcactgtgac----------------aa----gcgct---gccccg-t--gcg-c--tt-caccac--
                Big brown bat  gggcgctgcgcc----------------aa----gcgct---gtcccc-t--gca-c--tt-cacaat--
         David's myotis (bat)  aggcactgggcc----------------aa----gcgct---gtccgg-t--gag-c--tt-cac-at--
                     Microbat  gggcactgggcc----------------aa----gagct---gtcccg-t--gcg-c--tt-cac-at--
                     Hedgehog  aggcaccctgcc----------------tg----gagct---gccctg-g--ggg-c--tt-gactgt--
                        Shrew  aaacactgagcc----------------ta----gaatg---gcccagtg--ggg-t--tt-taccat--
                     Elephant  aggcactgtgcc----------------aa----gcgct---t--tag-t--gca-t--tt-tacgat--
          Cape elephant shrew  aggtgttg-------------------------------------tag-t--gcgtt--tt-taccgt--
                      Manatee  aggcactgtgcc----------------aa----gcgct------aag-t--gca-t--tt-tacc-t--
             Cape golden mole  agacatggtgcc----------------aa----g----------aat-t--gta------------g--
                       Tenrec  aggcactttatc----------------at----g--------------t--gca------------c--
                     Aardvark  aggcactgggcc----------------aa----gccct---g--tag-t--aca-t--tt-taccat--
                    Armadillo  gggcactgtg-c----------------aa----gcgcc---g--ccg-g--gca-t--ca-caccat--
                      Opossum  gggacctg--------------------gt----gtgcc---ccctgg-g--------------------
              Tasmanian devil  agtacttgcgcctcagccgctgcaggctct----gcact---ccttcg-gtc------------------
           American alligator  acccacatcagc----------------at----gagcc---gcgtcc-t--gct-c--ct-tgccgccc
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  --ctgatcag----cacaa----cc------------------------------tc-tgtc--------
                        Chimp  --ctgatcag----cacaa----cc------------------------------tc-tgtc--------
                      Gorilla  --ctgatcag----cacaa----cc------------------------------tc-tgtc--------
                    Orangutan  -------------------------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnntc-tgtc--------
                       Gibbon  --ctgatcag----cacaa----cc------------------------------tc-tgtc--------
                       Rhesus  --ctgatcag----cacaa----ct-----------------------------------tc--------
          Crab-eating macaque  --ctgatcag----cacaa----ct-----------------------------------tc--------
                       Baboon  --ctgatcag----cacaa----ct-----------------------------------tc--------
                 Green monkey  --ctgatcag----cacaa----ct-----------------------------------tc--------
                     Marmoset  --ctggtcag----cacaa----ct------------------------------tc-tctc--------
              Squirrel monkey  --ctgctcag----cacaa----ct------------------------------tc-tctc--------
                     Bushbaby  --cgagccga----cagag----ct------------------------------tc-tttc--------
           Chinese tree shrew  --ctgaccac----tccag----ct------------------------------ta-cttc--------
                     Squirrel  --tgagtcaa----tataa----ct------------------------------tt-cctctggaaatg
       Lesser Egyptian jerboa  --------------caggc----aa------------------------------gt-cttc--------
                 Prairie vole  -------ctg----cccac----ct------------------------------gc-ctt---------
              Chinese hamster  -------ccg----cccac----ct------------------------------gc-cttc--------
                        Mouse  --------------tccac----ct------------------------------gc-cttc--------
                          Rat  -------cta----cccat----ct------------------------------gc-cctctggg----
                       Rabbit  --gcggtcaa----aacgt----cc------------------------------cc-tttc--------
                         Pika  -----------------------cc------------------------------cc-ttcc--------
                          Pig  --ctggtcaa----taata----ct-------------------------------c-cttc--------
                       Alpaca  --ctagttg------taca----tc-------------------------------c-tttt--------
               Bactrian camel  --ctagttg------taca----tc-------------------------------c-tttt--------
                      Dolphin  --ctggacag----tcaga----ca-------------------------------c-tttc--------
                 Killer whale  --ctggacag----tcaga----ca-------------------------------c-tttc--------
             Tibetan antelope  --ctagccgg----caata----ct-------------------------------c-tttc--------
                          Cow  --ctagccgg----caaca----ct-------------------------------c-tttc--------
                        Sheep  --ctagccgg----caata----ct-------------------------------c-tttc--------
                Domestic goat  --ctagccgg----caata----ct-------------------------------c-tttc--------
                        Horse  --ctggccaa----caata----ct------------------------------tc-tttc--------
             White rhinoceros  --gtagtcaa----taata----ct------------------------------tc-cttc--------
                          Cat  --cttgtcag----taaca----ct------------------------------tc-tctc--------
                      Ferret   --gcagtcaa----tagcg----ct---------------------------------cccc--------
                        Panda  --ccagtcaa----caacg----ct---------------------------------tctc--------
               Pacific walrus  --ctagtcaa----taacg----ct---------------------------------tctc--------
                 Weddell seal  --ctggtcaa----taacg----ct---------------------------------tctc--------
             Black flying-fox  --ctaggcaa----caata----ct------------------------------tctttac--------
                      Megabat  --ctaggcaa----caata----ct------------------------------tctttac--------
                Big brown bat  --ccaggcaa----cgtta----ct------------------------------tc-ttac--------
         David's myotis (bat)  --ctaggcactatgtacta----ct------------------------------tc-ttac--------
                     Microbat  --ctaggcac----tacta----ct------------------------------tc-ttac--------
                     Hedgehog  --ctagtcaa----taat--------------------------------------c-ttta--------
                        Shrew  --ctttccaa------------------------------------------------------------
                     Elephant  --ttagtcag----tataa----ct------------------------------tc-tttc--------
          Cape elephant shrew  --ttagtcag----tat-----------------------------------------------------
                      Manatee  --tcagtcaa----tataa----ct------------------------------cc-tttc--------
             Cape golden mole  --tgagtcag----tacaa----ct------------------------------tc-tttc--------
                       Tenrec  --atggtcaa----gataa----tt------------------------------tc-tttc--------
                     Aardvark  --ttagccaa----cttaattatct------------------------------tc-tttt--------
                    Armadillo  --tgagtcaa----tacta----cg------------------------------cc-tttc--------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
           American alligator  tgctggccgc----ctgcg----cc------------------------------gc-gctc--------
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  -----------t----
                        Chimp  -----------t----
                      Gorilla  -----------t----
                    Orangutan  -----------t----
                       Gibbon  -----------t----
                       Rhesus  -----------t----
          Crab-eating macaque  -----------t----
                       Baboon  -----------t----
                 Green monkey  -----------t----
                     Marmoset  -----------c----
              Squirrel monkey  -----------c----
                     Bushbaby  -----------c----
           Chinese tree shrew  -----------t----
                     Squirrel  caattcgctgct----
       Lesser Egyptian jerboa  ----------------
                 Prairie vole  -----------c----
              Chinese hamster  -----------c----
                        Mouse  -----------c----
                          Rat  ---------ggc----
                       Rabbit  -----------c----
                         Pika  -----------c----
                          Pig  -----------t----
                       Alpaca  -----------g----
               Bactrian camel  -----------g----
                      Dolphin  -----------t----
                 Killer whale  -----------t----
             Tibetan antelope  -----------a----
                          Cow  -----------a----
                        Sheep  -----------a----
                Domestic goat  -----------a----
                        Horse  -----------t----
             White rhinoceros  -----------t----
                          Cat  -----------t----
                      Ferret   -----------c----
                        Panda  -----------t----
               Pacific walrus  -----------t----
                 Weddell seal  -----------t----
             Black flying-fox  -----------t----
                      Megabat  -----------t----
                Big brown bat  -----------t----
         David's myotis (bat)  -----------t----
                     Microbat  -----------t----
                     Hedgehog  -----------g----
                        Shrew  ----------------
                     Elephant  -----------t----
          Cape elephant shrew  ----------------
                      Manatee  -----------t----
             Cape golden mole  -----------t----
                       Tenrec  -----------t----
                     Aardvark  -----------t----
                    Armadillo  -----------t----
                      Opossum  ----------------
              Tasmanian devil  ----------------
           American alligator  -----------tgccg
              Star-nosed mole  ----------------
             Brush-tailed rat  ----------------
                   Chinchilla  ----------------
                   Guinea pig  ----------------
               Naked mole-rat  ----------------
                          Dog  ----------------
     Chinese softshell turtle  ================

Inserts between block 11 and 12 in window
B D                 Marmoset 385bp

Alignment block 12 of 65 in window, 73853649 - 73853795, 147 bps 
B D                     Human  --gagag-----------------ag---------------------------gt-ctgatttacggcta
B D                     Chimp  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D                   Gorilla  --gagag-----------------ag---------------------------gt-ctgatttacggcta
B D                 Orangutan  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D                    Gibbon  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D                    Rhesus  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D       Crab-eating macaque  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D                    Baboon  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D              Green monkey  --gagag-----------------ag---------------------------gt-atgatttatggcta
B D                  Marmoset  --gaggg-----------------aa---------------------------gt-atgatttatggcta
B D           Squirrel monkey  --gaggg-----------------aa---------------------------gt-acgatttatggcta
B D                  Bushbaby  --aaggg-----------------ag---------------------------gt-atgattggtggcta
           Chinese tree shrew  --gaggg-----------------ag---------------------------ct-atg--ctgtggcta
B D                  Squirrel  --aagga-----------------aa---------------------------tg-atga--c-------
       Lesser Egyptian jerboa  -----------------------------------------------------tg-gttcatc-------
                 Prairie vole  --gagga-----------------ag---------------------------ag-gtgatgc-------
B D           Chinese hamster  --gaggg-----------------ag---------------------------ag-gtggtgc-------
B D                     Mouse  --gaggg-----------------ga---------------------------ag-gcgatgc-------
B D                       Rat  --ggggg-----------------gt---------------------------tg-atgatgc-------
B D                    Rabbit  --gaggg-----------------cg---------------------------gc-gtgatgtatggcgc
B D                      Pika  --gcagg-----------------ag---------------------------tc-ctgatgcattgcgc
B D                       Pig  --gagtg-----------------ag---------------------------gg-tttgtctgtgaatg
B D                    Alpaca  --gaggt-----------------a--------------------------------cgatttgtggatg
               Bactrian camel  --gaggt-----------------a--------------------------------tgatttgtggatg
B D                   Dolphin  --gaggg-----------------ag---------------------------gt-ctggtttgtggatg
                 Killer whale  --gaggg-----------------ag---------------------------gt-ctggtttgtggatg
             Tibetan antelope  --gaggg-----------------at---------------------------g---tggtttgtggatg
B D                       Cow  --gaggg-----------------at---------------------------g---tggtttgtgggtg
B D                     Sheep  --gaggg-----------------at---------------------------g---tggtttgtggatg
                Domestic goat  --gaggg-----------------at---------------------------g---tggtttgtggata
B D                     Horse  --gaagg-----------------ag---------------------------gt-atgatttgtggatg
B D          White rhinoceros  --gaaag-----------------ag---------------------------gt-atgatttgtgggtg
B D                       Cat  --gaggg-----------------ag---------------------------gt-atgatttatgggtg
B D                   Ferret   --gaggg------------------g---------------------------gt-atgagttgtggggg
B D                     Panda  --ggggg-----------------ag---------------------------gc-atgatttgtggggg
               Pacific walrus  --gaggg-----------------ag---------------------------gt-aggatttgtgcggg
                 Weddell seal  --gaggg-----------------ag---------------------------gt-aggatctgtggggg
             Black flying-fox  --gagtt-----------------ag---------------------------at-atggttcgtagact
B D                   Megabat  --gagtt-----------------ag---------------------------at-atggttcgtagact
                Big brown bat  --gcagg-----------------ag---------------------------gt-ttggtttgcggatg
         David's myotis (bat)  --gc-gg-----------------ag---------------------------gt-atggtctgtggttg
B D                  Microbat  --gcggg-----------------ag---------------------------gt-atggtttctgggtg
B D                  Hedgehog  --ggggcagagagggggtggtggtgg---------------------------ct-atgattaatggata
B D                     Shrew  ------------------------gg---------------------------ga-atgacttagggaac
B D                  Elephant  --gagaa-----------------aa---------------------------gt-atgatttgtggata
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  --gagaa-----------------ag---------------------------gt-atgatttgtggata
             Cape golden mole  --gagga-----------------ac---------------------------gt-atgatatgtgcata
B D                    Tenrec  --gagga-----------------ag---------------------------gt-aggctttgtagaca
                     Aardvark  --gagga-----------------ag---------------------------gtaactaaatgtgcata
B D                 Armadillo  --gaggg-----------------ag---------------------------gt-gtgatttgtggata
B D                   Opossum  ---agac-----------------ag---------------------------ga-gtggactcgaaacg
B D           Tasmanian devil  --aaggc-----------------tgctgcctctcttgttgctggctactttagc-gtgcattgccaatg
B D        American alligator  gggtgag-----------------gg---------------------------ga-cagggacaggggaa
             Star-nosed mole  ----------------------------------------------------------------------
            Brush-tailed rat  ----------------------------------------------------------------------
                  Chinchilla  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================

                        Human  --------aggaaaaga------------aagc-----tg----aaggt-----agt-----ggaaaagg
                        Chimp  --------aggaaaaga------------aggc-----tg----aatgt-----agt-----ggaaaagg
                      Gorilla  --------aggaaaaga------------aagc-----tg----aaggt-----agt-----ggaaaagt
                    Orangutan  --------aggaaaaga------------aggc-----tg----aaggt-----agt-----ggaaaagg
                       Gibbon  --------aggaaaaga------------cggc-----tg----aaggt-----agt-----ggaaaagg
                       Rhesus  --------aggaaaaga------------aggc-----tg----aaggt-----agt-----ggaaaaag
          Crab-eating macaque  --------aggaaaaga------------aggc-----tg----aaggt-----agt-----ggaaaaag
                       Baboon  --------aggaaaaga------------aggc-----tg----aaggt-----agt-----ggaaaaag
                 Green monkey  --------atgaaaaga------------aggc-----tg----aaggt-----agt-----ggaaaaag
                     Marmoset  --------aggagaaga------------aggc-----tg----gaggt-----agt-----ggaaaagg
              Squirrel monkey  --------aggagaaga------------aggc-----tg----gcggt-----aat-----ggaaaagg
                     Bushbaby  --------aggaaaggg------------aggc-----cg----gagct-----agc-----agaaatga
           Chinese tree shrew  --------gcgaactga------------gggc-----ca----gagg------agg-----gccagaga
                     Squirrel  --------------caa------------gg-------gc----agggg-----tgg-----gggatggg
       Lesser Egyptian jerboa  --------------tga------------gg-------cc----atggc-----cct-----ggaaagga
                 Prairie vole  --------------tac------------ag-------cc----aaggg-----taa-----agaaaagg
              Chinese hamster  --------------tat------------ag-------cc----aaggg-----tga-----ggaagagg
                        Mouse  --------------tgt------------aa-------cc----aagcc-----tgt-----ggaaa-gg
                          Rat  --------------tct------------ag-------cc----aaggg-----ttt-----ggaaaggg
                       Rabbit  --------aagaaatga------------aggc-----cc----aaggc-----agt-----gggaaata
                         Pika  --------aagaaatga------------aggt-----cg----aaggg-----agt-----gggaaaga
                          Pig  --------aggaaatga------------aggt-----ca----aatgc-----agc-----g-agaaga
                       Alpaca  --------aggaaatga------------aggt-----ca----aacgt-----agt-----gaaaaaga
               Bactrian camel  --------aggaaataa------------aggt-----ca----aacgt-----agt-----gaaaaaga
                      Dolphin  --------gggaagtga------------aggtcagacgc----cacgc-----cac-----g-agaaga
                 Killer whale  --------aggaagtga------------aggtcagacgc----cacgc-----cac-----g-agaaga
             Tibetan antelope  --------aggaaatga------------aggt-----gc----aaggc-----agt-----g-agaaga
                          Cow  --------aggaaatga------------aggt-----cc----aaggc-----agt-----g-agaaga
                        Sheep  --------aggaaatga------------aggt-----gc----aaggc-----agt-----g-agaaga
                Domestic goat  --------aggaaatga------------aggt-----gc----aaggc-----agt-----g-agaaga
                        Horse  --------aggaaatga------------aggc-----ca----aacgc-----agt-----gggaaaga
             White rhinoceros  --------aggaaatga------------ag----------------gc-----agt-----ggggaagg
                          Cat  --------aggaaatga------------aagc-----ca----aacgc-----aatg----aaaaaaga
                      Ferret   --------aggacatga------------aagc-----cactttagtac-----ggtttcccaagaaaga
                        Panda  --------aggaggtga------------aagc-----ca----aacgc-----aat-----gagaaaga
               Pacific walrus  --------aggaaatga------------aagc-----ca----aacgc-----agt-----gagaaaga
                 Weddell seal  --------aggaaatga------------aagc-----ca----aacgc-----agt-----gagaaaga
             Black flying-fox  --------aggaaatga------------aggc-----ca----cacgt-----agt-----gagaaatg
                      Megabat  --------aggaaatga------------aggc-----ca----cacgt-----agt-----gagaaatg
                Big brown bat  --------gggaaatga------------tggc-----tg----aacgc-----att-----gagaaaga
         David's myotis (bat)  --------gggaaatga------------aggc-----tg----aatgc-----aga-----gagaaaga
                     Microbat  --------gggaaatga------------aggc-----tg----aatgc-----aga-----gagaaaga
                     Hedgehog  --------aggaa-tga------------aggc-----ca----acagt-----ggc-----aggaataa
                        Shrew  --------aggaa-tga------------aggt-----cg----aaggc-----agt-----gggaaaga
                     Elephant  --------aggaaatga------------agtc-----ca----aacgc-----agt-----ggaaaaga
          Cape elephant shrew  ---------------------------------------t----aacac-----att-----gggaaata
                      Manatee  --------agggaataa------------attt-----ca----aacac-----agt-----ggaaaaga
             Cape golden mole  --------aggaaatga------------agtc-----ta----aatgc----aagt-----ataaaaga
                       Tenrec  --------aggaaatga------------agtc-----ca----aaggctgaaaaac-----attaaaaa
                     Aardvark  --------agggaataa------------agtc-----ca----aatgt-----agt-----tgataggc
                    Armadillo  --------aggaaatga------------aggc-----ca----agcgc-----agt-----gggaaaga
                      Opossum  at------agggacaaa------------tgtc-----tg----gaggt-----tgt-----ga-----t
              Tasmanian devil  gtgagaaagggaactaagaagacggttggcgac-----ct----ggggt-----tgg-----ggggaact
           American alligator  --------gggaaggga------------ag-------gg----aaggg-----aag-----gggtcggg
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  tcccta----------a---a--gta-t--ctc-tggct-actcagggagtc-a----ca----------
                        Chimp  tcccta----------a---a--gta-t--ctc-tggct-actcagggagtc-a----ca----------
                      Gorilla  tcccta----------a---a--gta-c--ctc-tggct-actcagagagtc-a----ca----------
                    Orangutan  tcccta----------a---a--gta-t--ctc-tggct-actcatggagtc-a----ca----------
                       Gibbon  tcccta----------a---a--gta-t--ctc-tggct-actcatggagtc-a----aaactccctccc
                       Rhesus  tgccta----------a---a--gta-c--ctc-tggct-actcatggagtc-a----cc----------
          Crab-eating macaque  tgccta----------a---a--gta-c--ctc-tggct-actcatggagtc-a----cc----------
                       Baboon  tgccta----------a---a--gta-c--ctc-tggct-actcatggagtc-a----cc----------
                 Green monkey  tcccta----------a---a--gta-c--ctc-tggct-actcatggagtc-a----cc----------
                     Marmoset  tcccta----------a---a--gta-c--ctc-tggcc-a-----------------------------
              Squirrel monkey  tcccta----------a---a--gta-c--ctc-tggcc-actcatggagtc-a----cc----------
                     Bushbaby  tcccta----------a---g--gtc-t--ccc-tggcc-actcatggaatc-a----cc----------
           Chinese tree shrew  gccctg----------a---g--gta-c--ctc-tggtc-acttacagagtc-a----cc----------
                     Squirrel  gc-agggagattagcta---g--gtg-c--ctc-tggcc-actcctgaaatc------cc----------
       Lesser Egyptian jerboa  ct-tct----------a---g--gtc-c--cgc-tggcc-actcatggtatc-a----cc----------
                 Prairie vole  tt-cag----------a---g--gta-c--aac-tggcc-aatgatgtggtc-acccatc----------
              Chinese hamster  tc-tag----------a---g--gta-c--cac-gagct-gatgatgtggtc-accc-cc----------
                        Mouse  tc-cag----------a---g--gta-ccacac-cggca-gatgatagggtc-a----tc----------
                          Rat  tc-cag----------a---g--gta-c--cac-tggcc-gatgaaagggtc-a----cc----------
                       Rabbit  ccgctg----------a---g--gta-c--ctt-tggcc-atccaaagcccc-cac--tc----------
                         Pika  cccctg----------a---g--gcg-c--ctc-gggat-a------------------c----------
                          Pig  gcgcta----------a---g--gta-t--cgt-ttgct-att--cagagtg-g----tc----------
                       Alpaca  tcccta----------a---g--gta-c--ttt-tggtt-att--cagagtc-a----tc----------
               Bactrian camel  tcccta----------a---g--gta-c--ttt-tggtt-att--cagagtc-a----tc----------
                      Dolphin  tcccta----------a---g--gta-c--ctc-tggct-attcacagagtc-g----tc----------
                 Killer whale  tcccta----------a---g--gta-c--ctc-tggct-attcacagagtc-g----tc----------
             Tibetan antelope  tcctca----------a---g--gtc-c--ctc-tgact-cttcacagagtc-g----tc----------
                          Cow  tcccca----------a---g--gtc-c--ctc-tgact-attcacagagtc-t----tc----------
                        Sheep  tcccca----------c---g--gtc-c--ctc-tgact-attcacagagtc-g----tc----------
                Domestic goat  tcccca----------a---g--gtc-c--ctc-tgact-attcacagagtc-g----tc----------
                        Horse  tcccta----------a---g--gaacc--cct-tggcc-gctcatggagtc-g----cc----------
             White rhinoceros  tcccta----------a---g--gaa-c--ctt-tggcc-actcatgaagtc-a----cc----------
                          Cat  tcccta----------a---g--gta-a--gtt-cgaag-gttcactgactc-a----cc----------
                      Ferret   gcccta----------a---g--gta-a--gtt-tggtg-gttccctgagtc-a----ac----------
                        Panda  tcccga----------a---g--gta-a--gtc-tggtg-gttcacggagtc-a----cc----------
               Pacific walrus  tcccta----------a---g--gta-a--gta-tgggg-gttcccggagtc-a----cc----------
                 Weddell seal  tcccta----------a---g--cta-a--gta-tgggg-attcccggagtc-a----cc----------
             Black flying-fox  tccctg----------a---g--gaa-c--gtt-taagc-atcctaggagtt-a----cc----------
                      Megabat  tccctg----------a---g--gaa-c--gtt-taagc-atcctaggagtt-a----cc----------
                Big brown bat  tcccta----------a---g--g-----------agtc-attctaggagtc-a----cc----------
         David's myotis (bat)  tcccta----------a---g--g-----------agac-attctaggagtc-a----cc----------
                     Microbat  tcccta---------------------------------------aggagtc-a----cc----------
                     Hedgehog  ttacta----------a---g--gaa----cct-atccc-ccttacgaagtc-a----tc----------
                        Shrew  tccctg----------a---a--gaa----gtt-cgctc-ttttacgaattc-t----cc----------
                     Elephant  tcccga----------a---g--gta-c--tct-taacc-actcatggagtt-a----cc----------
          Cape elephant shrew  tccctc----------a---a--gca-c-------------------aagtc-a----cc----------
                      Manatee  ttctta----------a---g--gta-c--tct-taacc-acttgtggagtt-a----cc----------
             Cape golden mole  tcttta----------a---a--ttg-t--tct-taact-attcatggagtt-t----cc----------
                       Tenrec  tcccta----------aggga--ctg-t--tga-taaatcattgctggagtg-a----cc----------
                     Aardvark  taccca----------a---a--gta-c--tctgtaaca-actcacggagtt-g----ct----------
                    Armadillo  tcccta----------a---g--gta-c--ccc-tgacc-actcaccaag--------------------
                      Opossum  gctttg----------a---c--aca-t--act-tgctt-tccgtaacagtt-a----tc----------
              Tasmanian devil  ggttag----------a---ctggga-t--acg-tgggtaactataaccattga----cc----------
           American alligator  ccggtg----------g---t--gac-g--agc-gcgtg-tcccgcaggggc-g----cc----------
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  -------------ac--------tc-c--cacccctcctcct-----ct---------c--------t--
                        Chimp  -------------gc--------tc-c--ctcccctcctcct-----ct---------c--------t--
                      Gorilla  -------------ac--------tc-c--cacccctcctcct-----ct---------c--------t--
                    Orangutan  -------------ac--------tc-c--ctcccctcctcct-----ct---------c--------t--
                       Gibbon  ctcctcctctcttac--------tc-c--ctcccctcctcct-----ct---------c--------t--
                       Rhesus  -------------at--------tc-c--gtcccctcctcct-----ct---------c--------t--
          Crab-eating macaque  -------------at--------tc-c--gtcccctcctcct-----ct---------c--------t--
                       Baboon  -------------at--------tc-c--gtcccctcctcct-----ct---------c--------t--
                 Green monkey  -------------at--------tc-c--gtcccctcctcct-----ct---------c--------t--
                     Marmoset  ------------------------------tgacctcctcct-----ctttccctcccc--------c--
              Squirrel monkey  -------------ac--------tc-c--ctgccctcctcct-----ct-----tcccc--------c--
                     Bushbaby  -------------ac--------tc-c--ttcccctatgccc-----at---------ctgtctgtgt--
           Chinese tree shrew  -------------a-----------------------ctccc-----at---------a--------t--
                     Squirrel  -------------cc--------tc-c--ctcccctactcctgg---ct---------c--------t--
       Lesser Egyptian jerboa  -------------ac--------tc-c--ttcctttactcc-------t---------g--------t--
                 Prairie vole  -------------ac--------ca-c--ctccttttctcct-----tt---------c--------t--
              Chinese hamster  -------------at--------ca-c--ctcctttactccc-----ct---------c--------c--
                        Mouse  -------------gc--------ta-t--ctcttctactccc-----ct---------c--------t--
                          Rat  -------------ac--------ta-t--ctcttctactccc-----ct---------c--------t--
                       Rabbit  -------------cc--------tg-c--cacctcccctctc-----tc---------c--------t--
                         Pika  -------------cc--------tg-c--caacttccgt-------------------------------
                          Pig  -------------cc--------tc-c--ctggca------------cc---------c--------g--
                       Alpaca  -------------ac--------tc-t--ctgcca------------cc---------c--------t--
               Bactrian camel  -------------ac--------tc-t--ctgcca------------cc---------c--------t--
                      Dolphin  -------------ac--------tc-c--ccactg------------tc---------c--------c--
                 Killer whale  -------------ac--------tc-c--ccactg------------tc---------c--------c--
             Tibetan antelope  -------------ac--------tc-c--ctgcca------------ct---------t--------c--
                          Cow  -------------at--------tc-c--ctgcca------------cc---------t--------t--
                        Sheep  -------------ac--------tc-c--ctgccg------------cc---------t--------c--
                Domestic goat  -------------ac--------tc-c--ctgccg------------cc---------t--------c--
                        Horse  -------------tc--------tc-t--ctcccctgctccaacct-ct---------t-----------
             White rhinoceros  -------------tc--------tc-c--ctcccctcctccaacct-ct---------c-----------
                          Cat  -------------gc--------tc-t--gtcctccaccgcctccccgc---------c--------c--
                      Ferret   -------------ac--------tctt--ctcttctgctgtcctgt-cc---------c--------t--
                        Panda  -------------at--------tc-t--ctcctccactgccctct-cc---------c--------c--
               Pacific walrus  -------------ac--------tc-t--ctccttcactgctgtttccc---------c--------g--
                 Weddell seal  -------------ac--------tc-t--ctctttcactgccgttt-cc---------c--------g--
             Black flying-fox  -------------ac--------gc-catttcccactctcatctcc-tc---------c--------t--
                      Megabat  -------------ac--------gc-catttcccactctcatctcc-tc---------c--------t--
                Big brown bat  -------------ac--------tc-c--ctccctccctcacgtcc-c----------------------
         David's myotis (bat)  -------------actcccttcttc-c--ctccctccctcatgacc-cc---------c--------t--
                     Microbat  -------------ac--------tc-c--ctccctccctcatgttc-cc---------c--------t--
                     Hedgehog  -------------tg--------tc-c--ttaaccctctgcag----cc---------t--------c--
                        Shrew  -------------tc--------tc-t--ccactccacttcag----cc---------t--------c--
                     Elephant  -------------gc--------tc-c--ttccctcacccctgta--cc---------a--------ccg
          Cape elephant shrew  -------------gc--------tc-c--tgccctcatgcctgca--cc---------a--------c--
                      Manatee  -------------ac--------tc-c--ttccctcatccctgca--cc---------a--------t--
             Cape golden mole  -------------ac--------t--t--ttctctcatccttgca--cc---------a--------t--
                       Tenrec  -------------tg--------t--c--ttccgtcatccctgct--c----------------------
                     Aardvark  -------------ac--------tc-c--tcgcttctttcctgca--tc---------t--------c--
                    Armadillo  --------------------------------cattactcctgct--cc---------c--------g--
                      Opossum  -------------ta--------cc-t--tt----------------tt---------t--------c--
              Tasmanian devil  -------------ca--------tc-t--ctgttggtg---------tc---------t--------c--
           American alligator  -------------cg--------t----------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================

                        Human  --------ta-ctccctccctttccccctcagctgaagc---tgaaga
                        Chimp  --------ta-ctccctccctttccccctcagctgaagc---tgaaga
                      Gorilla  --------ta-ctccctccctttccccctcagctgaagc---tgaaga
                    Orangutan  --------ta-ctccctccctttccccctcagctgaagc---tgaaga
                       Gibbon  --------ta-ctccctccctttccccctcagctgaagc---tgaaga
                       Rhesus  --------ta-caccttccctttccccctcagctgaagc---tgaaga
          Crab-eating macaque  --------ta-caccttccctttccccctcagctgaagc---tgaaga
                       Baboon  --------ta-caccctccctttccccctcagctgaagc---tgaaga
                 Green monkey  --------ta-caccctccctttccccctcagctgaagc---tgaaga
                     Marmoset  --------tc-ccccctcccctccccgcccagctgaagc---tgaaga
              Squirrel monkey  --------cc-tcccctcccctccccgcccagctgacgc---tgaaga
                     Bushbaby  --------cc-ccacctcccctgcaccctcagccgaccc---tgaagg
           Chinese tree shrew  --------cc-cacttctccctctatcctcagctgacct---caaaga
                     Squirrel  --------tc-ac-cttttctgtcaccctcagaggaccc---tgaaga
       Lesser Egyptian jerboa  --------tc-tttctccccttccacccttagctggccc---tgaaga
                 Prairie vole  --------cc-cttctccctttatgccctcagctagtcc---cgaaga
              Chinese hamster  --------cc-ctcctccccctttgtcctcagctagccc---tgaaga
                        Mouse  --------tc-tt-ctccccgtttaccctcagctggtcc---cgaaga
                          Rat  --------tc-ct-ctccccctttgcccacagctagtcc---tgaaga
                       Rabbit  --------cc-tc-ttcctccttccctctcagatgaccc---aaaaga
                         Pika  ---------------------tcccccctcagataaacctgaagaaga
                          Pig  --------cg-tccca---------cccccggcagaccc---tgaagg
                       Alpaca  --------ca-cccaa---------cccctagatgaccc---tgaagc
               Bactrian camel  --------ca-cccaa---------cccctagctgaccc---tgaagc
                      Dolphin  --------cg-gccca---------cccgcagcagactc---tgaagg
                 Killer whale  --------cg-gccca---------cccgcagcagactc---tgaagg
             Tibetan antelope  --------cg-tctcg---------ctcccggtggactc---tgaagg
                          Cow  --------cg-tcccg---------ctcccagcggactc---tgaagg
                        Sheep  --------ag-tctcg---------ctcccggcggactc---tgaagg
                Domestic goat  --------cg-tctcg---------ctcccggtggactc---tgaagg
                        Horse  -----------cccca---------cccccagcagatcc---tgaagc
             White rhinoceros  -----------cccca---------cccccagcagatcc---tgaagg
                          Cat  --------cc-cccaa---------ccctcagtggaccc---------
                      Ferret   --------ga-cccaa---------gccccagtggacct---ggaggg
                        Panda  --------ga-cccaa---------cccccagcggacct---ggaagg
               Pacific walrus  --------ga-cccaa---------cccccagtggacct---ggaagg
                 Weddell seal  --------ga-cccaa---------cccccagtggacct---ggaagg
             Black flying-fox  -----gtccc-tcccacctccaa--tccctagaagaccc---tgaaga
                      Megabat  -----gtccc-tcccacctccaa--tccctagaagaccc---tgaaga
                Big brown bat  -------ttc-ccccacccccgttttccccagcagaccc---tgaaga
         David's myotis (bat)  ------ttcc-ccccactcctgctttccccagaagaccc---tgaaga
                     Microbat  ------tccc-cccaattcctgttttccccagcagacgc---tgaaga
                     Hedgehog  --------tg-cacca---------ctcccaggagacct---tgaaga
                        Shrew  --------tc-ccgta---------atcctggaggacct---ggaagg
                     Elephant  ctccctcatc-ccccctcctccc-ctccacagctgagcc---tgcaga
          Cape elephant shrew  --------tt-ccctccctttct-catcacagatgacct---tacaga
                      Manatee  --------ta-ccccctccctct--tctatagctgaccc---cgcaga
             Cape golden mole  --------tatcccaaccctgca-cctaacagatgaccc---tgctgc
                       Tenrec  -----------cccgaccct--------atagctgaacc---tgtagg
                     Aardvark  --------ta-cctcctctctccaccccacagttgaccc---ctcagg
                    Armadillo  --------at-ccccttccccaa--tccccagctgactc---cgaagg
                      Opossum  --------tt-cttca---------ggagcgcctgtggc---caa---
              Tasmanian devil  --------ag-cttcc---------aagccaatcgtaac---cggaga
           American alligator  ------------------------------------------------
              Star-nosed mole  ------------------------------------------------
             Brush-tailed rat  ------------------------------------------------
                   Chinchilla  ------------------------------------------------
                   Guinea pig  ------------------------------------------------
               Naked mole-rat  ------------------------------------------------
                          Dog  ------------------------------------------------
     Chinese softshell turtle  ================================================

Inserts between block 12 and 13 in window
B D                 Marmoset 3bp
B D          Squirrel monkey 3bp
B D                 Bushbaby 3bp
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                 Hedgehog 3bp
B D                    Shrew 3bp
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp
B D                  Opossum 1bp

Alignment block 13 of 65 in window, 73853796 - 73853798, 3 bps 
B D                     Human  a---g---a-
B D                     Chimp  a---g---a-
B D                   Gorilla  a---g---a-
B D                 Orangutan  a---g---a-
B D                    Gibbon  a---g---a-
B D                    Rhesus  a---g---a-
B D       Crab-eating macaque  a---g---a-
B D                    Baboon  a---g---a-
B D              Green monkey  a---g---a-
B D                  Marmoset  a---g---a-
B D           Squirrel monkey  a---g---a-
B D                  Bushbaby  a---g---t-
           Chinese tree shrew  a---gacca-
B D                  Squirrel  a---------
       Lesser Egyptian jerboa  g---g---a-
                 Prairie vole  a---g---g-
B D           Chinese hamster  a---g---g-
B D                     Mouse  a---a---g-
B D                       Rat  a---a---g-
B D                    Rabbit  a---a---g-
B D                      Pika  a---a---g-
B D                       Pig  a---g---a-
B D                    Alpaca  a---g---c-
               Bactrian camel  a---g---a-
B D                   Dolphin  a---g---c-
                 Killer whale  a---g---c-
             Tibetan antelope  agagg---a-
B D                       Cow  agagt---c-
B D                     Sheep  agagg---a-
                Domestic goat  a---g---a-
B D                     Horse  a---g---a-
B D          White rhinoceros  a---g---a-
B D                       Cat  a---g---a-
B D                   Ferret   a---g---a-
B D                     Panda  a---g---a-
               Pacific walrus  a---g---a-
                 Weddell seal  a---g---a-
             Black flying-fox  a---g---a-
B D                   Megabat  a---g---a-
                Big brown bat  a---g---a-
         David's myotis (bat)  a---g---a-
B D                  Microbat  a---g---a-
B D                  Hedgehog  --------a-
B D                     Shrew  --------a-
B D                  Elephant  a---g---a-
          Cape elephant shrew  a---g---a-
B D                   Manatee  a---g---a-
             Cape golden mole  a---g---a-
B D                    Tenrec  a---g---a-
                     Aardvark  a---g---a-
B D                 Armadillo  a---g---a-
B D           Tasmanian devil  ----g-----
B D        American alligator  ----g---ac
             Star-nosed mole  ----------
            Brush-tailed rat  ----------
                  Chinchilla  ----------
B D                Guinea pig  ----------
B D            Naked mole-rat  ----------
B D                       Dog  ----------
B D                   Opossum  ==========
  D  Chinese softshell turtle  ==========

Inserts between block 13 and 14 in window
B D                 Squirrel 3bp

Alignment block 14 of 65 in window, 73853799 - 73853799, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  a
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D                    Rabbit  t
B D                      Pika  a
B D                       Pig  c
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  g
B D                       Cow  t
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  t
B D                       Cat  t
B D                   Ferret   c
B D                     Panda  g
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  g
B D                     Shrew  g
B D                  Elephant  c
          Cape elephant shrew  a
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  t
B D                   Wallaby  t
B D        American alligator  c
             Star-nosed mole  -
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D            Naked mole-rat  -
B D                       Dog  -
B D                  Squirrel  =
B D           Tasmanian devil  -
B D                   Opossum  =
  D  Chinese softshell turtle  =

Inserts between block 14 and 15 in window
      Lesser Egyptian jerboa 3bp
                Prairie vole 3bp
B D          Chinese hamster 9bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D                   Rabbit 3bp
B D                     Pika 3bp
B D                 Elephant 3bp
         Cape elephant shrew 2bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 9bp

Alignment block 15 of 65 in window, 73853800 - 73853802, 3 bps 
B D                     Human  ggg-
B D                     Chimp  ggg-
B D                   Gorilla  ggg-
B D                 Orangutan  ggg-
B D                    Gibbon  ggg-
B D                    Rhesus  cgg-
B D       Crab-eating macaque  cgg-
B D                    Baboon  ggg-
B D              Green monkey  ggg-
B D                  Marmoset  ggg-
B D           Squirrel monkey  ggg-
B D                  Bushbaby  ggg-
           Chinese tree shrew  gaa-
B D                  Squirrel  agg-
       Lesser Egyptian jerboa  ggg-
                 Prairie vole  gga-
B D           Chinese hamster  gca-
B D                     Mouse  gga-
B D                       Rat  gga-
B D                Guinea pig  --g-
                   Chinchilla  --g-
             Brush-tailed rat  --g-
B D                    Rabbit  gga-
B D                      Pika  gaa-
B D                       Pig  gcg-
B D                    Alpaca  gga-
               Bactrian camel  gga-
B D                   Dolphin  gga-
                 Killer whale  gga-
             Tibetan antelope  gag-
B D                       Cow  gag-
B D                     Sheep  gag-
                Domestic goat  gag-
B D                     Horse  gga-
B D          White rhinoceros  gga-
B D                       Cat  gag-
B D                   Ferret   gag-
B D                     Panda  gag-
               Pacific walrus  gag-
                 Weddell seal  gag-
             Black flying-fox  gag-
B D                   Megabat  gag-
                Big brown bat  ggg-
         David's myotis (bat)  ggg-
B D                  Microbat  ggg-
B D                  Hedgehog  atg-
B D                     Shrew  gta-
              Star-nosed mole  gta-
B D                   Wallaby  -gg-
B D        American alligator  -ggc
B D                    Tenrec  ====
         Cape elephant shrew  ====
B D                 Armadillo  ====
B D                   Manatee  ====
B D            Naked mole-rat  ----
B D                       Dog  ----
B D                  Elephant  ====
B D           Tasmanian devil  ----
B D                   Opossum  ====
  D  Chinese softshell turtle  ====
                    Aardvark  ====
            Cape golden mole  ====

Inserts between block 15 and 16 in window
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 4bp
B D                  Wallaby 1bp

Alignment block 16 of 65 in window, 73853803 - 73853920, 118 bps 
B D                     Human  gacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D                     Chimp  tacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D                   Gorilla  gacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D                 Orangutan  gacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D                    Gibbon  gacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gttccaggcacatcaccagcc
B D                    Rhesus  gacctgcagtgcgtgtgcgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D       Crab-eating macaque  gacctgcagtgcgtgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D                    Baboon  gacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D              Green monkey  gacctgcagtgcctgtgtgtgaagaccacctccc---aga---tct---gtcccaggcacatcaccagcc
B D                  Marmoset  gacctgcagtgcctgtgtgtgaagaccacttccc---agg---tcc---gtcccaggcacatcaccagcc
B D           Squirrel monkey  gacctgcagtgcctgtgtgtgaagaccacctccc---agg---tcc---gtcccaggcacatcaccagcc
B D                  Bushbaby  gacccgcaatgcctgtgcatgaagaccacctccc---ggg---tcc---acttcaagcacattaccagcc
           Chinese tree shrew  gaactgcactgcctgtgtctgaagaccacctctc---gag---tcc---gcctaaagcacatcgccaggc
B D                  Squirrel  gagtttcagtgcatgtgtgcaaagaccaggtaca---aag---tca---aagtcaaggacatcaccaacc
       Lesser Egyptian jerboa  gagctactctgcatgtgtgtgaagaccacctccc---ggg---ttc---atcctaaacatatcaccagcc
                 Prairie vole  ggtcttcactgtgtgtgtgtgaagaccttctcctctggga---tcc---acgctaaacatatcactgccc
B D           Chinese hamster  gatcttcactgtgtgtgtgtgaagaccatctcctctggga---ttc---atcctaagcatatcaccacat
B D                     Mouse  gatcttagctgtgtgtgtgtgaagaccatctcctctggga---tcc---atcttaagcacatcaccagcc
B D                       Rat  gatcttagctgtgtgtgtgtgaagaccagttcttccagga---tcc---atctcaaacgcatcaccagcc
B D            Naked mole-rat  gaactgcgctgcctatgtgtgaagacggtctctg---gaa---tcc---atcccagcaagatctccactt
B D                Guinea pig  gaactgcgatgcctgtgtctgaagacgatctctg---caa---tgc---accccagcaagatctccagtg
                   Chinchilla  gaactgcgctgcctgtgtgtgaggacagtctccg---gga---tgc---accccagcaagatctccagct
             Brush-tailed rat  gaactgcgttgcctgtgtctgagaacggtctctg---gag---tgc---atcccagcaagatttccagtg
B D                    Rabbit  gacctgcactgcgtgtgtgtgaagaccacttccc---tcg---tcc---ggcccaggcacatcaccaacc
B D                      Pika  gacttgcattgcgtttgtgtgaagaccacctccc---gcg---tcc---gtgccagacaggtcaccagcc
B D                       Pig  aatctgcgctgcgtgtgtgtaaagaccatctccg---gag---tca---gccccaagcatatctccagcc
B D                    Alpaca  gacctgcactgcctgtgtgtgaagaccacctccg---gag---tcc---atcccaagcacatctccagcc
               Bactrian camel  gacctgcactgcctgtgtgtgaagaccacctccg---gag---tcc---atcccaagcacatctccagcc
B D                   Dolphin  gacctgcgctgcgtgtgtgtgaagaccacctctg---cgg---tcc---atccccggagcatctccagcc
                 Killer whale  gacctgcgctgcgtgtgtgtgaagaccacctctg---cgg---tcc---atccccggagcatctccagcc
             Tibetan antelope  gacctgcaatgcgtgtgcctgaagaccacttcgg---gga---ttc---accccaggcacatctccagcc
B D                       Cow  gacctccaatgcgtgtgcctgaagaccacttcgg---gga---tta---accccaggcacatctccagcc
B D                     Sheep  gacctgcaatgcgtgtgcctgaagaccacttcgg---gga---ttc---accccaggcacatctccagcc
                Domestic goat  gacctgcaatgcgtgtgtctgaagaccacttcgg---gga---ttc---accccaggcacatctccagcc
B D                     Horse  gacctgcactgcctgtgtgtgaagaccaccaccc---gag---tcc---atcctaagcaagtccgcagcc
B D          White rhinoceros  gacctgcgctgcgtctgtgcgaagaccagctccc---aag---tcc---gtcccaagcaagtcaacagct
B D                       Cat  cacctgcgctgcgtgtgcgtgaagaccacctccg---aag---tcc---gtcccaagcatatccgcagcc
B D                       Dog  gaacttcgctgcatgtgtacaaagactgtctctg---gca---ttc---atccaagtaacatccaaaact
B D                   Ferret   gacctgcgctgcgtgtgtctgaagaccacctccc---tag---tcc---gccccaagcacatcagcagcc
B D                     Panda  gacctgcgctgcgtgtgtatgaagaccacccccc---tac---tcc---gtcccaaggacgtcagcagcc
               Pacific walrus  tacctgcgctgcgtgtgtatgaagaccacctccc---tag---tcc---gtcccaggcacatcagcaacc
                 Weddell seal  gacctgcgctgcgtgtgtatgaagaccacctccc---tag---ttc---gtcccaggcacatcagcagcc
             Black flying-fox  gaactgcaatgcatgtgtgtgaagaccacctccg---gag---tcc---accccaagcacatcatgagcc
B D                   Megabat  gaactgcaatgcatgtgtgtgaagaccacctccg---gag---tcc---accccaagcacatcatgagcc
                Big brown bat  gacctgcaatgcctgtgtgtgaagaccagcaccc---gag---tcc---atcccaagcacatcaccagcc
         David's myotis (bat)  ttcctgcaatgcatgtgtgtgaagaccatctccg---gag---tcc---atcccaagcacatcgccagct
B D                  Microbat  gacctgcaatgcatgtgtgtgaagaccagcgccc---gag---tcc---atcccaagcacatcgccagct
B D                  Hedgehog  aacccgcactgtctgtgtccagagactacctcca---ggg---tcc---gtttcaagcgcatctccagcc
B D                     Shrew  gatctgcaatgcctgtgtgtgaagaccacctctc---agt---tcc---acctcaagcacatctccagcc
              Star-nosed mole  gaacttcgctgcatgtgcatgaagaccatctcta---gca---ttc---accccaacaacatccaacgtt
B D                  Elephant  gacctgcgttgcttgtgtgtgagtaccacctcca---cgg---tcc---atcccaagcacgtcatcagcc
          Cape elephant shrew  --------ttgcatgtgtttgacgactgtctcca---cagtcatcc---atcccaaactcctcgccagcg
B D                   Manatee  gacctacattgcatgtgtgtgaagaccacctcca---cag---tcc---atcccaagcacgtcaccagcc
             Cape golden mole  gacctacattgcctgtgtgtgaggaccacctcca---ccg---tcc---atcccaagcatgtcaacagcc
B D                    Tenrec  gacgtgcggtgtatgtgtgcgaagacccacattg---tcg---tcc---atcccaagtacatcaacagcc
                     Aardvark  gacctaggttgcatgtgtgtgaagaccacctttg---cag---tcc---atcccaagcatgtcaccagcc
B D                 Armadillo  gacctgcgctgcatgtgtttgaaatccacctcca---gag---tcc---acccgaaacacgtcaacagcg
B D                   Opossum  gagctacgttgccagtgtctgcaaactgttcaag---gag---ttc---ccttcaaggccattggcagcc
B D           Tasmanian devil  ---ctgcgctgcaagtgcgtgaagaccacacaaa---aga---ttc---atcccaaaattatagccagtg
B D                   Wallaby  gagcttcgctgcaggtgtgtgaagaccatgcaag---gga---ttc---atcccaaaaacatagtctctc
B D        American alligator  gagctgcgctgccagtgcctgcagaccgcgtcgg---agc---gcctgggcccgcggcgcctggcccacg
  D  Chinese softshell turtle  ======================================================================

                        Human  tggaggtgatcaaggccggaccccactgccccactgcccaactcatg-tga--------gt-cctcg-
                        Chimp  tggaggtgatcaaggccggaccccactgccccactgcccaactcatg-tga--------gt-cctcg-
                      Gorilla  tggaggtgatcaaggccggaccccactgccccactgcccaactcatg-tga--------gt-cctcg-
                    Orangutan  tggaggtgatcaaggccggaccccattgccccactgcccaacttatg-tga--------gt-ccttg-
                       Gibbon  tggaggtgatcaaggccggaccccactgccccactgcccaagtgatg-tga--------gt-cctcg-
                       Rhesus  tggaggtgatcaaggccggaccccactgccccactgcccaactgatg-tga--------gt-cctcg-
          Crab-eating macaque  tggaggtgatcaaggccggaccccactgccccactgcccaactgatg-tga--------gt-cctcg-
                       Baboon  tggaggtgatcaaggccggaccccactgccccactgcccaactgatg-tga--------gt-cctcg-
                 Green monkey  tggaggtgatcaaggccggaccccactgccccactgcccaactgatg-tga--------gt-cctcg-
                     Marmoset  tggaggtgatcaaggccggaccccattgccccactgtccaactgatg-tga--------gt-cctta-
              Squirrel monkey  tggaggtgatcaaggccggaccccactgccccaacgcccaactgatg-tga--------gt-cctta-
                     Bushbaby  tggaggtgatcaaggccggaccccactgtcccactgcccaagtgatg-tga--------gt-cctcg-
           Chinese tree shrew  tggaggtgatcaaggctgggtttcactgccccaccatccagatgatg-tga--------gt-cctcg-
                     Squirrel  tggagatgatcaagccaggacccctctgtgccaccacccagatgatg-tga--------gt-tctgg-
       Lesser Egyptian jerboa  tggaagttatcaaggctggacgccactgctctactccccagctcatg-tga--------gt-ccggc-
                 Prairie vole  tggaggtgatcaaggcaggacgccactgtgcggttccccagctcatg-tga--------gt-tctgc-
              Chinese hamster  tggaagtgatcaaggcaggacgccattgtgcggttccccagctcatg-tga--------gt-cctgc-
                        Mouse  tggaggtgatcaaggcaggacgccactgtgcggttccccagctcatg-tga--------gt-cctgc-
                          Rat  tggaggtgatcaaagcaggaccccactgtgcggttccccagctcatg-tga--------gt-cttgc-
               Naked mole-rat  tggagatgattaaggcaggatcccattgttccaaagtccaagtgatg-taa--------gt-tcctg-
                   Guinea pig  tggaggtgctgaaggcaggagcccactgccccaaaatccaagtcatg-taa--------gt-ccctg-
                   Chinchilla  tggaggtgatcaaggcaggagcccactgtcccaaggtccaagtgatg-taa--------gt-cccca-
             Brush-tailed rat  tggaggtgatcaaggcaggagctcactgtcccaaagtcgaagtgctg-taa--------gt-ccctg-
                       Rabbit  tggagctgatcaaggccggagcccactgccccaccgcccaactgatg-taagtcctcgtgt-ccctt-
                         Pika  tggagttgatcagggcgggaccgcattgccccactgcccaactgctg-tga--------gt-tcctc-
                          Pig  tagaggtgattggggccggaccccactgccccagcccgcagctgatg-taa--------gt-cgttg-
                       Alpaca  tggaggtgatcggggccggactccactgccccagcccccaactgatg-tga--------gt-ccttg-
               Bactrian camel  tggaggtgatcggggccggactccactgccccagcccccaactgatg-tga--------gt-ccttg-
                      Dolphin  tggaggtgatcggggctggactccactgccccagcccccaactgatg-tga--------gt-ccttg-
                 Killer whale  tggaggtgatcggggctggactccactgccccagcccccaactgatg-tga--------gt-ccttg-
             Tibetan antelope  tggaagtgatcggagccgggctccactgccccagcccccaactgatg-tga--------ga-tctgg-
                          Cow  tggaagtgatcggggccgggctccactgccccagcccccaactgatg-tga--------gt-cctgg-
                        Sheep  tggaagtgatcggagccgggctccactgccccagcccccaactgatg-tga--------gt-cctgg-
                Domestic goat  tggaagtgatcggagccgggctccactgccccagcccccaactgatg-tga--------gt-cctgg-
                        Horse  tggaggtgatcaaggctggactccactgtcctacccctcaagtgatg-tga--------gt-ccttg-
             White rhinoceros  tggaggtgatcagggccggcgtctactgtcgcaccccgcaactgatg-tga--------gt-ctttg-
                          Cat  tggaggtgatgggtgcgacagtccactgccccgttccccagatgatg-tga--------gt-ccctg-
                          Dog  tggaggtgctccgagcaggaccccattgtgccaacgtcgaagtgatg-taa--------gt-ccttg-
                      Ferret   tggaggtcatcggtgtgtcaagctactgtcccaccccccagatgatg-tga--------gt-ctcgc-
                        Panda  tggaagtgatcggtgtctcgggccactgccccaccccccagatgatg-tga--------gt-cctgc-
               Pacific walrus  tggaagtgattggagtctcagaccactgccccaccccccagatgatg-tga--------gt-cctgc-
                 Weddell seal  tggaagtgatcggtgtctcaggccactgctccaccccccagatgatgttga--------gt-cctgc-
             Black flying-fox  tggaggtgatccgggccggaccccactgccccacctcccaactgctg-tga--------gt-cctca-
                      Megabat  tggaggtgatccgggccggaccccactgccccacctcccaactgctg-tga--------gt-cctca-
                Big brown bat  tggaggtgatccgggctggactccactgccccaccacccaaatgatg-tga--------gt-tccct-
         David's myotis (bat)  tggaggtgatcgcggctggacgccactgccccacctcccaaatgatg-tga--------gt-cctct-
                     Microbat  tggaggtgatccgggctggactccactgccccacctcccaaatgatg-tga--------gt-cctct-
                     Hedgehog  tggaggtgatcagggccagtctctactgtcccagtccccaactgatg-tga--------gt-ctttt-
                        Shrew  tggaggtgattgtggccagtgcccactgtcctgccctccaagtgatg-tga--------gt-tcttt-
              Star-nosed mole  tagaggtgatcaaggcaggaccccactgcgccaaagtcgaagtgctg-taa--------gt-ccctg-
                     Elephant  tggaagtgatcaaggctggactccactgtcccaaggcccaactgatg-tga--------gt-ctttg-
          Cape elephant shrew  tgaaagtgatcgatgtgggaccccactgccctgtggtcgaactgatg-tga--------gtgttttg-
                      Manatee  tggaaatgatcaagtctggactccactgccccaaggcccaaatgatg-tga--------gt-ctttg-
             Cape golden mole  tggaagtgatcagggcagggctccactgccccaaggttcaactgatg-tga--------gt-ctttg-
                       Tenrec  tggaagtgatccgcgcaggaccccattgccccgtggcgcaaatgatg-tga--------gt-attcg-
                     Aardvark  tggaattgatcaaggcgggactccactgccccaaggcccagctgatg-tga--------gt-ctttg-
                    Armadillo  tggaggtgatcaaggccgggctccactgccccaaagctgaaattatg-tga--------gt-tcttg-
                      Opossum  ttaaggtgatcccagccgggccacactgctccaatgtcgaagtcatg-taa--------gt-ttatc-
              Tasmanian devil  tggaagtgatcacagcgggaccccactgtgccagaaacgaagtcatg-tga--------gt-ccatg-
                      Wallaby  tggaagtgatcagagcaggaccccactgtcccaatcacgaagtcatg-tga--------gt-ccctg-
           American alligator  tggagctcatcgccgaggggccgcactgccccgtgcccgaagtcatg-tga--------gt-gccgcc
     Chinese softshell turtle  ====================================================================

Inserts between block 16 and 17 in window
B D                 Hedgehog 19bp
B D                    Shrew 152bp
             Star-nosed mole 91bp

Alignment block 17 of 65 in window, 73853921 - 73853921, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  a
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  g
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
B D                  Elephant  c
          Cape elephant shrew  t
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  c
B D                   Wallaby  t
B D        American alligator  c
             Star-nosed mole  =
  D  Chinese softshell turtle  =

Inserts between block 17 and 18 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 68bp
B D               Guinea pig 100bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 1bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 4815bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 10bp
B D                    Shrew 22bp

Alignment block 18 of 65 in window, 73853922 - 73853922, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -c
B D                    Rabbit  -g
B D                      Pika  -g
B D                  Elephant  -g
          Cape elephant shrew  -g
B D                   Manatee  -a
             Cape golden mole  -a
B D                    Tenrec  -g
                     Aardvark  -a
B D                 Armadillo  -g
B D                   Opossum  -c
B D           Tasmanian devil  -g
B D                   Wallaby  -g
B D        American alligator  c-
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                     Panda  ==
               Big brown bat  ==
        David's myotis (bat)  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                  Microbat  ==
            Brush-tailed rat  --
               Domestic goat  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
              Bactrian camel  ==
B D                    Alpaca  ==
                Prairie vole  ==
              Pacific walrus  ==
B D          White rhinoceros  ==
                  Chinchilla  --
            Black flying-fox  ==
B D                       Cat  ==
B D                     Horse  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                       Cow  ==
                Killer whale  ==
B D                   Ferret   ==
            Tibetan antelope  ==
B D                       Dog  ==
B D                  Squirrel  ==
B D                       Pig  ==
                Weddell seal  ==
  D  Chinese softshell turtle  ==
B D                   Dolphin  ==
B D                   Megabat  ==

Alignment block 19 of 65 in window, 73853923 - 73853924, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  ga
           Chinese tree shrew  ct
B D                   Opossum  ct
B D           Tasmanian devil  ct
B D                   Wallaby  ct
B D        American alligator  cc
             Star-nosed mole  ==
B D                  Hedgehog  ==
B D                    Tenrec  --
         Cape elephant shrew  --
B D                     Panda  ==
B D                    Rabbit  --
               Big brown bat  ==
        David's myotis (bat)  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                  Microbat  ==
            Brush-tailed rat  --
               Domestic goat  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
              Bactrian camel  ==
B D                    Alpaca  ==
                Prairie vole  ==
B D                 Armadillo  --
              Pacific walrus  ==
B D          White rhinoceros  ==
B D                      Pika  --
                  Chinchilla  --
B D                   Manatee  --
            Black flying-fox  ==
B D                       Cat  ==
B D                     Horse  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                       Cow  ==
                Killer whale  ==
B D                   Ferret   ==
            Tibetan antelope  ==
B D                       Dog  ==
B D                  Squirrel  ==
B D                  Elephant  --
B D                       Pig  ==
                Weddell seal  ==
  D  Chinese softshell turtle  ==
B D                   Dolphin  ==
                    Aardvark  --
B D                   Megabat  ==
            Cape golden mole  --

Inserts between block 19 and 20 in window
B D                  Opossum 15bp
B D          Tasmanian devil 43863bp
B D                  Wallaby 12bp

Alignment block 20 of 65 in window, 73853925 - 73853967, 43 bps 
B D                     Human  gcat---------cagtt-----------------------------------------a----g-----
B D                     Chimp  gcat---------cagtc-----------------------------------------a----a-----
B D                   Gorilla  gcat---------cagtc-----------------------------------------a----g-----
B D                 Orangutan  gcat---------cagtc-----------------------------------------a----g-----
B D                    Gibbon  gcat---------cagtc-----------------------------------------c----g-----
B D                    Rhesus  acct---------cagtc-----------------------------------------a----g-----
B D       Crab-eating macaque  acct---------cagtc-----------------------------------------a----g-----
B D                    Baboon  acct---------cagtc-----------------------------------------a----g-----
B D              Green monkey  acct---------cagtc-----------------------------------------a----g-----
B D                  Marmoset  gcat---------cagtc-----------------------------------------a----g-----
B D           Squirrel monkey  gcat---------cagtc-----------------------------------------a----g-----
B D                  Bushbaby  gcct---------cagtc-----------------------------------------a----g-----
           Chinese tree shrew  gctt---------tgact-----------------------------------------g----g-----
B D                  Squirrel  ttgta--------tagtt-----------------------------------------g----g-----
       Lesser Egyptian jerboa  tggt---------cccag-----------------------------------------a----g-----
                 Prairie vole  aca----------ccctt-----------------------------------------a----g-----
B D           Chinese hamster  at-----------ccttc-----------------------------------------a----g-----
B D                     Mouse  acat---------ccccc-----------------------------------------a----g-----
B D                       Rat  acacccca-----ccccc-----------------------------------------a----g-----
B D                    Rabbit  -------------atctt-----------------------------------------g----gat---
B D                      Pika  -------------ctgct-----------------------------------------g----gcg---
B D                       Pig  -----acg-----aagct-----------------------------------------t----c-----
B D                    Alpaca  -----tt------cttct-----------------------------------------t----c-----
               Bactrian camel  -------------cttct-----------------------------------------t----c-----
B D                   Dolphin  -----tcg-----cttct-----------------------------------------t----t-----
                 Killer whale  -----tcg-----cttct-----------------------------------------t----t-----
             Tibetan antelope  -----ttg-----ctgct-----------------------------------------t----t-----
B D                       Cow  -----ttg-----ttgct-----------------------------------------t----t-----
B D                     Sheep  -----ttg-----ctgct-----------------------------------------t----t-----
                Domestic goat  -----ttg-----ctgct-----------------------------------------t----t-----
B D                     Horse  -----ttg-----cttct-----------------------------------------t----c-----
B D          White rhinoceros  -----ttg-----cttct-----------------------------------------t----c-----
B D                       Cat  -----tgg-----cttcg-----------------------------------------g-ggc------
B D                   Ferret   -----ctg-----cttct-----------------------------------------t-agcg-----
B D                     Panda  -----ttg-----cttct-----------------------------------------t-ggcg-----
               Pacific walrus  -----ttg-----cctct-----------------------------------------ctggcg-----
                 Weddell seal  -----ttg-----cttct-----------------------------------------c-ggcg-----
             Black flying-fox  -----ttg-----cactt----------------------------------------------------
B D                   Megabat  -----ttg-----cactt----------------------------------------------------
                Big brown bat  -----ttg-----cttgt-----------------------------------------g----------
         David's myotis (bat)  -----ttg-----ctcgt-----------------------------------------g----------
B D                  Microbat  -----ttg-----cttgt-----------------------------------------g----------
B D                  Hedgehog  -----cct-----gtgcc-----------------------------------------c----t-----
B D                     Shrew  -----tctttttggttct-----------------------------------------t----t-----
B D                  Elephant  -----ctg-----ctgca-----------------------------------------t----c-----
          Cape elephant shrew  -----cta-----ctgga-----------------------------------------t----c-----
B D                   Manatee  -----ctg-----ctgca-----------------------------------------t----c-----
             Cape golden mole  -----cta-----ctgca-----------------------------------------t----c-----
B D                    Tenrec  -----ctg-----cctct-----------------------------------------t----g-----
                     Aardvark  -----cgg-----ctgcatgcctgcccagcctctaaccccctctgcccatccttttccct----c-----
B D                 Armadillo  -----ctg-----ctgcc-----------------------------------------t----t-----
B D                   Opossum  -----------------------------------------------------------------gg---
B D           Tasmanian devil  -----------------------------------------------------------------gg---
B D                   Wallaby  -----------------------------------------------------------------ag---
B D        American alligator  ------------------------------------------------------------------ttat
             Star-nosed mole  ======================================================================
            Brush-tailed rat  ----------------------------------------------------------------------
                  Chinchilla  ----------------------------------------------------------------------
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                       Dog  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ---tgctccc-------gct-ccgt---gcctcctctgcc---catccc
                        Chimp  ---tgctccc-------gct-ccgt---gcctcctctgca---catccc
                      Gorilla  ---cgctccc-------gct-ccgt---gcctcctctgcc---catccc
                    Orangutan  ---tgctccc-------gct-ccgt---gcctcctctgcc---catccc
                       Gibbon  ---ttctccc-------gct-ccgt---gcctcctctgcc---catccc
                       Rhesus  ---tgccccc-------act-ccgt---gcctcctttgcc---cattcc
          Crab-eating macaque  ---tgccccc-------att-ccgt---gcctcctttgcc---cattcc
                       Baboon  ---tgccccc-------act-ccgt---gcctcctttgcc---cattcc
                 Green monkey  ---tgcccac-------act-ccgt---gcctcctttgcc---cattcc
                     Marmoset  ---tgccccc--------tt-ctgt---gactcctctgcc---catccc
              Squirrel monkey  ---tgccccc--------tt-ctgt---gactcctctgcc---catccc
                     Bushbaby  ---gg--ccc-------agc-ctgt---ccctcccctgct---c-tccc
           Chinese tree shrew  ---gaccctc--------tt-ttac---tcctcctttcct---cacttc
                     Squirrel  -------tac-------tgc-cctt---tgtccctctg--------tcc
       Lesser Egyptian jerboa  -------ggc-------cac-ctgt---atctcctatgcc---catatc
                 Prairie vole  -------gtc-------tcg-cctc---tc---cgctgcc---tgttcc
              Chinese hamster  -------gcc-------cac-cctc---tcct-ctctgct---cattcc
                        Mouse  -------gcc-------cgt-cctc---tcctctgctacc---tgttcc
                          Rat  -------gcc-------tgtccctc---tcatcctctgcc---caatcc
                       Rabbit  ---cggtgcc-------cat-gctt---tgcgcttctgcc---cacccc
                         Pika  ---tggtgcc-------cag-cccg---tgcctctctgct---catccc
                          Pig  ---cac-ccc-------atc-atct---c----ctctccc---cttccc
                       Alpaca  ---cgcgcct--------cc-ctcg---gcc-cctctgcc---ctcccc
               Bactrian camel  ---cgcgcct--------cc-ctcg---ccc-cctctgcc---cccccc
                      Dolphin  ---cgtgccc-------acc-ctct---tct-cctctccc---cttccc
                 Killer whale  ---cgtgccc-------acc-ctct---tct-cctctccc---cttccc
             Tibetan antelope  ---tgtggcc-------acc-ctct---g----ctctccc---cttccc
                          Cow  ---cgtgccc-------acc-ctct---g----ctctccc---cttccc
                        Sheep  ---cgtgccc-------acc-ctct---g----ctctccc---cttccc
                Domestic goat  ---tgtgccc-------acc-ctct---g----ctctccc---cttccc
                        Horse  ---tgtgccc-------gcc-ttca---gcctcctctgcc---cttccc
             White rhinoceros  ---tgcgccc-------acc-ctca---gcctcctttgcc---cttccc
                          Cat  -------cct-------acc-ctct---gcctcctttgcc---ttagcc
                      Ferret   ---cctgccg-------gcc-ctct----gctcctctccc---ttcccc
                        Panda  ---cccgccc-------acc-ctcg---gcctcctctgcc---c-----
               Pacific walrus  ---cccgccc-------acc-tccccccgcctcctctgcc---ttccct
                 Weddell seal  ---cccgccc-------acc-tccgtctgcctcctctgcc---t-----
             Black flying-fox  ---------c-------acc-ctct---gcttctgctgcc---cttacc
                      Megabat  ---------c-------acc-ctct---gcttctgctgcc---cttacc
                Big brown bat  -------cccgccctctgcc-ctct---gcctcctccacc---tttgcc
         David's myotis (bat)  -------ccc-------acc-ctct---gcttcctccacc---tttgcc
                     Microbat  -------ccc-------acc-ctct---gcctcctccacc---tttgcc
                     Hedgehog  ---tcctacc-------acc-caaa---gtcaccc--------------
                        Shrew  ---cacgccc-------atc-ctgt---gctcctc--------------
                     Elephant  ---cctgccc-------acc-ctct---gccccctctgct---catccc
          Cape elephant shrew  ---cgttatg-------ttc-ctct---gcc------------------
                      Manatee  ---cctgccc-------acc-ctct---gccccctctgcc---catccc
             Cape golden mole  ---tgtgccc-------gtt-ctct---gttccctctgca---tgcccc
                       Tenrec  ---ggtggcc-------acc-ctct---gtcctttctgtc---cagacc
                     Aardvark  ---tctgccc-------acc-ctct---gccccctttgcc---catccc
                    Armadillo  ---cttgccc-------at--ctct---gcctcctccgcc---agtccc
                      Opossum  -----cagca-------aac-tgct---gcattcagtccctttgtgccc
              Tasmanian devil  ---ttcagac-------aat-tgct---gcgtccaatttc--tctgccc
                      Wallaby  ---tttttaa-------agt-tgtt------ttttgtctc---ctgtcc
           American alligator  cccttctccc-------ggc-ccgg---cccggcccggcc---cgaccc
              Star-nosed mole  =================================================
             Brush-tailed rat  -------------------------------------------------
                   Chinchilla  -------------------------------------------------
                   Guinea pig  =================================================
               Naked mole-rat  =================================================
                          Dog  =================================================
     Chinese softshell turtle  =================================================

Inserts between block 20 and 21 in window
B D                      Pig 24bp
B D                   Alpaca 20bp
              Bactrian camel 20bp
B D                  Dolphin 19bp
                Killer whale 19bp
            Tibetan antelope 24bp
B D                      Cow 24bp
B D                    Sheep 24bp
               Domestic goat 24bp
B D                    Horse 46bp
B D         White rhinoceros 25bp
B D                      Cat 24bp
B D                  Ferret  74bp
B D                    Panda 46bp
              Pacific walrus 60bp
                Weddell seal 222bp
            Black flying-fox 8bp
B D                  Megabat 8bp
               Big brown bat 8bp
        David's myotis (bat) 19bp
B D                 Microbat 8bp
B D                 Hedgehog 3bp
B D                    Shrew 3bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 4bp
B D          Tasmanian devil 4bp
B D                  Wallaby 5bp

Alignment block 21 of 65 in window, 73853968 - 73853986, 19 bps 
B D                     Human  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D                     Chimp  tcc--------ccc----------ttc------taa----tgtca-----------------tt
B D                   Gorilla  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D                 Orangutan  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D                    Gibbon  ttc--------ccc----------ttc------taa----tgcca-----------------tt
B D                    Rhesus  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D       Crab-eating macaque  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D                    Baboon  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D              Green monkey  tcc--------ccc----------ttc------taa----tgcca-----------------tt
B D                  Marmoset  -ac--------ccc----------ttc------taa----tccta-----------------tc
B D           Squirrel monkey  -ac--------ccc----------ttc------taa----tccca-----------------tc
B D                  Bushbaby  ctc--------cct----------gcc------tga----tccct-----------------tc
           Chinese tree shrew  tgc--------tcc----------tg-------tga----tccca-----------------cc
B D                  Squirrel  -cc--------tct----------ttc------tga----tcttg-----------------tt
       Lesser Egyptian jerboa  ----------------------------------------tcccc-----------------tg
                 Prairie vole  -tt--------tgt----------gcc------tct----tccct-----------------tc
B D           Chinese hamster  -tc--------tct----------ttc------tat----tccct-----------------tc
B D                     Mouse  -tt--------ccc----------atc------tct----tccct-----------------tc
B D                       Rat  -tt--------cca----------gtc------tct----ttcct-----------------cc
B D                    Rabbit  -ac--------ccc----------ttt------ctc----ttcct-----------------gc
B D                      Pika  -ac--------ccc----------ggc------taa----tcccc-----------------gc
B D                       Pig  cta--------cccctg-------gcctccgcctca----tccca-----------------ct
B D                    Alpaca  ctc--------cac----------gcc--------c----ctcca-----------------cc
               Bactrian camel  ctc--------cac----------gcc--------c----ctcca-----------------cc
B D                   Dolphin  cct--------ccc----------gcc--agcctaa----tccca-----------------aa
                 Killer whale  cct--------ccc----------gcc--agcctaa----tccca-----------------aa
             Tibetan antelope  ctc--------ccc----------gcc--agcctaa----ttcta-----------------aa
B D                       Cow  ctc--------ccc----------gcc--agtctaa----ttcta-----------------aa
B D                     Sheep  ctc--------ccc----------gct--agcctaa----ttcta-----------------aa
                Domestic goat  ctc--------ccc----------gcc--agcctaa----ttcta-----------------aa
B D                     Horse  ccc--------tga----------gcc------taa----tcccc-----------------tg
B D          White rhinoceros  ccc--------tga----------gcc------taa----tcctg-----------------tg
B D                       Cat  cta--------cgc----------gtc------taa----cccca-----------------cg
B D                   Ferret   ccc--------cgc----------gtc------taatcactccct-----------------cg
B D                     Panda  ccc--------cgc----------gtc------taa----tccca-----------------cg
               Pacific walrus  ccc--------ctt----------gtc------taa----tccca-----------------ag
                 Weddell seal  ccc--------ctc----------gtc------taa----tccca-----------------ag
             Black flying-fox  ttc--------tac----------acc------cac----ctccacccacagcctaatcccttg
B D                   Megabat  ttc--------tac----------acc------cac----ctccacccacagcctaatcccttg
                Big brown bat  ccc--------tcc----------agc------ccg----ctccacctg-------------tg
         David's myotis (bat)  cccgacacacacac----------acc------gcc----atctacctg-------------tg
B D                  Microbat  ccc--------cac----------acc------ccg----atccacctg-------------tg
B D                  Hedgehog  ctc--------taccaaga-----gtc------caa----ccctt-------------------
B D                     Shrew  ctc--------tccctgaatccccggc------caa----cccct-------------------
B D                  Elephant  atc--------tgc----------atc------taa----tcccc-----------------tc
          Cape elephant shrew  -------------c----------atc------aaa----ccttc-----------------tc
B D                   Manatee  acc--------tag----------atc------taa----tcccc-----------------tc
             Cape golden mole  gct--------tgc----------att------tag----t--cc-----------------ac
B D                    Tenrec  ccc--------tgg----------gtg------tag----tgccc-----------------tc
                     Aardvark  acc---------ag----------atc------taa----tcctc-----------------tc
B D                 Armadillo  acc--------gca----------gtc------taa----tctga-----------------tc
B D                   Opossum  ---------------------------------cag----ttcag-----------------cc
B D           Tasmanian devil  ---------------------------------caa----ttcag-----------------cc
B D                   Wallaby  -----------------------------tccccaa----tccag-----------------tg
B D        American alligator  gcc--------cgc----------gc--------------------------------------
             Star-nosed mole  ================================================================
            Brush-tailed rat  ----------------------------------------------------------------
                  Chinchilla  ----------------------------------------------------------------
B D                Guinea pig  ================================================================
B D            Naked mole-rat  ================================================================
B D                       Dog  ================================================================
  D  Chinese softshell turtle  ================================================================

Inserts between block 21 and 22 in window
B D                 Hedgehog 1bp
B D                    Shrew 15bp
B D                  Opossum 5bp
B D          Tasmanian devil 5bp
B D                  Wallaby 5bp

Alignment block 22 of 65 in window, 73853987 - 73853988, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  ag
B D           Squirrel monkey  tg
B D                  Bushbaby  tc
           Chinese tree shrew  tt
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tc
                 Prairie vole  tt
B D           Chinese hamster  tt
B D                     Mouse  tt
B D                       Rat  tt
B D                    Rabbit  ct
B D                      Pika  tt
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  gt
B D          White rhinoceros  tt
B D                       Cat  tt
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                  Hedgehog  ct
B D                     Shrew  tt
              Star-nosed mole  gc
B D                  Elephant  ct
          Cape elephant shrew  gt
B D                   Manatee  tt
             Cape golden mole  tt
B D                    Tenrec  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                   Opossum  -c
B D           Tasmanian devil  -t
B D                   Wallaby  -t
            Brush-tailed rat  --
                  Chinchilla  --
B D                Guinea pig  ==
B D            Naked mole-rat  ==
B D                       Dog  ==
B D        American alligator  --
  D  Chinese softshell turtle  ==

Inserts between block 22 and 23 in window
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 23 of 65 in window, 73853989 - 73854016, 28 bps 
B D                     Human  caaa-cccaa---------ggactg-aaagtca-------------c---g-----tctc--
B D                     Chimp  caaa-cccaa---------ggactg-aaagaca-------------c---a-----tctc--
B D                   Gorilla  caaa-cccaa---------ggactg-aaaggca-------------c---a-----tctc--
B D                 Orangutan  caaa-cccaa---------ggactg-aaaggcg-------------c---a-----tctc--
B D                    Gibbon  caaa-cccaa---------ggactg-aaaggcg-------------c---a-----tctc--
B D                    Rhesus  caaa-cccaa---------ggactg-aaaggcg-------------c---a-----cctc--
B D       Crab-eating macaque  caaa-cccaa---------ggactg-aaaggcg-------------c---a-----cctc--
B D                    Baboon  caaa-cccaa---------ggactg-aaaggcg-------------c---a-----cctc--
B D              Green monkey  caaa-cccaa---------ggactg-aaaggcg-------------c---a-----cctc--
B D                  Marmoset  caaa-cccaa---------ggactg-aaaggc--------------c---a-----cttc--
B D           Squirrel monkey  caaa-cccaa---------ggacta-aaaggt--------------c---a-----cttc--
B D                  Bushbaby  caac-ccc--------------------------------------------------cc--
           Chinese tree shrew  cact-ccc-a---------ggtttg-aagggtg-------------t---a-----cctg--
B D                  Squirrel  ggaa-tgtag---------gcacca-aa----a-------------g---g-----tgca--
       Lesser Egyptian jerboa  tcat-ccag------------tctg-------------------------------------
                 Prairie vole  ccaa-ccaag---------gccctg-aa----g-------------g---t-----tgcg--
B D           Chinese hamster  ccaa-ccaag---------gccccg-aagagtg-------------a---g-----tgca--
B D                     Mouse  ccaa-ccaag---------gatctg-taaagca-------------a---t-----tcct--
B D                       Rat  ccaa-ccaag---------tttctgaaaaagta-------------a---t-----ttct--
B D            Naked mole-rat  cagg-ctagg---------atactc-acagatg-------------a---t-----tctg--
B D                    Rabbit  -cga-ac------------ccac---------------------------------------
B D                      Pika  -caa-ccagatgactgacgcttc---------------------------------------
B D                       Pig  caaa-tccaa---------ggactg-aaaggcg-------------c---g-----tctc--
B D                    Alpaca  caat-cccag---------tgactg-agaggtg-------------t---g-----tctt--
               Bactrian camel  caat-cccag---------tgactg-agaagtg-------------t---g-----tctt--
B D                   Dolphin  caaa-cccaa---------ggactg-aaaggcg-------------c---g-----cctt--
                 Killer whale  caaa-cccaa---------ggactg-aaaggcg-------------c---g-----cctc--
             Tibetan antelope  caaaccccca---------ggactg-aagcgca-------------c---c-----tctc--
B D                       Cow  caaaccccga---------ggactg-aaacgca-------------c---c-----tctc--
B D                     Sheep  caaaccccca---------ggactg-aaacgaa-------------c---c-----tctc--
                Domestic goat  caaaccccca---------ggactg-aaacgaa-------------c---c-----tctc--
B D                     Horse  caaa-gccag---------cagctg-aaaggcg-------------c---gcct--cttc--
B D          White rhinoceros  caaa-cccat---------cgactg-aagggcg-----------------------cctc--
B D                       Cat  caaa----------------------------------------------------------
B D                   Ferret   caaa-tccaa---------gccctg-aaaggcg-------------g---g-----tctc--
B D                     Panda  ccag-tccaa---------cccctg-aaaggcg-------------t---g-----tctc--
               Pacific walrus  caaa--ccaa---------cccctg-aaaggcg-------------c---g-----tctc--
                 Weddell seal  caaa--ccaa---------cccctg-aaaggtg-------------c---g-----tctc--
             Black flying-fox  caag-tccat---------ccctta-aaaggcg-------------c---g-----cctc--
B D                   Megabat  caag-tccat---------ccctta-aaaggcg-------------c---g-----cctc--
                Big brown bat  c-aa-cccag---------agaccc-aggggct-------------c---a-----cctc--
         David's myotis (bat)  caaa-cccag---------agacca-aggggct-------------c---a-----cctc--
B D                  Microbat  caaa-cccag---------agacca-aggggct-------------c---a-----cctc--
B D                  Hedgehog  caaa-ccact---------g---tg-aaagaca-------------ggttt-----cttc--
B D                     Shrew  tagc-tccaa---------a--ctc-tgagtct-------------g---t-----ctgt--
              Star-nosed mole  cagc-ccact---------g--atg-ggtaata-------------a---t-----ctgt--
B D                  Elephant  caag-cccaa---------agactg-caag----------------t---t-----tctc--
          Cape elephant shrew  caac-cacaa---------agactg-aaagctgtgctgttgtttttc---t-----ttct--
B D                   Manatee  caag-cccaa---------ggactg-aaat----------------t---t-----tctc--
             Cape golden mole  caag-cagga---------ggactg-aaaa----------------c---------------
B D                    Tenrec  caag-ca-------------gcctg-aagg----------------c------------c--
                     Aardvark  aaag-cccaa---------ggactg-aaag----------------c---------------
B D                 Armadillo  caaa-cccca---------ggtctg-aaaa----------------g---tg----cccc--
B D                   Opossum  --------------------accct-aggaatc-------------a---g-----tctc--
B D           Tasmanian devil  --------------------gtcct-aggaata-------------a---g-----ttgc--
B D                   Wallaby  --------------------gtccc-agccaag-------------t---c-----ttcc--
B D        American alligator  -----------------------------------------------------tcacctctg
            Brush-tailed rat  --------------------------------------------------------------
                  Chinchilla  --------------------------------------------------------------
B D                Guinea pig  ==============================================================
B D                       Dog  ==============================================================
  D  Chinese softshell turtle  ==============================================================

Inserts between block 23 and 24 in window
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 4bp
B D          Chinese hamster 4bp
B D                    Mouse 4bp
B D                      Rat 7bp
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp
            Cape golden mole 2bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp
B D                  Opossum 9bp
B D          Tasmanian devil 9bp
B D                  Wallaby 14bp

Alignment block 24 of 65 in window, 73854017 - 73854018, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  gt
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
B D                     Mouse  tt
B D                       Rat  cc
B D            Naked mole-rat  -t
B D                Guinea pig  tt
B D                    Rabbit  ct
B D                      Pika  ct
B D                       Pig  tt
B D                    Alpaca  ct
               Bactrian camel  ct
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tc
B D          White rhinoceros  tt
B D                       Cat  tc
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                  Hedgehog  tc
B D                     Shrew  cc
              Star-nosed mole  c-
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
             Cape golden mole  tt
B D                    Tenrec  ct
                     Aardvark  tg
B D                 Armadillo  tt
B D                   Opossum  ct
B D           Tasmanian devil  ct
B D                   Wallaby  tt
B D        American alligator  cc
            Brush-tailed rat  --
                  Chinchilla  --
B D                       Dog  ==
  D  Chinese softshell turtle  ==

Inserts between block 24 and 25 in window
B D           Naked mole-rat 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 25 of 65 in window, 73854019 - 73854024, 6 bps 
B D                     Human  ct---c------ttt
B D                     Chimp  ct---c------ttt
B D                   Gorilla  ct---c------ttt
B D                 Orangutan  ct---c------ttt
B D                    Gibbon  ct---c------ttt
B D                    Rhesus  ct---c------ttt
B D       Crab-eating macaque  ct---c------ttt
B D                    Baboon  ct---c------ttt
B D              Green monkey  ct---c------ttt
B D                  Marmoset  ct---c------ttt
B D           Squirrel monkey  ct---c------ttt
B D                  Bushbaby  ct---c------tct
           Chinese tree shrew  ct---c------ttt
B D                  Squirrel  ct---c------ttt
       Lesser Egyptian jerboa  ct---c------ttt
                 Prairie vole  cc---c------ttt
B D           Chinese hamster  cc---c------ttt
B D                     Mouse  tc---ccctctttcc
B D                       Rat  cc---ccccatgtcc
B D            Naked mole-rat  ct---c------tct
B D                Guinea pig  -----c------tgt
                   Chinchilla  cc---c------ttt
B D                    Rabbit  -c---c------tct
B D                      Pika  -c---c-----ttct
B D                       Pig  -----c------tt-
B D                    Alpaca  -----c------tt-
               Bactrian camel  -----c------tt-
B D                   Dolphin  -----c------tt-
                 Killer whale  -----c------tt-
             Tibetan antelope  -----c------tt-
B D                       Cow  -----c------tt-
B D                     Sheep  -----c------tt-
                Domestic goat  -----c------tt-
B D                     Horse  -----c------tt-
B D          White rhinoceros  -----c------tc-
B D                       Cat  -----t------tt-
B D                   Ferret   -----c------tc-
B D                     Panda  -----c------tt-
               Pacific walrus  -----c------tt-
                 Weddell seal  -----t------cc-
             Black flying-fox  -----c------tt-
B D                   Megabat  -----c------tt-
                Big brown bat  -----c---tcttt-
         David's myotis (bat)  -----c---tcttt-
B D                  Microbat  -----c---tcttt-
B D                  Hedgehog  -----c------ct-
B D                     Shrew  -----c------tt-
B D                  Elephant  tt---t------tt-
          Cape elephant shrew  tt---t------tt-
B D                   Manatee  tc---t------ct-
             Cape golden mole  tc---t------tt-
B D                    Tenrec  tt---c------tt-
                     Aardvark  tc---t------tt-
B D                 Armadillo  tc---t------tt-
B D                   Opossum  ctctcc------tcc
B D           Tasmanian devil  ct---c------gtt
B D                   Wallaby  ct---c------ttt
B D        American alligator  ct---c------ttt
             Star-nosed mole  ---------------
            Brush-tailed rat  ---------------
B D                       Dog  ===============
  D  Chinese softshell turtle  ===============

Inserts between block 25 and 26 in window
B D               Guinea pig 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                   Alpaca 6bp
              Bactrian camel 5bp

Alignment block 26 of 65 in window, 73854025 - 73854072, 48 bps 
B D                     Human  tccctgccagagccacgctgaagaatgggaggaaaat-ttgcttggatc
B D                     Chimp  tccctgccagagccacgctgaagaatgggaggaaaat-ttgcttggacc
B D                   Gorilla  tccctgccagagccacgctgaagaatgggaggaaaat-ttgcctggatc
B D                 Orangutan  tccctgccagagccacgctgaagaatgggaggaaaat-ttgcttggacc
B D                    Gibbon  tccctgccagagccacgctgaagaatgggaggaaaat-ttgcttggacc
B D                    Rhesus  tccctgccagagccacgctgcggaatggaaggaaaat-ttgcttggacc
B D       Crab-eating macaque  tccctgccagagccacgctgcggaatggaaggaaaat-ttgcttggacc
B D                    Baboon  cccctgccagagccacgctgaggaatggaaggaaaat-ttgcttggacc
B D              Green monkey  tccctgccagagccacgctgaagaatggaaggaaaat-ttgcttggacc
B D                  Marmoset  tccctgccagagccacactgaagaatgggaggaaaat-ctgcttggacc
B D           Squirrel monkey  tccctgccagagccacgctgaaaaatgggaggaaaat-ttgcttggacc
B D                  Bushbaby  tccctg-cagagccactctgaagaagggaggaaaagt-ttgcctggagc
           Chinese tree shrew  cccctg--acagccacactgaagaatgggagggaaataatgcctggacg
B D                  Squirrel  ttcctg-cagagctacactgaagagtgggagtagagt-ttgccttgcag
       Lesser Egyptian jerboa  cccctcacagagccacactgaagaatgggaggaaaat-ttgcctggacc
                 Prairie vole  cccctgacagagccactctgaagaatgggaggaaaat-ttgcctggaca
B D           Chinese hamster  cccctgacagagccactctgaagaatgggaggaaaat-ttgcctggacc
B D                     Mouse  cctctgacagagccaccctgaagaatgggaggaaaat-ttgcctggacc
B D                       Rat  ctcccgacagagccacgctgaagaatgggagcaaaat-ttgcctggacc
B D            Naked mole-rat  -----ttcagagccacactgaaagagggccagaaagt-ctgtctgaacc
B D                Guinea pig  tctctcccagagccaagttgaaagatgggaagaaagt-ctgcctggatc
                   Chinchilla  tgctccgcagagcctccttgaagaacgggaaacaaat-ctgtctggacc
             Brush-tailed rat  tctcttccagagccaccttaaagaacgggaaacaaat-ctgtctggacc
B D                    Rabbit  tccctggcagag-cacgctgaagaacgggaggaaact-ctgcctgga-t
B D                      Pika  tccctggcagagccacgctgaagaacgggaggaaact-ttgcctggacc
B D                       Pig  tccctggcagagccacgctgaagaaagggcataaaat-ttgcttggatc
B D                    Alpaca  acccctgcagagctacgctgaaaaaagggaggaaaat-ttgcctggacc
               Bactrian camel  acccccgcagagcaacgctgaaaaaagggaggaaaat-ttgcctggacc
B D                   Dolphin  tccctggcagagctacgcttaaggatgggaggaaaat-ttgtctggacc
                 Killer whale  tccctggcagagctacgcttaaggatgggaggaaaat-ttgtctggacc
             Tibetan antelope  tctctggcagagctacgctgaagacggggaggaaaat-ttgcctggacc
B D                       Cow  tctctgacagagctacgctgaagacgggaaggaaaat-ttgcctggacc
B D                     Sheep  tctctggcagagctacgctgaagacggggaggaaaat-ttgcctggacc
                Domestic goat  tctctggcagagctacgctgaagacggggaggaaaat-ttgcctggacc
B D                     Horse  tccctcgcagagctacgataagggatgggagcaagat-ttgcgtggacc
B D          White rhinoceros  tccctggcagagctaccatgaggaatgggaggaaaac-ttgcgtggacc
B D                       Cat  tctctggcagagcttctctgaagaatggtaggaaaat-atgcctggacc
B D                   Ferret   tccctggcagagcttcgctgaagaatgggaggaaaat-atgcctggacc
B D                     Panda  tccctggcagagcttcgctgaataatgggaggaaaat-atgcctggacc
               Pacific walrus  tccctggcagagcttcgctgaaggatgggaggaaaat-atgcctggacc
                 Weddell seal  tcccc-acagagcttcgctgaaggatgggaggaaaat-atgcctggacc
             Black flying-fox  cccctggcagagccacgctgaagaatgggaggaaaat-ttgcctggacc
B D                   Megabat  cccctggcagagccacgctgaagaatgggaggaaaat-ttgcctggacc
                Big brown bat  tccctggcagagccacattgaagaatgggaagaaaat-ttgcctggacc
         David's myotis (bat)  tccctggcagagccacattgaagaatggacagaaaat-ttgcctggacc
B D                  Microbat  tccctggcagagccacattgaagaatggaaagaaaat-ttgcctggacc
B D                  Hedgehog  tccctgacagagccaccttgaagaatgggctgaaaat-ctgcgtggacc
B D                     Shrew  ctcttggcagagctacactgaaggatgggaagaaaat-ttgcttggatc
              Star-nosed mole  ----ttgcagagccacaatgaaaaatggaaataaaat-ctgcctggacc
B D                  Elephant  tccctggcagagccactttgaagaatgggaggaagat-ttgcttggacc
          Cape elephant shrew  tctcttacagaggcaccctgaaggatgggcagaagat-ttgcctggatc
B D                   Manatee  tccctggcagagccacgttgaagaatgggaggaagat-ttgcctagacc
             Cape golden mole  tccctggcagagctaccctgaagaatggaaggaagat-ctgcctggacc
B D                    Tenrec  tcgctggcagagccacgctgaagagcggggtgaagat-ttgcctggacc
                     Aardvark  tccctcccagagccacattgaaaaatgggaggaagat-ttgcctggacc
B D                 Armadillo  tccctgccagagccacactgaagaatggggtgaaaat-ttgcctggacc
B D                   Opossum  tcctttgcagagcgactctaaagaatgggaatcaacg-ttgccttaacc
B D           Tasmanian devil  ttctttgcagagccactctgaagaatggaaaagtact-ttgccttaacc
B D                   Wallaby  tccggtgcagagctactctgaagaagggatctgaaat-ctgtctcaaag
B D        American alligator  ---cccgcagcgccaccctgaaggacggccgcaagct-ctgcctcaacc
B D                       Dog  =================================================
  D  Chinese softshell turtle  =================================================

Alignment block 27 of 65 in window, 73854073 - 73854091, 19 bps 
B D                     Human  tgcaagccctgctgtac-aa
B D                     Chimp  tgcaagccctgctgtac-aa
B D                   Gorilla  tgcaagccctgctgtac-ag
B D                 Orangutan  tgcaagccctgctgtac-aa
B D                    Gibbon  tgcaagccctgctgtac-aa
B D                    Rhesus  tgcaagccccgctgtac-aa
B D       Crab-eating macaque  tgcaagccccgctgtac-aa
B D                    Baboon  tgcaagccccgctgtac-aa
B D              Green monkey  tgcaagccccgctgtac-aa
B D                  Marmoset  tgaaagccccactgtac-aa
B D           Squirrel monkey  tgcaagccccactgtac-aa
B D                  Bushbaby  agcaagcctccctgtat-aa
           Chinese tree shrew  tgaaggcccctcagcat-aa
B D                  Squirrel  ggcaagtctccttcttt-aa
       Lesser Egyptian jerboa  gacaggccttcttgtat-aa
                 Prairie vole  agcaagcacccctgtat-aa
B D           Chinese hamster  ggcaagcacccttatat-aa
B D                     Mouse  ggcaagcacccctatat-aa
B D                       Rat  ggcaagtacctctgtat-aa
B D            Naked mole-rat  cagatgctccaggagtc-aa
B D                Guinea pig  cagaccttccaggagtc-aa
                   Chinchilla  cagaagccccgctgttc-aa
             Brush-tailed rat  cagaagccccattgttc-aa
B D                    Rabbit  cgcaggcggccctgtac-aa
B D                      Pika  caaaggcgcccctatat-aa
B D                       Pig  cacagaacctcctgtac-aa
B D                    Alpaca  cgcaggcccctctgtat-aa
               Bactrian camel  cgcaggcccctctgtat-aa
B D                   Dolphin  cgcagaatcctctgtat-aa
                 Killer whale  cgcagaatcctctgtat-aa
             Tibetan antelope  agcagaatcctctgtat-aa
B D                       Cow  agcagaatcctctgtat-aa
B D                     Sheep  agcagaatcctctgtat-aa
                Domestic goat  agcagaatcctctgtat-aa
B D                     Horse  cgcaggcccccctgtat-aa
B D          White rhinoceros  cgcaggcccccctgtat-aa
B D                       Cat  tgaacgcccccctgtat-aa
B D                   Ferret   cgagtgcccctgtgcat-aa
B D                     Panda  cgaatgctcgcctgtat-aa
               Pacific walrus  cgaatgcccccctgtac-ga
                 Weddell seal  cgaatgcccccctgtac-aa
             Black flying-fox  cacaaacccccaggtat-aa
B D                   Megabat  cacaaacccccaggtat-aa
                Big brown bat  ctcatgcccccatgtat-aa
         David's myotis (bat)  ctcatgcccccctttat-aa
B D                  Microbat  ctaatgcccccatttat-aa
B D                  Hedgehog  caaaggctactctgtat-aa
B D                     Shrew  ctcaagtctctaagaat-aa
              Star-nosed mole  cggaa-tctcccagaatgaa
B D                  Elephant  agcaggcccgcttgtat-aa
          Cape elephant shrew  cacaggtccccttatat-aa
B D                   Manatee  cgcaggccccaatgtat-aa
             Cape golden mole  agcaggcccccatctat-aa
B D                    Tenrec  accatgctgccaagtac-aa
                     Aardvark  agcaagcccccctgtat-aa
B D                 Armadillo  cgcaggacaatgtgtat-aa
B D                   Opossum  cagaggctccccaagta-aa
B D           Tasmanian devil  ccgaggctccccaagtt-aa
B D                   Wallaby  cagaagctccttgggtg-aa
B D                       Dog  ====================
B D        American alligator  --------------------
  D  Chinese softshell turtle  ====================

Inserts between block 27 and 28 in window
B D               Guinea pig 4342bp

Alignment block 28 of 65 in window, 73854092 - 73854112, 21 bps 
B D                     Human  gaaaatcattaaggaacattt
B D                     Chimp  gaaaataattaagaaacattt
B D                   Gorilla  gaaaataattaagaaacattt
B D                 Orangutan  gaaaataattaggaaacattt
B D                    Gibbon  gaaaataattaagaaacgttt
B D                    Rhesus  gaaaataattaagaaacattt
B D       Crab-eating macaque  gaaaataattaagaaacattt
B D                    Baboon  gaaaataattaagaaacattt
B D              Green monkey  gaaaataattaagaaacattt
B D                  Marmoset  gaaaatagttaagaaacgatt
B D           Squirrel monkey  gaaaatagttaagaaacgatt
B D                  Bushbaby  gaaaatacttaagaaactttt
           Chinese tree shrew  gaaagtaagggagaaacttct
B D                  Squirrel  ggcattaattggaaaactcat
       Lesser Egyptian jerboa  gagaataataaagaaactcct
                 Prairie vole  gaaagtaatcaagaaactcct
B D           Chinese hamster  gaaagtgatcaagaaactctt
B D                     Mouse  gaaagtaatcaagaaaatcct
B D                       Rat  gaaaataatcaagaaactcct
B D            Naked mole-rat  gaaaatgatacagaaaacatt
B D                Guinea pig  gaaagtca-ccagaaa---cc
                   Chinchilla  gaaagttatccagaaaatgct
             Brush-tailed rat  gaaagttatccagaaaatact
B D                    Rabbit  gaaagtgatcaagaaactcct
B D                      Pika  caaaatgatcaagaaactttt
B D                       Pig  gaaaataatcaagaaactttt
B D                    Alpaca  gagaataatcaagaaactttt
               Bactrian camel  gagaataatcaagaaactttt
B D                   Dolphin  gaaaataatcaagaaactttt
                 Killer whale  gaaaataatcaagaaactttt
             Tibetan antelope  gaaaataatcaagaggctttt
B D                       Cow  gaaaataatcaagaggctttt
B D                     Sheep  gaaaataatcaagaggctttt
                Domestic goat  gaaaataataaagaggctttt
B D                     Horse  gaaaataatcaagaaactttt
B D          White rhinoceros  gaaaataatcaagaaaatttt
B D                       Cat  gaaaatactccggaagctttt
B D                   Ferret   gaaaataattaggaagctttt
B D                     Panda  gaaaataatcaggaagctttt
               Pacific walrus  gaaaataatcaggaagctttt
                 Weddell seal  gaaaataatcagaaagctttt
             Black flying-fox  gaaaacaatgaagaaattcat
B D                   Megabat  gaaaacaatgaagaaattcat
                Big brown bat  gaaaataatcaagaaacttat
         David's myotis (bat)  gaaaatagtgaagaaacttat
B D                  Microbat  gaaaataatcaagaaacttat
B D                  Hedgehog  gaaaataatcaagaaaatttt
B D                     Shrew  gaatattctcaggaaaattct
              Star-nosed mole  gaaaatagtccagaaattttt
B D                  Elephant  gaaaataatcaagaaactttt
          Cape elephant shrew  gaaaattattaagaaactgat
B D                   Manatee  gaaaataatcaggaagctttt
             Cape golden mole  gaaaataatcaagaaactttt
B D                    Tenrec  gaaaataatcaagaaactttt
                     Aardvark  gaaaataatccggaagctttt
B D                 Armadillo  gaaaataatcaagaaacttgt
B D                   Opossum  gaaactcgtggaaaaggcgtt
B D           Tasmanian devil  gaaagtagtgcaaaaagctct
B D                   Wallaby  gaaattcatccaaagatattt
B D                       Dog  =====================
B D        American alligator  ---------------------
  D  Chinese softshell turtle  =====================

Inserts between block 28 and 29 in window
B D                   Tenrec 3bp

Alignment block 29 of 65 in window, 73854113 - 73854121, 9 bps 
B D                     Human  g--gagagtta
B D                     Chimp  g--gagagtta
B D                   Gorilla  g--gagagtta
B D                 Orangutan  g--gagagtta
B D                    Gibbon  g--gagagtta
B D                    Rhesus  g--gagcgtta
B D       Crab-eating macaque  g--gagcgtta
B D                    Baboon  g--gagcgtta
B D              Green monkey  g--gagcgtta
B D                  Marmoset  g--gagcatta
B D           Squirrel monkey  g--gagcgtta
B D                  Bushbaby  g--gagatcta
           Chinese tree shrew  g--gagagtta
B D                  Squirrel  g--cagaggta
       Lesser Egyptian jerboa  g--gagagtta
                 Prairie vole  g--gagagcta
B D           Chinese hamster  g--cagagcta
B D                     Mouse  g--gagagtta
B D                       Rat  g--gagagtta
B D            Naked mole-rat  g--gaaggtca
B D                Guinea pig  g--gggagcca
                   Chinchilla  g--gacaggta
             Brush-tailed rat  g--gacaggta
B D                    Rabbit  g--aaggagta
B D                      Pika  a--gagggata
B D                       Pig  g--aagagtca
B D                    Alpaca  g--aagactta
               Bactrian camel  g--aagactta
B D                   Dolphin  g--aagagtta
                 Killer whale  g--aagagtta
             Tibetan antelope  g--aagaatta
B D                       Cow  g--aagagtta
B D                     Sheep  g--aagaatta
                Domestic goat  g--aagagtta
B D                     Horse  g--gagagtca
B D          White rhinoceros  g--gagagtca
B D                       Cat  g--gagagcta
B D                   Ferret   g--aagagcta
B D                     Panda  g--aagagcta
               Pacific walrus  g--aagagcta
                 Weddell seal  g--aagagcta
             Black flying-fox  g--gagagtaa
B D                   Megabat  g--gagagtaa
                Big brown bat  g--aaaagtaa
         David's myotis (bat)  g--aaaagtaa
B D                  Microbat  g--aaaagtaa
B D                  Hedgehog  t--gagagtta
B D                     Shrew  g--aagagtca
              Star-nosed mole  g--aaaagt--
B D                  Elephant  g--gagaatta
          Cape elephant shrew  gaagaaaataa
B D                   Manatee  g--gggaatta
             Cape golden mole  g--aaaaatta
B D                    Tenrec  g--gagaaata
                     Aardvark  g--gagaatta
B D                 Armadillo  g--aagagtta
B D                   Opossum  g--aaaaggta
B D           Tasmanian devil  g--aaaaggta
B D                       Dog  ===========
B D        American alligator  -----------
  D  Chinese softshell turtle  ===========

Inserts between block 29 and 30 in window
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
            Brush-tailed rat 14577bp
             Star-nosed mole 9870bp
         Cape elephant shrew 1bp

Alignment block 30 of 65 in window, 73854122 - 73854125, 4 bps 
B D                     Human  gcta
B D                     Chimp  gcta
B D                   Gorilla  gcta
B D                 Orangutan  gcta
B D                    Gibbon  gcta
B D                    Rhesus  gcta
B D       Crab-eating macaque  gcta
B D                    Baboon  gcta
B D              Green monkey  gcta
B D                  Marmoset  gcta
B D           Squirrel monkey  gcta
B D                  Bushbaby  gcta
           Chinese tree shrew  gcta
B D                  Squirrel  gttt
       Lesser Egyptian jerboa  gcta
                 Prairie vole  ggtt
B D           Chinese hamster  gtta
B D                     Mouse  ggta
B D                       Rat  ggta
B D            Naked mole-rat  gaa-
B D                Guinea pig  gcc-
                   Chinchilla  -ct-
B D                    Rabbit  gctg
B D                      Pika  acta
B D                       Pig  actg
B D                    Alpaca  gcta
               Bactrian camel  gcta
B D                   Dolphin  gctc
                 Killer whale  gctc
B D                     Horse  gcca
B D          White rhinoceros  ccta
B D                       Cat  gcta
B D                   Ferret   gtta
B D                     Panda  gtta
               Pacific walrus  gcta
                 Weddell seal  gcta
             Black flying-fox  gctg
B D                   Megabat  gctg
                Big brown bat  agca
         David's myotis (bat)  acca
B D                  Microbat  acca
B D                  Hedgehog  gtta
B D                     Shrew  gtta
B D                  Elephant  gcta
          Cape elephant shrew  gctg
B D                   Manatee  gcta
             Cape golden mole  gcta
B D                    Tenrec  gctg
                     Aardvark  gcta
B D                 Armadillo  gctg
B D                   Opossum  acta
B D           Tasmanian devil  acta
             Star-nosed mole  ====
B D                     Sheep  ----
            Brush-tailed rat  ====
               Domestic goat  ----
B D                       Cow  ----
            Tibetan antelope  ----
B D                       Dog  ====
B D        American alligator  ----
  D  Chinese softshell turtle  ====

Inserts between block 30 and 31 in window
                  Chinchilla 13054bp

Alignment block 31 of 65 in window, 73854126 - 73854137, 12 bps 
B D                     Human  c-----ta----------------------gctgcctaa---
B D                     Chimp  c-----ta----------------------gctgcctaa---
B D                   Gorilla  c-----ta----------------------gctgcctaa---
B D                 Orangutan  c-----ta----------------------gctgcctaa---
B D                    Gibbon  c-----ta----------------------gctgcctaa---
B D                    Rhesus  c-----ta----------------------gctgcctga---
B D       Crab-eating macaque  c-----ta----------------------gctgcctga---
B D                    Baboon  c-----ta----------------------gctgcctga---
B D              Green monkey  c-----ta----------------------gctgcatga---
B D                  Marmoset  c-----ta----------------------gctgcctaa---
B D           Squirrel monkey  c-----ta----------------------gctgcctaa---
B D                  Bushbaby  c-----ca----------------------gctacctaa---
           Chinese tree shrew  c-----ca----------------------gccgttaaa---
B D                  Squirrel  c-----ta----------------------cctggctaa---
       Lesser Egyptian jerboa  a-----ta----------------------gctgcctaa---
                 Prairie vole  c-----ta----------------------actgcctac---
B D           Chinese hamster  c-----ta----------------------ggtacctaa---
B D                     Mouse  t-----ca----------------------gctgcctaa---
B D                       Rat  c-----ga----------------------gctgcctaa---
B D            Naked mole-rat  t-----ca----------------------gctgcttaa---
B D                Guinea pig  c-----ct----------------------gccggtggt---
B D                    Rabbit  c-----tt----------------------gctgcctaa---
B D                      Pika  c-----tg----------------------gttgccta----
B D                       Pig  c-----ta----------------------actgcctaa---
B D                    Alpaca  c-----ta----------------------actgcccaa---
               Bactrian camel  c-----ta----------------------actgcctaa---
B D                   Dolphin  t-----taaatctgtacttttgaagagtcggctgcctaa---
                 Killer whale  t-----taaatctgtacttttgaagagtcggctgcctaa---
             Tibetan antelope  ------------------------------gctgcctaa---
B D                       Cow  ------------------------------gttgcctaa---
B D                     Sheep  ------------------------------gctgcctaa---
                Domestic goat  ------------------------------gctgcctaa---
B D                     Horse  c-----ca----------------------gctgcctaa---
B D          White rhinoceros  t-----ca----------------------gctgcctga---
B D                       Cat  c-----ca----------------------gctgcctca---
B D                   Ferret   c-----tg----------------------gctgcctga---
B D                     Panda  c-----ta----------------------gctgcctga---
               Pacific walrus  c----tta----------------------gctgcctaa---
                 Weddell seal  c----tta----------------------gctgcctga---
             Black flying-fox  c-----ta----------------------actgcctaa---
B D                   Megabat  c-----ta----------------------actgcctaa---
                Big brown bat  c-----ca----------------------actgactaa---
         David's myotis (bat)  c-----ca----------------------actgactaa---
B D                  Microbat  c-----ca----------------------actgactaa---
B D                  Hedgehog  c-----ta----------------------gctgcctca---
B D                     Shrew  c-----aa----------------------gccgctgta---
B D                  Elephant  c-----ta----------------------gctgcctag---
          Cape elephant shrew  t-----ga----------------------gaaggctag---
B D                   Manatee  c-----ta----------------------gctgcctag---
             Cape golden mole  c-----ta----------------------tctacctaa---
B D                    Tenrec  ccaactta----------------------gctgttgag---
                     Aardvark  c-----ta----------------------gctacctaa---
B D                 Armadillo  c----------------------------------cttg---
B D                   Opossum  ------------------------------tcagtttgatat
B D           Tasmanian devil  ------------------------------tcagttcgatat
             Star-nosed mole  ==========================================
            Brush-tailed rat  ==========================================
                  Chinchilla  ==========================================
B D                       Dog  ==========================================
B D        American alligator  ------------------------------------------
  D  Chinese softshell turtle  ==========================================

Inserts between block 31 and 32 in window
B D           Naked mole-rat 4971bp
B D                   Rabbit 8bp
B D                     Pika 1bp

Alignment block 32 of 65 in window, 73854138 - 73854140, 3 bps 
B D                     Human  gtg
B D                     Chimp  gtg
B D                   Gorilla  gtg
B D                 Orangutan  gtg
B D                    Gibbon  gtg
B D                    Rhesus  gtg
B D       Crab-eating macaque  gtg
B D                    Baboon  gtg
B D              Green monkey  gtg
B D                  Marmoset  gtg
B D           Squirrel monkey  gtg
B D                  Bushbaby  atc
           Chinese tree shrew  atc
B D                  Squirrel  atg
       Lesser Egyptian jerboa  atc
                 Prairie vole  atc
B D           Chinese hamster  atc
B D                     Mouse  atg
B D                       Rat  atg
B D            Naked mole-rat  gtt
B D                Guinea pig  gtt
B D                    Rabbit  gtt
B D                      Pika  ctt
B D                       Pig  atc
B D                    Alpaca  atc
               Bactrian camel  atc
B D                   Dolphin  atc
                 Killer whale  atc
             Tibetan antelope  atc
B D                       Cow  atc
B D                     Sheep  atc
                Domestic goat  atc
B D                     Horse  gtc
B D          White rhinoceros  atc
B D                       Cat  ctc
B D                   Ferret   ccc
B D                     Panda  ctc
               Pacific walrus  ctc
                 Weddell seal  ctc
             Black flying-fox  atc
B D                   Megabat  atc
                Big brown bat  atc
         David's myotis (bat)  atc
B D                  Microbat  atc
B D                  Hedgehog  gtc
B D                     Shrew  cat
B D                  Elephant  atc
          Cape elephant shrew  atc
B D                   Manatee  atc
             Cape golden mole  atc
B D                    Tenrec  att
                     Aardvark  att
B D                 Armadillo  atc
B D                   Opossum  gtc
B D           Tasmanian devil  acc
             Star-nosed mole  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
B D                       Dog  ===
B D        American alligator  ---
  D  Chinese softshell turtle  ===

Inserts between block 32 and 33 in window
B D                 Squirrel 51bp
      Lesser Egyptian jerboa 31bp
                Prairie vole 34bp
B D          Chinese hamster 34bp
B D                    Mouse 33bp
B D                      Rat 35bp
B D                   Rabbit 33bp
B D                     Pika 24bp

Alignment block 33 of 65 in window, 73854141 - 73854153, 13 bps 
B D                     Human  tg-----------------------------cacttt-----------------caatc
B D                     Chimp  tg-----------------------------cacttt-----------------caatc
B D                   Gorilla  tg-----------------------------cacttt-----------------caatc
B D                 Orangutan  tg-----------------------------cacttt-----------------caatc
B D                    Gibbon  tg-----------------------------cacttt-----------------caatc
B D                    Rhesus  tg-----------------------------cgcttt-----------------caatc
B D       Crab-eating macaque  tg-----------------------------cgcttt-----------------caatc
B D                    Baboon  tg-----------------------------cgcttt-----------------caatc
B D              Green monkey  tg-----------------------------cacttt-----------------caatc
B D                  Marmoset  tg-----------------------------cacttt-----------------caatc
B D           Squirrel monkey  tg-----------------------------cacttt-----------------caatc
B D                  Bushbaby  tg-----------------------------cacctttgctacgtaatgtgttgtagta
           Chinese tree shrew  tgtttgctctgtgacctgcttgggtatttctctgttt-----------------taatc
B D                  Squirrel  ca-----------------------------cacatt-----------------cgctc
       Lesser Egyptian jerboa  -------------------------------tacttt-----------------tgata
                 Prairie vole  -------------------------------tatttt-----------------caatc
B D           Chinese hamster  -------------------------------tacttt-----------------caacc
B D                     Mouse  -------------------------------tacttt-----------------taatg
B D                       Rat  -------------------------------tacttt-----------------taatg
B D            Naked mole-rat  tg-----------------------------cacttt-----------------ccatg
B D                Guinea pig  tg-----------------------------tacttt-----------------cagtg
             Brush-tailed rat  tg-----------------------------cacatt-----------------taatg
B D                    Rabbit  tt-----------------------------cacttt-----------------c-acc
B D                      Pika  tt-----------------------------cccttt-----------------ctatc
B D                       Pig  ag-----------------------------tacttt-----------------ttcta
B D                    Alpaca  ta-----------------------------tacttt-----------------ggcta
               Bactrian camel  tg-----------------------------tacttt-----------------ggcta
B D                   Dolphin  tg-----------------------------tacttt-----------------tgcta
                 Killer whale  tg-----------------------------tacttt-----------------tgcta
             Tibetan antelope  cc-----------------------------tactgt-----------------tgcta
B D                       Cow  tc-----------------------------tacttt-----------------tgcta
B D                     Sheep  cc-----------------------------tactgt-----------------tgcta
                Domestic goat  cc-----------------------------tacagt-----------------tgcta
B D                     Horse  ta-----------------------------tacatt-----------------tgcta
B D          White rhinoceros  tg-----------------------------tacatt-----------------tgcta
B D                       Cat  tg-----------------------------tacagt-----------------tgcaa
B D                   Ferret   tg-----------------------------tacctt-----------------ttcga
B D                     Panda  tg-----------------------------tacctt-----------------ttcga
               Pacific walrus  tg-----------------------------tacctt-----------------ttcga
                 Weddell seal  tg-----------------------------taccct-----------------ttcga
             Black flying-fox  tg-----------------------------cacatt-----------------cgctc
B D                   Megabat  tg-----------------------------cacatt-----------------cgctc
                Big brown bat  tg-----------------------------tacatt-----------------tactg
         David's myotis (bat)  tg-----------------------------cacatt-----------------tactg
B D                  Microbat  tg-----------------------------cacatt-----------------tactg
B D                  Hedgehog  ta-----------------------------tatatc-----------------tgcta
B D                     Shrew  cc-----------------------------tatg--------------------atta
B D                  Elephant  tg-----------------------------tatatt-----------------tgcta
          Cape elephant shrew  tg-----------------------------tatgtt-----------------tgcta
B D                   Manatee  ta-----------------------------tacgtt-----------------tgcta
             Cape golden mole  tg-----------------------------tatgtt-----------------tgata
B D                    Tenrec  tg-------------------------------tgtt-----------------tgcta
                     Aardvark  tg-----------------------------tacctt-----------------tgcta
B D                 Armadillo  ca-----------------------------cacatt-----------------tgcgg
B D                   Opossum  ta-----------------------------gatagt-----------------tatcc
B D           Tasmanian devil  ta-----------------------------aacaga-----------------tgtca
             Star-nosed mole  ===========================================================
                  Chinchilla  ===========================================================
B D                       Dog  ===========================================================
B D        American alligator  -----------------------------------------------------------
  D  Chinese softshell turtle  ===========================================================

Inserts between block 33 and 34 in window
B D                      Pig 50bp
B D                   Alpaca 42bp
              Bactrian camel 42bp
B D                  Dolphin 38bp
                Killer whale 40bp
            Tibetan antelope 36bp
B D                      Cow 37bp
B D                    Sheep 36bp
               Domestic goat 36bp
B D                    Horse 32bp
B D         White rhinoceros 37bp
B D                      Cat 34bp
B D                  Ferret  39bp
B D                    Panda 38bp
              Pacific walrus 39bp
                Weddell seal 39bp
            Black flying-fox 42bp
B D                  Megabat 42bp
               Big brown bat 36bp
        David's myotis (bat) 36bp
B D                 Microbat 34bp
B D                 Hedgehog 35bp
B D                    Shrew 36bp
B D                 Elephant 37bp
         Cape elephant shrew 29bp
B D                  Manatee 27bp
            Cape golden mole 25bp
B D                   Tenrec 29bp
                    Aardvark 31bp
B D                Armadillo 31bp

Alignment block 34 of 65 in window, 73854154 - 73854160, 7 bps 
B D                     Human  taactgt
B D                     Chimp  taactgt
B D                   Gorilla  taactgt
B D                 Orangutan  taactgt
B D                    Gibbon  taactat
B D                    Rhesus  taactgt
B D       Crab-eating macaque  taactgt
B D                    Baboon  taactgt
B D              Green monkey  taactgt
B D                  Marmoset  taactgt
B D           Squirrel monkey  taactgt
B D                  Bushbaby  ttactgt
           Chinese tree shrew  taacctt
B D                  Squirrel  taactaa
       Lesser Egyptian jerboa  taactac
                 Prairie vole  taacggc
B D           Chinese hamster  taactgt
B D                     Mouse  taactgc
B D                       Rat  taactgc
B D            Naked mole-rat  aagctgc
B D                Guinea pig  cagctgc
             Brush-tailed rat  cagctgt
B D                    Rabbit  taactgt
B D                      Pika  aacttgt
B D                       Pig  taacctt
B D                    Alpaca  taactgt
               Bactrian camel  taactgt
B D                   Dolphin  taactgc
                 Killer whale  taactgc
             Tibetan antelope  tacttgt
B D                       Cow  tacttgt
B D                     Sheep  tacttgt
                Domestic goat  tacttgt
B D                     Horse  t----gt
B D          White rhinoceros  t----gt
B D                       Cat  taatggt
B D                   Ferret   taactgt
B D                     Panda  caactgt
               Pacific walrus  taactgt
                 Weddell seal  taactgt
             Black flying-fox  aaactgt
B D                   Megabat  aaactgt
                Big brown bat  taactat
         David's myotis (bat)  taactat
B D                  Microbat  taactat
B D                  Hedgehog  taagca-
B D                     Shrew  taactgt
B D                  Elephant  taactct
          Cape elephant shrew  caaatgt
B D                   Manatee  caactct
             Cape golden mole  taattct
B D                    Tenrec  tg----t
                     Aardvark  taactct
B D                 Armadillo  taattt-
B D                   Opossum  aaaccat
B D           Tasmanian devil  gaatcgt
             Star-nosed mole  =======
                  Chinchilla  =======
B D                       Dog  =======
B D        American alligator  -------
  D  Chinese softshell turtle  =======

Inserts between block 34 and 35 in window
B D          Tasmanian devil 22bp

Alignment block 35 of 65 in window, 73854161 - 73854204, 44 bps 
B D                     Human  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----tata
B D                     Chimp  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----ta--
B D                   Gorilla  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----tata
B D                 Orangutan  g----aaa---gaattt-----tctgat-g------tttgtattatccttctta-----tat----ta--
B D                    Gibbon  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----tata
B D                    Rhesus  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----ta--
B D       Crab-eating macaque  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----ta--
B D                    Baboon  g----aaa---gaatct-----tctgat-g------tttgcattatccttctta-----tat----ta--
B D              Green monkey  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----ta--
B D                  Marmoset  g----aaa---gaatct-----tctgat-g------tttgtattatccttctta-----tat----taaa
B D           Squirrel monkey  g----aaa---taatct-----tctgat-g------tttgtattatccttctta-----tat----taaa
B D                  Bushbaby  g----aaa---gaattt-----ttggct-g------tttgtttttctaatcttg-----aat----aa--
           Chinese tree shrew  ggaaaaaa---aaatct-----tctact-g------tttatattactcttcaaa-----cct----ta--
B D                  Squirrel  a----aaa---gaatct-----tctaat-g------cttatattatccttcaaa-----tcttcaata--
       Lesser Egyptian jerboa  a----aaa---g-aatc-----tcctat-g------tttacattgcttttcaaa-----tcttaaata--
                 Prairie vole  a------------acct-----tccaat-g------tttatattttcctttgag-----ac-----ta--
B D           Chinese hamster  a------------gtct-----tctgat-g------tttatattatcatctgag-----act----ta--
B D                     Mouse  a------------atct-----tccgat-g------tttatattatccttcaag-----att----ta--
B D                       Rat  a------------gtct-----tctgat-g------ttt-tattatcc-tcgag-----att----ta--
B D            Naked mole-rat  a----taa---cagctt-----cctggt-g------cctg---tgcccttccgg-----tct----ta--
B D                Guinea pig  c----taa---cagcct-----cctagt-g------tctg---tgtcttttcag-----tct----ta--
             Brush-tailed rat  g----tga---cagccc-----cctgat-g------tctg---tgtccttccag-----tct----tc--
B D                    Rabbit  c----caa---gagtcc-----tctgat-g------tttatatcatctttcaaa-----tct----ta--
B D                      Pika  g----caa---gaattt-----tctgat-g------tttataccatcttccaaa-----ttt----ca--
B D                       Pig  g----aat---aaa--------tctgat-g------tttttattatcctttttt-----atc----ta--
B D                    Alpaca  g----gaaa--aagtct-----tctgat-g------tttttattacccttgaaa-----tgc----ta--
               Bactrian camel  g----gaaa--aagtct-----tctgat-g------tttttattacccttgaaa-----tgc----ta--
B D                   Dolphin  g----gaa---aaatca-----tctgat-g------attttattatccttgaaa-----ttc----ta--
                 Killer whale  g----gaa---aaatca-----tctgat-g------attttattatccttgaaa-----ttc----ta--
             Tibetan antelope  g----gaaaacaaatca-----tctgat-g------tttttattatccttgaaa-----ctc----ta--
B D                       Cow  g----gaaaacaaatca-----tctaat-g------tttttattgtccttgaaa-----ctc----ta--
B D                     Sheep  g----gaaaacaaatca-----tctgat-g------tttttattacccttgaaa-----ctc----ta--
                Domestic goat  g----gaaaacaaatca-----tctgat-g------tttttattatccttgaaa-----ctc----ta--
B D                     Horse  c----gaa--------------tctgat-g------tttttattgtccttcaaa-----ttc----ta--
B D          White rhinoceros  g----gaa---aaatct-----tctgat-g------tttttattatcctttaaa-----ttc----ta--
B D                       Cat  g----gaa---aaatct-----cccgat-gtttttttttttattgccctccaag-----ttc----ta--
B D                   Ferret   g----gaa---aaatct-----tctgaa-g------tttttatgatacttcaaa-----ttc----tt--
B D                     Panda  g----gaa---aaatct-----tctggt-g------cttttattatccttcaaa-----ttc----ta--
               Pacific walrus  g----gaa---gaatct-----tctgat-g------gttttatgatctttcaaa-----ttc----ta--
                 Weddell seal  g----gaa---gaatct-----tcttat-c------gttttatgatctttcaaa-----ttc----ta--
             Black flying-fox  g----gga---aaatct--------gat-g------tttttattatccttcaat-----ttc----ta--
B D                   Megabat  g----gga---aaatct--------gat-g------tttttattatccttcaat-----ttc----ta--
                Big brown bat  -----gga---aaatct---------at-g-------tcttatcatcctccaaa-----ttc----t---
         David's myotis (bat)  -----gga---aaatct---------at-g-------ttttatcatccttcaaa-----tta----ta--
B D                  Microbat  -----gga---aaatct---------at-g-------ttttatcatccttcaaa-----ttc----ta--
B D                  Hedgehog  t----gga---aatttt---tttctgat-g------ttt-----atatttcaca-----ttc----aa--
B D                     Shrew  t----tga---aattctaagtaactaac-----------------tctttcaaa-----ttc----ta--
B D                  Elephant  g----aaa---gaatcc-----tctgat-g------tttacattagccttcaaa-----tac----ta--
          Cape elephant shrew  a----taa---g--ttt-----tttggtgg------ctttcactacccttcaaagtgattaa----ta--
B D                   Manatee  g----aaa---gaatct-----tctcat-g------tttacattagccttcata-----tgc----ta--
             Cape golden mole  g----caa---gaatct-----ttcaat-g------tttacattatccttcaaa-----tac----tg--
B D                    Tenrec  g----tca---caatct-----tttgat-g------ttcatattacccttcaaa-----tgc----tg--
                     Aardvark  g----caa---aaatct-----tttgat-c------gttgcattacccttcaaa-----tgc----ta--
B D                 Armadillo  ------------aatct-----gctgat-g------tttacattagccttcaaa-----tcc----ta--
B D           Tasmanian devil  -----gaa---aaagat--------gaa-g------tcaggattttaccttaag-----ggt----t---
             Star-nosed mole  ======================================================================
                  Chinchilla  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================

                        Human  tt
                        Chimp  --
                      Gorilla  tt
                    Orangutan  --
                       Gibbon  tt
                       Rhesus  --
          Crab-eating macaque  --
                       Baboon  --
                 Green monkey  --
                     Marmoset  tt
              Squirrel monkey  tt
                     Bushbaby  --
           Chinese tree shrew  --
                     Squirrel  --
       Lesser Egyptian jerboa  --
                 Prairie vole  --
              Chinese hamster  --
                        Mouse  --
                          Rat  --
               Naked mole-rat  --
                   Guinea pig  --
             Brush-tailed rat  --
                       Rabbit  --
                         Pika  --
                          Pig  --
                       Alpaca  --
               Bactrian camel  --
                      Dolphin  --
                 Killer whale  --
             Tibetan antelope  --
                          Cow  --
                        Sheep  --
                Domestic goat  --
                        Horse  --
             White rhinoceros  --
                          Cat  --
                      Ferret   --
                        Panda  --
               Pacific walrus  --
                 Weddell seal  --
             Black flying-fox  --
                      Megabat  --
                Big brown bat  --
         David's myotis (bat)  --
                     Microbat  --
                     Hedgehog  --
                        Shrew  --
                     Elephant  --
          Cape elephant shrew  --
                      Manatee  --
             Cape golden mole  --
                       Tenrec  --
                     Aardvark  --
                    Armadillo  --
              Tasmanian devil  --
              Star-nosed mole  ==
                   Chinchilla  ==
                          Dog  ==
           American alligator  --
                      Opossum  --
     Chinese softshell turtle  ==

Inserts between block 35 and 36 in window
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 4bp
B D          Chinese hamster 4bp
B D                    Mouse 4bp
B D                      Rat 4bp
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
            Brush-tailed rat 4bp
B D                   Rabbit 8bp
B D                     Pika 8bp
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 4bp
B D                      Cow 4bp
B D                    Sheep 4bp
               Domestic goat 4bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Cat 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
            Black flying-fox 4bp
B D                  Megabat 4bp
        David's myotis (bat) 4bp
B D                 Microbat 4bp
B D                 Hedgehog 4bp
B D                    Shrew 4bp
B D                 Elephant 4bp
         Cape elephant shrew 42bp
B D                  Manatee 4bp
            Cape golden mole 4bp
B D                   Tenrec 4bp
                    Aardvark 8bp
B D                Armadillo 15bp

Alignment block 36 of 65 in window, 73854205 - 73854235, 31 bps 
B D                     Human  aacgaaataaatcaag---ttgtggtatagtcaa
B D                     Chimp  -acaaaattaatcaag---ttgtagtatagtcaa
B D                   Gorilla  aacaaaataaatcaag---ttgtggtatagtcaa
B D                 Orangutan  -acaaaataaataaag---ttgtggtgtagtcaa
B D                    Gibbon  aacaaaataaattaag---ttgtggtatagtcaa
B D                    Rhesus  -agaaaataaatcaag---ttgtggtatagtaaa
B D       Crab-eating macaque  -agaaaataaatcaag---ttgtggtatagtaaa
B D                    Baboon  ---aaaataaatcaag---ttgtggtatagtaaa
B D              Green monkey  -agaaaataaatcaag---ttgtggta---tcaa
B D                  Marmoset  aacaaaataaatgagg---ttctggtatagtcaa
B D           Squirrel monkey  aacaaaataagtcagg---ttgtggtatagtcaa
B D                  Bushbaby  -aaaaaattaattaag---ctgaattatagtcaa
           Chinese tree shrew  ---aataaaaatgaat---atg----accatcaa
B D                  Squirrel  aataatatgaatcaag---gtgttatttcgtcaa
       Lesser Egyptian jerboa  aatgcaatgaatcaag---gtgtcatatagtcaa
                 Prairie vole  aatgcattgaaccaaa---gtgacataaagtcaa
B D           Chinese hamster  aatgcattgaaccaag---atgtcataaagtcaa
B D                     Mouse  aatgcattgaaccaag---ttgtcataaagtcaa
B D                       Rat  aatgcattgaaccaag---ttgtcataaagccaa
B D            Naked mole-rat  aataaaatgaaccgag---ct--------gtcca
B D                Guinea pig  aataaaatgaatcagt---tcgtaacacagtcca
                   Chinchilla  aataaaatgagccgag---ccgtggtgtagtcca
             Brush-tailed rat  actaaaatgagccaag---ccatggtgtagccca
B D                    Rabbit  actaatataaaccaga---tcttggtagagtcaa
B D                      Pika  aataa---aaagaaga---tggttgtgtggtcaa
B D                       Pig  aataaaagaaatcaag---tcgtggtatagcc--
B D                    Alpaca  aataaaataaatcaag---ttgtggtatagtc--
               Bactrian camel  aataaaataaatcaag---ttgtggtatagtc--
B D                   Dolphin  aacaaaataaatgaag---ttgtggtatagtc--
                 Killer whale  aacaaaataaatgaag---ttgtggtatagtc--
             Tibetan antelope  aataaaagaaatgaag---ttttgat--------
B D                       Cow  aataaaagaaatgaag---ttttgat--------
B D                     Sheep  aataaaagaaatgaag---ttttgat--------
                Domestic goat  aataaaagaaatgaag---ttttgat--------
B D                     Horse  aataaaataaatcaag---ttgtggtattgtcaa
B D          White rhinoceros  aataaaataaatcaag---ttgtggtatagtcaa
B D                       Cat  aataaaataaatcgac---gtgtggtgta-----
B D                   Ferret   aacaaaataaatcgac---ttatggtatagtcaa
B D                     Panda  aataaaataaatcgac---ttgtggtatagtcaa
               Pacific walrus  aatacaataaatcgac---ttgtggtatagtcaa
                 Weddell seal  aatacaataaatccac---ttgcggtatagtcaa
             Black flying-fox  ---aaaacaaatcaag---ttacggtatattcta
B D                   Megabat  ---aaaacaaatcaag---ttacggtatattcta
                Big brown bat  aataaaatcaatgaag---gtgtgat--------
         David's myotis (bat)  aataaaatcaatcaag---ttgtgat--------
B D                  Microbat  aataaaatcaatcaag---ttgtgct--------
B D                  Hedgehog  aataaaatgaatgatg---ttataatataat---
B D                     Shrew  aataaaataaatgaaa---ctatggtcttttcaa
B D                  Elephant  aacaaaatagatcaag---ttgtggcatgtttaa
          Cape elephant shrew  aactaaaccactcaaa---tcgtagtctgttc-a
B D                   Manatee  aataaaataaatcaag---ctgcagtatgtttaa
             Cape golden mole  aacaaaataactcaaa---ttgt--tatgtttaa
B D                    Tenrec  aataaaatagctcaaa---ttgtggtatggtcaa
                     Aardvark  aataaaataactcagg---ctgtgttgtgtt-aa
B D                 Armadillo  aatgaaatatatcaag---ctgggatgttttt--
B D           Tasmanian devil  gaaaaacaaaatcgagagtttctattaaatttaa
             Star-nosed mole  ==================================
B D                       Dog  ==================================
B D        American alligator  ----------------------------------
B D                   Opossum  ----------------------------------
  D  Chinese softshell turtle  ==================================

Inserts between block 36 and 37 in window
B D                    Shrew 452bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 37 of 65 in window, 73854236 - 73854239, 4 bps 
B D                     Human  tcta
B D                     Chimp  tcta
B D                   Gorilla  tcta
B D                 Orangutan  tcta
B D                    Gibbon  tctg
B D                    Rhesus  tcta
B D       Crab-eating macaque  tcta
B D                    Baboon  tcta
B D              Green monkey  tcta
B D                  Marmoset  tcta
B D           Squirrel monkey  tcta
B D                  Bushbaby  agta
           Chinese tree shrew  aata
B D                  Squirrel  aata
       Lesser Egyptian jerboa  acat
                 Prairie vole  atca
B D           Chinese hamster  acca
B D                     Mouse  gcta
B D                       Rat  gcta
B D            Naked mole-rat  agta
B D                Guinea pig  aggg
                   Chinchilla  agta
             Brush-tailed rat  agga
B D                    Rabbit  aatg
B D                      Pika  actg
B D                       Pig  aata
B D                    Alpaca  aata
               Bactrian camel  aata
B D                   Dolphin  aata
                 Killer whale  aata
             Tibetan antelope  agca
B D                       Cow  agca
B D                     Sheep  agca
                Domestic goat  agca
B D                     Horse  aata
B D          White rhinoceros  aata
B D                   Ferret   gtta
B D                     Panda  actc
               Pacific walrus  acta
                 Weddell seal  acta
             Black flying-fox  aaca
B D                   Megabat  aaca
                Big brown bat  ---a
         David's myotis (bat)  ---a
B D                  Microbat  ---a
B D                  Hedgehog  ttcg
B D                  Elephant  aata
          Cape elephant shrew  atta
B D                   Manatee  aata
             Cape golden mole  aata
B D                    Tenrec  gcta
                     Aardvark  aata
B D                 Armadillo  aata
B D           Tasmanian devil  tcta
             Star-nosed mole  ====
B D                     Shrew  ====
B D                       Cat  ----
B D                       Dog  ====
B D        American alligator  ----
B D                   Opossum  ----
  D  Chinese softshell turtle  ====

Inserts between block 37 and 38 in window
B D                 Bushbaby 115bp
B D                      Rat 4bp

Alignment block 38 of 65 in window, 73854240 - 73854245, 6 bps 
B D                     Human  tttctt-
B D                     Chimp  tttctt-
B D                   Gorilla  tttctt-
B D                 Orangutan  tttctt-
B D                    Gibbon  tttctt-
B D                    Rhesus  tttctt-
B D       Crab-eating macaque  tttctt-
B D                    Baboon  tttctt-
B D              Green monkey  tttctt-
B D                  Marmoset  ttcttt-
B D           Squirrel monkey  ttcttt-
B D                  Bushbaby  tttcct-
           Chinese tree shrew  tttctt-
B D                  Squirrel  ttgctt-
       Lesser Egyptian jerboa  -ttttt-
                 Prairie vole  tttctt-
B D           Chinese hamster  -ttctt-
B D                     Mouse  --tttt-
B D                       Rat  tttttt-
B D            Naked mole-rat  -ttctt-
B D                Guinea pig  -ttctt-
                   Chinchilla  -ttctt-
             Brush-tailed rat  -ttctt-
B D                    Rabbit  tttatt-
B D                      Pika  tttttt-
B D                       Pig  tttctt-
B D                    Alpaca  tttctt-
               Bactrian camel  tttctt-
B D                   Dolphin  tttatt-
                 Killer whale  tttatt-
             Tibetan antelope  tgcctc-
B D                       Cow  tgcctc-
B D                     Sheep  tgcctc-
                Domestic goat  tgcgtc-
B D                     Horse  tttctg-
B D          White rhinoceros  tttctt-
B D                       Cat  tttctt-
B D                   Ferret   tttctt-
B D                     Panda  tttctt-
               Pacific walrus  tttcct-
                 Weddell seal  tttctt-
             Black flying-fox  tttctg-
B D                   Megabat  tttctg-
                Big brown bat  tttctt-
         David's myotis (bat)  tttctt-
B D                  Microbat  tttctt-
B D                  Hedgehog  tttctt-
B D                  Elephant  tttctt-
          Cape elephant shrew  tttctt-
B D                   Manatee  tttctt-
             Cape golden mole  tttctt-
B D                    Tenrec  tttctt-
                     Aardvark  tttctt-
B D                 Armadillo  tttctc-
B D           Tasmanian devil  -ttcttt
             Star-nosed mole  =======
B D                     Shrew  =======
B D                       Dog  =======
B D        American alligator  -------
B D                   Opossum  -------
  D  Chinese softshell turtle  =======

Inserts between block 38 and 39 in window
B D                 Hedgehog 1323bp

Alignment block 39 of 65 in window, 73854246 - 73854248, 3 bps 
B D                     Human  aat
B D                     Chimp  aat
B D                   Gorilla  aat
B D                 Orangutan  aat
B D                    Gibbon  aat
B D                    Rhesus  aac
B D       Crab-eating macaque  aac
B D                    Baboon  aac
B D              Green monkey  aac
B D                  Marmoset  aat
B D           Squirrel monkey  aat
B D                  Bushbaby  aaa
           Chinese tree shrew  aat
B D                  Squirrel  cat
       Lesser Egyptian jerboa  tat
                 Prairie vole  tgt
B D           Chinese hamster  tgt
B D                     Mouse  tgt
B D                       Rat  tgt
B D            Naked mole-rat  cat
B D                Guinea pig  tat
                   Chinchilla  cat
             Brush-tailed rat  cac
B D                    Rabbit  aat
B D                      Pika  act
B D                       Pig  aat
B D                    Alpaca  aat
               Bactrian camel  aat
B D                   Dolphin  aat
                 Killer whale  aat
             Tibetan antelope  aat
B D                       Cow  aat
B D                     Sheep  aat
                Domestic goat  aat
B D                     Horse  aga
B D          White rhinoceros  aac
B D                       Cat  aat
B D                   Ferret   aat
B D                     Panda  aat
               Pacific walrus  aat
                 Weddell seal  aat
             Black flying-fox  aat
B D                   Megabat  aat
                Big brown bat  aat
         David's myotis (bat)  aat
B D                  Microbat  aat
B D                  Elephant  aat
          Cape elephant shrew  aac
B D                   Manatee  aat
             Cape golden mole  gat
B D                    Tenrec  aat
                     Aardvark  aat
B D                 Armadillo  aat
B D           Tasmanian devil  tac
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                       Dog  ===
B D        American alligator  ---
B D                   Opossum  ---
  D  Chinese softshell turtle  ===

Alignment block 40 of 65 in window, 73854249 - 73854251, 3 bps 
B D                     Human  aat
B D                     Chimp  aat
B D                   Gorilla  aat
B D                 Orangutan  aat
B D                    Gibbon  aat
B D                    Rhesus  aat
B D       Crab-eating macaque  aat
B D                    Baboon  aat
B D              Green monkey  aat
B D                  Marmoset  aat
B D           Squirrel monkey  aat
B D                  Bushbaby  gat
           Chinese tree shrew  aat
B D                  Squirrel  aat
       Lesser Egyptian jerboa  aat
                 Prairie vole  a--
B D           Chinese hamster  aat
B D                     Mouse  aat
B D                       Rat  aac
B D            Naked mole-rat  tac
B D                Guinea pig  tac
                   Chinchilla  tac
             Brush-tailed rat  tac
B D                    Rabbit  aat
B D                      Pika  agt
B D                       Pig  -ag
B D                    Alpaca  -ag
               Bactrian camel  -ag
B D                   Dolphin  -ag
                 Killer whale  -ag
             Tibetan antelope  -ag
B D                       Cow  -ag
B D                     Sheep  -ag
                Domestic goat  -ag
B D                     Horse  -ag
B D          White rhinoceros  -ag
B D                       Cat  -ag
B D                   Ferret   -ag
B D                     Panda  -ag
               Pacific walrus  -ag
                 Weddell seal  -ag
             Black flying-fox  -ag
B D                   Megabat  -ag
                Big brown bat  -ag
         David's myotis (bat)  -ag
B D                  Microbat  -gg
B D                  Elephant  aac
          Cape elephant shrew  aat
B D                   Manatee  aat
             Cape golden mole  aat
B D                    Tenrec  act
                     Aardvark  ggt
B D                 Armadillo  aat
B