Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 713 in window, 64269828 - 64269860, 33 bps 
B D                     Human  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                     Chimp  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                   Gorilla  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                 Orangutan  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                    Gibbon  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                    Rhesus  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D       Crab-eating macaque  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                    Baboon  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D              Green monkey  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D                  Marmoset  t---cggcggcaca-gacgcgggct-----------------ttatt----a--acat--tt
B D           Squirrel monkey  t---cggcggcaca-gacaggggct-----------------ttatt----a--acat--tt
B D                  Bushbaby  t---cgacggcaca-gacgcgggct-----------------ttatt----atcacgt--tt
           Chinese tree shrew  t---cggcggcaca-gacacgggct-----------------ttatt----agcatat--ct
B D                  Squirrel  g---cggcggcaca-ggtgtgactt-----------------ttatt----a--gcat-gta
       Lesser Egyptian jerboa  t---cagcggcaca-tgcgcagcct-----------------ttatt----t--gcac-gtt
                 Prairie vole  g---cgacagcaca-ggcgcgggct-----------------ttataataaa--gcac-gtt
B D           Chinese hamster  g---cggtagcaca-ggcgcgggct-----------------ttattataaa--gcac-gtt
               Golden hamster  g---cagcagcaca-ggtgcaggct-----------------ttattataaa--acac-gtt
B D                     Mouse  g---cggcggcaca-tgcgcaggct-----------------ttattataaa--gcac-gtt
B D                       Rat  g---cagcgacaca-tgcgcgggct-----------------ttattataaa--gcac-gtt
B D            Naked mole-rat  g---cggcggcaca-ggg-tgggct-----------------ttatt----a--acac-att
B D                Guinea pig  a---cgggggcaca-gac-tgcact-----------------ttatt----a--acaa-gtt
                   Chinchilla  g---gggcggcaca-ggc-cggtct-----------------ttatt----a--agac-gtt
             Brush-tailed rat  a---tagcggcaca-agc-cgggct-----------------ttatt----a--acac-aca
B D                      Pika  c---gggcggcaca-gacgctgact-----------------ttatt----a--gcac----
B D                       Pig  t---ccagggcaca-cacgcgggct-----------------ttatt----a--gcacgttt
B D                    Alpaca  t---cgctggcaca-gacgcgggct-----------------ttatt----a--gcacattt
               Bactrian camel  t---cgctggcaca-gacgcgggct-----------------ttatt----a--gcacattt
B D                   Dolphin  t---ccacggcaca-gacgcgggct-----------------ttatt----a--ccac-att
                 Killer whale  t---ccacggcaca-gacgcggact-----------------ttatt----a--ccac-att
             Tibetan antelope  t---tcgcggcaca-gacgtgggct-----------------ttatt----a--gcat-ttt
B D                       Cow  t---ccgcggcaca-gacgtgggct-----------------ttatt----a--gcat-ttt
B D                     Sheep  t---ccgcggcaca-gacgtgggct-----------------ttatt----a--gcat-ttt
                Domestic goat  t---ccgcggcaca-gacgtgggct-----------------ttatt----a--gcat-ttt
B D                     Horse  g---cggccacacg-gacgcgaact-----------------ttatt----g--gcacgtt-
B D          White rhinoceros  t---gggcggcacg-gacgcgagct-----------------ttatt----a--gcgcgttt
B D                       Cat  t---cggcggcaca-aacacgggct-----------------ttatt----a--gcacgctt
B D                       Dog  t---cggcggcaca-aacgcgggct-----------------ttatt----a--gcacattt
B D                   Ferret   t---cggcggcaca-aacgcgggct-----------------ttatt---aa--gcacatgt
B D                     Panda  t---cggcggcaca-aaggcggctt-----------------ttatt----a--gcacattt
               Pacific walrus  t---cggcggcaca-aacgcgggct-----------------ttatt----a--gcatattt
                 Weddell seal  t---cggaggcaca-aacgcgggct-----------------ttatt----a--gcacattt
             Black flying-fox  t---cggcggcaca-gacgcgggct-----------------ttatt----a--gcattttt
B D                   Megabat  t---cggcggcaca-gacgcgggct-----------------ttatt----a--gcattttt
                Big brown bat  g---cggcggcaga-gat-ggggct-----------------ttatt----a--gtgcgatc
         David's myotis (bat)  g---c-gcggcgta-gat-ggggct-----------------ttatt----a--gcacattc
B D                  Microbat  g---c-gcggcgta-gatgggggct-----------------ttatt----a--gcacattc
B D                  Hedgehog  t---gggcggcgga-gacgc-ggtt-----------------ttatt----c--gcacgt--
B D                     Shrew  g---cggcggcaca-cacacgggct-----------------ttatt----c--gcacgtag
              Star-nosed mole  gactcggcggcaca-gacgcgggct-----------------ttatt----c--gcaacctg
B D                  Elephant  g---cggcggcaca-gacgcgggct-----------------ttatt----c--gcacaagg
          Cape elephant shrew  c---gagcggcaca-gac-cggcct-----------------ttatt----t--gcacaggg
B D                   Manatee  t---tggcggcaaa-gacacgggct-----------------ttatt----a--gcacagtg
             Cape golden mole  t---tagcggcaca-aatgcgggct-----------------ttatt----c--gcgtgtgg
B D                    Tenrec  c---gggagg--ca-gatgcgggct-----------------ttatt----c--gcgctcgg
                     Aardvark  t---cgggggcaca-gacgcgggct-----------------ttatt----c--gcacaagg
B D                 Armadillo  t---cggcggcaca-gacgcgggct-----------------ttatt----c--gcacactg
B D                   Opossum  ----caggggggagtgatccagccc-----------------gc-cc----g--cccc-ccg
B D           Tasmanian devil  a---caacaacaaatgactcggctt-----------------ttatt----g--ccac-ttt
  D    White-throated sparrow  t---ctgcg-----------gggctgaca---------------------------------
           Tibetan ground jay  c---cggcg-----------gggct-------------------------------------
B D        American alligator  t---aggagtcaga-gacgcgggttgccaatgagcagggttt--------------------
B D              Atlantic cod  ==============================================================
B D                 Tetraodon  ==============================================================
      Yellowbelly pufferfish  ==============================================================
B D             X. tropicalis  ==============================================================
  D  Chinese softshell turtle  ==============================================================
  D            Painted turtle  ==============================================================
  D           Green seaturtle  ==============================================================
B D                  Platypus  ==============================================================
B D                   Wallaby  ==============================================================
B D                      Fugu  ==============================================================

Alignment block 2 of 713 in window, 64269861 - 64269900, 40 bps 
B D                     Human  ggtagtgag-c-a------cggccccc------------ag--gg-ca------tcgcgggggctcggg-
B D                     Chimp  ggtagtgag-c-g------cggccccc------------gg--ag-aa------tcgcgggggctcggg-
B D                   Gorilla  ggtagtgag-c-g------cggccccc------------gg--gg-ca------tcgcgggggctcgcg-
B D                 Orangutan  ggtagtgag-c-g------cggccccc------------gg--gg-ca------tcgcggggactcggg-
B D                    Gibbon  ggtagtgag-c-g------cggccccc------------gg--gg-ca------tcgccggggctcggg-
B D                    Rhesus  agtagtgag-c-g------cggcccgc------------gg--ga-ca------tcgcggggactcggg-
B D       Crab-eating macaque  agtagtgag-c-g------cggcccgc------------gg--ga-ca------tcgcggggactcggg-
B D                    Baboon  agtagtgag-c-g------cggcccgc------------gg--ga-ca------tcgcggggactcggg-
B D              Green monkey  agtagtgag-c-g------cggcccgc------------gg--ga-cc------tcgcggggactcggg-
B D                  Marmoset  ggtagcgag-c-g------cagtccgc------------ag--gg-ca------tcgcgagggctcg-g-
B D           Squirrel monkey  ggtagcgag-c-g------cggcccgc------------gg--gg-ca------tcgcggggggtct-g-
B D                  Bushbaby  acccacgag-ctt------cagtccac------------ag--gg-ca------ccgcagaggaaccgg-
           Chinese tree shrew  ggtcgcgag-c-g-----tcggcccgc------------ag-cgt-ca------cagcggggcaggggg-
B D                  Squirrel  ggtcgct------------gggcccac------------ag--cttcc------tggcggaggagaggg-
       Lesser Egyptian jerboa  tgtcacgct-c-a------tggtccct------------aa--ct------------tgcgggaaaatg-
                 Prairie vole  tgttgcaac-c-a------------------------------tt------------tgcgtgataggg-
B D           Chinese hamster  tgttgcgac-c-a-----cgagctccc------------ag--tt------------cacataataggg-
               Golden hamster  tgctgcgac-c-a-----cgggctccc------------ag--tt------------cgcat-gttggg-
B D                     Mouse  tctcgcgac-c-t-----cgggtcccc------------ag--tt---------------atgacagga-
B D                       Rat  tctcccgac-c-t-----ggggcctcc------------ag--ct------------aggatgatagga-
B D            Naked mole-rat  tgcggtgag-c-a-----caggagtgc------------ag--cc---------gt------gaagggg-
B D                Guinea pig  tgtgcggag-c-a-----caggtgtgc------------ag--cg---------tcaccttagaaaggg-
                   Chinchilla  tgcggcgag-c-a-----caggtgtga------------ag--ca---------tcaccgcagaaaaga-
             Brush-tailed rat  tgcggcggg-c-a-----caggcgtgc------------aa--ca---------ttgccgcagaaaagg-
B D                      Pika  --ctgtggt-c-a-----tgggc-----------------g--cc----------------------gg-
B D                       Pig  cctagcgag-c-a-----tcggcccgc------------gg--ctttc------cctctgagcaaagga-
B D                    Alpaca  cgtagcgag-ctg-----ttagccctc------------ag--cgtta------ccgtggaggaaaggg-
               Bactrian camel  cgtagcgag-ctg-----tcagccctc------------ag--cgtta------ccgtggaggaaaggg-
B D                   Dolphin  tctagcgag-c-a-----tcggcccgc------------ag--cgtta------ccgcggaggaaaggg-
                 Killer whale  tctagcgag-c-a-----tcggcccgc------------ag--cgtta------ccgcgga-gaaaggg-
             Tibetan antelope  agtatcggg-c-g-----taggtccgc------------ag--cgtta------ccgcggaggaaaggg-
B D                       Cow  agtatcggg-c-g-----taggtccgc------------ag--cgtta------ccacggaggaaaggg-
B D                     Sheep  agtatcggg-c-g-----taggtccgc------------ag--cgtta------ccgcggaggaaaggg-
                Domestic goat  agtatcggg-c-g-----taggtccgc------------ag--cgtta------ccgcggaggaaaggg-
B D                     Horse  ---cgggcg-c-g-----tcggcccac------------ag--ctccc------gcgcggagggaaggg-
B D          White rhinoceros  c--tgcgag-c-g-----gcggcccgc------------gg--cgcct------ccgcggagggagggg-
B D                       Cat  cgttgcgag-c-g-----atggcccgc------------ac--cgata------ccgcggaggagaggg-
B D                       Dog  cgtagcgag-t-g-----acagcccgc------------ag--cgacg------ccgcggaggaaaggg-
B D                   Ferret   cgctgcaag-c-g-----atggccccc------------ag--cgaca------ccgcggaggaaaggg-
B D                     Panda  cgttgcaag-c-g-----acgacccac------------ag--cgata------ccgcgcaggaaaagg-
               Pacific walrus  cgttgccag-c-g-----atggcccgc------------ag--cgata------ccgcggaggaaaggg-
                 Weddell seal  cgttgcgag-c-g-----atggcccgc------------ag--cgata------ccgcggaggaaaggg-
             Black flying-fox  agtggcgat-c-a-----tcggccccc------------ag--ggtca------cctcagaggaaaagg-
B D                   Megabat  agtggtgat-c-a-----tcggccccc------------ag--ggtca------cctcagaggaaaagg-
                Big brown bat  cgtggcgag-c-g-----gca--ccgc------------gg--g------------------gaaaggg-
         David's myotis (bat)  cgtggcgag-c-g-----gcag-ccgc------------gg--ggtca------ccgc-ga-gagaggg-
B D                  Microbat  cgtggcgag-c-g-----gcag-ccgc------------gg--ggtca------ccgc-gaggagaggg-
B D                  Hedgehog  -----cgag---g-----agggggcg-------------------ccg------ccgggg----------
B D                     Shrew  ct--gcggg-c-g-----ggcgggcgc------------gc--tccgg------cccgcggcgtc-----
              Star-nosed mole  cc---cgag-c-g-----tcgggccgc------------ag--ttccg------ccggggaggccaggg-
B D                  Elephant  ggccgcgag-c-a-----cgggcccg-------------gg--cgtta------cccgggagtaaaggc-
          Cape elephant shrew  cgtggcgaacc-a-----caggctgg-------------ggaaagtga------ccctcgcct-------
B D                   Manatee  agttgcgag-c-a-----cagacccgc------------tg--tgtta------cccgggagtaaacgg-
             Cape golden mole  agttgcgag-c-t-----tcggtcttc------------cg--cattg------ctggggaat-acggg-
B D                    Tenrec  aggcgcgag-c-g-----ccggcccgc------------ag--cagta------gcgggcgcg-ccgga-
                     Aardvark  agtcgagag-c-a-----tcagcccgc------------ag--cgtaaaactagcccggaagtaaaggg-
B D                 Armadillo  agtggccac-c-g-----tccgcccgc------------aa--cgtta------cccgggaggacaggc-
B D                   Opossum  ctcagagag-c-ggctccccggctcgt-------------------------------------------
B D           Tasmanian devil  cacgtagag-a-aatcctagagtctgctacaagagcagc-------------------------------
B D                  Platypus  ----gggag-c-t--cgcccagcctcc------------ag--cg-ct------tcg-------------
  D    White-throated sparrow  -----ccag-t-g-------agcccgc------------cc--tg-ca------gggcatcgagaaggcc
           Tibetan ground jay  ------cag---g-------gccccgc------------tg--cg-ct------cagcatggacacggag
B D        American alligator  aggggtgag-g-g-------ggcaggg------------cc--tg-gt------aagggtgggggcggga
B D              Atlantic cod  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Wallaby  ======================================================================
B D                      Fugu  ======================================================================

                        Human  --------------
                        Chimp  --------------
                      Gorilla  --------------
                    Orangutan  --------------
                       Gibbon  --------------
                       Rhesus  --------------
          Crab-eating macaque  --------------
                       Baboon  --------------
                 Green monkey  --------------
                     Marmoset  --------------
              Squirrel monkey  --------------
                     Bushbaby  --------------
           Chinese tree shrew  --------------
                     Squirrel  --------------
       Lesser Egyptian jerboa  --------------
                 Prairie vole  --------------
              Chinese hamster  --------------
               Golden hamster  --------------
                        Mouse  --------------
                          Rat  --------------
               Naked mole-rat  --------------
                   Guinea pig  --------------
                   Chinchilla  --------------
             Brush-tailed rat  --------------
                         Pika  --------------
                          Pig  --------------
                       Alpaca  --------------
               Bactrian camel  --------------
                      Dolphin  --------------
                 Killer whale  --------------
             Tibetan antelope  --------------
                          Cow  --------------
                        Sheep  --------------
                Domestic goat  --------------
                        Horse  --------------
             White rhinoceros  --------------
                          Cat  --------------
                          Dog  --------------
                      Ferret   --------------
                        Panda  --------------
               Pacific walrus  --------------
                 Weddell seal  --------------
             Black flying-fox  --------------
                      Megabat  --------------
                Big brown bat  --------------
         David's myotis (bat)  --------------
                     Microbat  --------------
                     Hedgehog  --------------
                        Shrew  --------------
              Star-nosed mole  --------------
                     Elephant  --------------
          Cape elephant shrew  --------------
                      Manatee  --------------
             Cape golden mole  --------------
                       Tenrec  --------------
                     Aardvark  --------------
                    Armadillo  --------------
                      Opossum  --------------
              Tasmanian devil  --------------
                     Platypus  --------------
       White-throated sparrow  ct----------gg
           Tibetan ground jay  c-------------
           American alligator  cttatctgaaaggg
                 Atlantic cod  ==============
                    Tetraodon  ==============
       Yellowbelly pufferfish  ==============
                X. tropicalis  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
              Green seaturtle  ==============
                      Wallaby  ==============
                         Fugu  ==============

Alignment block 3 of 713 in window, 64269901 - 64269901, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -g
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -c
           Chinese tree shrew  -t
B D                  Squirrel  -c
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -c
               Golden hamster  -c
B D                     Mouse  -c
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -a
B D                      Pika  -c
B D                       Pig  -c
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                       Cow  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -t
B D                       Dog  -c
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -c
                 Weddell seal  -c
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
              Star-nosed mole  -g
B D                  Elephant  -t
B D                   Manatee  -t
             Cape golden mole  -t
B D                    Tenrec  -c
                     Aardvark  -t
B D                 Armadillo  -t
B D                   Opossum  -t
B D           Tasmanian devil  -t
  D    White-throated sparrow  a-
B D        American alligator  g-
         Cape elephant shrew  --
B D                  Hedgehog  --
B D                     Shrew  --
B D              Atlantic cod  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
          Tibetan ground jay  --
B D                  Platypus  --
B D                   Wallaby  ==
B D                      Fugu  ==

Alignment block 4 of 713 in window, 64269902 - 64269902, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  c
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  a
B D                   Manatee  t
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
  D    White-throated sparrow  c
B D        American alligator  c
         Cape elephant shrew  -
B D                  Hedgehog  -
B D              Atlantic cod  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
          Tibetan ground jay  -
B D                  Platypus  -
B D                      Fugu  =

Inserts between block 4 and 5 in window
B D       American alligator 5bp

Alignment block 5 of 713 in window, 64269903 - 64270026, 124 bps 
B D                     Human  ccggt--gacgcaacgg----ttaaa-cctg---gctc----g--------------------cgactta
B D                     Chimp  ccggt--gacgcaacgg----ttaaa-cctg---gctc----g--------------------cgactta
B D                   Gorilla  ccggt--gacgcaacgg----ttaaa-cctg---gctc----g--------------------cggctta
B D                 Orangutan  tcggt--gacgcaacgg----ttaaa-cctg---gctc----g--------------------ccactta
B D                    Gibbon  tcggt--gacgcaacgg----ttaaa-cctg---gctc----g--------------------cgactta
B D                    Rhesus  cgggt--gacgcaacgg----ttaag-cctg---gttc----a--------------------cgacttg
B D       Crab-eating macaque  cgggt--gacgcaacgg----ttaag-cctg---gttc----a--------------------cgacttg
B D                    Baboon  cgggt--gacgcaacgg----ttaag-cctg---gttc----a--------------------cgacttg
B D              Green monkey  ccggt--gacgcaacgg----ttaag-cctg---gttc----a--------------------cgacttg
B D                  Marmoset  ccggt--gacgcaacgg----tgaag-cctg---ggtc----g--------------------tgacttg
B D           Squirrel monkey  gcggt--gacgcaacgg----agaag-ccag---gttc----g--------------------cgccttg
B D                  Bushbaby  ctggt--gaggcaacgg----ttaat-acca---gctc----a--------------------caactga
           Chinese tree shrew  ctggt--gaaataatgg----ttaat-cccg---gatc----g--------------------caactcg
B D                  Squirrel  ttggc--aaagaaatgagggttaaat-cccg---gctc----g--------------------cagcttg
       Lesser Egyptian jerboa  ctagc--ct---------------------g---gctc----c--------------------caaattg
                 Prairie vole  gcagc--cgagtcacgg----tttac-cccg---gttc----g--------------------caattta
B D           Chinese hamster  gcagc--caagtcacga----tgtaa-cccg---gctc----g--------------------caatttg
               Golden hamster  gcagc--caagtcacgg----tttaa-cccg---gctc----g--------------------caatttg
B D                     Mouse  gcacc--ca---------------------g---accc----c--------------------caactta
B D                       Rat  gcacc--ca-gtctcgg----tttac-cagg---actc----g--------------------caactta
B D            Naked mole-rat  ctggc--accggaacgg----ttaat-ctta---gcgc----t--------------------cttctcg
B D                Guinea pig  ctggc--agaggaacgg----ttaat-caca---gagc----g--------------------cttccca
                   Chinchilla  ctggc--agcagaatgg----ttaat-ctta---gcgc----g--------------------cttctcg
             Brush-tailed rat  ctggc--agcggaacgg----ttaat-ctca---gcgt----g--------------------cttcttg
B D                      Pika  gcggc--ca---cccgg----aaggg-caca---gcgt----g--------------------c----tg
B D                       Pig  ctggc--ggcgttaggg----ttaat-ctcg---gctg----g--------------------caac-gg
B D                    Alpaca  ctggc--gaagttaggg----ttaat-cccg---gctg----g--------------------caac-tg
               Bactrian camel  ctggc--gaagttaggg----ttaat-cccg---gctg----g--------------------caac-tg
B D                   Dolphin  ctggc--aaagttaggg----ttaat-tccg---gctc----g--------------------caac-tg
                 Killer whale  ctggc--gaagttaggg----ttaat-tccg---gctc----g--------------------caac-tg
             Tibetan antelope  ccggc--gaagttaggg----ttaat-ctcg---gctc----g--------------------caac-tg
B D                       Cow  ccggc--gaagttaggg----ttaat-ctcg---gctc----g--------------------caac-tg
B D                     Sheep  ccggc--gaagttaggg----ttaat-ctcg---gctc----g--------------------caac-tg
                Domestic goat  ccggc--gaagttaggg----ttaat-ctcg---gctc----g--------------------caac-tg
B D                     Horse  ccggg--gaggtcgggg----tt-aaccccg---gctc----g--------------------caacctg
B D          White rhinoceros  ctggt--gaagtcaggg----tt-aa-ccgg---gctc----g--------------------caacttg
B D                       Cat  ctggt--gaagttgggg----tt-tc-ccgg---actt----g--------------------caacttg
B D                       Dog  ctgga--gaagttaggg----tt-tt-cctg---cccc----g--------------------caacttg
B D                   Ferret   ctggtgagaagtcagga----ct-tc-ttcg---aatt----g--------------------caactt-
B D                     Panda  ctggt--gaagtcagga----ct-tt-cccg---actt----g--------------------caacttg
               Pacific walrus  ctggt--gaagttagaa----ct-tt-ccca---gctt----g--------------------caacttg
                 Weddell seal  ctggt--gaagttaggg----ct-tt-tccg---gctt----g--------------------caacttg
             Black flying-fox  ctgtt--gaagttaggg----tt-at-tccg---actc----t--------------------c-acctg
B D                   Megabat  ctgtc--gaagttaggg----tt-at-tccg---actc----t--------------------c-acctg
                Big brown bat  cc-------------gg----tg-ac-tccg---gccc----g--------------------caacctg
         David's myotis (bat)  ct-------------gg----gg-gt-tccg---acca----g--------------------caagttg
B D                  Microbat  ct-------------gg----gg-gt-tccc---acca----g--------------------caacttg
B D                  Hedgehog  --gaa--gaggccgagg----tc-ac-cccg---gctc----cggactcggtgtccccg----gggcctt
B D                     Shrew  ccggg--gagggc--------------------------------------------------agggttc
              Star-nosed mole  ctggg--gaagtcgggg----tt-tt-ccca---gtgg----acggacggacgtccaggcgcgaggcttg
B D                  Elephant  ctggc--gcaggaacgg----ttaag-cccg---gctcgctcg--------------------cgacttg
          Cape elephant shrew  -cggc--gccggcgggg----ttaag-cccg---cctc-------------------------cgggatc
B D                   Manatee  cttgc--gcagtaacgg----ttaat-tctg---gctc----g--------------------caacttg
             Cape golden mole  atggc--acagaagtgg----ttaat-cccg---ccat--------------------------------
B D                    Tenrec  ccggt--gcggccatgc----ttaac-cccggcccctt--------------------------------
                     Aardvark  ctggc--gcagtactgg----ttaat-ccca---gctc----c--------------------caacttg
B D                 Armadillo  gcggc--gaagtaatgg----ttaat-cccg---actc----g--------------------ccacttc
B D                   Opossum  ttggg--ggggaaatgg----ttaac-ctcg---gctccttgt--------------------tcacaag
B D           Tasmanian devil  cccag--gggaaagtgg----ttaat-ctcg---gttc----t--------------------gaccacg
B D                   Wallaby  ccggg--ggagaaatgg----ttaac-ctcg---gttc----t--------------------gagcaag
B D                  Platypus  ---gg--caacagacgg----ttaac-tccg---gcag----g--------------------ggccgag
           Tibetan ground jay  ----------acggagg----gaaaa-ccct---gctc--------------------------------
B D        American alligator  -------ctggtggctg----ggggg-ccct---ggtt----g---------------------------
B D              Atlantic cod  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                      Fugu  ======================================================================

                        Human  gcg--caggcg-cc--tgggg---------gaaagc-c----c---ggagcc--------------t--g
                        Chimp  gcg--caggag-cc--tgggg---------gaaagc-c----c---ggagcc--------------t--g
                      Gorilla  gcg--caggcg-cc--tgggg---------ggcagc-c----c---ggagcc--------------t--g
                    Orangutan  gcg--cagacg-cc--tgggg-----------cagc-c----c---ggagcc--------------g--c
                       Gibbon  gcg--caggcg-cc--tgggg---------g-cagc-c----c---gaagcc--------------g--g
                       Rhesus  gcg--caggca-ct--tgggga--------ggtagc-c----c---ggagcc--------------g--g
          Crab-eating macaque  gcg--caggca-ct--tgggga--------ggtagc-c----c---ggagcc--------------g--g
                       Baboon  gcg--caggca-ct--tggag---------ggtagc-c----c---ggagcc--------------g--g
                 Green monkey  gcg--caggca-ct--tggggg--------ggtagc-c----c---ggagcc--------------g--g
                     Marmoset  gct--caggcg-cc--tggag---------g-cagc-c----c---ggtgcc--------------g--a
              Squirrel monkey  gct--caggag-cc--tgggg---------g-cagc-c----c---ggtacc--------------g--a
                     Bushbaby  gcg--caagtg-cc--ccggg---------g-cagc-c----t---agcgcc--------------g--g
           Chinese tree shrew  gcg--catccg-ca--aggag---------gggaga-c----c---------------------------
                     Squirrel  g-g--cgg----------------------ggctgc-c----c---agcgcc--------------g--t
       Lesser Egyptian jerboa  gcg--caggcg-cc--tgg-----------ggaagc-c----c---agcgcc--------------a--g
                 Prairie vole  gcg--caggcg-cc--agag----------ggcggc-c----t---gttacc--------------g--g
              Chinese hamster  gcg--caggag-------------------ggcagc-c----c---ggtacg--------------g--g
               Golden hamster  gcg--caggcg-cc--ggac----------agcagc-c----c---ggtacg--------------g--g
                        Mouse  gca--caggca-cc--cgag----------ggcagt-c----c---agaaca--------------g--g
                          Rat  gca--caggcg-cc--tgag----------ggctgt-c----c---agtaac--------------g--g
               Naked mole-rat  gcg--caggggccc--tt------------gggaac-c----a---agtgcc--------------a--g
                   Guinea pig  gcg--caggcg-cc--tt------------gggcac-c----a---acagca--------------c--g
                   Chinchilla  gcg--caggcg-ct--gt------------ggatac-c----a---agcgc---------------a--g
             Brush-tailed rat  gcg--caggcg-cc--ct------------gggcac-c----a---agcgct--------------a--g
                         Pika  gag--aagtca-cc--gt------------tgaccc-c----g---gctgat--------------c--c
                          Pig  gcg--caggcg-cc--t--gc---------ggcagc-c----c---agcgcc--------------g--g
                       Alpaca  gcg--caggca-cc--t--gg---------ggccga-c----c---agcgcc-----------------g
               Bactrian camel  acg--caggca-cc--t--gg---------ggccga-c----c---agcgcc-----------------g
                      Dolphin  gcg--aaggcg-ac--t--gt---------ggcagc-c----c---agtgcc--------------g--g
                 Killer whale  gcg--aaggcg-ac--t--gt---------ggcagc-c----c---agtgcc--------------g--g
             Tibetan antelope  gcg--caggc---------------------------------------gcg--------------t--g
                          Cow  gcg--caggc---------------------------------------gcg--------------t--g
                        Sheep  gcg--caggc---------------------------------------gcg--------------t--g
                Domestic goat  gcg--caggc---------------------------------------gcg--------------t--g
                        Horse  gcg--caggcg-cc--t--gg---------ggcagc-c----c---ggcg-c--------------g--g
             White rhinoceros  gcg--caggcg-cc--t--gg---------ggcagc-c----c---ggcgcc--------------g--g
                          Cat  gcg--ctggcg-c----------------------------------gcgcc--------------g--g
                          Dog  gcg--cagacg-ct--c--gg---------ggcagc-ccgggc---gggggc--------------c--g
                      Ferret   --g--cagacg-at--g--ag---------ggtatc-c----c---atcgcc--------------g--g
                        Panda  gcg--cagacg-ct--a--gg---------gctagc-c----c---agcgcc--------------g--g
               Pacific walrus  gcg--cagacg-ct--a--gg---------ggtagc-c----c---agcgcc--------------g--g
                 Weddell seal  gtg--cagacg-ct--a--gg---------cgtagc-c----c---agcgcc--------------g--g
             Black flying-fox  gcg--c------------------------------------a---ggcgcc--------------t--g
                      Megabat  gcg--c------------------------------------a---ggcgcc--------------t--g
                Big brown bat  gcg--c------------------------------------g---ggcgcc--------------g--g
         David's myotis (bat)  gcg--c------------------------------------g---ggcgcc--------------g--g
                     Microbat  gcg--c------------------------------------g---ggcgcc--------------g--g
                     Hedgehog  gca--ccag----------ag---------ggcgga-t----c---------------------------
                        Shrew  ccg--cgggcg--------gg---------ggcggc-c----c---------------------------
              Star-nosed mole  gcg--caggcg-cc--tt-gg---------ggcagc-c----ccgcagcgc------------------a
                     Elephant  gcg--caggcg-cc--tgagg---------cagagc------a---agcgccgaag---------gg--c
          Cape elephant shrew  gcg--catgcg-t------gg---------tggggc------c---cgc-----------------g--c
                      Manatee  tcg--caggcg-cc--tgggg---------ggcagg------a---agcgcc--------------g--g
             Cape golden mole  -----ttagtg-cc--ggggg---------gagggg------a---agaacagtag---------cgccg
                       Tenrec  -----cctggg-cg--caggg---------gagagg------g---agg--------------------g
                     Aardvark  gcg--caggcg-cc--tggag---------ggcacc------a---agagcc--------------g--g
                    Armadillo  gtg--caggcg-cc--cagcg---------gggcgg------g---gcacccgaggagccacttccg--g
                      Opossum  gcg--caggcg-ca--gtgaggccccgcccagaagc-c----g---ataatt--------------g--g
              Tasmanian devil  gcg--caggcg-ca--acgaagccccgcccccgagc-c----g---attgtt--------------a--g
                      Wallaby  gcg--caggcg-ca--acgaagccccgcccacaggc-c----g---cttgtt--------------a---
                     Platypus  gcggccacgcc-cc--c-------------ttcggctc----c---aacgcc--------------g--g
           Tibetan ground jay  -----cgagtc-cc----------------aggggc-a----a---agtctg--------------c--c
           American alligator  --g--cagggc-ttagcaggg---------aggggc-g----g---ggcctg--------------g--g
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                         Fugu  ======================================================================

                        Human  agg-gcggg------------g------------------------------------------------
                        Chimp  agg-gcggg------------g------------------------------------------------
                      Gorilla  agg-gcgtg------------g------------------------------------------------
                    Orangutan  aag-gcggg------------g------------------------------------------------
                       Gibbon  agg-gcggg------------g------------------------------------------------
                       Rhesus  agg-gcggg------------g------------------------------------------------
          Crab-eating macaque  agg-gcggg------------g------------------------------------------------
                       Baboon  agg-gcggg------------g------------------------------------------------
                 Green monkey  agg-gcggg------------g------------------------------------------------
                     Marmoset  agg-gcggg------------g------------------------------------------------
              Squirrel monkey  agg-gcggg------------g------------------------------------------------
                     Bushbaby  agg-gcggg------------g------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ggg-------------------------------------------------------------------
       Lesser Egyptian jerboa  agg-gcggg------------g------------------------------------------------
                 Prairie vole  aga-gggg--------------------------------------------------------------
              Chinese hamster  aaaggggga------------aaagttgccgcttccggaagttggggtagcgcaggcgc-------cagc
               Golden hamster  aaa-gggga------------aaagttgccacttccggaagctggggtggcgcaggcgcctcagggcagc
                        Mouse  aga-gg----------------------------------------------------------------
                          Rat  aga-gg----------------------------------------------------------------
               Naked mole-rat  tga-cagg--------------------------------------------------------------
                   Guinea pig  tgg-ctgg--------------------------------------------------------------
                   Chinchilla  tga-ctgg--------------------------------------------------------------
             Brush-tailed rat  tgg-ctgg--------------------------------------------------------------
                         Pika  cgg-gc----------------------------------------------------------------
                          Pig  -gg-gcggg------------g------------------------------------------------
                       Alpaca  -gg-gcggg------------g------------------------------------------------
               Bactrian camel  -gg-gcggg------------g------------------------------------------------
                      Dolphin  -gg-gcggg------------g------------------------------------------------
                 Killer whale  -gg-gcggg------------g------------------------------------------------
             Tibetan antelope  -gg-gcggg------------g------------------------------------------------
                          Cow  -gg-gtggg------------g------------------------------------------------
                        Sheep  -gg-gcggg------------g------------------------------------------------
                Domestic goat  -gg-gcgag------------g------------------------------------------------
                        Horse  -gg-gcggg------------g------------------------------------------------
             White rhinoceros  -gg-gcggg------------g------------------------------------------------
                          Cat  -gg-gcggg------------g------------------------------------------------
                          Dog  -gg-gcggg------------g------------------------------------------------
                      Ferret   -gg-gcggg------------a------------------------------------------------
                        Panda  -gg-gcggg------------g------------------------------------------------
               Pacific walrus  -gg-gcggg------------g------------------------------------------------
                 Weddell seal  -gg-gcggg------------g------------------------------------------------
             Black flying-fox  -gg-gc-gg------------g------------------------------------------------
                      Megabat  -gg-gcggg------------g------------------------------------------------
                Big brown bat  -gg-gc----------------------------------------------------------------
         David's myotis (bat)  -gg-gc----------------------------------------------------------------
                     Microbat  -gg-gc----------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  -gg-gcggg------------a------------------------------------------------
                     Elephant  agg-gcggg------------g------------------------------------------------
          Cape elephant shrew  gtg-ccggg------------g------------------------------------------------
                      Manatee  agg-gcggg------------g------------------------------------------------
             Cape golden mole  agg-gcggg------------g------------------------------------------------
                       Tenrec  agg-gaggt------------g------------------------------------------------
                     Aardvark  tgg-gcggg------------a------------------------------------------------
                    Armadillo  tgg-cttgg------------g------------------------------------------------
                      Opossum  ggg-gcgggcctggaagacgaa------------------------------------------------
              Tasmanian devil  ggg-gaggatctggaagtctag------------------------------------------------
                      Wallaby  aag-gcggacctggaagcatag------------------------------------------------
                     Platypus  -aa-gtggg------------g------------------------------------------------
           Tibetan ground jay  agg-ccggg------------g------------------------------------------------
           American alligator  cga-cgggg------------g------------------------------------------------
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                         Fugu  ======================================================================

                        Human  -------------------cc------acggagcc------acttc---cg---gcggc-----------
                        Chimp  -------------------ct------acggagcc------acttc---cg---gcggc-----------
                      Gorilla  -------------------cc------acggagcc------acttc---cg---gcggc-----------
                    Orangutan  -------------------cc------acggagcc------acttc---cg---gcggc-----------
                       Gibbon  -------------------cc------acggagcc------acttc---cg---gcggc-----------
                       Rhesus  -------------------cc------ac-gagcc------acttc---tg---gcggc-----------
          Crab-eating macaque  -------------------cc------ac-gagcc------acttc---tg---gcggc-----------
                       Baboon  -------------------cc------ac-gagcc------acttc---tg---gcggc-----------
                 Green monkey  -------------------cc------ac-gagcc------acttc---tg---gcggc-----------
                     Marmoset  -------------------cc------gtggagcc------acttc---cg---ggggc-----------
              Squirrel monkey  -------------------cc------ccggagcc------acttc---cg---ggggc-----------
                     Bushbaby  -------------------cc------tcggagcc------acttc---ct---gcggc-----------
           Chinese tree shrew  ------------------------------gagcc------acttc---cg---gcggc-----------
                     Squirrel  -------------------gc------gaccagcc-----------------------------------
       Lesser Egyptian jerboa  -------------------cc------atgagacc------ccttc---cg---gcggccgatggg----
                 Prairie vole  -------------------aa------aagttgcc------acttc---cg---gaagctggggtgggga
              Chinese hamster  ctggtactggagagaggg-aa------aagttgcc------acttc---cg---gaagttggggtg----
               Golden hamster  ccggtaggggagagggggaaa------aagttgcc------acttc---cg---gaagttagggt-----
                        Mouse  -------------------ga------aaacagcc------acttc---cg---gaggcttagggggtgg
                          Rat  -------------------ga------acatagcc------acttc---cg---gaggcgtagggggtag
               Naked mole-rat  --------------------------------gta------acttc---cg---ccgcc-----------
                   Guinea pig  --------------------------------gcg------acttc---cg---gcggc-----------
                   Chinchilla  --------------------------------gag------acttc---cg---gcggc-----------
             Brush-tailed rat  --------------------------------gcg------acttc---cggcagcagc-----------
                         Pika  --------------------------------gcc------acttc---cg---gaggctt---------
                          Pig  -------------------tc------acagggcc------acttc---cg---gcagt-----------
                       Alpaca  -------------------tc------acggagcc------acttc---cg---gcaac-----------
               Bactrian camel  -------------------tc------acggagcc------acttc---cg---gcaac-----------
                      Dolphin  -------------------tc------acagggcc------atttc---ca---gcacc-----------
                 Killer whale  -------------------tc------acagggcc------atttc---ca---gcacc-----------
             Tibetan antelope  -------------------tc------acggggcc------gcttc---cg---gcagg-----------
                          Cow  -------------------tc------acggggcc------gcttc---cg---gcagg-----------
                        Sheep  -------------------tc------acggggcc------gcttc---cg---gcagg-----------
                Domestic goat  -------------------tc------acggggcc------gcttc---cg---gcagg-----------
                        Horse  -------------------tc------acggggcc------acttc---cg---gcggg-----------
             White rhinoceros  -------------------cc------ac--ggct------acttc---cg---gcggc-----------
                          Cat  -------------------tc------acggggcc------atttc---cg---gcggc-----------
                          Dog  -------------------gc------acggggcc------acttc---cg---gccgc-----------
                      Ferret   -------------------tc------acagggcc------acttc---cg---gcggc-----------
                        Panda  -------------------tc------acggggcc------acttc---cg---gcggc-----------
               Pacific walrus  -------------------tc------acggggcc------acttc---cg---gcggc-----------
                 Weddell seal  -------------------tc------acggggcc------acttc---cg---gcggc-----------
             Black flying-fox  -------------------tc------agggggct------acttc---cg---gtagc-----------
                      Megabat  -------------------tc------agggggct------acttc---cg---gtagc-----------
                Big brown bat  ------------------------------agccc------cctcc---ca---gcggc-----------
         David's myotis (bat)  ------------------------------aaccc------acttc---ca---gcggc-----------
                     Microbat  ------------------------------aaccc------acttc---ca---gcggc-----------
                     Hedgehog  ----------------------------cggagcc------gcttc---cg---gggtc-----------
                        Shrew  --------------------------------gcc------acttc---cg---gcg-c-----------
              Star-nosed mole  -------------------tc------cccgagcc------acttc---cg---gcg-c-----------
                     Elephant  -------------------cc------ggagagccactggaacttc---c--------------------
          Cape elephant shrew  -------------------gc------g--gagccacccgcacttc---c--------------------
                      Manatee  -------------------ct------agatagccgcttgaacttc---c--------------------
             Cape golden mole  -------------------cc------a--gagcaacttgaccttc---c--------------------
                       Tenrec  -------------------tc------c--gcg------gaccttc---c--------------------
                     Aardvark  -------------------tc------a----gccactccaagttc---c--------------------
                    Armadillo  -------------------gc------ggaaaatatgcaaaacttc---c--------------------
                      Opossum  -------------------tt------gcagagtc------gcttctggtg---gcggccatgttggt--
              Tasmanian devil  -------------------tt------gca--gcc------tcttc---cg---gcgaccatgttgtc--
                      Wallaby  -------------------tt------gcag-gcc------gcttc---cg---gcgaccatgttggc--
                     Platypus  -------------------cctgcccggagacgtc------acttc---cg---gcggccatatttct--
           Tibetan ground jay  -------------------ca------ctgacact------cccca---cg-------------------
           American alligator  ----------------------------tggggct------t-------cg-------------------
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                         Fugu  ======================================================================

                        Human  -tgtg----------------ggcggaa---aacc--c---a-aaacttcc
                        Chimp  -tgtg----------------ggcggaa---aacc--c---a-aaacttcc
                      Gorilla  -tgtg----------------ggcggaa---aacc--c---a-aaacttcc
                    Orangutan  -tatg----------------agcggaa---aacc--c---a-aagcttcc
                       Gibbon  -tatg----------------ggcggaa---aacc--c---a-aaacttcc
                       Rhesus  -tatg----------------ggcggaa---aacc--c---a-aaacttcc
          Crab-eating macaque  -tatg----------------ggcggaa---aacc--c---a-aaacttcc
                       Baboon  -tatg----------------ggcggaa---aacc--c---a-aaacttcc
                 Green monkey  -tatg----------------ggcggaa---aacc--c---a-aaacttcc
                     Marmoset  -tacc----------------ggcggaa---aacg--c---a-aaacttcc
              Squirrel monkey  -ttcg----------------ggcggaa---aacg--c---a-atacttcc
                     Bushbaby  -tttg----------------agcggaa---aaaa--cttag-aaacttcc
           Chinese tree shrew  -tagg----------------gccagaa---aaacttc---c-gaacttcc
                     Squirrel  -gtgg----------------gcggaaa---acct--t---caaaactt--
       Lesser Egyptian jerboa  -------------------------------------------atctaccc
                 Prairie vole  ggggg----------------tgcggaa---actt--t---a-gaatttcc
              Chinese hamster  gggga----------------ggcggaa---actt--t---t-aaacttcc
               Golden hamster  -ggga----------------ggcggaa---actt--t---g-aaacttcc
                        Mouse  ggtgc----------------gtggaaa---actt--t---g-aaactcca
                          Rat  ggtgt----------------gtggaaa---actt--t---gaaaactcca
               Naked mole-rat  -ggcg----------------ggcggaa---ctcc--c---a-aaacttcc
                   Guinea pig  -agag----------------gtcggaa---cctt--c-----agacttcc
                   Chinchilla  -ggcg----------------ctcggaa---cctt--c---a-agacttcc
             Brush-tailed rat  -ggcg----------------gctggaa---ccgt--c---a-agacttct
                         Pika  -cggg----------------cggaaaa---actt--a---a-aaacttcc
                          Pig  -taag----------------ggcggaa-aaactt--c---a-aaacttcc
                       Alpaca  -taag----------------ggcggaa-aaattt--c---a-aaacttcc
               Bactrian camel  -taag----------------ggcggaa-gaattt--c---a-aaacttcc
                      Dolphin  -taag----------------ggcggaa-aaactt--c---a-agacttcc
                 Killer whale  -taag----------------ggcggaa-aaactt--c---a-agacttcc
             Tibetan antelope  -taag----------------ggcgaaa-aaactt--c---c-a-acttcc
                          Cow  -taag----------------ggcggaa-aaactt--c---c-a-acttcc
                        Sheep  -taag----------------ggcgaaa-aaactc--c---c-a-acctcc
                Domestic goat  -taag----------------ggcgaaa-aaactt--c---c-a-acttcc
                        Horse  -taag----------------ggcggaa---------------aagcttcc
             White rhinoceros  -tgag----------------ggcggaa---------------aagcttcc
                          Cat  -taag----------------ggcgact-aaactt--c---a-aaacttcc
                          Dog  -caag----------------ggcgcgt-aaactt--c---a-aaacttcc
                      Ferret   -taag----------------agccgataaaactt--c---a-aaacttcc
                        Panda  -taag----------------gaccgat-aaactt--c---a-aaacttcc
               Pacific walrus  -taag----------------ggcggat-aaactt--c---a-aaactttc
                 Weddell seal  -taag----------------ggcggct-aaactt--c---a-aaacttcc
             Black flying-fox  -taag----------------ggcagaa-taactt--c---a-aaatatcc
                      Megabat  -taag----------------ggcagaa-taactt--c---a-aaatatcc
                Big brown bat  -taag----------------ggcggaa-aaactt--c---a-aaacttcc
         David's myotis (bat)  -tgag----------------ggcggag-gaactt--c---a-aaacttcc
                     Microbat  -tgag----------------ggcggag-gaactt--c---a-aaacttcc
                     Hedgehog  -aacg----------------ggcggaa-aacttt--c---c-caacttcc
                        Shrew  -gaga----------------agcgggg-aatttt--c---a-aaacttcc
              Star-nosed mole  -tacg----------------ggcagaa-actttt--t---a-aaacttcc
                     Elephant  ---------------------------------------------------
          Cape elephant shrew  ---------------------------------------------------
                      Manatee  ---------------------------------------------------
             Cape golden mole  ---------------------------------------------------
                       Tenrec  ---------------------------------------------------
                     Aardvark  ---------------------------------------------------
                    Armadillo  ---------------------------------------------------
                      Opossum  -tgtg----------------ggcgaaa---------a---c-agccggcc
              Tasmanian devil  -tgtg----------------ggcagaa---------g---c----ctgcc
                      Wallaby  -tgtg----------------ggcggaa---------a---a-acgctgcc
                     Platypus  -cgag----------------ggcggac---cccc--t---c-cccccgcc
           Tibetan ground jay  -tggg----------------ggctgca-----------------------
           American alligator  -tgggttatggggtaatccctggct--a-----------------------
                 Atlantic cod  ===================================================
                    Tetraodon  ===================================================
       Yellowbelly pufferfish  ===================================================
                X. tropicalis  ===================================================
     Chinese softshell turtle  ===================================================
               Painted turtle  ===================================================
              Green seaturtle  ===================================================
                         Fugu  ===================================================

Inserts between block 5 and 6 in window
B D           Naked mole-rat 180bp
B D                  Opossum 12bp
B D          Tasmanian devil 12bp
B D                  Wallaby 17bp
B D                 Platypus 34bp

Alignment block 6 of 713 in window, 64270027 - 64270186, 160 bps 
B D                     Human  ga-tg-gg----a-ccaag---ccttccgtg--gct-t----ca-------cac-gca------ccggaa
B D                     Chimp  ga-tg-gg----a-ccaag---ccttccgtg--gct-t----ca-------cac-gca------ccggaa
B D                   Gorilla  ga-tg-gg----a-ccaag---ccttccgtg--gct-t----ca-------cac-gca------ccggaa
B D                 Orangutan  ga-tg-gg----a-ccaag---ccttccgtg--gct-t----ca-------cac-gca------ccggaa
B D                    Gibbon  ga-tg-gg----a-ccaag---ccttccgtg--gct-t----ca-------cac-gca------ccggaa
B D                    Rhesus  ca-tg-gg----a-ccaag---ccttctgcg--gct-t----ca-------cat-gca------ccggaa
B D       Crab-eating macaque  ca-tg-gg----a-ccaag---ccttctgcg--gct-t----ca-------cat-gca------ccggaa
B D                    Baboon  ga-tg-gg----a-ccaag---ccttctgcg--gct-t----ca-------cat-gca------ccggaa
B D              Green monkey  ga-tg-gg----a-ccaag---ccttccgtg--gct-t----ca-------cat-gca------ccggaa
B D                  Marmoset  ga-tg-gt----a-ccaag---ttttccgcg--gct-t----ca-------cac-gca------ccggaa
B D           Squirrel monkey  ga-tg-gg----a-ccaag---ccttccgcg--gct-t----ca-------cac-gca------ccggaa
B D                  Bushbaby  ga-tg-gg------ccgaa---cctttcgtg--gctct----cg-------cac-gca------ccgaaa
           Chinese tree shrew  ga-tg-gg----g-tcgaa---ccctctgtg--gctct----cg-------ctc-gcg------ccggaa
B D                  Squirrel  -g-cg-tg----g-accta---ccctctgc---gctcc----ca-------tgc-gc-------------
       Lesser Egyptian jerboa  ca-c--------------c---cacttcgta--gctct----tt-------aac----------ccagga
                 Prairie vole  aa-cg-ag----a-accac---cccttcgta--gctat----tg-------cac-gca------ccggaa
B D           Chinese hamster  aa-cg-ag----a-accac---cccttcgtg--gctat----tg-------cac-gca------ccggaa
               Golden hamster  aa-cg-ag----a-accac---cccttcgtg--gctat----tg-------cac-gca------ccggaa
B D                     Mouse  aa-ca-gg----a-gccac---ccctccgtg--gctat----tg-------cac-gca------ccggaa
B D                       Rat  aagca-ag----g-gccac---ccctccatg--gctat----tg-------cac-gca------ccggaa
B D                Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
B D                      Pika  ---ca-aa----g-cgccg---aacttcgtgcagctct----cg-------cct-gcc------ccggaa
B D                       Pig  ga-tgagg----g-tcgag--cccttccgcg--gtcct----cg-------cac-aca------caggaa
B D                    Alpaca  ga-tgggg----a-ccgag--cccctccgtg--gtc------cg-------cac-acc------ccggaa
               Bactrian camel  ga-tgggg----a-ccgag--cgcctccgtg--gtc------cg-------cat-acc------ccggaa
B D                   Dolphin  ga-cgggg----g-ccgag--cccctccgcg--gtcct----cg-------cac-aca------ccggaa
                 Killer whale  ga-cgggg----g-ccgag--cccctccgcg--gtcct----cg-------cac-aca------ccggaa
             Tibetan antelope  ga-tgggg----g-ccgag--cccctccgtg--gtcct----cg-------cac-aca------ccggaa
B D                       Cow  ga-tgggg----g-ccgag--cccctccgtg--gtcct----cg-------cac-aca------ccggaa
B D                     Sheep  ga-tgggg----g-ccgag--cccctccgcg--gtcctcg--cg-------cac-aca------ccggaa
                Domestic goat  ga-tgggg----g-ccgag--cccctccgtg--gtcct----cg-------cac-aca------ccggaa
B D                     Horse  ga-cg-gg----g-tcgca---ccctccgtg--gtcct----cg-------cac-gc-------tcggaa
B D          White rhinoceros  ga-tg-gg----g-ccgaa---ccctccgtg--gtcct----ca-------cgc-ac-------tcggaa
B D                       Cat  ga-cg-ga----g-cccaa--accctccatg--ctcct----cg-------cac-aca------ccggaa
B D                       Dog  ga-cg-gg----g-ccaaa--cccctccgtg--ctcct----gg-------tgc-aca------ccggaa
B D                   Ferret   ga-cg-ag----g-acaaa--cccctccgtg--ctctt----cg-------tac-aca------ccggaa
B D                     Panda  ga-cg-gg----g-ccaaa--cccctctgtc--ctcct----gg-------tac-aca------ccggaa
               Pacific walrus  ga-cg-gg----g-ccaaa--cccctccgta--ctcct----cg-------tac-aca------ccggaa
                 Weddell seal  ga-cg-gg----g-ccaaa--cccctccgta--ctcct----cg-------tac-aca------ccggaa
             Black flying-fox  ga-tg-gg----g-ccgaa---tcctcggtg--gtccc----tg-------cac-aca------ccggaa
B D                   Megabat  ga-tg-gg----g-ccaaa---tcctcggtg--gtccc----tg-------cac-aca------ccggaa
                Big brown bat  gc-t--ga----g-atgaa---gccgcggga--gtccc----cg-------cac-aca------ccggaa
         David's myotis (bat)  gc-t--ga----g-tggga---gcctccgca--gttcc----cg-------cac-aca------ccggaa
B D                  Microbat  gc-t--ga----g-tggga---gcctccgca--gtccc----cg-------cac-aca------ccggaa
B D                  Hedgehog  ga-gg-ggaagtt-gccgg-cgccctccgag--gtcct----cg-------cac-atc------cc-gaa
B D                     Shrew  ca-ag-gg----g-ccccg--gccctcccgg--gtcct----cg-------cag-acg------ccggaa
              Star-nosed mole  ga-tg-gc----t-cccag----cctccgtg--gtcct----ga-------cgc-aca------ccggaa
B D                  Elephant  ga-tg-ag----g-tc-----------------gaaag----gg-------ttc-gca------ccggaa
          Cape elephant shrew  gc-ca----------------------------gcggg----gg-------cgc-gca------ccggaa
B D                   Manatee  ga-tg-gg----g-ccgaa---ccctcggtg--gcccc----ag-------ttc-gca------ccggaa
             Cape golden mole  cc-tg-ga----g-cggaa---ccctcagtg--gcggt----ggctcca-gctc-gct------ccggaa
B D                    Tenrec  ct----gg----g-ccgaa---ccctcggcg--gc----------------ccc-ggc------ccggaa
                     Aardvark  ca-tg-gg----g-c-gaa---ccctccgtg--gtctg----gg-------ctc-gca------ccggaa
B D                 Armadillo  gc-tg-gg----g-ca-----------------gcccc----ggcctcgcacgc-aca------ccggaa
B D                   Opossum  cc-ca-gc----accctag---ttccccaaa--tgctt----cc-------cgcagct----------ga
B D           Tasmanian devil  gc-cg-gc----gtcctgg---ctccccaaa--gcatt----cg-------cccggcg------ccggca
B D                   Wallaby  gc-cg-gc----g-cccga---ctccccaaa--taatt----cg-------catggct------caggaa
B D                  Platypus  gc-cg-gg----c-tccgaactccttccgcg--cctcc----gg-------ggc-gagggcggtccgcac
           Tibetan ground jay  ---------------------------------------gacgg-------ggc-gag------ctgggc
B D        American alligator  ---------------------------------------gaggg-------ggc-ggg------ctggtt
B D            Naked mole-rat  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                      Fugu  ======================================================================

                        Human  gg--gaa---------tctgggtcagccc---t---ccct----ccaaag-----gagacagcacgg--a
                        Chimp  gg--gaa---------tcggggtcagccc---t---ccct----ccaaag-----gagacagcacgg--a
                      Gorilla  gg--gaa---------tctgggtcagcct---t---ccct----ccaaag-----gagacagcacgg--a
                    Orangutan  gg--gaa---------tctgggtcagccc---t---ccct----ccgaag-----gagacagcaagg--a
                       Gibbon  gg--gaa---------tctgggtcagccc---t---ccct----ccgaag-----gagacagcacgg--a
                       Rhesus  gg--gaa---------tctgggtcagccc---t---ccca----ccgaaa-----gaggcagcacgt--a
          Crab-eating macaque  gg--gaa---------tctgggtcagccc---t---ccca----ccgaaa-----gaggcagcacgg--a
                       Baboon  gg--gaa---------tctgggtcagccc---t---ccca----ccgaaa-----gagggagcacgg--a
                 Green monkey  gg--gaa---------tctgggtcagccc---t---ccca----ccaaaa-----gaggcagcacgg--a
                     Marmoset  gg--gaa---------tctgggtcagccc---g---ccct----ccgaaa-----gagacagcgcgg--a
              Squirrel monkey  gg--gaa---------tctgggtcagccc---t---ccct----ccgaaa-----gagacagcacgg--a
                     Bushbaby  gg--gaa---------tctgggtcacaccattt---ctat----ccgaaa-----aaga----aagg--a
           Chinese tree shrew  gg--gaatcgg--gt-tctaggtcagaccgcct---ttct----ccgaaa-----gggacagaacag--a
                     Squirrel  ----------------------------c---t---ccca----gcc-aa-----gggacagaaggg-tc
       Lesser Egyptian jerboa  gg--g----------------------tc---t---ccca----gcgaaa-----gtgacagaacga---
                 Prairie vole  gc--gactcga--gc-ggttcgccagctc---ttcaccct----gttgaa-----gggacacagcga-tc
              Chinese hamster  gg--gagtcta--gc-cgttggccagttc---t---ccca----gttaaa-----gggacacagcga-cc
               Golden hamster  gg--gagtcta--gc-cgttggccagttc---t---ccca----gttaaa-----gggacacagcaatcc
                        Mouse  gg--gactcaa--gc-tgtacgtcagctc---ttctccct----gttaaa-----gggacacagcgatcc
                          Rat  gg--aactcaac-gc-tgtacgtcagctc---ttctccct----gttaaa-----gggacacagcgatcc
                   Guinea pig  -----------gtgc-tctaaatcagacc---gactccct----gcgaaa-----ggtatacaacag---
                   Chinchilla  -----------gggt-tctaactcagacc---gcttccct----acgaaa-----gggatagaacag---
             Brush-tailed rat  -----------gggc-t----ctcagacc---gcctccct----acgaaa-----gggatagaacag---
                         Pika  gg--gaatcggg-gc-ctggggtcggccc---gcctcctc----acggaa-----gggaccggacac---
                          Pig  gg--gaatcgg--cc-tttgggtcacact---gccttctt----ccgaaa-----gggacgaaac-----
                       Alpaca  gg--gaatcgg--gc-tctgggtcagacc---gcttcctt----ccgaaa-----gggacgaaatgg--a
               Bactrian camel  gg--gaatcgg--gc-tctgggtcagacc---gcttcctt----ccgaaa-----gggacgaaatgg--a
                      Dolphin  gg--gaattgg--gc-tctgggtcagacc---gcctcctt----ctgaaa-----gggacgaaac----a
                 Killer whale  gg--gaattgg--gc-tctggatcagacc---gcctcctt----ctgaaa-----gggacgaaac----a
             Tibetan antelope  gg--ggatcgg--ac-tctgggtcagacc---tcagtctt----ccgaaa-----ggaacgaatccg--a
                          Cow  gg--ggaccga--ac-tttgggtcagacc---tcagtctt----ccgaaa-----ggaacgaatccg--a
                        Sheep  gg--ggatcgg--ac-tctggatcagacc---tcagtctt----ccgaaa-----ggaacgaatccg--a
                Domestic goat  gg--ggatcgg--ac-tctaggtcagacc---tcagtctt----ccgaaa-----ggaacgaatccg--a
                        Horse  gg--gagtcg---gc-ctcgggtcagacc---gcctcctt----c-caaa----ggagacagaatgg--a
             White rhinoceros  gg--gaatcgc--gc-tctgggtcagacc---gcctcctg----c-cgaa------------actcg--a
                          Cat  ga--gaatcag--g--tttgggtcagatc---gcctcctt----c-gaaa-----aggaaaggaccg--a
                          Dog  gg--ggatcgg----ctttgggtcagatc---gcctcctt----c-gaga-----aggaaagaactg--a
                      Ferret   gg--aaatcgg--gc-tttgggtcagatc---acctcctt----c-gaaa-----aggaaaggactg--a
                        Panda  gg--gaatcgg--gctttggggtcagatc---gcctcctt----c-gaaa-----aggaaagaactg--a
               Pacific walrus  gg--gaattcg--gcctttgggtcagatc---gcctcctt----c-gaaa-----aggaaagaactg--a
                 Weddell seal  gg--gaattcg--gcctttgggtcagatc---gcctcctt----c-gaaa-----aggaaagaactg--a
             Black flying-fox  gg--aaattgg--gc-tctggttcaaacc---ccctcttt----ctgaaa-----gggacagacctg--a
                      Megabat  gg--aaactgg--gc-tctggttcaaacc---ccctcttt----ctgaaa-----gggacagacctg--a
                Big brown bat  gg--gaac-cg--gc-tccgg-tcaggac---tcctcctg----ccgacg-----cggagagacc-g--a
         David's myotis (bat)  gg--gaacgcg--gc-tccgg-tcaggac---tcctcctt----ccgacg-----cggggagaccgg--a
                     Microbat  gg--gaacccg--gc-tccgg-tcaggac---tcctcctt----ccgaca-----cggggagaccgg--a
                     Hedgehog  gg--gagtcgg--gc-tgcgggtctcgcc---gcttcctt----ccgaaa-----ggg--gaagacg--g
                        Shrew  gg--g--ccgg--gc-gctgggcccgcac---gccttctt----ccggaa-----aggg-ggagccg--a
              Star-nosed mole  gg--gaacggg--gc-tctgggtcaaa---------cctc----ccgaaa-----agg-----actg--g
                     Elephant  gg--gaatcgg--gc-tccggctcaggcc---ggttccct----cctaac-----gggagggaacgg--a
          Cape elephant shrew  gg--aagtcgg--ac-actggctccgctc---agttcact----cctaac----------ggacccg--a
                      Manatee  gg--gaatcgg--tc-tctggctcagacc---ggctccct----gctaac-----gggatagaacgg--a
             Cape golden mole  gg--gaatc----------------gacc---agctctct----ttccac-----gggccagaaagg--t
                       Tenrec  gg--a--------------------ggcg---ggctc------------c-----gcgtcagacgga--c
                     Aardvark  gg--gaatcgg--gc-t----------tc---ggctccct----cctaac-----ggggccgaacgg--a
                    Armadillo  gg--gaatcgg--ac-tccctgtc-cacc---gcctccct----ccggaa-----ggaaaagagctg--g
                      Opossum  gg--attccag--tc-gcgggagaggctc---cctgacgc----cctgaa-------------------a
              Tasmanian devil  ag--atcccag--tc-aggccacgggctc---tctgactc----tctgaa-------------------c
                      Wallaby  ag--gctccag--tc-acgccgtaagctc---tctgaatc----cctgaa-------------------c
                     Platypus  gg--ggagcgt--gg-cccggccgggaag---g--ggctc----cggagc-----ggggagatacgg--a
           Tibetan ground jay  taccggggctg--ga-tccggggagggtg---tccggggcacggccggggtgtccggggcacggccg--g
           American alligator  ga--ggggcgg--ag-caagtggggggtc---cccccaac----ccaaggtcacggagacgccattg--a
               Naked mole-rat  ======================================================================
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                         Fugu  ======================================================================

                        Human  tcctct---------------ttttgca---------t-ag-gcctgagggaa----------gtacttc
                        Chimp  tcctct---------------ttttgca---------t-ag-gcctgagggaa----------gtacttc
                      Gorilla  tcctct---------------ttttgca---------t-ag-gcctgagggaa----------gtacttc
                    Orangutan  tcctct---------------ttttgca---------t-ag-gcctgtgggaa----------gcacttc
                       Gibbon  tcctct---------------ttttgca---------t-ag-gcctgcggaaa----------gcacttc
                       Rhesus  tcctc----------------ttttgca---------taag-gcctgagggaa----------gcacttc
          Crab-eating macaque  tcctc----------------ttttgca---------taag-gcctgagggaa----------gcacttc
                       Baboon  tcctc----------------ttttgca---------taag-gcctgagggaa----------gcacttc
                 Green monkey  tcctc----------------ttttgca---------taag-gcctgagggaa----------acacttc
                     Marmoset  tcctct---------------ttttgca---------taag-gcctgtaggaa----------gcacttc
              Squirrel monkey  tcctct---------------ttttgca---------taag-gcctgcaggaa----------gcacttc
                     Bushbaby  tcctc----------------ttttgca---------taaa-acttgcggaaa----------a-acttc
           Chinese tree shrew  ccct-----------------ttttgca---------c-ag-gactgcggaaa----------agacttc
                     Squirrel  ccctct---------------gcac--------------ag-gcct-gcggag------------acttc
       Lesser Egyptian jerboa  tcttct---------------ttttgca---------taag-gcccgtgggcg------------acttc
                 Prairie vole  ctcttt---------------ttatccc---------caag-gc-t-cgg---------------acttc
              Chinese hamster  cccttt---------------ttatccc---------cacg-gctt-cggaaa------------acttc
               Golden hamster  tttttt---------------ttatccc---------caag-gcct-cggaaa------------acttc
                        Mouse  tctttt---------------tttttcc---------taag-gcct-cgaaag------------acttc
                          Rat  -----t---------------tttttcc---------taag-gcct-cgaaag------------acttc
                   Guinea pig  --atgc---------------tctcgtg---------caag-ggctgtagaag------------actcc
                   Chinchilla  --atcc---------------tctcgtg---------caag-gcctg--gaag------------acttc
             Brush-tailed rat  --atcc---------------tcttgtg---------caag-gcctgcagaag------------acttc
                         Pika  --agcc---------------tcgttccgcggccaggcaaa-gcga-cagcag------------acttc
                          Pig  ggctct---------------ttttgca---------agggcgcctgcagaaa----------agacttc
                       Alpaca  tcctat---------------ttttgca---------taag-gcctgcagaaa----------agacttc
               Bactrian camel  tcctat---------------ttttgca---------taag-gcctgcagaaa----------agacttc
                      Dolphin  gcctcc---------------ttttgca---------taag-gcctgcagaaa----------agacttc
                 Killer whale  gcctcc---------------ttttgca---------taag-gcctgcagaaa----------agacttc
             Tibetan antelope  gcctcc---------------ttttgcg---------taag-gcctgcagaaa----------agacttc
                          Cow  gcctcg---------------ttttgca---------taag-gcctgcagaaa----------agacttc
                        Sheep  gcctcc---------------ttttgcg---------taag-gcctgcagaaa----------agacttc
                Domestic goat  gcctcc---------------ttttgcg---------taag-gcctgcagaaa----------agacttc
                        Horse  tcctct---------------ctttgct---------tagg-gcctgcggaag----------ggacttc
             White rhinoceros  cccgct----------------tttgca---------taag-gcctgcggaaa----------agacttc
                          Cat  tcttctt--------------ttttgca---------gaag-tcgtgccaaaa----------cgacttc
                          Dog  acctctt--------------tcttaca---------tcga-gcctgcgggaa----------agacttc
                      Ferret   tcctctt--------------tcttgca---------taaa-gcctgcggaaa----------agacttc
                        Panda  tcctctt--------------tcttgca---------taaa-gcctgcataaa----------agacttc
               Pacific walrus  tcctctt--------------tcttgca---------taaa-gcctgcggaaa----------agacttc
                 Weddell seal  tcctctt--------------tcttgca---------taaa-gcctgcggaaa----------agacttc
             Black flying-fox  tcctct---------------ttttgca---------ta-g-gcctgcggaaa----------cgacttc
                      Megabat  tcctct---------------ttttgca---------ta-g-gcctgcggaaa----------cgacttc
                Big brown bat  tcctcc-------------------gca---------ga-g-gcccgcggaga----------cgacttc
         David's myotis (bat)  tcctct-------------------gca---------ga-g-gcccgcggagg----------cgacttc
                     Microbat  tcctct----------------------------------------gcggagg----------cgacttc
                     Hedgehog  gcggcca--------------gtctgcg---------ggaagacctgcgggga----------ggacttc
                        Shrew  tcctctc--------------gctctt----------------tctgcgggag----------gcacttc
              Star-nosed mole  acgcgtc--------------gc-----------------------------g----------agacttc
                     Elephant  tcctct---------------ttttgct---------taag-gcctgcggaag------------acttc
          Cape elephant shrew  gcctct---------------gttggcc---------gaag-gcttccgggcg------------acttc
                      Manatee  tcctct---------------ttttgct---------taag-gcctgcggaag------------acttc
             Cape golden mole  tcccca---------------ttttgca---------taag-gtctgcgggtg------------gcttc
                       Tenrec  tcc-------------------ttggc-------------g-gccagcgcggg------------gcct-
                     Aardvark  tcc--t---------------ttcggcg---------caag-gcctgcggaag------------acttc
                    Armadillo  tccact---------------tgttgct---------taag-gcctgcggggg------------acttc
                      Opossum  atttgc---------------gcttctt---------cccg-gcccctggaagtaggggaagggcacttc
              Tasmanian devil  ttttac---------------gcctgct---------ctcg-gccccggtaagtgggggcggagcacttc
                      Wallaby  ttttac---------------actcgct---------cctg-gcccctggagatagaggcagagcacttc
                     Platypus  gccccc-------------------------------aaac-g---gggggac----------ggacttc
           Tibetan ground jay  ggtgtctggggagg----gtgtccgggg---------cacg-gcc--ggggtg-----------------
           American alligator  cacccccaaaaatgcatcctgtttatta---------caaa-gct--cggtag----------aaacccc
               Naked mole-rat  ======================================================================
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                         Fugu  ======================================================================

                        Human  cgcccatattcaagatggc------tgccca----------gggc-----agtgggaacgggtg--ga--
                        Chimp  cgcccatattcaagatggc------tgccca----------gggc-----agtgggaacgggtg--ga--
                      Gorilla  cgcccgtattcaagatggc------tgccca----------gggc-----agtgggaacgggtg--ga--
                    Orangutan  cgcccatattcaagatggc------cgccca----------gggc-----agtgggaacg---g--ga--
                       Gibbon  cgcccatattcaaggtggc------cgccca----------gggc-----agtgggaacgggtg--ga--
                       Rhesus  cgcccatatccaagatggc------cgacca----------ggac-----agtgagagcgggtg--ga--
          Crab-eating macaque  cgcccatatccaagatggc------cgacca----------ggac-----agtgagagcgggtg--ga--
                       Baboon  cgcccatatccaagatggc------cgacca----------ggac-----agtgagagcgggtg--ga--
                 Green monkey  cgcccatatccaagatggc------cgacca----------ggac-----agtgagagcgggtg--ga--
                     Marmoset  cgcccatatccaagatggc------cgctca----------gggc-----gatgggagttggtg--ga--
              Squirrel monkey  cgcccatgtccaagatggc------cgccca----------gggc-----gatgggagcgggta--ga--
                     Bushbaby  cgcccatacccaagatggc------cgccaa----------agg------atctggagggggca--ga--
           Chinese tree shrew  cgcccacacccaagatggc------cgccaa----------cggc-----ggcgggagcgggtg--gg--
                     Squirrel  cgcccacacccaagatggtcgccaacggcga----------ca-----------ggaaccggtg--ga--
       Lesser Egyptian jerboa  cgcccacactaataatggc------gggagc------------------------gggcgggcg--ga--
                 Prairie vole  cgcccacacccaacatggc------gggtga----------cg-----------agagctggta--ca--
              Chinese hamster  cgcccacacccaatatggc------gggcga----------cg-----------ggagcgggta--ga--
               Golden hamster  cgcccacacccaatatggc------gggcga----------cg-----------ggagcgggta--ga--
                        Mouse  cgcccacacccaatatggc------gggcga----------cg-----------ggagcgggta--ga--
                          Rat  cgcccacacccaatatggc------gggcga----------tg-----------ggagcgggta--ga--
                   Guinea pig  cgcccacacccaagaaggc------cgtcaa----------cgga-----acc-ggggtgggtg--gg--
                   Chinchilla  cgcccacacccaagaaggc------cgtcaa----------caga-----gactggagtgggtg--gg--
             Brush-tailed rat  cgcccacacccaagaaggc------cgtcca----------ctga-----ggc-ggagtgggtg--gg--
                         Pika  cgcccacacgcaacatggc------cgccac----------cagc-----cccgggggcggg--------
                          Pig  cgcccattcccaggatggc------cgccag----------cggc-----gg------------------
                       Alpaca  cgcccactcccaagatggc------caccaa----------cggc-----ggtggg----------ga--
               Bactrian camel  cgcccactcccaagatggc------caccaa----------cggc-----ggtgcg----------gc--
                      Dolphin  cgcccactcccaagatggc------cgccag----------cagc-----ggttcg----------ga--
                 Killer whale  cgcccactcccaagatggc------cgccag----------cagc-----ggttcg----------ga--
             Tibetan antelope  cgcccgctcccaagatggc------caccag----------cacc-----ggttgg----------ga--
                          Cow  cgcccgctcccaagatggc------caccag----------cagc-----ggttgg----------ga--
                        Sheep  cgcccgctcccaagatggc------caccag----------cacc-----ggtt----------------
                Domestic goat  cgcccgctcccaagatggc------caccag----------cacc-----ggttgg----------ga--
                        Horse  cgcccacacccaggatggc------cgccag----------cggc-----ggcgggagcggggg------
             White rhinoceros  cgcccacacccaaaatggc------caccag----------cggc-----ggcggg--------------
                          Cat  cgcccacacccaagatggc------cgccgc----------cggc-----gccgggagcgggga------
                          Dog  cgcccacacccaagatggc------cgccgg----------cggc-----gccgagagaagggg-aga--
                      Ferret   cgcccacacccaagatggc------cgccgg----------cggc-----gccgggaaaggggg--ga--
                        Panda  cgcccacacccaagatggc------cgccgg----------cggc-----gccggaaagggggg--ga--
               Pacific walrus  cgcccacagccaagatggc------cgccgg----------cggc-----gccgagaaggggggaaga--
                 Weddell seal  cgcccacacccaagatggc------cgccgg----------cggc-----gccgggaagggggg-aga--
             Black flying-fox  cgcccacacccaagatggc------tgacaa----------caga-----ggcgcgaacgggga--ga--
                      Megabat  cgcccacacccaagatggc------tgacaa----------caga-----ggcgcgaacgggga--ga--
                Big brown bat  cgcccacacccaagatggc------tgccgg---------------------------------------
         David's myotis (bat)  cgcccacacccaagatggc------cgccgg------------gc-----ggcgcgct---ggg--gc--
                     Microbat  cgcccacacccaagatggc------cgccgg------------gc-----ggcgcgca---ggg--gc--
                     Hedgehog  cgcccgcacccaagatggc------cgctc-----------ctag-----gc----------gg--ga--
                        Shrew  cgcccgcaacagacatgg-------cgccga----------caga-----gct---------gg--ga--
              Star-nosed mole  cgcccgcatccaagatggc------cgcccg----------cgag-----gccc-------ggg--ga--
                     Elephant  cgcccacacccaagatggc------caccgg----------cggctgc--tgcgggagtgggtg--gg--
          Cape elephant shrew  tgcccgcatcaaag-tggc------cgccag----------cggc---------gaggacagtg--gg--
                      Manatee  cgcccacacccaagatggc------caccgg----------cggc-----ggcgggagtgggcg--gg--
             Cape golden mole  cgcccacacccaagatggc------tgccaa----------cggc-----gacagaagtgggca--gg--
                       Tenrec  ---------------tggc------tgc--------------------------------ggcg--gg--
                     Aardvark  cgcccacacccaaaatggc------cgcc-------------------------------cgtg--gg--
                    Armadillo  tgcccatacccaagatggc------cgccca-----------ggc-----aacggaggcgggcg--gg--
                      Opossum  cgcccttacccaacatggc------cgtcaaactacttcagcatc-----gcagtgcttagaaa--ga--
              Tasmanian devil  cgcccttacccaacatggc------cgccacactacttcagggat-----ggggtgcgtgttaa--ga--
                      Wallaby  cgcccttacccaatatggc------caccaaactacttcagggtc-----agggtgtttgggaa--aa--
                     Platypus  cgcccgcactcaagatggc------cgccgg----------cggcttccggtccggcgcgg---------
           Tibetan ground jay  ------tccggggcacggc------cg--------------gggt-----gtccggagcgggag--ca--
           American alligator  ccctcccccatagcaaaat--------------------------------------gtggggg--cagc
               Naked mole-rat  ======================================================================
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                         Fugu  ======================================================================

                        Human  -------------------
                        Chimp  -------------------
                      Gorilla  -------------------
                    Orangutan  -------------------
                       Gibbon  -------------------
                       Rhesus  -------------------
          Crab-eating macaque  -------------------
                       Baboon  -------------------
                 Green monkey  -------------------
                     Marmoset  -------------------
              Squirrel monkey  -------------------
                     Bushbaby  -------------------
           Chinese tree shrew  -------------------
                     Squirrel  -------------------
       Lesser Egyptian jerboa  -------------------
                 Prairie vole  -------------------
              Chinese hamster  -------------------
               Golden hamster  -------------------
                        Mouse  -------------------
                          Rat  -------------------
                   Guinea pig  -------------------
                   Chinchilla  -------------------
             Brush-tailed rat  -------------------
                         Pika  -------------------
                          Pig  -------------------
                       Alpaca  -------------------
               Bactrian camel  -------------------
                      Dolphin  -------------------
                 Killer whale  -------------------
             Tibetan antelope  -------------------
                          Cow  -------------------
                        Sheep  -------------------
                Domestic goat  -------------------
                        Horse  -------------------
             White rhinoceros  -------------------
                          Cat  -------------------
                          Dog  -------------------
                      Ferret   -------------------
                        Panda  -------------------
               Pacific walrus  -------------------
                 Weddell seal  -------------------
             Black flying-fox  -------------------
                      Megabat  -------------------
                Big brown bat  -------------------
         David's myotis (bat)  -------------------
                     Microbat  -------------------
                     Hedgehog  -------------------
                        Shrew  -------------------
              Star-nosed mole  -------------------
                     Elephant  -------------------
          Cape elephant shrew  -------------------
                      Manatee  -------------------
             Cape golden mole  -------------------
                       Tenrec  -------------------
                     Aardvark  -------------------
                    Armadillo  -------------------
                      Opossum  -------------------
              Tasmanian devil  -------------------
                      Wallaby  -------------------
                     Platypus  -------------------
           Tibetan ground jay  ccgctggaacgcaggtgcg
           American alligator  cccctgccccacacttg-g
               Naked mole-rat  ===================
                 Atlantic cod  ===================
                    Tetraodon  ===================
       Yellowbelly pufferfish  ===================
                X. tropicalis  ===================
     Chinese softshell turtle  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
                         Fugu  ===================

Inserts between block 6 and 7 in window
B D                  Opossum 2bp
B D          Tasmanian devil 6bp
B D                  Wallaby 6bp

Alignment block 7 of 713 in window, 64270187 - 64270196, 10 bps 
B D                     Human  gtttcgg---g-at
B D                     Chimp  gtttcgg---g-at
B D                   Gorilla  gtttcgg---g-at
B D                 Orangutan  cttccgg---g-at
B D                    Gibbon  gtttcgg---g-at
B D                    Rhesus  gtttccg---g-gc
B D       Crab-eating macaque  gtttccg---g-gc
B D                    Baboon  gtttcgg---g-gc
B D              Green monkey  gtttcgg---g-gc
B D                  Marmoset  gtgtcgg---g-at
B D           Squirrel monkey  gtttcgg---g-at
B D                  Bushbaby  gcctcaa---g-gc
           Chinese tree shrew  gtctcgg---gaat
B D                  Squirrel  gttc--g---ggat
       Lesser Egyptian jerboa  gttccga---gaat
                 Prairie vole  gttccgg---gaat
B D           Chinese hamster  gttccgg---gaat
               Golden hamster  gttccgg---gaat
B D                     Mouse  gttccgg---g-at
B D                       Rat  attccgg---gaat
B D            Naked mole-rat  gtttagg---gaat
B D                Guinea pig  gttccgg---gaac
                   Chinchilla  gttccgg---gaat
             Brush-tailed rat  gttccag---tgat
B D                       Pig  -------------t
B D                    Alpaca  gcttcgg---c-tt
               Bactrian camel  actttgg---a-tt
B D                   Dolphin  gattcgg---g-at
                 Killer whale  gattcgg---g-at
             Tibetan antelope  gcttc-g---g-tt
B D                       Cow  gcttc-g---g-tt
B D                     Sheep  ------g---g-tt
                Domestic goat  gcttc-g---g-tt
B D                     Horse  -tttcgg---g-gt
B D                       Cat  gtgtcgg---g-ct
B D                       Dog  gtttcgg---g-ac
B D                   Ferret   gtttcgg---g-ct
B D                     Panda  gtttc-g---g-ct
               Pacific walrus  gtttcgg---g-ct
                 Weddell seal  gtttcgg---g-ct
             Black flying-fox  gcttccg---g-aa
B D                   Megabat  gcttccg---g-aa
                Big brown bat  gcttccg------c
         David's myotis (bat)  gcttccg------c
B D                  Microbat  gcttccg------c
B D                  Hedgehog  cttccgg---g-ca
B D                     Shrew  actccgg---g---
              Star-nosed mole  gcttcgg---g-ac
B D                  Elephant  gcctcgg---gaac
          Cape elephant shrew  gctccgg---gcgc
B D                   Manatee  gtttcag---gaac
             Cape golden mole  ttttcaa---gaac
B D                    Tenrec  cttcc---------
                     Aardvark  gtttcgg---gaag
B D                 Armadillo  --ctcgg---gaat
B D                  Platypus  ggccggg---g-gc
           Tibetan ground jay  ggctcgccgt----
B D        American alligator  gtctctc-------
B D                      Pika  --------------
B D          White rhinoceros  --------------
B D              Atlantic cod  ==============
B D                 Tetraodon  ==============
      Yellowbelly pufferfish  ==============
B D             X. tropicalis  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D                   Wallaby  ==============
B D                      Fugu  ==============
B D                   Opossum  ==============
B D           Tasmanian devil  ==============

Alignment block 8 of 713 in window, 64270197 - 64270306, 110 bps 
B D                     Human  gt-ggagc-g------a----------ag----------gtcactggg-ag----gggg----cggagct
B D                     Chimp  gt-ggagc-g------a----------ag----------gtcactggg-ag----gggg----cggagct
B D                   Gorilla  gt-gcagc-g------a----------ag----------gtcactggg-ag----gggg----cggagct
B D                 Orangutan  gt-ggagc-g------a----------ag----------ctcactggg-ag----gggg----cggagct
B D                    Gibbon  at-ggagc-g------a----------ag----------gtcactggg-ag----gggg----cggagct
B D                    Rhesus  gt-ggagc-g------a----------ag----------gtcactggg-ag----ggtg----cggagct
B D       Crab-eating macaque  gt-ggagc-g------a----------ag----------gtcactggg-ag----ggtg----cggagct
B D                    Baboon  gt-ggagc-g------a----------ag----------gtcactggg-ag----gggg----cggagct
B D              Green monkey  gt-ggagc-g------a----------ag----------gtcactggg-ag----gggg----cggagct
B D                  Marmoset  gt-ggagc-g------a----------aa----------gtcactggg-aa----ggag----cggagcc
B D           Squirrel monkey  gt-ggagc-g------a----------ag----------gtcactggg-ag----ggag----cggagcc
B D                  Bushbaby  -------c-g------a----------ag----------gtcactggc-ag----gggg----cggaacc
           Chinese tree shrew  gt-gggac-g------ag---------ag----------gtcactggg-ag----ggaa----cggagcc
B D                  Squirrel  gt-gggga-------------------cg----------gtcactggg-ag----gggg----cggagcc
       Lesser Egyptian jerboa  gt-cagacac------a----------gg----------atcactggg-at----ggag----cggggcc
                 Prairie vole  gt-ggagc-------------------ag----------atcactggg-ag----gggg----tggagcc
B D           Chinese hamster  gt-ggagcag------a----------ag----------atcactgag-ag----gggg----cggagcc
               Golden hamster  gt-ggagcag------a----------ag----------atcattggg-ag----ggag----tggagcc
B D                     Mouse  gt-ggagcag------a----------ag----------atcactggg-ag----gggg----tggagcc
B D                       Rat  gt-ggagc-------------------ag----------atcactggg-ag----ggag----tggagcc
B D            Naked mole-rat  gt-ggggcgg------a----------ag----------ttcactgag-ag----gggg----cggagcc
B D                Guinea pig  gtgggggcgg------a----------ag----------tttactggg-ag----gggg----cggagcc
                   Chinchilla  ga-ggggcgg------a----------ag----------ttcactggg-ag----gggg----cagagcc
             Brush-tailed rat  gt-ggggcgg------a----------ag----------ttcactggg-ag----gggg----gggagcc
B D                      Pika  -----ggc-g------a----------ag----------gtcactgcg-aa----gggg----cggaact
B D                       Pig  gt-ggggcgg------a----------ag----------gtcattggg-ag----gggg----cggggcc
B D                    Alpaca  at-gggacgg------a----------ag----------ttcactggg-ag----gggg----cggagcc
               Bactrian camel  at-gggacgg------a----------ag----------ttcactggg-ag----gggg----cggagcc
B D                   Dolphin  gt-gagacag------a----------ag----------gtcactggg-ag----gggg----cggggcc
                 Killer whale  gt-gggacag------a----------ag----------gtcactggg-ag----gggg----cggggcc
             Tibetan antelope  gc-ggggcgg------a----------cg----------gtcactggg-ag----gggg----cggagcc
B D                       Cow  gc-ggggcgg------a----------ag----------gtcactggg-ag----gggg----cggagcc
B D                     Sheep  gc-ggggcgg------a----------cg----------gtcactgag-ag----gggg----cggagcc
                Domestic goat  gt-ggggcgg------a----------ag----------gtcactggg-ag----gggg----cggagcc
B D                     Horse  gt-ggatgg-------a----------ag----------gtcactggg-ag----gggg----cggagcc
B D          White rhinoceros  ---------------------------ag----------gtcattggg-ag----gggg----cggagcc
B D                       Cat  gt-gggac-------------------gg----------gtcactggg-ag----gggg----cggagcc
B D                       Dog  gc-gggac-------------------gg----------gtcactggg-ac----gggg----cggagcc
B D                   Ferret   gt-gggac-------------------gg----------gtcattggg-ag----gggg----cggagcc
B D                     Panda  gt-gggac-------------------gg----------gtcattggg-ag----gggg----cggagcc
               Pacific walrus  gt-gggac-------------------tg----------gtcattggg-ag----gggg----cggagcc
                 Weddell seal  gt-gggac-------------------tg----------gtcattggg-ag----gggg----cggagcc
             Black flying-fox  gt-gggacgc------a----------ag----------gtcattggg-ag----gggg----cggagcc
B D                   Megabat  gt-gggacgc------a----------ag----------gtcattggg-ag----gggg----cggagcc
                Big brown bat  gt-ggga---------a----------ag----------gtcattggg-ag----gggg----cggagcc
         David's myotis (bat)  gt-gggaaag------a----------ag----------gtcactgga-ag----gggg----cggagcc
B D                  Microbat  gt-gggaaag------a----------ag----------gtcactggg-ag----gggg----cggagcc
B D                  Hedgehog  ga-gcggcggaaaagaa----------aa----------atcactgcg-ag----gggg----cggagcc
B D                     Shrew  -------cgg------a----------ag----------gtcactgcg-ag----gggg----cggggcc
              Star-nosed mole  ga-gggccgg------a----------ag----------gtcactggg-ag----gggg----cggagcc
B D                  Elephant  gt-gggacgt------a----------ag----------gtcactgag-ac----gggg----cggagct
          Cape elephant shrew  gt-ggagcgg------a----------ca----------gtcattggg-ag----gggc----cggagcc
B D                   Manatee  gt-gggacgg------a----------ag----------gtcattgag-ag----gggg----cggagcc
             Cape golden mole  gt-gggaggg------g----------aa----------gtcattggg-ag----gggg----cggagcc
B D                    Tenrec  ---gggcggg------a----------ac----------gtcactggg-ag----gggg----cggagcc
                     Aardvark  gt-gggaccg------a----------aa----------gtcattggg-ag----gggg----cggagcc
B D                 Armadillo  ga-gggac-g------a----------cg----------gtcactggg-ag----gggg----cggagcc
B D                   Opossum  ---------------------------ag----------gttagtggg-aa----ggac----cggcgcc
B D           Tasmanian devil  -----------------aggggtgg--gg----------gtcagtggg-aa----ggac----cgacgct
B D                   Wallaby  -----------------aggggtggaagt----------gtcagtggg-ta----ggac----cagcggc
B D                  Platypus  gt-gacgtca------g----------cg----------gtcactggg-ca----gagc----tggagc-
           Tibetan ground jay  -----------------------------gtccccgcgggtcccggagcggtcgcggcgctcaccggacc
B D        American alligator  ---------------------------------------gtcacgggg-ggccgcgggg-----ggggct
  D           Green seaturtle  ---------------------------gggaggctgca-gtcacttgg-agctcctagg-----gggggc
  D            Painted turtle  ---------------------------gggaagctgcc-gtcatttgg-agctcctggg-----gggggc
B D              Atlantic cod  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                      Fugu  ======================================================================

                        Human  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                        Chimp  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                      Gorilla  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                    Orangutan  tcccctgcccaagttccgatc----ccaccaggattg-gaagactcgcgtccagc---tgg-agctttgc
                       Gibbon  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                       Rhesus  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
          Crab-eating macaque  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                       Baboon  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                 Green monkey  tcccctgcccaagttccgatc----ccaccaggactg-gaagactcgcgtccagc---tgg-agctttgc
                     Marmoset  tcccctgcccaagttcctatc----ccaccaggactg-gatgactcgcgtccagc---tgg-agctttgc
              Squirrel monkey  tcccctgcccaagttccgatc----ccaccaggactg-gatgactcgcgtccagc---tgg-agctttgc
                     Bushbaby  tcccctgcccacgttccgatc----ccaccaggactg-aatgacacgcgtccagc---tgg-agctctgt
           Chinese tree shrew  tcctctccccaaatttcgatc----ccaccaggactg-gaagatgcgcgtccagc---tcg-agctctgc
                     Squirrel  tcgcctccccaagttccgatc----ccaccaggactg-gatgaagcgcgtccagc---tgg-agctttgc
       Lesser Egyptian jerboa  tcctctccccagatttcgatc----ccaccaggactg-gatgatgcgggtccaac---tgg-agctttgc
                 Prairie vole  tcctttgcccaagtttcgatc----ccaccaggattg-gataatacgcgtccagc---tag-cgctttgt
              Chinese hamster  tcctttgcccaagtttcgatc----ccaccaggactg-gataatgcgcgtccagc---tgg-cgctttgt
               Golden hamster  tcctttgcccaagtttcgatc----ccaccaggactg-gataatgcgcgtccagc---tgg-cgctttgt
                        Mouse  tcctttgcccaagtttcgatc----ccaccaggactg-gataatgcgcgtccagc---cgg-cgctttgt
                          Rat  tcctttccccaaatttcgatc----ccaccaggactg-gataatgcgcgtccaac---tgg-cgctttgt
               Naked mole-rat  tcctcttcccaagttccgatc----ccaccaggactg-gatggcgcgtgtccaac---tgg-agctctgc
                   Guinea pig  tcctctccccaagttccgatc----ccaccaggactg-gatggcccgtgtccaat---tag-agttctgc
                   Chinchilla  tcctctccccaagttccgatc----ccaccaggactg-gatggcgcgtgtccagt---tgg-agctctgc
             Brush-tailed rat  tgctctccccaagttccgatc----ccaccaggactg-gatggcgcgtgtccagg---tgg-agctctgc
                         Pika  ccctttgccccgattccgatc----ccaccaggattg-gatgacgcgcgtccaac---tgg-agctttcc
                          Pig  tcctctccccgagttccggta----ccaccaggactg-gaggaagcgcttccagc---tgg-ggctttgc
                       Alpaca  tcctctccccaagttccggcc----ccaccaggactg-gatgaagcgcgtccagc---tgg-gactttgc
               Bactrian camel  gcctctccccaagttccggcc----ccaccaggactg-gatgaagcgcgtccagc---tgg-gactttgc
                      Dolphin  tcctctccccaagttccggtt----ccaccaggactg-aaggaagcgcgtccagc---tgg-ggctttgt
                 Killer whale  tcctctccccaagttccggtt----ccaccaggactg-aaggaagcgcgtccagc---tgg-ggctttgt
             Tibetan antelope  tcctctccccaagttccggct----caaccaggactg-gaggaagcgcgtccagc---tag-ggctttgt
                          Cow  tcctctccccaagttccggct----caaccaggactg-gaggaagcgcgtccagc---tgg-ggctttgt
                        Sheep  tcctctccccaagttccggct----caaccaggactg-gaggaagcgcgtccagc---tag-ggctttgt
                Domestic goat  tcccctccccaagttccggct----caaccaggactg-gaggaagcgcgtccagc---tag-ggctttgt
                        Horse  tcctctccccaagttccgatc----ccaccaggactg-gatggcgcgcgtccagc---tgg-ggctttgc
             White rhinoceros  tcctctcgacgagttccgatc----ccaccaggactg-gatggcgcgcgtccagc---tgg-ggctttgc
                          Cat  tcctctccccaagttccgatc----ccaccaggactg-gatgaagcgcgtccagc---tgg-ggctttgc
                          Dog  tcctctccccaagttccgatc----ccaccaggactg-gatgacgcgcgtccagc---tgg-ggctttgt
                      Ferret   tcctctccccaagttccgatc----ccaccaggactg-gatgacgcgcgtccaac---tgg-ggctctgt
                        Panda  tcctctccccaagttccgatc----ccaccaggactg-gatgacgcgcgtccagc---tgg-ggctttgt
               Pacific walrus  tcctctccccaagttccgatc----ccaccaggactg-gatgacgcgcgtccagc---tgg-ggctttgt
                 Weddell seal  tcctcgccccaagttccaatc----ccaccaggactg-gatgacgcgcgtccagc---tgg-ggctttgt
             Black flying-fox  tcctcttcccaagttccgatc----ccaccaggactg-gaagatgtgcgtccagc---tgg-agttttgc
                      Megabat  tcctcttcccaagttccgatc----ccaccaggactg-gaagatgcgcgtccagc---tgg-agttttgc
                Big brown bat  tcctctccccgagttccgacc----ccaccaggcctg-gaaaaagcgcgtccagc---tgg-agttttgc
         David's myotis (bat)  tcctctccccgagttccgatc----ccaccaggactg-gaaaaagcgcgtccagc---tgg-acttttgc
                     Microbat  tcctctccccgagttccgatc----ccaccaggactg-gaaaaagcgcgtccagc---tgg-acttttgc
                     Hedgehog  tcctctccccaagttccggtc----ccaccacgactg-gaagatgcgcgtccagc---ttg-agctctgc
                        Shrew  tcctttccccacgttgcggtg----ccaccaggactg-gaaggtgcgtgtccagctggtgg-ggctctgg
              Star-nosed mole  tccgcgccccaagttccgatc----ccaccaggactg-aatgatgcgcgtccagc---tgg-ggctttgc
                     Elephant  gcctctccccaaattccgatc----ccaccaggcctg-gatgatgcgtgtccagc---tgg-ggctttgc
          Cape elephant shrew  acctctcccccagttccgatc----ccaccaggactg-gatgacgcgggtccagc---tgg-ggctctgc
                      Manatee  acctctccccaaattccgatc----ccaccaggactg-gatgatgcgtgtccagc---tgg-ggctttgc
             Cape golden mole  acctttccccaaattccgatc----ccaccaggactg-gatgacgtgtgtccagc---tgg-agctctgt
                       Tenrec  tcctcggcccaagttgcgatc----ccaccaggactg-gatgacgcgtgtccagc---tgg-cgctctgc
                     Aardvark  acctctccccaagttccgatc----ccaccaggactg-gataaggcgtgtccagc---tgg-ggcttggt
                    Armadillo  gcctctccccaagttccgatc----ccaccaggattg-gatgatgcgcgtccagc---tgg-gagtctgg
                      Opossum  ccctttccccaaattccgccc----gaaccaagactg-gacggtgcgggtccaac---cgt-ggctccga
              Tasmanian devil  ccctttccccaaattccgccc----gaaccaagactg-gaaggtgcgggtccagc---cat-ggctccga
                      Wallaby  cccttttcccaaattccgagt----gaaccaagactg-taacgtgcgggtccagg---cgt-ggctccga
                     Platypus  --------------tgcgatt----ccaccaggagcg-gaggacgcgggtccagc---ccg-agggtcgc
           Tibetan ground jay  gagctccgggggctgcgggctggggctgcgcgcagtgccaggacccacctgcacc---gctg--------
           American alligator  gggatgggggggccgccgccc----ccaccagccctg-cagggcctccctccagc---ccg---------
              Green seaturtle  atcacgggcaggtctgtgccc----caaccaggcctg-gagagtctctttccagc---tgt-tcccctgg
               Painted turtle  atcacgggcgggtctgtgtcc----caaccaggcctg-gagggtttctttccagc---tgt-tcccccgg
                 Atlantic cod  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
     Chinese softshell turtle  ======================================================================
                         Fugu  ======================================================================

                        Human  cgcatctgcgttgctg
                        Chimp  cgcatctgggttgctg
                      Gorilla  cgcatctgcgttgctg
                    Orangutan  cgcatctgcgttgctg
                       Gibbon  cgcatctgcgttgctg
                       Rhesus  cgcatctgcgtcgctg
          Crab-eating macaque  cgcatctgcgtcgctg
                       Baboon  cgcatctgcgtcgctg
                 Green monkey  cgcatctgcgtcgctg
                     Marmoset  cgcatctgcgttgctg
              Squirrel monkey  cgcatctgcgttgctg
                     Bushbaby  cgcatctgtgtcgctg
           Chinese tree shrew  cgcatctgcgtcgctg
                     Squirrel  cgcatctgcgacgctg
       Lesser Egyptian jerboa  cgcatctgtgtcgccg
                 Prairie vole  cgcatctgtgtggcag
              Chinese hamster  cgcatctgtgttgcag
               Golden hamster  cgcatctgtgttgcag
                        Mouse  cgcatctgtgttgcag
                          Rat  cgcatctgtgttgcag
               Naked mole-rat  cacagcttcgtcgctg
                   Guinea pig  cacagcttcgtcgctg
                   Chinchilla  cacagcttcgtcgctg
             Brush-tailed rat  cacagctttgtcgctg
                         Pika  cgcatctgcatggccg
                          Pig  cgcatctgcgtcgctg
                       Alpaca  cgcatctgtgtcgcgg
               Bactrian camel  cgcatctgtgtcgcgg
                      Dolphin  cgcatctgcgccgctg
                 Killer whale  cgcatctgcgccgctg
             Tibetan antelope  cgcatttgagttgccg
                          Cow  cgcatttgcgttgccg
                        Sheep  cgcatttgcgttgccg
                Domestic goat  cgcatttgcgttgccg
                        Horse  cgcatctgcgtcgctg
             White rhinoceros  tgcatctgcgtcggta
                          Cat  cgcatctgcgtcgctg
                          Dog  cgcatctgcgtcgctg
                      Ferret   cgcatctgcgtggctg
                        Panda  cgcatctgcgtcgctg
               Pacific walrus  cgcatctgcgtcgctg
                 Weddell seal  cgcatctgcgtcgctg
             Black flying-fox  cgcatctgcgtcgctg
                      Megabat  cgcatctgcgtcgctg
                Big brown bat  cgcatctgcgtcgctg
         David's myotis (bat)  cgcatctgcgttgccg
                     Microbat  cacatctgcgttgctg
                     Hedgehog  agcatctgcgtcgcgg
                        Shrew  agcatctgcatggcgg
              Star-nosed mole  cgcatctgcgtcgcgg
                     Elephant  cgcatctgcgttgctg
          Cape elephant shrew  tgcatctgcgtggcgg
                      Manatee  cgcatctgcgttgctg
             Cape golden mole  cgcatctgtatagctg
                       Tenrec  cgcatgtgcgtcgccg
                     Aardvark  tgcatctgcgtcgctg
                    Armadillo  cgcagctgcgtcgccg
                      Opossum  cgcatctggctcgcag
              Tasmanian devil  cgcatctggctcgcag
                      Wallaby  cgcatctggctcgcag
                     Platypus  tgcagctgcgccgcgg
           Tibetan ground jay  ----------------
           American alligator  ----------------
              Green seaturtle  tgcatctgggatgtcg
               Painted turtle  tgcagctgggatgttg
                 Atlantic cod  ================
                    Tetraodon  ================
       Yellowbelly pufferfish  ================
                X. tropicalis  ================
     Chinese softshell turtle  ================
                         Fugu  ================

Alignment block 9 of 713 in window, 64270307 - 64270340, 34 bps 
B D                     Human  tgcccgcgctcttcgggcgaggaagtcccttct-g
B D                     Chimp  tgcccgcgctcttcgggcgaggaagtcccttct-g
B D                   Gorilla  tgcctgcgctcttcgggcgaggaagtcccttct-g
B D                 Orangutan  tgcccgcgctcttcgggcgaggaagtcccttct-g
B D                    Gibbon  tgcccgcgctcttcgggcgaggaagtcccttct-g
B D                    Rhesus  tgcccgcgctcttcgggcgaggaagtcccttccgg
B D       Crab-eating macaque  tgcccgcgctcttcgggcgaggaagtcccttccgg
B D                    Baboon  tgcccgcgctcttcgggcgaggaagtcccttccgg
B D              Green monkey  tgcccgcgctcttcgggcgaggaagtcccttccgg
B D                  Marmoset  tgcccgcgctcttcgggcgaggaagtcccttccgg
B D           Squirrel monkey  tgcccgcgctcttcgggcgaggaagtcccttccgg
B D                  Bushbaby  tgcctgcgctcttcgggcgaggaagtcccttcg-g
           Chinese tree shrew  tgcccgcgctcttcgggcgaggaagtccctttg-g
B D                  Squirrel  tgcctgcgctcctcgggcgaggaagtccctt-ggg
       Lesser Egyptian jerboa  tgcctgcgctctttgggcgaggaagccccttcggg
                 Prairie vole  tcccagcgctctttgggcgaggaagtcccttcagg
B D           Chinese hamster  ttcctgcgctctttgggcgaggaagtcccttcggg
               Golden hamster  tccctgcgctctttgggcgaggaagtcccttcggg
B D                     Mouse  tgcctgcgctctttgggcgaggaagtcccttcagg
B D                       Rat  tgcctgcgctctttgggcgaggaagtcccttcagg
B D            Naked mole-rat  tgcccgcgcttttcgggcgaggaagacccttcggg
B D                Guinea pig  tgcccgcgctcttcgggcgaggaagacccttcggg
                   Chinchilla  tacccgcgctcttcgggcgaggaagacccttcggg
             Brush-tailed rat  tgcccgcgctcttcgggcgaggaagacccttcggg
B D                      Pika  tgcccgcgctcttcgggcgaggaagtcccttcggg
B D                       Pig  tgcccgcgctcttcgggcgaggaagtcccttctgg
B D                    Alpaca  tgccggcgctcttcgggcgagggagtccctttgaa
               Bactrian camel  tgccagcgctcttcgggcgagggagtccctttgaa
B D                   Dolphin  tgcccgcgctgttcgggcgaggaagtcccttcggg
                 Killer whale  tgcccgcgctgttcgggcgaggaagtcccttcggg
             Tibetan antelope  tgcccgcgctcttcgggcgaggaagccccttcagg
B D                       Cow  tgcccgcgctcttcgggcgaggaagccccttcagg
B D                     Sheep  tgcccgcgctcttcgggcgaggaagccccttcagg
                Domestic goat  ttcccgcgctcttcgggcgaggaagccccttcagg
B D                     Horse  tgcccgcgctcttcgggcgaggaagtgccttcggg
B D          White rhinoceros  tgcccgcgctcctcgggcgaggaagtcccttcggg
B D                       Cat  tgcccgcgctcttcgggcgtggaagtcccttcggg
B D                       Dog  tccccgcgctcttcgggcgaggaagtcccttcggg
B D                   Ferret   tgcctgcgctcttcgggcgaggaagccccttc-gg
B D                     Panda  tgcccgcgctcttcgggcgaggaagtcccttcggg
               Pacific walrus  tgcccgcgctcctcgggcgaggaagtcccttcggg
                 Weddell seal  tgcccgcgctcttcgggcgaggaagtcccttcagg
             Black flying-fox  tgcccgcgcttttcgggcgaggaagtcccttcggg
B D                   Megabat  tgcccgcgcttttcgggcgaggaagtcccttcggg
                Big brown bat  tgcctgcgctcttcgggcgagggagtccctgc-gg
         David's myotis (bat)  tgccagcgctcttcgggcgagggagacccttc--g
B D                  Microbat  tgccagcgctcttcgggcgagggagacccttc--g
B D                  Hedgehog  tgcccgcgctcttcgggcggggaagccccttcggg
B D                     Shrew  tgcccgcgctcttcgggcggggaagtcccttcggg
              Star-nosed mole  tgcccgcgctcttcggacgaggaagtcccttcggg
B D                  Elephant  tgcccgcgctcttcgggcgaggaagtcccttcgga
          Cape elephant shrew  agcccaagctcttcgggcgaggaaggccctttgga
B D                   Manatee  tgcccgcgctcttcgggcgaggaagtcccttcgga
             Cape golden mole  tgcccgcgctcttcgggcgaggaagtccctttgga
B D                    Tenrec  taccctcgctcttcgggcgaggaaggcccttcgga
                     Aardvark  tgcccgcgctcttcggtcgaggaagtcccttcgga
B D                 Armadillo  tgcccgcgctcttcggacgaggaagtccct--ggg
B D                   Opossum  tgccggcgctcttcgggcgcggaagtccctgttag
B D           Tasmanian devil  tgcctgcgctcttcgggcggggaagtccctgcagg
B D                   Wallaby  tgctggcgctcttcgggcgaggaagaccctgtggc
B D                  Platypus  tgcccgcgctcttcggccggggcagaccctacag-
B D        American alligator  tgccggcgctccggggccgcggcagcacctggtt-
  D           Green seaturtle  tgcctgcactcttggggcgtggaagcacctggag-
  D            Painted turtle  tgcctgcactcttggggcgtggcagcacctagag-
B D              Atlantic cod  ===================================
B D                 Tetraodon  ===================================
      Yellowbelly pufferfish  ===================================
B D             X. tropicalis  ===================================
  D  Chinese softshell turtle  ===================================
B D                      Fugu  ===================================

Alignment block 10 of 713 in window, 64270341 - 64270351, 11 bps 
B D                     Human  g-t--gg-a---------ggg-aga
B D                     Chimp  g-t--gg-a---------ggg-aga
B D                   Gorilla  g-t--gg-a---------ggg-aga
B D                 Orangutan  g-t--gg-g---------ggg-aga
B D                    Gibbon  g-t--gg-g---------ggg-aga
B D                    Rhesus  g-t--tg-t---------ggg-aga
B D       Crab-eating macaque  g-t--tg-t---------ggg-aga
B D                    Baboon  g-t--tg-t---------ggg-aga
B D              Green monkey  g-t--tg-t---------ggg-aga
B D                  Marmoset  g-t--gt-g---------ggg-aga
B D           Squirrel monkey  g-t--gt-g---------ggg-aga
B D                  Bushbaby  g-a--tg-a---------gag-ggg
           Chinese tree shrew  g-t--tg-g---------ggg-agg
B D                  Squirrel  g-t--gg-g---------agg-agg
       Lesser Egyptian jerboa  g-t--ag-g---------acg-aga
                 Prairie vole  g-a--ag-g---------a------
B D           Chinese hamster  g-a--ag-g---------a-g-agt
               Golden hamster  g-a--ag-g---------a-g-agt
B D                     Mouse  g-a--ag-g---------agg-agg
B D                       Rat  g-a--ag-g---------agg-agg
B D            Naked mole-rat  g-a--tgag---------aag-agg
B D                Guinea pig  g-g--tgag---------aaa-agg
                   Chinchilla  g-g--tgac---------aag-agg
             Brush-tailed rat  g-g--tgac---------aag-agg
B D                      Pika  g-c--gg-a---------gag-gga
B D                       Pig  g-t--gg-g---------agg-agg
B D                    Alpaca  g-t--gg-g---------agg-agg
               Bactrian camel  g-t--gg-g---------agg-agg
B D                   Dolphin  g-t--gg-g---------agg-agg
                 Killer whale  g-t--gg-g---------agg-agg
             Tibetan antelope  g-t--gg-g---------aag-aag
B D                       Cow  g-t--gg-g---------aag-aag
B D                     Sheep  g-t--gg-g---------aag-aag
                Domestic goat  g-t--gg-g---------aag-aag
B D                     Horse  g-t--gg-g---------agg-agg
B D          White rhinoceros  g-t--gg-g---------agg-agg
B D                       Cat  g-t--gg-g---------agg-agg
B D                       Dog  g-t--gg-g---------agg-agg
B D                   Ferret   g-t--gg-g---------aag-ag-
B D                     Panda  a-t--gg-g---------agg-agg
               Pacific walrus  g-c--gg-g---------agg-agg
                 Weddell seal  g-t--gg-g---------agg-agg
             Black flying-fox  g-t--gg-g---------agg-agg
B D                   Megabat  g-t--gg-g---------agg-agg
                Big brown bat  g-t--gg-g---------aag-atg
         David's myotis (bat)  g-t--gg-g---------aag-acg
B D                  Microbat  g-t--gg-g---------aag-acg
B D                  Hedgehog  g-t--tt-g---------aga-agg
B D                     Shrew  a-t--gg-c---------agg-agg
              Star-nosed mole  g-t--gg-g---------agg-agg
B D                  Elephant  g-t--ag-g---------gag-acg
          Cape elephant shrew  g-g--gg-g---------gag---g
B D                   Manatee  gtg--gg-g---------gag---g
             Cape golden mole  g-t--gg-g---------ggggagg
B D                    Tenrec  g-c--gg-g---------gag----
                     Aardvark  g-----------------aag---g
B D                 Armadillo  g-c--ag-g---------gag---g
B D                   Opossum  a-g--gt-gta-------aag-agc
B D           Tasmanian devil  g-gacgg-gagagaaaacaag-agc
B D                   Wallaby  g-g--gg-gcgggaagatgag-agg
B D        American alligator  g-g--gg-a---------ggg-aga
  D           Green seaturtle  g-g--gg-a---------ggg-aga
  D            Painted turtle  g-a--gg-a---------ggg-aga
B D              Atlantic cod  =========================
B D                 Tetraodon  =========================
      Yellowbelly pufferfish  =========================
B D             X. tropicalis  =========================
  D  Chinese softshell turtle  =========================
B D                  Platypus  -------------------------
B D                      Fugu  =========================

Inserts between block 10 and 11 in window
B D                  Megabat 1bp
B D       American alligator 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 586bp

Alignment block 11 of 713 in window, 64270352 - 64270353, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  aa
B D                  Squirrel  aa
       Lesser Egyptian jerboa  ga
                 Prairie vole  aa
B D           Chinese hamster  aa
               Golden hamster  ta
B D                     Mouse  aa
B D                       Rat  aa
B D            Naked mole-rat  ag
B D                Guinea pig  ga
                   Chinchilla  ga
             Brush-tailed rat  ga
B D                      Pika  ga
B D                       Pig  aa
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  aa
                 Killer whale  aa
             Tibetan antelope  aa
B D                       Cow  aa
B D                     Sheep  aa
                Domestic goat  aa
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  aa
B D                       Dog  aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  aa
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                  Hedgehog  aa
B D                     Shrew  aa
              Star-nosed mole  aa
B D                  Elephant  ga
          Cape elephant shrew  ta
B D                   Manatee  ga
             Cape golden mole  ca
                     Aardvark  ca
B D                 Armadillo  aa
B D                   Opossum  aa
B D           Tasmanian devil  ca
B D                   Wallaby  at
B D        American alligator  -g
  D           Green seaturtle  -a
B D                    Tenrec  --
B D                   Ferret   --
B D              Atlantic cod  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                  Platypus  --
B D                      Fugu  ==

Inserts between block 11 and 12 in window
  D          Green seaturtle 577bp

Alignment block 12 of 713 in window, 64270354 - 64270362, 9 bps 
B D                     Human  aggg---------ttaca
B D                     Chimp  aggg---------ttaca
B D                   Gorilla  aggg---------ttaca
B D                 Orangutan  agga---------ttaca
B D                    Gibbon  acgg---------ttaca
B D                    Rhesus  agag---------ttaca
B D       Crab-eating macaque  agag---------ttaca
B D                    Baboon  aggg---------ttaca
B D              Green monkey  aggg---------ttaca
B D                  Marmoset  aggg---------ttaca
B D           Squirrel monkey  aggg---------ttaca
B D                  Bushbaby  aggg---------ctaat
           Chinese tree shrew  aggg---------ttaaa
B D                  Squirrel  aagg--------attaaa
       Lesser Egyptian jerboa  aggg---------ttaaa
                 Prairie vole  agag---------ttgta
B D           Chinese hamster  agag---------ttaaa
               Golden hamster  agag---------tta--
B D                     Mouse  ag----------------
B D                       Rat  ag----------------
B D            Naked mole-rat  a-------------taag
B D                Guinea pig  aagt---------ttaag
                   Chinchilla  aggt---------ttaag
             Brush-tailed rat  aggt---------ttaag
B D                      Pika  agag---------atcag
B D                       Pig  aggt---------taaa-
B D                    Alpaca  aggg---------ttaag
               Bactrian camel  aggg---------ttaag
B D                   Dolphin  aggg---------ttatg
                 Killer whale  aggg---------ttatg
             Tibetan antelope  aggg---------tagaa
B D                       Cow  aagg---------tagaa
B D                     Sheep  aggg---------tagaa
                Domestic goat  aggg---------tagaa
B D                     Horse  agga---------ttaaa
B D          White rhinoceros  aggg---------ttaaa
B D                       Cat  aggg---------ttaca
B D                       Dog  aggg---------ttaaa
B D                   Ferret   aggg---------ttaaa
B D                     Panda  aggg---------ttaaa
               Pacific walrus  aggg---------ttaaa
                 Weddell seal  aggg---------ttaaa
             Black flying-fox  aaaa---------ttaag
B D                   Megabat  aaaa---------ttaag
                Big brown bat  aggg---------ctgtg
         David's myotis (bat)  gggg---------ttaga
B D                  Microbat  aggg---------ttaga
B D                  Hedgehog  aggg--------------
B D                     Shrew  agggagagaaggcaggaa
              Star-nosed mole  aggg---------ttgag
B D                  Elephant  aggg---------ttaaa
          Cape elephant shrew  aggg---------t---g
B D                   Manatee  aggg---------ttaaa
             Cape golden mole  aggg---------ttaaa
B D                    Tenrec  ---------------aga
                     Aardvark  aggg---------tgaaa
B D                 Armadillo  aggg---------ttaaa
B D                   Opossum  aggc---------ttc--
B D           Tasmanian devil  agac---------tta--
B D                   Wallaby  aaga---------tta--
B D        American alligator  gggg---------acaca
B D              Atlantic cod  ==================
B D                 Tetraodon  ==================
      Yellowbelly pufferfish  ==================
B D             X. tropicalis  ==================
  D  Chinese softshell turtle  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D                  Platypus  ------------------
B D                      Fugu  ==================

Inserts between block 12 and 13 in window
B D                  Opossum 56bp
B D          Tasmanian devil 18bp
B D                  Wallaby 203bp
B D       American alligator 34bp

Alignment block 13 of 713 in window, 64270363 - 64270374, 12 bps 
B D                     Human  --------tgagttag--a-tta
B D                     Chimp  --------tgagttag--a-tta
B D                   Gorilla  --------tgagttag--a-tta
B D                 Orangutan  --------tgagttag--a-tta
B D                    Gibbon  --------tgagttag--a-tta
B D                    Rhesus  --------tgagttag--a-tta
B D       Crab-eating macaque  --------tgagttag--a-tta
B D                    Baboon  --------tgagttag--a-tta
B D              Green monkey  --------tgagttag--a-tta
B D                  Marmoset  --------tgagttag--a-tta
B D           Squirrel monkey  --------tgagttag--a-tta
B D                  Bushbaby  --------tgaattag--a-tta
           Chinese tree shrew  --------ccagttag--c-gca
B D                  Squirrel  --------ttaatcgg--c-tta
       Lesser Egyptian jerboa  --------tgagttaa--cgtta
                 Prairie vole  --------tgagcgag--cctta
B D           Chinese hamster  --------tgaatgag--cctcg
               Golden hamster  ----------aatgag--cctca
B D                     Mouse  ----------agtgag--cctca
B D                       Rat  ----------agtgag--cctca
B D            Naked mole-rat  --------tatgttag--c-tta
B D                Guinea pig  --------tgtgttag--c-tta
                   Chinchilla  --------tgcgttag--c-tta
             Brush-tailed rat  --------tgtgttag--c-tca
B D                      Pika  --------cgagttgc--t-ttt
B D                    Alpaca  --------tgaattag--t-tta
               Bactrian camel  --------tgaattag--c-tta
B D                   Dolphin  --------tgaattag--c-tta
                 Killer whale  --------tgaattag--c-tta
             Tibetan antelope  --------tgaattag--c-tta
B D                       Cow  --------tgaattag--c-tta
B D                     Sheep  --------tgaattag--c-tta
                Domestic goat  --------tgaattag--c-tta
B D                     Horse  --------tacgttag--c-gtc
B D          White rhinoceros  --------taagtgag--c-ttc
B D                       Cat  --------tgagttag--c-ttc
B D                       Dog  --------tgagttag--c-ttg
B D                   Ferret   --------tgagttag--c-ctg
B D                     Panda  --------cgagttag--c-tcg
               Pacific walrus  --------tgagttag--c-ttg
                 Weddell seal  --------tgagttag--c-ttg
             Black flying-fox  --------tgagttagctt-tta
B D                   Megabat  --------tgagttagctt-tta
                Big brown bat  --------tgagttag-------
         David's myotis (bat)  --------tgagttag-------
B D                  Microbat  --------tgagttag-------
B D                  Hedgehog  --------ttagcaga--g-tta
B D                     Shrew  --------taagcgga--c-gct
              Star-nosed mole  --------tgagt-----c-gcc
B D                  Elephant  --------agagct-------ca
          Cape elephant shrew  --------agagctgg--g-cca
B D                   Manatee  --------agagttag--c-tca
             Cape golden mole  --------agggttac--g-tca
B D                    Tenrec  --------agggccag--c-tag
                     Aardvark  --------aaagttag--g-cc-
B D                 Armadillo  --------ggcgttag--c-tcg
B D        American alligator  gtggctactg-------------
B D                       Pig  -----------------------
B D              Atlantic cod  =======================
B D                 Tetraodon  =======================
      Yellowbelly pufferfish  =======================
B D             X. tropicalis  =======================
  D  Chinese softshell turtle  =======================
  D            Painted turtle  =======================
  D           Green seaturtle  =======================
B D                  Platypus  -----------------------
B D                   Wallaby  =======================
B D                      Fugu  =======================
B D                   Opossum  =======================
B D           Tasmanian devil  =======================

Alignment block 14 of 713 in window, 64270375 - 64270399, 25 bps 
B D                     Human  cc--atg--------gcag----ctcgagcc-agg-------ct-ctc
B D                     Chimp  cc--atg--------gcag----ctcgagcc-agg-------ct-ctc
B D                   Gorilla  cc--atg--------gcag----ctcgagcc-agg-------ct-ctc
B D                 Orangutan  cc--aag--------gcag----ctggagcc-agg-------ct-ctc
B D                    Gibbon  cc--atg--------gcag----ctcgagcc-agg-------ct-ctc
B D                    Rhesus  cc--atg--------gcag----ctggtgcc-agg-------ct-ctc
B D       Crab-eating macaque  cc--atg--------gcag----ctggtgcc-agg-------ct-ctc
B D                    Baboon  cc--atg--------gcag----ctggtgcc-agg-------ct-ctc
B D              Green monkey  cc--atg--------gcag----ctggtgcc-agg-------ct-ctc
B D                  Marmoset  cc--agg--------gcgg----ctcgagcc-ata-------cc-gtc
B D           Squirrel monkey  cc--agg--------gcgg----ctggagcc-aga-------cc-gtc
B D                  Bushbaby  cc--ctg--------gcag----ctagagcc-agg-------cc---c
           Chinese tree shrew  gc--ctg--------gcgg----ctcgagcc-acg-------cccctc
B D                  Squirrel  cc--cag--------gcgg----atcgaatc-aag-------ta-c-c
       Lesser Egyptian jerboa  tt--cgg--------atgg----ccggaatc-aag-------tc-c--
                 Prairie vole  cc--ctg--------gcat----cccgaa-c-aag-------tc-c-c
B D           Chinese hamster  cc--ctg--------tggt----cccgaatc-aac-------tc-c-c
               Golden hamster  ca--ctg--------tcgt----cccgaatc-aag-------tc-c-c
B D                     Mouse  tt--ctg--------gcat----cccgaatc-agg-------tc-c-c
B D                       Rat  ct--cta--------gcgt----cccgaatc-agg-------tt-c-c
B D            Naked mole-rat  cc--ctg--------g-------ctcgaatc-tgg-------cc-c-c
B D                Guinea pig  ct--ctg--------g-------ctggaatc-ggg-------gt-c-t
                   Chinchilla  tc--ctg--------g-------ctcgaatc-agg-------gc-c-c
             Brush-tailed rat  tc--ctg--------g-------cttgaatc-aag-------gc-c-c
B D                      Pika  cc--ctg--------gcgt----ctgctgtc-ggg-------gc-c-c
B D                       Pig  -----------------------------------------------t
B D                    Alpaca  -c--ctg--------gcag----cccaagtc-agg-------cc-c-c
               Bactrian camel  tc--ctg--------gcag----cccaagtc-agg-------cc-c-c
B D                   Dolphin  tc--ctg--------gcac----ctcgagcc-tgg-------cc-c-c
                 Killer whale  tc--ctg--------gcac----ctcgagcc-tgg-------cc-c-c
             Tibetan antelope  tc--ctg--------gcag----cctgaatcaagg-------cc-c-c
B D                       Cow  tc--ctg--------gcag----cccgaagcaagg-------cc-c-c
B D                     Sheep  tc--ctg--------gcag----tctgaatcaagg-------cc-c-c
                Domestic goat  tc--ctg--------gcag----cctgaatcaagg-------cc-c-c
B D          White rhinoceros  tt--ttg--------g--------------------------gc-c-c
B D                       Cat  tc--ctg--------acat----cccgagtc-ggg-------gc-c-c
B D                       Dog  tt--ctg--------gcag----cgcgagtc-gga-------gc-c-c
B D                   Ferret   tc--gtg--------gcag----cccaagtc-gga-------gc-c-c
B D                     Panda  tc--ctg--------gaat----cccaagtc-gca-------gc-c-c
               Pacific walrus  cc--ctg--------gcag----cccgagtc-gga-------gc-c-c
                 Weddell seal  tc--ctg--------gcag----cccgagtc-gga-------gc-c-c
             Black flying-fox  tc--ctg--------gcag----cccgagtc-agg-------gg-c-c
B D                   Megabat  tc--ctg--------gcag----cccgagtc-agg-------gg-c-c
                Big brown bat  ------------------------------c-agg-------gt-c-c
         David's myotis (bat)  ------------------------------c-a-g-------gc-c-c
B D                  Microbat  ------------------------------c-agg-------gc-c-c
B D                  Hedgehog  tc--ctg------------------------------------t-c-c
B D                     Shrew  tccactg--------c-----------ggac-tcg--------c-g-c
              Star-nosed mole  tc--ctg--------c-----------tgtc-agg-------tc-c-t
B D                  Elephant  cc--cgg--------gtgg----ccagcttc-gga-------------
          Cape elephant shrew  tc--ggg--------gcaggactcaggctca-gac-------------
B D                   Manatee  cc--cgg--------gtgg----cagcttcc-gga-------------
             Cape golden mole  ct--cgg--------gtag----ctggctcc-aga-----cc------
B D                    Tenrec  ct--cagcgggcgtcggag----ccgggtcc-gg-------c------
                     Aardvark  tc--tgg--------gcgg----ctggagcc-aggcccctcc------
B D                 Armadillo  ca--ggg--------gcag----acaaagtc-gag-gccctc------
B D                   Opossum  tt--ctg--------gtcg----cc-----------------------
B D           Tasmanian devil  ga--gcg--------ttcgt---cc-----------------------
B D        American alligator  ----ctg--------ggataggacaggaccc-tg--------------
B D                     Horse  ------------------------------------------------
B D              Atlantic cod  ================================================
B D                 Tetraodon  ================================================
      Yellowbelly pufferfish  ================================================
B D             X. tropicalis  ================================================
  D  Chinese softshell turtle  ================================================
  D            Painted turtle  ================================================
  D           Green seaturtle  ================================================
B D                  Platypus  ------------------------------------------------
B D                   Wallaby  ================================================
B D                      Fugu  ================================================

Inserts between block 14 and 15 in window
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 3bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 322bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                     Pika 3bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp

Alignment block 15 of 713 in window, 64270400 - 64270417, 18 bps 
B D                     Human  cacttccgtg----agccttcc
B D                     Chimp  cacttccgtg----agccttcc
B D                   Gorilla  cacttccgtg----agccttcc
B D                 Orangutan  cacttccgta----agccttcc
B D                    Gibbon  cacttccgtg----agccttcc
B D                    Rhesus  cacttccgtg----agccttcc
B D       Crab-eating macaque  cacttccgtg----agccttcc
B D                    Baboon  cacttccgtg----agccttcc
B D              Green monkey  cacttccgtg----agccttcc
B D                  Marmoset  cacttccgtg----acccctcc
B D           Squirrel monkey  cacttccgtg----acccctcc
B D                  Bushbaby  cattt-----------------
           Chinese tree shrew  cacttccgga----ctcccgcc
B D                  Squirrel  catttccgga----acccagtg
       Lesser Egyptian jerboa  catc----aa----gcccgaag
                 Prairie vole  cat-------------------
B D           Chinese hamster  cat-------------------
B D            Naked mole-rat  catttccaga----atcccagc
B D                Guinea pig  catgtccgaa----gtcccagc
                   Chinchilla  tatttccaga----gtcccagg
             Brush-tailed rat  cattaccaga----atcctagc
B D                      Pika  cacttccgga----atcccac-
B D                       Pig  tgcttccgga----atcctacc
B D                    Alpaca  tacttctgga----atcccacc
               Bactrian camel  cacttctgga----atcccacc
B D                   Dolphin  cgcttccgga----atcccacc
                 Killer whale  cgcttccgga----atcccacc
             Tibetan antelope  cgcttacaga----atcccacc
B D                       Cow  cgcttacgga----atcccacc
B D                     Sheep  cgcttacaga----atcccacc
                Domestic goat  cgcttacaga----atcccacc
B D          White rhinoceros  cacttctgga----atcccacc
B D                       Cat  cacctccgga----atcccacc
B D                       Dog  ctcctccggg----accccgcc
B D                   Ferret   cacctctgaa----at-ccacc
B D                     Panda  cacctccgga----atcccacc
               Pacific walrus  cacctccgga----atcccacc
                 Weddell seal  cacctccgga----atcccacc
             Black flying-fox  cacttccaga----atcctagc
B D                   Megabat  cacttccaga----atcctagc
                Big brown bat  ca-ttccgga----atcccatc
         David's myotis (bat)  ca-ctccgga----agcccatc
B D                  Microbat  ca-ttccgga----agcccatc
B D                  Hedgehog  cggcttctag------------
B D                     Shrew  cgggcccaag----actacgtt
              Star-nosed mole  cacttccgcg----atccctcc
B D                  Elephant  --------------atccgacc
          Cape elephant shrew  --------------atcccacc
B D                   Manatee  --------------atccgacc
             Cape golden mole  cgctaccgg-----aggcgacc
B D                    Tenrec  agcgtccggaaggcaggcgccc
                     Aardvark  agcttccaga----acccgacc
B D                 Armadillo  cacttccgtc----atccgact
B D                   Opossum  cacttcct------ggcccgtc
B D           Tasmanian devil  cgcctccc------acccgact
B D        American alligator  gacacctggg----ttctctcc
B D                     Mouse  ======================
B D                       Rat  ======================
              Golden hamster  ======================
B D                     Horse  ----------------------
B D              Atlantic cod  ======================
B D                 Tetraodon  ======================
      Yellowbelly pufferfish  ======================
B D             X. tropicalis  ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
  D           Green seaturtle  ======================
B D                  Platypus  ----------------------
B D                   Wallaby  ======================
B D                      Fugu  ======================

Inserts between block 15 and 16 in window
B D                  Opossum 2bp
B D          Tasmanian devil 130bp

Alignment block 16 of 713 in window, 64270418 - 64270434, 17 bps 
B D                     Human  tctaagtgaga-tcg-ggg
B D                     Chimp  tctaagtgaga-tcg-ggg
B D                   Gorilla  tctaagtgaga-tcg-ggg
B D                 Orangutan  tctaagtgaga-tcg-ggg
B D                    Gibbon  tctaagtgaga-tcgtggg
B D                    Rhesus  tctaactgaga-tc--ggg
B D       Crab-eating macaque  tctaactgaga-tc--ggg
B D                    Baboon  tctaagtgaga-tc--ggg
B D              Green monkey  tctaagtgaga-tc--ggg
B D                  Marmoset  tc----tgaga-tg--ggg
B D           Squirrel monkey  tc----tgaga-tc--cgg
B D                  Bushbaby  -----gtgaga-tc--tcg
           Chinese tree shrew  cc----tgaga-tcc-ggg
B D                  Squirrel  t--agaggaga-tcc-ggg
       Lesser Egyptian jerboa  t----cggatc-tca-aag
                 Prairie vole  ---------tc-tga-gtt
B D           Chinese hamster  ------------tga-gtt
B D            Naked mole-rat  tccaagtgaga-ccc-tcg
B D                Guinea pig  tccaagtgaga-ccc-tcg
                   Chinchilla  tctaagtgaga-ccc-tcg
             Brush-tailed rat  tccaagtcaga-ccc-tcg
B D                       Pig  gctaagtgagactcc-ccg
B D                    Alpaca  gctaagtgaaa-ttc-cgg
               Bactrian camel  gctaagtgaaa-ttc-cgg
B D                   Dolphin  gccaagtgaga-tca-cgg
                 Killer whale  gccaagtgaga-tca-cgg
             Tibetan antelope  accaagtgaga-tcc-cac
B D                       Cow  accaagtgaga-tct-ggg
B D                     Sheep  accaagtgaga-tcc-cac
                Domestic goat  accaagtgaga-tcc-cac
B D                     Horse  ------------tcc-cgg
B D          White rhinoceros  tctacgtgaga-tcc-cgg
B D                       Cat  gc----tgaga-ag--cgg
B D                       Dog  gctaagtgaga-cgc-cgg
B D                   Ferret   gc----tgaga-tgc-ccg
B D                     Panda  gcgaattgaga-tgc-cgg
               Pacific walrus  gctaagtgaga-tgc-cgg
                 Weddell seal  gctaagtgaga-tgc-cgg
             Black flying-fox  tctaagtgaga-agc-cgg
B D                   Megabat  tctaagtgaga-agc-cgg
                Big brown bat  tctaagt------------
         David's myotis (bat)  tctg---------------
B D                  Microbat  tctaaga------------
B D                  Hedgehog  ----tgcgagc-cctgcgc
B D                     Shrew  tcccagagtgg-ccagcgc
              Star-nosed mole  gctcagtgggc-cccgggg
B D                  Elephant  tctgcatgagc-ccc-cac
          Cape elephant shrew  tctgcacgagc-ccc-ggg
B D                   Manatee  tctgcgtgagc-tcc-cgg
             Cape golden mole  actgcctgagc-tcc-cgg
B D                    Tenrec  tcggcctgagg-acc-tgg
                     Aardvark  tgtgcatgacc-tcc-ctg
B D                 Armadillo  tc----caaga-tcc-caa
B D                   Opossum  cctttctcaga-cct-tcg
B D        American alligator  ------acagc-tct-ggg
B D                      Pika  -------------------
B D                     Mouse  ===================
B D                       Rat  ===================
              Golden hamster  ===================
B D              Atlantic cod  ===================
B D                 Tetraodon  ===================
      Yellowbelly pufferfish  ===================
B D             X. tropicalis  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D                  Platypus  -------------------
B D                   Wallaby  ===================
B D                      Fugu  ===================
B D           Tasmanian devil  ===================

Inserts between block 16 and 17 in window
         Cape elephant shrew 124bp
                    Aardvark 2bp

Alignment block 17 of 713 in window, 64270435 - 64270479, 45 bps 
B D                     Human  g--ggagata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggc-
B D                     Chimp  g--ggagata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggc-
B D                   Gorilla  g--ggagaca---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggc-
B D                 Orangutan  g--gaagata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggc-
B D                    Gibbon  g--gcggata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggc-
B D                    Rhesus  g--ggagata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggt-
B D       Crab-eating macaque  g--ggagata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggt-
B D                    Baboon  g--ggagata---a-t-gaagg--ccacaact-ccc-aggaggctccacgccgggt-
B D              Green monkey  g--ggagata---a-t-gaagt--ccacaact-ccc-aggaggctccacgccgggt-
B D                  Marmoset  ggcgcagata---a-t-gaagg--ccacaact-tcc-agcaggcttcacgctgggt-
B D           Squirrel monkey  g--ggagata---a-t-gaagg--ccacaact-tcc-agcaggcttcaggctgggt-
B D                  Bushbaby  a--ggcaata---a-t-caaga--ccataacg-gcc-----tgccctacactgggt-
           Chinese tree shrew  g--agagaag---a-t-aaaag----accagg-gcc-gggcactcctaaactcggt-
B D                  Squirrel  g--aga---t---g-taaaaga--ccacggcc-tcc-agcatgtcctgtaccgaat-
       Lesser Egyptian jerboa  g--gat---t---a-c-aaaga--ccacagcc-acc-tgctggcactgtactgaga-
                 Prairie vole  g--gaa---t---a-t-aaaga--ccaccgcc-acc-agcttgctctgaactgggc-
B D           Chinese hamster  g--gaa---t---a-t-aaaga--tcactgcc-ac----------ctacacttgga-
               Golden hamster  -------------------aga--tcactgcc-acc-agcctgctctacactgggc-
B D                     Mouse  -----------------------------acc-acc-agcttgctctgcactgggc-
B D            Naked mole-rat  g--ggagagg---a-t-gaaga--cga--gtt-tcc-aggatg--------------
B D                Guinea pig  g--gga---a---a-t-gaaga--cta--gtt-tcc-aacctgccctgtaccaagt-
                   Chinchilla  g--gga---a---a-t-gaaga--ccc--gtt-tcc-agcatgccctgtactaaat-
             Brush-tailed rat  g--gga---g---a-t-gaaga--cca--gtt-tcc-agcatgccctgtaataaat-
B D                      Pika  ---------t---a-t-taaga-------gct-ccc-aagatgccttgcgcctcgg-
B D                       Pig  g--gga---g---a-t-aaagg--ccgtagct-ccc-agcaggccctgtaccgagg-
B D                    Alpaca  g--gga---g---a-t-aaaga--t-------------------cctgtaccgagg-
               Bactrian camel  g--gga---g---a-t-aaaga--t-------------------cctgtaccgagg-
B D                   Dolphin  g--gga---g---a-t-aaaga--caatag-t-gcc-agcaggccctgtaccgaga-
                 Killer whale  g--gga---g---a-t-aaaga--caatag-t-gcc-agcaggccctgtaccgaga-
             Tibetan antelope  a--gga---g---c-tgaaaga--tcgtagat-cct-aacgggactcgtacggaga-
B D                       Cow  a--gga---g---a-taaaaga--gcgtagat-cct-aacaggccttgtatggaga-
B D                     Sheep  a--gga---g---a-taaaaga--ccgtagat-cct-aacaggacccgtacggaga-
                Domestic goat  a--gga---g---a-taaaaga--ccgtagat-cct-aacaggactcgtacggaga-
B D                     Horse  g--gag---a---t-a-aaaga--ccacagct-ccc-ggcatgcactgtac------
B D          White rhinoceros  g--aag---a---t---aaaga--cca--------c-ggcatgccctatcccgcgg-
B D                       Cat  c--gga---c---c-t-acaga--ccgtagat-ttc-agcatgccgtgtaccgagg-
B D                       Dog  c--cgg---ccgac-c-aaaga--ccgtagct-ccc-agcatgccctgcaccgagg-
B D                   Ferret   g--ggc---c---c-t-aaaccatacatagct-ccc-cgcatgccctgta-cgagt-
B D                     Panda  c--gga---c---c-t-aaaga--ccgtagct-ccc-agcataccttgtaccaagg-
               Pacific walrus  c--gga---c---c-t-aaaga--ccatagct-ccc-ggcatgccctctaccgagg-
                 Weddell seal  c--gga---c---c-t-aaaca--ccatagctcccc-ggcatgccctgtaccgagg-
             Black flying-fox  g--gaa---a---g-c-aaaga--ccacagct-ccc-agcatcccctttgccgggg-
B D                   Megabat  a--gaa---a---g-c-aaaga--ccacaact-ccc-agcatcccctttgccgggg-
                Big brown bat  -----------------aaaga--ccacggct-ccc-agcatgccccgtaccaaag-
         David's myotis (bat)  -----------------agaga--caacgg-c-ccc-agcatgccctgttccgagg-
B D                  Microbat  ---------------t-agaga--ccacggcc-ccc-agcatgccccgtaccgagg-
B D                  Hedgehog  c--gag---g---g-c-gccga--gggcgtcg-c-----------------------
B D                     Shrew  c--ggg---g---gtc-cccga--ccgctttc-cc-------------------gg-
              Star-nosed mole  c--ggg---g---g-c-aaagg--ccacagct-ct-------------------gg-
B D                  Elephant  g--ggagatc---c-t-agagc--cctcagct-ccc-ag---agtgaacgccgggc-
B D                   Manatee  g--ggaaacc---a-t-ggagc--cctcagct-ccc-agcacaccctatgctgaat-
             Cape golden mole  g--ggagagg---a-c-ggagc--cctcggct-gcgc--------------------
B D                    Tenrec  g--ggagagg---g-c----gc--ctgccgcc-gag---------------------
                     Aardvark  g--gaagaac---t-taagagc--cctcagat-tcccagcacgccctgtactgagt-
B D                 Armadillo  g--ggaaata---a-c-agaga--cacgagct-cgc-agcgtgccctgggccgagt-
B D                   Opossum  g--gaa---c---g-c-cgcga--ctacaaag-acc-aacatgccccgcggc-----
B D        American alligator  -------------------------------------agaagagtggggtccaagtg
         Cape elephant shrew  =========================================================
B D                       Rat  =========================================================
B D              Atlantic cod  =========================================================
B D                 Tetraodon  =========================================================
      Yellowbelly pufferfish  =========================================================
B D             X. tropicalis  =========================================================
  D  Chinese softshell turtle  =========================================================
  D            Painted turtle  =========================================================
  D           Green seaturtle  =========================================================
B D                  Platypus  ---------------------------------------------------------
B D                   Wallaby  =========================================================
B D                      Fugu  =========================================================
B D           Tasmanian devil  =========================================================

Inserts between block 17 and 18 in window
B D                    Horse 14bp
B D                 Elephant 176bp
B D                  Opossum 1bp

Alignment block 18 of 713 in window, 64270480 - 64270481, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  gg
B D                  Squirrel  gg
       Lesser Egyptian jerboa  gg
                 Prairie vole  gg
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                Guinea pig  gg
                   Chinchilla  gg
             Brush-tailed rat  ga
B D                      Pika  gg
B D                       Pig  gt
B D                    Alpaca  gg
               Bactrian camel  gg
             Tibetan antelope  ga
B D                       Cow  gg
B D                     Sheep  ga
                Domestic goat  ga
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  ga
                 Weddell seal  gg
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  gg
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                     Shrew  ga
              Star-nosed mole  ga
B D                   Manatee  gg
             Cape golden mole  gg
B D                    Tenrec  gg
                     Aardvark  gg
B D                 Armadillo  ag
B D                   Opossum  g-
B D        American alligator  gg
         Cape elephant shrew  ==
B D                  Hedgehog  --
B D                       Rat  ==
B D                   Dolphin  --
                Killer whale  --
B D                  Elephant  ==
B D                     Horse  ==
B D            Naked mole-rat  --
B D              Atlantic cod  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  --
B D                   Wallaby  ==
B D                      Fugu  ==
B D           Tasmanian devil  ==

Inserts between block 18 and 19 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                      Cow 1bp
B D         White rhinoceros 17bp
B D                      Cat 19bp
B D                      Dog 18bp
B D                  Ferret  18bp
B D                    Panda 18bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 33bp
B D                  Megabat 33bp
               Big brown bat 42bp
        David's myotis (bat) 41bp
B D                 Microbat 40bp
B D                    Shrew 2bp

Alignment block 19 of 713 in window, 64270482 - 64270499, 18 bps 
B D                     Human  tcaggga----cgctcgcgagg
B D                     Chimp  tcgggga----cgctcgcgagg
B D                   Gorilla  tcaggga----cgcccgcgagg
B D                 Orangutan  tcaggga----cgctcgggagg
B D                    Gibbon  tcaggga----cgctcgggagg
B D                    Rhesus  tcaggga----cgctcgggagg
B D       Crab-eating macaque  tcaggga----cgctcgggagg
B D                    Baboon  tcaggga----cgctcgggagg
B D              Green monkey  tcaggga----cgctcgggagg
B D                  Marmoset  tcgggga----cgcttgggagg
B D           Squirrel monkey  tcgggga----cgcctggcagg
B D                  Bushbaby  tttggaa----agcatgggagc
           Chinese tree shrew  tcaggga---------------
B D                  Squirrel  tcagggagccagccac-agagg
       Lesser Egyptian jerboa  tcaagga------aacacggaa
                 Prairie vole  tcagaga------cactacaag
B D           Chinese hamster  tcagaca------cgctattag
               Golden hamster  tcagaga-----ccgctattag
B D                     Mouse  tcagaga------cacgggatg
B D            Naked mole-rat  tcagaaa----aacacga-agg
B D                Guinea pig  ccatgga----aacacgacagg
                   Chinchilla  ccaagga----aacaggagagg
             Brush-tailed rat  cccaaga----aatacgaccgg
B D                      Pika  accgggg------cgctggcgt
B D                       Pig  ---------------cccctga
B D                    Alpaca  ---------------ctcctga
               Bactrian camel  ---------------ctcctga
B D                   Dolphin  ---------------tcccaga
                 Killer whale  ---------------tcccaga
             Tibetan antelope  ---------------ctgctga
B D                       Cow  ---------------ctcctga
B D                     Sheep  ---------------ctcctga
                Domestic goat  ---------------ctcctga
B D                   Manatee  ------------------tcgg
             Cape golden mole  ------------------tagg
B D                    Tenrec  ------------------gggg
                     Aardvark  ------------------tcgg
B D                 Armadillo  ------------------tcgg
B D                   Opossum  tcaggct----ccctc------
B D        American alligator  tcagagc----agagcaccagg
             Star-nosed mole  ----------------------
         Cape elephant shrew  ======================
B D                  Hedgehog  ----------------------
B D                     Shrew  ======================
B D                       Rat  ======================
            Black flying-fox  ======================
                Weddell seal  ======================
B D                   Megabat  ======================
B D                     Panda  ======================
               Big brown bat  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
B D                  Elephant  ======================
B D          White rhinoceros  ======================
B D                     Horse  ======================
B D                       Dog  ======================
B D                   Ferret   ======================
B D                       Cat  ======================
              Pacific walrus  ======================
B D              Atlantic cod  ======================
B D                 Tetraodon  ======================
      Yellowbelly pufferfish  ======================
B D             X. tropicalis  ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
  D           Green seaturtle  ======================
B D                  Platypus  ----------------------
B D                   Wallaby  ======================
B D                      Fugu  ======================
B D           Tasmanian devil  ======================

Inserts between block 19 and 20 in window
B D                     Pika 2bp
B D                      Pig 10bp
B D                   Alpaca 10bp
              Bactrian camel 10bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                  Manatee 13bp
            Cape golden mole 13bp
B D                   Tenrec 13bp
                    Aardvark 10bp
B D                Armadillo 12bp
B D                  Opossum 1bp

Alignment block 20 of 713 in window, 64270500 - 64270504, 5 bps 
B D                     Human  ac-gca
B D                     Chimp  ac-gca
B D                   Gorilla  ac-gca
B D                 Orangutan  ac-gca
B D                    Gibbon  ac-gca
B D                    Rhesus  ac-gca
B D       Crab-eating macaque  ac-gca
B D                    Baboon  ac-gca
B D              Green monkey  ac-gca
B D                  Marmoset  ac-gca
B D           Squirrel monkey  ac-gca
B D                  Bushbaby  ac-gtt
B D                  Squirrel  ac-gct
       Lesser Egyptian jerboa  atccaa
                 Prairie vole  at-gag
B D           Chinese hamster  at-gag
               Golden hamster  at-ggg
B D                     Mouse  at-gcg
B D            Naked mole-rat  ac-gct
B D                Guinea pig  ac-gca
                   Chinchilla  ac-gct
             Brush-tailed rat  ac-gct
B D                       Pig  aa-gca
B D                    Alpaca  ag-gca
               Bactrian camel  ag-gca
             Tibetan antelope  aa-gca
B D                       Cow  aa-gca
B D                     Sheep  aa-gca
                Domestic goat  aa-gca
B D                     Horse  ag-gca
B D          White rhinoceros  aa-gca
B D                       Cat  aa-gct
B D                       Dog  ag-cct
B D                   Ferret   ga-gct
B D                     Panda  aa-gct
               Pacific walrus  aa-ggt
                 Weddell seal  aa-ggt
B D                     Shrew  gc-gcg
B D                   Manatee  ac-gc-
             Cape golden mole  ac----
B D                    Tenrec  ac----
                     Aardvark  ac-gc-
B D                 Armadillo  ac-tc-
B D                   Opossum  a-----
B D        American alligator  ac-acc
             Star-nosed mole  ------
B D                      Pika  ======
         Cape elephant shrew  ======
B D                  Hedgehog  ------
B D                       Rat  ======
            Black flying-fox  ======
B D                   Dolphin  ------
B D                   Megabat  ======
                Killer whale  ------
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                  Elephant  ======
          Chinese tree shrew  ------
B D              Atlantic cod  ======
B D                 Tetraodon  ======
      Yellowbelly pufferfish  ======
B D             X. tropicalis  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                  Platypus  ------
B D                   Wallaby  ======
B D                      Fugu  ======
B D           Tasmanian devil  ======

Inserts between block 20 and 21 in window
B D                      Pig 10bp
B D                   Alpaca 12bp
              Bactrian camel 12bp
B D                    Horse 16bp
B D         White rhinoceros 16bp
B D                      Cat 12bp
B D                      Dog 12bp
B D                  Ferret  12bp
B D                    Panda 12bp
              Pacific walrus 12bp
                Weddell seal 12bp
B D                    Shrew 5bp

Alignment block 21 of 713 in window, 64270505 - 64270505, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  a
               Golden hamster  c
B D                     Mouse  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  c
B D        American alligator  t
             Star-nosed mole  -
B D                      Pika  =
         Cape elephant shrew  =
B D                  Hedgehog  -
B D                       Rat  =
B D                    Tenrec  -
B D                   Dolphin  -
                Killer whale  -
               Big brown bat  =
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
B D                  Elephant  =
          Chinese tree shrew  -
B D              Atlantic cod  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  -
B D                   Wallaby  =
B D                      Fugu  =
B D           Tasmanian devil  =
            Cape golden mole  -

Inserts between block 21 and 22 in window
            Black flying-fox 16bp
B D                  Megabat 14bp

Alignment block 22 of 713 in window, 64270506 - 64270509, 4 bps 
B D                     Human  gggc
B D                     Chimp  gggc
B D                   Gorilla  gggc
B D                 Orangutan  gggc
B D                    Gibbon  gggc
B D                    Rhesus  gggc
B D       Crab-eating macaque  gggc
B D                    Baboon  gggc
B D              Green monkey  gggc
B D                  Marmoset  gggc
B D           Squirrel monkey  gggc
B D                  Bushbaby  gggc
B D                  Squirrel  aggc
       Lesser Egyptian jerboa  tggc
                 Prairie vole  aggc
B D           Chinese hamster  gggc
               Golden hamster  -ggc
B D                     Mouse  gtgc
B D            Naked mole-rat  aggc
B D                Guinea pig  aggc
                   Chinchilla  aggc
             Brush-tailed rat  aggc
B D                       Pig  gggc
B D                    Alpaca  gggc
               Bactrian camel  ggcc
B D                     Horse  gggc
B D          White rhinoceros  gggc
B D                       Cat  gggc
B D                       Dog  gggc
B D                   Ferret   gggc
B D                     Panda  gggc
               Pacific walrus  gggc
                 Weddell seal  gggc
             Black flying-fox  ggcc
B D                   Megabat  ggcc
                Big brown bat  gggc
         David's myotis (bat)  gggc
B D                  Microbat  gggc
B D                  Hedgehog  gggc
B D                     Shrew  gcgg
              Star-nosed mole  ggga
B D                   Manatee  gggc
B D                    Tenrec  -tgc
                     Aardvark  tggt
B D                 Armadillo  tggc
B D                   Opossum  gggt
B D        American alligator  gggt
B D                      Pika  ====
         Cape elephant shrew  ====
B D                       Rat  ====
B D                   Dolphin  ----
                Killer whale  ----
B D                       Cow  ----
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                  Elephant  ====
          Chinese tree shrew  ----
B D              Atlantic cod  ====
B D                 Tetraodon  ====
      Yellowbelly pufferfish  ====
B D             X. tropicalis  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                  Platypus  ----
B D                   Wallaby  ====
B D                      Fugu  ====
B D           Tasmanian devil  ====
            Cape golden mole  ----

Alignment block 23 of 713 in window, 64270510 - 64270510, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  a
B D                     Mouse  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                       Pig  c
B D                    Alpaca  t
               Bactrian camel  t
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  t
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  t
B D                     Shrew  g
              Star-nosed mole  g
B D                   Manatee  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D        American alligator  t
B D                      Pika  =
         Cape elephant shrew  =
B D                       Rat  =
B D                   Dolphin  -
                Killer whale  -
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
B D                  Elephant  =
          Chinese tree shrew  -
B D              Atlantic cod  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  -
B D                   Wallaby  =
B D                      Fugu  =
B D                   Opossum  -
B D           Tasmanian devil  =
            Cape golden mole  -

Inserts between block 23 and 24 in window
      Lesser Egyptian jerboa 18bp
B D                    Mouse 300bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 24 of 713 in window, 64270511 - 64270521, 11 bps 
B D                     Human  --cccagg-aatgg---
B D                     Chimp  --cccagg-aatgg---
B D                   Gorilla  --cccagg-aatgg---
B D                 Orangutan  --cccagg-aatag---
B D                    Gibbon  --cccagg-aatgg---
B D                    Rhesus  --cccagg-aatgg---
B D       Crab-eating macaque  --cccagg-aatgg---
B D                    Baboon  --cccagg-aatgg---
B D              Green monkey  --cccagg-aatgg---
B D                  Marmoset  --ctcagg-aatgg---
B D           Squirrel monkey  --cttagg-aatgg---
B D                  Bushbaby  --ttcagg-aatgg---
           Chinese tree shrew  ---------gctgg---
B D                  Squirrel  --ctcagg-aatgg---
       Lesser Egyptian jerboa  --cccaaa-tacc----
                 Prairie vole  --cttagg-aatcg---
B D           Chinese hamster  --ctcagg-aatcg---
               Golden hamster  --ctcagg-aatct---
B D            Naked mole-rat  --tttagg-aacgg---
B D                Guinea pig  --tttagg-aacgg---
                   Chinchilla  --tttagg-aacgg---
             Brush-tailed rat  --tttaga-aacag---
B D                       Pig  --cttagg-aatg----
B D                    Alpaca  --cttagg-aatg----
               Bactrian camel  --cttagg-aatg----
B D                     Horse  --tttagg-aatg----
B D          White rhinoceros  --cttaag-aatg----
B D                       Cat  --cttagg-aatg----
B D                       Dog  --cttagg-aacg----
B D                   Ferret   --ctcaga-aatg----
B D                     Panda  --cttcgg-aatg----
               Pacific walrus  --ttcagg-agtg----
                 Weddell seal  --cttagg-aatg----
             Black flying-fox  --cttagg-aatg----
B D                   Megabat  --cttagg-aatg----
                Big brown bat  --cttagg-gacg----
         David's myotis (bat)  --cttagg-ggcg----
B D                  Microbat  --cttagg-ggcg----
B D                  Hedgehog  --ctttgg-gata----
B D                     Shrew  --ccctgg-g--g----
              Star-nosed mole  --ccctgg-ggag----
B D                   Manatee  --cttaggaatcg----
             Cape golden mole  ---------gttg----
B D                    Tenrec  --ctgagg-aatg----
                     Aardvark  --cttaggaaatg----
B D                 Armadillo  --ctttgggactg----
B D        American alligator  ccctctgc-agtggtgg
B D                      Pika  =================
         Cape elephant shrew  =================
B D                     Mouse  =================
B D                       Rat  =================
B D                   Dolphin  -----------------
                Killer whale  -----------------
B D                       Cow  -----------------
               Domestic goat  -----------------
B D                     Sheep  -----------------
            Tibetan antelope  -----------------
B D                  Elephant  =================
B D              Atlantic cod  =================
B D                 Tetraodon  =================
      Yellowbelly pufferfish  =================
B D             X. tropicalis  =================
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
  D           Green seaturtle  =================
B D                  Platypus  -----------------
B D                   Wallaby  =================
B D                      Fugu  =================
B D                   Opossum  -----------------
B D           Tasmanian devil  =================

Inserts between block 24 and 25 in window
                    Aardvark 229bp
B D                Armadillo 1bp

Alignment block 25 of 713 in window, 64270522 - 64270528, 7 bps 
B D                     Human  gaactgg
B D                     Chimp  gaactgg
B D                   Gorilla  gaactgg
B D                 Orangutan  gaactgg
B D                    Gibbon  gaactgg
B D                    Rhesus  gaactgg
B D       Crab-eating macaque  gaactgg
B D                    Baboon  gaactgg
B D              Green monkey  gaactgg
B D                  Marmoset  gaactgg
B D           Squirrel monkey  ggactgg
B D                  Bushbaby  ggacagt
           Chinese tree shrew  gtggcgg
B D                  Squirrel  ggactgg
       Lesser Egyptian jerboa  ---ctgc
                 Prairie vole  ggattgg
B D           Chinese hamster  ggattgg
               Golden hamster  ggaatgg
B D            Naked mole-rat  ggcctgg
B D                Guinea pig  ggcctcg
                   Chinchilla  ggcccag
             Brush-tailed rat  ggtccag
B D                       Pig  gaactgg
B D                    Alpaca  gaactgg
               Bactrian camel  gaactgg
B D                     Horse  ggactgc
B D          White rhinoceros  ggactgc
B D                       Cat  agactgg
B D                       Dog  ggactga
B D                   Ferret   ggactgg
B D                     Panda  gggctgg
               Pacific walrus  ggactgg
                 Weddell seal  ggactgg
             Black flying-fox  agacgag
B D                   Megabat  agacgag
                Big brown bat  -ggcggt
         David's myotis (bat)  -ggcgg-
B D                  Microbat  -ggcgg-
B D                  Hedgehog  gaactga
B D                     Shrew  gcgcgat
              Star-nosed mole  gggctac
B D                   Manatee  gtactag
             Cape golden mole  gttctag
B D                    Tenrec  gcgctag
B D                 Armadillo  ggaccga
B D        American alligator  gaaagga
B D                      Pika  =======
         Cape elephant shrew  =======
B D                     Mouse  =======
B D                       Rat  =======
B D                   Dolphin  -------
                Killer whale  -------
B D                       Cow  -------
               Domestic goat  -------
B D                     Sheep  -------
            Tibetan antelope  -------
B D                  Elephant  =======
B D              Atlantic cod  =======
B D                 Tetraodon  =======
      Yellowbelly pufferfish  =======
B D             X. tropicalis  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D                  Platypus  -------
B D                   Wallaby  =======
B D                      Fugu  =======
B D                   Opossum  -------
B D           Tasmanian devil  =======
                    Aardvark  =======

Inserts between block 25 and 26 in window
B D                  Manatee 193bp
            Cape golden mole 6bp
B D                   Tenrec 6bp

Alignment block 26 of 713 in window, 64270529 - 64270530, 2 bps 
B D                     Human  --tt
B D                     Chimp  --tt
B D                   Gorilla  --tt
B D                 Orangutan  --tt
B D                    Gibbon  --tt
B D                    Rhesus  --tt
B D       Crab-eating macaque  --tt
B D                    Baboon  --tt
B D              Green monkey  --tt
B D                  Marmoset  --tt
B D           Squirrel monkey  --tt
B D                  Bushbaby  --tt
           Chinese tree shrew  --tt
       Lesser Egyptian jerboa  --tg
                 Prairie vole  --tt
B D           Chinese hamster  --tt
               Golden hamster  --tt
B D            Naked mole-rat  --gg
B D                Guinea pig  --ag
                   Chinchilla  --gg
             Brush-tailed rat  --gg
B D                       Pig  --ct
B D                    Alpaca  --tt
               Bactrian camel  --tt
B D                     Horse  --tt
B D          White rhinoceros  --tt
B D                       Cat  --tt
B D                       Dog  --tt
B D                   Ferret   --tt
B D                     Panda  --tt
               Pacific walrus  --tt
                 Weddell seal  --tt
             Black flying-fox  --tt
B D                   Megabat  --tt
                Big brown bat  --tt
         David's myotis (bat)  --tt
B D                  Microbat  --tt
B D                  Hedgehog  --cc
B D                     Shrew  --ca
              Star-nosed mole  --ct
B D                 Armadillo  --t-
B D        American alligator  gg--
B D                      Pika  ====
         Cape elephant shrew  ====
B D                     Mouse  ====
B D                       Rat  ====
B D                    Tenrec  ====
B D                   Dolphin  ----
                Killer whale  ----
B D                       Cow  ----
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                   Manatee  ====
B D                  Elephant  ====
B D                  Squirrel  ----
B D              Atlantic cod  ====
B D                 Tetraodon  ====
      Yellowbelly pufferfish  ====
B D             X. tropicalis  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                  Platypus  ----
B D                   Wallaby  ====
B D                      Fugu  ====
B D                   Opossum  ----
B D           Tasmanian devil  ====
            Cape golden mole  ====
                    Aardvark  ====

Inserts between block 26 and 27 in window
B D                Armadillo 5bp

Alignment block 27 of 713 in window, 64270531 - 64270559, 29 bps 
B D                     Human  a----gatcc---------------------caggaactccgtgcc------ggagacgg
B D                     Chimp  a----gatcc---------------------caggaactccgtgcc------ggggacgg
B D                   Gorilla  a----gatcc---------------------caggaactccgtgcc------ggggacgg
B D                 Orangutan  a----gatcc---------------------caggaactccgtgcc------ggggacgg
B D                    Gibbon  a----gatcc---------------------caggtactccgtgcc------ggggacgg
B D                    Rhesus  a----gatcc---------------------caggaactccgtgcc------ggggacgg
B D       Crab-eating macaque  a----gatcc---------------------caggaactccgtgcc------ggggacgg
B D                    Baboon  a----gatcc---------------------caggaattccgtgcc------ggggacgg
B D              Green monkey  a----gatcc---------------------cagaaactccgtgcc------ggggacgg
B D                  Marmoset  a----gatcc---------------------cgggaactccgtgct------ggggacgg
B D           Squirrel monkey  a----gatcc---------------------caggaactccgtgct------ggggacgg
B D                  Bushbaby  a----gatcc---------------------caggaactccaaact------ggggacgg
           Chinese tree shrew  g----gctcc---------------------cagaaggctggtgtg------gagggcgg
B D                  Squirrel  --------------------------------ga--------------------------
       Lesser Egyptian jerboa  g----gggcc---------------------ggg--------------------------
                 Prairie vole  g----gagcc---------------------cag--------------------------
B D           Chinese hamster  g----gagcc---------------------cag--------------------------
               Golden hamster  a----gagcc---------------------cag--------------------------
B D            Naked mole-rat  a----gagcc---------------------aataaactcagtgct------gagggtcg
B D                Guinea pig  t----gagcc---------------------aaa--------------------------
                   Chinchilla  t----gagcc---------------------aaaaaaccccgtgct------gacagccg
             Brush-tailed rat  t----aagcc---------------------aaacaacgttgtgtt------gggggctg
B D                       Pig  a----gatcc---------------------cagtccctcctagcc------gggggcgg
B D                    Alpaca  a----gattc---------------------tggaccctccatagc------ggggacgg
               Bactrian camel  a----gattc---------------------tggaccctccatagc------ggggacgg
B D                   Dolphin  -----------------------------------ccctccatgcc------gggggcgg
                 Killer whale  -----------------------------------ccctccatgcc------gggggcgg
             Tibetan antelope  -------------------------------tggtccctccacgtt------gcgagcag
B D                       Cow  -------------------------------tggtccctccatgtt------gcgagcag
B D                     Sheep  -------------------------------tggtccctccacgtt------gctagcag
                Domestic goat  -------------------------------tggtccctccacgtt------gcgagcag
B D                     Horse  a----ggccc---------------------cagacactccgcgcc------g-ggaga-
B D          White rhinoceros  a----ggccc---------------------cagacactccgcgcc------gcggacg-
B D                       Cat  a----gatcc---------------------tagac--actatgcc------aggggtgc
B D                       Dog  a----ggtcc---------------------cagacacactgtgcc------aggggcgc
B D                   Ferret   a----gatcc---------------------cagacgcaccctgcc------aggggcgc
B D                     Panda  a----gatcc---------------------cagacacaccgcgcc------aggggcgc
               Pacific walrus  a----gatcc---------------------cagacgcaccgtgcc------agggacgc
                 Weddell seal  ataacgatcc---------------------cagacgtaccgtgcc------agggacgc
             Black flying-fox  a----gatcc---------------------tagacgctccttgcc------aggggcgg
B D                   Megabat  a----gatcc---------------------tagacgctccttgcc------aggggcgg
                Big brown bat  g----gatcc---------------------g-gacgctccgtgtt------gggggcgg
         David's myotis (bat)  a----gattc---------------------t-gacgctccgtgtt------gggggcgg
B D                  Microbat  a----gatcc---------------------t-gacgctccgtgtc------gggggcgg
B D                  Hedgehog  a----gacta---------------------taggatattagctcg------gggggagg
B D                     Shrew  a----gacta----------------------ggaatccgcgc---------aggggccg
              Star-nosed mole  a----gagcc----------------------agaactctagctcctggaaaacgggctg
B D                  Elephant  a----gatca---------------------cagaaactccgtgct------gggggcgg
B D                   Manatee  a----gatcc---------------------cagaaactccatgcc------gggggcgg
             Cape golden mole  a----gatcttgagtcctagaatatagatcatagaaaccccgtacc------tggggga-
B D                    Tenrec  a----agtcc---------------------cagaagccccgcaca------gcggcgg-
B D                 Armadillo  a----gatcc---------------------cagaaact--gtgaa------gggaatgg
B D        American alligator  ----ggaatc---------------------caatggtttag----------agggactg
B D                      Pika  ============================================================
         Cape elephant shrew  ============================================================
B D                     Mouse  ============================================================
B D                       Rat  ============================================================
B D              Atlantic cod  ============================================================
B D                 Tetraodon  ============================================================
      Yellowbelly pufferfish  ============================================================
B D             X. tropicalis  ============================================================
  D  Chinese softshell turtle  ============================================================
  D            Painted turtle  ============================================================
  D           Green seaturtle  ============================================================
B D                  Platypus  ------------------------------------------------------------
B D                   Wallaby  ============================================================
B D                      Fugu  ============================================================
B D                   Opossum  ------------------------------------------------------------
B D           Tasmanian devil  ============================================================
                    Aardvark  ============================================================

Inserts between block 27 and 28 in window
B D                 Elephant 225bp

Alignment block 28 of 713 in window, 64270560 - 64270560, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  g
B D            Naked mole-rat  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   t
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
B D                 Armadillo  g
B D        American alligator  g
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  -
B D                       Rat  =
B D           Chinese hamster  -
              Golden hamster  -
      Lesser Egyptian jerboa  -
B D                Guinea pig  -
B D                  Squirrel  -
B D              Atlantic cod  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                  Platypus  -
B D                   Wallaby  =
B D                      Fugu  =
B D                   Opossum  -
B D           Tasmanian devil  =
                    Aardvark  =

Inserts between block 28 and 29 in window
B D                  Manatee 248bp

Alignment block 29 of 713 in window, 64270561 - 64270561, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -g
           Chinese tree shrew  -g
B D            Naked mole-rat  -g
B D                Guinea pig  -a
                   Chinchilla  -g
             Brush-tailed rat  -a
B D                       Pig  -g
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -g
B D          White rhinoceros  -g
B D                       Cat  -g
B D                       Dog  -g
B D                   Ferret   -g
B D                     Panda  -g
               Pacific walrus  -g
                 Weddell seal  -g
             Black flying-fox  -g
B D                   Megabat  -g
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
B D                     Shrew  -a
B D                  Elephant  -a
             Cape golden mole  -a
B D                    Tenrec  -a
B D                 Armadillo  -g
B D        American alligator  t-
             Star-nosed mole  --
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  --
B D                     Mouse  ==
                Prairie vole  --
B D                       Rat  ==
B D           Chinese hamster  --
              Golden hamster  --
      Lesser Egyptian jerboa  --
B D                   Manatee  ==
              Bactrian camel  --
B D                    Alpaca  --
B D                  Squirrel  --
B D              Atlantic cod  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  --
B D                   Wallaby  ==
B D                      Fugu  ==
B D                   Opossum  --
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 29 and 30 in window
            Cape golden mole 5bp
B D                   Tenrec 160bp

Alignment block 30 of 713 in window, 64270562 - 64270563, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  gg
           Chinese tree shrew  ta
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                       Pig  ag
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  cg
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                     Shrew  cg
B D                  Elephant  -g
             Cape golden mole  -g
B D                 Armadillo  tg
B D        American alligator  ag
             Star-nosed mole  --
B D                      Pika  ==
         Cape elephant shrew  ==
B D                  Hedgehog  --
B D                     Mouse  ==
                Prairie vole  --
B D                       Rat  ==
B D           Chinese hamster  --
              Golden hamster  --
      Lesser Egyptian jerboa  --
B D                    Tenrec  ==
B D                   Manatee  ==
B D                  Squirrel  --
B D              Atlantic cod  ==
B D                 Tetraodon  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                  Platypus  --
B D                   Wallaby  ==
B D                      Fugu  ==
B D                   Opossum  --
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 30 and 31 in window
B D                 Elephant 1bp
            Cape golden mole 2bp

Alignment block 31 of 713 in window, 64270564 - 64270605, 42 bps 
B D                     Human  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                     Chimp  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                   Gorilla  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                 Orangutan  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                    Gibbon  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                    Rhesus  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D       Crab-eating macaque  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                    Baboon  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D              Green monkey  --agaggatgcct----------------------------ag---ggcc---cta--a-atgga-----
B D                  Marmoset  --agaggatacct----------------------------ag---ggcc---cta--a-atgga-----
B D           Squirrel monkey  --agaggatacct----------------------------ag---ggcc---cta--a-atgga-----
B D                  Bushbaby  --agaggacgtct----------------------------ag---agcc---taa--t-atgg------
           Chinese tree shrew  --agata----------------------------------ag---agaa---ctc--c-atgga-----
B D                  Squirrel  -----aaatgctt----------------------------tg---ggat---cta--a-gtgga-----
       Lesser Egyptian jerboa  ---taggactctt----------------------------gg---gacc---tta--atgagaaaagtc
                 Prairie vole  -----aaactgct----------------------------gg---gacc---cta--a-atgaaacctc
B D           Chinese hamster  -----agactgct----------------------------gg---gacc---cta--a-gtgaaacctc
               Golden hamster  -----agactgct----------------------------gg---gacc---cta--a-gtgaaacctc
B D            Naked mole-rat  --agaggacgcct----------------------------ag---gatc---gaa--a-ctaga-----
B D                Guinea pig  --agacgacgcca----------------------------ag---gaac---taa--a-ctaga-----
                   Chinchilla  --acaggacgcct----------------------------ag---gaac---taa--a-ctaga-----
             Brush-tailed rat  --agaggacacct----------------------------aa---gaac---taa--c-gtaga-----
B D                       Pig  --aagggacgcct----------------------------ag---gact---ctg--t-a---------
B D                    Alpaca  --agaggaggcct----------------------------aggaagacc---cta--t-t---------
               Bactrian camel  --agaggaggcct----------------------------aggaagacc---cta--t-t---------
B D                   Dolphin  --agaggatgcct----------------------------ag---gacc---ctg--t-a---------
                 Killer whale  --agaggatgcct----------------------------ag---gacc---ctg--t-a---------
             Tibetan antelope  --aaaggaggcct----------------------------ac---gatc---ctg--t-a---------
B D                       Cow  --aaaggacgcct----------------------------ac---ggtc---ctg--t-a---------
B D                     Sheep  --aaaggaggcct----------------------------ac---gatc---ctg--t-a---------
                Domestic goat  --aaaggaggcct----------------------------ac---gatc---ctg--t-a---------
B D                     Horse  --gcaga--gcct----------------------------ac---gacc---ctg--t-atgtt-----
B D          White rhinoceros  --agaggacgcct----------------------------ag---gacc---ctg--t-atgtt-----
B D                       Cat  --agaggacgcct----------------------------ag---gacc---ctg--t-a---------
B D                       Dog  --agagaacgcc-----------------------------ag---gacc---ccg--g-a---------
B D                   Ferret   --ggagaacgctt----------------------------ag---gacc---ttg--c-g---------
B D                     Panda  --agagaacgcct----------------------------ag---aaac---ctg--t-a---------
               Pacific walrus  --agagaacgcct----------------------------aa---gacc---ctg--t-a---------
                 Weddell seal  --agagaacgcct----------------------------aa---gacc---ctg--t-c---------
             Black flying-fox  --agagggcacct----------------------------aa---ggcc---ttg--t-atgtt-----
B D                   Megabat  --agagggcacct----------------------------aa---ggcc---ttg--t-atgtt-----
                Big brown bat  --cgagga--cgt----------------------------gg---gacc---ctg--t-gtgtt-----
         David's myotis (bat)  --agaggac-cgg----------------------------ag---gacc---ctg--t-gtgtt-----
B D                  Microbat  --agaggac-cgg----------------------------ag---gacc---ccg--t-gtgtt-----
B D                  Hedgehog  --------ctcct----------------------------ag---ggcc---ccg--a-t-gtt-----
B D                     Shrew  --ag-ggacgcct----------------------------cg---aacc---tcg--------------
              Star-nosed mole  --------catca----------------------------cg---aattaaaacg--------------
B D                  Elephant  --gggggaggctt----------------------------ag---gacc---cca-tt-atggc-----
B D                   Manatee  --aagggatgcct----------------------------ag---gacc---cta--t-atggc-----
             Cape golden mole  --gggggacacctg---------------------------gg---gatc---ctagga-atggc-----
B D                 Armadillo  --ggggcgtgctt----------------------------cg---cacc---cca--t-atagc-----
B D        American alligator  cactaggatgcctgggtttcctctgcacctctgggaaaagtgg---ggtc---cta--g-agggt-----
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Tenrec  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
B D                   Wallaby  ======================================================================
B D                      Fugu  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
                    Aardvark  ======================================================================

                        Human  aaggccagagctggag---
                        Chimp  aaggccagagctggag---
                      Gorilla  aaggccagagctggag---
                    Orangutan  aaggccagagctggag---
                       Gibbon  aaggccagagctggag---
                       Rhesus  aaggccagagctggag---
          Crab-eating macaque  aaggccagagctggag---
                       Baboon  aaggccagagctggag---
                 Green monkey  aaggccagagctggag---
                     Marmoset  aaggccagagctggaa---
              Squirrel monkey  aacgtcagagctggaa---
                     Bushbaby  aagacctgagccggaa---
           Chinese tree shrew  agcgccagagtccgag---
                     Squirrel  agagccaaat---------
       Lesser Egyptian jerboa  agcaccagag---------
                 Prairie vole  aaagccagag---------
              Chinese hamster  agagccagag---------
               Golden hamster  agagccagag---------
               Naked mole-rat  agggtcagag---------
                   Guinea pig  aaggtcagag---------
                   Chinchilla  aaggccaaag---------
             Brush-tailed rat  aacgccaaag---------
                          Pig  agcgccagaatcgtag---
                       Alpaca  aggaccagagccagag---
               Bactrian camel  agggccagagccggag---
                      Dolphin  agcgccagagctggag---
                 Killer whale  agcgccagagctggag---
             Tibetan antelope  agcgccagagccggag---
                          Cow  agcgccagagccggag---
                        Sheep  agcgccagagccggag---
                Domestic goat  agcgccagagccggag---
                        Horse  agcaccagagctggag---
             White rhinoceros  agcgccagggccgaag---
                          Cat  agcgccagagtcggag---
                          Dog  ------agagcccgag---
                      Ferret   agtatcagagcccgag---
                        Panda  agcgccagagcccgag---
               Pacific walrus  agccccagagaccgag---
                 Weddell seal  agccccagagaccgag---
             Black flying-fox  agcgcctgaaccggag---
                      Megabat  agcgcctgaaccggag---
                Big brown bat  agcgcgagagcc-------
         David's myotis (bat)  agcgcgagagccggag---
                     Microbat  agcgcgagagccggag---
                     Hedgehog  ggcacccgcaccggag---
                        Shrew  cgtgcgcgcgttggag---
              Star-nosed mole  gttacaag---tagag---
                     Elephant  agctccagagctggag---
                      Manatee  agctccagagctgcag---
             Cape golden mole  agctccagagctggag---
                    Armadillo  agcgcccgagc--------
           American alligator  cagagcagagccccaggac
                         Pika  ===================
          Cape elephant shrew  ===================
                        Mouse  ===================
                          Rat  ===================
                       Tenrec  ===================
                 Atlantic cod  ===================
                    Tetraodon  ===================
       Yellowbelly pufferfish  ===================
                X. tropicalis  ===================
     Chinese softshell turtle  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
                     Platypus  -------------------
                      Wallaby  ===================
                         Fugu  ===================
                      Opossum  -------------------
              Tasmanian devil  ===================
                     Aardvark  ===================

Inserts between block 31 and 32 in window
B D          Chinese hamster 11bp

Alignment block 32 of 713 in window, 64270606 - 64270610, 5 bps 
B D                     Human  acct---a
B D                     Chimp  acct---a
B D                   Gorilla  acct---a
B D                 Orangutan  acct---a
B D                    Gibbon  acct---a
B D                    Rhesus  acct---a
B D       Crab-eating macaque  acct---a
B D                    Baboon  acct---a
B D              Green monkey  acct---a
B D                  Marmoset  actt---a
B D           Squirrel monkey  actt---a
B D                  Bushbaby  accc---a
           Chinese tree shrew  atct---g
B D                  Squirrel  atct---a
       Lesser Egyptian jerboa  gtct---a
                 Prairie vole  acct---a
               Golden hamster  atct---a
B D            Naked mole-rat  atct---a
B D                Guinea pig  aact---a
                   Chinchilla  atct---a
             Brush-tailed rat  atct---a
B D                       Pig  atct---a
B D                    Alpaca  atccggaa
               Bactrian camel  atccggaa
B D                   Dolphin  atct---g
                 Killer whale  atct---g
             Tibetan antelope  actt---a
B D                       Cow  actt---a
B D                     Sheep  actt---a
                Domestic goat  actt---a
B D                     Horse  acct---a
B D          White rhinoceros  accg---a
B D                       Cat  actc---a
B D                       Dog  accc---a
B D                   Ferret   acct---a
B D                     Panda  acct---a
               Pacific walrus  acct---a
                 Weddell seal  acct---a
             Black flying-fox  atct---a
B D                   Megabat  atct---a
         David's myotis (bat)  gtct---g
B D                  Microbat  gtct---a
B D                  Hedgehog  atac---a
B D                     Shrew  ccgc---a
              Star-nosed mole  ttcc---a
B D                  Elephant  atct---a
B D                   Manatee  atct---a
             Cape golden mole  atca---a
B D                 Armadillo  -gct---a
B D        American alligator  acct---g
B D                      Pika  ========
         Cape elephant shrew  ========
B D                     Mouse  ========
B D                       Rat  ========
B D           Chinese hamster  ========
B D                    Tenrec  ========
               Big brown bat  --------
B D              Atlantic cod  ========
B D                 Tetraodon  ========
      Yellowbelly pufferfish  ========
B D             X. tropicalis  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D                  Platypus  --------
B D                   Wallaby  ========
B D                      Fugu  ========
B D                   Opossum  --------
B D           Tasmanian devil  ========
                    Aardvark  ========

Inserts between block 32 and 33 in window
                Prairie vole 3bp
              Golden hamster 9bp

Alignment block 33 of 713 in window, 64270611 - 64270630, 20 bps 
B D                     Human  g----------cac----ccagaaga-t-gagacc-----------g
B D                     Chimp  g----------cac----ccagaaga-t-gagacc-----------g
B D                   Gorilla  g----------c-------------a-t-gagacc-----------g
B D                 Orangutan  g----------cac----ccagaaga-t-gagacg-----------g
B D                    Gibbon  g----------cac----aca-aaga-t-gagacc-----------g
B D                    Rhesus  g----------cac----ccagaaga-t-gggacc-----------g
B D       Crab-eating macaque  g----------cac----ccagaaga-t-gggacc-----------g
B D                    Baboon  g----------cac----ccagaaga-t-gggacc-----------g
B D              Green monkey  g----------cac----ccagaaga-t-gggacc-----------g
B D                  Marmoset  g----------cac----tcagaaga-t-gggacc-----------g
B D           Squirrel monkey  g----------cac----tcagaaga-t--ggact-----------g
B D                  Bushbaby  g----------cac----cca---ga-t-gggacc-----------t
           Chinese tree shrew  -------------------cagaaga-t-gggacc-----------g
B D                  Squirrel  g----------cac----ctagaaga-t-gggacc-----------g
       Lesser Egyptian jerboa  t----------tac----ctagagga-t-gggatt-----------g
                 Prairie vole  t----------ta-------agagga-t-ggggct-----------g
B D            Naked mole-rat  a----------cac----ctagaaga-t-ggaatc-----------a
B D                Guinea pig  a----------cac----ctacaaga-tggggatc-----------a
                   Chinchilla  a----------cac----ctagaaga-t-ggaatc-----------a
             Brush-tailed rat  a----------cac----ctagaaaa-t-ggaatc-----------a
B D                       Pig  g----------cac----ctggtaga-t-aagac-------------
B D                    Alpaca  g----------cac----ctgtaaga-c-gggacc-----------a
               Bactrian camel  g----------cac----ctgtaaga-c-gcgacc-----------a
B D                   Dolphin  g----------cac----ctggaaga-t-gggacc-----------g
                 Killer whale  g----------cac----ctggaaga-t-gggacc-----------g
             Tibetan antelope  g----------cac----ctggaaga-t-gggacc-----------a
B D                       Cow  g----------cac----ctggaaga-t-gggacc-----------a
B D                     Sheep  g----------cac----ctggaaga-t-gggacc-----------a
                Domestic goat  g----------cac----ctggaaga-t-gggacc-----------a
B D                     Horse  g----------cac----ctggaaaa-t-gggacc-----------g
B D          White rhinoceros  g----------cat----ctggaaga-t-gggacc-----------a
B D                       Cat  g----------cat----ctagaaga-c-tggagg-----------g
B D                       Dog  g----------cct----ctggaagc-c-gggacg-----------g
B D                   Ferret   g----------cct----c--gaagc-c-cgaacg-----------g
B D                     Panda  g----------ccg----c--gaagc-c-gggacg-----------g
               Pacific walrus  g----------ccg----c--gaagc-c-gggaca-----------g
                 Weddell seal  g----------ccg----c--gaagc-c-gggacg-----------g
             Black flying-fox  t----------cac----gtggaaaa-t-gggacc-----------a
B D                   Megabat  c----------cac----ctggaaaa-t-gggacc-----------a
                Big brown bat  --------------------ggaaga-t-gggacc-----------g
         David's myotis (bat)  c----------cac----cgggaaga-t-gggacc-----------g
B D                  Microbat  c----------cac----cgggaaga-t-gggacc-----------g
B D                  Hedgehog  g----------cat----ccagaagg-g-acctcg------------
B D                     Shrew  ga---------cttagtacctggagc-t-gcggcc-----------g
              Star-nosed mole  ga---------cac----ccgaaagg-g-gcggcg-----------g
B D                  Elephant  g----------cac----ctggaaga-t-ggggcc-----------g
B D                   Manatee  g----------cac----ctggaaga-t-gggacc-----------g
             Cape golden mole  g----------cat----ctggaaaact-ggggccaatggattcgga
B D                 Armadillo  c----------cac----ccagaaac-t-gggact-----------g
B D        American alligator  -ggttccctcttcc----tgtgcata-t-gaggcc------------
B D                      Pika  ===============================================
         Cape elephant shrew  ===============================================
B D                     Mouse  ===============================================
B D                       Rat  ===============================================
B D           Chinese hamster  ===============================================
              Golden hamster  ===============================================
B D                    Tenrec  ===============================================
B D              Atlantic cod  ===============================================
B D                 Tetraodon  ===============================================
      Yellowbelly pufferfish  ===============================================
B D             X. tropicalis  ===============================================
  D  Chinese softshell turtle  ===============================================
  D            Painted turtle  ===============================================
  D           Green seaturtle  ===============================================
B D                  Platypus  -----------------------------------------------
B D                   Wallaby  ===============================================
B D                      Fugu  ===============================================
B D                   Opossum  -----------------------------------------------
B D           Tasmanian devil  ===============================================
                    Aardvark  ===============================================

Inserts between block 33 and 34 in window
B D                    Shrew 44bp
             Star-nosed mole 2bp
B D                Armadillo 179bp

Alignment block 34 of 713 in window, 64270631 - 64270641, 11 bps 
B D                     Human  caattcga------gaa
B D                     Chimp  caattcga------gaa
B D                   Gorilla  caattcga------gaa
B D                 Orangutan  caattcga------gaa
B D                    Gibbon  caattcga------gaa
B D                    Rhesus  caattcaa------gaa
B D       Crab-eating macaque  caattcaa------gaa
B D                    Baboon  caattcaa------gaa
B D              Green monkey  caattcaa------gaa
B D                  Marmoset  cgattcaa------gaa
B D           Squirrel monkey  caattcaa------gaa
B D                  Bushbaby  caattcaa------gaa
           Chinese tree shrew  caattcaa------gaa
B D                  Squirrel  caattcaa------gaa
       Lesser Egyptian jerboa  caatttta------gga
                 Prairie vole  -aattcaa------gaa
B D            Naked mole-rat  taactcag------gaa
B D                Guinea pig  taactcag------aaa
                   Chinchilla  taactcag------aaa
             Brush-tailed rat  taactc--------taa
B D                       Pig  -----tga------gaa
B D                    Alpaca  gaattcga------gaa
               Bactrian camel  gaattcga------gaa
B D                   Dolphin  taattcga------aaa
                 Killer whale  taattcga------aaa
             Tibetan antelope  taatttga------aaa
B D                       Cow  taatttga------aaa
B D                     Sheep  taatttga------aaa
                Domestic goat  taatttga------aaa
B D                     Horse  ccactcga------gaa
B D          White rhinoceros  caactcga------caa
B D                       Cat  cagttcaa------aaa
B D                       Dog  cagtccaa------gaa
B D                   Ferret   caattcaa------gca
B D                     Panda  caattcaa------gaa
               Pacific walrus  caattcaa------gaa
                 Weddell seal  caattcaa------gac
             Black flying-fox  caatacga------gta
B D                   Megabat  caatacga------gta
                Big brown bat  cagtccaa------gaa
         David's myotis (bat)  cagcccga------gaa
B D                  Microbat  cagcccga------gaa
B D                  Hedgehog  ctattcac------gaa
              Star-nosed mole  ggattcat--------a
B D                  Elephant  caactcaa------gag
B D                   Manatee  caactcga------gag
             Cape golden mole  aaacccaaccggctggg
B D                      Pika  =================
         Cape elephant shrew  =================
B D                     Shrew  =================
B D                     Mouse  =================
B D                       Rat  =================
B D           Chinese hamster  =================
              Golden hamster  =================
B D                    Tenrec  =================
B D                 Armadillo  =================
B D              Atlantic cod  =================
B D                 Tetraodon  =================
      Yellowbelly pufferfish  =================
B D             X. tropicalis  =================
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
  D           Green seaturtle  =================
B D                  Platypus  -----------------
B D                   Wallaby  =================
B D                      Fugu  =================
B D        American alligator  -----------------
B D                   Opossum  -----------------
B D           Tasmanian devil  =================
                    Aardvark  =================

Inserts between block 34 and 35 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 236bp

Alignment block 35 of 713 in window, 64270642 - 64270645, 4 bps 
B D                     Human  tcaa
B D                     Chimp  tcaa
B D                   Gorilla  tcaa
B D                 Orangutan  tcaa
B D                    Gibbon  tcaa
B D                    Rhesus  tcaa
B D       Crab-eating macaque  tcaa
B D                    Baboon  tc--
B D              Green monkey  tcaa
B D                  Marmoset  ttaa
B D           Squirrel monkey  ttaa
B D                  Bushbaby  ttaa
           Chinese tree shrew  tgaa
B D                  Squirrel  ttga
       Lesser Egyptian jerboa  taaa
B D            Naked mole-rat  ttaa
B D                Guinea pig  ttaa
                   Chinchilla  ctaa
             Brush-tailed rat  ctaa
B D                       Pig  tgga
B D                    Alpaca  ttaa
               Bactrian camel  ttaa
B D                   Dolphin  ttaa
                 Killer whale  ttaa
             Tibetan antelope  tgaa
B D                       Cow  tcaa
B D                     Sheep  tgaa
                Domestic goat  tgaa
B D                     Horse  ttaa
B D          White rhinoceros  ttag
B D                       Cat  a---
B D                       Dog  ct--
B D                   Ferret   ct--
B D                     Panda  c---
               Pacific walrus  ct--
                 Weddell seal  ct--
             Black flying-fox  ttaa
B D                   Megabat  ttaa
                Big brown bat  ttaa
         David's myotis (bat)  ttaa
B D                  Microbat  ttaa
B D                  Hedgehog  cgaa
              Star-nosed mole  ctac
B D                  Elephant  ttat
B D                   Manatee  ttaa
             Cape golden mole  t---
B D                      Pika  ====
         Cape elephant shrew  ====
B D                     Shrew  ====
B D                     Mouse  ====
                Prairie vole  ====
B D                       Rat  ====
B D           Chinese hamster  ====
              Golden hamster  ====
B D                    Tenrec  ====
B D                 Armadillo  ====
B D              Atlantic cod  ====
B D                 Tetraodon  ====
      Yellowbelly pufferfish  ====
B D             X. tropicalis  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                  Platypus  ----
B D                   Wallaby  ====
B D                      Fugu  ====
B D        American alligator  ----
B D                   Opossum  ----
B D           Tasmanian devil  ====
                    Aardvark  ====

Inserts between block 35 and 36 in window
B D                 Hedgehog 86bp

Alignment block 36 of 713 in window, 64270646 - 64270649, 4 bps 
B D                     Human  aggg
B D                     Chimp  aggg
B D                   Gorilla  aggg
B D                 Orangutan  aggg
B D                    Gibbon  aggg
B D                    Rhesus  aagg
B D       Crab-eating macaque  aagg
B D                    Baboon  aagg
B D              Green monkey  aagg
B D                  Marmoset  aagg
B D           Squirrel monkey  aggg
B D                  Bushbaby  gtga
B D                  Squirrel  cgt-
       Lesser Egyptian jerboa  caa-
B D            Naked mole-rat  aatg
B D                Guinea pig  agag
                   Chinchilla  agtg
             Brush-tailed rat  agtt
              Star-nosed mole  cagg
B D                  Elephant  agag
B D                   Manatee  agaa
B D        American alligator  atgg
B D                      Pika  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                     Mouse  ====
                Prairie vole  ====
B D                       Rat  ====
B D           Chinese hamster  ====
              Golden hamster  ====
            Black flying-fox  ----
B D                    Tenrec  ====
B D                       Pig  ----
B D                   Dolphin  ----
                Weddell seal  ----
B D                   Megabat  ----
                Killer whale  ----
B D                     Panda  ----
               Big brown bat  ----
B D                       Cow  ----
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                  Microbat  ----
        David's myotis (bat)  ----
B D                 Armadillo  ====
B D          White rhinoceros  ----
B D                     Horse  ----
              Bactrian camel  ----
B D                    Alpaca  ----
          Chinese tree shrew  ----
B D                       Dog  ----
B D                   Ferret   ----
B D                       Cat  ----
              Pacific walrus  ----
B D              Atlantic cod  ====
B D                 Tetraodon  ====
      Yellowbelly pufferfish  ====
B D             X. tropicalis  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                  Platypus  ----
B D                   Wallaby  ====
B D                      Fugu  ====
B D                   Opossum  ----
B D           Tasmanian devil  ====
            Cape golden mole  ----
                    Aardvark  ====

Inserts between block 36 and 37 in window
B D                 Squirrel 7bp
      Lesser Egyptian jerboa 4bp
B D           Naked mole-rat 9bp
B D               Guinea pig 37bp
                  Chinchilla 9bp
            Brush-tailed rat 9bp

Alignment block 37 of 713 in window, 64270650 - 64270660, 11 bps 
B D                     Human  cc-------------------------gggag----cgat----
B D                     Chimp  cc-------------------------gggag----cgat----
B D                   Gorilla  cc-------------------------gggag----cgat----
B D                 Orangutan  cc-------------------------gggag----cgat----
B D                    Gibbon  cc-------------------------gggag----cgat----
B D                    Rhesus  cc-------------------------gggag----tggt----
B D       Crab-eating macaque  cc-------------------------gggag----tggt----
B D                    Baboon  ct-------------------------gggag----tggt----
B D              Green monkey  cc-------------------------gggag----tggt----
B D                  Marmoset  cc-------------------------gggag----cggt----
B D           Squirrel monkey  cc-------------------------gggagcctccggt----
B D                  Bushbaby  ct-------------------------a--------cgaa----
B D                  Squirrel  ac-------------------------gcgat------------
       Lesser Egyptian jerboa  ag-------------------------gggat------------
B D            Naked mole-rat  tt-------------------------gggac----cgaa----
                   Chinchilla  tt-------------------------gggag----tgaa----
             Brush-tailed rat  tt-------------------------gggac----tgaa----
B D                       Pig  ---------------------------agaag----tg------
B D                    Alpaca  ---------------------------agagg----tg------
               Bactrian camel  ---------------------------agagg----tg------
B D                   Dolphin  ---------------------------agaag----gg------
                 Killer whale  ---------------------------agaag----gg------
             Tibetan antelope  ---------------------------agaag----tg------
B D                       Cow  ---------------------------agaag----tg------
B D                     Sheep  ---------------------------agaag----tg------
                Domestic goat  ---------------------------agaag----tg------
B D                     Horse  ---------------------------agaag----tg------
B D          White rhinoceros  ---------------------------agaag----tg------
B D                       Cat  -----------------------------aac----ta------
B D                       Dog  -----------------------------gag----ga------
B D                   Ferret   -----------------------------aag----ta------
B D                     Panda  ------------------------------------ta------
               Pacific walrus  -----------------------------aag----ta------
                 Weddell seal  -----------------------------aag----ta------
             Black flying-fox  ---------------------------agaag----tg------
B D                   Megabat  ---------------------------agaag----tg------
                Big brown bat  ---------------------------agaag----gg------
         David's myotis (bat)  ---------------------------agaag----gg------
B D                  Microbat  ---------------------------agaag----gg------
              Star-nosed mole  ccgcgcgctccgcggatttgggggcccagag-------------
B D                  Elephant  -------------------------------g----tg------
B D                   Manatee  -------------------------------g----tg------
B D        American alligator  cc-------------------------aggat----cc--tcat
B D                      Pika  ============================================
         Cape elephant shrew  ============================================
B D                  Hedgehog  ============================================
B