Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 242 in window, 196761 - 196766, 6 bps 
B D                     Human  cctctc----------
B D                     Chimp  cctctc----------
B D                   Gorilla  cctctc----------
B D                 Orangutan  cctctc----------
B D                    Gibbon  cctctc----------
B D                    Rhesus  cctctc----------
B D       Crab-eating macaque  cctctc----------
B D                    Baboon  cctctc----------
B D              Green monkey  cctctc----------
B D                  Marmoset  cctctc----------
B D           Squirrel monkey  cctctc----------
B D                  Bushbaby  cccctc----------
           Chinese tree shrew  tgtctt----------
B D                  Squirrel  cccttc----------
       Lesser Egyptian jerboa  cccctc----------
                 Prairie vole  cccctc----------
B D           Chinese hamster  cccctc----------
               Golden hamster  cccctc----------
B D                     Mouse  cccctc----------
B D                       Rat  cccctc----------
B D            Naked mole-rat  accctc----------
B D                Guinea pig  cccctc----------
                   Chinchilla  cccctc----------
             Brush-tailed rat  cccctc----------
B D                       Pig  cccctc----------
B D                    Alpaca  cccctc----------
               Bactrian camel  cccctc----------
B D                   Dolphin  cccttc----------
                 Killer whale  cccttc----------
             Tibetan antelope  cacctc----------
B D                       Cow  cacttc----------
B D                     Sheep  cacctc----------
                Domestic goat  cacctc----------
B D                     Horse  cccctc----------
B D          White rhinoceros  cccctt----------
B D                       Cat  tctctccccaccccca
B D                       Dog  cccctc----------
B D                   Ferret   cccctc----------
B D                     Panda  cccttc----------
               Pacific walrus  cccctc----------
                 Weddell seal  cccctc----------
             Black flying-fox  -acctc----------
B D                   Megabat  -acctc----------
                Big brown bat  --gccc----------
         David's myotis (bat)  cccccc----------
B D                  Hedgehog  cccctc----------
B D                     Shrew  -tcatc----------
              Star-nosed mole  -cccct----------
B D                  Elephant  gccctt----------
B D                   Manatee  gccctt----------
B D                    Tenrec  gcacct----------
                     Aardvark  gtcctt----------
B D                 Armadillo  gccctt----------
B D           Tasmanian devil  gatctc----------
B D                  Platypus  atcctc----------
  D               Rock pigeon  --------------ga
  D              Saker falcon  --------------gg
  D       Collared flycatcher  --------------gg
  D    White-throated sparrow  --------------ga
           Tibetan ground jay  --------------gg
B D                Budgerigar  --------------ga
  D             Scarlet macaw  --------------gt
B D                   Chicken  --------------ga
B D                    Turkey  --------------ga
B D        American alligator  --------------ct
  D  Chinese softshell turtle  --------------gc
B D             X. tropicalis  tttctc----------
B D                 Tetraodon  gcgttc----------
B D              Atlantic cod  gacctc----------
B D                      Pika  ----------------
         Cape elephant shrew  ================
B D                    Rabbit  ----------------
B D                   Lamprey  ================
B D               Stickleback  ================
  D            Painted turtle  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D          Peregrine falcon  ================
B D                   Wallaby  ================
    Mexican tetra (cavefish)  ================
B D                   Opossum  ================
            Cape golden mole  ================

Alignment block 2 of 242 in window, 196767 - 196769, 3 bps 
B D                     Human  ccc
B D                     Chimp  ccc
B D                   Gorilla  ccc
B D                 Orangutan  ccc
B D                    Gibbon  ccc
B D                    Rhesus  ccc
B D       Crab-eating macaque  ccc
B D                    Baboon  ccc
B D              Green monkey  ccc
B D                  Marmoset  ccc
B D           Squirrel monkey  ccc
B D                  Bushbaby  ccc
           Chinese tree shrew  ccc
B D                  Squirrel  ccc
       Lesser Egyptian jerboa  ccc
                 Prairie vole  ccc
B D           Chinese hamster  ccc
               Golden hamster  ccc
B D                     Mouse  ccc
B D                       Rat  ccc
B D            Naked mole-rat  ccc
B D                Guinea pig  cct
                   Chinchilla  ccc
             Brush-tailed rat  ccc
B D                    Rabbit  ccc
B D                      Pika  ccc
B D                       Pig  ccc
B D                    Alpaca  ccc
               Bactrian camel  ccc
B D                   Dolphin  ccc
                 Killer whale  ccc
             Tibetan antelope  ccc
B D                       Cow  ccc
B D                     Sheep  ccc
                Domestic goat  ccc
B D                     Horse  ccc
B D          White rhinoceros  ccc
B D                       Cat  ccc
B D                       Dog  ccc
B D                   Ferret   ccc
B D                     Panda  ccc
               Pacific walrus  ccc
                 Weddell seal  ccc
             Black flying-fox  ccc
B D                   Megabat  ccc
                Big brown bat  ccc
         David's myotis (bat)  ccc
B D                  Hedgehog  ccc
B D                     Shrew  ccc
              Star-nosed mole  ccc
B D                  Elephant  ccc
B D                   Manatee  ccc
B D                    Tenrec  ccc
                     Aardvark  ccc
B D                 Armadillo  ccc
B D           Tasmanian devil  aga
B D                  Platypus  ctc
  D               Rock pigeon  tcc
  D              Saker falcon  ggc
  D       Collared flycatcher  aca
  D    White-throated sparrow  acc
B D       Medium ground finch  acc
B D               Zebra finch  atc
           Tibetan ground jay  aga
B D                Budgerigar  tgc
  D             Scarlet macaw  gtc
B D                   Chicken  ccc
B D                    Turkey  tgg
B D        American alligator  gcc
  D  Chinese softshell turtle  tcc
B D             X. tropicalis  a--
B D                 Tetraodon  cct
B D              Atlantic cod  agc
B D                   Lamprey  ctc
         Cape elephant shrew  ===
B D               Stickleback  ===
  D            Painted turtle  ===
  D          Peregrine falcon  ===
B D                   Wallaby  ===
    Mexican tetra (cavefish)  ===
B D                   Opossum  ===
            Cape golden mole  ===

Inserts between block 2 and 3 in window
  D              Rock pigeon 24bp
  D             Saker falcon 16bp
  D      Collared flycatcher 5bp
  D   White-throated sparrow 4bp
B D      Medium ground finch 9bp
B D              Zebra finch 15bp
          Tibetan ground jay 6bp
B D               Budgerigar 9bp
  D            Scarlet macaw 9bp
B D                  Chicken 10bp
B D                   Turkey 8bp
B D       American alligator 6bp
B D                Tetraodon 4bp
B D             Atlantic cod 4bp

Alignment block 3 of 242 in window, 196770 - 196770, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -a
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -a
B D           Chinese hamster  -a
               Golden hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                    Rabbit  -c
B D                      Pika  -a
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Hedgehog  -a
B D                     Shrew  -a
              Star-nosed mole  -a
B D                  Elephant  -a
B D                   Manatee  -a
                     Aardvark  -a
B D                 Armadillo  -c
B D           Tasmanian devil  -t
B D                  Platypus  -c
  D  Chinese softshell turtle  -a
B D             X. tropicalis  -g
B D                 Tetraodon  -g
B D              Atlantic cod  -a
B D                   Lamprey  c-
         Cape elephant shrew  ==
B D                    Tenrec  --
B D               Stickleback  ==
  D            Painted turtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
B D        American alligator  ==
B D                   Opossum  ==
            Cape golden mole  ==

Alignment block 4 of 242 in window, 196771 - 196783, 13 bps 
B D                     Human  attctgtaa-gccc
B D                     Chimp  attctgtaa-gccc
B D                   Gorilla  gttctgtaa-gccc
B D                 Orangutan  attctggaa-gccc
B D                    Gibbon  attctgtaa-gccc
B D                    Rhesus  attctgtaa-gccc
B D       Crab-eating macaque  attctgtaa-gccc
B D                    Baboon  gttctgtaa-gccc
B D              Green monkey  attctgtaa-gccc
B D                  Marmoset  gttctgtaa-gccc
B D           Squirrel monkey  gttctgtaa-gccc
B D                  Bushbaby  attcttgaa-gccc
           Chinese tree shrew  attctcaac-ccac
B D                  Squirrel  attcttgaa-gccc
       Lesser Egyptian jerboa  attctcaaa-g--c
                 Prairie vole  gttctcaga-a--g
B D           Chinese hamster  attctcaaa-a--c
               Golden hamster  attctcaaa-a--c
B D                     Mouse  gttctcaaa-a--c
B D                       Rat  attctcaaa-a--c
B D            Naked mole-rat  attctca-a-gccc
B D                Guinea pig  attct---------
                   Chinchilla  attctcaaa-gccc
             Brush-tailed rat  actttcaga-gttc
B D                    Rabbit  agtctggaa-gccc
B D                      Pika  ggcc------acac
B D                       Pig  attctcgaa-gccc
B D                    Alpaca  attcttgaa-gccc
               Bactrian camel  attcttgaa-gccc
B D                   Dolphin  gttctcgaa-gccc
                 Killer whale  gttctcgaa-gccc
             Tibetan antelope  attcttgat-gccc
B D                       Cow  attcttgac-gccc
B D                     Sheep  attcttgat-gccc
                Domestic goat  attcttgat-gccc
B D                     Horse  atcctcgaa-gccc
B D          White rhinoceros  attctcgaa-gtcc
B D                       Cat  attctccaa-gccc
B D                       Dog  attctccaa-gccc
B D                   Ferret   attctccaa-gccc
B D                     Panda  attctccaa-gccc
               Pacific walrus  actctccaa-gccc
                 Weddell seal  attctccaa-gccc
             Black flying-fox  attctcaaa-gccc
B D                   Megabat  attctcaaa-gccc
                Big brown bat  actctcaaa-gccc
         David's myotis (bat)  actcttaaa-gccc
B D                  Hedgehog  attccagaa-gttc
B D                     Shrew  attcttgaa-accc
              Star-nosed mole  gttctagaa-gccc
B D                  Elephant  gttctc----acag
B D                   Manatee  gttctc----acag
B D                    Tenrec  -----c----acct
                     Aardvark  gttctt----gcag
B D                 Armadillo  gttcttgag-gcac
B D           Tasmanian devil  gctctttgg----c
B D                  Platypus  ctcctccgctgcct
B D             X. tropicalis  gatatttag-gccg
B D                 Tetraodon  aatctgcag-gacc
B D              Atlantic cod  gacccggcc-tacc
B D                   Lamprey  attcacaag-tc--
         Cape elephant shrew  ==============
B D               Stickleback  ==============
  D  Chinese softshell turtle  --------------
  D            Painted turtle  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
B D       Medium ground finch  ==============
  D    White-throated sparrow  ==============
  D       Collared flycatcher  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
B D                   Wallaby  ==============
    Mexican tetra (cavefish)  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
            Cape golden mole  ==============

Alignment block 5 of 242 in window, 196784 - 196793, 10 bps 
B D                     Human  at-g-------------------------ag-------------gagag
B D                     Chimp  at-g-------------------------ag-------------gagag
B D                   Gorilla  at-g-------------------------ag-------------gagag
B D                 Orangutan  ct-g-------------------------ag-------------gagag
B D                    Gibbon  ct-g-------------------------ag-------------gacag
B D                    Rhesus  ct-g-------------------------aa-------------gagag
B D       Crab-eating macaque  ct-g-------------------------aa-------------gagag
B D                    Baboon  ct-g-------------------------aa-------------gagag
B D              Green monkey  ct-g-------------------------aa-------------gagag
B D                  Marmoset  ct-g-------------------------aa-------------gagag
B D           Squirrel monkey  ct-g-------------------------ag-------------gagag
B D                  Bushbaby  cc-a-------------------------gg-------------gagag
           Chinese tree shrew  cc-a-------------------------gg-------------gagag
B D                  Squirrel  tg-t-------------------------gg-------------aagag
       Lesser Egyptian jerboa  tg-g-------------------------gg-------------aagag
                 Prairie vole  tg-g-------------------------gg-------------gagag
B D           Chinese hamster  tg-g-------------------------gg-------------gaaag
               Golden hamster  tt-g-------------------------gg-------------gaaag
B D                     Mouse  tg-g-------------------------gg-------------gagaa
B D                       Rat  tg-g-------------------------gg-------------gagaa
B D            Naked mole-rat  ca-a-------------------------gg-------------gagaa
B D                Guinea pig  -c-a-------------------------gg-------------gagta
                   Chinchilla  cc-a-------------------------gg-------------gagaa
             Brush-tailed rat  cc-a-------------------------gg-------------gagaa
B D                    Rabbit  ca-g-------------------------gg-------------agaca
B D                      Pika  ca-g-------------------------gg-------------aca--
B D                       Pig  cc-g-------------------------ag-------------gagag
B D                    Alpaca  cc-a-------------------------gg-------------gggag
               Bactrian camel  cc-a-------------------------gg-------------gggag
B D                   Dolphin  cc-a-------------------------gg-------------gggag
                 Killer whale  cc-a-------------------------gg-------------gggag
             Tibetan antelope  cc-a-------------------------gg-------------gggag
B D                       Cow  cc-a-------------------------gg-------------gggag
B D                     Sheep  cc-a-------------------------gg-------------gggag
                Domestic goat  cc-a-------------------------gg-------------gggag
B D                     Horse  ct---------------------------gg-------------ga---
B D          White rhinoceros  ct---------------------------gg-------------at---
B D                       Cat  cc---------------------------tg-------------ggaag
B D                       Dog  cc---------------------------tg-------------gaaag
B D                   Ferret   cc---------------------------ca-------------gggag
B D                     Panda  cc---------------------------tg-------------gggag
               Pacific walrus  cc---------------------------tg-------------gggag
                 Weddell seal  cc---------------------------tg-------------gggag
             Black flying-fox  ct-g-------------------------gt-------------ggcag
B D                   Megabat  ct-g-------------------------gt-------------ggcag
                Big brown bat  cc-----------------------------------------------
         David's myotis (bat)  cccg-------------------------gt-------------gggag
B D                  Hedgehog  ct-g-------------------------ag-------------ggagg
B D                     Shrew  ct-ggg-----------------------gg-------------gaagg
              Star-nosed mole  cc-agggaaaaggacagcaggagggaacagg-------------gaagg
B D                  Elephant  ct-c-------------------------g--------------ggaag
B D                   Manatee  ct-t-------------------------ggagaaaaagaaaaagaaaa
B D                    Tenrec  ca-t-------------------------gaggg----------gcgag
                     Aardvark  ct-g-------------------------gg-------------gaaag
B D                 Armadillo  ct-c-------------------------g--------------gcgag
B D           Tasmanian devil  cg-t-------------------------ga-------------gactg
B D                  Platypus  cc-a-------------------------gc------------------
  D       Collared flycatcher  -----------------------------tg-------------agcga
  D    White-throated sparrow  --------------------------------------------aatgg
           Tibetan ground jay  ---------------------------tctg-------------gctgg
B D                Budgerigar  ---------------------------tctg-------------ctgtg
  D             Scarlet macaw  ---------------------------tgtg-------------agggg
B D                   Chicken  -----------------------accccatg-------------aatgg
B D                    Turkey  ---------------------------cagg-------------aaggg
B D        American alligator  -----------------agccttcccccagg-------------aaggg
  D            Painted turtle  -----------------gttctgggaattta-------------gggga
  D  Chinese softshell turtle  -----------------ggcctgccacccag-------------aggta
B D             X. tropicalis  ag-c-------------------------gg-------------ggggg
B D              Atlantic cod  ----------------------------ggg-------------ggggg
B D                   Lamprey  ----------------------------ggg-------------gagag
         Cape elephant shrew  =================================================
B D               Stickleback  =================================================
B D               Zebra finch  =================================================
B D       Medium ground finch  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D               Rock pigeon  =================================================
B D                   Wallaby  =================================================
    Mexican tetra (cavefish)  =================================================
B D                   Opossum  =================================================
            Cape golden mole  =================================================

Inserts between block 5 and 6 in window
  D      Collared flycatcher 22bp
  D   White-throated sparrow 21bp
          Tibetan ground jay 26bp
B D               Budgerigar 15bp
  D            Scarlet macaw 15bp
B D                   Turkey 7bp
B D       American alligator 6bp
B D             Atlantic cod 2bp

Alignment block 6 of 242 in window, 196794 - 196794, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  g
B D           Tasmanian devil  a
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  c
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  c
           Tibetan ground jay  g
B D                Budgerigar  a
  D             Scarlet macaw  a
B D                    Turkey  c
B D        American alligator  a
B D             X. tropicalis  g
B D              Atlantic cod  g
B D                   Lamprey  a
B D                      Pika  -
         Cape elephant shrew  =
B D                    Baboon  -
               Big brown bat  -
B D          White rhinoceros  -
B D                     Horse  -
          Chinese tree shrew  -
B D               Stickleback  =
  D  Chinese softshell turtle  -
  D            Painted turtle  -
B D                  Platypus  -
B D                   Wallaby  =
    Mexican tetra (cavefish)  =
B D                   Opossum  =
            Cape golden mole  =
B D              Green monkey  -
B D       Crab-eating macaque  -
B D                    Rhesus  -

Alignment block 7 of 242 in window, 196795 - 196802, 8 bps 
B D                     Human  g--------------------------gaagg-----cc----
B D                     Chimp  g--------------------------gaagg-----cc----
B D                   Gorilla  g--------------------------gaagg-----cc----
B D                 Orangutan  g--------------------------gaagg-----tc----
B D                    Gibbon  g--------------------------caagg-----cc----
B D                    Rhesus  ----------------------------aagg-----cc----
B D       Crab-eating macaque  ----------------------------aagg-----cc----
B D                    Baboon  ----------------------------aagg-----cc----
B D              Green monkey  ----------------------------aagg-----cc----
B D                  Marmoset  g--------------------------ggagg-----cc----
B D           Squirrel monkey  g--------------------------ggagg-----cc----
B D                  Bushbaby  g--------------------------ggagc-----cc----
           Chinese tree shrew  -----------------------------agg-----cc----
B D                  Squirrel  g--------------------------ggagg-----tc----
       Lesser Egyptian jerboa  g--------------------------ggagg------c----
                 Prairie vole  g--------------------------ggaag------c----
B D           Chinese hamster  g--------------------------ggaag------c----
               Golden hamster  g--------------------------ggaag------c----
B D                     Mouse  g--------------------------agaaagcttccc----
B D                       Rat  g--------------------------agaag------c----
B D            Naked mole-rat  g--------------------------gaatc------c----
B D                Guinea pig  g--------------------------gagtc------c----
                   Chinchilla  g--------------------------gagtc------c----
             Brush-tailed rat  g--------------------------gattc------t----
B D                    Rabbit  g--------------------------gaggc------c----
B D                       Pig  g---------------gagagagagggagagg-----gc----
B D                    Alpaca  a---------------gagagagaaagagagg-----cc----
               Bactrian camel  a---------------gagagagaaagagagg-----cc----
B D                   Dolphin  g---------------gagagagagggagagg-----cc----
                 Killer whale  g---------------gagagagagggagagg-----cc----
             Tibetan antelope  -------------------------ggggaag-----cc----
B D                       Cow  -------------------------ggggagg-----cc----
B D                     Sheep  -------------------------gaggaag-----cc----
                Domestic goat  -------------------------gaggaag-----cc----
B D                     Horse  -------------------------ggagagg-----tc----
B D          White rhinoceros  -------------------------ggagagg-----tc----
B D                       Cat  g---------------gagagagagggaaagg-----cc----
B D                       Dog  g---------------gagagagaggaaggag-----cc----
B D                   Ferret   g---------------gagaaagaggaagagg-----cc----
B D                     Panda  g---------------gagagagagggagagg-----cc----
               Pacific walrus  -------------------------ggagagg-----ct----
                 Weddell seal  g---------------gagagagagggagagg-----ct----
             Black flying-fox  c---------------gagagagagggaggcg-----cc----
B D                   Megabat  c---------------aagagggagggaggcg-----cc----
                Big brown bat  -----------------ggtgggaggtggcag-----cc----
         David's myotis (bat)  g---------------gagggggaggtgggag-----cc----
B D                  Hedgehog  g---------------------gggggagaga-----cc----
B D                     Shrew  g--------------------agaggcggagg-----cc----
              Star-nosed mole  gaaagccagcgggaggagagcagaggcggggg-----gc----
B D                  Elephant  g--------------------------agaag-----cc----
B D                   Manatee  g--------------------------aaaag-----cc----
B D                    Tenrec  g--------------------------agatg-----cc----
                     Aardvark  g--------------------------agaat-----cc----
B D                 Armadillo  g--------------------------agagg-----cc----
B D           Tasmanian devil  g--------------------------caagt-----ca----
B D                  Platypus  -------------------------------------tc----
  D               Rock pigeon  -------------------------ggtgagg-----a-----
  D              Saker falcon  -------------------------ggaaggg-----c-----
  D          Peregrine falcon  -------------------------gagggga-----t-----
  D       Collared flycatcher  -------------------------gaggggc-----a-----
  D    White-throated sparrow  -------------------------aatggga-----t-----
B D       Medium ground finch  -------------------------ggggaga-----t-----
B D               Zebra finch  -------------------------cccgtta-----t-----
           Tibetan ground jay  -------------------------gccacgg-----c-----
B D                Budgerigar  -------------------------atctgtg-----t-----
  D             Scarlet macaw  -------------------------gcagggg-----c-----
B D                    Turkey  -------------------------gcagggc-----c-----
B D        American alligator  -------------------------ggaaagc-----------
  D           Green seaturtle  -------------------------ggaggac-----c-----
  D  Chinese softshell turtle  -------------------------gcggagc-----c-----
B D             X. tropicalis  --------------------------ggggca-----cc----
B D              Atlantic cod  --------------------------gggagg-----cc----
B D                   Lamprey  ------------------------------gg-----ccgacc
B D                      Pika  -------------------------------------------
         Cape elephant shrew  ===========================================
B D               Stickleback  ===========================================
  D            Painted turtle  -------------------------------------------
B D                   Wallaby  ===========================================
    Mexican tetra (cavefish)  ===========================================
B D                   Opossum  ===========================================
            Cape golden mole  ===========================================

Inserts between block 7 and 8 in window
B D                   Baboon 1bp
  D              Rock pigeon 7bp
  D             Saker falcon 12bp
  D         Peregrine falcon 10bp
  D      Collared flycatcher 2bp
  D   White-throated sparrow 7bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 7bp
B D               Budgerigar 17bp
B D                   Turkey 25bp

Alignment block 8 of 242 in window, 196803 - 196808, 6 bps 
B D                     Human  ttt---ctc
B D                     Chimp  ttt---ctc
B D                   Gorilla  ttt---ctc
B D                 Orangutan  ttt---ctc
B D                    Gibbon  ttt---ctc
B D                    Rhesus  ttt---ctc
B D       Crab-eating macaque  ttt---ctc
B D                    Baboon  ttt---ctc
B D              Green monkey  ttt---ctc
B D                  Marmoset  ttc---ctc
B D           Squirrel monkey  ttc---ctc
B D                  Bushbaby  ttt---ctc
           Chinese tree shrew  tgt---ctc
B D                  Squirrel  ttt---ctc
       Lesser Egyptian jerboa  tct---ctc
                 Prairie vole  ttt---ctc
B D           Chinese hamster  ttt---ctc
               Golden hamster  ttt---ctc
B D                     Mouse  ttt---ctc
B D                       Rat  ttt---ctc
B D            Naked mole-rat  tt-----tc
B D                Guinea pig  ttt---ctc
                   Chinchilla  ttt---ctc
             Brush-tailed rat  tt-------
B D                    Rabbit  ttt---gtc
B D                      Pika  ------gct
B D                       Pig  ttc---ctc
B D                    Alpaca  ttc---ctc
               Bactrian camel  ttc---ctc
B D                   Dolphin  ttc---ctc
                 Killer whale  ttc---ctc
             Tibetan antelope  tcc---ctc
B D                       Cow  ttc---ctc
B D                     Sheep  tcc---ctc
                Domestic goat  tcc---ctc
B D                     Horse  ttc---ctc
B D          White rhinoceros  ttc---ctc
B D                       Cat  ttc---ctt
B D                       Dog  ttc---ctc
B D                   Ferret   ttc---ctc
B D                     Panda  ttc---ctc
               Pacific walrus  tac---ctc
                 Weddell seal  tac---ctc
             Black flying-fox  tgg---ctc
B D                   Megabat  tgg---ctc
                Big brown bat  ttc---ctc
         David's myotis (bat)  ttc---ctc
B D                  Hedgehog  ttg---ctg
B D                     Shrew  ttc---ctc
              Star-nosed mole  cct---ctc
B D                  Elephant  ctt---ccg
B D                   Manatee  ctt---ccc
B D                    Tenrec  ctt---gcg
                     Aardvark  ctc---ccc
B D                 Armadillo  tct---ctc
B D           Tasmanian devil  cttacactc
B D                  Platypus  ctc---ctc
  D               Rock pigeon  --g---ctc
  D              Saker falcon  -gt---ccc
  D          Peregrine falcon  -at---tcc
  D       Collared flycatcher  tgg------
  D    White-throated sparrow  tgg---gga
B D       Medium ground finch  tgg---cgc
           Tibetan ground jay  tgg---gcc
B D                Budgerigar  tcc---ctc
B D                    Turkey  cgg---gga
  D           Green seaturtle  cag---gtc
  D  Chinese softshell turtle  cag---ccc
B D             X. tropicalis  -tc---tat
B D              Atlantic cod  tac---ctc
B D                   Lamprey  ---caacac
         Cape elephant shrew  =========
B D               Stickleback  =========
  D            Painted turtle  ---------
B D               Zebra finch  =========
B D                   Wallaby  =========
    Mexican tetra (cavefish)  =========
B D        American alligator  ---------
B D                   Opossum  =========
            Cape golden mole  =========

Alignment block 9 of 242 in window, 196809 - 196820, 12 bps 
B D                     Human  tc---cat--gctc-------ctt
B D                     Chimp  tc---cat--gctc-------ctt
B D                   Gorilla  tc---cat--gctc-------ctt
B D                 Orangutan  tc---cat--gctc-------ctt
B D                    Gibbon  tc---cat--gctc-------ctt
B D                    Rhesus  tc---cat--gctc-------ctt
B D       Crab-eating macaque  tc---cat--gctc-------ctt
B D                    Baboon  tc---cat--gctc-------ctt
B D              Green monkey  tt---cat--gttc-------ctt
B D                  Marmoset  tc---cat--gctc-------ctt
B D           Squirrel monkey  tc---cat--gctc-------ctt
B D                  Bushbaby  tc---cat--gttt-------ctt
           Chinese tree shrew  tc---cat--gctc-------ctc
B D                  Squirrel  tc---cat--gctc-------ctt
       Lesser Egyptian jerboa  t----cat--gcca-------ctt
                 Prairie vole  tc---cat--gctc-------ctt
B D           Chinese hamster  tc---cat--gctc-------ctt
               Golden hamster  tc---cat--gctc-------ctt
B D                     Mouse  cc---cat--gttc-------ctt
B D                       Rat  tc---cat--gctc-------ctt
B D            Naked mole-rat  tc---tgt--gttc-------ttt
B D                Guinea pig  tc---tgt--gttc-------ttt
                   Chinchilla  tc---tgt--gttc-------ttt
             Brush-tailed rat  tc---tgt--gttc-------ttt
B D                    Rabbit  tc---cat--gctc-------ctg
B D                      Pika  ct---cat--gtgc-------cat
B D                       Pig  tc---cat--gttc-------ctt
B D                    Alpaca  tc---cac--gctc-------ctt
               Bactrian camel  tc---cat--gctc-------ctt
B D                   Dolphin  gc---cat--gctc-------ctt
                 Killer whale  gc---cat--gctc-------ctt
             Tibetan antelope  tc---cat--gctc-------ctt
B D                       Cow  tc---cat--gctc-------ctt
B D                     Sheep  tc---cat--gctc-------ctt
                Domestic goat  tc---cat--gctc-------ctt
B D                     Horse  tc---cat--gctc-------ctt
B D          White rhinoceros  tc---cat--gctc-------ctt
B D                       Cat  tc---cat--gccc-------ctt
B D                       Dog  tc---cat--gccc-------ctt
B D                   Ferret   tc---cat--gccc-------ctt
B D                     Panda  tc---cat--gccc-------ctt
               Pacific walrus  tc---cat--gccc-------gtt
                 Weddell seal  tc---cat--gccc-------ctt
             Black flying-fox  tc---cat--gctc-------cct
B D                   Megabat  tc---tat--gctc-------cct
                Big brown bat  tc---cat--gtcc-------ctc
         David's myotis (bat)  tc---cat--gtcc-------ctt
B D                  Hedgehog  tc---t----cctt-------ctg
B D                     Shrew  cc---cat--gctc-------ctt
              Star-nosed mole  cc---c----tctc-------cgg
B D                  Elephant  ac---cat--gctc-------ctg
B D                   Manatee  tc---cat--gctc-------ctg
B D                    Tenrec  cc---cat--gttc-------cgg
                     Aardvark  tc---cat--gctc-------ctg
B D                 Armadillo  tc---cat--gctc-------ctt
B D           Tasmanian devil  ta---ctt--gcct-------cag
B D                  Platypus  gtaagcat--cctg-------ctg
  D               Rock pigeon  tc---cca--tggc-------ctt
  D              Saker falcon  tt---ggg--gagg-------gtg
  D          Peregrine falcon  tg---caa--gggg-------ttc
  D       Collared flycatcher  -t---gag--gggg-------ctc
  D    White-throated sparrow  cc---cag--gaatggga---tcc
B D       Medium ground finch  tt---ccg--gctc-------tcc
B D               Zebra finch  -c---acg--gctc-------ctc
           Tibetan ground jay  cc---cag--gtgtg------tcc
B D                Budgerigar  ac---cag--gtcaa------gac
B D                    Turkey  cc---tga--gcgc-------cac
B D        American alligator  ----------------tagacctc
  D           Green seaturtle  cg---ccc--gcca-------cct
  D            Painted turtle  tt---tcc--atgg-------cct
  D  Chinese softshell turtle  ca---gcccagggg-------gcc
B D             X. tropicalis  tt---aaa--gctc-------ctg
B D                   Lamprey  tc---cgt--gttc-------cct
         Cape elephant shrew  ========================
B D               Stickleback  ========================
B D                   Wallaby  ========================
    Mexican tetra (cavefish)  ========================
B D                   Opossum  ========================
            Cape golden mole  ========================

Alignment block 10 of 242 in window, 196821 - 196829, 9 bps 
B D                     Human  ----t----------------------------------------------------t--g--------c
B D                     Chimp  ----tnnnnnnnnnngcccatgaggagagaggaaggcctttctctccatgcttctttt--g--------c
B D                   Gorilla  ----t----------------------------------------------------t--g--------c
B D                 Orangutan  ----t----------------------------------------------------t--g--------c
B D                    Gibbon  ----t----------------------------------------------------t--g--------c
B D                    Rhesus  ----t----------------------------------------------------t--g--------c
B D       Crab-eating macaque  ----t----------------------------------------------------t--g--------c
B D                    Baboon  ----t----------------------------------------------------t--g--------c
B D              Green monkey  ----t----------------------------------------------------t--g--------c
B D                  Marmoset  ----t----------------------------------------------------t--g--------c
B D           Squirrel monkey  ----t----------------------------------------------------t--g--------c
B D                  Bushbaby  ----t----------------------------------------------------t--g--------c
           Chinese tree shrew  ----c----------------------------------------------------t--g--------c
B D                  Squirrel  ----t----------------------------------------------------t--t--------t
       Lesser Egyptian jerboa  ----t----------------------------------------------------t--t--------t
                 Prairie vole  ----t----------------------------------------------------t--t--------a
B D           Chinese hamster  ----t----------------------------------------------------t--t--------a
               Golden hamster  ----t----------------------------------------------------t--t--------a
B D                     Mouse  ----t----------------------------------------------------t--t--------a
B D                       Rat  ----t----------------------------------------------------t--t--------a
B D            Naked mole-rat  ----t----------------------------------------------------c--c--------c
B D                Guinea pig  ----t----------------------------------------------------c--t--------c
                   Chinchilla  ----t----------------------------------------------------c--t--------t
             Brush-tailed rat  ----t----------------------------------------------------a--t--------c
B D                    Rabbit  ----t----------------------------------------------------t--g--------c
B D                      Pika  ----t----------------------------------------------------t--g--------c
B D                       Pig  ----t----------------------------------------------------t--c--------t
B D                    Alpaca  ----t----------------------------------------------------t--c--------t
               Bactrian camel  ----t----------------------------------------------------t--c--------t
B D                   Dolphin  ----t----------------------------------------------------t--c--------t
                 Killer whale  ----t----------------------------------------------------t--c--------t
             Tibetan antelope  ----t----------------------------------------------------t--c--------t
B D                       Cow  ----t----------------------------------------------------t--c--------t
B D                     Sheep  ----t----------------------------------------------------t--c--------t
                Domestic goat  ----t----------------------------------------------------t--c--------t
B D                     Horse  ----t----------------------------------------------------t--t--------c
B D          White rhinoceros  ----t----------------------------------------------------t--t--------c
B D                       Cat  ----t----------------------------------------------------t--t---------
B D                       Dog  ----t----------------------------------------------------t--t--------c
B D                   Ferret   ----t----------------------------------------------------c--t--------c
B D                     Panda  ----t----------------------------------------------------t--t--------c
               Pacific walrus  ----t----------------------------------------------------t--t--------c
                 Weddell seal  ----t----------------------------------------------------t--t--------c
             Black flying-fox  ----t----------------------------------------------------c--g--------c
B D                   Megabat  ----t----------------------------------------------------c--g--------c
                Big brown bat  ----t----------------------------------------------------g--t--------c
         David's myotis (bat)  ----t----------------------------------------------------t--t--------c
B D                  Hedgehog  ----g----------------------------------------------------g--g--------t
B D                     Shrew  ----t----------------------------------------------------t--t--------c
              Star-nosed mole  ----t----------------------------------------------------t--c--------c
B D                  Elephant  ----g----------------------------------------------------t--g--------t
B D                   Manatee  ----g----------------------------------------------------t--g--------t
B D                    Tenrec  ----c----------------------------------------------------c--g--------c
                     Aardvark  ----g----------------------------------------------------t--g--------t
B D                 Armadillo  ----c----------------------------------------------------t--g--------c
B D           Tasmanian devil  ----t----------------------------------------------------t--t--------c
B D                  Platypus  ----g----------------------------------------------------t--c--------g
  D               Rock pigeon  ----t----------------------------------------------------t--g--------g
  D              Saker falcon  ----a----------------------------------------------------c--g--------c
  D          Peregrine falcon  ----c----------------------------------------------------t--g--------c
  D       Collared flycatcher  ----c----------------------------------------------------t--g--------g
  D    White-throated sparrow  aggaa----------------------------------------------------t--g--------g
B D       Medium ground finch  ----c----------------------------------------------------c--g--------g
B D               Zebra finch  ----g----------------------------------------------------t--g--------g
           Tibetan ground jay  ----c----------------------------------------------------c--a--------g
B D                Budgerigar  ----a----------------------------------------------------t--g--------g
B D                    Turkey  ----c----------------------------------------------------a--g--------c
B D        American alligator  ----c----------------------------------------------------t--g--------g
  D           Green seaturtle  ----c----------------------------------------------------t--gccctcgccc
  D            Painted turtle  ----g----------------------------------------------------t--g--------t
  D  Chinese softshell turtle  ----g----------------------------------------------------t--g----ctccc
B D             X. tropicalis  ----t----------------------------------------------------taag--------t
         Cape elephant shrew  ======================================================================
B D               Stickleback  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Opossum  ======================================================================
            Cape golden mole  ======================================================================

                        Human  gg------ga-a
                        Chimp  gg------ga-a
                      Gorilla  gg------ga-a
                    Orangutan  ga------ga-a
                       Gibbon  gg------ga-a
                       Rhesus  ag------ga-a
          Crab-eating macaque  ag------ga-a
                       Baboon  ag------ga-a
                 Green monkey  ag------ga-a
                     Marmoset  ag------ga-a
              Squirrel monkey  gg------ga-a
                     Bushbaby  gg------ca-a
           Chinese tree shrew  ag------ga-a
                     Squirrel  gg------ga-a
       Lesser Egyptian jerboa  gg------ga-a
                 Prairie vole  gg------ga-a
              Chinese hamster  gg------ga-a
               Golden hamster  gg------ga-a
                        Mouse  gg------ga-g
                          Rat  gg------ga-a
               Naked mole-rat  tg------ga-a
                   Guinea pig  gg------ga-a
                   Chinchilla  gg------aa-a
             Brush-tailed rat  gg------ga-a
                       Rabbit  ag------ga-c
                         Pika  ag------ga--
                          Pig  -g------ga-a
                       Alpaca  -g------ga-a
               Bactrian camel  -g------ga-a
                      Dolphin  -g------gg-a
                 Killer whale  -g------gg-a
             Tibetan antelope  -g------ga-a
                          Cow  -g------ga-a
                        Sheep  -g------ga-a
                Domestic goat  -g------ga-a
                        Horse  gg------ga-a
             White rhinoceros  ag------ga-a
                          Cat  gg------ga-a
                          Dog  ga------ga-a
                      Ferret   gg------ga-a
                        Panda  gg------ga-a
               Pacific walrus  gg------ga-a
                 Weddell seal  gg------ga-a
             Black flying-fox  -g------ga-a
                      Megabat  -g------ga-a
                Big brown bat  gg------ga-c
         David's myotis (bat)  gg------ga-a
                     Hedgehog  gg------gagg
                        Shrew  ag------ga-a
              Star-nosed mole  ag------g---
                     Elephant  gg------gc--
                      Manatee  gg------gc--
                       Tenrec  gg------ga--
                     Aardvark  gg------gt--
                    Armadillo  ag------ga-a
              Tasmanian devil  -----------c
                     Platypus  gg------gc-a
                  Rock pigeon  gg------gg-t
                 Saker falcon  at------gg-g
             Peregrine falcon  ga------gg-g
          Collared flycatcher  gt------ga-g
       White-throated sparrow  gg------aa-c
          Medium ground finch  gg------aa-t
                  Zebra finch  agct----ga-g
           Tibetan ground jay  gt------gt-g
                   Budgerigar  gg------ca-g
                       Turkey  agctgccaga-g
           American alligator  gg------ga-g
              Green seaturtle  ct----------
               Painted turtle  gt----------
     Chinese softshell turtle  gt----------
                X. tropicalis  gg------ga-a
          Cape elephant shrew  ============
                  Stickleback  ============
                      Wallaby  ============
     Mexican tetra (cavefish)  ============
                      Opossum  ============
             Cape golden mole  ============

Inserts between block 10 and 11 in window
  D          Green seaturtle 7bp
  D           Painted turtle 4bp
  D Chinese softshell turtle 14bp

Alignment block 11 of 242 in window, 196830 - 196835, 6 bps 
B D                     Human  ctccct
B D                     Chimp  ctccct
B D                   Gorilla  ctccct
B D                 Orangutan  ctccct
B D                    Gibbon  ctccct
B D                    Rhesus  ctccct
B D       Crab-eating macaque  ctccct
B D                    Baboon  ccccct
B D              Green monkey  ctccct
B D                  Marmoset  ctccct
B D           Squirrel monkey  ctccct
B D                  Bushbaby  ctccct
           Chinese tree shrew  ctcctt
B D                  Squirrel  ctgcct
       Lesser Egyptian jerboa  ttacct
                 Prairie vole  ctgcct
B D           Chinese hamster  ctgcct
               Golden hamster  ctgcct
B D                     Mouse  ttgcct
B D                       Rat  ttgcct
B D            Naked mole-rat  ctgcct
B D                Guinea pig  ctacca
                   Chinchilla  ctgcct
             Brush-tailed rat  ctgact
B D                    Rabbit  ctccct
B D                       Pig  ctccct
B D                    Alpaca  ctccct
               Bactrian camel  ctccct
B D                   Dolphin  ctccct
                 Killer whale  ctccct
             Tibetan antelope  caccct
B D                       Cow  caccct
B D                     Sheep  caccct
                Domestic goat  caccct
B D                     Horse  caccct
B D          White rhinoceros  cagcct
B D                       Cat  ctgcct
B D                       Dog  ccccct
B D                   Ferret   ctccct
B D                     Panda  ctccct
               Pacific walrus  ctccct
                 Weddell seal  ctccct
             Black flying-fox  ctcccc
B D                   Megabat  ctgccc
                Big brown bat  ctccct
         David's myotis (bat)  ctccct
B D                  Hedgehog  gctgct
B D                     Shrew  atccct
              Star-nosed mole  -ccccc
B D                 Armadillo  ctccct
B D           Tasmanian devil  catccg
  D               Rock pigeon  ctcc--
  D              Saker falcon  accctt
  D          Peregrine falcon  cttcct
  D       Collared flycatcher  t-----
  D    White-throated sparrow  ctggaa
B D       Medium ground finch  tttgtc
B D               Zebra finch  ctcatc
           Tibetan ground jay  tcccct
B D                Budgerigar  agggtc
B D                    Turkey  cccct-
B D        American alligator  cc----
B D             X. tropicalis  cttatt
B D                      Pika  ------
         Cape elephant shrew  ======
B D                    Tenrec  ------
B D                   Manatee  ------
B D                  Elephant  ------
B D               Stickleback  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                  Platypus  ------
B D                   Wallaby  ======
    Mexican tetra (cavefish)  ======
B D                   Opossum  ======
            Cape golden mole  ======
                    Aardvark  ------

Inserts between block 11 and 12 in window
  D              Rock pigeon 10bp
  D             Saker falcon 16bp
  D         Peregrine falcon 6bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 9bp
B D              Zebra finch 11bp
          Tibetan ground jay 11bp
B D               Budgerigar 21bp
B D       American alligator 11bp

Alignment block 12 of 242 in window, 196836 - 196864, 29 bps 
B D                     Human  ggcac---------caaggc------cagg------------gggga-------a-------------a-
B D                     Chimp  ggcac---------caaggc------cagg------------gggga-------a-------------a-
B D                   Gorilla  ggcac---------caaggc------cagg------------gggga-------a-------------a-
B D                 Orangutan  ggcac---------caaggc------c-gg------------gggga-------a-------------a-
B D                    Gibbon  ggcac---------caaggc------cagg------------gggga-------a-------------a-
B D                    Rhesus  ggcac---------caaggc------cagg------------gggga-------c-------------a-
B D       Crab-eating macaque  ggcac---------caaggc------cagg------------gggga-------c-------------a-
B D                    Baboon  ggcac---------caaggc------cagg------------gggca-------c-------------a-
B D              Green monkey  ggcac---------caaggc------cagg------------gcgga-------c-------------a-
B D                  Marmoset  ggtac---------aaagac------caga------------gggga-------c-------------a-
B D           Squirrel monkey  ggcac---------caaaac------caga------------gggga-------c-------------a-
B D                  Bushbaby  ggcac---------agaggc------c-ca------------gggga-------c-------------a-
           Chinese tree shrew  ggagc---------aaaggc------t----------------gtga-------g-------------c-
B D                  Squirrel  ggcat---------tgaggc------c-ag------------gggga-------c-------------a-
       Lesser Egyptian jerboa  ggaac---------aggtgc------c-ag------------gggga-------c-------------a-
                 Prairie vole  ggcac---------agacgc------c-ag------------ggggc-------t-------------a-
B D           Chinese hamster  ggcac---------agacgc------c-ag------------gggga-------c-------------a-
               Golden hamster  ggcac---------agacgc------c-ag------------gggga-------c-------------a-
B D                     Mouse  ggcac---------agacac------c-ag------------gggga-------c-------------a-
B D                       Rat  ggcac---------agacgc------c-ag------------gggga-------c-------------a-
B D            Naked mole-rat  ggcac---------tgagac------c-c-----------------------------------------
B D                Guinea pig  ggtac---------tgagat------c-ca------------gggaa-------g-------------g-
                   Chinchilla  ggtac---------tgagac------c-cg------------gggaa-------g-------------g-
             Brush-tailed rat  ggtac---------tgagac------c-ag------------gggaa-------g-------------g-
B D                    Rabbit  ggctc---------caa-gc------c-cg------------gggga-------c-------------a-
B D                      Pika  --------------------------a-cg------------gggca-------c-------------a-
B D                       Pig  ggcac---------cgaggc------c-gg------------tgtga-------c-------------g-
B D                    Alpaca  ggcag---------caaggc------t-gg------------tgtgg-------c-------------a-
               Bactrian camel  ggcagcaaggccatcaaggc------t-gg------------cgtgg-------c-------------a-
B D                   Dolphin  ggcac---------cgaggc------c-ag------------tgcga-------c-------------g-
                 Killer whale  ggcac---------cgaggc------c-ag------------tgcga-------c-------------g-
             Tibetan antelope  ggcac---------caaggc------t-gg------------tgcga-------c-------------a-
B D                       Cow  ggcac---------caaggc------t-gg------------tgcga-------c-------------g-
B D                     Sheep  ggcac---------caaggc------t-gg------------tgcga-------c-------------a-
                Domestic goat  ggcac---------caaggc------g-gg------------tgcga-------c-------------a-
B D                     Horse  ggcac---------caagga------t-gg------------tgcaa-------c-------------a-
B D          White rhinoceros  ggcac---------caaagc------c-ag------------tgcaa-------c-------------a-
B D                       Cat  ggcat---------tgaggc------c-gg------------tgcga-------c-------------g-
B D                       Dog  ggcac---------tgaggc------c-ag------------ctcga-------c-------------g-
B D                   Ferret   ggcac---------tgaggc------c-ag------------agtga-------c-------------a-
B D                     Panda  ggcac---------tgaggc------c-ag------------agtga-------c-------------g-
               Pacific walrus  ggcac---------tgaggc------c-ag------------agcaa-------a-------------g-
                 Weddell seal  ggcac---------tgaggc------c-gg------------agtga-------c-------------g-
             Black flying-fox  ggctc---------caagga------c-aa------------tgtga-------c-------------a-
B D                   Megabat  ggctc---------cacgga------c-aa------------tgtga-------c-------------a-
                Big brown bat  gacgc---------ggagcg------c-ga------------tgcag-------c-------------g-
         David's myotis (bat)  gacgc---------ggagga------c-ga------------tgcga-------c-------------a-
B D                  Hedgehog  ggcac---------ccccac--------------------------------------------------
B D                     Shrew  ggcac---------caacgt------c-gg------------tgcaa-------c-------------a-
              Star-nosed mole  ggcac---------caaggc----------------------------------c-------------a-
B D                  Elephant  ---ac---------caaggc------c-ag------------gggtt-------c-------------a-
B D                   Manatee  ---ac---------cgagac------c-ag------------cgg-t-------c-------------a-
B D                    Tenrec  ---cc---------cgaggc------c-gg------------tgggg-------c-------------t-
                     Aardvark  ---ac---------caaggt------c-ag------------ggggt-------c-------------a-
B D                 Armadillo  gggac---------cgaggc------c-gg------------gggga-------c-------------a-
B D           Tasmanian devil  caaaa---------tgagga------caca------------ctgga-------g-------------a-
B D                  Platypus  ---ag---------ggagga------g-ga------------ggtgg-------g-------------g-
  D               Rock pigeon  ----------------ggtg------c-cc------------tggga-------g-------------g-
  D              Saker falcon  ----------------ggtc------c-ct------------tgggg-------agggtgatgaaggca-
  D          Peregrine falcon  ----------------ggtc------c-ct------------gcgag-------gaaatcttgcaa--a-
  D       Collared flycatcher  ----------------ggca------g-tt------------ggtga-------a-------------a-
  D    White-throated sparrow  ----------------ggaa------c-cc------------cggaa-------t-------------g-
B D       Medium ground finch  ----------------ggtg------c-cc------------ggg-------------------------
B D               Zebra finch  ----------------ggcagcagctc-cc------------agcag-------c-------------g-
           Tibetan ground jay  ----------------tgtc------c-cc------------aggtg-------t-------------gt
B D                Budgerigar  ----------------ggaa------c-acgt--------tagggga-------c-------------a-
  D             Scarlet macaw  ----------------agga------c-cc----------tgtggga-------t-------------g-
B D                    Turkey  ------------------------------gccaggacggtgagtga-------c-------------a-
B D        American alligator  ----------------ggga------t-gc------------agaaa-------g-------------g-
  D           Green seaturtle  ----------------gggc------c-cg------------gggga-------c-------------a-
  D            Painted turtle  ----------------gggt------c-ct------------gggaatgcccagt-------------a-
  D  Chinese softshell turtle  ----------------gggc------c-ct------------gg--------------------------
B D             X. tropicalis  cccac---------tcaggc--------ag------------cagaa-------t-------------g-
         Cape elephant shrew  ======================================================================
B D               Stickleback  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Opossum  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---------------ggac---------------agt----
                        Chimp  ---------------ggac---------------agt----
                      Gorilla  ---------------ggac---------------agt----
                    Orangutan  ---------------ggac---------------ggt----
                       Gibbon  ---------------gggc---------------ggt----
                       Rhesus  ---------------ggac---------------ggt----
          Crab-eating macaque  ---------------ggac---------------ggt----
                       Baboon  ---------------ggac---------------ggt----
                 Green monkey  ---------------ggac---------------ggt----
                     Marmoset  ---------------ggac---------------ggt----
              Squirrel monkey  ---------------ggac---------------ggt----
                     Bushbaby  ----------------gac---------------tgt----
           Chinese tree shrew  ---------------tggc---------------tgt----
                     Squirrel  ---------------ggac---------------tac----
       Lesser Egyptian jerboa  ---------------gg-c---------------cac----
                 Prairie vole  ---------------gg-c---------------cac----
              Chinese hamster  ---------------gg-c---------------tac----
               Golden hamster  ---------------gg-c---------------cac----
                        Mouse  ---------------gg-c---------------cac----
                          Rat  ---------------gg-c---------------cat----
               Naked mole-rat  ---------------ggac---------------tgc----
                   Guinea pig  ---------------ggac---------------cac----
                   Chinchilla  ---------------ggac---------------cac----
             Brush-tailed rat  ---------------ggac---------------cac----
                       Rabbit  ---------------gaac---------------ccc----
                         Pika  ---------------gagt---------------gcc----
                          Pig  ---------------ggac---------------tgc----
                       Alpaca  ---------------ggac---------------cgc----
               Bactrian camel  ---------------ggac---------------cgc----
                      Dolphin  ---------------ggat---------------tgc----
                 Killer whale  ---------------ggat---------------tgc----
             Tibetan antelope  ---------------ggac---------------cgc----
                          Cow  ---------------ggac---------------cac----
                        Sheep  ---------------ggac---------------cgc----
                Domestic goat  ---------------ggac---------------cgc----
                        Horse  ---------------ggac---------------cgc----
             White rhinoceros  ---------------ggac---------------cgc----
                          Cat  ---------------ggac---------------gac----
                          Dog  ---------------ggac---------------cac----
                      Ferret   ---------------ggac---------------cgc----
                        Panda  ---------------ggac---------------cgc----
               Pacific walrus  ---------------ggac---------------cac----
                 Weddell seal  ---------------ggac---------------cgc----
             Black flying-fox  ---------------ggac---------------cac----
                      Megabat  ---------------ggac---------------cac----
                Big brown bat  ---------------gtac---------------cgc----
         David's myotis (bat)  ---------------ggac---------------cac----
                     Hedgehog  ---------------tgga---------------cgc----
                        Shrew  ---------------ggac---------------cac----
              Star-nosed mole  ---------------gggc---------------cgc----
                     Elephant  ---------------ggaa---------------ccc----
                      Manatee  ---------------ggaa---------------ccc----
                       Tenrec  ---------------gaaa---------------ccc----
                     Aardvark  ---------------ggac---------------ccc----
                    Armadillo  ---------------gcac---------------cgc----
              Tasmanian devil  ---------------agac---------------aat----
                     Platypus  ---------------gg------------------------
                  Rock pigeon  ---------------gggt----------------------
                 Saker falcon  ---------------gggt----------------------
             Peregrine falcon  ---------------ggga----------------------
          Collared flycatcher  ---------------gggc----------------------
       White-throated sparrow  ---------------ggga----------------------
          Medium ground finch  -----------------------------------------
                  Zebra finch  ---------------ggaa----------------------
           Tibetan ground jay  ccccaccccccaggtgtgt----------------------
                   Budgerigar  ---------------gggt------ggttcctga-------
                Scarlet macaw  ---------------aagc----------------------
                       Turkey  ---------------gggt----------------------
           American alligator  ---------------gggcaagggcagctccaga-------
              Green seaturtle  ---------------ggac----------------------
               Painted turtle  ---------------gaat----------------------
     Chinese softshell turtle  -----------------------------------------
                X. tropicalis  ---------------ggcc---------------cgattgt
          Cape elephant shrew  =========================================
                  Stickleback  =========================================
                      Wallaby  =========================================
     Mexican tetra (cavefish)  =========================================
                      Opossum  =========================================
             Cape golden mole  =========================================

Inserts between block 12 and 13 in window
B D          Tasmanian devil 2550bp
B D                 Platypus 2bp
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 2bp
B D                   Turkey 1bp
B D       American alligator 3bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp

Alignment block 13 of 242 in window, 196865 - 196886, 22 bps 
B D                     Human  ctctg-atgaggatgg----------gtctcta
B D                     Chimp  ctctg-atgaggatgg----------gtctcta
B D                   Gorilla  ctctg-atgaggatgg----------gtctcta
B D                 Orangutan  ctctg-aggaggatgg----------gtctgta
B D                    Gibbon  ctctg-aggaggatgg----------gtccgta
B D                    Rhesus  ctctg-aggaggatgg----------gtccgta
B D       Crab-eating macaque  ctctg-aggaggatgg----------gtccgta
B D                    Baboon  ctctg-aggaggatgg----------gtccata
B D              Green monkey  ctctg-aggaggatgg----------gtccgta
B D                  Marmoset  ctctg-aggaggatgg----------gaccgta
B D           Squirrel monkey  ctctg-aggaggatgg----------gacagta
B D                  Bushbaby  cccag-aggaggctgg----------gtccata
           Chinese tree shrew  ccctg-aggaggctgg----------gtctgta
B D                  Squirrel  ctgtg-aggaggctgg----------gtca-ca
       Lesser Egyptian jerboa  ctgtg-aag------------------tcc-ca
                 Prairie vole  cggtg-aggcggctgg----------tccc-ca
B D           Chinese hamster  cggtg-agaaggctgg----------gtcc-ca
               Golden hamster  cggtg-aggaggctgg----------gtcc-ca
B D                     Mouse  cggtg-aggaggctgg----------gtcc-ta
B D                       Rat  cggtg-aggaggctag----------gtcc-ta
B D            Naked mole-rat  ctgca-aggaggctgg----------gtgg-ca
B D                Guinea pig  ctacg-aggagtttgg----------gtgt-ca
                   Chinchilla  ctgcg-aggaggctgg----------gtgg-ca
             Brush-tailed rat  ctaca-aggaggctgg----------gtgg-ca
B D                    Rabbit  ctctg-acaaggccgg----------gtccaca
B D                      Pika  ccctg-atcaggctgg----------gtcc---
B D                       Pig  ctctg-aaaagtccca----------gtccata
B D                    Alpaca  ctctg-aggaggctgg----------gtccgta
               Bactrian camel  ctctg-aggaggctgg----------gtccgta
B D                   Dolphin  ctctg-agaaggctcg----------gtccata
                 Killer whale  ctctg-agaaggctcg----------gtccata
             Tibetan antelope  ctctg-agaaggctca----------gtccact
B D                       Cow  ctctg-agaaggctca----------gtccata
B D                     Sheep  ctctg-agaaggctca----------gtccact
                Domestic goat  ctctg-agaaggctca----------gtcccct
B D                     Horse  ctctg-aggc---ttg----------gtctgta
B D          White rhinoceros  ctcta-aggagg-ctg----------gtccata
B D                       Cat  ctcca-aggaggctcg----------gtccata
B D                       Dog  ctctg-aggaggtttg----------gtccgta
B D                   Ferret   ctctg-aggaggcctg----------gtccata
B D                     Panda  ctctg-aggaggcttg----------gtccata
               Pacific walrus  ctctg-aggaggcttg----------ttccata
                 Weddell seal  ctctg-aggaggcttg----------gtccata
             Black flying-fox  ctctg-aggaggcttg----------gcccata
B D                   Megabat  ctctg-aggaggcttg----------gcccata
                Big brown bat  ctctg-aggaggcgcg----------gcccgta
         David's myotis (bat)  ctctg-aggaggctcg----------gtccata
B D                  Hedgehog  ctctg-aggaggctca----------gc---ta
B D                     Shrew  ctctg-aggaggctcg----------ggccata
              Star-nosed mole  ctctgtaggtagcttg----------gtccaca
B D                  Elephant  cactg-a-gcagctca----------gtcccta
B D                   Manatee  cactg-a-gcagctcg----------gtcccta
B D                    Tenrec  cactg-a-gccactca----------ag-cctg
                     Aardvark  cacta-a-g--------------------ccta
B D                 Armadillo  cacag-acgaggctca----------gtccata
B D                  Platypus  cggcg-gggggggggg----------ggcca--
  D               Rock pigeon  ccccc-ttcctgaccccccttccctcg------
  D              Saker falcon  ccttg-gggagggtgacgc-------a------
  D          Peregrine falcon  cctgt-gaggggatcctgct------a------
  D       Collared flycatcher  gctgg-tga-----------------g------
  D    White-throated sparrow  cccgg-aat-----------------g------
B D       Medium ground finch  cccgg-agc-----------------a------
B D               Zebra finch  cagga-ggt-----------------g------
           Tibetan ground jay  ccagg-tgtgtcccca----------g------
B D                Budgerigar  caggg-cacagacccacttc------t------
  D             Scarlet macaw  caggg-aatgaggctgcttt------g------
B D                    Turkey  acagg-gtgggcacagcacag-----g------
B D        American alligator  gccgg-gccaggccctctag------g------
  D           Green seaturtle  cctgc-ggcggcgtgct---------g------
  D            Painted turtle  ttggg-gggggggtcct---------g------
  D  Chinese softshell turtle  ctggg-aggggcagaca---------t------
B D             X. tropicalis  cctgc-agaaccatct----------gttacct
         Cape elephant shrew  =================================
B D               Stickleback  =================================
B D                   Wallaby  =================================
    Mexican tetra (cavefish)  =================================
B D                   Opossum  =================================
B D           Tasmanian devil  =================================
            Cape golden mole  =================================

Inserts between block 13 and 14 in window
B D                 Platypus 8bp

Alignment block 14 of 242 in window, 196887 - 196952, 66 bps 
B D                     Human  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                     Chimp  gact-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                   Gorilla  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                 Orangutan  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                    Gibbon  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                    Rhesus  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D       Crab-eating macaque  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                    Baboon  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D              Green monkey  ggct-----------gc-t--c-------tg---agtg-----ct---------------------gt-c
B D                  Marmoset  ggct-----------gc-c--t-------gg---agtg-----ct---------------------gt-c
B D           Squirrel monkey  gggg-----------gc-c--t-------gg---------------------------------------
B D                  Bushbaby  ggct-----------gc-t--c-------tg---agca-----cc---------------------ac-c
           Chinese tree shrew  gg-t-----------gc-c--c-------tg---agag-----tt---------------------gc-c
B D                  Squirrel  ggtt-----------gc-t--c-------tg---agc------ct---------------------gc-t
       Lesser Egyptian jerboa  agct-----------gc-t--c-------ta---cac------ct---------------------gc-t
                 Prairie vole  agtt-----------gc-t--c-------ta---agc------cc---------------------at-t
B D           Chinese hamster  agct-----------gc-c--c-------ta---agc------cc---------------------at-t
               Golden hamster  agct-----------gc-c--c-------ta---agc------cc---------------------at-t
B D                     Mouse  agct-----------gc-t--c-------ta---agc------cc---------------------at-t
B D                       Rat  agct-----------gc-t--c-------ta---agc------cc---------------------at-t
B D            Naked mole-rat  ggcc-----------ac-t--c-------tg---agc------t-----------------------g-c
B D                Guinea pig  ggcc-----------ac-t--c-------tg---aac------t-----------------------g-c
                   Chinchilla  ggct-----------ac-t--c-------tg---cac------t-----------------------g-c
             Brush-tailed rat  ggcc-----------ac-t--c-------tg---agc------t-----------------------g-c
B D                    Rabbit  ggtt-----------gc-t--c-------gg---agc------cc---------------------ac-t
B D                      Pika  ----------------c-t--a-------gg---agg------cc---------------------ac-t
B D                       Pig  ggct-----------gt-t--c-------tg---ggca-----cc---------------------gc-t
B D                    Alpaca  ggtc-----------tc-t--c-------tg---agtg-----ct---------------------gc-t
               Bactrian camel  ggtc-----------tc-t--c-------tg---agtg-----ct---------------------gc-t
B D                   Dolphin  ggtt-----------gc-t--c-------tg---agca-----tt---------------------tc-t
                 Killer whale  ggtt-----------gc-t--c-------tg---agca-----tt---------------------gc-t
             Tibetan antelope  ggtc-----------gc-t--c-------tg---agtg-----ct---------------------gc-t
B D                       Cow  ggtc-----------gc-t--c-------tg---agtg-----ct---------------------gc-t
B D                     Sheep  ggtc-----------gc-t--c-------tg---agtg-----ct---------------------gc-t
                Domestic goat  ggtc-----------gc-t--c-------tg---agtg-----ct---------------------gc-t
B D                     Horse  ggtt-----------gc-t--c-------tg---agcg-----tt---------------------gc-t
B D          White rhinoceros  tgtt-----------gc-t--c-------tg---agcg-----tc---------------------gc-t
B D                       Cat  ggtt-----------gc-t--c-------tg---agtg-----ca---------------------gc-t
B D                       Dog  ggtt-----------gc-t--c-------tg---agcg-----ca---------------------gc-t
B D                   Ferret   ggtt-----------gc-t--c-------tg---agag-----ca---------------------gc-t
B D                     Panda  ggtt-----------gc-t--c-------tg---agca-----ca---------------------gc-t
               Pacific walrus  ggtt-----------gc-t--c-------tg---agcg-----ca---------------------gc-t
                 Weddell seal  ggtt-----------gc-t--c-------tg---agcg-----ca---------------------gc-t
             Black flying-fox  ggtt-----------gc-t--c-------tg---agtg-----cg---------------------gc-t
B D                   Megabat  ggtt-----------gctt--c-------tg---agtg-----cg---------------------gcat
                Big brown bat  ggtt------------c-t--c-------gg---agcg-----cc---------------------gc-a
         David's myotis (bat)  ggtt-----------gc-t--c-------gg---agca-----cc---------------------gc-c
B D                  Hedgehog  ggct-----------gc----t-------ga---ggga-----cg-------------------------
B D                     Shrew  ggtt-----------gc-t--c-------ta---agag-----ct---------------------gc-t
              Star-nosed mole  gggt-----------gc----c-------ag---gggg-----cg---------------------gc-t
B D                  Elephant  ggtt-----------gc-t------------------------ct---------------------gt-a
B D                   Manatee  ggtt-----------gg-t------------------------ct---------------------gt-a
B D                    Tenrec  cgtg-----------g---------------------------ct---------------------gt-c
                     Aardvark  ggtt-----------gc-t------------------------ct---------------------gt-t
B D                 Armadillo  ggga-----------cc-t------------------------ct---------------------gc-a
B D                   Opossum  ---g-----------gc-t--t-------ag---aaagga--cct---------------------gc-t
B D                  Platypus  agcc-----------ac-t--c-------gg---ggcgggatcct---------------------gc-c
  D               Rock pigeon  -gca-----------ga-g--c-------ct---caca-----cc---------------------tt-c
  D              Saker falcon  -ggg-----------tc-c--c-------ct---gggg-----gc----------------gcgatgg-c
  D          Peregrine falcon  -ggg-----------ga-t--c-------ct---gcga-----gc---------------------ga-t
  D       Collared flycatcher  -gaa-----------gg-c--c-------tt---gtca-----gt---------------------gc-t
  D    White-throated sparrow  -ggg-----------ac-c--c-------cg---gaat-----gg---------------------ga-t
B D       Medium ground finch  -gct-----------cc-c--c-------ag---gtga-----gt---------------------gc-t
B D               Zebra finch  -gca-----------gg-c--c-------caattaagc-----ag---------------------gc-t
           Tibetan ground jay  -gtg-----------tg-t--c-------cc---aggt-----gt---------------------gt-c
B D                Budgerigar  -gca-----------cc-c--caatgcagct---gggc-----ac---------------------at-c
  D             Scarlet macaw  -gga-----------gc-c--c-------cc---aggc-----ca---------------------ag-g
B D                    Turkey  -gtg-----------gg-g--g-------ct---gggt-----gccggtgttggtgtactggtgctga-t
B D        American alligator  -gta-----------ag-cagc-------ca---ggca-----tg---------------------gg-c
  D           Green seaturtle  -ggc-----------tc-t--c-------tc---gggg-----gc---------------------tg-c
  D            Painted turtle  -gga-----------gg-t--c-------cc---gggg----------------------------tg-c
  D  Chinese softshell turtle  -ggccgcccacacaggc-t--c-------tg---ggga-----gc---------------------tg-t
B D             X. tropicalis  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D               Stickleback  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================

                        Human  cctg----------c--------actga----------------agaagt---tat--a-gttc--c--c
                        Chimp  cctg----------c--------actga----------------agaagt---tat--a-gttc--c--c
                      Gorilla  cctg----------c--------actga----------------agaagt---tat--a-gttc--c--c
                    Orangutan  cctg----------c--------accga----------------agaagt---tat--a-gttc--c--c
                       Gibbon  cctg----------c--------accaa----------------agaagt---tat--a-gttc--c--c
                       Rhesus  cctg----------c--------gccaa----------------agaagt---tat--a-gttc--c--c
          Crab-eating macaque  cctg----------c--------gccaa----------------agaagt---tat--a-gttc--c--c
                       Baboon  cctg----------c--------gccga----------------agaagt---tat--a-gttc--c--c
                 Green monkey  cctg----------c--------gccga----------------agaagt---tat--a-gttc--c--c
                     Marmoset  cctg----------c--------accga----------------agaagt---tat--a-gccc--c--c
              Squirrel monkey  -----------------------accgg----------------agaagt---tac--a-gccc--c--t
                     Bushbaby  cctg----------c--------accaa----------------agaggt---aa---------------
           Chinese tree shrew  cctg----------c--------actga----------------agaggt---aa---a-ggcc--c--c
                     Squirrel  cctg----------c--------a---a----------------agaggt---gag--g-------t--c
       Lesser Egyptian jerboa  cctg----------t--------actga----------------ggaggt---gag--g-------c--c
                 Prairie vole  cctg----------c--------acaga----------------ggaggt---gag--g-------c--c
              Chinese hamster  cctg----------c--------acgga----------------ggaggt---gag--g-------c--c
               Golden hamster  cctg----------c--------acgga----------------ggaggt---gag--g-------c--c
                        Mouse  cctg----------c--------acaga----------------ggaggt---gag--g-------c--c
                          Rat  cctg----------c--------acgga----------------ggaggt---gag--g-------c--c
               Naked mole-rat  ccca----------c--------ccaga----------------agaggt---aag--g-------c---
                   Guinea pig  ccta----------c--------tccaa----------------ggaggt---aag--g-------c---
                   Chinchilla  ccca----------t--------tccaa----------------agaggt---aag--g-------t---
             Brush-tailed rat  ccca----------c--------tccaa--------------------gt---aag--g-------t---
                       Rabbit  cctg----------c--------ctgga----------------agaggt--------------------
                         Pika  cctg----------c--------ccaga----------------agaggt---aac--c-------g--c
                          Pig  cctg----------g--------accag----------------acaggt---gag--a-gcc---c--c
                       Alpaca  tctg----------g--------accaa----------------agaggt---aag--g-gcc---c--t
               Bactrian camel  tctg----------g--------accaa----------------agaggt---aag--g-gcc---c--t
                      Dolphin  cctg----------g--------actaa----------------ggaggt---gag--g-gcc---c--c
                 Killer whale  cctg----------g--------actaa----------------ggaggt---gag--g-gcc---c--c
             Tibetan antelope  ccca----------g--------accaa----------------agaggt---gag--g-gcc---c--c
                          Cow  ccca----------g--------accga----------------agaggt---gag--g-gcc---c--c
                        Sheep  ccca----------g--------accaa----------------agaggt---gag--g-gcc---c--c
                Domestic goat  ccca----------g--------accaa----------------agaggt---gag--g-gcc---c--c
                        Horse  cctg----------g--------a-cga----------------gaaggt---aag--g-gac---c--c
             White rhinoceros  cctg----------g--------accga----------------ggaggt---aag--c-gcc---c--c
                          Cat  cctg----------g--------actga----------------agaggt---aag--g-gct---c--c
                          Dog  cctg----------c--------accag----------------agaggt---gag--g-gtc---c--c
                      Ferret   cctg----------g--------accaa----------------agaggt---gag--g-acc---c--t
                        Panda  cctg----------g--------accaa----------------agaggt---gag--g-gcc---c--c
               Pacific walrus  cccg----------g--------accaa----------------agaggt---gag--a-gcc---c--c
                 Weddell seal  cccg----------g--------accaa----------------agaggt---gag--g-gcc---c--c
             Black flying-fox  cctg----------g--------actga----------------agaggt---gag--g-gtc---c--c
                      Megabat  cctg----------g--------actga----------------agaggt---gag--g-gtc---c--c
                Big brown bat  cctg----------g--------acc--------------------aggt---cag--g-g-c---c--t
         David's myotis (bat)  cctg----------g--------acc--------------------aggt---aag--g-g-c---c--c
                     Hedgehog  -cca----------g--------agcc-------------------aggt---gag----gcc---c---
                        Shrew  cttg----------g--------acccg----------------agaggt---aag----gcc---c--c
              Star-nosed mole  gctg----------g--------a-cca----------------agaggt---gag----acc---c--c
                     Elephant  cc-------------------------t----------------agaggt---gag--g-ccc---ctgc
                      Manatee  cc-------------------------g----------------acaggt---gag--g-ccc---ctgc
                       Tenrec  ag-------------------------g----------------agaggt---gat--g-gcc---c-ac
                     Aardvark  tg-------------------------g----------------agaggt---gag--g-ccc---ccgc
                    Armadillo  cc------------------------------------------agaggt---gagcag-ccc---c---
                      Opossum  gatg----------c--------agtgg----------------ccggttcctgac--g-ccc---c--c
                     Platypus  cctg----------c--------ggcggcagcgac---------gacggt---gag--g-gca---a--c
                  Rock pigeon  ctcg----------c--------cctgc-------------------------gtg--a-------c--a
                 Saker falcon  cacc----------c--------gggtg-------------------------atg--aaggcgcac--g
             Peregrine falcon  ccta----------c--------gagtg----------------gtccct---gtg--agggc---t--t
          Collared flycatcher  ccca----------a--------gtgtc---------------------t---ctc--a-------t--c
       White-throated sparrow  cctggaatggggacc--------ctgga-------------------------atg--a-gac---c--c
          Medium ground finch  ccca----------c--------ctgtc-------------------------ctc--a-------c--c
                  Zebra finch  cctg-------------------------------------------------ctg--a-------t--t
           Tibetan ground jay  ccca----------g--------gtgt--------------------------gtc--c-------c--c
                   Budgerigar  ccca----------c--------ctgcc---------------------t---ctg--g-------c---
                Scarlet macaw  tttg----------c--------c-----------------------------ctg--g-------c-aa
                       Turkey  gccg----------t--------gctgc-------------------------cgg--g-------c--a
           American alligator  tctc----------c--------ccact-------------------------gtg--g-------t--t
              Green seaturtle  cctc----------c-----------cc----------------cgg------ctg--a-------c--g
               Painted turtle  ccag----------cagggtggaaggtc----------------cggggtgccttg--a-------a--g
     Chinese softshell turtle  cccg----------a--------ctgcc----------------cggagt---cgc--a-------c--a
                X. tropicalis  -----------------------------ggctgcgctccatgtgcgggg---gag--a-cgc---c--c
          Cape elephant shrew  ======================================================================
                  Stickleback  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Tasmanian devil  ======================================================================
             Cape golden mole  ======================================================================

                        Human  tccc--agg----------cg----g----------------------------c---ccc-c-tcc---
                        Chimp  tccc--agg----------cg----g----------------------------c---ccc-cctcc---
                      Gorilla  tccc--agg----------cg----g----------------------------c---ccc-c-tcc---
                    Orangutan  tccc--agg----------cg----g----------------------------c---ccc-c-tcc---
                       Gibbon  tcct--ggg----------cg----g----------------------------c---ccc-c-tcc---
                       Rhesus  tcct--ggg----------gg----g----------------------------c---ccc-c-tcc---
          Crab-eating macaque  tcct--ggg----------gg----g----------------------------c---ccc-c-tcc---
                       Baboon  tcct--ggg----------gg----g----------------------------c---ccc-c-tcc---
                 Green monkey  tcct--ggg----------gg----g----------------------------c---ccc-c-tcc---
                     Marmoset  tcct--agg----------ca----gccccctcctaggcag-------------c---ccc-c-tcc---
              Squirrel monkey  tcct--aga----------ca----g--------------------------------ccc-c-tcc---
                     Bushbaby  -------------------ag----g---------------------------------cc-c-tcc---
           Chinese tree shrew  tccg--cag----------ca----g----------------------------cgcttcc-c-acc---
                     Squirrel  tccc--aag----------ca----g----------------------------g---ccc-c-tcc---
       Lesser Egyptian jerboa  tcct--tga----------tt----g----------------------------c---cca-c-ctc---
                 Prairie vole  tccc--ga-----------tt----g----------------------------c---tcc-c-ctc---
              Chinese hamster  tccc--aa-----------tt----g----------------------------c---tcc-c-ttc---
               Golden hamster  tccc--aa-----------tt----g----------------------------c---tcc-c-ctc---
                        Mouse  tccc--gat----------tt----g----------------------------c---tcc-c-ctc---
                          Rat  tctc--gat----------tt----g----------------------------c---tcc-c-ctc---
               Naked mole-rat  -tcc--ag--------------------------------------------------ccc-c-tac---
                   Guinea pig  -cct--ga-----------------g----------------------------c---ctc-t-tac---
                   Chinchilla  -cct--ga-----------------g----------------------------c---ccc-c-tac---
             Brush-tailed rat  -cct--ga-----------------g----------------------------c---cct-c-tac---
                       Rabbit  -------------------ca----g----------------------------c---acc-c-tcc---
                         Pika  tccc--cccc-----aaaaca----g----------------------------c---cca-c-tcc---
                          Pig  tcca--gag----------cg----g--------------------------------ccc-c-atc---
                       Alpaca  tccg--gag----------tg----g----------------------------t---ccc-t-ccc---
               Bactrian camel  tccg--gag----------tg----g----------------------------t---ccc-t-ccc---
                      Dolphin  tcca--gag----------ca----g----------------------------a---ccc-c-ggc---
                 Killer whale  tcca--gag----------ca----g----------------------------a---ccc-c-tgc---
             Tibetan antelope  tcca--gag----------cg----g--------------------------------ccc-c-tcc---
                          Cow  tcca--gag----------cg----g----------------------------c---ccc-c-tcc---
                        Sheep  tcca--gag----------cg----g--------------------------------ccc-c-tcc---
                Domestic goat  tcca--gag----------cg----g--------------------------------ccc-c-tcc---
                        Horse  tcta--gag----------aa----g----------------------------c---cct-c-cc----
             White rhinoceros  tcca--gag----------aa----g----------------------------c---ccc-c-tcc---
                          Cat  tctg--gag----------cg----g----------------------------c---cct-c-tcc---
                          Dog  cctg--ggg----------ca----g----------------------------c---ctg-c-ccc---
                      Ferret   tctg--gag----------ct----g----------------------------c---ctg-c-c-----
                        Panda  actg--gag----------cg----g----------------------------c---ct--c-ccc---
               Pacific walrus  tctg--gaa----------cg----g----------------------------c---ctg-c-ccc---
                 Weddell seal  tctg--gag----------ca----g----------------------------c---ctg-c-ccc---
             Black flying-fox  ccca--gag----------g----------------------------------------g-t-cgc---
                      Megabat  caca--gag----------g----------------------------------------g-t-cgc---
                Big brown bat  ccca--ggg----------g---------------------------------------cc-c-cgc---
         David's myotis (bat)  ccca--gag----------a-----g----------------------------c---ccc-t-cgc---
                     Hedgehog  ------agg----------ga----g----------------------------c---acc---------
                        Shrew  tccg--aag----------ca----g----------------------------c---tcc---acc---
              Star-nosed mole  tcc---acg----------ca----g----------------------------c---ctccg-gcg---
                     Elephant  tact--gtg----------ca----g----------------------------c---ccc-t-ccc---
                      Manatee  tgct--ctg----------ca----g----------------------------c---ccc-t-ccc---
                       Tenrec  tgccaagcg----------ca----g----------------------------t---cct-t-tct---
                     Aardvark  tgct--atg----------aa----g----------------------------c---ccc---------
                    Armadillo  --cc--cag----------ca----g----------------------------c---ccc-t-cctggc
                      Opossum  ttct--gagcccccggccgcg----g----------------------------c---tct-c-ttc---
                     Platypus  tcgg--agaatc-------cg----g----------------------------c---gcc-g-ccc---
                  Rock pigeon  c------cg----------gg----c----------------------------g---ccc-c-a-----
                 Saker falcon  cctt--aca----------gc----c----------------------------c---ccc-c-c-----
             Peregrine falcon  cctt--tga----------gg----t----------------------------g---ccc-c-t-----
          Collared flycatcher  c---------------------------------------------------------ctc-t-a-----
       White-throated sparrow  tgga--atg----------gg----g----------------------------a---ccc-t-g-----
          Medium ground finch  tgt-------------------------------------------------------ccc-c-a-----
                  Zebra finch  aaga--gaa----------aa----a----------------------------a---cgc-t-a-----
           Tibetan ground jay  aggt--gcg----------t--------------------------------------ccc-c-a-----
                   Budgerigar  tgca--gca----------ag----g----------------------------a---ccc-c-a-----
                Scarlet macaw  tgcc--acc----------ag----c----------------------------a---ccc-c-c-----
                       Turkey  ggct--gcc----------gg----t----------------------------g---ccc-g-------
           American alligator  tggg--gct----------gg----ccaatgaagtaatgtcagcagggaaggatg---gca-c-g-----
              Green seaturtle  cgtg--acg----------gg----gcc--------------------------a---ttc-c-------
               Painted turtle  ggtt--cca----------ga----g----------------------------g---tgc-c-------
     Chinese softshell turtle  gg-----ca----------gg----gtc--------------------------t---tcc-t-------
                X. tropicalis  tccc--gga----------taaattg----------------------------c---ccc-t-ttc---
          Cape elephant shrew  ======================================================================
                  Stickleback  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Tasmanian devil  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ------ctg
                        Chimp  ------ctg
                      Gorilla  ------ctg
                    Orangutan  ------ctg
                       Gibbon  ------ctg
                       Rhesus  ------ctg
          Crab-eating macaque  ------ctg
                       Baboon  ------ctg
                 Green monkey  ------ctg
                     Marmoset  ------ttg
              Squirrel monkey  ------ctg
                     Bushbaby  ------ctg
           Chinese tree shrew  ------cag
                     Squirrel  ------ctg
       Lesser Egyptian jerboa  ------ctg
                 Prairie vole  ------ttg
              Chinese hamster  ------tca
               Golden hamster  ------tcg
                        Mouse  ------ccg
                          Rat  ------ctg
               Naked mole-rat  ------cca
                   Guinea pig  ------cca
                   Chinchilla  ------cca
             Brush-tailed rat  ------cca
                       Rabbit  ------ccg
                         Pika  ------cca
                          Pig  ------ccc
                       Alpaca  ------tgc
               Bactrian camel  ------tgc
                      Dolphin  ------tca
                 Killer whale  ------tca
             Tibetan antelope  ------cga
                          Cow  ------cca
                        Sheep  ------cga
                Domestic goat  ------cga
                        Horse  ---------
             White rhinoceros  ------ctg
                          Cat  ------ctg
                          Dog  ------ccc
                      Ferret   ---------
                        Panda  ------ctg
               Pacific walrus  ------cca
                 Weddell seal  ------cca
             Black flying-fox  ------cca
                      Megabat  ------cca
                Big brown bat  ------gct
         David's myotis (bat)  ------ccg
                     Hedgehog  ---------
                        Shrew  ------ctg
              Star-nosed mole  ------ctg
                     Elephant  --------g
                      Manatee  --------a
                       Tenrec  ------cag
                     Aardvark  ---------
                    Armadillo  cccagcaag
                      Opossum  ------tct
                     Platypus  ------ccg
                  Rock pigeon  ---------
                 Saker falcon  ---------
             Peregrine falcon  ---------
          Collared flycatcher  ---------
       White-throated sparrow  ---------
          Medium ground finch  ---------
                  Zebra finch  ---------
           Tibetan ground jay  ---------
                   Budgerigar  ---------
                Scarlet macaw  ---------
                       Turkey  ---------
           American alligator  ---------
              Green seaturtle  ---------
               Painted turtle  ---------
     Chinese softshell turtle  ---------
                X. tropicalis  ------atg
          Cape elephant shrew  =========
                  Stickleback  =========
                      Wallaby  =========
     Mexican tetra (cavefish)  =========
              Tasmanian devil  =========
             Cape golden mole  =========

Inserts between block 14 and 15 in window
                Weddell seal 7bp
  D              Rock pigeon 31bp
  D             Saker falcon 26bp
  D         Peregrine falcon 26bp
  D      Collared flycatcher 46bp
B D      Medium ground finch 32bp
B D              Zebra finch 25bp
          Tibetan ground jay 57bp
B D               Budgerigar 46bp
  D            Scarlet macaw 38bp
B D       American alligator 23bp
B D            X. tropicalis 5bp

Alignment block 15 of 242 in window, 196953 - 196958, 6 bps 
B D                     Human  cccc----tc-
B D                     Chimp  cccc----tc-
B D                   Gorilla  cccc----tc-
B D                 Orangutan  cccc----tc-
B D                    Gibbon  cccc----tc-
B D                    Rhesus  cccc----tc-
B D       Crab-eating macaque  cccc----tc-
B D                    Baboon  cccc----tc-
B D              Green monkey  cccc----tc-
B D                  Marmoset  cccc----tc-
B D           Squirrel monkey  cccc----tc-
B D                  Bushbaby  gtcc----ag-
           Chinese tree shrew  gcacagcgtc-
B D                  Squirrel  tcca----c--
       Lesser Egyptian jerboa  cgca----t--
                 Prairie vole  ccca----t--
B D           Chinese hamster  ccca----t--
               Golden hamster  ccca----t--
B D                     Mouse  ccca----t--
B D                       Rat  tcca----t--
B D            Naked mole-rat  ccca----a--
B D                Guinea pig  gcaa----c--
                   Chinchilla  gcca----c--
             Brush-tailed rat  gcca----c--
B D                    Rabbit  tcct----gc-
B D                      Pika  tcct----g--
B D                       Pig  gccc----ag-
B D                    Alpaca  ctcc----ac-
               Bactrian camel  ctcc----at-
B D                   Dolphin  gccc----ac-
                 Killer whale  gccc----ac-
             Tibetan antelope  cccc----ag-
B D                       Cow  ctcc----ag-
B D                     Sheep  cccc----ag-
                Domestic goat  cccc----ag-
B D                     Horse  -cgc----at-
B D          White rhinoceros  tccc----at-
B D                       Cat  cccc----ac-
B D                       Dog  gacc----at-
B D                   Ferret   accc----at-
B D                     Panda  cccc----at-
               Pacific walrus  cccc----gt-
                 Weddell seal  cccc----at-
             Black flying-fox  cccc----cc-
B D                   Megabat  cccc----cc-
                Big brown bat  cccc----ac-
         David's myotis (bat)  cccc----ct-
B D                  Hedgehog  --cc----tc-
B D                     Shrew  accc----ac-
              Star-nosed mole  tgcc-----c-
B D                  Elephant  c----------
B D                   Manatee  cc---------
B D                    Tenrec  ct---------
B D                 Armadillo  cc---------
B D                   Opossum  gcc--------
B D                  Platypus  cccc----cc-
  D               Rock pigeon  cac--------
  D              Saker falcon  gcc--------
  D          Peregrine falcon  gtg--------
  D       Collared flycatcher  ttc--------
           Tibetan ground jay  ccc--------
B D                Budgerigar  ccc--------
  D             Scarlet macaw  ctc--------
B D                    Turkey  -cc--------
B D        American alligator  ccc--------
B D             X. tropicalis  -tcc----atg
         Cape elephant shrew  ===========
B D               Stickleback  ===========
  D  Chinese softshell turtle  -----------
  D            Painted turtle  -----------
  D           Green seaturtle  -----------
B D               Zebra finch  ===========
B D       Medium ground finch  ===========
B D                   Wallaby  ===========
    Mexican tetra (cavefish)  ===========
B D           Tasmanian devil  ===========
            Cape golden mole  ===========
                    Aardvark  -----------

Inserts between block 15 and 16 in window
B D                   Rabbit 1bp
B D                  Opossum 1bp
  D              Rock pigeon 12bp
  D             Saker falcon 33bp
  D         Peregrine falcon 35bp
          Tibetan ground jay 26bp
B D               Budgerigar 35bp
  D            Scarlet macaw 14bp
B D                   Turkey 25bp
B D       American alligator 11bp

Alignment block 16 of 242 in window, 196959 - 196967, 9 bps 
B D                     Human  a-----------------------------------------gctcagc-c
B D                     Chimp  a-----------------------------------------gctcagc-c
B D                   Gorilla  a-----------------------------------------gctcagc-c
B D                 Orangutan  a-----------------------------------------gcacagc-c
B D                    Gibbon  a-----------------------------------------gcacagc-c
B D                    Rhesus  a-----------------------------------------gcacagc-c
B D       Crab-eating macaque  a-----------------------------------------gcacagc-c
B D                    Baboon  a-----------------------------------------gcacagc-c
B D              Green monkey  a-----------------------------------------gcacagc-c
B D                  Marmoset  a-----------------------------------------gcacagc-c
B D           Squirrel monkey  a-----------------------------------------gcacagc-c
B D                  Bushbaby  a-----------------------------------------gcacagc-c
           Chinese tree shrew  a-----------------------------------------gcccggc-c
B D                  Squirrel  t-----------------------------------------gcacagcg-
       Lesser Egyptian jerboa  ggcattgcccaaacttctacccttgctagctgcccatggcatacacagc--
                 Prairie vole  g-----------------------------------------acacagc--
B D           Chinese hamster  g-----------------------------------------acacagc--
               Golden hamster  g-----------------------------------------acacagc--
B D                     Mouse  g-----------------------------------------acacagc--
B D                       Rat  g-----------------------------------------acacagc--
B D            Naked mole-rat  a-----------------------------------------acacagc--
B D                Guinea pig  t-----------------------------------------gtacagc--
                   Chinchilla  a-----------------------------------------gcacagc--
             Brush-tailed rat  a-----------------------------------------gcacagc--
B D                    Rabbit  g-----------------------------------------gcactgc--
B D                      Pika  g-----------------------------------------acagagc--
B D                       Pig  g-----------------------------------------gcacagt-c
B D                    Alpaca  g-----------------------------------------gcagagt-c
               Bactrian camel  g-----------------------------------------gcagagt-c
B D                   Dolphin  g-----------------------------------------gcacagt-c
                 Killer whale  g-----------------------------------------gcacagt-c
             Tibetan antelope  g-----------------------------------------gca-agc-c
B D                       Cow  g-----------------------------------------gca-agt-c
B D                     Sheep  g-----------------------------------------gca-agc-c
                Domestic goat  g-----------------------------------------gca-agc-c
B D                     Horse  g-----------------------------------------gcacagc-c
B D          White rhinoceros  g-----------------------------------------gcacagc-c
B D                       Cat  a-----------------------------------------gcacagc-c
B D                       Dog  g-----------------------------------------gcacagt-c
B D                   Ferret   g-----------------------------------------gcacagc-c
B D                     Panda  g-----------------------------------------gtgcagt-c
               Pacific walrus  g-----------------------------------------gcacagt-c
                 Weddell seal  g-----------------------------------------gcacagt-c
             Black flying-fox  a--------------------------------------------cagc-c
B D                   Megabat  a--------------------------------------------cagc-c
                Big brown bat  a-----------------------------------------gcccagc-c
         David's myotis (bat)  a-----------------------------------------gcacagc-c
B D                  Hedgehog  a-----------------------------------------gtgctgc-c
B D                     Shrew  a-----------------------------------------gcacagc-c
              Star-nosed mole  a-----------------------------------------gcacagc-c
B D                  Platypus  g-----------------------------------------actca----
  D               Rock pigeon  ------------------------------ggtgcg---------------
  D              Saker falcon  ------------------------------tctgct---------------
  D          Peregrine falcon  ------------------------------tgtgag---------------
B D       Medium ground finch  ------------------------------tgctc----------------
B D               Zebra finch  ------------------------------tcctcc---------------
           Tibetan ground jay  ------------------------------tgtg-----------------
B D                Budgerigar  ------------------------------gtccc----------------
  D             Scarlet macaw  ------------------------------ggctc----------------
B D                    Turkey  ------------------------------tgtg-----------------
B D        American alligator  ------------------------------tgctcc---------------
B D             X. tropicalis  -----------------------------------------agcaccga-c
         Cape elephant shrew  ===================================================
B D                    Tenrec  ---------------------------------------------------
B D                 Armadillo  ---------------------------------------------------
B D                   Manatee  ---------------------------------------------------
B D                  Elephant  ---------------------------------------------------
B D               Stickleback  ===================================================
  D  Chinese softshell turtle  ---------------------------------------------------
  D            Painted turtle  ---------------------------------------------------
  D           Green seaturtle  ---------------------------------------------------
  D       Collared flycatcher  ===================================================
B D                   Wallaby  ===================================================
    Mexican tetra (cavefish)  ===================================================
B D                   Opossum  ===================================================
B D           Tasmanian devil  ===================================================
            Cape golden mole  ===================================================
                    Aardvark  ---------------------------------------------------

Inserts between block 16 and 17 in window
          Chinese tree shrew 1149bp

Alignment block 17 of 242 in window, 196968 - 196994, 27 bps 
B D                     Human  tc----------------aa----------------------------------tc-------aaga---
B D                     Chimp  tc----------------aa----------------------------------tc-------aaga---
B D                   Gorilla  tc----------------aa----------------------------------tc-------aaga---
B D                 Orangutan  tc----------------aa----------------------------------tc-------aaga---
B D                    Gibbon  tc----------------ag----------------------------------tc-------aaga---
B D                    Rhesus  tc----------------aa----------------------------------tc-------aaga---
B D       Crab-eating macaque  tc----------------aa----------------------------------tc-------aaga---
B D                    Baboon  tc----------------aa----------------------------------tc-------aaga---
B D              Green monkey  tc----------------ga----------------------------------tc-------aaga---
B D                  Marmoset  tc----------------aa----------------------------------cc-------aaga---
B D           Squirrel monkey  tc----------------aa----------------------------------cc-------aaga---
B D                  Bushbaby  tc----------------aa----------------------------------tt-------aaga---
B D                  Squirrel  tc----------------ag----------------------------------cc-------agaa---
       Lesser Egyptian jerboa  cc----------------aggcaaaccccaccccccttgcctgctggctcctcacc-------aagt---
                 Prairie vole  tc----------------ag----------------------------------cc-------aaga---
B D           Chinese hamster  tc----------------ag----------------------------------cc-------aaga---
               Golden hamster  tc----------------ag----------------------------------cc-------aaga---
B D                     Mouse  tc----------------ag----------------------------------cc-------aaga---
B D                       Rat  tc----------------ag----------------------------------cc-------aaga---
B D            Naked mole-rat  tg----------------ca--------------------------------ccat-------ggga---
B D                Guinea pig  tc----------------ta--------------------------------cccc-------agga---
                   Chinchilla  tc----------------ca--------------------------------cccc-------ggga---
             Brush-tailed rat  tc----------------ta-------------------------------ccccc-------agga---
B D                    Rabbit  cc----------------tg---------------------------------gcc-------aggg---
B D                      Pika  tg----------------cg---------------------------------gtc-------aaaa---
B D                       Pig  tt----------------at----------------------------------cc-------agga---
B D                    Alpaca  tc----------------at----------------------------------cc-------aaga---
               Bactrian camel  tc----------------at----------------------------------cc-------aaga---
B D                   Dolphin  tc----------------ac----------------------------------cc-------caga---
                 Killer whale  tc----------------ac----------------------------------cc-------caga---
             Tibetan antelope  tc----------------at----------------------------------gc-------gaga---
B D                       Cow  tc----------------at----------------------------------gc-------aaga---
B D                     Sheep  tc----------------ct-------------------------------------------gaga---
                Domestic goat  tc----------------at----------------------------------gc-------gaga---
B D                     Horse  tc----------------ag----------------------------------cc-------aaga---
B D          White rhinoceros  tc----------------ag----------------------------------cc-------aaga---
B D                       Cat  tc----------------ag----------------------------------cc-------aaga---
B D                       Dog  tc----------------ag----------------------------------cc-------agac---
B D                   Ferret   tc----------------ac----------------------------------cc-------agga---
B D                     Panda  tc----------------ag----------------------------------cc-------aaga---
               Pacific walrus  tc----------------ag----------------------------------cc-------aaga---
                 Weddell seal  tc----------------ag----------------------------------cc-------aaga---
             Black flying-fox  tt----------------gg--------------------------------------------------
B D                   Megabat  tt----------------gg--------------------------------------------------
                Big brown bat  gc----------------ag-----------------------------------c-------gagg---
         David's myotis (bat)  tc----------------ag----------------------------------cc-------caga---
B D                  Hedgehog  cc------------acctgg----------------------------------cc-------aggc---
B D                     Shrew  ttcaggggaaaaaaaaaagg----------------------------------tc-------aaga---
              Star-nosed mole  cc----------------gg----------------------------------cc-------aaga---
B D                  Elephant  ----------------------------------------------------------------------
B D                   Manatee  ------------------------------------------------------cc-------cagg---
B D                    Tenrec  ------------------------------------------------------cc-------ttgg---
                     Aardvark  ----------------------------------------------------------------agg---
B D                 Armadillo  ------------------------------------------------------tcagccaagcaga---
B D                   Opossum  tc----------------gc----------------------------------cc-------aggccac
B D                  Platypus  -----------------------------------------------------------cgtgcagg---
  D               Rock pigeon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
B D       Medium ground finch  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
B D             X. tropicalis  --------------------------------------------------tgcgcc-------aggg---
         Cape elephant shrew  ======================================================================
          Chinese tree shrew  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---------------agt--------------------------tccc-------c-a------------
                        Chimp  ---------------agt--------------------------tccc-------c-a------------
                      Gorilla  ---------------agt--------------------------tccc-------c-a------------
                    Orangutan  ---------------agt--------------------------tccc-------c-a------------
                       Gibbon  ---------------agt--------------------------tccc-------c-a------------
                       Rhesus  ---------------agt--------------------------tccc-------c-g------------
          Crab-eating macaque  ---------------agt--------------------------tccc-------c-g------------
                       Baboon  ---------------agt--------------------------tccc-------c-g------------
                 Green monkey  ---------------agt--------------------------tccc-------c-g------------
                     Marmoset  ---------------cgt--------------------------tccc-------c-a------------
              Squirrel monkey  ---------------cgt--------------------------tccc-------c-a------------
                     Bushbaby  ---------------aat--------------------------tcca-------c-a------------
                     Squirrel  ---------------agc--------------------------tgtc-------c-a------------
       Lesser Egyptian jerboa  ---------------ggc--------------------------actc-------a-g------------
                 Prairie vole  ---------------agc--------------------------tctc-------g-a------------
              Chinese hamster  ---------------agc--------------------------tctc-------c-a------------
               Golden hamster  ---------------agc--------------------------tctc-------g-a------------
                        Mouse  ---------------agc--------------------------tctg-------g-a------------
                          Rat  ---------------agc--------------------------tctg-------g-a------------
               Naked mole-rat  ---------------gct--------------------------tctt-------a-c------------
                   Guinea pig  ---------------gat--------------------------tctt-------a-c------------
                   Chinchilla  ---------------gat--------------------------cctt-------a-c------------
             Brush-tailed rat  ---------------gat--------------------------cttt-------a-t------------
                       Rabbit  ---------------agg--------------------------tccc-------c-a------------
                         Pika  ---------------------------------------------cca-------c-c------------
                          Pig  ---------------agt--------------------------tgcc-------c-a------------
                       Alpaca  ---------------ggt--------------------------tccc-------c-a------------
               Bactrian camel  ---------------ggt--------------------------tccc-------c-a------------
                      Dolphin  ---------------agt--------------------------tccc-------c-a------------
                 Killer whale  ---------------agt--------------------------tccc-------c-a------------
             Tibetan antelope  ---------------agt--------------------------tccc-------c-a------------
                          Cow  ---------------agt--------------------------tccc-------c-a------------
                        Sheep  ---------------agt--------------------------cccc-------c--------------
                Domestic goat  ---------------agt--------------------------tccc-------c-a------------
                        Horse  ---------------agc--------------------------tcca-------c-a------------
             White rhinoceros  ---------------agt--------------------------tccg-------c-a------------
                          Cat  ---------------agt--------------------------tttc-------c-a------------
                          Dog  ---------------a-t--------------------------ttcc-------c-a------------
                      Ferret   ---------------a-c--------------------------ttcc-------c-a------------
                        Panda  ---------------ggt--------------------------ttct-------caa------------
               Pacific walrus  ---------------agt--------------------------ttcc-------c-a------------
                 Weddell seal  ---------------agt--------------------------ttcc-------c-a------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ---------------agc---------------------------ccc-------c-a------------
         David's myotis (bat)  ---------------agc---------------------------tcc-------c-a------------
                     Hedgehog  ---------------a------------------------------------------------------
                        Shrew  ---------------a-a--------------------------ttcc-------c-c------------
              Star-nosed mole  ---------------aca--------------------------gcac-------c-g------------
                     Elephant  -----------------c--------------------------ccc--------t-a------------
                      Manatee  ---------------agc--------------------------ccc--------t-a------------
                       Tenrec  ---------------act--------------------------tcc--------t-a------------
                     Aardvark  ---------------ggc--------------------------ccc--------t-c------------
                    Armadillo  ---------------ggt--------------------------ccccacgcacac-a------------
                      Opossum  cccaggcacatcttcaat--------------------------tctt-------c-a------------
                     Platypus  ---------------tgc--------------------------tctc-------c-a------------
                  Rock pigeon  -----------------------------------------tgtcccc-------c-aaacgctggcatg
                 Saker falcon  -----------------------------------------gcaccca-------c-t------------
             Peregrine falcon  -----------------------------------------gggtccc-------t-g------------
          Medium ground finch  --------------------------------------------tcca-------g-a------------
                  Zebra finch  -----------------------------------------tctttca-------t-a------------
           Tibetan ground jay  --------------------------------------------tccc-------c-a------------
                   Budgerigar  --------------------------------------------tccc-------t-ggcagagcagagg
                Scarlet macaw  --------------------------------------------tccc----------------------
                       Turkey  --------------------------------------------tcaa-------t-g------------
           American alligator  ------------------agacactg-----------accagcttccc-------t-gg-----------
              Green seaturtle  ---------------------cagag------------ccgttctctc-------t-g------------
               Painted turtle  ---------------------cagagaagcaaagggtcccagagtcccaagag--t-g------------
     Chinese softshell turtle  ---------------------cacag--------gctccccgtgtccg-------a-t------------
                X. tropicalis  ---------------agt--------------------------ttac-------t-g------------
          Cape elephant shrew  ======================================================================
           Chinese tree shrew  ======================================================================
                  Stickleback  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Tasmanian devil  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ---tcttt-------ga-----c
                        Chimp  ---tcttt-------ga--tcac
                      Gorilla  ---tcttt-------ga--tcac
                    Orangutan  ---tcttt-------ga--tcac
                       Gibbon  ---tcttt-------ga--tcac
                       Rhesus  ---tcttt-------ga--tcac
          Crab-eating macaque  ---tcttt-------ga--tcac
                       Baboon  ---tcttt-------ga--tcac
                 Green monkey  ---tcttt-------ga--tcac
                     Marmoset  ---ccttt-------ca--tcac
              Squirrel monkey  ---ccttt-------ga--tcac
                     Bushbaby  ---ccttg-------gc--ctac
                     Squirrel  ---ccagt-------gt--c---
       Lesser Egyptian jerboa  ---t-------------------
                 Prairie vole  ---ccctt-------gc--c---
              Chinese hamster  ---ccctt-------gc--c---
               Golden hamster  ---ccctt-------gc--c---
                        Mouse  ---ccctt-------gc--c---
                          Rat  ---ccctt-------gt--c---
               Naked mole-rat  ---caagt-------ga--g---
                   Guinea pig  ---caagt-------ga--t---
                   Chinchilla  ---caagt-------ga--t---
             Brush-tailed rat  ---caagc-------ga--t---
                       Rabbit  ---tcggt-------gc--c---
                         Pika  ---cctgt-------gg--t---
                          Pig  ---ccttt-------cccac---
                       Alpaca  ---ccttt-------gc--c---
               Bactrian camel  ---ccttt-------gc--c---
                      Dolphin  ---ccttt-------gc--c---
                 Killer whale  ---ccttt-------gc--c---
             Tibetan antelope  ---tcttt-------gc--c---
                          Cow  ---tcttt-------gt--c---
                        Sheep  ---tcttt-------cc--c---
                Domestic goat  ---tcttt-------gc--c---
                        Horse  ---ccttt-------gc--c---
             White rhinoceros  ---ccttt-------gc--t---
                          Cat  ---ccttt-------gc--c---
                          Dog  ---cttgt-------gc--c---
                      Ferret   ---ccttt-------gc--t---
                        Panda  ---ctttt-------gc--c---
               Pacific walrus  ---ccttt-------gc--c---
                 Weddell seal  ---ccttt-------gc--c---
             Black flying-fox  -----------------------
                      Megabat  -----------------------
                Big brown bat  ---cctcc-------a-------
         David's myotis (bat)  ---cctcc-------ac--c---
                     Hedgehog  -----------------------
                        Shrew  ---cactt-------gc--c---
              Star-nosed mole  ---ctccc-------gc--c---
                     Elephant  ---cctta--------c--c---
                      Manatee  ---cctta-------gc--c---
                       Tenrec  ---ctggaaaa----aa--c---
                     Aardvark  ---cctta-------gc--c---
                    Armadillo  ---ccttt-------gc--c---
                      Opossum  ---tttttaaaactgga--c---
                     Platypus  ---gcttc-------tc--c---
                  Rock pigeon  ggc--------------------
                 Saker falcon  -----------------------
             Peregrine falcon  -----------------------
          Medium ground finch  -----------------------
                  Zebra finch  -----------------------
           Tibetan ground jay  -----------------------
                   Budgerigar  ggt--------------------
                Scarlet macaw  -----------------------
                       Turkey  -----------------------
           American alligator  -----------------------
              Green seaturtle  -----------------------
               Painted turtle  -----------------------
     Chinese softshell turtle  -----------------------
                X. tropicalis  ---gg------------------
          Cape elephant shrew  =======================
           Chinese tree shrew  =======================
                  Stickleback  =======================
          Collared flycatcher  =======================
                      Wallaby  =======================
     Mexican tetra (cavefish)  =======================
              Tasmanian devil  =======================
             Cape golden mole  =======================

Inserts between block 17 and 18 in window
B D                 Squirrel 31bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 6bp
B D          Chinese hamster 6bp
              Golden hamster 6bp
B D                    Mouse 37bp
B D                      Rat 6bp
B D           Naked mole-rat 6bp
B D               Guinea pig 8bp
                  Chinchilla 6bp
            Brush-tailed rat 8bp
B D                   Rabbit 6bp
B D                     Pika 6bp
            Black flying-fox 11bp
B D                  Megabat 11bp
               Big brown bat 27bp
        David's myotis (bat) 29bp
B D                 Hedgehog 3bp
  D              Rock pigeon 16bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 15bp
  D            Scarlet macaw 2bp
B D                   Turkey 2bp
B D       American alligator 2bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp

Alignment block 18 of 242 in window, 196995 - 196998, 4 bps 
B D                     Human  c-act
B D                     Chimp  c-act
B D                   Gorilla  c-act
B D                 Orangutan  c-act
B D                    Gibbon  c-act
B D                    Rhesus  c-act
B D       Crab-eating macaque  c-act
B D                    Baboon  c-act
B D              Green monkey  c-act
B D                  Marmoset  c-act
B D           Squirrel monkey  c-att
B D                  Bushbaby  ctgct
B D                  Squirrel  c-tct
       Lesser Egyptian jerboa  t-tct
                 Prairie vole  c-tct
B D           Chinese hamster  c-tct
               Golden hamster  c-tct
B D                       Rat  c-tct
B D            Naked mole-rat  c-att
B D                Guinea pig  t-ttt
                   Chinchilla  t-ttt
             Brush-tailed rat  t-tgt
B D                    Rabbit  c-tcc
B D                      Pika  c-tcc
B D                       Pig  c-act
B D                    Alpaca  c-act
               Bactrian camel  g-act
B D                   Dolphin  c-act
                 Killer whale  c-act
             Tibetan antelope  c-act
B D                       Cow  c-act
B D                     Sheep  c-cct
                Domestic goat  c-act
B D                     Horse  t-gct
B D          White rhinoceros  g-gct
B D                       Cat  c-acc
B D                       Dog  c-gct
B D                   Ferret   t-acc
B D                     Panda  c-acc
               Pacific walrus  c-acc
                 Weddell seal  c-act
B D                     Shrew  c-aat
              Star-nosed mole  c-act
B D                  Elephant  c-cct
B D                   Manatee  c-cct
B D                    Tenrec  a-cct
                     Aardvark  t-cct
B D                 Armadillo  c-act
B D                   Opossum  ---tt
B D                  Platypus  c-act
B D             X. tropicalis  -ggct
         Cape elephant shrew  =====
B D                  Hedgehog  =====
B D                     Mouse  =====
            Black flying-fox  =====
B D                   Megabat  =====
               Big brown bat  =====
        David's myotis (bat)  =====
          Chinese tree shrew  =====
B D               Stickleback  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                    Turkey  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D       Collared flycatcher  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D                   Wallaby  =====
    Mexican tetra (cavefish)  =====
B D        American alligator  =====
B D           Tasmanian devil  =====
            Cape golden mole  =====

Inserts between block 18 and 19 in window
B D                      Pig 25bp
B D                   Alpaca 156bp
              Bactrian camel 29bp
B D                  Dolphin 29bp
                Killer whale 29bp
            Tibetan antelope 29bp
B D                      Cow 29bp
B D                    Sheep 29bp
               Domestic goat 29bp
B D                    Horse 29bp
B D         White rhinoceros 29bp
B D                      Cat 29bp
B D                      Dog 29bp
B D                  Ferret  29bp
B D                    Panda 29bp
              Pacific walrus 29bp
                Weddell seal 29bp
B D                    Shrew 3bp
             Star-nosed mole 3bp
B D                  Opossum 2bp
B D                 Platypus 5bp

Alignment block 19 of 242 in window, 196999 - 197011, 13 bps 
B D                     Human  c----------caagta------------------------------ggaga-a
B D                     Chimp  c----------caagta------------------------------ggaga-a
B D                   Gorilla  c----------caagta------------------------------ggaga-a
B D                 Orangutan  c----------caagta------------------------------ggaga-a
B D                    Gibbon  c----------cgagta------------------------------ggaga-a
B D                    Rhesus  c----------taagta------------------------------ggaga-a
B D       Crab-eating macaque  c----------taagta------------------------------ggaga-a
B D                    Baboon  c----------taagta------------------------------ggaga-a
B D              Green monkey  c----------taagta------------------------------ggaga-a
B D                  Marmoset  c----------caagta------------------------------ggaga-a
B D           Squirrel monkey  c----------caagta------------------------------ggaga-a
B D                  Bushbaby  c----------cttgcc------------------------------gggg---
B D                  Squirrel  g----------agtagg-------------------------------------
       Lesser Egyptian jerboa  g----------agtgac-------------------------------------
                 Prairie vole  t----------tgcaaa-------------------------------------
B D           Chinese hamster  t----------tgcaaa-------------------------------------
               Golden hamster  t----------tgcaaa-------------------------------------
B D                       Rat  t----------tgaaaa-------------------------------------
B D            Naked mole-rat  t----------ttcaaa-------------------------------------
                   Chinchilla  t----------ttca---------------------------------------
             Brush-tailed rat  t----------ttta-g-------------------------------------
B D                    Rabbit  t----------cactgactcgtgcccagggtcctctgagcagaaaga-------
B D                      Pika  t----------tgccaacacat---tggggtgttc-aagtagaagga-------
B D                       Pig  c----------tgagca------------------------------ggagg-a
B D                    Alpaca  c----------tgagta------------------------------agagg-a
               Bactrian camel  c----------tgagta------------------------------ggagg-a
B D                   Dolphin  c----------tgagcc------------------------------ggaag-c
                 Killer whale  c----------tgagca------------------------------gaaag-c
             Tibetan antelope  c----------cgagca------------------------------ggagg-a
B D                       Cow  c----------tgagca------------------------------ggagg-a
B D                     Sheep  c----------tgggca------------------------------ggagg-a
                Domestic goat  c----------tgggca------------------------------ggagg-a
B D                     Horse  c----------tgagta------------------------------g-agg-a
B D          White rhinoceros  c----------tgagta------------------------------g-agg-a
B D                       Cat  c----------tgaata------------------------------ggagg-a
B D                       Dog  c----------tgagtg------------------------------ggagg-t
B D                   Ferret   c----------tgagta------------------------------gaagg-a
B D                     Panda  c----------tgagta------------------------------ggagg-a
               Pacific walrus  c----------tgagta------------------------------ggaga-a
                 Weddell seal  c----------tgagta------------------------------ggaga-a
             Black flying-fox  c----------tgagag------------------------------ggagg-a
B D                   Megabat  c----------tgagag------------------------------ggaggaa
                Big brown bat  c----------tgagcg------------------------------ggagg-a
         David's myotis (bat)  c----------tgagcg------------------------------ggagg-a
B D                  Hedgehog  c----------------------------------------------cgggg-a
B D                     Shrew  cctttaccaatcatacc------------------------------caggg-c
              Star-nosed mole  c----------cacgcc------------------------------ccggc-c
B D                  Elephant  -----------------------------------------------ggagc-t
B D                   Manatee  -----------------------------------------------ggagc-t
B D                    Tenrec  -----------------------------------------------gggga-t
                     Aardvark  -----------------------------------------------ggagc-t
B D                 Armadillo  -----------------------------------------------ggccc-t
B D                   Opossum  -----------ccggca------------------------------gta----
B D                  Platypus  c----------ggtgtg------------------------------g------
  D               Rock pigeon  c-----------------------------------------------------
  D              Saker falcon  g-----------------------------------------------------
  D          Peregrine falcon  a-----------------------------------------------------
B D       Medium ground finch  a-----------------------------------------------------
B D               Zebra finch  a-----------------------------------------------------
           Tibetan ground jay  c-----------------------------------------------------
B D                Budgerigar  a-----------------------------------------------------
  D             Scarlet macaw  a-----------------------------------------------------
B D                    Turkey  a-----------------------------------------------------
B D        American alligator  c-----------------------------------------------------
  D           Green seaturtle  g-----------------------------------------------------
  D            Painted turtle  c-----------------------------------------------------
  D  Chinese softshell turtle  c-----------------------------------------------------
B D             X. tropicalis  ----------ttgggga-------------------------------------
         Cape elephant shrew  ======================================================
B D                     Mouse  ======================================================
B D                Guinea pig  ------------------------------------------------------
          Chinese tree shrew  ======================================================
B D               Stickleback  ======================================================
  D       Collared flycatcher  ======================================================
B D                   Wallaby  ======================================================
    Mexican tetra (cavefish)  ======================================================
B D           Tasmanian devil  ======================================================
            Cape golden mole  ======================================================

Inserts between block 19 and 20 in window
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 19bp
B D          Chinese hamster 8bp
              Golden hamster 20bp
B D                      Rat 20bp
B D           Naked mole-rat 8bp
                  Chinchilla 7bp
            Brush-tailed rat 8bp
B D                   Tenrec 4bp
B D                Armadillo 22bp

Alignment block 20 of 242 in window, 197012 - 197022, 11 bps 
B D                     Human  accggcccagg
B D                     Chimp  accggcccagg
B D                   Gorilla  accggcccagg
B D                 Orangutan  accggcccagg
B D                    Gibbon  accggcccagg
B D                    Rhesus  acccgcccagg
B D       Crab-eating macaque  acccgcccagg
B D                    Baboon  acccgcccagg
B D              Green monkey  acccgcccagg
B D                  Marmoset  actggcccagg
B D           Squirrel monkey  actggcccagg
B D                  Bushbaby  -------tagg
B D                  Squirrel  acttgccca-g
       Lesser Egyptian jerboa  acctgccca-g
                 Prairie vole  ccctggttt-t
B D           Chinese hamster  acctgccca-t
               Golden hamster  agccggcca-t
B D                     Mouse  accagcccg-a
B D                       Rat  accagccca-a
B D            Naked mole-rat  gcctgccca-g
B D                Guinea pig  ------cca-g
                   Chinchilla  gcctgccca-g
             Brush-tailed rat  gccttccca-g
B D                    Rabbit  accagccca-g
B D                      Pika  acccacct--g
B D                       Pig  accagccca-g
B D                    Alpaca  acctgccca-g
               Bactrian camel  acctgccca-g
B D                   Dolphin  acctgcgca-g
                 Killer whale  acctgcgca-g
             Tibetan antelope  gcctgccca-g
B D                       Cow  acctgccca-g
B D                     Sheep  gcctgccca-g
                Domestic goat  gcctgccca-g
B D                     Horse  acctgccca-g
B D          White rhinoceros  acctgccca-g
B D                       Cat  acctatcca-g
B D                       Dog  acctgccca-g
B D                   Ferret   acctgccca-g
B D                     Panda  acctgccca-g
               Pacific walrus  acctgccca-g
                 Weddell seal  acctgccca-g
             Black flying-fox  acccggcca-g
B D                   Megabat  acccggcca-g
                Big brown bat  ggctggcca-g
         David's myotis (bat)  agctggcca-g
B D                  Hedgehog  agctgcctg-c
B D                     Shrew  cccta-ctc-a
              Star-nosed mole  ctc-----c-a
B D                  Platypus  ccccgccga-g
  D               Rock pigeon  ccccacccg-a
  D              Saker falcon  ctgggtgcg-g
  D          Peregrine falcon  ggaaatctt-g
B D       Medium ground finch  tttgggtc---
B D               Zebra finch  accggcgct-g
           Tibetan ground jay  cccaggtgt-g
B D                Budgerigar  gacagagcg-a
  D             Scarlet macaw  ccctgctcc-a
B D                    Turkey  gccagtgcc-a
B D        American alligator  accagtgcc-a
  D           Green seaturtle  actgaggag-a
  D            Painted turtle  agcggggtg-g
  D  Chinese softshell turtle  accggcagg-a
B D             X. tropicalis  accttcc----
         Cape elephant shrew  ===========
B D                    Tenrec  ===========
B D                 Armadillo  ===========
B D                   Manatee  -----------
B D                  Elephant  -----------
          Chinese tree shrew  ===========
B D               Stickleback  ===========
  D       Collared flycatcher  ===========
B D                   Wallaby  ===========
    Mexican tetra (cavefish)  ===========
B D                   Opossum  -----------
B D           Tasmanian devil  ===========
            Cape golden mole  ===========
                    Aardvark  -----------

Inserts between block 20 and 21 in window
  D              Rock pigeon 30bp
  D             Saker falcon 11bp
  D         Peregrine falcon 11bp
B D      Medium ground finch 6bp
B D              Zebra finch 7bp
          Tibetan ground jay 535bp
B D               Budgerigar 2bp
  D            Scarlet macaw 2bp
B D                   Turkey 24bp
B D       American alligator 6bp
  D          Green seaturtle 20bp
  D           Painted turtle 26bp
  D Chinese softshell turtle 15bp

Alignment block 21 of 242 in window, 197023 - 197037, 15 bps 
B D                     Human  g----------ct-----------------------------ccc-tt---------------agagccg
B D                     Chimp  g----------ct-----------------------------gcc-tt---------------agagccg
B D                   Gorilla  g----------ct-----------------------------ccc-tt---------------agagccg
B D                 Orangutan  g----------ct-----------------------------ccc-tt---------------agagccg
B D                    Gibbon  g----------ct-----------------------------ccc-tt---------------agagcta
B D                    Rhesus  g----------ct-----------------------------ccc-tt---------------agagccg
B D       Crab-eating macaque  g----------ct-----------------------------ccc-tt---------------agagccg
B D                    Baboon  g----------ct-----------------------------ccc-tt---------------agagctg
B D              Green monkey  g----------ct-----------------------------ccc-tt---------------agagcca
B D                  Marmoset  g----------cc-----------------------------tcc-tt---------------acagctg
B D           Squirrel monkey  g----------ct-----------------------------tcc-tt---------------acagcag
B D                  Bushbaby  g----------ga-----------------------------tcc-tt---------------agagcca
B D                  Squirrel  g----------cc-----------------------------ccc-tt---------------aga----
       Lesser Egyptian jerboa  g----------ct-----------------------------ccc-tt---------------agagtca
                 Prairie vole  g----------ct-----------------------------ccc-cc---------------aaa----
B D           Chinese hamster  g----------ct-----------------------------ccc-cc---------------agagcca
               Golden hamster  g----------ct-----------------------------ccc-ct---------------agaccca
B D                     Mouse  g----------ct-----------------------------cct-tc---------------agagcca
B D                       Rat  g----------ct-----------------------------ccc-tc---------------agagcca
B D            Naked mole-rat  g----------tc-----------------------------ccc-cg---------------ag--cct
B D                Guinea pig  g----------cc-----------------------------ccc-tg---------------aaaccta
                   Chinchilla  g----------gc-------------------------------c-ca---------------agagcca
             Brush-tailed rat  g----------cc-----------------------------ctc-tg---------------agagcca
B D                    Rabbit  g----------cc-----------------------------ccc-tt---------------agagccg
B D                      Pika  g----------cc-----------------------------cct-gt---------------aggagta
B D                       Pig  a----------cc-----------------------------ccc-tt---------------agattca
B D                    Alpaca  a----------cc-----------------------------ccc-tt---------------agagcca
               Bactrian camel  a----------cc-----------------------------ccc-tt---------------agagcca
B D                   Dolphin  a----------cc-----------------------------ccc-tc---------------agagcc-
                 Killer whale  a----------cc-----------------------------ccc-tc---------------agagcc-
             Tibetan antelope  a----------cc-----------------------------ccc-tc---------------agagccg
B D                       Cow  a----------cc-----------------------------ccc-tc---------------agagccg
B D                     Sheep  a----------cc-----------------------------ccc-tc---------------agagccg
                Domestic goat  a----------cc-----------------------------ccc-tc---------------agagccg
B D                     Horse  a----------cc-----------------------------tcc-tt---------------agagcca
B D          White rhinoceros  a----------cc-----------------------------ccc-tt---------------agagcca
B D                       Cat  ag---------cc-----------------------------cct-gc---------------agagcca
B D                       Dog  ag---------cc-----------------------------ccc-tg---------------agagcca
B D                   Ferret   ag---------cc------------------------------cc-tt---------------agaacca
B D                     Panda  ag---------cc-----------------------------tcc-tt---------------agagcca
               Pacific walrus  aa---------cc-----------------------------ccc-tt---------------agagcca
                 Weddell seal  aa---------cc-----------------------------ccc-tt---------------agagcca
             Black flying-fox  a-----------a-----------------------------cccttt---------------agggcca
B D                   Megabat  a-----------a-----------------------------ccc-tt---------------agggcca
                Big brown bat  a-----------c-----------------------------ccc-ct---------------ggag-ca
         David's myotis (bat)  g-----------c-----------------------------cgc-ct---------------ggag-ca
B D                  Hedgehog  a-----------g-----------------------------cct-ca---------------gagccc-
B D                     Shrew  a-----------a-----------------------------ccc-tttctggagcccacccagaggca-
              Star-nosed mole  a-----------g-----------------------------ccc-ct---------------aaagcc-
B D                  Elephant  ------------------------------------------ccc-ct---------------agggg--
B D                   Manatee  ------------------------------------------ccc-gg---------------agggg--
B D                    Tenrec  -------------------ctggga-----------------ccc-ac---------------aggga--
                     Aardvark  ------------------------------------------cct-ga---------------aggga--
B D                 Armadillo  -------------acctgcccgggatgcctcctccccgtccccct-ac---------------agctg--
B D                   Opossum  -------------------------------------accggccc-tc-----------gtgaggagccg
B D                  Platypus  gggcgggcagcag-----------------------------cct-cc---------------agcgtcg
  D           Green seaturtle  ---------------------------------------------------------------------g
  D            Painted turtle  ---------------------------------------------------------------------g
  D  Chinese softshell turtle  ---------------------------------------------------------------------g
B D             X. tropicalis  -----------cc-----------------------------ccc-cc---------------atagcta
         Cape elephant shrew  ======================================================================
          Chinese tree shrew  ======================================================================
B D               Stickleback  ======================================================================
B D                    Turkey  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D        American alligator  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================

Inserts between block 21 and 22 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                    Sheep 92bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
                    Aardvark 2bp
  D          Green seaturtle 44bp
  D           Painted turtle 5bp
  D Chinese softshell turtle 36bp

Alignment block 22 of 242 in window, 197038 - 197063, 26 bps 
B D                     Human  agaacagtggtgagttaagggccagc----
B D                     Chimp  agaacagtggtgagttaagggccagc----
B D                   Gorilla  agaacagtggtgagttaagggccagc----
B D                 Orangutan  agaacagtggtgagttgagggccagc----
B D                    Gibbon  agaacagtggtgagttgagggccagc----
B D                    Rhesus  aaaacggtggtgagttgagggccagc----
B D       Crab-eating macaque  aaaacggtggtgagttgagggccagc----
B D                    Baboon  aaaacggtggtgagttgagggccagc----
B D              Green monkey  aaaacggtggtgagttgagggccagc----
B D                  Marmoset  agaagcgtggtgagttgagggccacc----
B D           Squirrel monkey  agaagcgtggtgagttgagggccacc----
B D                  Bushbaby  taaggggt-atcagtctggggccaga----
B D                  Squirrel  ---------gtccatcatgggaaaga----
       Lesser Egyptian jerboa  agaa-agtggtcagtgcaggtccaga----
                 Prairie vole  ---------------gcaaggccaga----
B D           Chinese hamster  agag-aatagtcagtgcagggccaga----
               Golden hamster  aaag-aatagtcagtgcagggccagg----
B D                     Mouse  aaac-agtagtcagtgcagggccag-----
B D                       Rat  aagg-aatagtcagcgcagggccaga----
B D            Naked mole-rat  agag-gatggtcagtcactagccaga----
B D                Guinea pig  aaag-ggtggccagttactagccaga----
                   Chinchilla  agag-gatggccagtcactagccaga----
             Brush-tailed rat  agag-gatggccagtcactagccaaa----
B D                    Rabbit  ggag-ggc----------------------
B D                      Pika  gcag-ggccagaggtgcaggccctga----
B D                       Pig  ggc-gggtggtccgt-gagtgctgaa----
B D                    Alpaca  tga-gggtggctggt-gagtgctgag----
               Bactrian camel  aga-gggtggctggt-gagtgctgag----
B D                   Dolphin  --------------------actgtg----
                 Killer whale  --------------------actgtg----
             Tibetan antelope  ---------------------ctgtg----
B D                       Cow  ---------------------ctgtg----
                Domestic goat  ---------------------ctgtg----
B D                     Horse  agaggggtggccagt-gaggacctga----
B D          White rhinoceros  agatgggtggtcagt-gagggcctga----
B D                       Cat  ggaagtgtggtcagt-ga-ggctgga----
B D                       Dog  ggaggggtgtttggt-gagggctggg----
B D                   Ferret   gggggggtggtctgc-g-------------
B D                     Panda  ggaggggtggtcagt-gagggctgga----
               Pacific walrus  ggaggggtggtctgt-gagggctgga----
                 Weddell seal  ggaggggtggtctct-gagggctgga----
             Black flying-fox  gga-gggtggccagt-gagg-gcaga----
B D                   Megabat  gga-gggtggccagt-gagg-gcaga----
                Big brown bat  ggc-gggtggccggg---ggcccaga----
         David's myotis (bat)  gga-gggtggtcggg-gaggcccaaa----
B D                  Hedgehog  agagcagtggcc--------gcggca----
B D                     Shrew  aggatggtggccagt-gagggcgagg----
              Star-nosed mole  aaggtggtggccagc-aaggcacgga----
B D                  Elephant  -------------------------a----
B D                   Manatee  -------------------------c----
B D                    Tenrec  -------------------------a----
                     Aardvark  -------------------------a----
B D                 Armadillo  -------------------------a----
B D                   Opossum  ------caaatgggaaaggggccggg----
B D                  Platypus  --------ggcccgg-gcgggccggg----
  D            Painted turtle  -------------------------g----
B D             X. tropicalis  -----------aagtgctgagccggcctgt
         Cape elephant shrew  ==============================
B D                     Sheep  ==============================
          Chinese tree shrew  ==============================
B D               Stickleback  ==============================
  D  Chinese softshell turtle  ==============================
  D           Green seaturtle  ==============================
B D                    Turkey  ==============================
  D             Scarlet macaw  ==============================
B D                Budgerigar  ==============================
          Tibetan ground jay  ==============================
B D               Zebra finch  ==============================
B D       Medium ground finch  ==============================
  D       Collared flycatcher  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
  D               Rock pigeon  ==============================
B D                   Wallaby  ==============================
    Mexican tetra (cavefish)  ==============================
B D        American alligator  ==============================
B D           Tasmanian devil  ==============================
            Cape golden mole  ==============================

Inserts between block 22 and 23 in window
B D                   Alpaca 59bp
              Bactrian camel 26bp
B D                  Dolphin 17bp
                Killer whale 17bp
            Tibetan antelope 17bp
B D                      Cow 17bp
               Domestic goat 17bp
B D                 Elephant 1bp
B D                  Manatee 1bp
B D                   Tenrec 9bp
                    Aardvark 7bp
B D                Armadillo 25bp
B D                  Opossum 6bp
B D                 Platypus 9bp
  D           Painted turtle 21bp

Alignment block 23 of 242 in window, 197064 - 197081, 18 bps 
B D                     Human  atgg-----acag----------c-------------aactctggg
B D                     Chimp  atgg-----acag----------c-------------aactctggg
B D                   Gorilla  acgg-----acag----------c-------------aactctggg
B D                 Orangutan  atgg-----acag----------c-------------aactctggg
B D                    Gibbon  atgg-----acag----------c-------------aactctggg
B D                    Rhesus  atgg-----acag----------t-------------agctctggg
B D       Crab-eating macaque  atgg-----acag----------t-------------agctctggg
B D                    Baboon  atgg-----acgg----------t-------------agctctggg
B D              Green monkey  atgg-----acag----------t-------------agctctggg
B D                  Marmoset  atgg-----acag----------c-------------aactctggg
B D           Squirrel monkey  atgg-----acag----------c-------------aactctggg
B D                  Bushbaby  gtgg-----agag----------c-------------ccctct---
B D                  Squirrel  atag-----atag----------t-------------tcctctggg
       Lesser Egyptian jerboa  gtgg-----gcag----------c-------------tcctacagg
                 Prairie vole  gtgg-----gcag----------c-------------ccctctggg
B D           Chinese hamster  gtgg-----gcag----------c-------------ccctctggg
               Golden hamster  gtgg-----gcag----------c-------------ccctctgag
B D                     Mouse  ---a-----gcag----------c-------------tcctctggg
B D                       Rat  acaa-----gcat----------c-------------tcctctggg
B D            Naked mole-rat  gtga-----cca------------------------------caga
B D                Guinea pig  gtga-----aca------------------------------ctga
                   Chinchilla  gtga-----cca------------------------------caga
             Brush-tailed rat  ggga-----cca------------------------------agga
B D                      Pika  g--a-----gtag----------g-------------attagtggt
B D                       Pig  agtg-----acag----------c-------------atccgtggc
               Bactrian camel  ---------aggg----------atgatgctcccc--ctctggtgg
B D                   Dolphin  tgaa-----agag----------a----------------catggg
                 Killer whale  tgaa-----agag----------a----------------catggg
             Tibetan antelope  taag-----acag----------c--------------ttcacggg
B D                       Cow  tcag-----agag----------c--------------ttcgtggg
                Domestic goat  tgag-----acag----------c--------------ttcacggg
B D                     Horse  agag-----gcag----------c-------------tcttctggg
B D          White rhinoceros  agag-----gcag----------c-------------tcttctggg
B D                       Cat  ggag-----acag----------c-------------ccttcccag
B D                       Dog  agagtgaccacag----------t----gctgagaaggcttctggg
B D                   Ferret   agag-----acag----------t-------------ccttctggg
B D                     Panda  agag-----acaa----------c-------------acttctggg
               Pacific walrus  agag-----acag----------c-------------ccttctggg
                 Weddell seal  agag-----acag----------c-------------ccttctggg
             Black flying-fox  ggag-----acag----------c-------------tcttccagg
B D                   Megabat  ggag-----acag----------c-------------tcttccagg
                Big brown bat  aggg-----acag----------c-------------cagcctggg
         David's myotis (bat)  aggg-----acag----------c-------------caacctggg
B D                  Hedgehog  ggag-----aggg---------------------------------
B D                     Shrew  agag-----acagcttctctggg-----------------------
              Star-nosed mole  gggg-----acag---------------------------------
B D                  Elephant  -tag-----ccac----------c-------------tcctctgtg
B D                   Manatee  -taa-----gcaa----------c-------------ccctctggg
B D                    Tenrec  ctga-----atgc----------c-------------tgatcttgg
                     Aardvark  ctgg-----gcag----------t-------------acgtggtgg
B D                 Armadillo  gtac-----tcag----------t-------------agttctggg
B D                   Opossum  gggg-----gggg---------------------------------
B D                  Platypus  ccag-----cagg----------c-------------cccaccgtg
  D            Painted turtle  ------------------------------------------ccag
B D             X. tropicalis  -----------------------------ctggcccacattctgca
         Cape elephant shrew  ==============================================
B D                    Rabbit  ----------------------------------------------
B D                     Sheep  ==============================================
B D                    Alpaca  ==============================================
          Chinese tree shrew  ==============================================
B D               Stickleback  ==============================================
  D  Chinese softshell turtle  ==============================================
  D           Green seaturtle  ==============================================
B D                    Turkey  ==============================================
  D             Scarlet macaw  ==============================================
B D                Budgerigar  ==============================================
          Tibetan ground jay  ==============================================
B D               Zebra finch  ==============================================
B D       Medium ground finch  ==============================================
  D       Collared flycatcher  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
  D               Rock pigeon  ==============================================
B D                   Wallaby  ==============================================
    Mexican tetra (cavefish)  ==============================================
B D        American alligator  ==============================================
B D           Tasmanian devil  ==============================================
            Cape golden mole  ==============================================

Inserts between block 23 and 24 in window
B D                      Pig 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
               Domestic goat 3bp
B D                    Horse 24bp
B D         White rhinoceros 27bp
B D                      Cat 27bp
B D                      Dog 30bp
B D                  Ferret  27bp
B D                    Panda 24bp
              Pacific walrus 27bp
                Weddell seal 30bp
            Black flying-fox 24bp
B D                  Megabat 24bp
               Big brown bat 21bp
        David's myotis (bat) 96bp
B D                 Hedgehog 2bp
B D                    Shrew 5bp
             Star-nosed mole 2bp
B D                 Platypus 2bp
  D           Painted turtle 18bp

Alignment block 24 of 242 in window, 197082 - 197091, 10 bps 
B D                     Human  ttaca-----------------------------------------gttaa
B D                     Chimp  ttaca-----------------------------------------gttaa
B D                   Gorilla  ttaca-----------------------------------------gttaa
B D                 Orangutan  ttaca-----------------------------------------gttaa
B D                    Gibbon  ttaca-----------------------------------------gttaa
B D                    Rhesus  ataca-----------------------------------------gttaa
B D       Crab-eating macaque  ataca-----------------------------------------gttaa
B D                    Baboon  ataca-----------------------------------------gttaa
B D              Green monkey  at--a-----------------------------------------gttaa
B D                  Marmoset  ttagg-----------------------------------------gttaa
B D           Squirrel monkey  ttagg-----------------------------------------gttaa
B D                  Squirrel  cttgc-------------accagagtccaaaact-----ccttaccttgga
       Lesser Egyptian jerboa  actg------------------------gtgccc-----ccccatcttgga
                 Prairie vole  cctat--------------cctgaaggcatgacccccatccatatcttgga
B D           Chinese hamster  cctac--------------cctgaaggcatgact-----ccatatcttgga
               Golden hamster  cctat--------------cctgagagcatgactcctacccatatcttgga
B D                     Mouse  cctgt--------------cctgaaggcatgactcccacccttatcttgga
B D                       Rat  cctgt--------------cctgaagtcatgactcccacccatatcttgta
B D            Naked mole-rat  c---------------------------------------------ctaga
B D                Guinea pig  acaca--------------actggcatc-----------ccttatcttgga
                   Chinchilla  cagga--------------cctggcacc-----------tctcattttaga
             Brush-tailed rat  cagga--------------cctggctcc-----------cctcattttgga
B D                    Rabbit  ----------------------gatggcaaggtct----------------
B D                      Pika  ctgaacaccaactaggaaagcagaggggaagggctgcc-cccaaccctaga
B D                       Pig  gt-------------------------------------------------
               Bactrian camel  gt-------------------------------------------------
B D                   Dolphin  gt-------------------------------------------------
                 Killer whale  gt-------------------------------------------------
             Tibetan antelope  gt-------------------------------------------------
B D                       Cow  gt-------------------------------------------------
                Domestic goat  gt-------------------------------------------------
B D                     Horse  gt-------------------------------------------------
B D          White rhinoceros  ct-------------------------------------------------
B D                       Cat  ct-------------------------------------------------
B D                       Dog  ct-------------------------------------------------
B D                   Ferret   ct-------------------------------------------------
B D                     Panda  ct-------------------------------------------------
               Pacific walrus  ct-------------------------------------------------
                 Weddell seal  ct-------------------------------------------------
             Black flying-fox  cc-------------------------------------------------
B D                   Megabat  cc-------------------------------------------------
                Big brown bat  gg-------------------------------------------------
B D                  Hedgehog  ct-------------------------------------------------
B D                     Shrew  ac-------------------------------------------------
              Star-nosed mole  gt-------------------------------------------------
B D                  Elephant  ---------------------------------------------gctgga
B D                   Manatee  ---------------------------------------------gct---
B D                    Tenrec  ---------------------------------------------cctcgc
                     Aardvark  ---------------------------------------------tctgag
B D                 Armadillo  ---------------------------------------------ccagca
B D                   Opossum  ---------------------------------------------cttc--
B D                  Platypus  ----------------------------------------tcgggcctgg-
B D             X. tropicalis  -----------------------------------------tcatggccga
         Cape elephant shrew  ===================================================
B D                     Sheep  ===================================================
        David's myotis (bat)  ===================================================
B D                    Alpaca  ===================================================
          Chinese tree shrew  ===================================================
B D               Stickleback  ===================================================
  D  Chinese softshell turtle  ===================================================
  D            Painted turtle  ===================================================
  D           Green seaturtle  ===================================================
B D                    Turkey  ===================================================
  D             Scarlet macaw  ===================================================
B D                Budgerigar  ===================================================
          Tibetan ground jay  ===================================================
B D               Zebra finch  ===================================================
B D       Medium ground finch  ===================================================
  D       Collared flycatcher  ===================================================
  D          Peregrine falcon  ===================================================
  D              Saker falcon  ===================================================
  D               Rock pigeon  ===================================================
B D                   Wallaby  ===================================================
    Mexican tetra (cavefish)  ===================================================
B D        American alligator  ===================================================
B D           Tasmanian devil  ===================================================
            Cape golden mole  ===================================================
B D                  Bushbaby  ---------------------------------------------------

Inserts between block 24 and 25 in window
B D                      Pig 7bp
              Bactrian camel 3bp
B D                  Dolphin 10bp
                Killer whale 10bp
            Tibetan antelope 10bp
B D                      Cow 10bp
               Domestic goat 10bp
B D                    Horse 7bp
B D         White rhinoceros 7bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                  Ferret  7bp
B D                    Panda 8bp
              Pacific walrus 6bp
                Weddell seal 6bp
            Black flying-fox 7bp
B D                  Megabat 7bp
               Big brown bat 6bp
B D                 Elephant 2bp
B D                   Tenrec 3bp
                    Aardvark 2bp
B D                Armadillo 4bp

Alignment block 25 of 242 in window, 197092 - 197096, 5 bps 
B D                     Human  gc-------tgg
B D                     Chimp  gc-------tgg
B D                   Gorilla  gc-------tgg
B D                 Orangutan  gc-------tag
B D                    Gibbon  gc-------tga
B D                    Rhesus  gc-------tgg
B D       Crab-eating macaque  gc-------tgg
B D                    Baboon  gc-------tgg
B D              Green monkey  gc-------tgg
B D                  Marmoset  gc-------tgg
B D           Squirrel monkey  gc-------tga
B D                  Bushbaby  ---------tgg
B D                  Squirrel  gg-------tgt
       Lesser Egyptian jerboa  gc-------tgg
                 Prairie vole  gc-------tgg
B D           Chinese hamster  gc-------tgg
               Golden hamster  gc-------tgt
B D                     Mouse  gc-------tgg
B D                       Rat  gc-------tgg
B D            Naked mole-rat  gc-------tgg
B D                Guinea pig  gc-------tga
                   Chinchilla  gc-------tgg
             Brush-tailed rat  gc-------tgg
B D                    Rabbit  ---------cgg
B D                      Pika  gagaggaaccag
B D                       Pig  ----------gg
B D                    Alpaca  gc-------aga
               Bactrian camel  gc-------aga
B D                   Dolphin  -c-------tga
                 Killer whale  -c-------tga
             Tibetan antelope  -c-------tga
B D                       Cow  -c-------tga
                Domestic goat  -c-------tga
B D                     Horse  gt-------tgg
B D          White rhinoceros  gt-------tgg
B D                       Cat  gc-------tgg
B D                       Dog  gt-------tgg
B D                   Ferret   at-------tgg
B D                     Panda  gt-------tgg
               Pacific walrus  gt-------tgg
                 Weddell seal  gt-------tgg
             Black flying-fox  ac-------tgg
B D                   Megabat  ac-------tgg
                Big brown bat  -c-------ctg
B D                  Hedgehog  ----------ga
B D                     Shrew  ----------gc
              Star-nosed mole  ----------gc
B D                   Opossum  -----ttcttgg
B D                  Platypus  ga-------ggg
  D               Rock pigeon  g-----------
  D              Saker falcon  g-----------
  D          Peregrine falcon  t-----------
B D       Medium ground finch  a-----------
B D               Zebra finch  a-----------
B D                Budgerigar  c-----------
  D             Scarlet macaw  c-----------
B D                    Turkey  g-----------
B D        American alligator  a-----------
  D           Green seaturtle  g-----------
  D            Painted turtle  g-----------
  D  Chinese softshell turtle  g-----------
B D             X. tropicalis  -----cccacg-
         Cape elephant shrew  ============
B D                    Tenrec  ============
B D                     Sheep  ============
        David's myotis (bat)  ============
B D                 Armadillo  ============
B D                   Manatee  ------------
B D                  Elephant  ============
          Chinese tree shrew  ============
B D               Stickleback  ============
          Tibetan ground jay  ============
  D       Collared flycatcher  ============
B D                   Wallaby  ============
    Mexican tetra (cavefish)  ============
B D           Tasmanian devil  ============
            Cape golden mole  ============
                    Aardvark  ============

Inserts between block 25 and 26 in window
  D              Rock pigeon 74bp
B D      Medium ground finch 67bp
B D              Zebra finch 76bp
B D               Budgerigar 134bp
  D            Scarlet macaw 52bp
B D                   Turkey 43bp
B D       American alligator 95bp
  D          Green seaturtle 49bp
  D           Painted turtle 42bp
  D Chinese softshell turtle 56bp

Alignment block 26 of 242 in window, 197097 - 197099, 3 bps 
B D                     Human  --t-g-a
B D                     Chimp  --t-g-a
B D                   Gorilla  --t-g-a
B D                 Orangutan  --t-g-a
B D                    Gibbon  --t-g-a
B D                    Rhesus  --t-g-a
B D       Crab-eating macaque  --t-g-a
B D                    Baboon  --t-g-a
B D              Green monkey  --t-g-a
B D                  Marmoset  --t-g-a
B D           Squirrel monkey  --t-g-a
B D                  Bushbaby  --t-g-t
B D                  Squirrel  --g----
       Lesser Egyptian jerboa  --g-g-a
                 Prairie vole  --gtt-a
B D           Chinese hamster  --g-g-a
               Golden hamster  --a-g-a
B D                     Mouse  --g-t-a
B D                       Rat  --g-taa
B D            Naked mole-rat  --a-g-a
B D                Guinea pig  --a-g-a
                   Chinchilla  --a-a-a
             Brush-tailed rat  --g-g-a
B D                    Rabbit  --g-c-a
B D                      Pika  --c-t-g
B D                       Pig  --t-g--
B D                    Alpaca  --g-g--
               Bactrian camel  --g-g--
B D                   Dolphin  --g-g--
                 Killer whale  --g-g--
             Tibetan antelope  --t-g--
B D                       Cow  --t-g--
                Domestic goat  --t-g--
B D                     Horse  --t-g-a
B D          White rhinoceros  --t-g-a
B D                       Cat  --t-g-a
B D                       Dog  --t-g-a
B D                   Ferret   --t-g-g
B D                     Panda  --t-g-g
               Pacific walrus  --t-g-g
                 Weddell seal  --t-g-g
             Black flying-fox  --t-g-a
B D                   Megabat  --t-g-a
                Big brown bat  --g-g-g
B D                  Hedgehog  --g-g-t
B D                     Shrew  --t-g--
              Star-nosed mole  --t-g-t
B D                 Armadillo  ------a
B D                   Opossum  --g-c--
B D                  Platypus  --c-a-a
B D             X. tropicalis  tct----
         Cape elephant shrew  =======
B D                    Tenrec  =======
B D                     Sheep  =======
        David's myotis (bat)  =======
B D                   Manatee  -------
B D                  Elephant  =======
          Chinese tree shrew  =======
B D               Stickleback  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D                    Turkey  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D       Collared flycatcher  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D                   Wallaby  =======
    Mexican tetra (cavefish)  =======
B D        American alligator  =======
B D           Tasmanian devil  =======
            Cape golden mole  =======
                    Aardvark  =======

Inserts between block 26 and 27 in window
B D                      Pig 4bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 18bp
                Killer whale 18bp
            Tibetan antelope 32bp
B D                      Cow 30bp
               Domestic goat 32bp
B D                    Shrew 1bp

Alignment block 27 of 242 in window, 197100 - 197101, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  ga
B D                  Bushbaby  gc
       Lesser Egyptian jerboa  gg
                 Prairie vole  ag
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                    Rabbit  ga
B D                      Pika  gg
B D                     Horse  ag
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  gg
B D                  Hedgehog  ga
              Star-nosed mole  ga
B D                 Armadillo  gg
B D                  Platypus  ga
  D               Rock pigeon  gg
  D              Saker falcon  gg
  D          Peregrine falcon  gg
B D       Medium ground finch  gg
B D               Zebra finch  gg
           Tibetan ground jay  gg
B D                Budgerigar  gg
  D             Scarlet macaw  ag
B D             X. tropicalis  gg
         Cape elephant shrew  ==
B D                     Shrew  ==
B D                    Tenrec  ==
B D                       Pig  ==
B D                   Dolphin  ==
                Killer whale  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
B D                   Manatee  --
B D                  Elephant  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                  Squirrel  --
          Chinese tree shrew  ==
B D               Stickleback  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
  D       Collared flycatcher  ==
B D                   Wallaby  ==
    Mexican tetra (cavefish)  ==
B D        American alligator  ==
B D                   Opossum  --
B D           Tasmanian devil  ==
            Cape golden mole  ==
                    Aardvark  ==

Inserts between block 27 and 28 in window
      Lesser Egyptian jerboa 62bp
                Prairie vole 4bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                    Mouse 4bp
B D                      Rat 4bp
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                    Horse 8bp
B D         White rhinoceros 8bp
B D                      Cat 8bp
B D                      Dog 8bp
B D                  Ferret  8bp
B D                    Panda 8bp
              Pacific walrus 8bp
                Weddell seal 8bp
            Black flying-fox 8bp
B D                  Megabat 8bp
               Big brown bat 8bp
B D                 Hedgehog 2bp
             Star-nosed mole 2bp
B D                Armadillo 6bp
B D                 Platypus 7bp
  D              Rock pigeon 12bp
  D             Saker falcon 19bp
  D         Peregrine falcon 19bp
B D      Medium ground finch 13bp
B D              Zebra finch 12bp
          Tibetan ground jay 12bp
B D               Budgerigar 12bp
  D            Scarlet macaw 12bp

Alignment block 28 of 242 in window, 197102 - 197120, 19 bps 
B D                     Human  agctc--acag------ac----------------------------------c-----ca---------
B D                     Chimp  agctc--acag------tc----------------------------------c-----ca---------
B D                   Gorilla  agctc--acag------tc----------------------------------c-----ca---------
B D                 Orangutan  agctc--acag------tc----------------------------------c-----cg---------
B D                    Gibbon  agctc--acag------tc----------------------------------c-----ca---------
B D                    Rhesus  agctc--acag------tc----------------------------------c-----ca---------
B D       Crab-eating macaque  agctc--acag------tc----------------------------------c-----ca---------
B D                    Baboon  agctc--acag------tc----------------------------------c-----ca---------
B D              Green monkey  agctc--acag------tc----------------------------------c-----ca---------
B D                  Marmoset  cattc--acaa------tc----------------------------------c-----ta---------
B D           Squirrel monkey  cgttc--acag------tc----------------------------------c-----ta---------
B D                  Bushbaby  atggc--aggg------tc----------------------------------t----------------
           Chinese tree shrew  agccc--tcta------tt----------------------------------c-----ca---------
B D                  Squirrel  agctc--acta------ca----------------------------------ctacagca---------
                 Prairie vole  agctt--acca------ca----------------------------------c-----c----------
B D           Chinese hamster  agctc--acca------ct----------------------------------c-----tg---------
               Golden hamster  agctc--acca------ct----------------------------------c-----cg---------
B D                     Mouse  agctc--acca------ca----------------------------------c-----ca---------
B D                       Rat  agctt--acca------ca----------------------------------c-----ca---------
B D            Naked mole-rat  agtcc--acct------ca----------------------------------c-----ca---------
B D                Guinea pig  agcac--actt------ca----------------------------------t-----ca---------
                   Chinchilla  agccc--atct------ca----------------------------------c-----ca---------
             Brush-tailed rat  agccc--agcc------ca----------------------------------c-----ca---------
B D                    Rabbit  agc-----cct------cagg--------------------------------c-----tg---------
B D                      Pika  cgctg--accc------caggagtgaccccaatacaaaggcccctccctgaccc-----tg---------
B D                       Pig  atcct--actg------ct----------------------------------g-----gcggtcggtgt
B D                    Alpaca  gaccc--actg------cc----------------------------------c-----aa---------
               Bactrian camel  gaccc--actg------ct----------------------------------c-----aa---------
B D                   Dolphin  gacgg--gttg------gt----------------------------------g-----c----------
                 Killer whale  gacgg--gttg------gt----------------------------------g-----c----------
             Tibetan antelope  aaccc--actg------ct----------------------------------c-----ta---------
B D                       Cow  aaccc--actg------ct----------------------------------c-----ta---------
B D                     Sheep  aaccc--actg------ct----------------------------------c-----ta---------
                Domestic goat  aaccc--actg------ct----------------------------------c-----ta---------
B D                     Horse  aa-cc--acga------tt----------------------------------c-----ca---------
B D          White rhinoceros  aa-cc--acta------ct----------------------------------c-----ca---------
B D                       Cat  agccc--actg------ct----------------------------------c-----ca---------
B D                       Dog  agccc--acta------ct----------------------------------c-----cg---------
B D                   Ferret   ggccc--ccca-----cct----------------------------------c-----ga---------
B D                     Panda  agccc--acta------ct----------------------------------c-----ca---------
               Pacific walrus  agccc--acta------ct----------------------------------c-----ca---------
                 Weddell seal  agccc--acta------ct----------------------------------c-----ca---------
             Black flying-fox  aagct--gctc------ct----------------------------------c-----cg---------
B D                   Megabat  aagct--gctc------ct----------------------------------c-----cg---------
                Big brown bat  aa---------------cc----------------------------------c-----ca---------
B D                  Hedgehog  gcttg--a--t------cc----------------------------------c-----gt---------
B D                     Shrew  gcctg--acgt------cc-------ctcca----------------------c-----ct---------
              Star-nosed mole  gcctc--atgc------cc----------------------------------c-----ct---------
B D                   Opossum  agatc--tctggccctgcc----------------------------------c-----cg---------
B D                  Platypus  aggcc--ag-------------------------------------------------------------
  D               Rock pigeon  ccacc--atgc------ag---------------------------------------------------
  D              Saker falcon  cacca--atgc------ca---------------------------------------------------
  D          Peregrine falcon  cacca--atgc------ca---------------------------------------------------
B D       Medium ground finch  gttcc--agga------gc---------------------------------------------------
B D               Zebra finch  gcacc--atcc------ct---------------------------------------------------
           Tibetan ground jay  gaccc--ctga------gg---------------------------------------------------
B D                Budgerigar  gacac--aggc------tc---------------------------------------------------
  D             Scarlet macaw  gaccct-tggc------tc---------------------------------------------------
B D                    Turkey  gagca--gtga------cg---------------------------------------------------
B D        American alligator  aatcc--agtg------cc---------------------------------------------------
  D           Green seaturtle  aagct--ggga------ag---------------------------------------------------
  D            Painted turtle  gtgcccggtgg------gg---------------------------------------------------
  D  Chinese softshell turtle  gacctggctag------gg---------------------------------------------------
B D             X. tropicalis  ggccc--cccc------at----------------------------------cagtgcca---------
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================

                        Human  tgc---ag
                        Chimp  ggc---ag
                      Gorilla  tgc---ag
                    Orangutan  tgc---ag
                       Gibbon  tgc---ag
                       Rhesus  tgc---ag
          Crab-eating macaque  tgc---ag
                       Baboon  tgc---ag
                 Green monkey  ggc---ag
                     Marmoset  tgc---ag
              Squirrel monkey  tgc---ag
                     Bushbaby  --------
           Chinese tree shrew  agg---ag
                     Squirrel  agc---ag
                 Prairie vole  aat---gg
              Chinese hamster  aat---gg
               Golden hamster  gat---gg
                        Mouse  gac---gg
                          Rat  aat---gg
               Naked mole-rat  agc---ag
                   Guinea pig  agc---ag
                   Chinchilla  agc---ag
             Brush-tailed rat  agc---ag
                       Rabbit  catccctg
                         Pika  aacccatg
                          Pig  ggc---ag
                       Alpaca  agc---ag
               Bactrian camel  agc---ag
                      Dolphin  ggc---ag
                 Killer whale  ggc---ag
             Tibetan antelope  agc---ag
                          Cow  agc---ag
                        Sheep  agc---ag
                Domestic goat  agc---ag
                        Horse  agc---ag
             White rhinoceros  aac---ag
                          Cat  agc---at
                          Dog  ggc---ag
                      Ferret   aac---ag
                        Panda  ggc---ag
               Pacific walrus  agc---ag
                 Weddell seal  agc---ag
             Black flying-fox  ggc---ag
                      Megabat  ggc---ag
                Big brown bat  gg-----a
                     Hedgehog  gag---ag
                        Shrew  ggc---ac
              Star-nosed mole  ggc---gt
                      Opossum  g-------
                     Platypus  --------
                  Rock pigeon  --------
                 Saker falcon  --------
             Peregrine falcon  --------
          Medium ground finch  --------
                  Zebra finch  --------
           Tibetan ground jay  --------
                   Budgerigar  --------
                Scarlet macaw  --------
                       Turkey  --------
           American alligator  --------
              Green seaturtle  --------
               Painted turtle  --------
     Chinese softshell turtle  --------
                X. tropicalis  --------
          Cape elephant shrew  ========
       Lesser Egyptian jerboa  ========
                       Tenrec  ========
         David's myotis (bat)  ========
                    Armadillo  ========
                      Manatee  --------
                     Elephant  ========
                  Stickleback  ========
          Collared flycatcher  ========
                      Wallaby  ========
     Mexican tetra (cavefish)  ========
              Tasmanian devil  ========
             Cape golden mole  ========
                     Aardvark  ========

Inserts between block 28 and 29 in window
B D                  Opossum 1bp
B D                 Platypus 8bp

Alignment block 29 of 242 in window, 197121 - 197128, 8 bps 
B D                     Human  -aaagc-------------------------------------------------tcc
B D                     Chimp  -aaagc-------------------------------------------------tcc
B D                   Gorilla  -aaagc-------------------------------------------------tcc
B D                 Orangutan  -aaagc-------------------------------------------------tcc
B D                    Gibbon  -aaaac-------------------------------------------------tcc
B D                    Rhesus  -aaagc-------------------------------------------------gcc
B D       Crab-eating macaque  -aaagc-------------------------------------------------gcc
B D                    Baboon  -caagc-------------------------------------------------gcc
B D              Green monkey  -aaagc-------------------------------------------------tcc
B D                  Marmoset  -aaagc-------------------------------------------------tcc
B D           Squirrel monkey  -aaagc-------------------------------------------------tcc
           Chinese tree shrew  -aaagc-------------------------------------------------tcc
B D                  Squirrel  -aaagc-------------------------------------------------tcc
                 Prairie vole  -ggagc-------------------------------------------------tcc
B D           Chinese hamster  -ggaac-------------------------------------------------tcc
               Golden hamster  -ggagc-------------------------------------------------tcc
B D                     Mouse  -ggagc-------------------------------------------------tct
B D                       Rat  -ggagc-------------------------------------------------tcc
B D            Naked mole-rat  -aaagc-------------------------------------------------tcc
B D                Guinea pig  -aaagt-------------------------------------------------ttc
                   Chinchilla  -aaagt-------------------------------------------------ttc
             Brush-tailed rat  -aaagt-------------------------------------------------tcc
B D                    Rabbit  -ccagg-------------------------------------------------tcc
B D                      Pika  -agtga-------------------------------------------------ccc
B D                       Pig  -agcca-------------------------------------------------act
B D                    Alpaca  -aaact-------------------------------------------------cc-
               Bactrian camel  -aaact-------------------------------------------------cc-
B D                   Dolphin  -aatct-------------------------------------------------cc-
                 Killer whale  -aatct-------------------------------------------------cc-
             Tibetan antelope  -aggcc-------------------------------------------------cct
B D                       Cow  -aggct-------------------------------------------------cc-
B D                     Sheep  -aggcc-------------------------------------------------cc-
                Domestic goat  -aggcc-------------------------------------------------cc-
B D                     Horse  -aggct-------------------------------------------------cc-
B D          White rhinoceros  -aggct-------------------------------------------------cc-
B D                       Cat  -aacct----------------------------------------------------
B D                       Dog  -atgtt----------------------------------------------------
B D                   Ferret   -aagtt----------------------------------------------------
B D                     Panda  -aagtt----------------------------------------------------
               Pacific walrus  -aagtt----------------------------------------------------
                 Weddell seal  -aagtt----------------------------------------------------
             Black flying-fox  -aggcc----------------------------------------------------
B D                   Megabat  -aggcc----------------------------------------------------
                Big brown bat  -gcgtc----------------------------------------------------
B D                  Hedgehog  -cagaa-------------------------------------------------ca-
B D                     Shrew  -tggta-------------------------------------------------ag-
              Star-nosed mole  -gggcc-------------------------------------------------ag-
B D                  Elephant  -----caaggg--------------------------------------------tct
B D                   Manatee  -------------------------------------------------------tct
B D                    Tenrec  ----tcagagaccagctcccattgcccacatcccccaatccccactgcccacccctcc
                     Aardvark  -------------------------------------------------------cct
B D                 Armadillo  -agaggaagggagagc---------------------------------------tca
B D                   Opossum  -agggg-------------------------------------------------cct
B D           Tasmanian devil  -aaggc-------------------------------------------------tct
B D                  Platypus  -agcca-------------------------------------------------gcc
B D             X. tropicalis  ggagct-------------------------------------------------ac-
         Cape elephant shrew  ==========================================================
      Lesser Egyptian jerboa  ==========================================================
        David's myotis (bat)  ==========================================================
B D               Stickleback  ==========================================================
  D  Chinese softshell turtle  ----------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------
          Tibetan ground jay  ----------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------
B D       Medium ground finch  ----------------------------------------------------------
  D       Collared flycatcher  ==========================================================
  D          Peregrine falcon  ----------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------
B D                   Wallaby  ==========================================================
    Mexican tetra (cavefish)  ==========================================================
B D        American alligator  ----------------------------------------------------------
            Cape golden mole  ==========================================================
B D                  Bushbaby  ----------------------------------------------------------

Alignment block 30 of 242 in window, 197129 - 197198, 70 bps 
B D                     Human  tactgt---ccc-----------------tgactc--------------------ctggctc-------c
B D                     Chimp  tactgt---ccc-----------------tgactc--------------------ctggctc-------c
B D                   Gorilla  tactgt---ccc-----------------tgactc--------------------ctggctc-------c
B D                 Orangutan  taccgt---ccc-----------------tgactc--------------------ctggttc-------c
B D                    Gibbon  taccgt---ccc-----------------ttactc--------------------ctggctc-------c
B D                    Rhesus  taccat---ccc-----------------ttactc--------------------ctggctc-------c
B D       Crab-eating macaque  taccat---ccc-----------------ttactc--------------------ctggctc-------c
B D                    Baboon  taccat---ccc-----------------ttactc--------------------ccggctc-------c
B D              Green monkey  taccat---ctc-----------------ttactc--------------------ctgggtc-------c
B D                  Marmoset  cacggt---ccc-----------------taactc--------------------ctggctc-------c
B D           Squirrel monkey  caccct---ccc-----------------tcactc--------------------ctggctc-------c
B D                  Bushbaby  -----g---ccc-----------------tacctc--------------------ctggctc-------c
           Chinese tree shrew  cgctgc---ccc----------------------------------------------------------
B D                  Squirrel  cactgc---cca-----------------taata------------------------------------
                 Prairie vole  gtctgc---ttg-----------------gagct------------------------------------
B D           Chinese hamster  ctctgc---ttg-----------------taact------------------------------------
               Golden hamster  ctctgc---ttg-----------------taact------------------------------------
B D                     Mouse  ctttgc---ttg-----------------taact------------------------------------
B D                       Rat  ctttgc---ttg-----------------taaca------------------------------------
B D            Naked mole-rat  cactgc---cca-----------------tgact------------------------------------
B D                Guinea pig  tactgc---ccc-----------------tgact------------------------------------
                   Chinchilla  cactgc---ccc-----------------taact------------------------------------
             Brush-tailed rat  cactgc---cc---------------------ct------------------------------------
B D                    Rabbit  caccgc---cc--------------------agc------------------------------------
B D                      Pika  tagtgc---ac--------------------agg------------------------------------
B D                       Pig  cactgc---tct-----------------caaat---------------------ccaggcc-------c
B D                    Alpaca  cactgc---tct-----------------tgagt---------------------ctgggcc-------c
               Bactrian camel  caccgc---tct-----------------tgagt---------------------ctgggcc-------c
B D                   Dolphin  cactgc---tct-----------------gaagt---------------------ctgggcc-------t
                 Killer whale  cactgc---tct-----------------gaagt---------------------ctgggcc-------t
             Tibetan antelope  gagtga---tcc-----------------tcggt---------------------ctgggcc-------c
B D                       Cow  cagtga---ccc-----------------tccgt---------------------ctgggcc-------c
B D                     Sheep  aagtga---tcc-----------------ttggt---------------------ctgggcc-------c
                Domestic goat  gagtga---ccc-----------------ttggt---------------------ctgggcc-------c
B D                     Horse  cactgc---cct-----------------taagc---------------------ctgggcc-------c
B D          White rhinoceros  cactgc---cct-----------------tatgt---------------------ccaggcc-------c
B D                       Cat  ---------ctg-----------------tg-------------------------tagacc-------c
B D                       Dog  ---------ctg-----------------aaagt---------------------ctgggcc-------c
B D                   Ferret   ---------ctg-----------------taagt---------------------ctggg-c-------c
B D                     Panda  ---------cta-----------------taagt---------------------ctgggac-------c
               Pacific walrus  ---------ctg-----------------taagt---------------------ctgggcc-------c
                 Weddell seal  ---------ccg-----------------taagt---------------------ctgggcc-------c
             Black flying-fox  taccgctcactg------------------aggt---------------------ctgggct-------c
B D                   Megabat  tactgctcactg------------------aggt---------------------ctgggct-------c
                Big brown bat  cactgc---ccg------------------aggc---------------------atgggc--------c
B D                  Hedgehog  gacatc---cca-----------------gggat---------------------gt--ctc-------c
B D                     Shrew  ggcaga---gca-----------------aacac---------------------actgctc-------t
              Star-nosed mole  ggcaca---gca-----------------gacac---------------------ctgaccc-------c
B D                  Elephant  gagctt---ctc--------------------gt---------------------ctctgc---------
B D                   Manatee  catctc---tgc----------------------------------------------------------
B D                    Tenrec  cacttc---ctcctaatcccactgcctaacctat---------------------tcctgcc-------c
                     Aardvark  catttc---agc--------------------ct---------------------cgctgtg-------c
B D                 Armadillo  cattgc---aag----------------------------------------------------------
B D                   Opossum  tccagg---gct-----------------tagac---------------------agggggctc-----c
B D           Tasmanian devil  ttctgt---ttg-----------------ttgtc---------------------cggtttctcggagac
B D                  Platypus  agccac---cca-----------------gcgag---------------------ccagctc-------c
  D               Rock pigeon  ----------------------------------tgccaccccttgg--gggctgcaggaac-------c
  D              Saker falcon  ----------------------------------ctgtcaccat-------gctaccagctc-------c
  D          Peregrine falcon  ----------------------------------ctgtcaccat-------gctaccagctc-------c
B D       Medium ground finch  ----------------------------------ttttccca---------------------------c
B D               Zebra finch  ----------------------------------gtgtccca----------ctgcgggatt-------c
           Tibetan ground jay  ----------------------------------gggaacca----------tggcgggacc-------c
B D                Budgerigar  ----------------------------------agttccct----------------catc-------c
  D             Scarlet macaw  ----------------------------------caggctct-------------tggtact-------c
B D                    Turkey  ----------------------------------ctgtgtccccctg--cggccaaggccac-------c
B D        American alligator  ----------------------------------tggtcaca-----------cgctgtccc-------c
  D           Green seaturtle  ----------------------------------agatcccaggttgcctcactcccagtcc-------c
  D            Painted turtle  ----------------------------------agatcccgggggg------tccaggtgc-------c
  D  Chinese softshell turtle  ----------------------------------gggtctc-------ctcactccc----c-------t
         Cape elephant shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
        David's myotis (bat)  ======================================================================
B D               Stickleback  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
            Cape golden mole  ======================================================================

                        Human  cag---------ctg----------------ga----------ga---------------------t---
                        Chimp  cag---------ctg----------------ga----------ga---------------------t---
                      Gorilla  cag---------ctg----------------ga----------ga---------------------t---
                    Orangutan  cag---------ctg----------------ga----------ga---------------------t---
                       Gibbon  cag---------ctg----------------ga----------ga---------------------t---
                       Rhesus  cag---------ctg----------------ga----------ga---------------------t---
          Crab-eating macaque  cag---------ctg----------------ga----------ga---------------------t---
                       Baboon  cag---------ctg----------------ga----------ga---------------------t---
                 Green monkey  cag---------ctg----------------ga----------ga---------------------t---
                     Marmoset  cag---------ctg----------------ga----------g----------------------t---
              Squirrel monkey  cag---------ctg----------------ga----------g----------------------c---
                     Bushbaby  cag---------ttg----------------ga---------------------------------c---
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  --g---------ctc----------------aa----------aa---------------------c---
                 Prairie vole  --g---------ctta---------------aa----------ga---------------------c---
              Chinese hamster  --g---------ctc----------------ga----------ga---------------------c---
               Golden hamster  --g---------ctc----------------aa----------ga---------------------c---
                        Mouse  --a---------ctc----------------ga----------ga---------------------c---
                          Rat  --g---------ctt----------------ga----------ga---------------------c---
               Naked mole-rat  --g---------ctt----------------ga----------ga---------------------t---
                   Guinea pig  --g---------cat----------------ga----------ga---------------------t---
                   Chinchilla  --g---------cat----------------ta----------ga-------------------------
             Brush-tailed rat  --g---------ctt----------------ga----------ga---------------------c---
                       Rabbit  --c---------ctc----------------gc----------ga---------------------t---
                         Pika  --c---------ccc----------------tccctgaccct-ga---------------------t---
                          Pig  caa---------ctc----------------ga----------ga---------------------t---
                       Alpaca  cag---------ctt----------------ga----------ga---------------------c---
               Bactrian camel  cag---------ctt----------------ga----------ga---------------------c---
                      Dolphin  caa---------ctc----------------aa----------ga---------------------c---
                 Killer whale  caa---------ctc----------------aa----------ga---------------------c---
             Tibetan antelope  caa---------ggc----------------ga----------ga---------------------c---
                          Cow  caa---------gtc----------------ga----------ga---------------------c---
                        Sheep  caa---------ggc----------------ga----------ga---------------------c---
                Domestic goat  caa---------ggc----------------ga----------ga---------------------c---
                        Horse  cag---------ctt----------------ga----------ga---------------------c---
             White rhinoceros  cag---------ttt----------------ga----------ga---------------------c---
                          Cat  cag---------ctc----------------aa----------ga---------------------c---
                          Dog  cag---------gtc----------------aa----------ga---------------------c---
                      Ferret   cag---------ctc----------------aa----------ga---------------------c---
                        Panda  cag---------ctc----------------aa----------ga---------------------c---
               Pacific walrus  cag---------ctc----------------aa----------ga---------------------g---
                 Weddell seal  cag---------ctc----------------aa----------ga---------------------c---
             Black flying-fox  cag---------ctc----------------gg----------ga---------------------c---
                      Megabat  cag---------ctc----------------gg----------ga---------------------c---
                Big brown bat  cag---------ctc-----------------c----------cc---------------------c---
                     Hedgehog  cgg---------ctg----------------ca----------ga---------------------c---
                        Shrew  aga---------cag----------------aaataaccacttacccctcagtctccagctccaaac---
              Star-nosed mole  agg---------cag----------------ga----------gcccctgtgc-------------c---
                     Elephant  -------------------------------ct----------cg---------------------c---
                      Manatee  -------------------------------ct----------ca---------------------c---
                       Tenrec  caa---------ctcccatcatactccaactcc----------cg---------------------c---
                     Aardvark  caa---------gaa-------------------------------------------------------
                    Armadillo  cag---------aaa----------------gc----------cc---------------------c---
                      Opossum  ggg---------ctg----------------gg----------ga---------------------g---
              Tasmanian devil  cgg---------ccg----------------ga----------gg---------------------c---
                     Platypus  cac---------ctc----------------cg----------g----------------------c---
                  Rock pigeon  tgg---------gcg----------------gg----------gg---------------------t---
                 Saker falcon  ttg---------------------------------------------------------------c---
             Peregrine falcon  ttg---------------------------------------------------------------c---
          Medium ground finch  ctg---------cct----------------gg----------ta---------------------t---
                  Zebra finch  cag---------cct----------------gg----------aa---------------------ttcg
           Tibetan ground jay  ctg---------agg----------------gg----------ga---------------------a---
                   Budgerigar  atg----------------------------gg----------ga---------------------g---
                Scarlet macaw  acg----------------------------gg----------ca---------------------t---
                       Turkey  ccg----------------------------tg----------ca---------------------c---
           American alligator  tgc---------aga----------------gg----------ga---------------------c---
              Green seaturtle  ctgctctaaccagca----------------ga----------ca---------------------t---
               Painted turtle  cag--cggagtgagg----------------gg----------tt---------------------c---
     Chinese softshell turtle  ctg-------caggg----------------ag----------gc---------------------c---
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
         David's myotis (bat)  ======================================================================
                  Stickleback  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Cape golden mole  ======================================================================

                        Human  -----ccc--------cactga------------------------------------------------
                        Chimp  -----ccc--------cactgag-----------------------------------------------
                      Gorilla  -----ccc--------cactgag-----------------------------------------------
                    Orangutan  -----ccc--------cactgag-----------------------------------------------
                       Gibbon  -----ccc--------cactgag-----------------------------------------------
                       Rhesus  -----ccc--------cactgag-----------------------------------------------
          Crab-eating macaque  -----ccc--------cactgag-----------------------------------------------
                       Baboon  -----ccc--------cactgag-----------------------------------------------
                 Green monkey  -----ccc--------cactgag-----------------------------------------------
                     Marmoset  -----ccc--------cactgac-----------------------------------------------
              Squirrel monkey  -----ccc--------cactgag-----------------------------------------------
                     Bushbaby  -----acc--------cacaaag-----------------------------------------------
           Chinese tree shrew  ------------------ctgga-----------------------------------------------
                     Squirrel  -----cct---------acagag-----------------------------------------------
                 Prairie vole  -----cctcatgtctccatgagg-----------------------------------------------
              Chinese hamster  -----tcccatgtctccat-ggg-----------------------------------------------
               Golden hamster  -----ccccatgtctccatgggg-----------------------------------------------
                        Mouse  -----tcccatgtctccacgggg-----------------------------------------------
                          Rat  -----tcccatgtcttcacgggg-----------------------------------------------
               Naked mole-rat  -----cct---------gtggaa----------------------------------g------------
                   Guinea pig  -----cct---------gtggag----------------------------------g------------
                   Chinchilla  -----cct---------gtggag----------------------------------g------------
             Brush-tailed rat  -----cct---------gtggag----------------------------------g------------
                       Rabbit  -----cgt---------gtagga-----------------------------------------------
                         Pika  -----ccc---------atgagg-----------------------------------------------
                          Pig  -----ccc---------actgag-----------------------------------------------
                       Alpaca  -----cct---------gctgag-----------------------------------------------
               Bactrian camel  -----cct---------gttgag-----------------------------------------------
                      Dolphin  -----ccc---------actgag-----------------------------------------------
                 Killer whale  -----ccc---------actgag-----------------------------------------------
             Tibetan antelope  -----ccc---------actgag-----------------------------------------------
                          Cow  -----ccc---------actgca-----------------------------------------------
                        Sheep  -----ccc---------actgag-----------------------------------------------
                Domestic goat  -----ccc---------actgag-----------------------------------------------
                        Horse  -----cct---------gctgag-----------------------------------------------
             White rhinoceros  -----ccc---------gctgag-----------------------------------------------
                          Cat  -----ctt---------actgag-----------------------------------------------
                          Dog  -----ctc---------actgag-----------------------------------------------
                      Ferret   -----ctc---------actgag-----------------------------------------------
                        Panda  -----ctc---------actgag-----------------------------------------------
               Pacific walrus  -----ctc---------actgag-----------------------------------------------
                 Weddell seal  -----ctc---------actgag-----------------------------------------------
             Black flying-fox  -----ct----------gccctg-----------------------------------------------
                      Megabat  -----ct----------gccctg-----------------------------------------------
                Big brown bat  -----ct----------gctgag-----------------------------------------------
                     Hedgehog  -----ccc---------acagag-----------------------------------------------
                        Shrew  -----ctt---------gctgga-----------------------------------------------
              Star-nosed mole  -----cct---------gctgag-----------------------------------------------
                     Elephant  -----tgt---------tccaag----------------------------------ga-----------
                      Manatee  -----cgt---------tgcaag----------------------------gaacaag------------
                       Tenrec  -----tgc---------ccccaaactcccagtgcccccaaactcccactgtgccccaaatcccatcatcc
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  -----cgt---------tcccag-----------------------------------------------
                      Opossum  -----gct---------gcccgc-----------------------------------------------
              Tasmanian devil  -----gtg---------gccgat-----------------------------------------------
                     Platypus  -----cga---------gctgcg-----------------------------------------------
                  Rock pigeon  -----ctc-------accttgtg-----------------------------------------------
                 Saker falcon  -----cca---------cagatg-----------------------------------------------
             Peregrine falcon  -----cca---------cagatg-----------------------------------------------
          Medium ground finch  ----------------------------------------------------------------------
                  Zebra finch  ctctgtcc---------tggggg-----------------------------------------------
           Tibetan ground jay  -----cca---------tggcgg-----------------------------------------------
                   Budgerigar  -----ctc---------tgtggg-----------------------------------------------
                Scarlet macaw  -----ccc--------------------------------------------------------------
                       Turkey  -----ttc---------tccctg-----------------------------------------------
           American alligator  -aggacca---------tacagg-----------------------------------------------
              Green seaturtle  -----gct---------gctatg-----------------------------------------------
               Painted turtle  -----ccc---------gggaga-----------------------------------------------
     Chinese softshell turtle  -----ccc---------ctcatg-----------------------------------------------
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
         David's myotis (bat)  ======================================================================
                  Stickleback  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ------t---------g----------c-tg-c---agc-------------aggttccgcaggtcttac
                        Chimp  ----gat---------g----------c-tg-c---agc-------------aggttccgcaggtcttac
                      Gorilla  ----gat---------g----------c-tg-c---agc-------------aggttccgcaggtcttac
                    Orangutan  ----gat---------g----------c-tg-c---agc-------------aggttcagcaggtcttac
                       Gibbon  ----gat---------g----------c-tg-t---ggc-------------aggttcggcaggtc-cac
                       Rhesus  ----gac---------g----------c-tg-t---ggc-------------aggttcagcaggtc-tac
          Crab-eating macaque  ----gac---------g----------c-tg-t---ggc-------------aggttcagcaggtc-tac
                       Baboon  ----gac---------g----------c-tg-t---ggc-------------aggttcagcaggtc-tac
                 Green monkey  ----gac---------a----------c-tg-t---ggc-------------aggttcagcaggtc-tac
                     Marmoset  ----aat---------c----------c-tg-t---agc-------------agcttcagcaggtc-tgc
              Squirrel monkey  ----agc---------c----------c-tg-t---a-c-------------aggttcagcagctc-tga
                     Bushbaby  ----gat---------a----------c-tg--------------------------ctgtgggtc-tgc
           Chinese tree shrew  ----gga---------g----------c-tg-c---agc----------------------------tgc
                     Squirrel  ----gag---------g----------c-ctgt---gg--------------------------------
                 Prairie vole  ----caa---------g----------g-ac-t---gg--------------------------------
              Chinese hamster  ----caa---------g----------g-ac-t---gg--------------------------------
               Golden hamster  ----caa---------g----------g-ac-t---gg--------------------------------
                        Mouse  ----caa---------g----------g-ct-t---gg--------------------------------
                          Rat  ----caa---------g----------g-at-t---gg--------------------------------
               Naked mole-rat  -ctacag---------c----------c-ta-c---gg--------------------------------
                   Guinea pig  -ctgaag---------a----------c-tg-t---gg--------------------------------
                   Chinchilla  -ctgcag---------a----------c-tg-t---gc--------------------------------
             Brush-tailed rat  -cttcag---------a----------c-tg-t---gg--------------------------------
                       Rabbit  -ctctgc---------a----------g-cc-tggggg--------------------------------
                         Pika  -ctgtta---------t----------t-ct-t---gg--------------------------------
                          Pig  ----gag---------g----------c-ta-c---agc----------ctgcagttctgc---------
                       Alpaca  ----gag---------g----------c-tg-t---gag----------ctgcagttctgt---------
               Bactrian camel  ----gag---------g----------c-tg-t---gag----------atgcagttctgt---------
                      Dolphin  ----gag---------g----------c-tg-t---ggc----------ctgcagttctgc---------
                 Killer whale  ----gag---------g----------c-tg-t---ggc----------ctacagttctgc---------
             Tibetan antelope  ----gag---------g----------cacg-g---tgt----------ctgcacttctgc---------
                          Cow  ----gag---------g----------caca-g---tgc----------ctgcagctctgc---------
                        Sheep  ----gag---------g----------caca-g---tgc----------ctgcactgctgc---------
                Domestic goat  ----gag---------g----------caca-g---tgc----------ctgcacttctgc---------
                        Horse  ----gag---------g----------c-tg-t---ggc----------ctgcaattctgc---------
             White rhinoceros  ----gag---------g----------c-ag-t---ggc----------ctgcagctctgc---------
                          Cat  ----gag---------g----------c-tg-t---ggc----------ctgcagttctgc---------
                          Dog  ----gag---------g----------c-tg-t---ggc----------ctgaggtcctgc---------
                      Ferret   ----gag---------a----------c-tg-t---ggc----------gtgaaattctgc---------
                        Panda  ----gag---------g----------c-tg-t---ggc----------ctgaagttctgc---------
               Pacific walrus  ----gag---------a----------c-tg-t---ggc----------ctgaagttctgc---------
                 Weddell seal  ----gag---------a----------c-tg-t---ggc----------ctgaagttctgc---------
             Black flying-fox  ----gaa---------g----------c-tg-t---ggc----------ctgacgttctgc---------
                      Megabat  ----gaa---------g----------c-tg-t---ggc----------ctgacgttctgc---------
                Big brown bat  ----gag---------t----------g-gg-g---ggc----------ctg-cagcccgc---------
                     Hedgehog  ----gct---------g----------g-gg---------------------------------------
                        Shrew  ----gag---------g----------g-gg---------------------------------------
              Star-nosed mole  ----gag---------g----------g-tg---------------------------------------
                     Elephant  -ccaagt---------c----------c-ta-c---tgc----------------tcctca---------
                      Manatee  ------t---------c----------c-ta-c---tgc----------------tcccca---------
                       Tenrec  cccaact---------c----------c-ca-c---tgccctccaactcatgctgccctca---------
                     Aardvark  -ccaact---------c----------c-ca-c---tgc----------------tcccca---------
                    Armadillo  -cagggg---------t----------c-ag-t---gag----------------ggcaga---------
                      Opossum  ----acg---------g-----------------------------------------------------
              Tasmanian devil  ----ctg---------gcggccgcagc-------------------------------------------
                     Platypus  ----ggg---------c----------c-cc-t---tcc----------cgcccgccctcc---------
                  Rock pigeon  ----tcccc--cca-tg----------c-tg-t---ggc-------------------------------
                 Saker falcon  ----gcc---------g----------c-tg-g---tgc-------------------------------
             Peregrine falcon  ----gcc---------g----------c-tg-g---tgc-------------------------------
          Medium ground finch  ----------------g----------g-gg-a---acc-------------------------------
                  Zebra finch  ----aaa------a-gg----------a-gg-g---acc-------------------------------
           Tibetan ground jay  ----gaccc--ctg-ag----------g-gg-g---aac-------------------------------
                   Budgerigar  ----gca---------g----------g-ga-g---gtc-------------------------------
                Scarlet macaw  ----------------a----------g-ga-g---atc-------------------------------
                       Turkey  ----tcccc--atg--g----------c-tg-a---acc-------------------------------
           American alligator  ----gag---------g----------a-gg-g---aag-------------------------------
              Green seaturtle  ----gttttagatg-tg----------c-tg-c---tgc-------------------------------
               Painted turtle  ----gtccggggtgccg----------c-tg-g---ggt-------------------------------
     Chinese softshell turtle  ----gtgcaggagg-ct----------c-ag-c---aag-------------------------------
          Cape elephant shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
         David's myotis (bat)  ======================================================================
                  Stickleback  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ---------------------------
                        Chimp  ---------------------------
                      Gorilla  ---------------------------
                    Orangutan  ---------------------------
                       Gibbon  ---------------------------
                       Rhesus  ---------------------------
          Crab-eating macaque  ---------------------------
                       Baboon  ---------------------------
                 Green monkey  ---------------------------
                     Marmoset  ---------------------------
              Squirrel monkey  ---------------------------
                     Bushbaby  ---------------------------
           Chinese tree shrew  ---------------------------
                     Squirrel  ---------------------------
                 Prairie vole  ---------------------------
              Chinese hamster  ---------------------------
               Golden hamster  ---------------------------
                        Mouse  ---------------------------
                          Rat  ---------------------------
               Naked mole-rat  ---------------------------
                   Guinea pig  ---------------------------
                   Chinchilla  ---------------------------
             Brush-tailed rat  ---------------------------
                       Rabbit  ---------------------------
                         Pika  ---------------------------
                          Pig  ---------------------------
                       Alpaca  ---------------------------
               Bactrian camel  ---------------------------
                      Dolphin  ---------------------------
                 Killer whale  ---------------------------
             Tibetan antelope  ---------------------------
                          Cow  ---------------------------
                        Sheep  ---------------------------
                Domestic goat  ---------------------------
                        Horse  ---------------------------
             White rhinoceros  ---------------------------
                          Cat  ---------------------------
                          Dog  ---------------------------
                      Ferret   ---------------------------
                        Panda  ---------------------------
               Pacific walrus  ---------------------------
                 Weddell seal  ---------------------------
             Black flying-fox  ---------------------------
                      Megabat  ---------------------------
                Big brown bat  ---------------------------
                     Hedgehog  ---------------------------
                        Shrew  ---------------------------
              Star-nosed mole  ---------------------------
                     Elephant  ---------------------------
                      Manatee  ---------------------------
                       Tenrec  ---------------------------
                     Aardvark  ---------------------------
                    Armadillo  ---------------------------
                      Opossum  ---------------------------
              Tasmanian devil  ---------------------------
                     Platypus  ---------------------------
                  Rock pigeon  acc--------------cagctctccc
                 Saker falcon  cca-----gg----ctacagacccacg
             Peregrine falcon  cca-----gg----ctacagacccacg
          Medium ground finch  cac--------------ctggac----
                  Zebra finch  ca-----------------gcac----
           Tibetan ground jay  cat-----gg-------cgggac----
                   Budgerigar  acc-----gg----tgacagagccttg
                Scarlet macaw  ctc--------------caggtccagg
                       Turkey  c------------------ggcttctg
           American alligator  gac-----gga---caagaagccccca
              Green seaturtle  cccctactggagtgtgacaggccagcc
               Painted turtle  ccc-----ggaaggtgccagg------
     Chinese softshell turtle  tcc------------tcccggtcagcc
          Cape elephant shrew  ===========================
       Lesser Egyptian jerboa  ===========================
         David's myotis (bat)  ===========================
                  Stickleback  ===========================
          Collared flycatcher  ===========================
                      Wallaby  ===========================
     Mexican tetra (cavefish)  ===========================
             Cape golden mole  ===========================

Inserts between block 30 and 31 in window
B D                 Squirrel 11bp
                Prairie vole 12bp
B D          Chinese hamster 13bp
              Golden hamster 12bp
B D                    Mouse 12bp
B D                      Rat 12bp
B D           Naked mole-rat 7bp
B D               Guinea pig 7bp
                  Chinchilla 7bp
            Brush-tailed rat 6bp
B D                   Rabbit 6bp
B D                     Pika 4bp
  D           Painted turtle 1bp

Alignment block 31 of 242 in window, 197199 - 197211, 13 bps 
B D                     Human  ---------------------------cct-t------ca--------gt---------------gtcag
B D                     Chimp  ---------------------------cct-t------ca--------gt---------------gtccg
B D                   Gorilla  ---------------------------cct-t------ca--------gt---------------gtcag
B D                 Orangutan  ---------------------------cct-t------ca--------gt---------------gtcag
B D                    Gibbon  ---------------------------cct-t------ca--------gt---------------gtcag
B D                    Rhesus  ---------------------------ccc-t------ca--------gt---------------gtcag
B D       Crab-eating macaque  ---------------------------ccc-t------ca--------gt---------------gtcag
B D                    Baboon  ---------------------------ccc-t------ca--------gt---------------gtcag
B D              Green monkey  ---------------------------ccc-t------ca--------gt---------------gtcag
B D                  Marmoset  ---------------------------tct-t------ca--------gt---------------gtcgg
B D           Squirrel monkey  ---------------------------tct-t------ca--------ct---------------gtcag
B D                  Bushbaby  ---------------------------tctgt------ca--------gt---------------gttgg
           Chinese tree shrew  ---------------------------tct-----------------------------------gaccg
B D                  Squirrel  --------------------------------------ta--------gt---------------gacag
       Lesser Egyptian jerboa  ----------------------------------t---ca--------gt---------------atcag
                 Prairie vole  --------------------------------------ca--------gc---------------atcag
B D           Chinese hamster  --------------------------------------ca--------gt---------------atcag
               Golden hamster  --------------------------------------ca--------gt---------------atcag
B D                     Mouse  --------------------------------------ca--------at---------------atcag
B D                       Rat  --------------------------------------ca--------gt---------------atcag
B D            Naked mole-rat  ----------------------------------gcctca--------gc---------------atcag
B D                Guinea pig  ----------------------------------ctatca--------ac---------------atgaa
                   Chinchilla  ----------------------------------ccctca--------ac---------------atcag
             Brush-tailed rat  ----------------------------------ccctca--------ac---------------atcag
B D                    Rabbit  -------------------------------ctgc---cg--------gt---------------gtcgg
B D                      Pika  ---------------------------------ac---tg--------gt---------------gtcag
B D                       Pig  ----------------------------------ccatcgcagggggtgg---------------ggggg
B D                    Alpaca  ----------------------------------ccgtca--------gt---------------ggggg
               Bactrian camel  ----------------------------------ccgtca--------gt---------------ggggg
B D                   Dolphin  ----------------------------------ccctca--------gt---------------ggggg
                 Killer whale  ----------------------------------ccctca--------gt---------------ggggg
             Tibetan antelope  ----------------------------------ccgcca--------gt---------------gcggg
B D                       Cow  ----------------------------------ccatca--------g----------------gcagg
B D                     Sheep  ----------------------------------ccgcca--------gt---------------gcagg
                Domestic goat  ----------------------------------ccgcca--------gt---------------gcggg
B D                     Horse  ----------------------------------ctgtca--------gt---------------ggggg
B D          White rhinoceros  ----------------------------------ctatca--------gt---------------ggggg
B D                       Cat  ----------------------------------ccacca--------gt---------------gggga
B D                       Dog  ----------------------------------ccatca--------ct---------------gcaga
B D                   Ferret   ----------------------------------ccatca--------gt---------------gggga
B D                     Panda  ----------------------------------ccatca--------gt---------------gggga
               Pacific walrus  ----------------------------------ccatca--------gt---------------gggga
                 Weddell seal  ----------------------------------ccatca--------gt---------------gggga
             Black flying-fox  ----------------------------------ccatca--------gt---------------ggggc
B D                   Megabat  ----------------------------------ccatca--------gt---------------ggggc
                Big brown bat  ----------------------------------ccaccg------------------------------
B D                  Elephant  ---------------------------------actccgg--------ct---------------agggg
B D                   Manatee  ---------------------------------actccgg--------ct---------------ggcag
B D                    Tenrec  ---------------------------------actctga--------ct---------------ggagg
                     Aardvark  ---------------------------------tctccgg--------ct---------------gaggg
B D                 Armadillo  ---------------------------------agcagag--------at---------------ggggg
B D                   Opossum  ------------------------------------gaca--------gtgcacgaa--------gcagg
B D           Tasmanian devil  ----------------------------------ccggca--------gt---cgaaggccaccggccgg
B D                  Platypus  ---------------------------------ctctctg--------gc---------------ggccg
  D               Rock pigeon  atc--------------tcattgccag-------------------------------------------
  D              Saker falcon  tct--------------ccgccaaggg-------------------------------------------
  D          Peregrine falcon  tct--------------ccgccaaggg-------------------------------------------
B D       Medium ground finch  -----------------ccacctgggg-------------------------------------------
B D               Zebra finch  -----------------catccatggg-------------------------------------------
           Tibetan ground jay  -----------------ccctgagggg-------------------------------------------
B D                Budgerigar  tgc-------------atccc---cag-------------------------------------------
  D             Scarlet macaw  agc--------------tcccgagctg-------------------------------------------
B D                    Turkey  tcc--------------ccagcgtgtg-------------------------------------------
B D        American alligator  tcccccagttaaaagagcctttgggg--------------------------------------------
  D           Green seaturtle  tgtg------------------------------------------------------------------
  D  Chinese softshell turtle  tctg------------------------------------------------------------------
             Star-nosed mole  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ----------------------------------------------------------------------
B D                     Shrew  ----------------------------------------------------------------------
        David's myotis (bat)  ======================================================================
B D               Stickleback  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
            Cape golden mole  ======================================================================

Inserts between block 31 and 32 in window
  D              Rock pigeon 2853bp
  D             Saker falcon 13bp
  D         Peregrine falcon 13bp
B D      Medium ground finch 18bp
B D              Zebra finch 23bp
          Tibetan ground jay 12bp
B D               Budgerigar 39bp
  D            Scarlet macaw 26bp
B D                   Turkey 13bp
B D       American alligator 14bp

Alignment block 32 of 242 in window, 197212 - 197214, 3 bps 
B D                     Human  ---ca-----a
B D                     Chimp  ---ca-----a
B D                   Gorilla  ---ca-----a
B D                 Orangutan  ---ca-----a
B D                    Gibbon  ---ca-----a
B D                    Rhesus  ---ca-----a
B D       Crab-eating macaque  ---ca-----a
B D                    Baboon  ---ca-----a
B D              Green monkey  ---ca-----a
B D                  Marmoset  ---aa-----g
B D           Squirrel monkey  ---ca-----g
B D                  Bushbaby  ---ca-----g
           Chinese tree shrew  ---ca-----g
B D                  Squirrel  ---ca-----a
       Lesser Egyptian jerboa  ---ca-----g
                 Prairie vole  ---ca-----g
B D           Chinese hamster  ---ca-----g
               Golden hamster  ---ca-----g
B D                     Mouse  ---ca-----g
B D                       Rat  ---ca-----g
B D            Naked mole-rat  ---ga-----g
B D                Guinea pig  ---ta-----a
                   Chinchilla  ---ca-----g
             Brush-tailed rat  ---ca-----g
B D                    Rabbit  ---tg---tcg
B D                      Pika  ---tgaactgg
B D                       Pig  ---ta-----a
B D                    Alpaca  ---ca-----a
               Bactrian camel  ---aa-----a
B D                   Dolphin  ---ca-----g
                 Killer whale  ---ca-----g
             Tibetan antelope  ---ca-----g
B D                       Cow  ---ca-----a
B D                     Sheep  ---ca-----g
                Domestic goat  ---ca-----g
B D                     Horse  ---ca-----a
B D          White rhinoceros  ---ca-----a
B D                       Cat  ---c------a
B D                       Dog  ---c------a
B D                   Ferret   ---c------a
B D                     Panda