Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 58 in window, 30151886 - 30151955, 70 bps 
B D                   Human  ttta--gtggcttaaaagcag-----caataataatttatttacatctcttacagtttctgtggaccaga
B D                   Chimp  ttta--gtggcttaaaagcag-----caataataatttatttacatctcttacagtttctgtggaccaga
B D                 Gorilla  ttta--gtggcttaaaaacag-----caataataatttatttacatctcttacagtttctgtggaccaga
B D               Orangutan  ttta--gtggcttaaaaacag-----caataataatttatttacatctcttacagtttctgtggaccaga
B D                  Gibbon  ctta--gtggcttgaaaacag-----caataataatttatttacgtctcttacagtttctgtggaccaga
B D                  Rhesus  ctta--gtggcttaaaaacag-----caataataatttatttatatctcttgcagtttctgtggaccaga
B D     Crab-eating macaque  ctta--gtggcttaaaaacag-----caataataatttatttacatctcttgcagtttctgtggaccaga
B D                  Baboon  ctta--gtggcttaaaaacag-----caataataatttatttacatctcttgcagtttctgtggaccaga
B D            Green monkey  ctta--gtggcttaaaaacag-----caataataatttatttgcatctcttacagtttctgtggaccaga
B D                Marmoset  catc--ctggcttgaaaacag-----caattacaatttatttacatctcttacagtttctgtggaccaga
B D         Squirrel monkey  cttc--ctagcttgaaaacag-----caattataatttatttatatctcttacagtttctgtgggccaga
B D                Bushbaby  ctta--gtagcttagaaacag-----caataataatttattaatacctcttgcagtttctgtagtaagaa
         Chinese tree shrew  tgta--gtggctcaaaaataa-----tgatcattatttatttacacctttcacagtttctgtggagcaga
B D                Squirrel  ttag--atggattaaaaagag-----caatcatattttatttttaat-ctctcagtttctgggggtcaga
     Lesser Egyptian jerboa  ctag--gtggcttggaaacaa-----cagtcaca--------ggagg-gtcactgttcccacgggtccga
               Prairie vole  gcagtcatggc------acac-----cgttaaca---------------tcacagattctgtggggcccc
B D              Guinea pig  ttac--atggcttac--acag-----caaccttaggttggttacatt--cctcacatgctctaggttgga
           Brush-tailed rat  ctct--gtggcttaa--acag-----caagcatagattatttatatc--tctcacattctctaggtcaga
B D                  Rabbit  cttg--gcgactcga--acat---cacaatgataatttatttcct-----ttcagttcctgtggg-----
B D                    Pika  -------tgactcaa--acatacccccaataacgccttagtttctgt-ggttcagatat--tcag-----
B D                 Dolphin  cttt--gtggcttaagaccag-----caatgagcctttcttgacatctctcacagtttctgtgtttcagg
               Killer whale  cttt--gtggcttaagaccag-----caatgagcctttcttgacatctctcacagtttctgtgtttcagg
B D                   Horse  ttta--gtgtcttaaaatcag-----cagtgataatttacttccatctctcacagtttccgtgggtgaga
B D        White rhinoceros  ctta--gtgtcttaaaatcag-----caatgatgatgcatttacaactctcacagtttctgtgggtgaga
B D                     Cat  cttc--atggctgcgaaacag-----c----------------cagctgtcgcagtgtctggggtcagga
B D                     Dog  ctta--gcggctgcaaaacag-----cagtgatcatttatttccagctgtcacagtttctgtgggtgaga
B D                 Ferret   ctca--gcaactgtaaaacag-----cagcgatcatttatttccagctgtcacagtctctgtgggtaaga
B D                   Panda  ctta--gcggctgcaaaacag-----cagtgatcatttattcccagctgtcacattgtctgtgggggaca
             Pacific walrus  ctta--gccggtgcaaaacag-----cagtgatcatttatcttcagatgtcacagtctccgtgggtggga
               Weddell seal  ctta--gcggctgcaaaacag-----cagtgatcatttatctccagatgtcacagtctctgggggtgaga
            Star-nosed mole  cttg--gaggcttaaaaacag-----aaaggattttcta----catctctcatagtttctctgggtcaga
B D                Elephant  ttta--gtggcttaca-gaga-----gcgtcgtaattgatgtacctctcccactgtcactgggggtcagt
B D                 Manatee  ttta--ctggcttata-gcaa-----tagtcagaactgcagaacgtctcccagagtcgcc-ggggtcagt
           Cape golden mole  ctta--gtggcttaca-gcag-----tagtcatcaacgatacacatctcccatagtctctggggatcagc
B D                     Rat  ======================================================================
B D                Microbat  ----------------------------------------------------------------------
      David's myotis (bat)  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Sheep  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D                   Mouse  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
          Black flying-fox  ======================================================================
            Bactrian camel  ======================================================================
B D                     Pig  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Wallaby  ======================================================================
  D          Painted turtle  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  aattcag
                      Chimp  aattcag
                    Gorilla  aattcat
                  Orangutan  aattcag
                     Gibbon  aattcag
                     Rhesus  aattcag
        Crab-eating macaque  aattcag
                     Baboon  aattcag
               Green monkey  aattcag
                   Marmoset  aattcag
            Squirrel monkey  aattcag
                   Bushbaby  atttcag
         Chinese tree shrew  aatttag
                   Squirrel  aaattca
     Lesser Egyptian jerboa  aatctcg
               Prairie vole  aaactca
                 Guinea pig  aaactca
           Brush-tailed rat  aaattca
                     Rabbit  -------
                       Pika  -------
                    Dolphin  cgttcag
               Killer whale  cgttcag
                      Horse  aattcag
           White rhinoceros  aattcaa
                        Cat  aaggcag
                        Dog  aactcag
                    Ferret   aatgcaa
                      Panda  catgcaa
             Pacific walrus  aatgcaa
               Weddell seal  aatgcaa
            Star-nosed mole  aattgac
                   Elephant  gactcag
                    Manatee  gactccg
           Cape golden mole  gg-ttag
                        Rat  =======
                   Microbat  -------
       David's myotis (bat)  =======
                     Tenrec  =======
        Cape elephant shrew  =======
                      Shrew  =======
                   Hedgehog  =======
                      Sheep  =======
              Domestic goat  =======
                        Cow  =======
           Tibetan antelope  =======
             Golden hamster  =======
            Chinese hamster  =======
                      Mouse  =======
             Naked mole-rat  =======
                 Chinchilla  =======
              Big brown bat  -------
                  Armadillo  =======
                     Alpaca  =======
           Black flying-fox  =======
             Bactrian camel  =======
                        Pig  =======
                   Aardvark  =======
                    Megabat  =======
                    Wallaby  =======
             Painted turtle  =======
            Green seaturtle  =======
                    Chicken  =======
                    Opossum  =======
            Tasmanian devil  =======

Inserts between block 1 and 2 in window
B D               Squirrel 1bp
              Prairie vole 12bp
B D             Guinea pig 1bp
          Brush-tailed rat 1bp

Alignment block 2 of 58 in window, 30151956 - 30151976, 21 bps 
B D                   Human  gagtggctgggctgg-----g-ggctg
B D                   Chimp  gagtggctgggctgg-----g-ggctc
B D                 Gorilla  gagtggctgggctgg-----g-ggctc
B D               Orangutan  gagtggctgggctgg-----g-ggctc
B D                  Gibbon  gagtggctgggctgg-----g-gactc
B D                  Rhesus  gagtggctgggctgg-----g-ggctc
B D     Crab-eating macaque  gagtggctgggctgg-----g-ggctc
B D                  Baboon  gagtggctgggctgg-----g-ggctc
B D            Green monkey  gagtggctgggctgg-----g-ggctc
B D                Marmoset  gagtggctaggctgg-----g-ggctc
B D         Squirrel monkey  gagtggctgggctgg-----g-ggctc
B D                Bushbaby  gagcagcttggctag-----g-ggctc
         Chinese tree shrew  gagtggtttgg-tag-----g-agcac
B D                Squirrel  gagccacttgg-ctg-----g-agctc
     Lesser Egyptian jerboa  ggg------gg-ggg-----g-gattg
B D              Guinea pig  ------------------------gcg
           Brush-tailed rat  ------------------------cgg
B D                  Rabbit  -------------ga-----g-gggct
B D                    Pika  -------------ga-----g-gggct
B D                 Dolphin  gagcagcttggctgt-----a-ggttc
               Killer whale  gagcagcttggctgt-----a-ggttc
B D                   Horse  gagtggctgggctgc----aa-gcttc
B D        White rhinoceros  gagtggcttggctgctaggta-ggttc
B D                     Cat  gaccggcttggctct------------
B D                     Dog  gagtgacttggctct------------
B D                 Ferret   gaacggcttggctct------------
B D                   Panda  gaatggcttggctct------------
             Pacific walrus  gagcgacttggctct------------
               Weddell seal  gagcgacctggctct------------
            Star-nosed mole  aaatgacttagctat----gg-ggctc
B D                Elephant  cagtggcttggctgg-----gtggttc
B D                 Manatee  cagtagcttgactgg-----gttgctc
           Cape golden mole  cagtggcttggtcta-----gtggttc
B D                     Rat  ===========================
B D                Microbat  ---------------------------
      David's myotis (bat)  ===========================
B D                  Tenrec  ===========================
       Cape elephant shrew  ===========================
B D                   Shrew  ===========================
B D                Hedgehog  ===========================
B D                   Sheep  ===========================
             Domestic goat  ===========================
B D                     Cow  ===========================
          Tibetan antelope  ===========================
            Golden hamster  ===========================
              Prairie vole  ===========================
B D         Chinese hamster  ===========================
B D                   Mouse  ===========================
B D          Naked mole-rat  ===========================
                Chinchilla  ===========================
             Big brown bat  ---------------------------
B D               Armadillo  ===========================
B D                  Alpaca  ===========================
          Black flying-fox  ===========================
            Bactrian camel  ===========================
B D                     Pig  ===========================
                  Aardvark  ===========================
B D                 Megabat  ===========================
B D                 Wallaby  ===========================
  D          Painted turtle  ===========================
  D         Green seaturtle  ===========================
B D                 Chicken  ===========================
B D                 Opossum  ===========================
B D         Tasmanian devil  ===========================

Alignment block 3 of 58 in window, 30151977 - 30151991, 15 bps 
B D                   Human  tggctc-ag-----ggtctct
B D                   Chimp  tggctc-ag-----ggtctct
B D                 Gorilla  tggctc-ag-----ggtctct
B D               Orangutan  tggctc-ag-----ggtctct
B D                  Gibbon  tggctc-ag-----ggtctct
B D                  Rhesus  tggctc-ag-----ggtctct
B D     Crab-eating macaque  tggctc-ag-----ggtctct
B D                  Baboon  tggctc-ag-----ggtctct
B D            Green monkey  tggctc-ag-----ggtctct
B D                Marmoset  tgactc-ag-----ggtctct
B D         Squirrel monkey  tggctc-ag-----ggtctct
B D                Bushbaby  tggctc-ac-----agtctct
         Chinese tree shrew  ccattc-ag-----gacctct
B D                Squirrel  tggctc-tga-----gactct
     Lesser Egyptian jerboa  tggctc-ggc-----gcttgt
B D              Guinea pig  tggctc-agtt---gggcttt
           Brush-tailed rat  tagctt-gact---gggcttt
B D                  Rabbit  tggctctggctcagggtgtct
B D                    Pika  tggctc-agctcagggtgtcc
B D                 Dolphin  tggctc-ag-----gctatgc
               Killer whale  tggctc-ag-----gctatgc
B D                   Horse  tggctc-ag-----gctcact
B D        White rhinoceros  tgtctc-ag-----gccctct
B D                     Cat  ggggtc-tg-----gctctcg
B D                     Dog  ggggtc-tg-----gctgtcg
B D                 Ferret   gggttc-tg-----gctgtca
B D                   Panda  ggggtc-tg-----gctctca
             Pacific walrus  ggggtc-tg-----gctctca
               Weddell seal  ggggtc-tg-----gctctca
            Star-nosed mole  aaactc-tg-----ggtcttt
B D                Elephant  tggctc-ag-----ggccatt
B D                 Manatee  tggctc-ag-----ggcctct
           Cape golden mole  ta-----ag-----agtctct
                   Aardvark  tggctc-ag-----ggtctc-
B D                     Rat  =====================
B D                Microbat  ---------------------
      David's myotis (bat)  =====================
B D                  Tenrec  =====================
       Cape elephant shrew  =====================
B D                   Shrew  =====================
B D                Hedgehog  =====================
B D                   Sheep  =====================
             Domestic goat  =====================
B D                     Cow  =====================
          Tibetan antelope  =====================
            Golden hamster  =====================
              Prairie vole  =====================
B D         Chinese hamster  =====================
B D                   Mouse  =====================
B D          Naked mole-rat  =====================
                Chinchilla  =====================
             Big brown bat  ---------------------
B D               Armadillo  =====================
B D                  Alpaca  =====================
          Black flying-fox  =====================
            Bactrian camel  =====================
B D                     Pig  =====================
B D                 Megabat  =====================
B D                 Wallaby  =====================
  D          Painted turtle  =====================
  D         Green seaturtle  =====================
B D                 Chicken  =====================
B D                 Opossum  =====================
B D         Tasmanian devil  =====================

Inserts between block 3 and 4 in window
B D               Elephant 5bp
B D                Manatee 1942bp
          Cape golden mole 2240bp

Alignment block 4 of 58 in window, 30151992 - 30152000, 9 bps 
B D                   Human  catgaagtt
B D                   Chimp  cacgaagtt
B D                 Gorilla  catgaagtt
B D               Orangutan  cacgaagtt
B D                  Gibbon  cacaaagtt
B D                  Rhesus  cacaaagtt
B D     Crab-eating macaque  cacaaagtt
B D                  Baboon  cacaaagtt
B D            Green monkey  cacaaagtt
B D                Marmoset  cacaaagtt
B D         Squirrel monkey  cacaaagtt
B D                Bushbaby  catggggtt
         Chinese tree shrew  cacaaggct
B D                Squirrel  cacaaggtt
     Lesser Egyptian jerboa  cat----tg
B D              Guinea pig  catgatgtt
           Brush-tailed rat  catgaggtt
B D                  Rabbit  cgtgaggct
B D                    Pika  cgggaggct
B D                 Dolphin  cgtgagcct
               Killer whale  cgtgagcct
B D                   Horse  cgtgaggtt
B D        White rhinoceros  catgaggtt
B D                     Cat  cacgaggt-
B D                     Dog  catgaggtc
B D                 Ferret   caggaggct
B D                   Panda  caggaggct
             Pacific walrus  tgggaggct
               Weddell seal  caggaggct
            Star-nosed mole  catgaagtt
B D                Elephant  catgtaatt
                   Aardvark  -atgagc--
B D                     Rat  =========
B D                Microbat  ---------
      David's myotis (bat)  =========
B D                  Tenrec  =========
       Cape elephant shrew  =========
B D                   Shrew  =========
B D                Hedgehog  =========
B D                   Sheep  =========
             Domestic goat  =========
B D                     Cow  =========
          Tibetan antelope  =========
            Golden hamster  =========
              Prairie vole  =========
B D         Chinese hamster  =========
B D                   Mouse  =========
B D          Naked mole-rat  =========
                Chinchilla  =========
             Big brown bat  ---------
B D               Armadillo  =========
B D                  Alpaca  =========
          Black flying-fox  =========
B D                 Manatee  =========
            Bactrian camel  =========
B D                     Pig  =========
          Cape golden mole  =========
B D                 Megabat  =========
B D                 Wallaby  =========
  D          Painted turtle  =========
  D         Green seaturtle  =========
B D                 Chicken  =========
B D                 Opossum  =========
B D         Tasmanian devil  =========

Inserts between block 4 and 5 in window
B D               Elephant 1939bp

Alignment block 5 of 58 in window, 30152001 - 30152024, 24 bps 
B D                   Human  gcagtcagatgtcagccagggctg
B D                   Chimp  gcagtcagatgtcagccagggctg
B D                 Gorilla  gcagtcagatgtcagcaagggctg
B D               Orangutan  gcagtcagatgtcagccagggctg
B D                  Gibbon  -caatcagatgtcagccagggccg
B D                  Rhesus  gcagtcagatgtcagccagggctg
B D     Crab-eating macaque  gcagtcagatgtcagccagggctg
B D                  Baboon  gcagtcagatgtcagccagggctg
B D            Green monkey  gcagtcagatgtcagccagggctg
B D                Marmoset  gcagtcagatgtcagccagggctg
B D         Squirrel monkey  gcagtcagatgtcagccagggctg
B D                Bushbaby  acagtcagacctcagcctgggctt
         Chinese tree shrew  gtagtcagatgttggctggggctg
B D                Squirrel  gcagtcaggtgtcaggcagggctg
     Lesser Egyptian jerboa  gcatcc---catcgtgcagggctg
B D              Guinea pig  acagccaagtatcaggcagggctg
           Brush-tailed rat  acaa--------cagggagggctg
B D                  Rabbit  gc--gcagatgtcccacagggctg
B D                    Pika  gccgtcaggggcaggccagggctg
B D                 Dolphin  gcggtcagatgtcagtcagggctg
               Killer whale  gcggtcagatgtcagtcagggctg
B D                   Horse  gcgatcatatgttggccagggctg
B D        White rhinoceros  gcaatcatatg-tggccagggctg
B D                     Cat  ------------tggccaggggtg
B D                     Dog  acagtcagatactggccagggatg
B D                 Ferret   gcagtcagataccggccagggctg
B D                   Panda  gcagtcagacactggctggggctg
             Pacific walrus  gcagtcagatagtggccaggactg
               Weddell seal  gcagtcagatagtggccagggcta
            Star-nosed mole  acatctggacaacagccagggatg
                   Aardvark  gcagtcagatgccctcgggcgt--
B D                     Rat  ========================
B D                Microbat  ------------------------
      David's myotis (bat)  ========================
B D                  Tenrec  ========================
       Cape elephant shrew  ========================
B D                   Shrew  ========================
B D                Hedgehog  ========================
B D                   Sheep  ========================
             Domestic goat  ========================
B D                     Cow  ========================
          Tibetan antelope  ========================
            Golden hamster  ========================
              Prairie vole  ========================
B D         Chinese hamster  ========================
B D                Elephant  ========================
B D                   Mouse  ========================
B D          Naked mole-rat  ========================
                Chinchilla  ========================
             Big brown bat  ------------------------
B D               Armadillo  ========================
B D                  Alpaca  ========================
          Black flying-fox  ========================
B D                 Manatee  ========================
            Bactrian camel  ========================
B D                     Pig  ========================
          Cape golden mole  ========================
B D                 Megabat  ========================
B D                 Wallaby  ========================
  D          Painted turtle  ========================
  D         Green seaturtle  ========================
B D                 Chicken  ========================
B D                 Opossum  ========================
B D         Tasmanian devil  ========================

Alignment block 6 of 58 in window, 30152025 - 30152027, 3 bps 
B D                   Human  tga
B D                   Chimp  tga
B D                 Gorilla  tga
B D               Orangutan  tga
B D                  Gibbon  tga
B D                  Rhesus  tga
B D     Crab-eating macaque  tga
B D                  Baboon  tga
B D            Green monkey  tga
B D                Marmoset  tgg
B D         Squirrel monkey  tgg
B D                Bushbaby  tgg
         Chinese tree shrew  tgg
B D                Squirrel  tgg
     Lesser Egyptian jerboa  agg
B D              Guinea pig  cag
           Brush-tailed rat  cag
B D                  Rabbit  ggg
B D                    Pika  gat
B D                 Dolphin  tgg
               Killer whale  tgg
B D                   Horse  tgg
B D        White rhinoceros  tgg
B D                     Cat  cga
B D                     Dog  tgg
B D                 Ferret   tgg
B D                   Panda  cgg
             Pacific walrus  tgg
               Weddell seal  tgg
       David's myotis (bat)  tgg
            Star-nosed mole  tgg
                   Aardvark  tgg
B D                     Rat  ===
B D                Microbat  ---
B D                  Tenrec  ===
       Cape elephant shrew  ===
B D                   Shrew  ===
B D                Hedgehog  ===
B D                   Sheep  ===
             Domestic goat  ===
B D                     Cow  ===
          Tibetan antelope  ===
            Golden hamster  ===
              Prairie vole  ===
B D         Chinese hamster  ===
B D                Elephant  ===
B D                   Mouse  ===
B D          Naked mole-rat  ===
                Chinchilla  ===
             Big brown bat  ---
B D               Armadillo  ===
B D                  Alpaca  ===
          Black flying-fox  ===
B D                 Manatee  ===
            Bactrian camel  ===
B D                     Pig  ===
          Cape golden mole  ===
B D                 Megabat  ===
B D                 Wallaby  ===
  D          Painted turtle  ===
  D         Green seaturtle  ===
B D                 Chicken  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===

Alignment block 7 of 58 in window, 30152028 - 30152275, 248 bps 
B D                   Human  ---------tctcatctgaagtcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D                   Chimp  ---------tctcatctgaagtcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D                 Gorilla  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D               Orangutan  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D                  Gibbon  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D                  Rhesus  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D     Crab-eating macaque  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctctc-----c-ca----gcct
B D                  Baboon  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctccc-----c-ca----gcct
B D            Green monkey  ---------tctcatctgaaggcttgatcaggact-ga-----ggatcctccc-----c-ca----gcct
B D                Marmoset  ---------tctcatctgaaggtttgatcagaact-ga-----ggattgtctc-----c-ca----acct
B D         Squirrel monkey  ---------tctcatctgaagatttgatcaggact-ga-----ggattgtctc-----c-ca----gcct
B D                Bushbaby  ---------tcccatctaaaggcgccactgggactaga-----ggatcctct------c-aa----ggct
         Chinese tree shrew  ---------tctcatcagaagttccaactgggactgga-----ggctcctctc-----c-caaagcggat
B D                Squirrel  ---------ttacatctgacggctcgactgggactgga-----ggatatgctc-----a-ggaggtggct
     Lesser Egyptian jerboa  ---------tccccccaggaggcccg-ctggagcccga-----gggtccactccactgg-tgtggtggtt
B D              Guinea pig  ---------tctcatctgatgtctggacctgaactaga-----ggccccattg-----g-cgatgtggct
           Brush-tailed rat  ---------tctcatttgatgactggatcaggacccga-----ggccctgctc-----t-cagcgtggtt
B D                  Rabbit  ---------tttcctcggaaggctcagctgggacggca-----gggcccacgg------------tggct
B D                    Pika  ---------gctcctctaaaggctcagctggaactgcaccgcgggatcctctg------------c-tct
B D                 Dolphin  ---------tctcatctgaaggctccaccgggactaca-----ggc-cctgct-----c-ccaggcagct
               Killer whale  ---------tctcatctgaaggctccaccgggactaca-----ggc-cctgct-----c-ccaggcagct
B D                   Horse  ---------tctcatctgaaggctccactgggaccaga-----ggctcctctt-----c-caaggtggct
B D        White rhinoceros  ---------tctcatctgaaggctccactgggactgga-----ggctcctctt-----c-caaggcagct
B D                     Cat  ---------gctccccggaagcct-ccctgggactgaa-----ggctcctatc-----ctcaggatgatt
B D                     Dog  ---------tcttcttagaagcctcccctcagactgga-----ggctcctgtt-----c-caaggtggtt
B D                 Ferret   ---------tctcctcgggagcctcccctcagattgga-----ggctcctatt-----c-cagggtggtt
B D                   Panda  ---------tctcctcgggagcctcccctgagactgga-----ggctccgatt-----c-caaggtggtt
             Pacific walrus  ---------actcctcagaagtctcccctgagaccgga-----ggctcctatt-----c-caaggtggtt
               Weddell seal  ---------actcctcggaagcctcccctgagaccgga-----ggctcctatt-----c-caaggtggtt
              Big brown bat  ---------tcttatctgaaggcctccctgggacagga-----ggctcctctt-----c-caaggcagct
       David's myotis (bat)  ---------tctcatctgaaggcctccctgggacaaga-----ggctcctctt-----c-caaggcagct
B D                Microbat  ---------tctcatctgaaggcctccctgggacaaga-----ggctcctctt-----c-caaggcagct
            Star-nosed mole  ---------tctcatctgaaggctccattaagtctgga-----ggctgctctt-----c-t---------
                   Aardvark  ccaggctgcagtcatctga-ggcctgtgtgggcctgga-----ggatctgttt-atttc-caaggtacct
B D                     Rat  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Sheep  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Elephant  ======================================================================
B D                   Mouse  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
          Black flying-fox  ======================================================================
B D                 Manatee  ======================================================================
            Bactrian camel  ======================================================================
B D                     Pig  ======================================================================
          Cape golden mole  ======================================================================
B D                 Megabat  ======================================================================
B D                 Wallaby  ======================================================================
  D          Painted turtle  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
                      Chimp  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
                    Gorilla  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
                  Orangutan  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatact-gtcagtatcag
                     Gibbon  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
                     Rhesus  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
        Crab-eating macaque  cacctgtgt---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
                     Baboon  cacctgtgc---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
               Green monkey  cacctgtgc---ggctgacaagctgat--gctggcctttagcaggaagcctccatgct-ctcaatatcag
                   Marmoset  ctactgtgt---ggctgatgagctgat--gttggctgttagcaggaagcct-catgct-ctcattgtcag
            Squirrel monkey  ccactgtgt---ggctgacgaactgat--gctggctgttagcaggaagcctccatgct-ctcattgtcaa
                   Bushbaby  ca-ctacac---agctgacta-ttgct--gcttgctgttagcaggaggcct-ggtcct-cccaatgccag
         Chinese tree shrew  cacctacct---gactgatgtgttgat--gatggctgctagtgagagacctccatctt-ctccatatgag
                   Squirrel  ---cactga---ggctgacaaactggt--gctggccagt--------agctcagcctc-ctcaatcaaag
     Lesser Egyptian jerboa  ---tgacgacgccgctggcaacttggt------------------------------------------g
                 Guinea pig  --cctgtgt---ggctgatgaggt-gt--gctggctgatcataggaggcctcagcttt-ttcaaaatgag
           Brush-tailed rat  --cccctga---ggctgaagaggtggt--gctggctggtctcaagaggcctctgc-tt-ttcaaaatgag
                     Rabbit  cacctgcat---ggatgacgagccggg--gctggctggcagtaggaggctgcagtctt-cttgttctcat
                       Pika  cacctgcat---ggctaacgagtcacc--atgggctggcatgggcaggctgctaacct-cgcattctcat
                    Dolphin  ccctca------------cgtgatggc-------ttgctggcaagaggcttcagttcttcttcacgtggg
               Killer whale  ccctca------------cgtgatggc-------ttgctggcaagaggcttcagttcttcttcacgtggg
                      Horse  cactcacac---ggttggtgagctagt--gctggccgatagcgagaggcctcagttcttctcaacatggg
           White rhinoceros  tactcacat---ggttgatgagctggt--gctggctgttagtgagaggcctcagttcttctcaacatggg
                        Cat  ccgtca--t---ggctgatgagctggt--gctgcttggcagt--gacactgaggttcttctccatgtggg
                        Dog  cagctg--t---ggctgatgagctggt--gctggctgttagt--gagacttcagttct---cagtgtcga
                    Ferret   cggtca--t---ggctgacgagctgactgacgagctgtcagt--gaggcctcagttcttcgc--------
                      Panda  cagtca-----------------cggctgacgagctgtcagt--gaggccccagttcttctcaatgtggg
             Pacific walrus  cagtca--t---ggctgacgagctggctgacgagctgttagt--gaggcctcagttcttctcaatgcggg
               Weddell seal  cagtca--t---ggctgacgagctggctgacgagctgttggt--gaagcctcagttcttctcagtgtggg
              Big brown bat  cacttacat---ggctggcagggtggt--gctggctgttagtgagaggccaaagttctcctcaacatggg
       David's myotis (bat)  cacttacgt---ggctggcagggaggt--gctggctgctagcgagaggccgaagttctcctcaatgtggg
                   Microbat  cacttacat---ggctggcagggtggt--gctggctgctagcgagaggccgaagttctcctcaacgtggg
            Star-nosed mole  --------------------------t--gctgacatcttatgagaggcttctgttcctctcagcactcg
                   Aardvark  cacttacat---ggc-----atgtggt------gctcttggcaggaggcctcggcact-tcccacgtgag
                        Rat  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                      Shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Sheep  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
            Chinese hamster  ======================================================================
                   Elephant  ======================================================================
                      Mouse  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
           Black flying-fox  ======================================================================
                    Manatee  ======================================================================
             Bactrian camel  ======================================================================
                        Pig  ======================================================================
           Cape golden mole  ======================================================================
                    Megabat  ======================================================================
                    Wallaby  ======================================================================
             Painted turtle  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                      Chimp  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                    Gorilla  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                  Orangutan  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                     Gibbon  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                     Rhesus  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
        Crab-eating macaque  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                     Baboon  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
               Green monkey  cttctgcacagggctat-ttgagaattcacagaatattttggc---tgacttccctctgaacaagtgat-
                   Marmoset  cctctagacagggctat-ttgagaattcacagaatatattggc---tgacttccctctgaataagcaat-
            Squirrel monkey  cctctggacagggctat-ttgagaattcacagaatatattggc---tgactgccctctgagtaagtgat-
                   Bushbaby  cctctccacagggttatgttgacagtccgcaagatatgttggc---cgacttcccctggaactagcaac-
         Chinese tree shrew  cctctccacacagctgt-ttaggagtccacag-ataaactgac---tgacttctattggaataagttgt-
                   Squirrel  cctctacaagtggctat-ttgagagtccacaaaatgtgccagt---tgactttgcctcaaacaaatgat-
     Lesser Egyptian jerboa  cctctccacaaggcgag-ctgagagcccagaggaggagctgaa---ggacccc-cctggaccgtgtgac-
                 Guinea pig  cctctccacctggctat-ttgaggggccccaagatatgctgac---caacttcctatggaatatgtaatc
           Brush-tailed rat  cctctccacctggctac-ttgggaggccccaagatgggctggc---tcactttccacggactctgtaag-
                     Rabbit  cctct-------gacag-ccgagggtccgt-agataggctgag---tgacttc-tccagaatgagcgat-
                       Pika  cctct-------gacat-ctgagagtccttaaggtacattcagccctgacttcatccagaatgagtggt-
                    Dolphin  cctctccaccaggctac-ctgagtgtccacaagacatgctgg----tggctttcaccagagtgagtggt-
               Killer whale  cctctccaccaggctac-ctgagtgtccacaagacatgctgg----tggctttcaccagagtgagtggt-
                      Horse  cctctccatagggctgc-ctgagagtctacaagacatg-tgc----tggctttccccagagtgagtgat-
           White rhinoceros  cctctccacagggctac-ctgagtgtctgcaagacatgttgg----tggcttt-cctggagtgagtgat-
                        Cat  actctccatatggctcc-ccgagcatccacaagacatgttgg----tggctttgctcagagtgactaat-
                        Dog  acttgccacctggctcc-ccgagcagccacaagacacattgg----tggctctcctcagagtgactaat-
                    Ferret   ------catgtggctac-ctgagcagacgcaagacatactgg----gggctttcctcagagcgattcat-
                      Panda  acagt-cacctggctac-ctgagcagccaaaagacatgttgg----tggctttcttcagaacgactaat-
             Pacific walrus  actctccacctggctac-ctgagcagccacaagacatattgg----tggctttcctcagagcgactgat-
               Weddell seal  actctccacctggctac-ctgagcagccacgagacatattgg----tggctttcctcagagcgactaat-
              Big brown bat  cctct-cttggggctat-ctgagtgtccacaagatatgttag----tggctttctctggagtgagagat-
       David's myotis (bat)  tctct-ctcagggctat-ctgagtgtccgcaagacatgttag----tggctttctctggagtgagagat-
                   Microbat  tctct-ctcagggctac-ctgagtgtccacaagacatgttag----tggctttctctggagtgagagat-
            Star-nosed mole  cctttccacagttctac-ccaaacatccacaagctaagttgt----tggctttcttcagagcaagcaac-
                   Aardvark  cctctgcacggggctgt-ttcagggtctgcaagatgtggtgg----tggctgcccctggggtgagagat-
                        Rat  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                      Shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Sheep  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
            Chinese hamster  ======================================================================
                   Elephant  ======================================================================
                      Mouse  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
           Black flying-fox  ======================================================================
                    Manatee  ======================================================================
             Bactrian camel  ======================================================================
                        Pig  ======================================================================
           Cape golden mole  ======================================================================
                    Megabat  ======================================================================
                    Wallaby  ======================================================================
             Painted turtle  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  cca-caa-aacaaggtggaag-cctcaatgcctttcctgcccagccttgg-aagtcacatatcatcagct
                      Chimp  cca-caa-aacaaggtggaag-cctcaatgcctttcctgcccagccttgg-aagttacatatcatcagct
                    Gorilla  cca-caa-aacaaggtggaag-cctcaattcctttcctgcccagccttgg-aagtcacatatcatcagct
                  Orangutan  cca-caa-aacaaggtggaag-cctcaatgcctttcctgcccagccttgg-aagtcacatatcatcagct
                     Gibbon  cca-caa-aacaaggtggaag-cctcaatgcctttcctgcccagccttgg-aagtcacatatcgtcagct
                     Rhesus  cca-gaa-aacaaggtggaag-cctcaatgcctttgctgcccagccttgg-aagtcacatatcatcagct
        Crab-eating macaque  cca-gaa-aacaaggtggaag-cctcaatgcctttgctgcccagccttgg-aagtcacatatcatcagct
                     Baboon  cca-gaa-aacaaggtggaag-cctcaatgcctttgctgcccagccttgg-aagtcacatatcatcagct
               Green monkey  cca-caa-aacaaggtggaag-cctcaatgcctttgctgcccagccttgg-aagtcacatatcgtcagct
                   Marmoset  cca-caa-aacaaggtagaag-cctcaatccctttcctgcccagccttgg-aagtcacatatcatcagct
            Squirrel monkey  ccc-caa-aacaaagtagaag-cctcaatccctttcctgcccagccttgg-aagtcgcatatcatcagct
                   Bushbaby  ccaggag-aacaaggtagatg-ccttgttacccttcctgcctggccttgg-aagccacactt------ct
         Chinese tree shrew  cca-caaggactagctggaag-actcagcgtctctcatgactagcctcag-aaaccacatattatcagtt
                   Squirrel  cca-tgagaacaaggtggaag-ctttgaggc-cctcacacctcagcttgg-aagtcacg-aacagtaact
     Lesser Egyptian jerboa  cca-tgag-----------------------------cacttcagcc--------------------act
                 Guinea pig  cca-tgagaacactgtggaca-cctcactactcttcacgtttctgcttca-gagtcatgtatcaccagct
           Brush-tailed rat  cca-tgcgaacactgtgggca-cctcactactcttcacaattc---------agtcctgtatcaccagct
                     Rabbit  -ca-cgggaacag---gtcag-cctccgtgtgcagcatgcccggccttgg-aagccagg----gcgagtt
                       Pika  gca-tgtgagcaacgtggaag-cct-caccttca-catgctcggccttgg-aagccgtggattgtcggct
                    Dolphin  cca-ggagaacaaggtgaa---gttcagcgccccttcggtctagccttgg-aagatgcatatcatcagcg
               Killer whale  cca-ggagaacaaggtgaa---gttcagcgccccttcggtctagccttgg-aagatgcatatcatcagcg
                      Horse  cca-agagagcaacgtggaag-cctcaacgccccttatgcctagccttag-aagtcacatatcattagtt
           White rhinoceros  cca-agagaacaaggtggaag-cctcgacaccccttatgcccagccttag-aagtcacatatcattacct
                        Cat  cca-agagaacaccgtggaagccctcaacaccctttacgcccagtcttggaaagtcacacatcactagtt
                        Dog  cca-agagaacaaggtggaag-cctcaacaccctttaggcctagccttgg-aagtcacatatcatcagct
                    Ferret   cca-agagaacaaagtagaag-cttccacaccttctcagtctcatcttgg-aagtcacccatcatcggct
                      Panda  cca-agagaacaaggtagaag-cttcaagaccctttatgcctagtctcgg-aagtcacatatcatcagct
             Pacific walrus  cta-agagaacaaggtagaag-cttcagcaccctttatgcttagtcttgg-aagtcacctatcgtcagtt
               Weddell seal  cca-agagaacaaggtagaag-cttcagcaccctttatgcctagtcttgg-aagtcacctatcatcagct
              Big brown bat  cca-agaga----------------tggt--------------gctgtag-aaaccacataccatccact
       David's myotis (bat)  cca-agagagcaaggtagaaa-cctgggt--------------gcagtag-aaaccatatatcatccact
                   Microbat  cca-agagaacaaggtagaaa-cctgggt--------------gcagtag-aaaccgcatatcatccact
            Star-nosed mole  cca-agagaatgaggtagaag-tccct-catccattgtgcccagcctaga-aaggtacatgtcaccagaa
                   Aardvark  cta-agg-aacaaggtggaag-cctccattcccttcatatctagctcagg-aggtcacgtatcgtcagat
                        Rat  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                      Shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Sheep  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
             Golden hamster  ======================================================================
               Prairie vole  ======================================================================
            Chinese hamster  ======================================================================
                   Elephant  ======================================================================
                      Mouse  ======================================================================
             Naked mole-rat  ======================================================================
                 Chinchilla  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
           Black flying-fox  ======================================================================
                    Manatee  ======================================================================
             Bactrian camel  ======================================================================
                        Pig  ======================================================================
           Cape golden mole  ======================================================================
                    Megabat  ======================================================================
                    Wallaby  ======================================================================
             Painted turtle  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  ctgccaca
                      Chimp  ctgccaca
                    Gorilla  ctgccaca
                  Orangutan  ctgccaca
                     Gibbon  ctgccaca
                     Rhesus  ctgccaca
        Crab-eating macaque  ctgccaca
                     Baboon  ctgccaca
               Green monkey  ctgccaca
                   Marmoset  ctgccgga
            Squirrel monkey  ctgccaga
                   Bushbaby  ctg--gtg
         Chinese tree shrew  ctaccgta
                   Squirrel  ctaccaca
     Lesser Egyptian jerboa  cacctgtc
                 Guinea pig  ctatgata
           Brush-tailed rat  ctaggata
                     Rabbit  cccctcta
                       Pika  ctcctgta
                    Dolphin  ctgtcgtg
               Killer whale  ctgtcgtg
                      Horse  ctactgtg
           White rhinoceros  ctgctgtg
                        Cat  ctgccgag
                        Dog  ctgccagg
                    Ferret   ctgccatg
                      Panda  ccgccatg
             Pacific walrus  ctgccatg
               Weddell seal  ctgccatg
              Big brown bat  ttactgag
       David's myotis (bat)  ttaccgag
                   Microbat  ttaccgag
            Star-nosed mole  ctactgtg
                   Aardvark  acactaca
                        Rat  ========
                     Tenrec  ========
        Cape elephant shrew  ========
                      Shrew  ========
                   Hedgehog  ========
                      Sheep  ========
              Domestic goat  ========
                        Cow  ========
           Tibetan antelope  ========
             Golden hamster  ========
               Prairie vole  ========
            Chinese hamster  ========
                   Elephant  ========
                      Mouse  ========
             Naked mole-rat  ========
                 Chinchilla  ========
                  Armadillo  ========
                     Alpaca  ========
           Black flying-fox  ========
                    Manatee  ========
             Bactrian camel  ========
                        Pig  ========
           Cape golden mole  ========
                    Megabat  ========
                    Wallaby  ========
             Painted turtle  ========
            Green seaturtle  ========
                    Chicken  ========
                    Opossum  ========
            Tasmanian devil  ========

Inserts between block 7 and 8 in window
B D                Dolphin 5bp
              Killer whale 5bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
           Star-nosed mole 1bp

Alignment block 8 of 58 in window, 30152276 - 30152283, 8 bps 
B D                   Human  tca----gctgg
B D                   Chimp  tca----gccgg
B D                 Gorilla  tca----gctgg
B D               Orangutan  tca----gctgg
B D                  Gibbon  tca----gctgg
B D                  Rhesus  tca----gctgg
B D     Crab-eating macaque  tca----gctgg
B D                  Baboon  tca----gctgg
B D            Green monkey  tca----gctgg
B D                Marmoset  tca----gctgg
B D         Squirrel monkey  tca----tctgg
B D                Bushbaby  tct----gctga
         Chinese tree shrew  ttt----gctag
B D                Squirrel  tc----------
     Lesser Egyptian jerboa  ta----------
B D              Guinea pig  tc----------
           Brush-tailed rat  tc----------
B D                  Rabbit  cct----gctg-
B D                    Pika  tca----g----
B D                 Dolphin  tct----gctga
               Killer whale  tct----gctga
B D                   Horse  -ctc--cattca
B D        White rhinoceros  -ctc--tattgg
B D                     Cat  -cc----gttgg
B D                     Dog  -ct----gttgg
B D                 Ferret   -ct----gttgg
B D                   Panda  -ct----gttgg
             Pacific walrus  -ct----gttgg
               Weddell seal  -ct----gttgg
           Black flying-fox  tct----gcggg
              Big brown bat  tct----gttgg
       David's myotis (bat)  tct----gttgg
B D                Microbat  tct----gttga
            Star-nosed mole  tct----gttgc
                   Aardvark  ---cgcccttga
B D                     Rat  ============
B D                  Tenrec  ============
       Cape elephant shrew  ============
B D                   Shrew  ============
B D                Hedgehog  ============
B D                   Sheep  ============
             Domestic goat  ============
B D                     Cow  ============
          Tibetan antelope  ============
            Golden hamster  ============
              Prairie vole  ============
B D         Chinese hamster  ============
B D                Elephant  ============
B D                   Mouse  ============
B D          Naked mole-rat  ============
                Chinchilla  ============
B D               Armadillo  ============
B D                  Alpaca  ============
B D                 Manatee  ============
            Bactrian camel  ============
B D                     Pig  ============
          Cape golden mole  ============
B D                 Megabat  ============
B D                 Wallaby  ============
  D          Painted turtle  ============
  D         Green seaturtle  ============
B D                 Chicken  ============
B D                 Opossum  ============
B D         Tasmanian devil  ============

Inserts between block 8 and 9 in window
B D                Dolphin 2bp
              Killer whale 2bp

Alignment block 9 of 58 in window, 30152284 - 30152293, 10 bps 
B D                   Human  cctcac--agac
B D                   Chimp  cctcac--agac
B D                 Gorilla  cctcac--agac
B D               Orangutan  cctcac--agac
B D                  Gibbon  cctcac--agac
B D                  Rhesus  cctcac--agac
B D     Crab-eating macaque  cctcac--agac
B D                  Baboon  cctcac--agac
B D            Green monkey  cctcac--agac
B D                Marmoset  ccccac--agac
B D         Squirrel monkey  cctcac--agac
B D                Bushbaby  tcttat--aggc
         Chinese tree shrew  tctcaa--agac
B D                  Rabbit  -ctctc--aggc
B D                 Dolphin  gctccc--agac
               Killer whale  gctccc--agac
B D                   Horse  tcacag--agac
B D        White rhinoceros  tcactc--agac
B D                     Cat  tgtcac--agac
B D                     Dog  tctcac--agag
B D                 Ferret   tctcac--agac
B D                   Panda  tctcac--agac
             Pacific walrus  tctcac--agac
               Weddell seal  tctcac--agac
           Black flying-fox  --tcacgcgggc
B D                 Megabat  cctcac-----c
              Big brown bat  tctcac--aggc
       David's myotis (bat)  tctcac--gggc
B D                Microbat  tctcac--gggc
            Star-nosed mole  tctcac--agac
                   Aardvark  cctcac--agcc
B D                     Rat  ============
B D                  Tenrec  ============
       Cape elephant shrew  ============
B D                    Pika  ------------
B D                   Shrew  ============
B D                Hedgehog  ============
    Lesser Egyptian jerboa  ------------
B D                   Sheep  ============
             Domestic goat  ============
B D                     Cow  ============
          Tibetan antelope  ============
            Golden hamster  ============
              Prairie vole  ============
B D         Chinese hamster  ============
B D                Elephant  ============
B D                   Mouse  ============
B D          Naked mole-rat  ============
                Chinchilla  ============
B D               Armadillo  ============
B D                  Alpaca  ============
B D                Squirrel  ------------
B D                 Manatee  ============
            Bactrian camel  ============
B D              Guinea pig  ------------
          Brush-tailed rat  ------------
B D                     Pig  ============
          Cape golden mole  ============
B D                 Wallaby  ============
  D          Painted turtle  ============
  D         Green seaturtle  ============
B D                 Chicken  ============
B D                 Opossum  ============
B D         Tasmanian devil  ============

Inserts between block 9 and 10 in window
                  Aardvark 162bp

Alignment block 10 of 58 in window, 30152294 - 30152324, 31 bps 
B D                   Human  caaccctgatgcagcgtgggaaga--gaccata
B D                   Chimp  caaccctgatgcagcgtgggaaga--gaccata
B D                 Gorilla  caaccctgatgcagcgtgggaaga--gaccata
B D               Orangutan  caaccctgatgcagcgtgggaaga--gaccata
B D                  Gibbon  caaccctgatgcagcgtgggaaga--gaccata
B D                  Rhesus  caaccctgatgcagtgtgggaaga--gaccata
B D     Crab-eating macaque  caaccctgatgcagtgtgggaaga--gaccata
B D                  Baboon  caaccctgatgcagtgtgggaaga--gaccata
B D            Green monkey  caaccctgatgccgtgtgggaaga--gaccata
B D                Marmoset  caaccctgatgcagcgtgggaaga--gactata
B D         Squirrel monkey  caaccctgatgcagcatgggatggttgactaca
B D                Bushbaby  cgttcctgacgcaacgcagcaaga--gactaca
         Chinese tree shrew  cagctctgatatagtgtgagaaga--gataaca
B D                Squirrel  -----ctgattcagcatgggaagg--gactaca
     Lesser Egyptian jerboa  -----ctgatgcagtgtgggaaga--gaccaca
B D              Guinea pig  -----ctgatgcatcctgggaaga--gaccaca
           Brush-tailed rat  -----ctgatgcagcccgggaaga--ctacgca
B D                  Rabbit  cag-ccccgcacagtgtgggaaga--gactgca
B D                    Pika  -----ccagtacaaggtggagaac--tactgca
B D                 Dolphin  gagccctggccccgtgtgggaaga--gactacg
               Killer whale  gagccctggccccgtgtgggaaga--gactacg
B D                   Horse  cagccctgactcagtgtgtgaaga--gagtaca
B D        White rhinoceros  ccaccctgactcagtgtgggaaga--gactaca
B D                     Cat  cagccttgactccgtgtgggaaga--cgctaca
B D                     Dog  cagcccaggctcagtgtggaaaga--ctccata
B D                 Ferret   c-gccctgactcagcgtggaaaga--ctcaaca
B D                   Panda  cagccctgattc--aggggaaaga--ctgtaga
             Pacific walrus  cagccctgactcagaggggaaata--ctctaca
               Weddell seal  cagccctgactcagaggggaaaca--ctctaca
           Black flying-fox  cagccctggctcgg-gtgggcaga--ggtgacg
B D                 Megabat  cagccctggcttgg-gtgggcaga--ggtgacg
              Big brown bat  cagccctgactcggtgtgggcaga--gactata
       David's myotis (bat)  cagccctgacttggtgtggacaga--gactaca
B D                Microbat  cagccctgactcggtgtggacaga--gactaca
            Star-nosed mole  ca------agttggtgtgggaaaa--gaccaca
B D                     Rat  =================================
B D                  Tenrec  =================================
       Cape elephant shrew  =================================
B D                   Shrew  =================================
B D                Hedgehog  =================================
B D                   Sheep  =================================
             Domestic goat  =================================
B D                     Cow  =================================
          Tibetan antelope  =================================
            Golden hamster  =================================
              Prairie vole  =================================
B D         Chinese hamster  =================================
B D                Elephant  =================================
B D                   Mouse  =================================
B D          Naked mole-rat  =================================
                Chinchilla  =================================
B D               Armadillo  =================================
B D                  Alpaca  =================================
B D                 Manatee  =================================
            Bactrian camel  =================================
B D                     Pig  =================================
          Cape golden mole  =================================
                  Aardvark  =================================
B D                 Wallaby  =================================
  D          Painted turtle  =================================
  D         Green seaturtle  =================================
B D                 Chicken  =================================
B D                 Opossum  =================================
B D         Tasmanian devil  =================================

Alignment block 11 of 58 in window, 30152325 - 30152409, 85 bps 
B D                   Human  tgaggtgcaaaaatca------------agggtcattgg---ggggtac-cttggaggttgtct------
B D                   Chimp  tgaggtgcaaaaatca------------agggtcattgg---gggctac-cttggaggttgtct------
B D                 Gorilla  tgaggtgcaaaaatca------------agggtcattgg---gggctgc-cttggaggttgtct------
B D               Orangutan  tgaggtgcaaaaatca------------agggtcattgg---gggctac-cttggaggttgtct------
B D                  Gibbon  tgaggtgcaaaaatca------------agggtcattgg---gggctat-cttggaggttgtct------
B D                  Rhesus  tgaggtgcaaaaatca------------agggtcattgg---gggctat-cttggaggttgtct------
B D     Crab-eating macaque  tgaggtgcaaaaatca------------agggtcattgg---ggactat-cttggaggttgtct------
B D                  Baboon  tgaggtgcaaaaatca------------agggtcattgg---gggctat-cttggaggttgtct------
B D            Green monkey  tcaggtgcaaaaatca------------agggtcattgg---gggctat-cttggagattgtct------
B D                Marmoset  agaggtacaaaaatca------------agggtcactgg---gggctat-cttggaggttgtct------
B D         Squirrel monkey  agagatgcaaaaatca------------agggtcactgg---gggctat-cttggaggctgtct------
B D                Bushbaby  catggtgtgactatca-----ggagacgaggatcgttgg---gg-ctgt-c-tggactgtgcct------
         Chinese tree shrew  caaggtgtaaataaca-----ggctataagaatcattgg---gggctat-attgaagattgttt------
B D                Squirrel  c-agatacccatgtat-----aaatacaaggatcactg------------------ggttgtct------
     Lesser Egyptian jerboa  --gggtccacacgggc-----acagccgcg--tcactgg---cggccat-cttgatggttgtct------
B D              Guinea pig  caagctgccagtatga-----ggtgacaaggatcactggggttggttac-cttggagactctcc------
           Brush-tailed rat  cagggtgccagtatga-----ggaggcaaggatcattgg---tggctcc-cttggaggtttcct------
B D                  Rabbit  ccaagtgtgactgtca-----ggagatgacaatcactgg---gggttgt--------------ctactgc
B D                    Pika  gcaagcacgaatatca-----ggaggtaagaatcactgg---gggctgttgtggggggttgtctcattgc
B D                 Dolphin  c-aggtgtgaggacca-----ggtggtgagg-ccact-g---gggccac-tttggaggctggct-cccac
               Killer whale  c-aggtgtgaggacca-----ggtggtgagg-ccact-g---gggccac-cttggaggctggct-cccac
B D                   Horse  caagacgtgaatacca-----ggcggccaggagcactgg---gggccat-cttggaggctggct-cccgc
B D        White rhinoceros  caagatgtgaatacca-----ggtggcaaggatcattgg---gggccat-cttggaggttggct-cccac
B D                     Cat  tgaggtgtgaatacca-----gggggc-tggatcgctgg---gggccct-cggagaggctgactcccccc
B D                     Dog  caaggtgcgaatacca-----ggtggcaaggatcattgg---aggccat-cttggaggctggct-cccac
B D                 Ferret   caa-gcgtgaatacca-----ggaggcaggggccgttgg---tggccat-cttggaggctggct-ccccc
B D                   Panda  caaggcgtgaatgcca-----ggcagcaagggtcaatgg---gggccat-cttggaggctggtt-cccac
             Pacific walrus  caaggcatgaatacca-----ggtggcaaggagc------------------------ctggct-cccac
               Weddell seal  caaggtgtgaatacca-----ggtggcaaggatcattgg---gggccat-cttggaggctggct-cccac
           Black flying-fox  cggggcgtgaatacca-----ggtggcc-agacggctcg---gggccat-ccggggggctggct-cccgc
B D                 Megabat  cggggcgtgactacca-----ggtggcg-ggacggctca---gggccgt-ccggggggctggct-cccgc
              Big brown bat  taaggtgtagacatca-----ggtggtgaggaccattgg---gggccat-ctgggaggatgagt-cccac
       David's myotis (bat)  tgaggtgtggacgcca-----ggtgatgaggaccattgg---ggaccat-ctgggaggatgagt-cccac
B D                Microbat  tgagatgtggacacca-----ggtggtgaggaccattag---gggccat-ctgggaggatgagt-cccac
            Star-nosed mole  caa-gtttgaaggcca-----ggtggcg-gggtcactga---tggccat-cttgaaggttggct-cccac
                   Aardvark  tgaagtgccaaccttctggttagcagtcaagtgccttag---gcactac-gccaccagagctct------
B D                     Rat  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Sheep  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Elephant  ======================================================================
B D                   Mouse  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
B D                 Manatee  ======================================================================
            Bactrian camel  ======================================================================
B D                     Pig  ======================================================================
          Cape golden mole  ======================================================================
B D                 Wallaby  ======================================================================
  D          Painted turtle  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  ----atcacctgaaatttgatcttgaaatggggacttgctg
                      Chimp  ----atcacctgaaatttgatcttgaaatggggacttgctg
                    Gorilla  ----gtcacctgaaatttgatcttgaaatggggacttgctg
                  Orangutan  ----atcacctgcaatttgatcttgaaatggggacttgcta
                     Gibbon  ----atcacctgaaatttgatcttgaaatggggacttgcta
                     Rhesus  ----atcacctgaaatttgatcttgaaatggggacttgcta
        Crab-eating macaque  ----atcacctgaaatttgatcttgaaatggggacttgcta
                     Baboon  ----atcacctgaaatttgatcttgaaatggggacttgcta
               Green monkey  ----atcacctgaaatttgatcttgaaatggggacttgcta
                   Marmoset  ----atcacctgaaatttgatctcgaaatggggacttgctg
            Squirrel monkey  ----atcacctgaaatttgatctcgaaatggggacttgctg
                   Bushbaby  ----ttcacctgatagttgatcttgaaataaggg-tggcta
         Chinese tree shrew  ----attacctgatagttgatcttgaaattgggagttgata
                   Squirrel  ----ctctcctaata-ttgatccaaaaattgggacttgctg
     Lesser Egyptian jerboa  ----attacctgatatttgaacttgaaattgggacttggtc
                 Guinea pig  ----atcacctgatgttcaacattgaagctgggatttgcca
           Brush-tailed rat  ----atcacctgatatttgatgttgaaactgggatttgcta
                     Rabbit  agacgtcagctgatacttcagctcgcgatcgagagcggctg
                       Pika  agacatcaactggtgtttgatcttaaaactgagagccgcta
                    Dolphin  ggata-cacctgacagtcaatctcgaaactgggagcggctc
               Killer whale  ggata-cacctgacagtcaatctcgaaactgggagcggctc
                      Horse  tgatatcatgtgacatttgatcttgaaattgggagtttctt
           White rhinoceros  agatatcatgtgatatttgatttcaaaattgggagttgctt
                        Cat  agatgtcacatgatatttcgcctcgaaaccgggagtggctt
                        Dog  agataccacatgatattttatctcaaaattgggagttgctt
                    Ferret   agataccacaggctg--ttatcttggaattgggagttgctt
                      Panda  agatatcac---atattttatctcaaatttgggagttgctt
             Pacific walrus  agatctcacatgatattttatctcaaaattgggagttgctt
               Weddell seal  agatctcacatgatattttatctcaaaattgggagttgctt
           Black flying-fox  aggtaccacgtgacatttgatcccggaaccgggagctgggc
                    Megabat  aggtaccacgtgacattcgatcccggaaccgggagctgtgc
              Big brown bat  aaataccacatgatatttgatcttgaagttgggagttgctc
       David's myotis (bat)  aaatatcacatgatatttgatcttgaaattgggagttgctc
                   Microbat  aaaaatcacatgatatttgatcttgaagttgggagttgctc
            Star-nosed mole  atgtaacacctgatatttgatcatgaaac--agagttgtcc
                   Aardvark  ----atgacccaacatttagtcccaaacttaggagttgctg
                        Rat  =========================================
                     Tenrec  =========================================
        Cape elephant shrew  =========================================
                      Shrew  =========================================
                   Hedgehog  =========================================
                      Sheep  =========================================
              Domestic goat  =========================================
                        Cow  =========================================
           Tibetan antelope  =========================================
             Golden hamster  =========================================
               Prairie vole  =========================================
            Chinese hamster  =========================================
                   Elephant  =========================================
                      Mouse  =========================================
             Naked mole-rat  =========================================
                 Chinchilla  =========================================
                  Armadillo  =========================================
                     Alpaca  =========================================
                    Manatee  =========================================
             Bactrian camel  =========================================
                        Pig  =========================================
           Cape golden mole  =========================================
                    Wallaby  =========================================
             Painted turtle  =========================================
            Green seaturtle  =========================================
                    Chicken  =========================================
                    Opossum  =========================================
            Tasmanian devil  =========================================

Alignment block 12 of 58 in window, 30152410 - 30152411, 2 bps 
B D                   Human  ca
B D                   Chimp  ca
B D                 Gorilla  ca
B D               Orangutan  ca
B D                  Gibbon  ca
B D                  Rhesus  ca
B D     Crab-eating macaque  ca
B D                  Baboon  ca
B D            Green monkey  ca
B D                Marmoset  ca
B D         Squirrel monkey  ca
B D                Bushbaby  c-
         Chinese tree shrew  ta
B D                Squirrel  ca
     Lesser Egyptian jerboa  ca
B D              Guinea pig  ca
           Brush-tailed rat  ca
B D                  Rabbit  cg
B D                    Pika  ca
B D                 Dolphin  ca
               Killer whale  ca
B D                   Horse  ca
B D        White rhinoceros  ca
B D                     Cat  ca
B D                     Dog  ca
B D                 Ferret   ca
B D                   Panda  ca
             Pacific walrus  ca
               Weddell seal  ca
           Black flying-fox  ca
B D                 Megabat  ca
              Big brown bat  ca
       David's myotis (bat)  ca
B D                Microbat  ca
            Star-nosed mole  ca
B D                Elephant  ca
                   Aardvark  ta
B D                     Rat  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                   Shrew  ==
B D                Hedgehog  ==
B D                   Sheep  ==
             Domestic goat  ==
B D                     Cow  ==
          Tibetan antelope  ==
            Golden hamster  ==
              Prairie vole  ==
B D         Chinese hamster  ==
B D                   Mouse  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
B D               Armadillo  ==
B D                  Alpaca  ==
B D                 Manatee  ==
            Bactrian camel  ==
B D                     Pig  ==
          Cape golden mole  ==
B D                 Wallaby  ==
  D          Painted turtle  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==

Inserts between block 12 and 13 in window
                  Aardvark 154bp

Alignment block 13 of 58 in window, 30152412 - 30152413, 2 bps 
B D                   Human  ct
B D                   Chimp  ct
B D                 Gorilla  ct
B D               Orangutan  ct
B D                  Gibbon  ct
B D                  Rhesus  ct
B D     Crab-eating macaque  ct
B D                  Baboon  ct
B D            Green monkey  ct
B D                Marmoset  ct
B D         Squirrel monkey  ct
         Chinese tree shrew  ct
B D                Squirrel  cc
     Lesser Egyptian jerboa  tc
B D              Guinea pig  tc
           Brush-tailed rat  cc
B D                  Rabbit  tc
B D                    Pika  cc
B D                 Dolphin  tc
               Killer whale  tc
B D                   Horse  tc
B D        White rhinoceros  tc
B D                     Cat  tc
B D                     Dog  tc
B D                 Ferret   cc
B D                   Panda  tc
             Pacific walrus  tc
               Weddell seal  tc
           Black flying-fox  cc
B D                 Megabat  cc
              Big brown bat  tc
       David's myotis (bat)  tt
B D                Microbat  tt
            Star-nosed mole  tc
B D                Elephant  t-
B D                     Rat  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                   Shrew  ==
B D                Hedgehog  ==
B D                   Sheep  ==
             Domestic goat  ==
B D                     Cow  ==
          Tibetan antelope  ==
            Golden hamster  ==
              Prairie vole  ==
B D         Chinese hamster  ==
B D                   Mouse  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
B D               Armadillo  ==
B D                  Alpaca  ==
B D                 Manatee  ==
            Bactrian camel  ==
B D                Bushbaby  --
B D                     Pig  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Wallaby  ==
  D          Painted turtle  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==

Inserts between block 13 and 14 in window
B D               Elephant 1bp

Alignment block 14 of 58 in window, 30152414 - 30152419, 6 bps 
B D                   Human  cagacc
B D                   Chimp  cagacc
B D                 Gorilla  cagacc
B D               Orangutan  cagacc
B D                  Gibbon  tagacc
B D                  Rhesus  cagacc
B D     Crab-eating macaque  cagacc
B D                  Baboon  cagacc
B D            Green monkey  cagacc
B D                Marmoset  cagacc
B D         Squirrel monkey  cagacc
B D                Bushbaby  ---atc
         Chinese tree shrew  cagaca
B D                Squirrel  cagact
     Lesser Egyptian jerboa  catact
B D              Guinea pig  tagact
           Brush-tailed rat  cagact
B D                  Rabbit  caga--
B D                    Pika  cagacc
B D                 Dolphin  cagccc
               Killer whale  cagccc
B D                   Horse  cagatc
B D        White rhinoceros  cagacc
B D                     Cat  cagtcc
B D                     Dog  cacacc
B D                 Ferret   cacacc
B D                   Panda  cagacc
             Pacific walrus  cagacc
               Weddell seal  ccgacc
           Black flying-fox  cgcacc
B D                 Megabat  tgcacc
              Big brown bat  cagatt
       David's myotis (bat)  cagatt
B D                Microbat  cagatt
            Star-nosed mole  cagccc
B D                Elephant  cacacc
B D                  Tenrec  cacacc
                   Aardvark  cacacc
B D                     Rat  ======
       Cape elephant shrew  ======
B D                   Shrew  ======
B D                Hedgehog  ======
B D                   Sheep  ======
             Domestic goat  ======
B D                     Cow  ======
          Tibetan antelope  ======
            Golden hamster  ======
              Prairie vole  ======
B D         Chinese hamster  ======
B D                   Mouse  ======
B D          Naked mole-rat  ======
                Chinchilla  ======
B D               Armadillo  ======
B D                  Alpaca  ======
B D                 Manatee  ======
            Bactrian camel  ======
B D                     Pig  ======
          Cape golden mole  ======
B D                 Wallaby  ======
  D          Painted turtle  ======
  D         Green seaturtle  ======
B D                 Chicken  ======
B D                 Opossum  ======
B D         Tasmanian devil  ======

Alignment block 15 of 58 in window, 30152420 - 30152465, 46 bps 
B D                   Human  c--------------taacaaccacgtt---gcatttctgcctccctctgctcatccgtaaaa
B D                   Chimp  c--------------taacaaccacgtt---gcatttctgcctccctctgctcatctgtaaaa
B D                 Gorilla  c--------------taacaaccacgtt---gcatttctgcctccatctgctcatctgtaaaa
B D               Orangutan  c--------------taacaaccacgtt---gcatttctgcctccatctgctcatctgtaaaa
B D                  Gibbon  ctaacacttagaccttaacaaccatgtt---gcatttctgcctccatctgctcatctgtaaaa
B D                  Rhesus  c--------------taacaaccatgtt---gcatttctgcctccatctgctcatctgtaaaa
B D     Crab-eating macaque  c--------------taacaaccatgtt---gcatttctgcctccatctgctcatctgtaaaa
B D                  Baboon  c--------------taacaaccatgtt---gcatttctgcctccatctgctcatctgtcaaa
B D            Green monkey  c--------------taacaaccatgtt---gcatttctgcctccatctgctcatctgtaaaa
B D                Marmoset  c--------------tgacaaccttgtt---gcatttctgcctccatctgctcatttgtaaaa
B D         Squirrel monkey  c--------------tgacaaccttgtt---gcgtttgtgcctccatctgctcatctgtaaaa
B D                Bushbaby  c--------------acacagccaggtt---gtattcctgcctccatctgctcttctgtaaaa
         Chinese tree shrew  g--------------tggcaatcatgct------ttctcacctccatctgcttatct------
B D                Squirrel  t--------------tgacaatcatgta---gc-cttgtagctccatctg----tctataaaa
     Lesser Egyptian jerboa  a--------------tggcaat----------------tacctccagctgctcatctgtgcaa
B D              Guinea pig  t--------------tgacaaacatatt---gcattttgacttccatgtgctcatctctagaa
           Brush-tailed rat  t--------------ttccaaccacaat---gcattttgacttccatgtgcgcatttctagaa
B D                  Rabbit  -------------------------------------ctgtctgtgtctgctcgcctgtaaaa
B D                    Pika  c--------------taccaacca-gtg---gcatttctgcctgcacctgtccacctgcaaag
B D                 Dolphin  c--------------tggcgactgcatt---gcctttccaccttcgtctgcttatctgcaaaa
               Killer whale  c--------------tggcgactgcatt---gcctttccacctttgtctgctcatctgcaaaa
B D                   Horse  t--------------tgacaaccaggtt---gcatttctacct--------ccatctgtaaaa
B D        White rhinoceros  t--------------tgacaaccatgtt---gcatttctaccttcatctgctcatctgtaaaa
B D                     Cat  c--------------tggcgatcacgtt---gcctttccgcctccccttgcttatgcgcaaca
B D                     Dog  t--------------tgatgatcatgtt---gcatttctacctctacttgcttatctgcaaaa
B D                 Ferret   t--------------cgataatcaggtt---tcatttctacctc-acttgctcatctgcaaaa
B D                   Panda  t--------------ttataatcatgtt---tcatttctacctccacctgcttatctacaaaa
             Pacific walrus  t--------------tgataatcaggtt---tcatttctacctctacctgcttatccgcaaaa
               Weddell seal  t--------------tgataatcagatt---tcatttctacctctacctgcttatctgcaaaa
           Black flying-fox  t--------------tgagagccaggtt---gtgcctgttcctccgtctgcccgtctgtgaaa
B D                 Megabat  t--------------tgagagccaggtt---gcgcctgttcctccgtctgcccgtctgtgaaa
              Big brown bat  t--------------ttacatccatgtt---gcatctctacctctgtctgctcatctatgaaa
       David's myotis (bat)  t--------------ttatgtccatgtt---gcgtctctacctccgactgctcatctgtgaaa
B D                Microbat  t--------------ttatgtccatgtt---gcgtctctacttcccactgctcatctgtgaaa
            Star-nosed mole  c--------------taataactatatt---gtactcccacctccatctgttcatttgtaaga
B D                Elephant  c--------------tgataaccgtcca------tttctacctcagtctgctcatccgtaaaa
B D                 Manatee  c--------------taacaataacaca--------tccacctcagtctgtgcatctgtaaaa
B D                  Tenrec  c--------------atatgaccatgtgtatttatctctacctcagcctgctcatctgtacga
                   Aardvark  c--------------tgacaaccataaa-------cacggcccccatctgctcacgtgtacaa
B D                     Rat  ===============================================================
       Cape elephant shrew  ===============================================================
B D                   Shrew  ===============================================================
B D                Hedgehog  ===============================================================
B D                   Sheep  ===============================================================
             Domestic goat  ===============================================================
B D                     Cow  ===============================================================
          Tibetan antelope  ===============================================================
            Golden hamster  ===============================================================
              Prairie vole  ===============================================================
B D         Chinese hamster  ===============================================================
B D                   Mouse  ===============================================================
B D          Naked mole-rat  ===============================================================
                Chinchilla  ===============================================================
B D               Armadillo  ===============================================================
B D                  Alpaca  ===============================================================
            Bactrian camel  ===============================================================
B D                     Pig  ===============================================================
          Cape golden mole  ===============================================================
B D                 Wallaby  ===============================================================
  D          Painted turtle  ===============================================================
  D         Green seaturtle  ===============================================================
B D                 Chicken  ===============================================================
B D                 Opossum  ===============================================================
B D         Tasmanian devil  ===============================================================

Inserts between block 15 and 16 in window
    Lesser Egyptian jerboa 1095bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  4bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp

Alignment block 16 of 58 in window, 30152466 - 30152470, 5 bps 
B D                   Human  tgaag
B D                   Chimp  tgaag
B D                 Gorilla  tgaag
B D               Orangutan  tgaag
B D                  Gibbon  tgaag
B D                  Rhesus  tgaag
B D     Crab-eating macaque  tgaag
B D                  Baboon  tgaag
B D            Green monkey  tgaag
B D                Marmoset  tgaag
B D         Squirrel monkey  tgaag
B D                Bushbaby  tgaag
         Chinese tree shrew  tgagg
B D                Squirrel  tgaag
B D              Guinea pig  tgaag
           Brush-tailed rat  ggaag
B D                  Rabbit  caaag
B D                    Pika  tgaag
B D                 Dolphin  tgaca
               Killer whale  tgaca
B D                   Horse  tgaag
B D        White rhinoceros  tgaag
B D                     Cat  cgaag
B D                     Dog  tgaag
B D                   Panda  tga--
             Pacific walrus  tgaag
               Weddell seal  tgaag
           Black flying-fox  tgcag
B D                 Megabat  tgcag
              Big brown bat  caaag
       David's myotis (bat)  tgaag
B D                Microbat  cgaag
            Star-nosed mole  tgaag
B D                Elephant  tggtg
B D                 Manatee  tgaag
B D                  Tenrec  caaag
                   Aardvark  tgaaa
B D                     Rat  =====
       Cape elephant shrew  =====
B D                   Shrew  =====
B D                Hedgehog  =====
    Lesser Egyptian jerboa  =====
B D                   Sheep  =====
             Domestic goat  =====
B D                     Cow  =====
          Tibetan antelope  =====
            Golden hamster  =====
              Prairie vole  =====
B D         Chinese hamster  =====
B D                   Mouse  =====
B D          Naked mole-rat  =====
                Chinchilla  =====
B D               Armadillo  =====
B D                  Alpaca  =====
            Bactrian camel  =====
B D                 Ferret   =====
B D                     Pig  =====
          Cape golden mole  =====
B D                 Wallaby  =====
  D          Painted turtle  =====
  D         Green seaturtle  =====
B D                 Chicken  =====
B D                 Opossum  =====
B D         Tasmanian devil  =====

Inserts between block 16 and 17 in window
B D               Squirrel 1383bp

Alignment block 17 of 58 in window, 30152471 - 30152473, 3 bps 
B D                   Human  cgc
B D                   Chimp  cgc
B D                 Gorilla  tgc
B D               Orangutan  tgc
B D                  Gibbon  cac
B D                  Rhesus  tgc
B D     Crab-eating macaque  tgc
B D                  Baboon  tgc
B D            Green monkey  tgc
B D                Marmoset  tgc
B D         Squirrel monkey  tgt
B D                Bushbaby  tgc
         Chinese tree shrew  tac
B D              Guinea pig  tac
           Brush-tailed rat  tac
B D                  Rabbit  gac
B D                    Pika  aac
B D                 Dolphin  tac
               Killer whale  tac
B D                   Horse  tac
B D        White rhinoceros  tac
B D                     Cat  tgc
B D                     Dog  tcc
B D                   Panda  tac
             Pacific walrus  tac
               Weddell seal  tac
           Black flying-fox  acc
B D                 Megabat  acc
              Big brown bat  aac
       David's myotis (bat)  aac
B D                Microbat  aac
            Star-nosed mole  gac
B D                Elephant  gcc
B D                 Manatee  cac
B D                  Tenrec  aac
                   Aardvark  tgc
B D                     Rat  ===
       Cape elephant shrew  ===
B D                   Shrew  ===
B D                Hedgehog  ===
    Lesser Egyptian jerboa  ===
B D                   Sheep  ===
             Domestic goat  ===
B D                     Cow  ===
          Tibetan antelope  ===
            Golden hamster  ===
              Prairie vole  ===
B D         Chinese hamster  ===
B D                   Mouse  ===
B D          Naked mole-rat  ===
                Chinchilla  ===
B D               Armadillo  ===
B D                  Alpaca  ===
B D                Squirrel  ===
            Bactrian camel  ===
B D                 Ferret   ===
B D                     Pig  ===
          Cape golden mole  ===
B D                 Wallaby  ===
  D          Painted turtle  ===
  D         Green seaturtle  ===
B D                 Chicken  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===

Inserts between block 17 and 18 in window
B D             Guinea pig 3226bp

Alignment block 18 of 58 in window, 30152474 - 30152474, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D              Guinea pig  a
           Brush-tailed rat  a
B D                    Pika  a
B D                 Dolphin  a
               Killer whale  a
B D                   Horse  t
B D        White rhinoceros  a
B D                     Cat  g
B D                     Dog  g
B D                   Panda  t
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  a
       David's myotis (bat)  a
B D                Microbat  g
            Star-nosed mole  a
B D                Elephant  a
B D                 Manatee  a
B D                  Tenrec  g
                   Aardvark  a
B D                     Rat  =
       Cape elephant shrew  =
B D                   Shrew  =
B D                Hedgehog  =
    Lesser Egyptian jerboa  =
B D                   Sheep  =
             Domestic goat  =
B D                     Cow  =
          Tibetan antelope  =
B D                  Rabbit  -
            Golden hamster  =
              Prairie vole  =
B D         Chinese hamster  =
B D                   Mouse  =
B D          Naked mole-rat  =
                Chinchilla  =
B D               Armadillo  =
B D                  Alpaca  =
B D                Squirrel  =
            Bactrian camel  =
B D                 Ferret   =
B D                     Pig  =
          Cape golden mole  =
B D                 Wallaby  =
  D          Painted turtle  =
  D         Green seaturtle  =
B D                 Chicken  =
B D                 Opossum  =
B D         Tasmanian devil  =

Inserts between block 18 and 19 in window
          Brush-tailed rat 24904bp

Alignment block 19 of 58 in window, 30152475 - 30152480, 6 bps 
B D                   Human  ttgctg
B D                   Chimp  ttgctg
B D                 Gorilla  ttgctg
B D               Orangutan  ttgctg
B D                  Gibbon  ttgctg
B D                  Rhesus  ttgctg
B D     Crab-eating macaque  ttgctg
B D                  Baboon  ttgctg
B D            Green monkey  ttgctg
B D                Marmoset  ttgctg
B D         Squirrel monkey  ttgctg
B D                Bushbaby  ttgctg
         Chinese tree shrew  ttgctg
B D              Guinea pig  ttgctg
B D                    Pika  -tactt
B D                 Dolphin  ttgctg
               Killer whale  ttgctg
B D                   Horse  tcgctg
B D        White rhinoceros  ttgctg
B D                     Cat  cggccg
B D                     Dog  ttgctg
B D                   Panda  tgg---
             Pacific walrus  tggctg
               Weddell seal  tggctg
           Black flying-fox  gagctg
B D                 Megabat  gagctg
              Big brown bat  ttgctg
       David's myotis (bat)  ttgctg
B D                Microbat  ttgctg
            Star-nosed mole  tggctg
B D                Elephant  tttctg
B D                 Manatee  ttgctg
B D                  Tenrec  tgacta
                   Aardvark  tgggtg
B D                     Rat  ======
       Cape elephant shrew  ======
B D                   Shrew  ======
B D                Hedgehog  ======
    Lesser Egyptian jerboa  ======
B D                   Sheep  ======
             Domestic goat  ======
B D                     Cow  ======
          Tibetan antelope  ======
B D                  Rabbit  ------
            Golden hamster  ======
              Prairie vole  ======
B D         Chinese hamster  ======
B D                   Mouse  ======
B D          Naked mole-rat  ======
                Chinchilla  ======
B D               Armadillo  ======
B D                  Alpaca  ======
B D                Squirrel  ======
            Bactrian camel  ======
B D                 Ferret   ======
          Brush-tailed rat  ======
B D                     Pig  ======
          Cape golden mole  ======
B D                 Wallaby  ======
  D          Painted turtle  ======
  D         Green seaturtle  ======
B D                 Chicken  ======
B D                 Opossum  ======
B D         Tasmanian devil  ======

Inserts between block 19 and 20 in window
B D                   Pika 1bp

Alignment block 20 of 58 in window, 30152481 - 30152485, 5 bps 
B D                   Human  ag-cac
B D                   Chimp  ag-cac
B D                 Gorilla  ag-cac
B D               Orangutan  ag-cac
B D                  Gibbon  ag-cac
B D                  Rhesus  ag-cac
B D     Crab-eating macaque  ag-cac
B D                  Baboon  ag-cac
B D            Green monkey  ag-cac
B D                Marmoset  ag-cac
B D         Squirrel monkey  ag-tac
B D                Bushbaby  ag-cac
         Chinese tree shrew  ag-cat
     Lesser Egyptian jerboa  ag-cgt
B D              Guinea pig  aa-cat
B D                    Pika  ag-cct
B D                 Dolphin  ag-cac
               Killer whale  ag-cac
B D                   Horse  ac-tgt
B D        White rhinoceros  ac-tgt
B D                     Cat  gg-caa
B D                     Dog  ag-cac
B D                   Panda  -----t
             Pacific walrus  gg-cat
               Weddell seal  gg-cat
           Black flying-fox  ag-ctc
B D                 Megabat  ag-ctc
              Big brown bat  ag-ctc
       David's myotis (bat)  ag-ctc
B D                Microbat  ag-ctc
            Star-nosed mole  agttat
B D                Elephant  ag-tat
B D                 Manatee  ag-tat
B D                  Tenrec  ag-cgc
                   Aardvark  ag-ta-
B D                     Rat  ======
       Cape elephant shrew  ======
B D                   Shrew  ======
B D                Hedgehog  ======
B D                   Sheep  ======
             Domestic goat  ======
B D                     Cow  ======
          Tibetan antelope  ======
B D                  Rabbit  ------
            Golden hamster  ======
              Prairie vole  ======
B D         Chinese hamster  ======
B D                   Mouse  ======
B D          Naked mole-rat  ======
                Chinchilla  ======
B D               Armadillo  ======
B D                  Alpaca  ======
B D                Squirrel  ======
            Bactrian camel  ======
B D                 Ferret   ======
          Brush-tailed rat  ======
B D                     Pig  ======
          Cape golden mole  ======
B D                 Wallaby  ======
  D          Painted turtle  ======
  D         Green seaturtle  ======
B D                 Chicken  ======
B D                 Opossum  ======
B D         Tasmanian devil  ======

Inserts between block 20 and 21 in window
B D                 Tenrec 1087bp

Alignment block 21 of 58 in window, 30152486 - 30152499, 14 bps 
B D                   Human  a---gtt-t----tactagttc
B D                   Chimp  a---gtt-t----tactagttc
B D                 Gorilla  a---gtt-t----tactagttc
B D               Orangutan  a---gtt-t----tactagttc
B D                  Gibbon  a---gtt-t----tactagttc
B D                  Rhesus  a---gtt-t----tactagttc
B D     Crab-eating macaque  a---gtt-t----tactagttc
B D                  Baboon  a---gtt-t----tactagttc
B D            Green monkey  a---gtt-t----tactagttc
B D                Marmoset  a---gtt-t----tactagttc
B D         Squirrel monkey  a---gtt-t----tactagttc
B D                Bushbaby  c---a-t-t----aactagttg
         Chinese tree shrew  t---gtt-t----actgcattg
     Lesser Egyptian jerboa  c---att-tcacaaactg----
B D              Guinea pig  t---gtt-c----aactg----
B D                    Pika  c---act-g----agcaa----
B D                 Dolphin  t---gtc-t----gcctggttg
               Killer whale  c---gtc-t----gcctggttg
B D                   Horse  t---gtc-t----tactggttg
B D        White rhinoceros  c---gtc-t----aactagttc
B D                     Cat  g---gtc-t----acctagttg
B D                     Dog  c---atg-t----aatgagttg
B D                   Panda  c---ctc-t----cactagttg
             Pacific walrus  c---acc-t----aactagttg
               Weddell seal  c---atc-t----aactagttg
           Black flying-fox  cccagtc-t----gtttccggg
B D                 Megabat  gccagtc-t----gtttcctag
              Big brown bat  c---gtc-t----aactagtgg
       David's myotis (bat)  c---gtc-t----aactagcgg
B D                Microbat  c---atc-t----aactagtgg
            Star-nosed mole  c---acc-t----aactagccc
B D                Elephant  -----tacc----cacaggttg
B D                 Manatee  -----tgcc----catatgttg
                   Aardvark  ----gtg-c----cacgtgtcg
B D                     Rat  ======================
B D                  Tenrec  ======================
       Cape elephant shrew  ======================
B D                   Shrew  ======================
B D                Hedgehog  ======================
B D                   Sheep  ======================
             Domestic goat  ======================
B D                     Cow  ======================
          Tibetan antelope  ======================
B D                  Rabbit  ----------------------
            Golden hamster  ======================
              Prairie vole  ======================
B D         Chinese hamster  ======================
B D                   Mouse  ======================
B D          Naked mole-rat  ======================
                Chinchilla  ======================
B D               Armadillo  ======================
B D                  Alpaca  ======================
B D                Squirrel  ======================
            Bactrian camel  ======================
B D                 Ferret   ======================
          Brush-tailed rat  ======================
B D                     Pig  ======================
          Cape golden mole  ======================
B D                 Wallaby  ======================
  D          Painted turtle  ======================
  D         Green seaturtle  ======================
B D                 Chicken  ======================
B D                 Opossum  ======================
B D         Tasmanian devil  ======================

Inserts between block 21 and 22 in window
B D             Guinea pig 3bp
B D                   Pika 3bp

Alignment block 22 of 58 in window, 30152500 - 30152554, 55 bps 
B D                   Human  attcaagcatc-tgtttcccaagttag--tctgc----------------------aagctgcttaaaga
B D                   Chimp  attcaagcatc-tgtttcccaagttag--tctgc----------------------aagctgcttaaaga
B D                 Gorilla  attcaagcatc-tgtttcccaagttag--tctgc----------------------aagctgcttaaaga
B D               Orangutan  attcaagcatc-tgtttcccaagttag--tctga----------------------aagttgcttaaaga
B D                  Gibbon  attcaagcatc-tgtttcccaagctag--tctgc----------------------aagctgcttaagga
B D                  Rhesus  attcaagcatc-tgtttctcaagttag--tctgc----------------------aagctgcttaagga
B D     Crab-eating macaque  attcaagcatc-tgtttctcaagttag--tctgc----------------------aagctgcttaagga
B D                  Baboon  attcaagcatc-tgtttcccaagttag--tctgc----------------------aagctgcttaagga
B D            Green monkey  attcaagcatc-tgtttcccaagttag--tctgc----------------------aagctgcttaagga
B D                Marmoset  attcaagcatc-tgtttctcaagctag--tctac----------------------aagctgcttaagga
B D         Squirrel monkey  attcaagcgtc-tatgtctcaagctag--tctgc----------------------aatctgcttaagga
B D                Bushbaby  gttccaaagtc-tgttccccagggtag--tctgc----------------------aagcaacgtaagaa
         Chinese tree shrew  actcaagtgtc-tatatcccaggctag--tctgt----------------------gagctcctta---a
     Lesser Egyptian jerboa  actccagcgtc-tgtgtcccaggctag--tctgt----------------------gagctcctcaagga
B D                   Mouse  attacagggtc-tgttcgccaggttaa--cccac----------------------agaccagcctggga
B D              Guinea pig  attctaccatc-tgggtcttgggatag--tccag----------------------g-------caaggg
B D                  Rabbit  atcacagtgtc-cgtgtcccaggcca---cctgt----------------------c-------------
B D                    Pika  attacagcatc-tgtgtcccaggtca---ccgatgctaagcggacaacttcttccca-------------
B D                 Dolphin  gtttaagcatc-tgttt-ccaggcgag--tctgt----------------------gagctttttaagaa
               Killer whale  gtttaagcatc-tgttt-ccaggcgag--tctgt----------------------gagc----------
B D                   Horse  atttgagcgtcttgttt-ccaggctag--tttgt----------------------gag-ctcttgggaa
B D        White rhinoceros  atttaagtgtcttgttc-ccaggctag--tttgt----------------------gag-ctcttaaaaa
B D                     Cat  acttaagtgtc-tgttt-tcagggtcg--tttgc--------------------------tccttaagcg
B D                     Dog  atttaagtgcc-tgttt-ctagggtag--tttg-----------------------------cttaagtg
B D                   Panda  atttaagtgtc-tgttt-ccagggtag--tttg-------------------------------------
             Pacific walrus  atttaagtgtc-tgttt-ccagggtag--tttgc--------------------------ttcttaagca
               Weddell seal  atttaaatgtc-tgctt-ccagggtag--tttgc--------------------------tttgtaagca
           Black flying-fox  gtg---------------gccgga------gagt--------------------------ccttcaagga
B D                 Megabat  gtg---------------gccgga------gagc--------------------------ccttcaagga
              Big brown bat  atgtaagcatc-tgaac-tctggattg--tgaat--------------------------tccttaagaa
       David's myotis (bat)  atgtaagtgtc-tgaac-tctggatta--tgcat--------------------------tccttaagaa
B D                Microbat  atgtaagtgtc-tgaac-tctggattg--tgagt--------------------------tccttaagaa
            Star-nosed mole  att----tgtc-tgttt-tcagactagcatgagc--------------------------cccttaagaa
B D                Elephant  ctttaagtgtc-tgtctcccagggtag--ttcat----------------------gagctccataagaa
B D                 Manatee  atttaaatctc-tgtttcccagggtag--tccac----------------------gagctccttaagag
                   Aardvark  attcaggtgtc-cattcatcaaggtgg--cctgt----------------------gagctct------g
B D                     Rat  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Sheep  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D         Chinese hamster  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
B D                Squirrel  ======================================================================
            Bactrian camel  ======================================================================
B D                 Ferret   ======================================================================
          Brush-tailed rat  ======================================================================
B D                     Pig  ======================================================================
          Cape golden mole  ======================================================================
B D                 Wallaby  ======================================================================
  D          Painted turtle  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  taaggactac
                      Chimp  taaggactac
                    Gorilla  taaggactac
                  Orangutan  taaggactgc
                     Gibbon  taaggactgc
                     Rhesus  taaggactac
        Crab-eating macaque  taaggactac
                     Baboon  taaggactac
               Green monkey  taaggactac
                   Marmoset  taaggaacac
            Squirrel monkey  taagcaatac
                   Bushbaby  caaggactgc
         Chinese tree shrew  taaagatttg
     Lesser Egyptian jerboa  aa--------
                      Mouse  aata------
                 Guinea pig  tgcag-----
                     Rabbit  ----------
                       Pika  ----------
                    Dolphin  aggggcctgc
               Killer whale  ----------
                      Horse  tagatcctac
           White rhinoceros  cagagaccac
                        Cat  taga-actac
                        Dog  taaagacttc
                      Panda  ----------
             Pacific walrus  taaagaccac
               Weddell seal  taaagaccac
           Black flying-fox  cggagaccac
                    Megabat  cggagaccac
              Big brown bat  tagagacctt
       David's myotis (bat)  tagaggcctt
                   Microbat  tagagacctt
            Star-nosed mole  taggggctgc
                   Elephant  tagagatcat
                    Manatee  tagacaccaa
                   Aardvark  tagggatcag
                        Rat  ==========
                     Tenrec  ==========
        Cape elephant shrew  ==========
                      Shrew  ==========
                   Hedgehog  ==========
                      Sheep  ==========
              Domestic goat  ==========
                        Cow  ==========
           Tibetan antelope  ==========
             Golden hamster  ==========
               Prairie vole  ==========
            Chinese hamster  ==========
             Naked mole-rat  ==========
                 Chinchilla  ==========
                  Armadillo  ==========
                     Alpaca  ==========
                   Squirrel  ==========
             Bactrian camel  ==========
                    Ferret   ==========
           Brush-tailed rat  ==========
                        Pig  ==========
           Cape golden mole  ==========
                    Wallaby  ==========
             Painted turtle  ==========
            Green seaturtle  ==========
                    Chicken  ==========
                    Opossum  ==========
            Tasmanian devil  ==========

Inserts between block 22 and 23 in window
B D                Dolphin 113bp
              Killer whale 20bp
B D       White rhinoceros 310bp

Alignment block 23 of 58 in window, 30152555 - 30152581, 27 bps 
B D                   Human  agcttctttatatctctatctgtatcc
B D                   Chimp  agcttctttatatctctatctgtatcc
B D                 Gorilla  agcttctttatatctctatctctatcc
B D               Orangutan  agcttctttatatctctatctctatcc
B D                  Gibbon  agcttctttatatctctatctctatcc
B D                  Rhesus  agcttctttacgtctctatctctaacc
B D     Crab-eating macaque  agcttctttacgtctctatctctaacc
B D                  Baboon  agcttctttacatctctatctctaacc
B D            Green monkey  agcttctttatatctctatctctaacc
B D                Marmoset  tgcttctttacatctctcttt----tc
B D         Squirrel monkey  agcttctttacatctctcttt----tc
B D                Bushbaby  agctcctcccgat--------------
         Chinese tree shrew  aa-ttctttatat--------------
     Lesser Egyptian jerboa  -----------------------actc
B D                   Mouse  ----------------------gaccc
B D              Guinea pig  -------------------cttgaccc
B D                 Dolphin  agcgtctttgc----------------
               Killer whale  agcatctttgc----------------
B D                   Horse  agcttcttcat----------------
B D        White rhinoceros  agcttcttcat----------------
B D                     Cat  agtttct--------------------
B D                     Dog  ggcttct--------------------
             Pacific walrus  cg---ct--------------------
               Weddell seal  ag---cc--------------------
           Black flying-fox  ggcttcttcgt----------------
B D                 Megabat  ggcttcttcgt----------------
              Big brown bat  agcttctttgt----------------
       David's myotis (bat)  agcttctttgt----------------
B D                Microbat  agcttctttgt----------------
            Star-nosed mole  agtttcctca-----------------
B D                Elephant  g---tcttcatctctctgtcc------
B D                 Manatee  gtcttcttcatctctccgttc------
                   Aardvark  gacgacatcatctctctgtcc------
B D                     Rat  ===========================
B D                  Tenrec  ===========================
       Cape elephant shrew  ===========================
B D                    Pika  ---------------------------
B D                   Shrew  ===========================
B D                Hedgehog  ===========================
B D                   Sheep  ===========================
             Domestic goat  ===========================
B D                     Cow  ===========================
          Tibetan antelope  ===========================
B D                  Rabbit  ---------------------------
            Golden hamster  ===========================
              Prairie vole  ===========================
B D         Chinese hamster  ===========================
B D          Naked mole-rat  ===========================
                Chinchilla  ===========================
B D               Armadillo  ===========================
B D                  Alpaca  ===========================
B D                Squirrel  ===========================
B D                   Panda  ---------------------------
            Bactrian camel  ===========================
B D                 Ferret   ===========================
          Brush-tailed rat  ===========================
B D                     Pig  ===========================
          Cape golden mole  ===========================
B D                 Wallaby  ===========================
  D          Painted turtle  ===========================
  D         Green seaturtle  ===========================
B D                 Chicken  ===========================
B D                 Opossum  ===========================
B D         Tasmanian devil  ===========================

Alignment block 24 of 58 in window, 30152582 - 30152590, 9 bps 
B D                   Human  tcac----aacat
B D                   Chimp  tcac----aacat
B D                 Gorilla  tcac----aacat
B D               Orangutan  tcac----aacat
B D                  Gibbon  tcac----aacat
B D                  Rhesus  tcgc----aacat
B D     Crab-eating macaque  tcgc----aacat
B D                  Baboon  tcgc----aacat
B D            Green monkey  tcgc----aacat
B D                Marmoset  tcac----aacct
B D         Squirrel monkey  tcac----aacct
B D                Bushbaby  ----------cat
B D                   Mouse  tagg----aa---
B D              Guinea pig  tcac---------
B D                Elephant  tcac----agtgc
B D                 Manatee  tcac----agttc
           Cape golden mole  tcacagtgagtgc
                   Aardvark  tcac----agtgc
B D                     Rat  =============
B D                Microbat  -------------
      David's myotis (bat)  -------------
B D                  Tenrec  =============
       Cape elephant shrew  =============
B D                    Pika  -------------
B D                   Shrew  =============
B D                Hedgehog  =============
    Lesser Egyptian jerboa  -------------
B D                   Sheep  =============
             Domestic goat  =============
B D                     Cow  =============
          Tibetan antelope  =============
B D                  Rabbit  -------------
            Golden hamster  =============
              Prairie vole  =============
B D         Chinese hamster  =============
B D          Naked mole-rat  =============
                Chinchilla  =============
           Star-nosed mole  -------------
             Big brown bat  -------------
B D               Armadillo  =============
B D                  Alpaca  =============
          Black flying-fox  -------------
B D                     Dog  -------------
B D        White rhinoceros  -------------
B D                Squirrel  =============
        Chinese tree shrew  -------------
B D                   Panda  -------------
B D                   Horse  -------------
            Bactrian camel  =============
B D                     Cat  -------------
B D                 Ferret   =============
              Killer whale  -------------
          Brush-tailed rat  =============
            Pacific walrus  -------------
B D                 Dolphin  -------------
              Weddell seal  -------------
B D                     Pig  =============
B D                 Megabat  -------------
B D                 Wallaby  =============
  D          Painted turtle  =============
  D         Green seaturtle  =============
B D                 Chicken  =============
B D                 Opossum  =============
B D         Tasmanian devil  =============

Alignment block 25 of 58 in window, 30152591 - 30152594, 4 bps 
B D                   Human  catc---
B D                   Chimp  catc---
B D                 Gorilla  catc---
B D               Orangutan  catc---
B D                  Gibbon  catc---
B D                  Rhesus  catc---
B D     Crab-eating macaque  catc---
B D                  Baboon  catc---
B D            Green monkey  catc---
B D                Marmoset  cagc---
B D         Squirrel monkey  catc---
B D                Bushbaby  catc---
         Chinese tree shrew  ---c---
     Lesser Egyptian jerboa  -ggc---
B D                   Mouse  -agg---
B D              Guinea pig  -agc---
B D                 Dolphin  -atc---
               Killer whale  -atc---
B D                   Horse  -acc---
B D        White rhinoceros  -aca---
           Black flying-fox  -gtg---
B D                 Megabat  -gtg---
              Big brown bat  -atc---
       David's myotis (bat)  -atc---
B D                Microbat  -atc---
B D                   Shrew  catc---
            Star-nosed mole  catt---
B D                Elephant  ---ctgg
B D                 Manatee  ---atgg
           Cape golden mole  ---tggc
                   Aardvark  ---ctgg
B D                     Rat  =======
B D                  Tenrec  =======
       Cape elephant shrew  =======
B D                    Pika  -------
B D                Hedgehog  =======
B D                   Sheep  =======
             Domestic goat  =======
B D                     Cow  =======
          Tibetan antelope  =======
B D                  Rabbit  -------
            Golden hamster  =======
              Prairie vole  =======
B D         Chinese hamster  =======
B D          Naked mole-rat  =======
                Chinchilla  =======
B D               Armadillo  =======
B D                  Alpaca  =======
B D                     Dog  -------
B D                Squirrel  =======
B D                   Panda  -------
            Bactrian camel  =======
B D                     Cat  -------
B D                 Ferret   =======
          Brush-tailed rat  =======
            Pacific walrus  -------
              Weddell seal  -------
B D                     Pig  =======
B D                 Wallaby  =======
  D          Painted turtle  =======
  D         Green seaturtle  =======
B D                 Chicken  =======
B D                 Opossum  =======
B D         Tasmanian devil  =======

Inserts between block 25 and 26 in window
    Lesser Egyptian jerboa 18bp
B D                  Mouse 24bp
B D             Guinea pig 1bp

Alignment block 26 of 58 in window, 30152595 - 30152596, 2 bps 
B D                   Human  tc
B D                   Chimp  tc
B D                 Gorilla  tc
B D               Orangutan  tc
B D                  Gibbon  tc
B D                  Rhesus  tc
B D     Crab-eating macaque  tc
B D                  Baboon  tc
B D            Green monkey  tc
B D                Marmoset  tc
B D         Squirrel monkey  tt
B D                Bushbaby  ct
         Chinese tree shrew  tc
                 Chinchilla  tt
B D                  Rabbit  tc
B D                    Pika  tc
B D                 Dolphin  cc
               Killer whale  cc
B D                   Horse  tc
B D        White rhinoceros  tc
           Black flying-fox  tc
B D                 Megabat  ac
              Big brown bat  tc
       David's myotis (bat)  tc
B D                Microbat  tc
B D                   Shrew  tc
            Star-nosed mole  tt
B D                Elephant  cc
B D                 Manatee  cc
           Cape golden mole  cc
                   Aardvark  cc
B D                     Rat  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                Hedgehog  ==
    Lesser Egyptian jerboa  ==
B D                   Sheep  ==
             Domestic goat  ==
B D                     Cow  ==
          Tibetan antelope  ==
            Golden hamster  ==
              Prairie vole  ==
B D         Chinese hamster  ==
B D                   Mouse  ==
B D          Naked mole-rat  ==
B D               Armadillo  ==
B D                  Alpaca  ==
B D                     Dog  --
B D                Squirrel  ==
B D                   Panda  --
            Bactrian camel  ==
B D                     Cat  --
B D                 Ferret   ==
B D              Guinea pig  ==
          Brush-tailed rat  ==
            Pacific walrus  --
              Weddell seal  --
B D                     Pig  ==
B D                 Wallaby  ==
  D          Painted turtle  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==

Alignment block 27 of 58 in window, 30152597 - 30152599, 3 bps 
B D                   Human  tat
B D                   Chimp  tat
B D                 Gorilla  tat
B D               Orangutan  caa
B D                  Gibbon  tat
B D                  Rhesus  tat
B D     Crab-eating macaque  tat
B D                  Baboon  tat
B D            Green monkey  tat
B D                Marmoset  tat
B D         Squirrel monkey  tgt
B D                Bushbaby  tat
         Chinese tree shrew  tat
B D                Squirrel  tat
                 Chinchilla  tat
B D                  Rabbit  tgt
B D                    Pika  gct
B D                 Dolphin  tgt
               Killer whale  tgt
B D                   Horse  cat
B D        White rhinoceros  tat
B D                     Cat  --c
B D                     Dog  --t
             Pacific walrus  --t
               Weddell seal  --t
           Black flying-fox  tgt
B D                 Megabat  cgt
              Big brown bat  tct
       David's myotis (bat)  tct
B D                Microbat  tct
B D                   Shrew  tat
            Star-nosed mole  tat
B D                Elephant  cac
B D                 Manatee  cac
           Cape golden mole  cac
                   Aardvark  cac
B D                     Rat  ===
B D                  Tenrec  ===
       Cape elephant shrew  ===
B D                Hedgehog  ===
    Lesser Egyptian jerboa  ===
B D                   Sheep  ===
             Domestic goat  ===
B D                     Cow  ===
          Tibetan antelope  ===
            Golden hamster  ===
              Prairie vole  ===
B D         Chinese hamster  ===
B D                   Mouse  ===
B D          Naked mole-rat  ===
B D               Armadillo  ===
B D                  Alpaca  ===
B D                   Panda  ---
            Bactrian camel  ===
B D                 Ferret   ===
B D              Guinea pig  ===
          Brush-tailed rat  ===
B D                     Pig  ===
B D                 Wallaby  ===
  D          Painted turtle  ===
  D         Green seaturtle  ===
B D                 Chicken  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===

Alignment block 28 of 58 in window, 30152600 - 30152624, 25 bps 
B D                   Human  cctctcaatgccttggtgcatgctc
B D                   Chimp  cctctcaatgccttggtgcatgctt
B D                 Gorilla  cctctcaatgccttggtgcatgctc
B D               Orangutan  cctctcaatgccttggtgcatgctc
B D                  Gibbon  cctctcaatgccttggtgcatgttc
B D                  Rhesus  cctctcaatgcctccgtgcacgttc
B D     Crab-eating macaque  ----------cctccgtgcacgttc
B D                  Baboon  cctctcaatgcctccgtgcacgttc
B D            Green monkey  cctctcaatgcctccgcgcacgttc
B D                Marmoset  cctcacaatgcctcagtgcacattc
B D         Squirrel monkey  cctcacaatacctcagtgcatgttc
B D                Bushbaby  ------gatgcctccagatgtcttg
         Chinese tree shrew  cctcacaatgtctcagtaaatgttg
B D                Squirrel  ccccacaatgcctctgcaaatgtca
     Lesser Egyptian jerboa  cttcacggtgcct-tgcaagtgctg
B D         Chinese hamster  cctcatcatgcct-ggtaaatatca
             Golden hamster  cctcgggatgcct-ggtaaatatca
B D                   Mouse  cctcacagtgcct-agtaaacagtg
B D              Guinea pig  ----------ccttggtaaatgttg
                 Chinchilla  tttcacggtgccttggtaaatgttg
B D                  Rabbit  gctcacaatgcttccgaaaatacag
B D                    Pika  gctcatggtgcttccataaatgcag
B D                 Dolphin  gctcacagtgcctcagtaaatgccg
               Killer whale  gctcacagtgcctcagtaaatgccg
B D                   Horse  cctcacaatgcctcagtcaatgtta
B D        White rhinoceros  cctcacaaagcctcaatcaatgtta
B D                     Cat  cttcgcgatgcctcagtagatgtta
B D                     Dog  cttcatgatgcctcaacaaatgtta
B D                   Panda  cttcacgatgcctcagtagatgtta
             Pacific walrus  cttcacgatgccttaataaatgtta
               Weddell seal  cttcatgatgcctcaataaatgtta
           Black flying-fox  cctcgcgatggcccagcacacgtta
B D                 Megabat  cctcacgatggcccagcacacgtta
              Big brown bat  cctcataatgcctcaacatacatta
       David's myotis (bat)  cctcataatgcctcaacatacatta
B D                Microbat  cctcataatgcctcaacatacatta
B D                   Shrew  gttctc------tcattaaatggca
            Star-nosed mole  cctcacgatgtgtccaaaaatatta
B D                Elephant  ---cagggtctctcagtgaatgatg
B D                 Manatee  ---tacgttctctcaataaatgttg
           Cape golden mole  ---caaaggctctcaataaatgctg
                   Aardvark  ---ccgactctctcaataaataatc
B D                     Rat  =========================
B D                  Tenrec  =========================
       Cape elephant shrew  =========================
B D                Hedgehog  =========================
B D                   Sheep  =========================
             Domestic goat  =========================
B D                     Cow  =========================
          Tibetan antelope  =========================
              Prairie vole  =========================
B D          Naked mole-rat  =========================
B D               Armadillo  =========================
B D                  Alpaca  =========================
            Bactrian camel  =========================
B D                 Ferret   =========================
          Brush-tailed rat  =========================
B D                     Pig  =========================
B D                 Wallaby  =========================
  D          Painted turtle  =========================
  D         Green seaturtle  =========================
B D                 Chicken  =========================
B D                 Opossum  =========================
B D         Tasmanian devil  =========================

Alignment block 29 of 58 in window, 30152625 - 30152635, 11 bps 
B D                   Human  aacggatgaat
B D                   Chimp  aacggatgaat
B D                 Gorilla  aacggatgaat
B D               Orangutan  aatggatgaat
B D                  Gibbon  aacggatgaat
B D                  Rhesus  aacggatgaat
B D     Crab-eating macaque  aacggatgaat
B D                  Baboon  aacggatgaat
B D            Green monkey  aacagatgaat
B D                Marmoset  aatggatgaat
B D         Squirrel monkey  aatggatgaat
B D                Bushbaby  gacagatggac
         Chinese tree shrew  gatgtgtgaat
B D                Squirrel  tgcaggtgata
     Lesser Egyptian jerboa  gacgggtaact
B D         Chinese hamster  gatgggtgatt
             Golden hamster  aatgggtgatt
B D                   Mouse  ggtgggtgact
B D          Naked mole-rat  aaaagaaaaaa
B D              Guinea pig  gatagatggac
                 Chinchilla  gacagatggat
B D                  Rabbit  ggtgggccg--
B D                    Pika  gatggggcc--
B D                 Dolphin  ga---------
               Killer whale  ga---------
B D                   Horse  gataaacagat
B D        White rhinoceros  gatgaatggat
B D                     Cat  ggcgattggac
B D                     Dog  gatgaatagac
B D                   Panda  gacaaacggac
             Pacific walrus  gatgaatggac
               Weddell seal  ggtgaatggac
           Black flying-fox  ggggagtgggc
B D                 Megabat  ggggagtgggc
              Big brown bat  gaggagtgggt
       David's myotis (bat)  gaggagtgggt
B D                Microbat  gaggagcgggt
B D                   Shrew  gatgaatgaat
            Star-nosed mole  ggtgaatgaat
B D                Elephant  gttgaatgaat
B D                 Manatee  gctgaatgaat
           Cape golden mole  gccgaatgaac
                   Aardvark  ggcgaatgaat
B D                     Rat  ===========
B D                  Tenrec  ===========
       Cape elephant shrew  ===========
B D                Hedgehog  ===========
B D                   Sheep  ===========
             Domestic goat  ===========
B D                     Cow  ===========
          Tibetan antelope  ===========
              Prairie vole  ===========
B D               Armadillo  ===========
B D                  Alpaca  ===========
            Bactrian camel  ===========
B D                 Ferret   ===========
          Brush-tailed rat  ===========
B D                     Pig  ===========
B D                 Wallaby  ===========
  D          Painted turtle  ===========
  D         Green seaturtle  ===========
B D                 Chicken  ===========
B D                 Opossum  ===========
B D         Tasmanian devil  ===========

Inserts between block 29 and 30 in window
B D             Guinea pig 1bp
                Chinchilla 1bp

Alignment block 30 of 58 in window, 30152636 - 30152637, 2 bps 
B D                   Human  gg
B D                   Chimp  gg
B D                 Gorilla  gg
B D               Orangutan  gg
B D                  Gibbon  gg
B D                  Rhesus  gg
B D     Crab-eating macaque  gg
B D                  Baboon  gg
B D            Green monkey  gg
B D                Marmoset  gg
B D         Squirrel monkey  gg
B D                Bushbaby  -t
         Chinese tree shrew  tg
B D                Squirrel  tg
     Lesser Egyptian jerboa  ga
B D         Chinese hamster  gg
             Golden hamster  gg
B D                   Mouse  ga
B D          Naked mole-rat  gg
B D              Guinea pig  -g
                 Chinchilla  -g
           Brush-tailed rat  -g
B D                  Rabbit  gg
B D                    Pika  tg
B D                   Horse  tg
B D        White rhinoceros  tg
B D                     Cat  tg
B D                     Dog  tg
B D                   Panda  tg
             Pacific walrus  tg
               Weddell seal  tg
           Black flying-fox  gg
B D                 Megabat  gg
              Big brown bat  tg
       David's myotis (bat)  tg
B D                Microbat  tg
B D                   Shrew  ta
            Star-nosed mole  ta
B D                Elephant  tg
B D                 Manatee  tg
           Cape golden mole  tg
                   Aardvark  tg
B D                     Rat  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                Hedgehog  ==
B D                   Sheep  ==
             Domestic goat  ==
B D                     Cow  ==
          Tibetan antelope  ==
              Prairie vole  ==
B D               Armadillo  ==
B D                  Alpaca  ==
            Bactrian camel  ==
B D                 Ferret   ==
              Killer whale  --
B D                 Dolphin  --
B D                     Pig  ==
B D                 Wallaby  ==
  D          Painted turtle  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==

Inserts between block 30 and 31 in window
                Chinchilla 3654bp
          Brush-tailed rat 1bp

Alignment block 31 of 58 in window, 30152638 - 30152641, 4 bps 
B D                   Human  a-aag
B D                   Chimp  a-aag
B D                 Gorilla  a-aag
B D               Orangutan  a-aag
B D                  Gibbon  a-aag
B D                  Rhesus  a-aag
B D     Crab-eating macaque  a-aag
B D                  Baboon  a-aag
B D            Green monkey  a-aag
B D                Marmoset  a-aag
B D         Squirrel monkey  a-aag
B D                Bushbaby  a-aag
         Chinese tree shrew  a-aag
B D                Squirrel  a-aag
     Lesser Egyptian jerboa  a-agg
B D         Chinese hamster  a-aag
             Golden hamster  a-aag
B D                   Mouse  a-agg
B D          Naked mole-rat  a-aaa
B D              Guinea pig  a-aaa
                 Chinchilla  a-aag
           Brush-tailed rat  a-aag
B D                  Rabbit  a-aag
B D                    Pika  a-aag
B D                 Dolphin  --aga
               Killer whale  --aga
B D                   Horse  a-aag
B D        White rhinoceros  a-aag
B D                     Cat  a-aag
B D                     Dog  a-aag
B D                   Panda  a-aag
             Pacific walrus  a-aag
               Weddell seal  a-aag
           Black flying-fox  --ggg
B D                 Megabat  --ggg
              Big brown bat  acagg
       David's myotis (bat)  atagg
B D                Microbat  acagg
B D                   Shrew  a-agg
            Star-nosed mole  a-aga
B D                Elephant  a-aag
B D                 Manatee  a-aag
           Cape golden mole  a-aag
                   Aardvark  a-aag
B D                     Rat  =====
B D                  Tenrec  =====
       Cape elephant shrew  =====
B D                Hedgehog  =====
B D                   Sheep  =====
             Domestic goat  =====
B D                     Cow  =====
          Tibetan antelope  =====
              Prairie vole  =====
B D               Armadillo  =====
B D                  Alpaca  =====
            Bactrian camel  =====
B D                 Ferret   =====
B D                     Pig  =====
B D                 Wallaby  =====
  D          Painted turtle  =====
  D         Green seaturtle  =====
B D                 Chicken  =====
B D                 Opossum  =====
B D         Tasmanian devil  =====

Inserts between block 31 and 32 in window
B D             Guinea pig 3790bp

Alignment block 32 of 58 in window, 30152642 - 30152784, 143 bps 
B D                   Human  actgga------tgctcttcagcaggga------------cct-------------a-----cagtttct
B D                   Chimp  actgga------tgctcttcagcaggga------------cct-------------a-----cagtttct
B D                 Gorilla  actgga------tgctcttcggcaggga------------cct-------------a-----cagtttct
B D               Orangutan  attgga------tgctctttggcaggga------------cct-------------a-----cagtttct
B D                  Gibbon  attgga------tgctctttggcaggga------------cct-------------a-----cagtttct
B D                  Rhesus  attgga------ggctctttggcagcga------------cct-------------a-----cagtttct
B D     Crab-eating macaque  attgga------ggctctttggcagcga------------cct-------------a-----cagtttct
B D                  Baboon  actgga------ggctctttggcagcga------------cct-------------a-----cagtttct
B D            Green monkey  attgga------tgctctttggcagcga------------cct-------------a-----cagtttct
B D                Marmoset  actgca------tgctctttggcaaaga------------cct-------------a-----aggtttct
B D         Squirrel monkey  actgga------tgctctctggcaaaga------------cct-------------a-----cggtttct
B D                Bushbaby  actgga------tgtcctttggcaagaagtgacagtttcccctttggcaagaagtga-----cagtttcc
         Chinese tree shrew  atcaga--------cttttgggaaagga------------act--------------------agcttct
B D                Squirrel  attgga------tgttctctagca--ag------------agc-------------c---tctagtttct
     Lesser Egyptian jerboa  -tcggg------tgattgttagcaacaa------------act-------------a---tatacttgct
B D         Chinese hamster  atcagactttgattttccttag----aa------------gca-------------a---tgtaatatat
             Golden hamster  atcagacttttattttcctta-----aa------------gga-------------a---tgtaatatcc
B D                   Mouse  atcatgctttt-tgttctttag---taa------------ggc-------------a---ggtgacgcct
B D          Naked mole-rat  --aagat-----tgtttctcagcaagaa------------aca-------------a-----tggtttct
B D              Guinea pig  attaga------tgctcgttagtgaaga------------aca-------------a-------gtttct
                 Chinchilla  attaga------tgctcctcagcaagga------------aca-------------a-------gtttct
           Brush-tailed rat  attaga------tgctccttagcaagga------------aca-------------a-------gtttcc
B D                  Rabbit  a--------------------------------------------------------------------t
B D                    Pika  atcag-------ctcttctttgcaagga------------act-------------a--------caggt
B D                 Dolphin  aatgaa------cgtcacctcacatctc------------act-------------ttcgtacagtttcc
               Killer whale  aatgaa------cgtcacctcacatctc------------act-------------ttcgtacagtttcc
B D                   Horse  attgaa------tgttggctggtgagga------------aag-------------t----acagtttct
B D        White rhinoceros  attgaa------cattgtctggcaagga------------aag-------------t----acagtttct
B D                     Cat  attcaa------tgttgtctggcgagga------------caa-------------ttt-gtcggtttct
B D                     Dog  aataag------tgttgtctggaaagga------------aag-------------ttt-tccagtttct
B D                   Panda  agtaaa------tgttgttgggcaagga------------aag-------------ttt-tccagtttct
             Pacific walrus  attaaa------tgttgtctggcaagga------------aag-------------ttt-tccagtttct
               Weddell seal  attaaa------tgttgtctggcaagga------------aag-------------ttt-tccagtttct
           Black flying-fox  gctgag------tgccgtctggcgaggg------------ag------------------------tctc
B D                 Megabat  gctgag------tgccgtctggcgaggg------------ag------------------------tctc
              Big brown bat  ttggat------tgttgtctggcaagga------------aag-------------t----acagtcccc
       David's myotis (bat)  ttggat------tgttgtctggcaagga------------aag-------------t----ccagtcccc
B D                Microbat  ttggat------tgttgtctggcaagga------------aag-------------t----ctagtcccc
B D                   Shrew  tgtt--------ggttgtcag-ccagta------------aac-------------a----ac--tttct
            Star-nosed mole  ttgtaa------gtttgtctgaccagga------------aac-------------t----atagcttct
B D                Elephant  attgaa------cagtgtttgaaaagaa------------aag-------------t----ccactttcc
B D                 Manatee  actgaa------tggtgtttggcaagac------------aat-------------t----ccactttcc
           Cape golden mole  attcaa------cg--------------------------------------------------------
                   Aardvark  agcgaa------cggtgtttggcaagaa------------aag-------------t----cctcttccc
B D                     Rat  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Sheep  ======================================================================
             Domestic goat  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
              Prairie vole  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
            Bactrian camel  ======================================================================
B D                 Ferret   ======================================================================
B D                     Pig  ======================================================================
B D                 Wallaby  ======================================================================
  D          Painted turtle  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
                      Chimp  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
                    Gorilla  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
                  Orangutan  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaagctccagaatc
                     Gibbon  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
                     Rhesus  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
        Crab-eating macaque  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
                     Baboon  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
               Green monkey  acttcatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------c
                   Marmoset  cccccatccctgagttctaatgagccaaag-------ccc-aggcag----ctccagaag---------t
            Squirrel monkey  cccccatccctgagttctaatgagccaaag-------ccc-gggcag----ctccagaag---------t
                   Bushbaby  actttgtccctgtgttctcatgggctggag-------ccc-acacag----gtgcagaac---------c
         Chinese tree shrew  actttgttcctgagttctgtagagccaaag-------ccc-atgata----ttcca-aac---------c
                   Squirrel  gctttgttcctgagatctaatgagccgaag-------gct-gtgcaa----attcagaac---------c
     Lesser Egyptian jerboa  gcttggttcctgaggtgggctaagccaaga-------cct-ccgcag-------caggat---------c
            Chinese hamster  atggtgttcctgaggtgtaaggagccaaag-------cct-ctgcag----gttcagaac---------c
             Golden hamster  gtgttgttcctgaggcataaggagccaaaa-------cctgttgtag----gttcagaac---------c
                      Mouse  gctttgtcccc----------------acg-------cct-atgcag----atccagaac---------c
             Naked mole-rat  actttgtttctgaggtctaatgagccaaaa-------ccc-acgcag----attcacaac---------c
                 Guinea pig  agtttgttcctgaggtctaatgagccaa-----------------ag----attcacaac---------t
                 Chinchilla  agtttgttcctcaggtctaatgagccaaag-------gcc-attcag----attcacaac---------t
           Brush-tailed rat  agttattt--tgaggtctaatgagccaaag-------gtc-atgcag----attcacgac---------t
                     Rabbit  tcctcggccctgagttctaacaaaccaaag-------acc-ctgaga----tgccc-aag---------t
                       Pika  tccttgttgctgagttctaatgagctgaag-------ccc-atgaag----agtca--------------
                    Dolphin  actttgtccccgagttctaaccagtgaaag-------ccc-aggaac----attcagagc---------c
               Killer whale  actttgtccccgagttctaaccagtgaaag-------ccc-aggaac----attcagagc---------c
                      Horse  actttgtccctgagttctaatgagccgacg-------tcc-acacag----atccagaac---------c
           White rhinoceros  actttgtctctgagttctaatgaagagaag-------ccc-atgcag----attcagaac---------c
                        Cat  gctttgtccctgagtcctaacaggcggaag-------ccc-agacgg----attcagaac---------c
                        Dog  actttgtctctgagttctcatgagctgaag-------ccc-aggcag----attcagaac---------c
                      Panda  acgtcatcccggcattctaacgagctgaag-------ccc-aggcag----attcagaac---------c
             Pacific walrus  actttgtccccaagttataatgagctaaag-------ccc-aggcag----attcagaac---------c
               Weddell seal  actttgtccccgagttataatgagctgaag-------ccc-aggcag----attcagaac---------c
           Black flying-fox  accgtgtc-cagagttctgacgggccgagg-------tct-acg--------------------------
                    Megabat  accgtgtc-cagagttctgacgggccgagg-------tcc-acg--------------------------
              Big brown bat  actttatc-cagcgttctaacaagccaa-a-------tcc-atg--------------------------
       David's myotis (bat)  actttatc-cagcgtcctaacaagccga-g-------tcc-atg--------------------------
                   Microbat  actttatc-cagcgttctaacaagccga-g-------tcc-atg--------------------------
                      Shrew  cctttgtccctgagttcgattgagccaacg-------tcc-aggcaga---attcagaa----------c
            Star-nosed mole  gctttgtccctgagttctaataagccaaagattcaaaacc-atgcagatgcatgcagaat---------t
                   Elephant  acattgtccctgagttctaatgatcccaag-------ccc-gtgcag----atttgaaac---------a
                    Manatee  ctgttgtcactgagttctaatgatctgaag-------cct-acgcag----atttggaac---------c
           Cape golden mole  ----tgtcactgggttctaatgatccgaat-------ccc-aggcag----atacttaac---------c
                   Aardvark  gctttgccactgagttctaatgatatgaag-------ccc-aagcgt----atttggaac---------c
                        Rat  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Sheep  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
               Prairie vole  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
                    Ferret   ======================================================================
                        Pig  ======================================================================
                    Wallaby  ======================================================================
             Painted turtle  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  tccagtg-tttgacacgcaaccccacac-a--gg-cggaggt-------tctag-agct----------g
                      Chimp  tccagtg-tttgacacgcaaccccacac-a--gg-cggaggt-------tctag-agct----------g
                    Gorilla  tccagtg-tttgacacgcaaccccacac-a--ga-cggaggt-------tctag-agct----------c
                  Orangutan  tccagtg-tttgacacacagccccacac-a--gg-cggaggt-------tctag-aggt----------g
                     Gibbon  tccagtg-tttgacacacagccccacac-a--gg-cggaggt-------tctag-agct----------g
                     Rhesus  tccagtg-tttgacatacagccccacac-a--gg-tggaggt-------tctag-agct----------g
        Crab-eating macaque  tccagtg-tttgacatacagccccacac-a--gg-tggaggt-------tctag-agct----------g
                     Baboon  tccagtg-tttgacgtacagccccacac-a--gg-cggaggt-------tctag-agct----------g
               Green monkey  tccagtg-tttgacacacagccccacac-a--gg-cggaggt-------tctag-agct----------g
                   Marmoset  ttcagtg-tttgacacacagccccacac-a--gg-cagaggt-------tctag-agct----------g
            Squirrel monkey  tccagtg-tttgacacacagccctacac-a--gg-cggaggt-------tctag-agct----------g
                   Bushbaby  tccagca-tttaacacacaactccaccc-a--ggacggaggt-------tc-ag-acct----------g
         Chinese tree shrew  tcaggat-cccaacacacagtttgacacaa--gg-tagaggt-------ttttgaagct----------a
                   Squirrel  tcaagga-cccaacacacagcacgacac-aa-gg-cagaggt-------gaggg-aggt----------a
     Lesser Egyptian jerboa  tcaatag-tccagcacacagcccaacac-aa-ca-ca--------------tgg-acta----------g
            Chinese hamster  tcagtgg-ccccataggctgtctgatat-ga-gg-tg-tggg-------tttgg-agta----------a
             Golden hamster  tcatgggcccccatacactgtctgaaac-gg-gg-tg-tgtg-------tttgg-agtg----------a
                      Mouse  tcactgg-ctcaactca--gtttgacac-aa-gg-ttctggt-------tttgg-actg----------a
             Naked mole-rat  tcaagag-tccaacaggcagcctgacat-aa-ga-tggacag-------tttgg-agct----------a
                 Guinea pig  tggagag-accaacaggcagcctgactt-aa-gg-tggaaag-------ttagg-agct----------a
                 Chinchilla  tcaaggg-tccaacaggcaaagtgacat-ac-gg-tggaaaa-------ttagg-agct----------a
           Brush-tailed rat  ttagggg-tccaacaggca-------gc-at-gg-tacaaaa-------ttagg-agct----------a
                     Rabbit  tcaaggg-ccccacacacagcttggtgc-ag-ag-tggcagt-------ctggg-agct----------g
                       Pika  tccagag-tcccacacacagcttgatgc-agaag-tggccgt-------cttgc-aggt----------g
                    Dolphin  tcaaagg-tcc--aacacagctcaacac-ag-gg-cagaggt-------gt-gg-agct----------g
               Killer whale  tcaaagg-tcc--aacacggctcaacac-ag-gg-cagaggt-------gt-gg-agct----------g
                      Horse  tcaa-gg-tgtgacacacagtgtgacac-ag-gg-cggcagc-------tt-gg-agct----------g
           White rhinoceros  tcaaggg-tccaacacacagtttgacac-ag-gg-cggaagt-------tt-gg-agct----------g
                        Cat  tcaa-gg-gtcgacacacagctcaacgc-ag-gg-cagacgt-------ct-gc-agctggaggggtggg
                        Dog  tcaa-ga-gtcgacacacagctcaacac-ag-gg-cagaagt-------ct-gg-agct----------g
                      Panda  ccaa-ga-gtcaacacacagctcaacac-ag-gg--ggaggt-------ct-gg-agct----------g
             Pacific walrus  tcaa-ga-gtcaacacacagctcaacac-ag-gg--ggaggt-------ct-gg-agct----------g
               Weddell seal  tcaa-ga-gtcaacacacagctcaacac-ag-gg--ggaggt-------ct-gg-agct----------g
           Black flying-fox  -------------cacacagcccgagac-g-------caggt-------cc--g-agct----------g
                    Megabat  -------------cacacagcccgagac-g-------caggt-------cc--g-agca----------g
              Big brown bat  -------------cactcagcccgagtc-tg-gg--tgaggc-------tt--c-agct----------g
       David's myotis (bat)  -------------cactcagcccgagac-t--gg--cgaggc-------tt--c-agct----------g
                   Microbat  -------------cactcagcccgagac-t--gg--tgaggc-------tt--c-agct----------g
                      Shrew  cgaagtc-tccaccacacagccgcatac-ag-gg-cggaggtgttggagct----gggt----------g
            Star-nosed mole  ttaaaag-tccagtgcgcagctggacac-a--ga-cagaagc-------ct----ggca----------c
                   Elephant  tcaaaga-tccaacacatagaaaggcac-aa-gg-tggaggt-------tttgg-aact----------t
                    Manatee  gcaaggg-tccaacacacagaaaggcac-ag-ag-tggaggt-------tttag-agtt----------t
           Cape golden mole  ttgaggg-tccaacacacggggaggcac-ag-gg-aggaggc-------tttgg-agca----------t
                   Aardvark  tccaggg-tccaacacacgggaaggcat-gg-gg-t--aggt-------ccggg-aggt----------t
                        Rat  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                   Hedgehog  ======================================================================
                      Sheep  ======================================================================
              Domestic goat  ======================================================================
                        Cow  ======================================================================
           Tibetan antelope  ======================================================================
               Prairie vole  ======================================================================
                  Armadillo  ======================================================================
                     Alpaca  ======================================================================
             Bactrian camel  ======================================================================
                    Ferret   ======================================================================
                        Pig  ======================================================================
                    Wallaby  ======================================================================
             Painted turtle  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================

                      Human  tatggg---tatggat
                      Chimp  tatggg---tatggat
                    Gorilla  tatggg---tatggat
                  Orangutan  catggg---tatggat
                     Gibbon  tatggg---tacggat
                     Rhesus  tatggg---catggat
        Crab-eating macaque  tatggg---catggat
                     Baboon  tatggg---catggat
               Green monkey  tatggg---catggat
                   Marmoset  cgtggg---tgtggat
            Squirrel monkey  tgtggg---tgtggat
                   Bushbaby  c-----------ggat
         Chinese tree shrew  gctggg---catggat
                   Squirrel  ggtgag---cttggat
     Lesser Egyptian jerboa  agtgta---cctgg-t
            Chinese hamster  gatgca---tgtgg-t
             Golden hamster  gatgca---tgtgg-t
                      Mouse  gat-------------
             Naked mole-rat  gttggg---catggat
                 Guinea pig  agtggg---caccaaa
                 Chinchilla  gatggg---cacggat
           Brush-tailed rat  gtgggg---cacaggt
                     Rabbit  gatgca---cctggat
                       Pika  tgcaca---cctgggc
                    Dolphin  agcggg---cgtggat
               Killer whale  agcggg---cgtggat
                      Horse  ggtggg---catggcc
           White rhinoceros  ggtggg---catggct
                        Cat  ggggga---catggat
                        Dog  ggtggc---catggat
                      Panda  gggggc---catgga-
             Pacific walrus  gggggc---catggag
               Weddell seal  gggggc---catggag
           Black flying-fox  ggtggg---cctgggg
                    Megabat  ggtgga---cgtgcgg
              Big brown bat  ggtgag---tgtgggt
       David's myotis (bat)  ggtgag---tgtggga
                   Microbat  ggtgag---tgtgggt
                      Shrew  ggcttg---cgtgga-
            Star-nosed mole  ggtagg---catggat
                   Elephant  aaaggg---catggag
                    Manatee  ggtgggtgtcatggat
           Cape golden mole  ggtggg---cctgcag
                   Aardvark  ggctga---catggag
                        Rat  ================
                     Tenrec  ================
        Cape elephant shrew  ================
                   Hedgehog  ================
                      Sheep  ================
              Domestic goat  ================
                        Cow  ================
           Tibetan antelope  ================
               Prairie vole  ================
                  Armadillo  ================
                     Alpaca  ================
             Bactrian camel  ================
                    Ferret   ================
                        Pig  ================
                    Wallaby  ================
             Painted turtle  ================
            Green seaturtle  ================
                    Chicken  ================
                    Opossum  ================
            Tasmanian devil  ================

Inserts between block 32 and 33 in window
B D                Manatee 1490bp

Alignment block 33 of 58 in window, 30152785 - 30152786, 2 bps 
B D                   Human  gc
B D                   Chimp  gc
B D                 Gorilla  gc
B D               Orangutan  gc
B D                  Gibbon  gc
B D                  Rhesus  ac
B D     Crab-eating macaque  ac
B D                  Baboon  ac
B D            Green monkey  gc
B D                Marmoset  gc
B D         Squirrel monkey  gc
B D                Bushbaby  gg
         Chinese tree shrew  gc
B D                Squirrel  gt
     Lesser Egyptian jerboa  gt
B D         Chinese hamster  gt
             Golden hamster  gt
B D          Naked mole-rat  gt
B D              Guinea pig  gt
                 Chinchilla  gt
           Brush-tailed rat  gt
B D                  Rabbit  gc
B D                    Pika  ac
B D                 Dolphin  gt
               Killer whale  gt
B D                   Horse  tc
B D        White rhinoceros  gc
B D                     Cat  ga
B D                     Dog  gc
B D                   Panda  gc
             Pacific walrus  gc
               Weddell seal  gc
           Black flying-fox  a-
B D                 Megabat  a-
              Big brown bat  ac
       David's myotis (bat)  ac
B D                Microbat  ac
            Star-nosed mole  at
B D                Elephant  gc
           Cape golden mole  gc
                   Aardvark  gc
B D                     Rat  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                   Shrew  --
B D                Hedgehog  ==
B D                   Sheep  ==
             Domestic goat  ==
B D                     Cow  ==
          Tibetan antelope  ==
              Prairie vole  ==
B D                   Mouse  --
B D               Armadillo  ==
B D                  Alpaca  ==
B D                 Manatee  ==
            Bactrian camel  ==
B D                 Ferret   ==
B D                     Pig  ==
B D                 Wallaby  ==
  D          Painted turtle  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==

Inserts between block 33 and 34 in window
B D               Elephant 2bp
          Cape golden mole 1548bp
                  Aardvark 1bp

Alignment block 34 of 58 in window, 30152787 - 30152809, 23 bps 
B D                   Human  ag------ct-ccagaagtctg----cagcct---tc
B D                   Chimp  ag------ct-ccagaagtctg----cagcct---gc
B D                 Gorilla  ag------ct-ccagaagtctg----cagcct---gc
B D               Orangutan  ag------ct-ccagaggtctg----cagcct---gc
B D                  Gibbon  ag------ct-ccaggggtctg----cagcct---gc
B D                  Rhesus  ag------ct-ccaggggtctg----cagcct---gc
B D     Crab-eating macaque  ag------ct-ccaggggtctg----cagcct---gc
B D                  Baboon  ag------ct-ccaggggtccg----cagcct---gc
B D            Green monkey  ag------ct-ccaggggtccg----cagcct---gc
B D                Marmoset  gg------ct-ccaggggtctg----cagcct---gc
B D         Squirrel monkey  gg------ct-ccaggggtctg----cagcct---gc
B D                Bushbaby  gac----cct-ccaggagtctg----ctgcca---ac
         Chinese tree shrew  tac----cct-ccagggaccag----cagcca---at
B D                Squirrel  ga-----ccc-ttggggctctg----catcca---ac
     Lesser Egyptian jerboa  gg-----cac-tggctg--ctg----cacccc---at
B D         Chinese hamster  gg-----ccc-tcatta--tga----cagcct---at
             Golden hamster  gg-----cct-tcatta--cga----cagccc---at
B D                   Mouse  ---------------------a----cggccc---at
B D          Naked mole-rat  gac----cca-tcagggatgta----catctg---ac
B D              Guinea pig  ga-----cca-ccagcaatgtg----catctg---ac
                 Chinchilla  gac----cca-ccaggggcgtg----catctg---ac
           Brush-tailed rat  gac----cca-ccagggatgcc----cggctg---ac
B D                  Rabbit  agc----ccc-ctcaggatttg----caacca---ag
B D                    Pika  agc----ccctctggggatatgttgtcaaccagccag
B D                 Dolphin  gac----cct-gcagggatctg----ccagca---cc
               Killer whale  gac----cct-gcagggatctg----ccagca---cc
B D                   Horse  gac----cct-gcggggatctg----cagcct---ag
B D        White rhinoceros  aa-----cct-gcaggaatcta----cagcct---ac
B D                     Cat  aaccc------agaagtgtctg----cagccg---ac
B D                     Dog  accccaccct-gaaggtgtctg----cagcca---ac
B D                   Panda  caccccacct-gcaggtgtctg----cagaca---ac
             Pacific walrus  aacgctccgt-gcaggtgtctg----cagcca---ac
               Weddell seal  aacgccccct-gcaggtgtctg----cagcca---ac
           Black flying-fox  --------ct-gcagggaccag----gac--------
B D                 Megabat  --------ct-gcagggaccag----gac--------
              Big brown bat  aac----cct-ccagggacctg----cag--------
       David's myotis (bat)  aac----cct-gcaggcacctg----cag--------
B D                Microbat  aac----cct-gcaggcacctg----cag--------
B D                   Shrew  gcc----cct-gccgggatctg----caacca---g-
            Star-nosed mole  gat----cct-ccagggacctg----aagcaa---c-
B D                Elephant  ------ctcc-actgggatctg----tagtaa---ac
                   Aardvark  ------ggct-gctgggatctg----cagccg---ac
B D                     Rat  =====================================
B D                  Tenrec  =====================================
       Cape elephant shrew  =====================================
B D                Hedgehog  =====================================
B D                   Sheep  =====================================
             Domestic goat  =====================================
B D                     Cow  =====================================
          Tibetan antelope  =====================================
              Prairie vole  =====================================
B D               Armadillo  =====================================
B D                  Alpaca  =====================================
B D                 Manatee  =====================================
            Bactrian camel  =====================================
B D                 Ferret   =====================================
B D                     Pig  =====================================
          Cape golden mole  =====================================
B D                 Wallaby  =====================================
  D          Painted turtle  =====================================
  D         Green seaturtle  =====================================
B D                 Chicken  =====================================
B D                 Opossum  =====================================
B D         Tasmanian devil  =====================================

Alignment block 35 of 58 in window, 30152810 - 30152814, 5 bps 
B D                   Human  cagga
B D                   Chimp  cagga
B D                 Gorilla  cagga
B D               Orangutan  cagga
B D                  Gibbon  cagga
B D                  Rhesus  cagga
B D     Crab-eating macaque  cagga
B D                  Baboon  cagga
B D            Green monkey  cagga
B D                Marmoset  caaga
B D         Squirrel monkey  caaga
B D                Bushbaby  --aga
         Chinese tree shrew  -agga
B D                Squirrel  cagcc
     Lesser Egyptian jerboa  gggca
B D         Chinese hamster  gagca
             Golden hamster  gagca
B D                   Mouse  gaaca
B D          Naked mole-rat  cagca
B D              Guinea pig  cagca
                 Chinchilla  cagca
           Brush-tailed rat  cagc-
B D                  Rabbit  aagca
B D                    Pika  gggca
B D                 Dolphin  cagca
               Killer whale  cagca
B D                     Cow  cagga
B D                   Horse  cggga
B D        White rhinoceros  cagga
B D                     Cat  caaga
B D                     Dog  cagga
B D                   Panda  ccgga
             Pacific walrus  cagga
               Weddell seal  cagga
B D                   Shrew  ccaaa
            Star-nosed mole  cagga
B D                Elephant  cagga
                   Aardvark  cagga
B D                     Rat  =====
B D                Microbat  -----
      David's myotis (bat)  -----
B D                  Tenrec  =====
       Cape elephant shrew  =====
B D                Hedgehog  =====
B D                   Sheep  =====
             Domestic goat  =====
          Tibetan antelope  =====
              Prairie vole  =====
             Big brown bat  -----
B D               Armadillo  =====
B D                  Alpaca  =====
          Black flying-fox  -----
B D                 Manatee  =====
            Bactrian camel  =====
B D                 Ferret   =====
B D                     Pig  =====
          Cape golden mole  =====
B D                 Megabat  -----
B D                 Wallaby  =====
  D          Painted turtle  =====
  D         Green seaturtle  =====
B D                 Chicken  =====
B D                 Opossum  =====
B D         Tasmanian devil  =====

Inserts between block 35 and 36 in window
B D               Elephant 918bp

Alignment block 36 of 58 in window, 30152815 - 30152819, 5 bps 
B D                   Human  gg---g-gg
B D                   Chimp  gg---g-gg
B D                 Gorilla  gg---g-gg
B D               Orangutan  gg---g-gg
B D                  Gibbon  gg---g-gg
B D                  Rhesus  gg---g-gg
B D     Crab-eating macaque  gg---g-gg
B D                  Baboon  gg---g-gg
B D            Green monkey  gg---g-gg
B D                Marmoset  gg---g-gc
B D         Squirrel monkey  ga---g-gg
B D                Bushbaby  aa---g-gg
         Chinese tree shrew  ag---t-gg
B D                Squirrel  ag---acgc
     Lesser Egyptian jerboa  gg---g-gt
B D         Chinese hamster  ag---g-ga
             Golden hamster  ag---g-ga
B D                   Mouse  ac---a-ga
B D          Naked mole-rat  ag---g-gg
B D              Guinea pig  aa---g-ag
                 Chinchilla  ag---g-gg
           Brush-tailed rat  ag---g-gg
B D                  Rabbit  ggc--g-gg
B D                    Pika  a----g-gg
B D                 Dolphin  a----g-gg
               Killer whale  a----g-gg
B D                     Cow  a----g-gg
B D                   Horse  ag---g-ag
B D        White rhinoceros  ag---g-ag
B D                     Cat  ag---g-gg
B D                     Dog  ag---g-gg
B D                   Panda  a----g-gg
             Pacific walrus  ag---g-gg
               Weddell seal  ag---g-gg
           Black flying-fox  -----g-gg
B D                 Megabat  -----g-gg
              Big brown bat  -----a-aa
       David's myotis (bat)  -----g-aa
B D                Microbat  -----g-aa
B D                   Shrew  aa---g-ga
            Star-nosed mole  ag---g-gc
                   Aardvark  --cgtg-g-
B D                     Rat  =========
B D                  Tenrec  =========
       Cape elephant shrew  =========
B D                Hedgehog  =========
B D                   Sheep  =========
             Domestic goat  =========
          Tibetan antelope  =========
              Prairie vole  =========
B D                Elephant  =========
B D               Armadillo  =========
B D                  Alpaca  =========
B D                 Manatee  =========
            Bactrian camel  =========
B D                 Ferret   =========
B D                     Pig  =========
          Cape golden mole  =========
B D                 Wallaby  =========
  D          Painted turtle  =========
  D         Green seaturtle  =========
B D                 Chicken  =========
B D                 Opossum  =========
B D         Tasmanian devil  =========

Inserts between block 36 and 37 in window
                  Aardvark 3655bp

Alignment block 37 of 58 in window, 30152820 - 30152825, 6 bps 
B D                   Human  gcgt-ga
B D                   Chimp  gcgt-ga
B D                 Gorilla  gcgt-ga
B D               Orangutan  gcgt-ga
B D                  Gibbon  gcgt-ga
B D                  Rhesus  gtgt-ga
B D     Crab-eating macaque  gtgt-ga
B D                  Baboon  gcgt-ga
B D            Green monkey  acgt-ga
B D                Marmoset  gcat-ga
B D         Squirrel monkey  gcgt-ga
B D                Bushbaby  gtgg-tt
         Chinese tree shrew  ttat-ta
B D                Squirrel  ccat--a
     Lesser Egyptian jerboa  tctt--a
B D         Chinese hamster  ccct--a
             Golden hamster  tctt--a
B D                   Mouse  cctt--a
B D          Naked mole-rat  ccac-ga
B D              Guinea pig  ccgt-ga
                 Chinchilla  ccat-ga
           Brush-tailed rat  ccgt-ga
B D                  Rabbit  cact--g
B D                    Pika  tact--g
B D                 Dolphin  ccac-ta
               Killer whale  ccac-ta
B D                     Cow  tcgt-ta
B D                   Horse  ccat---
B D        White rhinoceros  ccac-ga
B D                     Cat  ccac-tg
B D                     Dog  ccac-ca
B D                   Panda  ccac-tg
             Pacific walrus  ccac-tg
               Weddell seal  ccac-tg
           Black flying-fox  ccag-ca
B D                 Megabat  ccag-ca
              Big brown bat  ccagacg
       David's myotis (bat)  ccagacg
B D                Microbat  ccagacg
B D                   Shrew  gcca-ca
            Star-nosed mole  ccct-ca
B D                     Rat  =======
B D                  Tenrec  =======
       Cape elephant shrew  =======
B D                Hedgehog  =======
B D                   Sheep  =======
             Domestic goat  =======
          Tibetan antelope  =======
              Prairie vole  =======
B D                Elephant  =======
B D               Armadillo  =======
B D                  Alpaca  =======
B D                 Manatee  =======
            Bactrian camel  =======
B D                 Ferret   =======
B D                     Pig  =======
          Cape golden mole  =======
                  Aardvark  =======
B D                 Wallaby  =======
  D          Painted turtle  =======
  D         Green seaturtle  =======
B D                 Chicken  =======
B D                 Opossum  =======
B D         Tasmanian devil  =======

Alignment block 38 of 58 in window, 30152826 - 30152826, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D                Squirrel  g
     Lesser Egyptian jerboa  g
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  a
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                    Pika  g
B D                 Dolphin  a
               Killer whale  a
B D                     Cow  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                   Shrew  g
            Star-nosed mole  g
B D                Elephant  a
B D                     Rat  =
B D                  Tenrec  =
       Cape elephant shrew  =
B D                Hedgehog  =
B D                   Sheep  =
             Domestic goat  =
          Tibetan antelope  =
              Prairie vole  =
B D               Armadillo  =
B D                  Alpaca  =
B D                 Manatee  =
B D                   Horse  -
            Bactrian camel  =
B D                 Ferret   =
B D                     Pig  =
          Cape golden mole  =
                  Aardvark  =
B D                 Wallaby  =
  D          Painted turtle  =
  D         Green seaturtle  =
B D                 Chicken  =
B D                 Opossum  =
B D         Tasmanian devil  =

Alignment block 39 of 58 in window, 30152827 - 30152828, 2 bps 
B D                   Human  ga
B D                   Chimp  ga
B D                 Gorilla  ga
B D               Orangutan  ga
B D                  Gibbon  ga
B D                  Rhesus  ga
B D     Crab-eating macaque  ga
B D                  Baboon  ga
B D            Green monkey  ga
B D                Marmoset  ga
B D         Squirrel monkey  ga
B D                Bushbaby  gt
         Chinese tree shrew  ga
B D                Squirrel  ga
     Lesser Egyptian jerboa  ga
B D         Chinese hamster  ga
             Golden hamster  ga
B D                   Mouse  ga
B D          Naked mole-rat  ga
B D              Guinea pig  ga
                 Chinchilla  ga
           Brush-tailed rat  ga
B D                  Rabbit  ga
B D                    Pika  ag
B D                 Dolphin  ga
               Killer whale  ga
B D                     Cow  ga
B D                   Horse  ga
B D        White rhinoceros  ga
B D                     Cat  gg
B D                     Dog  gg
B D                   Panda  gg
             Pacific walrus  gg
               Weddell seal  gg
           Black flying-fox  ca
B D                 Megabat  ca
              Big brown bat  ga
       David's myotis (bat)  gg
B D                Microbat  ga
B D                   Shrew  aa
            Star-nosed mole  ga
B D                Elephant  ga
B D                 Manatee  ga
B D                     Rat  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                Hedgehog  ==
B D                   Sheep  ==
             Domestic goat  ==
          Tibetan antelope  ==
              Prairie vole  ==
B D               Armadillo  ==
B D                  Alpaca  ==
            Bactrian camel  ==
B D                 Ferret   ==
B D                     Pig  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Wallaby  ==
  D          Painted turtle  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==

Inserts between block 39 and 40 in window
B D                Dolphin 12bp
              Killer whale 12bp
B D                    Cow 35bp

Alignment block 40 of 58 in window, 30152829 - 30152834, 6 bps 
B D                   Human  cag-----------aac
B D                   Chimp  cag-----------aac
B D                 Gorilla  cag-----------aac
B D               Orangutan  cag-----------aac
B D                  Gibbon  cag-----------aac
B D                  Rhesus  cag-----------aac
B D     Crab-eating macaque  cag-----------aac
B D                  Baboon  cag-----------aac
B D            Green monkey  cag-----------aac
B D                Marmoset  cag-----------aac
B D         Squirrel monkey  cag-----------aac
B D                Bushbaby  ctg-----------ggc
         Chinese tree shrew  cat-----------aac
B D                Squirrel  cac-----------a-c
     Lesser Egyptian jerboa  cac-----------a-c
B D         Chinese hamster  cac-----------acc
             Golden hamster  cac-----------acc
B D                   Mouse  cac-----------acc
B D          Naked mole-rat  cac-----------acc
B D              Guinea pig  cac-----------acc
                 Chinchilla  cac-----------acc
           Brush-tailed rat  cac-----------acc
B D                  Rabbit  cct-----------ccc
B D                    Pika  cct-----------ccc
B D                 Dolphin  caggccggccctcaagc
               Killer whale  caggccggccctcaagc
           Tibetan antelope  cag-----------aac
B D                     Cow  cag-----------agc
B D                   Sheep  cag-----------aac
              Domestic goat  cag-----------aac
B D                   Horse  cag-----------agc
B D        White rhinoceros  cag-----------agc
B D                     Cat  cag-----------ggt
B D                     Dog  cac-----------agt
B D                   Panda  cac-----------agg
             Pacific walrus  cac-----------agt
               Weddell seal  cac-----------ggt
           Black flying-fox  ccc-----------agc
B D                 Megabat  ccc-----------agc
              Big brown bat  cac-----------agc
       David's myotis (bat)  cac-----------agc
B D                Microbat  cac-----------agc
B D                   Shrew  cac-----------aac
            Star-nosed mole  cct-----------ggc
B D                Elephant  cag-----------acc
B D                 Manatee  cag-----------acc
B D                     Rat  =================
B D                  Tenrec  =================
       Cape elephant shrew  =================
B D                Hedgehog  =================
              Prairie vole  =================
B D               Armadillo  =================
B D                  Alpaca  =================
            Bactrian camel  =================
B D                 Ferret   =================
B D                     Pig  =================
          Cape golden mole  =================
                  Aardvark  =================
B D                 Wallaby  =================
  D          Painted turtle  =================
  D         Green seaturtle  =================
B D                 Chicken  =================
B D                 Opossum  =================
B D         Tasmanian devil  =================

Inserts between block 40 and 41 in window
B D                  Horse 21bp
B D       White rhinoceros 21bp
          Black flying-fox 13bp
B D                Megabat 13bp
             Big brown bat 20bp
      David's myotis (bat) 20bp
B D               Microbat 20bp
B D                  Shrew 20bp
           Star-nosed mole 20bp

Alignment block 41 of 58 in window, 30152835 - 30152838, 4 bps 
B D                   Human  t------------------gta
B D                   Chimp  t------------------gta
B D                 Gorilla  t------------------gca
B D               Orangutan  t------------------gta
B D                  Gibbon  t------------------gta
B D                  Rhesus  t------------------gta
B D     Crab-eating macaque  t------------------gta
B D                  Baboon  t------------------gta
B D            Green monkey  t------------------gta
B D                Marmoset  t------------------gta
B D         Squirrel monkey  c------------------gta
B D                Bushbaby  c------------------agc
         Chinese tree shrew  tacccaagatgatctgcaggca
B D                Squirrel  g------------------gtc
     Lesser Egyptian jerboa  t------------------gtg
B D         Chinese hamster  t------------------gtg
             Golden hamster  c------------------gtg
B D                   Mouse  a------------------gta
B D          Naked mole-rat  t------------------gtg
B D              Guinea pig  c------------------gtg
                 Chinchilla  t------------------atg
           Brush-tailed rat  t------------------gag
B D                  Rabbit  t------------------gtg
B D                    Pika  t------------------gtc
B D                     Pig  -------------------gcc
B D                 Dolphin  ---------------------c
               Killer whale  ---------------------c
           Tibetan antelope  ---------------------c
B D                     Cow  ---------------------c
B D                   Sheep  ---------------------c
              Domestic goat  ---------------------c
B D                   Horse  -------------------gcc
B D        White rhinoceros  -------------------gcc
B D                     Cat  -------------------gag
B D                     Dog  -------------------gag
B D                   Panda  -------------------gag
             Pacific walrus  -------------------gag
               Weddell seal  -------------------gag
              Big brown bat  -------------------gct
       David's myotis (bat)  -------------------gct
B D                Microbat  -------------------gct
B D                   Shrew  -------------------gct
            Star-nosed mole  -------------------gct
B D                Elephant  ---------------------a
B D                 Manatee  ---------------------a
B D                     Rat  ======================
B D                  Tenrec  ======================
       Cape elephant shrew  ======================
B D                Hedgehog  ======================
              Prairie vole  ======================
B D               Armadillo  ======================
B D                  Alpaca  ======================
          Black flying-fox  ======================
            Bactrian camel  ======================
B D                 Ferret   ======================
          Cape golden mole  ======================
                  Aardvark  ======================
B D                 Megabat  ======================
B D                 Wallaby  ======================
  D          Painted turtle  ======================
  D         Green seaturtle  ======================
B D                 Chicken  ======================
B D                 Opossum  ======================
B D         Tasmanian devil  ======================

Inserts between block 41 and 42 in window
B D               Squirrel 18bp
    Lesser Egyptian jerboa 21bp
B D        Chinese hamster 21bp
            Golden hamster 21bp
B D                  Mouse 21bp
B D         Naked mole-rat 21bp
B D             Guinea pig 21bp
                Chinchilla 21bp
          Brush-tailed rat 20bp
B D                 Rabbit 20bp
B D                   Pika 20bp
B D                    Pig 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
B D                  Shrew 1bp
           Star-nosed mole 1bp

Alignment block 42 of 58 in window, 30152839 - 30152893, 55 bps 
B D                   Human  cc-------tc----------ccaa--tccctcctgacctgactcacatcagccaccaagcttgggtgga
B D                   Chimp  cc-------tc----------ccaa--tccctcctgacctgactcacatcagccaccaagcttgggtgga
B D                 Gorilla  cc-------tc----------tcaa--tccctcctgacctgactcacatcagccaccaagcttgggtgga
B D               Orangutan  cc-------tc----------ccaa--tccctcctgacctgactcaaatcagccaccaagcttgggtgga
B D                  Gibbon  cc-------tc----------ccaa--tccctcctgacctgactcacatcagccaccaagcttgggtgga
B D                  Rhesus  cc-------tc----------ccaa--cccttcctgacctgactcacatcagccaccaagcttgggtgga
B D     Crab-eating macaque  cc-------tc----------ccaa--cccttcctgacctgactcacatcagccaccaagcttgggtgga
B D                  Baboon  cc-------tc----------ccaa--cccttcctgacctgactcacatcagccaccaagcttgggtgga
B D            Green monkey  cc-------tc----------ccaa--ccctt-----cctgactcacatcagccaccaagcttgggtgga
B D                Marmoset  cc-------tc----------tcaa--cccctcctgacctgactcacatcagccatc-agcttgggtgga
B D         Squirrel monkey  cc-------tc----------tcaa--ccctgcctgacctgactcagctcagccgccaagcttgggtgga
B D                Bushbaby  cc-------tcaggcagcccaccca--cccgtcccatcctgactcacatcaagcactaaactcggggtgg
         Chinese tree shrew  gc-------ct----------tcaggctccctcctgacctgcttgacatcaattgccaaacttgagtggc
B D                Squirrel  cc-------ac----------ggga--ccaatcctgatctgactcacatcagttgccaggctttggcaga
     Lesser Egyptian jerboa  cg-------cc----------cggc--cccatcctgacctgcctcacatcaattgccaagctctggtgga
B D         Chinese hamster  cc-------tc----------caga--gcccttgtgacccgagtcacatctattgccaagcttcagtaga
             Golden hamster  cc-------tc----------caga--cccatggtgacctgagtcacacctattgccaagcttcggtaga
B D                   Mouse  cc-------tc----------cgga--cccatgctgacccgattcccatctattgccaagctttggtaga
B D                     Rat  cc-------tc----------caga--cccatgctgacttgattcccatctacagccaagctttggttga
B D          Naked mole-rat  ccggaaggatg----------caga--ctcatcccgacctgattctcatcaattcacatggtttggtgga
B D              Guinea pig  cc-------tc----------caga--tccacactgacctgatccatgtccactcccaagcttgggtgaa
                 Chinchilla  cc-------t-----------caga--cccattctgaacagattcgtgtcaattcccaggctttggtgaa
           Brush-tailed rat  cc-------tc----------caga--cccatcctgacc----ttgtg----attccagggttcagtgaa
B D                  Rabbit  cc-------cc----------aaga--cctatcctgatctgatgcacgtccattgccaagtgtgggtgga
B D                    Pika  cc-------cc----------gaaa--cccatcctgagt-----catggccattgccaagcttgggtgga
B D                     Pig  cc-------cc----------tgga--cccctccctccctga-tcacagcccctgccaagtccaggggga
B D                 Dolphin  cc-------tc----------tgga---tgcctcctccctga-tcacatccattgccaagcctgggtggg
               Killer whale  cc-------tc----------tgga---cgcctcctccctga-tcacatccattgccaagcctgggtggg
           Tibetan antelope  cc-------cc----------c------ctccaccgccctga-tcacatccattgccaa-cctgggtgga
B D                     Cow  cc-------cc----------c------ctccaccgccctga-tcacatccattgccaa-cctgggtgga
B D                   Sheep  cc-------cc----------c------ctccaccgccctga-tcacatccactgccaa-cctggatgga
              Domestic goat  cc-------cc----------c------ctccaccgccctga-tcacatccactgccaa-cctgggtgga
B D                   Horse  cc-------tc----------ttga--cccaccctgccctga-tcacatccattgccaagcctgggtgca
B D        White rhinoceros  cc-------tc----------tgga--cccatcctgccctga-ccacatccattgccaagcctggatgga
B D                     Cat  cc-------tc----------tgca--cccgtcctgccctgg-tcacacccgtggccgagcccgcgtgta
B D                     Dog  cc-------tc----------tgca--cccatcctgccctaa-tcacccccattgccaagcctgcttaga
B D                   Panda  cc-------tc----------tgga--cccgtcctgccctga-tcacatgcgttgccaagcctgcgtgga
             Pacific walrus  cc-------tc----------tgga--cccaacctgccctga-tcccacccattgccaggcctgcctgga
               Weddell seal  cc-------tc----------tgga--cccgtcctgccctga-tcccacccattgccaagcctgcctgga
           Black flying-fox  cc-------cc----------tgga--cacacccaaccctga-tcatgtccacctccacacctgggtaga
B D                 Megabat  cc-------cc----------cgga--cacacccaaccctga-tcatgtccacctccgcacctgggtaga
              Big brown bat  cc-------tc----------tgga--cgcactctgtcctga-taacacccattgccaagcatgggtgga
       David's myotis (bat)  cc-------tc----------tgga--cccactctgtcttga-taacacccattgccaagcgtgggtgga
B D                Microbat  cc-------tc----------tgga--cccactctgtcctga-taacacccattgccaagtgtgggtgga
B D                   Shrew  cc-------tc----------tggc--cccg-tgcatc-tga-tcacatctgttgccacacctggctaag
            Star-nosed mole  ct-------ac----------tgga--ctcactccatcttga-ccacatacactgccaggtcagggtgga
B D                Elephant  tc-------tc----------aggg--tccatcctcctctgactctcttctaccgccaagcccgggcagg
B D                 Manatee  tc-------tc----------agga--tccatcctcctctgactcacctctaccaccaagcctgggtgca
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
              Prairie vole  ======================================================================
B D               Armadillo  ======================================================================
B D                  Alpaca  ======================================================================
            Bactrian camel  ======================================================================
B D                 Ferret   ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Wallaby  ======================================================================
  D          Painted turtle  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================

                      Human  caag
                      Chimp  cgag
                    Gorilla  cgag
                  Orangutan  cgag
                     Gibbon  caag
                     Rhesus  cgag
        Crab-eating macaque  cgag
                     Baboon  cgag
               Green monkey  cgag
                   Marmoset  tgag
            Squirrel monkey  cgag
                   Bushbaby  gggg
         Chinese tree shrew  aaag
                   Squirrel  cgag
     Lesser Egyptian jerboa  caag
            Chinese hamster  ggag
             Golden hamster  ggag
                      Mouse  caag
                        Rat  caag
             Naked mole-rat  caaa
                 Guinea pig  taag
                 Chinchilla  taag
           Brush-tailed rat  tcag
                     Rabbit  caag
                       Pika  caaa
                        Pig  caag
                    Dolphin  caag
               Killer whale  caag
           Tibetan antelope  caag
                        Cow  caag
                      Sheep  caag
              Domestic goat  caag
                      Horse  caag
           White rhinoceros  caag
                        Cat  cgag
                        Dog  caag
                      Panda  caag
             Pacific walrus  caaa
               Weddell seal  caag
           Black flying-fox  tgag
                    Megabat  tgag
              Big brown bat  caag
       David's myotis (bat)  ccag
                   Microbat  ccag
                      Shrew  caag
            Star-nosed mole  caag
                   Elephant  agag
                    Manatee  caag
                     Tenrec  ====
        Cape elephant shrew  ====
                   Hedgehog  ====
               Prairie vole  ====
                  Armadillo  ====
                     Alpaca  ====
             Bactrian camel  ====
                    Ferret   ====
           Cape golden mole  ====
                   Aardvark  ====
                    Wallaby  ====
             Painted turtle  ====
            Green seaturtle  ====
                    Chicken  ====
                    Opossum  ====
            Tasmanian devil  ====

Inserts between block 42 and 43 in window
B D               Squirrel 7bp
    Lesser Egyptian jerboa 27bp
B D        Chinese hamster 541bp
            Golden hamster 170bp
B D                  Mouse 421bp
B D                    Rat 474bp
B D         Naked mole-rat 29bp
B D             Guinea pig 29bp
                Chinchilla 39bp
          Brush-tailed rat 29bp

Alignment block 43 of 58 in window, 30152894 - 30152894, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                     Pig  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                   Shrew  a
            Star-nosed mole  g
B D                Elephant  g
B D                 Manatee  g
B D                     Rat  =
B D                  Tenrec  =
       Cape elephant shrew  =
B D                    Pika  -
B D                Hedgehog  =
    Lesser Egyptian jerboa  =
B D                  Rabbit  -
            Golden hamster  =
              Prairie vole  =
B D         Chinese hamster  =
B D                   Mouse  =
B D          Naked mole-rat  =
                Chinchilla  =
B D               Armadillo  =
B D                  Alpaca  =
B D                Squirrel  =
            Bactrian camel  =
B