Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1519 in window, 78188812 - 78188870, 59 bps 
B D                     Human  cggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D                     Chimp  cggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D                   Gorilla  cggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D                 Orangutan  cggct-ggccttaaaggg-----------------gacgc-ggtcagagcggc-agctcgc-ggggt---
B D                    Gibbon  cggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctggc-ggggt---
B D                    Rhesus  tggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D       Crab-eating macaque  tggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D                    Baboon  tggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D              Green monkey  tggct-ggccttaaaggg-----------------gacgc-ggtcagagtggc-agctcgc-ggggt---
B D                  Marmoset  cggct-ggccttaaaggg-----------------gacgc-ggtccgagcacc-agctcgc-ggggt---
B D           Squirrel monkey  cggct-ggccttaaaggg-----------------gacgc-ggtccgagcggc-agctcgc-agggt---
B D                  Bushbaby  cggct-ggccttaaaggg-----------------aacgc-ggtccgggtggt-ggctcac-cgggt---
           Chinese tree shrew  cggct-agccttaaaggg-----------------gacgc-agcccgagtggc-ggcgcac-ggggt---
B D                  Squirrel  cagct-ggtcttaaaggg-----------------gacgc-agcccgagtggc-ggctcgc-ggggt---
       Lesser Egyptian jerboa  cagct-ggtcttaaaggg-----------------gacgc-ggtccgagtgggcagctcgc-ggggt---
                 Prairie vole  cagct-ggccttaaaggg-----------------gacgc-ggcccgagtggc-cgcccgcgggggt---
               Golden hamster  ctgct-ggccttaaaggg-----------------gacgc-ggcccgactgga-agctcgc-ggggt---
B D                     Mouse  cagct-ggccttaaaggg-----------------gacgc-ggcccgactggg-agctcgc-agggt---
B D                       Rat  cagct-ggccttaaaggg-----------------gacgc-agcccgactggg-agctctc-agggt---
B D            Naked mole-rat  cagct-ggttttaaaggg-----------------gacgc-ggaccgaacgaa-ggttcgc-ggggt---
B D                Guinea pig  cagct-ggtcttaaaggc-----------------gacgc-ggtttgagcgaa-ggctcat-ggggt---
                   Chinchilla  cagct-ggtcttaaaggg-----------------gacgc-ggtccgagcgaa-ggctcac-ggggt---
             Brush-tailed rat  cagct-ggtcttaaagga-----------------gacgc-ggtccgggcgaa-ggctcac-ggggt---
B D                    Rabbit  cagct-ggccttaaaggg-----------------gacgc-gacccgagtggc-agctcgc-gaggt---
B D                      Pika  cagct-ggccttaaaggg-----------------gacgc-ga-cagagtggc-agctcgc-gcggt---
B D                       Pig  cggct-ggccttaaaggg-----------------gacgc-ggcttgagtggc-ggttcgc-ggggt---
B D                    Alpaca  cggct-ggacttaaaggg-----------------gacgc-ggcccgagtggc-ggttcgc-ggggt---
               Bactrian camel  ccgct-ggacttaaaggg-----------------gacgc-ggcccgagtggc-ggttcgc-ggggt---
B D                   Dolphin  cggctgggccttaaaggg-----------------gacgcgggccctagtggc-tgctcgc-ggggt---
                 Killer whale  cggct-ggccttaaaggg-----------------gacgc-ggccctagtggc-tgctcgc-ggggt---
             Tibetan antelope  cggct-ggtcttaaaggg-----------------gacgc-agcttgagtggc-ggttcgc-ggggt---
B D                       Cow  cggct-ggccttaaaggg-----------------gacgc-agcgtgagtggc-ggttcgc-agggt---
B D                     Sheep  cggct-gggcttaaaggg-----------------gacgc-agcttgaccggc-g--------ggct---
B D                     Horse  cggct-ggccttaaaggg-----------------gacgc-ggcgtgagtgga-ggttcgc-ggggt---
B D          White rhinoceros  cggct-ggccttaaaggg-----------------gacgc-ggcctgagtggc-ggttcgc-ggggt---
B D                       Cat  cggct-ggccttaaaggg-----------------gacgc-ggcctgagtggc-ggttccc-agggt---
B D                       Dog  cggct-ggccttaaaggg-----------------gacgc-ggcctgagcggc-ggttcgc-ggggt---
B D                   Ferret   cggct-ggtcttaaaggg-----------------gacgc-ggcctgagtggc-ggttcgc-ggggt---
B D                     Panda  ctgct-ggccttaaaggg-----------------gacgc-ggcctgagtggc-ggttcgc-ggggt---
               Pacific walrus  cggct-ggtcttaaaggg-----------------gacgc-agcctgagtggc-ggttcgc-ggggt---
                 Weddell seal  cggct-ggtcttaaaggg-----------------gacgc-agcctgagtggc-ggttcgc-ggggt---
             Black flying-fox  cggct-ggccttaaagtg-----------------gacgc-ggcctgagtggc-ggttcac-ccggt---
B D                   Megabat  cggct-ggccttaaagtg-----------------gacgc-ggcctgagtggc-ggttcac-ccggt---
                Big brown bat  cggct-ggccttaaaggg-----------------gacgc-tgcctgagtggc-ggttcgc-ggggt---
         David's myotis (bat)  cggct-ggccttaaaggg-----------------gacgc-ggcctgagcggc-ggttcgc-ggggt---
B D                  Microbat  cggct-ggccttaaaggg-----------------gacgc-ggccagagcggc-ggttcgc-ggggt---
B D                  Hedgehog  c-gcc-gctcttaaagag-----------------gacgc-gg----agtggagggtatgc-ggact---
B D                     Shrew  cagct-gcccttaaaggg-----------------gccgc-gg-cggagtggc-cgtgcgc-ggggt---
              Star-nosed mole  ccgca-gcccttaaaggg-----------------gacgc-tgccctagtggc-agtttgc-ggggt---
B D                  Elephant  cggct-agccttaaaggg-----------------gacgc-ggcccgagtggc-ggctcgc-ggggt---
          Cape elephant shrew  cagct-agccttaaaggg-----------------gacgc-gtcccgtttggt-ggctcgc-ggggt---
B D                   Manatee  cggct-agccttaaaggg-----------------gacgc-ggcccgtgtggc-ggctcgc-ggggt---
             Cape golden mole  caact-ggccttaaaggg-----------------gacgc-ggcccttgtggt-ggctcgc-ggggt---
B D                    Tenrec  cagct-aaccttaaaggg-----------------gccgc-gacccaagtggc-agctcgc-ggggt---
                     Aardvark  cggct-agccttaaaggg-----------------gacgc-gggccgagtggt-ggctcgc-ggggt---
  D       Collared flycatcher  cagcc-ctcctgacaagg-----------------aggga-ggcaaacgtggc----cagc-tgagc-ct
B D        American alligator  cgtct-ccccagaggaggtgccgagccaacccgccagggg-ggggcggggggg----gagc-ggggcggc
  D            Painted turtle  ctgca-ccccacatgccgcg---------------gcgga-gaccactatgcc----tcgt-ggggc---
B D           Chinese hamster  ======================================================================
               Domestic goat  ======================================================================
B D                 Armadillo  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ------ggcc-------------------------cccgctccg
                        Chimp  ------ggcc-------------------------cccgctccg
                      Gorilla  ------ggcc-------------------------cccgctccg
                    Orangutan  ------ggcc-------------------------ccctctccg
                       Gibbon  ------ggcc-------------------------cccgctccg
                       Rhesus  ------ggcc-------------------------ctcgctccg
          Crab-eating macaque  ------ggcc-------------------------ctcgctccg
                       Baboon  ------ggcc-------------------------ctcgctccg
                 Green monkey  ------ggcc-------------------------ctcgctccg
                     Marmoset  ------ggcc-------------------------cccgctccg
              Squirrel monkey  ------ggcc-------------------------cccgctccg
                     Bushbaby  ------ggcc-------------------------cctgctccg
           Chinese tree shrew  ------gtcc-------------------------cccgtttcg
                     Squirrel  ------ggcc-------------------------cccgctc-g
       Lesser Egyptian jerboa  ------ggcc-------------------------ctcactctg
                 Prairie vole  ------agcc-------------------------cccgctctg
               Golden hamster  ------agcc-------------------------cccactctg
                        Mouse  ------aacc-------------------------cccgctgtg
                          Rat  ------agcc-------------------------cccgctcta
               Naked mole-rat  ------ggcc-------------------------cccgctccg
                   Guinea pig  ------ggcc-------------------------cccgctccg
                   Chinchilla  ------ggcc-------------------------cctgctccg
             Brush-tailed rat  ------ggcc-------------------------cccgctccg
                       Rabbit  ------ggcc-------------------------cccgctcca
                         Pika  ------ag-c-------------------------cccgctccg
                          Pig  ------ggtc-------------------------cccgctccg
                       Alpaca  ------agac-------------------------cccgctccg
               Bactrian camel  ------agac-------------------------cccgctctg
                      Dolphin  ------gg-c-------------------------cccgctccg
                 Killer whale  ------ggcc-------------------------cccgctccg
             Tibetan antelope  ------ggcc-------------------------cccact-cg
                          Cow  ------ggcc-------------------------cccgct-gg
                        Sheep  ------ggcg-------------------------cgcg-----
                        Horse  ------ggcc-------------------------cccgctccg
             White rhinoceros  ------ggcc-------------------------cccgctccg
                          Cat  ------ggcc-------------------------cccgctccg
                          Dog  ------ggcc-------------------------cccgctccg
                      Ferret   ------ggcc-------------------------cccgctccg
                        Panda  ------ggcc----------------------------------
               Pacific walrus  ------ggcc-------------------------cccgctccg
                 Weddell seal  ------ggcc-------------------------cccactccg
             Black flying-fox  ------ggcc-------------------------cccgctcgg
                      Megabat  ------ggcc-------------------------cccgctcgg
                Big brown bat  ------ggcc-------------------------cccgttcgg
         David's myotis (bat)  ------ggcc-------------------------cccgttcgg
                     Microbat  ------ggcc-------------------------cccgttcgg
                     Hedgehog  ------ggcc-------------------------ccgcccccg
                        Shrew  ------ggac-------------------------cctgctccg
              Star-nosed mole  ------ggct-------------------------tccgctccg
                     Elephant  ------ggcc-------------------------accgctccg
          Cape elephant shrew  ------ggcc-------------------------tccgctcca
                      Manatee  ------ggcc-------------------------tccgctccg
             Cape golden mole  ------ggcc-------------------------tccgctccg
                       Tenrec  ------ggcc-------------------------tccactccg
                     Aardvark  ------ggcc-------------------------tccgctccg
          Collared flycatcher  tctgcctgtc----------------------ctgctttcttct
           American alligator  cctggcagccgggcaggtagggccgcggggggcggagcgcagca
               Painted turtle  ------agcc-------------------------gcttctcca
              Chinese hamster  ============================================
                Domestic goat  ============================================
                    Armadillo  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Coelacanth  ============================================
                X. tropicalis  ============================================
                       Lizard  ============================================
       Spiny softshell turtle  --------------------------------------------
     Chinese softshell turtle  ============================================
              Green seaturtle  ============================================
                       Turkey  ============================================
                      Chicken  ============================================
                 Mallard duck  ============================================
                   Budgerigar  ============================================
           Tibetan ground jay  ============================================
                  Zebra finch  ============================================
          Medium ground finch  ============================================
       White-throated sparrow  ============================================
             Peregrine falcon  ============================================
                 Saker falcon  ============================================
                  Rock pigeon  ============================================
                      Wallaby  ============================================
                      Opossum  ============================================
              Tasmanian devil  ============================================

Inserts between block 1 and 2 in window
              Bactrian camel 93bp
B D                 Hedgehog 1bp

Alignment block 2 of 1519 in window, 78188871 - 78188913, 43 bps 
B D                     Human  gctccgcccca-ttt-------------cacgcacct----------------cgcc--------cct--
B D                     Chimp  gctccgcccca-ttt-------------cacgcacct----------------cgcc--------cct--
B D                   Gorilla  gctccgcccca-ttt-------------cacgcacct----------------cgcc--------cct--
B D                 Orangutan  gctccgccctg-ttt-------------cacgcacct----------------cgcc--------cct--
B D                    Gibbon  gctccgcccca-ttt-------------cacgcacct----------------cgcc--------cct--
B D                    Rhesus  gctccgcccca-ttt-------------acagcacct----------------cgcc--------cct--
B D       Crab-eating macaque  gctccgcccca-ttt-------------acagcacct----------------cgcc--------cct--
B D                    Baboon  gctccgcccca-ttt-------------acagcacct----------------cgcc--------cct--
B D              Green monkey  gctccgcccca-ttt-------------acagcacct----------------cgcc--------cct--
B D                  Marmoset  actccacctcc-ttt-------------ctcgcacct----------------cgcc--------cct--
B D           Squirrel monkey  gctccaccccc-ttt-------------cccacacct----------------ctcc--------cct--
B D                  Bushbaby  gctccgcccag-ttt-------------cccgcacct----------------cgcc--------cct--
           Chinese tree shrew  actccgccctg-ttt-------------cccgcacct----------------cgcc--------cct--
B D                  Squirrel  gctccgccctt-ttt-------------cccgcacct----------------cgcc--------cct--
       Lesser Egyptian jerboa  gctccgccccg-tctc------------cccgcacct----------------cgcc--------cct--
                 Prairie vole  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cct--
               Golden hamster  gctccgccctg-ttt-------------cccgcactt----------------cccc--------cct--
B D                     Mouse  gctccgccccg-tttc------------cccgcacct----------------cacc--------cct--
B D                       Rat  gctccgccccg-tttc------------cccgcacct----------------catc--------cct--
B D            Naked mole-rat  gctccgccccg-ttt-------------cccgcacct----------------cgtc--------cct--
B D                Guinea pig  gctccgccccatttc-------------cccgcaccg----------------cccc--------ccc--
                   Chinchilla  gctccgccccg-ttt-------------cccgcacct----------------cgtccctccccgcct--
             Brush-tailed rat  gctccgccccg-ttc-------------cccgcacct----------------catc--------cct--
B D                    Rabbit  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cct--
B D                      Pika  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cctcc
B D                       Pig  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cct--
B D                    Alpaca  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cct--
B D                   Dolphin  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cct--
                 Killer whale  gctccgccccg-ttt-------------cccgcacct----------------cgcc--------cct-c
             Tibetan antelope  gctccgcccct-ttt-------------cccgcacct----------------cgcc--------cct-c
B D                       Cow  gctccgcccct-ttt-------------cccgcacct----------------cgcc--------cct-c
B D                     Sheep  ----cgcccct-ttt-------------cccgcacct----------------cgcc--------cct-c
B D                     Horse  gctccgccccg-ttt-------------cccgcaccg----------------cgcc--------cct--
B D          White rhinoceros  gctccgccccg-ttt-------------cccgcacct----------------cgcg--------cct--
B D                       Cat  gctcctccccg-ttt-------------cccgcacct----------------cgcc--------cct--
B D                       Dog  gctcctccctg-ttt-------------cccgcacct----------------cgcc--------cct--
B D                   Ferret   gctcctcccca-ttt-------------cccgcacct----------------cgcc--------cct--
B D                     Panda  ------------ttt-------------cccgcacct----------------cgcc--------cct--
               Pacific walrus  gctcctccccg-ttt-------------cccgcacct----------------cgcc--------cct--
                 Weddell seal  gctcctccccg-ttt-------------cccgcacct----------------cgcc--------cct--
             Black flying-fox  gctccgccctg-tta-------------cccgcacct----------------cgcc--------cct--
B D                   Megabat  gctccgccctg-tta-------------cccgcacct----------------cgcc--------cct--
                Big brown bat  gctccgccctg-tca-------------cccgcacct----------------cgcc--------cct--
         David's myotis (bat)  gctccgccctg-tca-------------cccgcacct----------------cgcc--------cct--
B D                  Microbat  gctccgccctg-tca-------------cccgcacct----------------cgcc--------cct--
B D                  Hedgehog  accccgccccg-cctcgccccgctccgcccggcgcccggggcctggagccaggagcc--------ccg--
B D                     Shrew  actccgccctg-tttccccgcacttcgtcccacctca----------------cccc--------tcc--
              Star-nosed mole  gccccgccccg-ttcccgcgc-------cttaccccc----------------cacc--------ccc--
B D                  Elephant  gctccgccccg-tttt------------cccgcacct----------------cgcc--------cct--
          Cape elephant shrew  gctccgcccca-tttc------------cccgcacct----------------cgtc--------cct--
B D                   Manatee  gctccgcccag-ttt-------------cccgcacct----------------cgcc--------cct--
             Cape golden mole  gctccgccccg-ctt-------------cccgcacct----------------cgcc--------cct--
B D                    Tenrec  gctccgccctg-ttc-------------cccgcaccc------------------cc--------cct--
                     Aardvark  gctccgcccag-ttt-------------cccgcacct----------------cgcc--------cct--
B D                 Armadillo  gctccgccccg-tgg-------------cccgcacct----------------cgcc--------cct--
  D       Collared flycatcher  ------------------------------------------------------gcg--------cct--
B D        American alligator  ------------------------------------------------------gcg--------cct--
  D            Painted turtle  ------------------------------------------------------tca--------tct--
B D           Chinese hamster  ======================================================================
               Domestic goat  ======================================================================
              Bactrian camel  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  c---------ccca-----------t--gc--ttcat
                        Chimp  c---------ccca-----------t--gc--ttcat
                      Gorilla  c---------ccca-----------t--gc--ttcat
                    Orangutan  c---------ccca-----------t--gc--ttcgt
                       Gibbon  c---------ccca-----------t--gc--ttcgt
                       Rhesus  c---------ccca-----------c--gc--ttcgt
          Crab-eating macaque  c---------ccca-----------c--gc--ttcgt
                       Baboon  c---------ccca-----------c--gc--ttcgt
                 Green monkey  c---------ccca-----------c--gc--ttcgt
                     Marmoset  c---------ctcc-----------c--gc--ttcgt
              Squirrel monkey  c---------c-cc-----------c--ac--ttcgt
                     Bushbaby  c---------cccc-----------c--gc--ttcgt
           Chinese tree shrew  c---------cccc-----------g--gt--ttctc
                     Squirrel  c---------cccc-----------c--gc--ttcgt
       Lesser Egyptian jerboa  c---------ccccgcc--------t--ga--t----
                 Prairie vole  c---------cccccctc-------c--gc--tccgt
               Golden hamster  c---------cccccct--------g--gc--tccgt
                        Mouse  c---------tccc-----------a--gt--tccgt
                          Rat  c---------cccc-----------a--gc--tccgt
               Naked mole-rat  c---------cccc-----------c--gt--ttcgt
                   Guinea pig  c---------accc-----------c--gt--ttcgt
                   Chinchilla  c---------cccc-----------c--gc--ttcgt
             Brush-tailed rat  c---------cccc-----------c--gc--ttcat
                       Rabbit  c---------cccc-----------c--gc--ctcga
                         Pika  c---------cccc-----------c--gc--tccga
                          Pig  c---------cccc-----------c--ac--ttcgc
                       Alpaca  c---------cccc-----------c--ac--ttcgc
                      Dolphin  c---------cccc-----------c--ac--ttcgt
                 Killer whale  c---------cccc-----------c--ac--ttcgt
             Tibetan antelope  c---------cccc-----------c--ac--ctccc
                          Cow  c---------cccc-----------a--ac--ttcgc
                        Sheep  c---------cccc-----------c--ac--ttcgc
                        Horse  c---------cccc-----------c--gc--ttcgt
             White rhinoceros  c---------cgcc-----------c--gc--ttggt
                          Cat  c---------ccca-----------c--gc--ttcgt
                          Dog  c---------ccca-----------c--gc--ttctt
                      Ferret   c---------ccca-----------c--gc--ttcgt
                        Panda  c---------ccca-----------c--gc--ttggt
               Pacific walrus  c---------ccca-----------c--gc--atcgt
                 Weddell seal  c---------ccca-----------c--gc--accgt
             Black flying-fox  c---------cccc-----------t--gc--ttcgt
                      Megabat  c---------cccc-----------t--gc--ttcgt
                Big brown bat  c---------cccc-----------c--gc--atctc
         David's myotis (bat)  c---------cccc-----------c--gc--atcgt
                     Microbat  c---------cccc-----------c--gc--atcgt
                     Hedgehog  a---------gccc-----------tgagc--ccggt
                        Shrew  a---------tccc-----------c--gc--gtcct
              Star-nosed mole  a---------cccc-----------c-agc--ctagt
                     Elephant  c---------cccc-----------c--gc--cgcgt
          Cape elephant shrew  cccccccacgcccc-----------c--gc--cgcgt
                      Manatee  c---------cccc-----------c--ac--cgcgt
             Cape golden mole  c---------cccc-----------c--gc--ggcat
                       Tenrec  c---------cccc-----------c--gccgtgtgt
                     Aardvark  c---------cccc-----------c--ac--ggcgt
                    Armadillo  c---------cccc-----------g--gc--cgcgt
          Collared flycatcher  c---------ccc------------t--gc--tctg-
           American alligator  c---------tccg--ccgccgggtg--gt--gctg-
               Painted turtle  t---------cctggcccgcggcgtg--gt--tctg-
              Chinese hamster  =====================================
                Domestic goat  =====================================
               Bactrian camel  =====================================
                   Coelacanth  =====================================
                X. tropicalis  =====================================
                       Lizard  =====================================
       Spiny softshell turtle  -------------------------------------
     Chinese softshell turtle  =====================================
              Green seaturtle  =====================================
                       Turkey  =====================================
                      Chicken  =====================================
                 Mallard duck  =====================================
                   Budgerigar  =====================================
           Tibetan ground jay  =====================================
                  Zebra finch  =====================================
          Medium ground finch  =====================================
       White-throated sparrow  =====================================
             Peregrine falcon  =====================================
                 Saker falcon  =====================================
                  Rock pigeon  =====================================
                      Wallaby  =====================================
                      Opossum  =====================================
              Tasmanian devil  =====================================

Inserts between block 2 and 3 in window
            Black flying-fox 6bp
B D                  Megabat 6bp

Alignment block 3 of 1519 in window, 78188914 - 78188919, 6 bps 
B D                     Human  cc---cgca
B D                     Chimp  cc---cgca
B D                   Gorilla  cc---cgca
B D                 Orangutan  cc---cgca
B D                    Gibbon  cc---cgca
B D                    Rhesus  cc---cgca
B D       Crab-eating macaque  cc---cgca
B D                    Baboon  cc---cgca
B D              Green monkey  cc---cgca
B D                  Marmoset  cc---cgca
B D           Squirrel monkey  cc---cgca
B D                  Bushbaby  cc---cgca
           Chinese tree shrew  ct---tgca
B D                  Squirrel  cc---cgca
       Lesser Egyptian jerboa  cc---cgca
                 Prairie vole  cc---cgca
B D           Chinese hamster  cc---cgcg
               Golden hamster  cc---cgca
B D                     Mouse  cc---cgca
B D                       Rat  cc---cgca
B D            Naked mole-rat  cc---cgca
B D                Guinea pig  cc---cgca
                   Chinchilla  cc---cgca
             Brush-tailed rat  cc---cgca
B D                    Rabbit  cc---cgca
B D                      Pika  cc---tgca
B D                       Pig  cc---cgca
B D                    Alpaca  cc---cgca
B D                   Dolphin  cc---cgca
                 Killer whale  cc---cgca
             Tibetan antelope  cc---cgca
B D                       Cow  cc---cgca
B D                     Sheep  cc---cgca
B D                     Horse  cc---cgca
B D          White rhinoceros  cc---cgca
B D                       Cat  cc---cgca
B D                       Dog  cc---cgca
B D                   Ferret   cc---cgca
B D                     Panda  cc---cgca
               Pacific walrus  cc---cgca
                 Weddell seal  cc---cgca
                Big brown bat  ct---ctca
         David's myotis (bat)  ct---ggca
B D                  Microbat  ct---ggca
B D                  Hedgehog  cc---agta
B D                     Shrew  cc---cgcg
              Star-nosed mole  ct---cgca
B D                  Elephant  cc---cgca
          Cape elephant shrew  cc---cgca
B D                   Manatee  cc---cgca
             Cape golden mole  cc---cgca
B D                    Tenrec  cc---cgca
                     Aardvark  cc---cgca
B D                 Armadillo  cc---cgca
  D       Collared flycatcher  -c---tg--
B D        American alligator  -c---ga--
  D            Painted turtle  -tctgtg--
            Black flying-fox  =========
B D                   Megabat  =========
               Domestic goat  =========
              Bactrian camel  =========
B D                Coelacanth  =========
B D             X. tropicalis  =========
B D                    Lizard  =========
  D    Spiny softshell turtle  ---------
  D  Chinese softshell turtle  =========
  D           Green seaturtle  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D                   Wallaby  =========
B D                   Opossum  =========
B D           Tasmanian devil  =========

Inserts between block 3 and 4 in window
B D                      Pig 8bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Cat 8bp
B D                      Dog 8bp
B D                  Ferret  8bp
B D                    Panda 8bp
              Pacific walrus 8bp
                Weddell seal 8bp
               Big brown bat 15bp
        David's myotis (bat) 8bp
B D                 Microbat 8bp

Alignment block 4 of 1519 in window, 78188920 - 78188931, 12 bps 
B D                     Human  gcc------c----------------cgg----------gg-ccg
B D                     Chimp  gcc------c----------------cgg----------gg-ccg
B D                   Gorilla  gcc------c----------------cgg----------gg-ccg
B D                 Orangutan  gcc------c----------------cgg----------gg-cct
B D                    Gibbon  gct------g----------------cgg----------gg-ccg
B D                    Rhesus  gcc------c----------------cgg----------gg-ccg
B D       Crab-eating macaque  gcc------c----------------cgg----------gg-cct
B D                    Baboon  gcc------c----------------cgg----------gg-ccg
B D              Green monkey  gcc------c----------------cgg----------gg-ccg
B D                  Marmoset  tcc------c----------------cgg----------gg-ccg
B D           Squirrel monkey  tcc------c----------------cgg----------gg-ccg
B D                  Bushbaby  gct------c----------------cgc----------gg-ccg
           Chinese tree shrew  gcc------c----------------cgc----------gg-ccg
B D                  Squirrel  gcc------c----------------cgg----------gg-ccg
       Lesser Egyptian jerboa  gcc------c----------------cgc----------ga-tcg
                 Prairie vole  gcc------c----------------agc----------ca-ccg
B D           Chinese hamster  acc------g----------------cgc----------ga-ccg
               Golden hamster  gcc------c----------------cgc----------ga-tcg
B D                     Mouse  gct------c----------------tga----------ga-ccg
B D                       Rat  gcc------a----------------tga----------gt-ccg
B D            Naked mole-rat  gcc------t----------------ggc----------ag-ccg
B D                Guinea pig  gtc------c----------------tgc----------ag-ccg
                   Chinchilla  gtc------c----------------tgc----------ag-ccg
             Brush-tailed rat  gtc------c----------------tgc----------agccca
B D                    Rabbit  gcc------c----------------cac----------gg-ccg
B D                      Pika  gcc------c----------------cgc----------gg-ccg
B D                       Pig  gcc------c----------------cgc----------gg-ccg
B D                    Alpaca  gct------c----------------cgc----------gg-ccg
               Bactrian camel  gct------c----------------cgc----------gg-ccg
B D                   Dolphin  gcc------c----------------agt----------gg-ccg
                 Killer whale  gcc------c----------------agt----------gg-ccg
             Tibetan antelope  gcc------c----------------tgt----------gg-cta
B D                       Cow  gcc------c----------------tgt----------gg-cta
B D                     Sheep  gcc------c----------------tgt----------gg-cta
B D                     Horse  --------------------------ggc----------gg-ccg
B D          White rhinoceros  --------------------------tgc----------cg-ccg
B D                       Cat  gcc------ccgcagccccgcagcttagc----------gg-ccg
B D                       Dog  gcc------c----------------cgc----------ag-cgg
B D                   Ferret   gcc------c----------------agc----------cg-cga
B D                     Panda  gcc------c----------------agc----------gg-cgg
               Pacific walrus  gcc------c----------------agc----------gg-cag
                 Weddell seal  gcc------c----------------agc----------gg-cag
             Black flying-fox  gcc------c----------------agc----------gg-ctg
B D                   Megabat  gcc------c----------------agc----------gg-ctg
                Big brown bat  gcc------c----------------cgc----------gg-ctg
         David's myotis (bat)  gcc------c----------------cgc----------gg-ctg
B D                  Microbat  gcc------c----------------cgc----------gg-ctg
B D                  Hedgehog  tc-------t----------------tgc----------ag-ctc
B D                     Shrew  gccgggcggc----------------ggc----------gg-ctg
              Star-nosed mole  gcc------c----------------agc----------gg-ttg
B D                  Elephant  gcc------c----------------cgc----------gg-ccg
          Cape elephant shrew  gcc------c----------------cgc----------gg-ccg
B D                   Manatee  gcc------c----------------cgc----------gg-ccg
             Cape golden mole  g--------c----------------cgc----------cg-ccg
B D                    Tenrec  gcc------c----------------cgc----------tg-cca
                     Aardvark  gtc------t----------------c-------------g-ccg
B D                 Armadillo  gcc------c----------------cgc----------gg-ccg
  D       Collared flycatcher  gcc------c----------------agg----------gg-ctc
B D        American alligator  gcc------c----------------gggcatgggcggcgg-ccc
  D            Painted turtle  gct------------------------------------ga-cct
               Domestic goat  =============================================
B D                Coelacanth  =============================================
B D             X. tropicalis  =============================================
B D                    Lizard  =============================================
  D    Spiny softshell turtle  ---------------------------------------------
  D  Chinese softshell turtle  =============================================
  D           Green seaturtle  =============================================
B D                    Turkey  =============================================
B D                   Chicken  =============================================
  D              Mallard duck  =============================================
B D                Budgerigar  =============================================
          Tibetan ground jay  =============================================
B D               Zebra finch  =============================================
B D       Medium ground finch  =============================================
  D    White-throated sparrow  =============================================
  D          Peregrine falcon  =============================================
  D              Saker falcon  =============================================
  D               Rock pigeon  =============================================
B D                   Wallaby  =============================================
B D                   Opossum  =============================================
B D           Tasmanian devil  =============================================

Inserts between block 4 and 5 in window
B D       American alligator 3bp

Alignment block 5 of 1519 in window, 78188932 - 78189246, 315 bps 
B D                     Human  cgccgcagagtcg--ggc--------ttcctg-------------gatacata----g-aggc-------
B D                     Chimp  cgccgcagagtcg--ggc--------ttcctg-------------gatacata----g-aggc-------
B D                   Gorilla  cgccgcagagtcg--ggc--------ttcctg-------------gatacata----g-aggc-------
B D                 Orangutan  cgctgcagagtcg--ggc--------tccctg-------------gatacatg----g-aggc-------
B D                    Gibbon  cgccgcagagtcg--ggc--------tccctg-------------gatacata----g-aggc-------
B D                    Rhesus  cgccgcacagtcg--ggc--------tccctg-------------ggtgcata----g-agcc-------
B D       Crab-eating macaque  cgccgcacagtcg--ggc--------tccctg-------------ggtgcata----g-agcc-------
B D                    Baboon  cgccgcacagtcg--ggc--------tccctg-------------ggtgcata----g-agcc-------
B D              Green monkey  cgccgcacagtcg--ggc--------tccctg-------------ggtgcata----g-agcc-------
B D                  Marmoset  caccgcagagtcg--ggc--------tccctg-------------gatacata----c-aggc-------
B D           Squirrel monkey  cgccgcagagtcg--ggc--------tccctg-------------gatacata----c-aggc-------
B D                  Bushbaby  cgcctctgagtcg--ggc--------tttctg-------------ggtccata----c-aggc-------
           Chinese tree shrew  cgccgcagagcc---agc--------tctctg-------------ggtaccta----c-ccgc-------
B D                  Squirrel  cgccgcagagtcg--ggc--------tgcccg-------------ggtccata----c-aggg-------
       Lesser Egyptian jerboa  cgccgcagagttg--gac--------tccctg-------------agtccatccgcac-aggg-------
                 Prairie vole  cgcagaagagttt--cac--------tgtcct-------------ggtccatc----t-gggg-------
B D           Chinese hamster  cgcagcagagttt--cac--------tgccca-------------ggtccgtc----t-aggg-------
               Golden hamster  cgcagcagagttt--cac--------tgccta-------------ggtccgtc----t-aggg-------
B D                     Mouse  cgc-----agttg--cac--------tgccca-------------ggtccatc----t-aggg-------
B D                       Rat  cgcagcagagttg--cac--------tgccca-------------ggtccatc----t-aggg-------
B D            Naked mole-rat  cgccacagaatct--gaa--------tccctg-------------agttcata----c-aggg-------
B D                Guinea pig  cgctgcagaatcc--gga--------tccctg-------------ggttcata----c-agga-------
                   Chinchilla  agccgcagaatcg--gga--------tccttg-------------ggtttata----c-aggg-------
             Brush-tailed rat  agccgcagaatca--gga--------tccttg-------------ggttcata----t-aggc-------
B D                    Rabbit  cgccgcagaatcg--ggc--------tcttca-------------ggcacaga----c-ggac-------
B D                      Pika  cgccgcagcatcg--ggc--------tcctca-------------ggcacaga----c-aggc-------
B D                       Pig  cgcggttgagtcg--agc--------tgccgt-------------g----gga----c-tggc-------
B D                    Alpaca  cgccgctgagtcg--gac--------tgcctg-------------g----cta----c-atgc-------
               Bactrian camel  cgccgctgagtct--gac--------tgtctg-------------g----cta----t-atgc-------
B D                   Dolphin  cgccgctgagttg--ggc--------tcccct-------------g----ttc----c-aaac-------
                 Killer whale  cgccgctgagttg--ggc--------tcccct-------------g----ttc----c-agac-------
             Tibetan antelope  cgccgttgagtcg--agc--------tcccca-------------g----tta----c-agac-------
B D                       Cow  cgccgctgagtcg--agc--------tcccca-------------g----tta----c-agac-------
B D                     Sheep  cgccgttgagtcg--agc--------tcccca-------------g----tta----c-agac-------
                Domestic goat  cgccacggactgt--agc--------ctccca-------------ggctcctc----c-atcc-------
B D                     Horse  caccgctgagtcg--ggc--------tgcctg-------------g----gta----c-aggc-------
B D          White rhinoceros  cgccgctgagtcg--gac--------ttcctg-------------g----gta----c-gggc-------
B D                       Cat  cgcggctgagtcg--agc--------tccctg-------------g----gta----c-aagc-------
B D                       Dog  cgcggctgacttg--ggc--------tccctg-------------g----gta----c-aagc-------
B D                   Ferret   cgcggctgattcg--gac--------tccctg-------------g----gtt----c-aagc-------
B D                     Panda  agctgctgactcg--ggc--------tcccgg-------------g----gtt----c-aagc-------
               Pacific walrus  cgcggctgactcg--gga--------tccctg-------------g----gtt----c-aagc-------
                 Weddell seal  cgcggctgactcg--gga--------tccctg-------------g----gtt----c-aagc-------
             Black flying-fox  cgcctctgaatca--ggc--------tttctg-------------g----gta----c-agga-------
B D                   Megabat  cgcctctgaatca--ggc--------tttctg-------------g----gta----c-agga-------
                Big brown bat  cgcctctgagtca--ggc--------ttcctg-------------g----ata----g-aggc-------
         David's myotis (bat)  cgcctctgagtcg--ggc--------ttcccg-------------g----aca----g-aggc-------
B D                  Microbat  cgcctctgagtcg--ggc--------ttcccg-------------g----ata----g-aggc-------
B D                  Hedgehog  aggcgccgggtccggggc--------cgcctgagggctgagctgcg----ctg----c-aggtcacccgg
B D                     Shrew  cgcggcggggtca--ggc--------cgcctg-------------g----gca----g-aggt-------
              Star-nosed mole  cgctgctgagtcc--tcc--------ttactg-------------g----cta----c-aggc-------
B D                  Elephant  cgctgcagagtcg--ggc--------tctttc-------------g----gtt----c-aggc-------
          Cape elephant shrew  agccgcagagttg--ggc--------tctttg-------------a----aca----c-agat-------
B D                   Manatee  cgccgcagggtcg--ggc--------tctttg-------------g----gta----c-aggc-------
             Cape golden mole  cgccgcagagtct--ggc--------tgtctg-------------a----gta----c-agtc-------
B D                    Tenrec  cgccgcagagt-t--ggc--------tctctg-------------g----gtt----c-aggt-------
                     Aardvark  cgccgcagagtcg--ggt--------tctctg-------------g----gta----c-agga-------
B D                 Armadillo  cgccgcagagtcg--gtg--------tctcca-------------g----gca----c-aggc-------
  D       Collared flycatcher  agccccgag-cct--ggcgcaggcagaccaca-------------g------t----g-tggc-------
B D        American alligator  agccccgcgccct--ggc--------accgcg-------------g------a----gccggc-------
  D            Painted turtle  gaccacaggggct--gaa--------gcagag-------------g------a----g-atgc-------
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ttgtgccaggcgggg-t--------ggg-aa----------ga-ct------------------ggattt
                        Chimp  ttgtgccaggccggg-t--------ggg-aa----------ga-ct------------------ggattt
                      Gorilla  ttgtgccaggcgggg-t--------ggg-aa----------ga-ct------------------ggattt
                    Orangutan  ttgtgccaggcgggg-t--------ggg-aa----------ga-ct------------------ggattt
                       Gibbon  ttgtgccaggcgggg-t--------ggg-aa----------ga-ct------------------ggattt
                       Rhesus  ttgtgccaggcaggg-t--------ggg-aa----------ga-ct------------------ggattt
          Crab-eating macaque  ttgtgccaggcaggg-t--------ggg-aa----------ga-ct------------------ggattt
                       Baboon  ttgtgccaggcaggg-t--------ggg-aa----------ga-ct------------------ggattt
                 Green monkey  ttgtgccaggcaggg-t--------ggg-aa----------ga-ct------------------ggattt
                     Marmoset  ttgtgccaggcgggg-t--------agg-aa----------ga-ct------------------ggattt
              Squirrel monkey  ttgtaccgggctggg-t--------agg-aa----------ga-ct------------------ggattt
                     Bushbaby  ttgtgtagagcaggg-t--------ggg-aa----------ga-tt------------------ggactt
           Chinese tree shrew  tagtgcagagcaggg-t--------agg-aa----------ga-ct------------------ggactt
                     Squirrel  tagtgcagagctggg-t--------ggg-aa----------ga-tt------------------ggactt
       Lesser Egyptian jerboa  ttgtgccgaacgggg-t--------gtg-aa----------gaatt------------------gcactt
                 Prairie vole  ttatgcggagcgggg-t--------ggg-tg----------gagtt------------------ggacat
              Chinese hamster  ttatgcggagcgggg-t--------ggg-tg----------gagtt------------------ggccat
               Golden hamster  ttgtgcggagcgggg-t--------ggg-tg----------gagtt------------------gaccat
                        Mouse  ttgtgcggagcgggg-t--------ggg-tg----------gagtt------------------ggacat
                          Rat  ttgtgcggagcgggg-t--------ggg-tg----------gagtt------------------ggacat
               Naked mole-rat  ttgtgcagagcaggg-t--------gga-ag----------ga-tt------------------ggact-
                   Guinea pig  ttgtgcagagcaggg-t--------ggg-aa----------ga-tt------------------ggactt
                   Chinchilla  ttgtgcagagcaggg-t--------ggg-aa----------ga-tt------------------ggactt
             Brush-tailed rat  ttgtgcagagctggg-t--------ggg-aa----------ga-tt------------------acactc
                       Rabbit  ttgtgcagagcggag-t--------gtg-aa----------ga-tt------------------ggactt
                         Pika  ttgtgcagagcggagcc--------ggg-ga----------ga-tt------------------ggactt
                          Pig  ttgtgcagagctggg-t--------gga-ga----------gg-ct------------------gggctt
                       Alpaca  ttgtgcagagtgggg-t--------gga-ga----------gg-tt------------------ggactt
               Bactrian camel  ttgtgcagagcgggg-t--------gga-ga----------gg-tt------------------ggactt
                      Dolphin  ttgtgcagag-cggg-t--------gga-ga----------gg-tt------------------gggctt
                 Killer whale  ttgtgcagag-cggg-c--------gga-ga----------gg-tt------------------gggctt
             Tibetan antelope  ttgtgctgggccggg-t--------gga-ga----------gg-tt------------------gggctt
                          Cow  ttgtgcagggccggg-t--------gga-ga----------gg-tt------------------gggctt
                        Sheep  ttgtgcagggccggg-t--------gga-ga----------gg-tt------------------gggctt
                Domestic goat  gtggacagttccagg-c--------aag-aatcctagagtggg-tt------------------gccttt
                        Horse  ttgtgcagagcgggg-c--------ggg-ga----------gg-tt------------------ggac-t
             White rhinoceros  ttgtgcagagcccgg-t--------ggg-ga----------gg-ct------------------ggactt
                          Cat  ttgtacagagctggg-t--------ggg-ga----------gt-tt------------------ggactt
                          Dog  ttgtacagagctggg-t--------ggg-ga----------gt-tt------------------ggactt
                      Ferret   ttgtgcagagctggg-t--------ggg-ga----------gt-tt------------------ggactt
                        Panda  ttgtgcagagctggg-t--------ggg-ga----------at-tt------------------ggactt
               Pacific walrus  ttgtgcagagctggg-t--------ggg-ga----------gt-tt------------------ggactt
                 Weddell seal  ttctgcagagctggg-t--------ggg-ga----------gt-tt------------------ggactt
             Black flying-fox  ttgtgcaaagacggg-t--------ggg-ga----------gg-tt------------------gaacct
                      Megabat  ttgtgcaaagacggg-t--------ggg-ga----------gg-tt------------------gaacct
                Big brown bat  ttgtgc--agagggg-t--------ggg-ga----------g----------------------------
         David's myotis (bat)  ttgtgcagagagggg-c--------ggg-ga----------g----------------------------
                     Microbat  ttgtgcagagagggg-t--------ggg-ga----------g----------------------------
                     Hedgehog  ctgggtagagcggga-t--------cgg-ct----------gg-tt------------------ggacgt
                        Shrew  gtgtgcgccgc-gga-c--------ggc-gg----------tg-ct------------------ggactt
              Star-nosed mole  ttgtgcagagcagga-t--------agg-ga----------gg-tt------------------agactt
                     Elephant  ttgtgtagagcaagg-t--------gga-ga----------ga-tt------------------ggactt
          Cape elephant shrew  ttgtgcagagcaggg-t--------gga-ga----------gt-tt------------------ggactt
                      Manatee  ttctgcggagcaagg-t--------aga-ga----------ga-ct------------------ggactt
             Cape golden mole  ttgtgcagagcaggg-t--------gga-ga----------ca-ct------------------ggactt
                       Tenrec  tcgtgcagagcaggg-t--------gaa-ga----------ga-ct------------------gggctt
                     Aardvark  ttgtgcggaacaggg-t--------gga-ga----------ga-tt------------------agtctt
                    Armadillo  ttgtgcagctcgggg-t--------gca-ga----------gg-cc------------------ggactt
          Collared flycatcher  cactgctggccaggg-c--------agc-ct----------gg-ccccca--------------gaacac
           American alligator  tccttcccgccggag-ccc-----gggcgcc----------gg-ctgccagttgcgggcagagggggcgc
               Painted turtle  ccctggagcccgcgt-cccgccatgggc-tc----------ta-ctacta-----------------tgc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  tgc--agt---ggaagcagcatctcttccgtct----gggacctggctgagg---gcgtccccac-cct-
                        Chimp  tgc--agt---ggaagcagcatctcttccgtct----gggacctggctgagg---gcgtccccac-cct-
                      Gorilla  tgc--agt---ggaagcagcatctattccgttt----gggacctggctgagg---gcgtccccac-cct-
                    Orangutan  tgc--agt---ggaagcagcatctcttccgtct----gggacctggctgagg---gcgtccccac-cct-
                       Gibbon  tgc--agt---ggaagcagcatctcttccgtct----gggacctggctgagg---gcgtccccac-cct-
                       Rhesus  tgc--agt---ggaagcagcatctcttccatct----gggacctggctgagg---gcgtccccac-cct-
          Crab-eating macaque  tgc--agt---ggaagcagcatctcttccatct----gggacctggctgagg---gcgtccccac-cct-
                       Baboon  tgc--agt---ggaagcagcatctcttccatct----gggacctggctgagg---gcgtccccac-cct-
                 Green monkey  tgc--agt---ggaagcagcatctcttccatct----gggacctggctgagg---gcgtccccac-cct-
                     Marmoset  tgc--agt---ggaagcagcatctcttccgtct----gggacctggcggagg---gcgtccccac-cct-
              Squirrel monkey  tgc--agt---ggaagcagcatctcttccttct----gggacctggcggagg---gcgtctccac-cct-
                     Bushbaby  tgc--agt---agaagcagcatccctccggtct----gggaccaggcggagg---gcgtccccaa-cct-
           Chinese tree shrew  cgc--agt---gaaggtagcatccccgcggtcc----aggaccgg---gagg---gcgtccccac-ccg-
                     Squirrel  tgc--agt---ggctgcagcatccttgcggtct----gggacctggcggagg---gcgaccccac-cct-
       Lesser Egyptian jerboa  tgc--agt---ggaagcagcatccccgtcatct----gggaccc--------------------c-tct-
                 Prairie vole  cac--ggt---ggcggcagcatccctgaggtct----gggaccc--------------------c-cct-
              Chinese hamster  cac--tgt---ggcagcagcatccctgaggtct----cggaccc--------------------c-tct-
               Golden hamster  cac--tgt---ggcagcagcatcccttaggtct----cggaccc--------------------c-tct-
                        Mouse  cacaaagt---agcagcagcatccctgcggtct----gggaccc--------------------c-tcg-
                          Rat  cac--tgt---agcagcagcatccctgcgttct----gggaccc--------------------c-ccg-
               Naked mole-rat  tgc--agt---agaagcagcatccctgtagtct----gggacctggaggagg---acgaccccac-cct-
                   Guinea pig  tgc--aat---agaagcagcatcc-------ct----gggacgtggtggagg---gagacgccac-cctg
                   Chinchilla  tgc--agt---agaagcagcatccctgtagtct----gggacctggtggaga---gcgaccccac-cct-
             Brush-tailed rat  tgc--act---agaagcagcgtccccgtggtct----gggacctggtggaga---gcgaccccac-cct-
                       Rabbit  tgc--ggt---ggaagcagcatccttgtggtct----gggacctggcggagg---gcgaccccac-cct-
                         Pika  tgc--agt---gggagcagcagccctgtggtct----gggacctggcggagg---gcgaccccac-cca-
                          Pig  tgc--agt---ggaagcagcatctttgccagct----ggaacctggcagagg---gcgtccccac-tcc-
                       Alpaca  tgc--agt---ggaagcagcatccctgctgtct----gggacctggcggagg---gcgtccccac-ttc-
               Bactrian camel  tgc--agt---ggaagcagcatccctgctgtct----gggacctggcggagg---gcgtccccac-ttc-
                      Dolphin  ttc--agt---ggaagcagcatccctgccgtcc----gggacctggcggagg---gcgtctccac-tct-
                 Killer whale  ttc--agt---ggaagcagcatccctgccgtcc----gggacctggcggagg---gcgtctccac-tct-
             Tibetan antelope  tgc--agt---ggaagcagcatccctgccgtct----gggactgggcggcgg---gcgcccccac-tcc-
                          Cow  tgc--agt---ggaagcagcatccctgctgtct----gggacttggcggagg---gcgtccccac-tcc-
                        Sheep  tgc--agt---ggaagcagcatccctgccgtct----gggacttggcggcgg---gcgcccccac-tcc-
                Domestic goat  tcc--ttc---tccagcagcatccctgccgtct----gggacttggcggcgg---gcgcccccac-tcc-
                        Horse  tgc--agt---ggaagcagcatccctgcagtct----gggacttggcggagg---gcgtccccac-tcg-
             White rhinoceros  tgc--agt---ggaagcagcatccctgccgcct----gggacttggcggagg---gcgtcctcac-tca-
                          Cat  tgc--agt---ggaagcagcatccctgcctgctgagcgggacctggtggagg---gcgtccccac-tcc-
                          Dog  tgc--agt---gagagcagcatccctgccggct----gggacttggcggagg---gcgtccccac-tcc-
                      Ferret   tgc--agt---gaaggcagcatccctgccggct----gggacctggcggagg---gcgtccccac-tcc-
                        Panda  tgc--agt---gaaagcagcatccctgccagct----gggacctggcggagg---gcgtccccac-tcc-
               Pacific walrus  tgc--agt---gaaagcagcatccctgccggct----gggacctggcggagg---gtgtccccac-tcc-
                 Weddell seal  tgc--agt---gaaagcagcatccctgccggct----gggacctggcggagg---gcgtccccac-tcc-
             Black flying-fox  tgc--agt---ggtaggagcatccctgttgtct----gggacctggcggagg---gcgtcctcac-tcc-
                      Megabat  tgc--agt---ggtaggagcatccctgttgtct----gggacctggcggagg---gcgtcctcac-tcc-
                Big brown bat  ------gt---ggaagcagcatccc-gctatct----gggacctggtggagg---gcgtcgtcac-tta-
         David's myotis (bat)  ------gt---ggaggcagcgtccc-tctatca----gggacctggcggagg---gcgtcgtccc-ttc-
                     Microbat  ------gt---ggaggcagcatccc-gctatcg----gggacctggcggagg---gcgtcgtccc-ttc-
                     Hedgehog  tcc--tgg----ggagcagcatccctgccggct----gggagctgacggagg---gcgtctccacaccg-
                        Shrew  ttc--cac----cgcgcagcatccctgacgtcg----gggacccggcggagg---gcggccccgc-tcg-
              Star-nosed mole  ttc--agt---gcaagcagcatccttgccatct----gggacctggcggagg---gcgtcaccgc-ccg-
                     Elephant  tgc--agt---ggcagcagcatctctgccgttt----gggacctggaggagg---gcgtccccat-ccc-
          Cape elephant shrew  tgc--agt---ggaaatagcatcccagccatct----gagacctggcggagg---gcgtccccat-ccc-
                      Manatee  tgc--agt---ggaagcagaatccctgccgttt----gggacctggcggagg---gcgtccccat-ccc-
             Cape golden mole  tgc--agt---ggaagcagcatccctgctgtct----gggatct-gcggagg---gtgtccctgt-ccc-
                       Tenrec  tgc--agt---ggaagcagcatccctgccgcct----gggacctaacagagg---gcatccccat-ccc-
                     Aardvark  tgc--agt---agaagcagcatccctgccgtct----gggacctggcggagg---gcgtccccat-ccc-
                    Armadillo  tgt--ctt---ggaagccgcatccctgcggcct----gggacct---ggagg---gcatccccac-ccc-
          Collared flycatcher  cgc--cgt---gggatc--------ctccacct----ccgccgccgtgggca---gcatcctcag-cga-
           American alligator  cgc--tttctaggcagc--------tcttgctt----gcgcaccgggaggtgtgcgagcgcccag-cga-
               Painted turtle  ccc--tga---tgcaac----------ccacct----g-gctttcctgggtgt--ggacgagcag-cgg-
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                        Chimp  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                      Gorilla  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                    Orangutan  ----g------------------------------a-----g----gggagcagaggaccagccctgacc
                       Gibbon  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                       Rhesus  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
          Crab-eating macaque  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                       Baboon  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                 Green monkey  ----g------------------------------g-----g----gggagcagaggaccagccctgacc
                     Marmoset  ----t------------------------------g-----g----gggagcagaggacctgccctgacc
              Squirrel monkey  ----g------------------------------g-----g----gggagcagaggacccgccctgacc
                     Bushbaby  ----g------------------------------ggttgtg----gggagcagagggcccaccctgacc
           Chinese tree shrew  ----g------------------------------g-----g---tgggagcagaagactcgccctgacc
                     Squirrel  ----g------------------------------g-----g----gggagtagaggacccgccctgacc
       Lesser Egyptian jerboa  ----g-----------ttgtgcggggggaagggggc-----g----gagagcagaggacccgccctgacc
                 Prairie vole  ----g-----------g------------------a-----g----gggagcggaggacccgccctgacc
              Chinese hamster  ----g-----------t------------------a-----g----gggagcggaggacccgccctgacc
               Golden hamster  ----g-----------t------------------a-----g----gggagtcgaggacccgccctgacc
                        Mouse  ----g-----------t------------------a-----g----gggagcggaggacccgccctgacc
                          Rat  ----g-----------t------------------a-----g----gggagcggaggatccgccctgacc
               Naked mole-rat  --ggg-----------g------------------g-----g----gggggcagtggactcgccctgacc
                   Guinea pig  ggggg-----------g------------------g-----g----ggggacagtggacccgccctgatc
                   Chinchilla  ----g-----------g------------------g-----g----gggaacagtggacccgccctgacc
             Brush-tailed rat  ----------------g------------------g-----g----gggaacagtggacccgccctgacc
                       Rabbit  ----a------------------------------g-----g----gggagcagaggacccgccctgacc
                         Pika  ----a------------------------------g-----g----gggagcagaggacccgccctgacc
                          Pig  ----g------------------------------g-----g----ggaagcaaaggacccgccctgacc
                       Alpaca  ----g------------------------------g-----g----ggaagcaaaggg-cagccctgacc
               Bactrian camel  ----g------------------------------g-----g----ggaagcaaagggccagccctgacc
                      Dolphin  ----g------------------------------g-----g----ggaagcaaaggacccgccctgacc
                 Killer whale  ----g------------------------------g-----g----ggaagcaaaggacccgccctgacc
             Tibetan antelope  ----g------------------------------g-----g----gaaagccaaggacccgccctgacc
                          Cow  ----g------------------------------g-----g----ggaagccaaggacccgccctgacc
                        Sheep  ----g------------------------------g-----g----gaaagccaaggacccgccctgacc
                Domestic goat  ----g------------------------------g-----g----gaaagccaaggacccgccctgacc
                        Horse  ----g------------------------------g-----g----gtgggcagaggacccgccctgacc
             White rhinoceros  ----g------------------------------g-----g----gtgggcagaggacccgccctgacc
                          Cat  ----a------------------------------g-----g----gggagcagaggactcgccctgacc
                          Dog  ----a------------------------------g-----g----gggagcagaggactcgccctgacc
                      Ferret   ----a------------------------------g-----g----gggagcagaggactcgccctgacc
                        Panda  ----a------------------------------g-----g----gggagcagaggactcgccctgacc
               Pacific walrus  ----a------------------------------g-----g----gggagcagaggactcgccctgacc
                 Weddell seal  ----a------------------------------g-----g----gggagcagaggactcgccctgacc
             Black flying-fox  ----g------------------------------t-----g----gggagcagaggaaccaccttgacc
                      Megabat  ----g------------------------------t-----g----gggagcagaggaaccaccttgacc
                Big brown bat  ----g------------------------------g-----g----agaagcaaaggacccgccctgacc
         David's myotis (bat)  ----g------------------------------g-----g----ggaagcagaggacccgccctgacc
                     Microbat  ----g------------------------------g-----g----ggaagcagaggacccgccctgacc
                     Hedgehog  ----g------------------------------g-----g----ggcagtcggggacccg-cctgatc
                        Shrew  ----g------------------------------g-----g----tagcgcagaggactcgccct--cc
              Star-nosed mole  ----g------------------------------g-----t----gggagtcgaggacccgccctgacc
                     Elephant  ----g------------------------------g-----g----gggagcagcggatccgccctgacc
          Cape elephant shrew  ----a------------------------------a-----g----gggagcagtggatccgccctgact
                      Manatee  ----g------------------------------t-----g----aggagcagaggatccgccctgacc
             Cape golden mole  ----g------------------------------c-----a----gggagctaaggatccgccctgacc
                       Tenrec  ----a------------------------------c-----a----gggagcagaggatccgccctgacc
                     Aardvark  ----g------------------------------g-----g---tgggagcagaggatccgccctgacc
                    Armadillo  ----g------------------------------g-----gggcggggagctgaggacccgccctgatc
          Collared flycatcher  ----gtccggggtgccc------------------a-----t----caactcggggg----gctttgggc
           American alligator  ----g--cgggacgccc------------------g-----g----cagggcagcgg----gacccgctg
               Painted turtle  ----g------------------------------g-----g----ctatacagcca----gctcttctc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  tagcc-gggccc----------agcctcg-tcctgcccggcctg---ag-cgccccgcc-cagcagccgg
                        Chimp  tagcc-gggccc----------agcctcg-tcctgcccggcctg---ag-cgccccgcc-cagcagccgg
                      Gorilla  tagcc-gggccc----------agcctcg-tcctgcccggcctg---ag-cgccccgcc-cagcagccgg
                    Orangutan  tagcc-gggccc----------agccttg-tcctgcccggcctg---agcccccccgtc-cagcagccgg
                       Gibbon  tagcc-gggccc----------agcctcg-ttctgcccggcctg---ag-cgccccgcc-cagcagccgg
                       Rhesus  tagcc-gggccc----------agccctg-tcctgcccggccgg---ag-cgccccgcc-cagcagccgg
          Crab-eating macaque  tagcc-gggccc----------agccctg-tcctgcccggcctg---ag-cgccccgcc-cagcagccgg
                       Baboon  tagcc-gggccc----------agccctg-tcctgcccggcctg---ag-cgccccgcc-cagcagccgg
                 Green monkey  tagcc-cggccc----------agccctg-tcctgcccggcctg---ag-cgccccgcc-cagcagccgg
                     Marmoset  tagcc-gggctc----------agcctcg-tccaggccggcctg---ag-cgccccgcc-cagcagccgg
              Squirrel monkey  tagcc-gggctc----------agcctcg-tccagcgcggcctg---ag-cgccccgcc-cagcagccag
                     Bushbaby  tagc---------------------------------cggcctg---ag-agccccgcc-caggagccgg
           Chinese tree shrew  tagtc-cggccc----------agcctag-cccttcccg--ctg---ag-cgccccgcc-caagagccgg
                     Squirrel  tagct-tggccc----------agcctag-tcctgcccggcctg---ag-caccccgcc-caggagccgg
       Lesser Egyptian jerboa  tagtc-cggccc----------agccttg-tccagtctggcttg---ag-cgccccgcc-caggagctgg
                 Prairie vole  tcgcc-cggccc----------agcctag-tccagcctggcccg---ag-cgccccgcc-caggagtggg
              Chinese hamster  tagcc-tggccc----------agcctcg-tccagcctggccct---ag-cgccccgcc-caggagtggg
               Golden hamster  tagcc-ggactc----------agcctcg-tccatcctggccct---ag-cgccccgcc-caggagtggg
                        Mouse  tcgac-tggccc----------agcctag-tctagtccggccca---tg-cgccccgcc-caggagtggg
                          Rat  tagcc-tggccc----------agcctag-tctagcctggccca---ag-cgccccgcc-caggagtggg
               Naked mole-rat  tagtc-cggccc----------agcctag-ttcttctgggtccg---ag-cgccccgcc-caagagccgg
                   Guinea pig  tagcc-cggccc----------agcctag-ttctgcggggcctg---ag-cgccccgcc-caggagctgg
                   Chinchilla  tagcc-tggccc----------agcctag-ttctgctgggcctg---gg-cgccccgcc-caggagccgg
             Brush-tailed rat  tagcc-cggccc----------agcctag-tcctgctgggccta---ag-cgccccgcc-caggagccgg
                       Rabbit  tagcg-cggccc----------agcctag-ttctgcccggcctg---ag-agccccgcc-caggagccgg
                         Pika  tagcg-cggccc----------aggctag-tcctgcccggcctg---ag-cgccccgcc-cgggagcggg
                          Pig  tagcc-tggccc----------aggctgg-tccagcctggcctg---ag-cgccccgcc-cgggagccgg
                       Alpaca  tatcc-tggcct----------agactgg-tcctgcccagcctg---ag-ccctccgtc-caggagccgg
               Bactrian camel  tatcc-tggcct----------agactgg-tcctgcccagcctg---ag-ccctccgtc-caggagccgg
                      Dolphin  tagcc-tggccc----------agcctgg-tcctgcccggcctg---ag-cgccccgcc-caggagctga
                 Killer whale  tagtc-tggccc----------agcctgg-tcctgcccggcctg---ag-cgccccgcc-caggagctga
             Tibetan antelope  tcgcc-tggccc----------agcctggctccttcccgcccag---ag-ctcccctccttaggagctga
                          Cow  tcgtc-tggccc----------agcctggctccttcccggccag---ag-ctcccctccttaggagctga
                        Sheep  tcgcc-tggccc----------agcctggctccttcccggccag---ag-ctcccctccttaggagctga
                Domestic goat  tcgcc-tggccc----------agcctggctccttcccggccag---ag-ctcccctccttaggagctga
                        Horse  tagcc-tggccc----------agtctag-tcctgctgggcctg---ag-cgccccgcc-caggagccgg
             White rhinoceros  tagcc-tggccc----------ggtctag-tcctgccgggcctg---ac-cgccccacc-caggagcctg
                          Cat  tagcc-tggcct----------agcctag-tcctgccaggcctg---ag-cgccccacc-caagagctgg
                          Dog  taggc-tggcct----------agcctag-tcctgccaggcctg---ag-cgccccgcc-caggagcctg
                      Ferret   tagcc-tggcct----------agcctag-tcctgccaggcctg---ag-cgccccgcc-caggagccgg
                        Panda  tagcc-tggcct----------agcctag-tcctgccaggcctg---ag-cgccccgcc-caggagccgg
               Pacific walrus  tagcc-tggcct----------agcctag-tcctgccaggcctg---ag-cgccccgcc-cagaagccgg
                 Weddell seal  tagcc-tggcct----------agcctat-tcctgccaggcctg---ag-cgccccgcc-cagaagccgg
             Black flying-fox  tagcc-tgtcct----------agcctag-tcctgccctgcctg---ag-cgccctgcc-caggacccgg
                      Megabat  tagcc-tgtcct----------agcctag-tcctaccctgcctg---ag-cgccctgcc-caggacccgg
                Big brown bat  tagcc-tggccc----------aggcgag-tgctgccccgcctg---ag-cgcc--gcc-cgggagcctg
         David's myotis (bat)  tagcc-tggccc----------agccgag-cgcggccccgccag---ag-cgcc--gcc-caggagcctg
                     Microbat  tcgcc-tggccc----------agccgag-tgcggccccgcccg---ag-cgcc--gcc-caggagcctg
                     Hedgehog  tctcc-cgaccc----------ggccttg-ttcggccgtaccc----ag-tgtccctcc-ccggagcagg
                        Shrew  cgagc-tcgccc----------cagcggg-gtctgcgccagctg---ac-cgccgcccc-cgcg---ccg
              Star-nosed mole  tcgcc-tggccc----------tgcctat-ttctaccagacctg---ag-cgcccctcc-caggaaccga
                     Elephant  tagcc-cggccc----------tgcctag-cccagcctggcctg---ag-cgccccgcc-caggagccgg
          Cape elephant shrew  tagcc-cggccc----------tgccttg-ccctgcctggcctg---ag-tgccccacc-caggagccga
                      Manatee  tagcc-cggccc----------tgcctag-cccggcccggcctg---ag-cgccccgcc-caggagccgg
             Cape golden mole  tagcc-cagccc----------agtctag-tcctgcccagcttg---ag-cgccccgcc-caggagccag
                       Tenrec  tagcc-cagtcg----------tgcctag-gctgggctcgcctg---aa-cgccccgcc-caggaaccgg
                     Aardvark  tagcc-cggccc----------tgcctag-cactgtccagcctc---ag-cgccctgcc-cagaagtcgg
                    Armadillo  tagcc-c---------------------------gcccggcctg---ag-caccccgcc-caggagccga
          Collared flycatcher  tctcg-gggctctctggccttggtggccg-ctactgcggccgcaggtgc-ctgccctgc-tagagccggg
           American alligator  ttgca-gcgcccgcggggccaggacccgg-ctctgcccgcctc----gc-cttgcctcg-tctcggcgcg
               Painted turtle  tagctcgggccaccaggaggtcctccccg-tccacgcggacgtggccag-cttcctccc-cggcggcctg
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ct-ct--------------ggcccacc-gg-----gg-tccgggaggtaa-gg----gggttg-------
                        Chimp  cc-ct--------------ggcccacc-gg-----gg-tccgggaggtaa-gg----gggttg-------
                      Gorilla  ct-ct--------------ggcccacc-gg-----gg-tccgggaggtaa-gg----gggttg-------
                    Orangutan  ct-ct--------------ggcccacc-gg-----gg-tctgggaggtaa-gg----gggttg-------
                       Gibbon  ct-ct--------------ggcccacc-gg-----gg-tccgggaggtaa-gg----gggttg-------
                       Rhesus  ct-ctg-cg-----gca-gggcccacc-cg-----gg-tccgggaggtga-gg----gggttg-------
          Crab-eating macaque  ct-ctg-cg-----gca-gggcccacc-cg-----gg-tccgggaggtaa-gg----gggttg-------
                       Baboon  ct-ctg-cg-----gca-gggcccacc-ca-----gg-tccgggaggtaa-gg----gggttg-------
                 Green monkey  ct-ctg-cg-----gca-gggcccgcc-gg-----gg-tccgggaggtaa-gg----gggttg-------
                     Marmoset  ct-cgg-ag-----gca-gggcccact-gg-----gg-tctgggaggtaa-gg----gggttg-------
              Squirrel monkey  ct-cgg-ag-----gca-gggcccact-gg-----ga-tctgggaggtaa-gg----gggttg-------
                     Bushbaby  ct-ttc-ag-----tca-aggcccact-ga-----gg-tcctagaggtaa-gg----gggctg-------
           Chinese tree shrew  ct-ctg-ag-----gca-gggcccact-gc-----gg-tccgagaggtaa-gg----gggctg-------
                     Squirrel  tt-ctg-ag-----gta-gggcccgct-ga-----gg-tccgggaggtaa-gg----gggctg-------
       Lesser Egyptian jerboa  ct-ctg-ag-----gtaggggcccact-ga-----gg-gccaggaggtaa-gg----gggtcc-------
                 Prairie vole  tt-ctg-ag-----gta-aggcctgct-ga-----ag-tccaggaggtaa-gg----gggccc-------
              Chinese hamster  tt-ctg-ag-----gta-aggcccact-ga-----ag-tccaggaggtaa-ga----gggccc-------
               Golden hamster  tt-ctg-ag-----gta-aggcccact-ga-----ag-tccaggaggtaa-ga----gggcct-------
                        Mouse  tt-cta-ag-----gta-aggccctct-ga-----ag-tctaggagttaa-gg----gggctt-------
                          Rat  tt-cta-ag-----gta-aggcccttt-ga-----ag-tctaggaggtaa-gg----gggttg-------
               Naked mole-rat  ct-cag-aa-----gta-gggaccact-ga-----ga-tctgagaggtaa-gg----gggctg-------
                   Guinea pig  ct-ctg-aa-----ata-g--accact-ga-----ag-tctgagaggtaa-gg----gggttg-------
                   Chinchilla  ct-ctg-ga-----gta-gggaccact-ga-----gg-tctgagaggtaa-gg----gtattg-------
             Brush-tailed rat  ct-ccg-aa-----gtg-ggcaccact-ga-----gg-tctgagaggtaa-gg----ggggtg-------
                       Rabbit  ct-ctg-ta-----gca-gagcccgct-ga-----aa-tctgggaggtaa-gg----gggctg-------
                         Pika  ct-ctgtta-----gca-gagcctgct-aa-----aa-ccggggaggtaa-gg----gggctg-------
                          Pig  ct-ctg-ag-----gca-gggaccact-gg-----gg-tcccagaggtaa-gt----gggct--------
                       Alpaca  ct-ctg-ag-----gca-ggggctact-gt-----gg-tccccgaggtaa-gg----gggct--------
               Bactrian camel  ct-ctg-ag-----gca-ggggctact-gt-----gg-tccccgaggtaa-gg----gggct--------
                      Dolphin  ct-ctg-ag-----gca-gggaccact-gg-----gg-ttccagaggtaa-gg----gggct--------
                 Killer whale  ct-ctg-ag-----gca-ggggccact-gg-----ggtttccagaggtaa-gg----gggct--------
             Tibetan antelope  ctcctg-ag-----gcc-ggggccatc-ag-----gc-ttccgaaggtaa-gg----gagct--------
                          Cow  ctcctg-ag-----gcc-ggggccacc-ag-----gc-ttccgaaggtaa-gg----ggact--------
                        Sheep  ctcctg-ag-----gcc-ggggccatc-ag-----gc-ttccgaaggtaa-gg----gagct--------
                Domestic goat  ctcctg-ag-----gcc-ggggccatc-ag-----gc-ttccgaaggtaa-gg----gagct--------
                        Horse  ct-ctg-ag-----gcg-ggggccact-gg-----gg-tcccagaggtaa-gg----gggctg-------
             White rhinoceros  ct-ctg-ag-----gca-ggggccact-gg-----gg-tcccagaggtaa-gg----gggctg-------
                          Cat  ct-ctg-ag-----gca-ggggccacc-gg-----gg-tcccagaggtaa-gg----gggtc--------
                          Dog  ct-ctg-ag-----gca-ggggccacc-gg-----gg-tcccggaggtaa-gg----gggccg-------
                      Ferret   ct-ctg-ag-----gcc-ggggctacc-gc-----gg-tcccagaggtaa-gg----gggctg-------
                        Panda  ct-ctg-ag-----gcc-ggggccacc-ga-----gg-tcccagaggtaa-gg----gggccg-------
               Pacific walrus  ct-ctg-ag-----gcc-ggggccacc-gg-----gg-tcccagaggtaa-gg----gggctg-------
                 Weddell seal  ct-ctg-ag-----gcc-ggggccacc-gg-----gg-tcccagaggtaa-gg----gggccg-------
             Black flying-fox  gt-ttc-ag-----gca-gaggccact-gg-----gt-tcccagaggtaaggg----gggttg-------
                      Megabat  gt-ttc-ag-----gca-gaggccact-gg-----gt-tcccagaggtaaggg----gggttg-------
                Big brown bat  ac-ctg-ag-----gca-g-gtccact-gg-----gg-tcacagaggtaa-gg----gggctg-------
         David's myotis (bat)  gt-ctg-ag-----gca-g-gtccact-gg-----gg-tcactgaggtaa-gg----gggctg-------
                     Microbat  gt-ctg-ag-----gca-g-gtccact-gg-----gg-tcacagaggtaa-gg----gggctg-------
                     Hedgehog  ct-c----------gtc-gggtctcct----------------caggtta--g----cgggtg-------
                        Shrew  ct-ccc-gg-----gca-gggctctctggg-----gg-cc--gcaggtaa--g----cggcgg-------
              Star-nosed mole  ct-ctg-ag-----gct-ggggccccttgg-----gg-tccgggaggtaa-gg----gggctg-------
                     Elephant  ct-ctg-ag-----gca-ggggccgct-ga-----gg-tcagggaggtaa-gg----gggctg-------
          Cape elephant shrew  ct-ccg-ag-----gca-ggggccact-g------gg-ttagggaggtaa-gg----gggcta-------
                      Manatee  ct-ctg-ag-----gca-aggaccgct-gg-----gg-tcagagaggtaa-gg----gggctg-------
             Cape golden mole  ct-ctg-ag-----gcc-ggggccact-gg-----gg-tctgggaggtaa-gg----gggctg-------
                       Tenrec  ct-cag-ag-----gca-ggcaccgct-gg-----gg-tctggaaggtaa-gg----gggctt-------
                     Aardvark  at-ctc-ag-----gca-ggggccgtt-gg-----gg-tcagggaggtaa-ga----tggcag-------
                    Armadillo  ct-ct--ag-----gcg-ggggccact-gg-----gg-tccgggaggtaa-gg----gggccc-------
          Collared flycatcher  cc-gca-cgtcca-gcg-agtgcctcc-cccaggaag-cccc--aggcca-gg----ggcccgactgagg
           American alligator  cc-gcg-gg-----gcg-gggaccctc-ct-----gg-ccc----ggccc-ggc-ccggcccggcccggc
               Painted turtle  tc-cct-ggtccacagg-ggcaccttc-gg-----gg-cat----gggaa-tgcgtcaagctgatccaga
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  --g-gg--gcg--tgtgactgt-----------------ctt------------------tg-gggg-gc
                        Chimp  --g-gg--gcg--tgtgtctgt-----------------ctt------------------tg-gggg-gc
                      Gorilla  --g-gg--gcg--tgtgtctgt-----------------ctt------------------tg-gggg-gc
                    Orangutan  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggg-gc
                       Gibbon  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggg-gc
                       Rhesus  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggg-gc
          Crab-eating macaque  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggg-gc
                       Baboon  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggg-gc
                 Green monkey  --g-gg--gag--tgtgtctgg-----------------ctt------------------tg-gggg-gc
                     Marmoset  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggt-ac
              Squirrel monkey  --g-gg--gcg--tgtgtctgg-----------------ctt------------------tg-gggt-ac
                     Bushbaby  --g-gg--gcg--tgtgtgcgg-----------------gtt------------------gg-aagt-gg
           Chinese tree shrew  --g-gg--gtg--tgtgtg-gg-----------------ttg------------------ag-ggtg-gc
                     Squirrel  --a-at--gtg--tatgtgttg-----------------ggg----------------gtct-gggg-gg
       Lesser Egyptian jerboa  --c-gggagtg--tgagtattg-----------------gtt----------------gatg-aggg-gg
                 Prairie vole  --t-gg--gtg--tgagtgctg-----------------gtg----------------gcag-gggt-gg
              Chinese hamster  --t-gg--gtg--tgagtgatg-----------------gtg----------------gcag-agag-ag
               Golden hamster  --t-gg--gtg--tgagtgatg-----------------gtg----------------gcaa-ggag-ag
                        Mouse  --t-gg--gtgtttgagtgctc-----------------atg----------------tcgg-ggggcgg
                          Rat  --t-gg--gtg--tgagcgctc-----------------gtg----------------tcag-ggag-gg
               Naked mole-rat  --g-gg--gtg--tgggtaaag-----------------gtc----------------------ggg-tg
                   Guinea pig  --g-ga--gtg--tggg--agt-----------------gtc----------------------ggg-tg
                   Chinchilla  --g-gg--gtg--tgggtaaag-----------------gtc----------------------ggg-tg
             Brush-tailed rat  --g-g-----a--tgagtagag-----------------gtt----------------------ttg-ta
                       Rabbit  --g-gg--gcg--tgtatgagg-----------------gtt----------------------aag-gg
                         Pika  --g-gg--gtg--t-tgtgagg-----------------gtc----------------------ggg-gt
                          Pig  --c-ag--gca--tgtttgcgg-----------------gtt----------------gggg-ggag-gg
                       Alpaca  --g-gg--gcg--tgtttgcag-----------------gtt-----------------ggg-ggag-gg
               Bactrian camel  --g-gg--gcg--tgtttgcag-----------------gtt-----------------ggg-ggag-gg
                      Dolphin  --g-gg--gcg--tgtgtgtag-----------------ctt----------------gggg-ggag-gg
                 Killer whale  --g-gg--gcg--tgtgtgtag-----------------ctt----------------gggg-ggag-gg
             Tibetan antelope  --g-gg--gcg--tgtgtgcgg-----------------ctt-----------------ggg-ggag-gg
                          Cow  --g-gg--gcg--tgtatgagg-----------------gtt-----------------ggg-ggag-gg
                        Sheep  --g-gg--gcg--tgtgtgcgg-----------------gtt-----------------gtg-ggag-gg
                Domestic goat  --g-gg--gcg--tgtgtgcgg-----------------gtt-----------------ggg-ggag-gg
                        Horse  --g-gg--gcg--tgtgtgcgg-----------------gtt----------------gagg-ggag-gg
             White rhinoceros  --g-gg--gcg--tgtgtgcgg-----------------gtt----------------gcgg-ggaa-gg
                          Cat  --g-gg--tcg--tgtgtgcag-----------------gtt----------------gtg-----g-gg
                          Dog  --g-gg--gcg--tgtgtgcag-----------------gtt----------------gtgg-ggag-gg
                      Ferret   --g-gg--gcg--tgtgtgc-g-----------------gtt----------------gtgg-ggag-gg
                        Panda  --g-gg--gcg--tgtgggcag-----------------gtt----------------gtgg-ggag-gg
               Pacific walrus  --g-gg--gcg--tgtgtgcag-----------------gtt----------------atgg-ggag-gg
                 Weddell seal  --g-gg--gcg--tgtatgcag-----------------gtt----------------atgg-ggag-gg
             Black flying-fox  --g-tg--gcg--tgtgtgcgg-----------------gtt----------------gggg-ggtg-gg
                      Megabat  --g-tg--gcg--tgtgtgcgg-----------------gtt---------------ggggg-ggtg-gg
                Big brown bat  --g-gg--cca--ggtgtgcgg-----------------gtt----------------gggg-ggag-gg
         David's myotis (bat)  --g-gg--cca--ggtgtgcgg-----------------att----------------cggg-ggag-gg
                     Microbat  --g-gg--cca--ggtgtgcgg-----------------gtt----------------cggg-ggag-gg
                     Hedgehog  --t-gg--gta--ccatcccgg-----------------ccg------------------gg-gatg-ca
                        Shrew  --g-gg--gcg--tgtgcgcgc-----------------cgc------------------gg-ggag-ca
              Star-nosed mole  --g-cg--gtg--tgtgtgcgg-----------------gtt------------------ga-ggga-ta
                     Elephant  --g-gg--gcg--tgtgtgcgg-----------------gtt---------------------gggg-ga
          Cape elephant shrew  --g-gg--gcg--tgtttgcga-----------------a-----------------------gtgg-ga
                      Manatee  --a-gg--gcg--tgtgtgcgg-----------------ggt-------------------ggaggg-ga
             Cape golden mole  --a-gg--gcg--tgtatgtag-----------------ggc-------------------g-gggg-ga
                       Tenrec  --g-gg--gct--tgtgtatgg-----------------ggt-------------------c-gggg-ga
                     Aardvark  --g-gg--gcg--tgtgtgccg-----------------ggt-------------------c-gggg-aa
                    Armadillo  --gcgg--gcg--tgttcgcgg-----------------g-----------------------gtgg-gg
          Collared flycatcher  ctg-ga--gct--gctggccagcgtttccagaggcctcgggcccccttaagggaggcaaacg-tggc-ca
           American alligator  ccg-gc--gct--gccgtcctg-------------cccgggc-----------------gtg-ttgg-aa
               Painted turtle  acg-ag--acg--gacgggccg-----------ctccccggc------------------ag-ccac-ga
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -g----------gtg------------------------tc--------tgcac-c------c---tggc
                        Chimp  -g----------gtg------------------------tc--------tgcac-c------c---tggc
                      Gorilla  -g----------gtg------------------------tc--------tgcac-c------c---tggc
                    Orangutan  -g----------gtg------------------------tc--------tgcac-c------c---tggc
                       Gibbon  -g----------gtg------------------------tc--------tgcac-c------c---tggc
                       Rhesus  -g----------gtg------------------------tc--------tgcac-a------c---aggc
          Crab-eating macaque  -g----------gtg------------------------tc--------tgcac-a------c---aggc
                       Baboon  -g----------gtg------------------------tc--------tgcac-a------c---aggc
                 Green monkey  -g----------gtg------------------------tc--------tgcac-c------c---aggc
                     Marmoset  -g----------gtg------------------------tc--------tacac-c------c---tagc
              Squirrel monkey  -a----------gtg------------------------tc--------tacac-c------c---tggc
                     Bushbaby  -g----------agg------------------------tc--------tgccc-c------c---tggc
           Chinese tree shrew  -g----------gtt------------------------tt--------tgcac-t------c---tggc
                     Squirrel  -g---------ggtg------------------------tc--------tgcac-c------c---tgac
       Lesser Egyptian jerboa  -g----------gtg------------------------tc--------agcac-c------c---tgac
                 Prairie vole  -g-gggcagacagtg------------------------tc--------tgcac-c------c---tgat
              Chinese hamster  -gggggcagagtgtg------------------------tc--------tgcac-c------t---tgat
               Golden hamster  -g-----------------------------------------------tgcac-c------t---tgat
                        Mouse  -g------ggcagtg------------------------tc--------tgcactc------t---tgac
                          Rat  -g------ggcagtg------------------------tc--------tgcac-c------c---tgac
               Naked mole-rat  -g----------gtg------------------------tc--------tgcat-t------t---tggc
                   Guinea pig  -g----------gtg------------------------tc--------tgcac-t------t---tggc
                   Chinchilla  -g----------gtg------------------------tc--------tgcac-t------t---gggc
             Brush-tailed rat  -g----------gtg------------------------tc---------gcac-t------t---tggt
                       Rabbit  -g----------gtg------------------------tc--------tgcac-c------c---tggc
                         Pika  -g----------gga------------------------tcggtggttttgtgc-c------c---tggc
                          Pig  -a----------gtg------------------------tc--------tgcac-c------c---taat
                       Alpaca  -a----------gtg------------------------tc--------tgcac-c------c---tcat
               Bactrian camel  -a----------gtg------------------------tc--------tgcac-c------t---tcat
                      Dolphin  -a----------gtg------------------------ac--------tgcac-c------c---agat
                 Killer whale  -a----------gtg------------------------ac--------tgcac-c------c---accc
             Tibetan antelope  -a----------gtg------------------------tc--------tgaac-catccttc---tgat
                          Cow  -a----------gtg------------------------tc--------tgaac-catccttt---tgat
                        Sheep  -a----------gtg------------------------tc--------tgaac-catccttc---tgat
                Domestic goat  -a----------gtg------------------------tc--------tgaac-catccttc---tgat
                        Horse  -a----------gtg------------------------tc--------tgcac-c------c---tggc
             White rhinoceros  -a----------gtg------------------------tc--------tgcac-c------c---tggc
                          Cat  -a----------gtg------------------------tc--------tgcac-c------c---tggc
                          Dog  -a----------gtg------------------------tc--------tgcac-c------c---cggc
                      Ferret   -a----------gtg------------------------tc--------tgcac-c--------------
                        Panda  -a----------gtg------------------------tc--------tgcac-c------c---gggc
               Pacific walrus  -a----------gtg------------------------tc--------tgcac-c------c---tggc
                 Weddell seal  -a----------gtg------------------------tc--------tgcac-c------c---tggc
             Black flying-fox  -a----------gtg------------------------tc--------tgcac-t------t---tgaa
                      Megabat  -a----------gtg------------------------tc--------tgcac-t------t---tgaa
                Big brown bat  -a----------gtg------------------------tc--------agcac-c------c---tgac
         David's myotis (bat)  -a----------gag------------------------tc--------agcac-c------c---tgac
                     Microbat  -a----------gtg------------------------tc--------agcac-c------c---tgac
                     Hedgehog  -g----------gtg------------------------tc--------tgc----------------gc
                        Shrew  -a----------gtg------------------------ta--------cgccc-c------------gc
              Star-nosed mole  ga----------gta------------------------tc--------tgact-c------t---tggc
                     Elephant  -g----------gtg------------------------tc--------tgcac-t------t---tggt
          Cape elephant shrew  -g----------gta------------------------tc--------ttcat-c------t---tggt
                      Manatee  -g----------gtg------------------------tc--------tgcac-c------t---tggt
             Cape golden mole  -g----------gtg------------------------tc--------tgcat-g------g---tgat
                       Tenrec  -g----------gta------------------------tt--------tgaac-c------g---tggt
                     Aardvark  -g----------gtg------------------------gc--------tgtac-c------t---tggt
                    Armadillo  -g----------ctg------------------------cc--------ctttc-c------c---tggc
          Collared flycatcher  -g----------ctgagtcttctgcctgtcctgctttcttc--------tgcgc-c------tcccctgc
           American alligator  -g----------ttg-------------------------c--------agcgc-c------t----gga
               Painted turtle  -g----------ata-------------------------------------ac-c------c----gga
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ctttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                        Chimp  gtttcgacaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                      Gorilla  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                    Orangutan  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                       Gibbon  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                       Rhesus  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
          Crab-eating macaque  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                       Baboon  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                 Green monkey  gtttcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                     Marmoset  gactcgagaa-ccg---t-------------g-gagt-----------------tg----cgagccc---
              Squirrel monkey  gattcgagaa-ccc---t-------------g-gact-----------------tg----cgagccc---
                     Bushbaby  atttggagaa-ccc---t-------------g-gaat-----------------tg----tgagccc---
           Chinese tree shrew  atttctagaa-ccc---tgactcaaaagtagg-gttc-----------------tg----agagcca---
                     Squirrel  gtttcaaaaa-tcc---c-------------g-gactt--gccc-tagggctc-tg----cgagccc---
       Lesser Egyptian jerboa  atttcgagaacccc---c-------------a-aactt--gcctacaaggacc-tg----agagccc---
                 Prairie vole  gtttccaggg-ctc---c-------------a-tactt--acctacagggttc-tg----agagcag---
              Chinese hamster  gcttcgaggg-ccc---c-------------a-tactt--acccgcagggtt--tg----agagctc---
               Golden hamster  tcttcgagag-ccc---c-------------a-tactt--acccgcagggttc-tg----agagctc---
                        Mouse  atttcgagtg-ctc---c-------------t-tactt--atctttaggactc-tg----agagcac---
                          Rat  atttc-agtg-ccc---c-------------a-tactt--ctcttcaggactcttg----agagcac---
               Naked mole-rat  ttttcaagaa-ccc---c-------------a-gactt--gcctgtgaggctc-tt----a-agtca---
                   Guinea pig  ttttcgagaa-ccc---t-------------a-gactt--gcctgtggggctg-ta----a-agtca---
                   Chinchilla  atttcaagaa-ccc---c-------------g-ggctt--gcctgtagggctc-ca----a-agtca---
             Brush-tailed rat  ttttcaagaa-ccc---c-------------g-gactt--gcctgtagggctc-ta----a-agtca---
                       Rabbit  gtttcaggaa-ccc---c-------------g-gacta--gcctgtagggctc-ta----tgaaccc---
                         Pika  gtttcaggaa-ccc---c-------------a-gactt--gtctgtaggtctc-ta----acaaacc---
                          Pig  ggttcaagag-ccg-----------------g-gatac--gcgcctagggctc-tt----gaattcctag
                       Alpaca  ggttcaagag-cct-----------------gaaacac--gcgcgtagggctc-ta----agagtac---
               Bactrian camel  ggttcgagag-cct-----------------gaaacac--gcgcgtagggttc-tg----agagtac---
                      Dolphin  ggttcgagag-ccg-----------------g-gacgc--gcgcgtagggctt-tt----agagtcc---
                 Killer whale  g--tcgagag-ccg-----------------g-gacgc--gcgcgtagggctt-tt----agagtcc---
             Tibetan antelope  ggttcgagag-ccc-----------------g-gacac--gcgcgtggggctt-tg----agaatcc---
                          Cow  ggttcgagag-ccc-----------------g-gacac--gcgcgtggggctc-tg----agaatcc---
                        Sheep  ggttcgagag-ccc-----------------g-gacac--gcgcgtggggctc-tg----agaatcc---
                Domestic goat  ggttcgagag-ccc-----------------g-gacac--gcgcgtggggctc-tg----agaatcc---
                        Horse  ggttcgagag-ccc---c-------------g-aaggc--acgcgtagggctt-tg----agagcct---
             White rhinoceros  ggttcaagag-ccc---c-------------g-aacac--acgcgtagggctt-tg----agagtct---
                          Cat  ggttcgagag-ccc---t-------------g-ggcac--gcgcgaagggctc-cc----agagttt---
                          Dog  ggcccgagag-ccctggt-------------g-ggcac--gcgcgaagggctc-tg----agagttt---
                      Ferret   --------ag-ccc---t-------------g-ggcac--gcgcgaagggctc-tg----agagttt---
                        Panda  ggttctagag-cct---t-------------g-ggcac--gcgcgaagggctc-tg----agagttt---
               Pacific walrus  ggttcgagag-ccc---t-------------g-ggcac--ccgcgaagggctc-tg----agagttt---
                 Weddell seal  ggttcgagag-ccc---t-------------g-ggcag--gcgcgaagggctc-tg----agagttt---
             Black flying-fox  ggttcgagag-ctc--------------------------------cgcacac-gggcgtagggccc---
                      Megabat  ggttcgagag-ctc--------------------------------cgcacgc-gggcgtagggccc---
                Big brown bat  agttcgagag-agt--------------------------------agggctc-cg----aggggcc---
         David's myotis (bat)  agttcgggag-cgt--------------------------------agggctc-cg----aggggcc---
                     Microbat  agttcgggag-cgt--------------------------------agggctc-cg----aggggcc---
                     Hedgehog  gcctg------------------------------------------gggctg-t-----------g---
                        Shrew  gtctgcagag-cc------------------g-ggacc--gcgcgccggggtc-t-----agcgccc---
              Star-nosed mole  gcttgcagaa-cca---g-------------g-gagaa--acgcgtagggctt-tg----agagacc---
                     Elephant  catttgagag-aca---g-------------g-gccactcgcatgtagggctc-tg----agagcct---
          Cape elephant shrew  tgcttgagag-atc-------------------cccacctgcgtgtggggctc-tg----agaggct---
                      Manatee  catttgagag-acc---a-------------g-gcaaa--gcgcttagggctc-tg----agagccc---
             Cape golden mole  cattagagag-acc---c-------------g-gagat--gcacgtagggctc-tg----agagcct---
                       Tenrec  ccattgagag-att---t-------------g-gacac--gcacatacagctc-tg----agagcca---
                     Aardvark  tgtttgagag-acc---c-------------g-gacac--gcgcatagggctc-gg----agagccc---
                    Armadillo  agtgcgagag-ccc---c-------------g-gactc--gcgcgcaggaccc-cg----aggaccc---
          Collared flycatcher  tctgctggcc-c-----a-------------g-gggct--cagccccgagcc------------------
           American alligator  atttatggca-caa---a-------------g-gagctgcccgctctgcact------------------
               Painted turtle  aggtcggacg-cgt---g-------------g-aa-----------------------------------
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ---agggc-----------t
                        Chimp  ---agggc-----------t
                      Gorilla  ---agggc-----------t
                    Orangutan  ---agggc-----------t
                       Gibbon  ---agggc-----------t
                       Rhesus  ---agggc-----------t
          Crab-eating macaque  ---agggc-----------t
                       Baboon  ---agggc-----------t
                 Green monkey  ---agggc-----------t
                     Marmoset  ---agggc-----------t
              Squirrel monkey  ---agggc-----------t
                     Bushbaby  ---ggagc-----------t
           Chinese tree shrew  ---gaggc-----------t
                     Squirrel  ---ggggc-----------t
       Lesser Egyptian jerboa  ---cagac-----------t
                 Prairie vole  ---gagaa-----------t
              Chinese hamster  ---gagattgggagggaggt
               Golden hamster  ---gagat-----------t
                        Mouse  ---gagat-----------t
                          Rat  ---gagat-----------t
               Naked mole-rat  ---gggcc-----------t
                   Guinea pig  ---ggtgc-----------c
                   Chinchilla  ---gggg------------c
             Brush-tailed rat  ---ggggc-----------c
                       Rabbit  ---aggcc-----------c
                         Pika  ---aggcc-----------t
                          Pig  tagggtgc-----------t
                       Alpaca  ---agcgt-----------t
               Bactrian camel  ---agcgt-----------t
                      Dolphin  ---gggga-----------t
                 Killer whale  ---gggga-----------t
             Tibetan antelope  ---ggggc-----------t
                          Cow  ---ggggc-----------t
                        Sheep  ---ggggc-----------t
                Domestic goat  ---ggggc-----------t
                        Horse  ---ggggc-----------t
             White rhinoceros  ---ggggc-----------t
                          Cat  ---ggggc-----------t
                          Dog  ---ggggc-----------t
                      Ferret   ---ggggc-----------t
                        Panda  ---ggggc-----------t
               Pacific walrus  ---ggggc-----------t
                 Weddell seal  ---ggggc-----------t
             Black flying-fox  ---ggagt-----------t
                      Megabat  ---ggagt-----------t
                Big brown bat  ---gatgc-----------t
         David's myotis (bat)  ---gatgt-----------t
                     Microbat  ---gatgt-----------t
                     Hedgehog  ---gagtc-----------c
                        Shrew  ---gggtc-----------c
              Star-nosed mole  ---agggc-----------t
                     Elephant  ---ggggc-----------t
          Cape elephant shrew  ---ggggc-----------t
                      Manatee  ---ggggc-----------t
             Cape golden mole  ---agggt-----------t
                       Tenrec  ---ggtgc-----------a
                     Aardvark  ---gaggc-----------t
                    Armadillo  ---ggggc-----------t
          Collared flycatcher  --------------------
           American alligator  --------------------
               Painted turtle  --------------------
                   Coelacanth  ====================
                X. tropicalis  ====================
                       Lizard  ====================
       Spiny softshell turtle  --------------------
     Chinese softshell turtle  ====================
              Green seaturtle  ====================
                       Turkey  ====================
                      Chicken  ====================
                 Mallard duck  ====================
                   Budgerigar  ====================
           Tibetan ground jay  ====================
                  Zebra finch  ====================
          Medium ground finch  ====================
       White-throated sparrow  ====================
             Peregrine falcon  ====================
                 Saker falcon  ====================
                  Rock pigeon  ====================
                      Wallaby  ====================
                      Opossum  ====================
              Tasmanian devil  ====================

Inserts between block 5 and 6 in window
B D       American alligator 25bp

Alignment block 6 of 1519 in window, 78189247 - 78189259, 13 bps 
B D                     Human  gggagtcgggaga-----
B D                     Chimp  gggagtcgggaga-----
B D                   Gorilla  gggagtcgggaga-----
B D                 Orangutan  gggagtcgggaga-----
B D                    Gibbon  ggaagtcgggaga-----
B D                    Rhesus  gggattcgggaga-----
B D       Crab-eating macaque  gggattcgggaga-----
B D                    Baboon  gggattcgggaga-----
B D              Green monkey  gggattcgggaga-----
B D                  Marmoset  gggagtcgggaga-----
B D           Squirrel monkey  gggagtcgggaga-----
B D                  Bushbaby  gggagtcgggagg-----
           Chinese tree shrew  gggaggcaggagg-----
B D                  Squirrel  gggaggcgggagg-----
       Lesser Egyptian jerboa  gggaggtaggagg-----
                 Prairie vole  gggaggtgggagg-----
B D           Chinese hamster  gggaggtgggagg-----
               Golden hamster  gggaggtgggagg-----
B D                     Mouse  ggaaggtggggga-----
B D                       Rat  gggaggtgggaga-----
B D            Naked mole-rat  ggggggcaggagg-----
B D                Guinea pig  gggaagcaggggg-----
                   Chinchilla  gggaggcagaagg-----
             Brush-tailed rat  ggtaggcaggagg-----
B D                    Rabbit  gggaggcaggagg-----
B D                      Pika  tttagacaggagg-----
B D                       Pig  gggaggtgggaga-----
B D                    Alpaca  gggaggtgagagg-----
               Bactrian camel  gggaggcgagagg-----
B D                   Dolphin  gggaggcgggagg-----
                 Killer whale  gggaggcgggagg-----
             Tibetan antelope  gggaggcgggagg-----
B D                       Cow  gggaggcgggagg-----
B D                     Sheep  gggaggcgggagg-----
                Domestic goat  gggaggcgggagg-----
B D                     Horse  gagaggcgggagg-----
B D          White rhinoceros  gagaggtgggagg-----
B D                       Cat  gggagaagggagg-----
B D                       Dog  gggagtagggagg-----
B D                   Ferret   gggagaagggagg-----
B D                     Panda  gggagaagggagg-----
               Pacific walrus  gggagaagggagg-----
                 Weddell seal  gggagaagggagg-----
             Black flying-fox  gggaggcgggggg-----
B D                   Megabat  gggaggcgggagg-----
                Big brown bat  ggcaggcaggagg-----
         David's myotis (bat)  gggaggcaggagg-----
B D                  Microbat  gggaggcaggagg-----
B D                  Hedgehog  gggaggtggggcg-----
B D                     Shrew  gggaggcggaggg-----
              Star-nosed mole  gggaggtgggagg-----
B D                  Elephant  gggagatgggagg-----
          Cape elephant shrew  gggaggcaggagg-----
B D                   Manatee  gggagacgggagg-----
             Cape golden mole  gggaggcggtagg-----
B D                    Tenrec  gggaggcgtcagg-----
                     Aardvark  gggaggcgggagg-----
B D                 Armadillo  gggaggcgagatg-----
  D       Collared flycatcher  -------tggcgcaggca
  D            Painted turtle  gagaaattggc-----ca
B D                Coelacanth  ==================
B D             X. tropicalis  ==================
B D                    Lizard  ==================
  D    Spiny softshell turtle  ------------------
  D  Chinese softshell turtle  ==================
  D           Green seaturtle  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
B D                Budgerigar  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
B D       Medium ground finch  ==================
  D    White-throated sparrow  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D               Rock pigeon  ==================
B D                   Wallaby  ==================
B D        American alligator  ==================
B D                   Opossum  ==================
B D           Tasmanian devil  ==================

Inserts between block 6 and 7 in window
  D      Collared flycatcher 8bp
  D           Painted turtle 13bp

Alignment block 7 of 1519 in window, 78189260 - 78189325, 66 bps 
B D                     Human  tctgggtg-c---------------------atcctgggcct--cctgggcc-tc---ac--tgtgtgac
B D                     Chimp  tctgggtg-c---------------------atcctgggcct--cctgggcc-tc---ac--tgtgtgac
B D                   Gorilla  tctgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D                 Orangutan  tctgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D                    Gibbon  tctgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D                    Rhesus  tgtgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D       Crab-eating macaque  tgtgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D                    Baboon  tgtgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D              Green monkey  tgtgggtg-c---------------------a---------t--cctgggcc-tc---ac--tgtgtgac
B D                  Marmoset  tctgggtg-c---------------------a---------t--cctgggcc-tc---gc--tgtgtgac
B D           Squirrel monkey  tgtgggtg-c---------------------a---------t--cctggacc-tc---gc--tgtgtgac
B D                  Bushbaby  tttgtgtg-c---------------------a---------t--tctgggcc-tc---gc--tgtgtgac
           Chinese tree shrew  tctgagtg-c---------------------g---------t--ctggggcc-tc---gc--tgtgtgac
B D                  Squirrel  tctgagtg-c---------------------a---------t--cctgggcc-tc---gc--tgtgtgac
       Lesser Egyptian jerboa  tgtgggtg-c---------------------a---------t--cctgggcc-tt---gc--tgtgtgac
                 Prairie vole  tctaggtt-c-------------------------------t--tctgggcc-tt---gc--tgtgtgac
B D           Chinese hamster  tataggtt-c-------------------------------t--tctggacc-tt---gc--tgtgtgac
               Golden hamster  tctaggtt-c-------------------------------ttctctgggcc-tt---gc--tgtgtgac
B D                     Mouse  tctaggtg-c-------------------------------t--tctgggccttt---gc--tgtgtgac
B D                       Rat  t-taagtg-c-------------------------------t--tctgggcc-tt---gctgtgtgtgac
B D            Naked mole-rat  tctggatg-c---------------------a---------c--cctgggcc-tt---gc--tgtgtgac
B D                Guinea pig  tctgaatg-c---------------------a---------c--ctggggca-ct---gc--tgtgtgac
                   Chinchilla  tctgaatg-c---------------------a---------c--cctgggca-at---gc--tgtgtgac
             Brush-tailed rat  tctgaatg-c---------------------a---------c--cttgggca-ct---gc--tgtgtgac
B D                    Rabbit  tctgggtg-c---------------------a---------t--catgggtc-tt---gc--tgtgtgac
B D                      Pika  gctaagaa-c---------------------a---------t--cataggtc-tt---cc--tgtgtgac
B D                       Pig  tctgggtg-c---------------------a---------t--cctgggcc-tg---gc--tgtgtgac
B D                    Alpaca  tctccgta-c---------------------a---------t--cctgggcc-tg---gc--tgtgtgac
               Bactrian camel  tctccgta-t---------------------a---------t--cctgggcc-tg---gc--tgtgtgac
B D                   Dolphin  tctaggtg-c---------------------a---------t--actgggcc-tt---gc--tgtgtgac
                 Killer whale  tctaggtg-c---------------------a---------t--actgggcc-tt---gc--tgtgtgac
             Tibetan antelope  tctgggtg-c---------------------a---------t--aatgggcc-tg---gc--tgtgtgac
B D                       Cow  tctgggtg-c---------------------a---------t--agtgggcc-tg---gc--tgtgtgac
B D                     Sheep  tctgggtg-c---------------------a---------t--aatgggcc-tg---gc--tgtgtgac
                Domestic goat  tctgggtg-c---------------------a---------t--aatgggcc-tg---gc--tgtgtgac
B D                     Horse  tctgggtg-c---------------------a---------t--cctgggcc-tc---gc--tgtgtgac
B D          White rhinoceros  tctgggtg-c---------------------a---------t--cctgggcc-tc---gc--tgtgtgac
B D                       Cat  tccaggtg-c---------------------a---------a--cttgggcc-tc---gc--tgtgtgac
B D                       Dog  tctaggtg-c---------------------a---------t--cttgggcc-tc---gc--tgtgtgac
B D                   Ferret   tctaggtg-c---------------------a---------t--cttgggcc-tc---gc--tgtgtgac
B D                     Panda  tctaggtg-c---------------------a---------t--cttgggcc-tc---gc--tgtgtgac
               Pacific walrus  tctaggtg-c---------------------a---------t--cttgggcc-tc---gc--tgtgtgac
                 Weddell seal  tctaggtg-c---------------------a---------t--cttgggcc-tc---gc--tgtgtgac
             Black flying-fox  tctggatg-c---------------------a---------t--ccttggcc-tc---gc--tgtgtgac
B D                   Megabat  tctggatg-c---------------------a---------t--ccttggcc-tc---gc--tgtgtgac
                Big brown bat  tctgggtg-c---------------------a---------t--cc-tggcc-tc---gc--tgtgtgac
         David's myotis (bat)  actgggtg-c---------------------a---------t--cc-tggcc-tc---gc--tgtgtgac
B D                  Microbat  tctgggtg-c---------------------a---------t--cc-tggcc-tc---gc--tgtgtgac
B D                  Hedgehog  -ccaggct---------------------------------------gcacc-tc---gc--tgtgtgac
B D                     Shrew  -ctggatg-c---------------------a---------t--caggggcc-tc---gc--tgtgtgac
              Star-nosed mole  -tcggttt-t---------------------a---------g--tccgggcc-tc---gc--tgtgtgac
B D                  Elephant  tctgggtg-c---------------------a---------t--cctgggcc-tt---gc--tgtgtgac
          Cape elephant shrew  tctaggtg-c---------------------a---------t--gctgggcc-tt---gc--tgtgtgac
B D                   Manatee  tctgggtg-c---------------------a---------t--cctgggcc-tt---gc--tgtgtgac
             Cape golden mole  tttgggag-c---------------------a---------t--cctgggcc-tc---gc--tgtgtgac
B D                    Tenrec  gctgagtg-t---------------------a---------t--cttgggcc-tt---gc--tgtgcgac
                     Aardvark  tctgggtg-c---------------------a---------t--actaggcc-tc---gc--tgtgtgac
B D                 Armadillo  tctgggagcc---------------------a---------g--cccctgcc-tc---gc--tgtgtgac
  D       Collared flycatcher  tgtggcca-ctg--ctggccagggcagcctgg---------c--ccggggcc-ct---gc--cca---cc
B D        American alligator  tctggctg-c---------------------a---------a--ccgggacc-ttttcat--ccc---cc
  D            Painted turtle  cacggccg-gttccccggcccctgcagacctg---------t--ctgtggcc-tt---gc--tc------
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  cttgggcgagtagcta-----ttcctctctg
                        Chimp  cttgggcgagtagcta-----ttcctctctg
                      Gorilla  cttgggcgagtagcta-----ctcctctctg
                    Orangutan  cttgggcgagtagcta-----ctcgtctctg
                       Gibbon  cttgggcgagtagcta-----ctcctctctg
                       Rhesus  cttgggcgagtagcta-----ctcctctctg
          Crab-eating macaque  cttgggcgagtagcta-----ctcctctctg
                       Baboon  cttgggcgagttgcta-----ctcctctctg
                 Green monkey  cttgggcgagtagcta-----ctcctctctg
                     Marmoset  cttgggcgagtagcta-----ttcctctctg
              Squirrel monkey  cttgggcaagtagcta-----ctcctctctg
                     Bushbaby  cttgggcgagtagcta-----cccctctctg
           Chinese tree shrew  cttgggcgagtagctg-----cccctctctg
                     Squirrel  cttgggccagtaacta-----cccctctctg
       Lesser Egyptian jerboa  cttggacaagtaacta-----cccctctctg
                 Prairie vole  cttgggctagt-actg-----cccctctctg
              Chinese hamster  cttgggctagt-actg-----cccctctctg
               Golden hamster  cttgggctagt-actg-----cccctctctg
                        Mouse  cttggccttctaactg-----cccctctctg
                          Rat  cttgggctactaactg-----cccctctctg
               Naked mole-rat  cttgggtgagtaacta-----cccctctctg
                   Guinea pig  cttgggcaagttgctg-----cccctttctg
                   Chinchilla  cttgggtgagtagcta-----cccctctctg
             Brush-tailed rat  cttgggtgagtagcta-----cccctctctg
                       Rabbit  cttggacaagtagcta-----cccctctctg
                         Pika  cttggacaagtagcta-----cccctctctg
                          Pig  cttgggcaagtggctg-----cccctctctg
                       Alpaca  cttgggcgagtagctg-----cccctctctg
               Bactrian camel  cttgggcgagtagctg-----cccctctctg
                      Dolphin  cttgggcgagtagctg-----cccctctctg
                 Killer whale  cttgggcgagtagctg-----cccctctctg
             Tibetan antelope  cttgggcgagtagctg-----cccctctctg
                          Cow  cttgggcgagtagcta-----cccctctctg
                        Sheep  cttgggcgagtagctg-----cccctctctg
                Domestic goat  cttgggcgagtagctg-----cccctctctg
                        Horse  cttgggcgagtagctg-----tccctctctg
             White rhinoceros  cttgggcgagtagctg-----cccctctctg
                          Cat  cttgggcgagtagctg-----cccctctctg
                          Dog  cttgggcgagtagctg-----cccctctctg
                      Ferret   cttgggcgagtagctg-----cccctctctg
                        Panda  cttgggcgagtagctg-----cccctctctg
               Pacific walrus  cttgggcgagtagatg-----cccctctctg
                 Weddell seal  cttgggcgagtagatg-----cccctctctg
             Black flying-fox  cttgggcaagtaactg-----cccctctctg
                      Megabat  cttgggcaagtagctg-----cccctctctg
                Big brown bat  cttgggtgaataccta-----cccctctctg
         David's myotis (bat)  cttgggtgaataccta-----cccctctctg
                     Microbat  cttgggtgaataccta-----cccctctctg
                     Hedgehog  cctgggccagtagctg-----accctctctg
                        Shrew  cttgggtgggtggctg-----accctctctg
              Star-nosed mole  cttgggttagtagctg-----tccctctctg
                     Elephant  cttgggcgagtagctg-----cccctctctg
          Cape elephant shrew  cttgggcgagtagccg-----cccctctctg
                      Manatee  cttgggtgagtagcag-----cccctctctg
             Cape golden mole  cttgggcgagtagccg-----accctctctg
                       Tenrec  cttgggcgagtagctg-----tccctctctg
                     Aardvark  cttgggcgagtagatg-----cccctctctg
                    Armadillo  cttgggctagtagctg-----cccctctctg
          Collared flycatcher  ctctgct------ttg-----tttctgtctg
           American alligator  ctccgtc------gtaaatccccccttcccg
               Painted turtle  --caggc------cca-----gttctccctg
                   Coelacanth  ===============================
                X. tropicalis  ===============================
                       Lizard  ===============================
       Spiny softshell turtle  -------------------------------
     Chinese softshell turtle  ===============================
              Green seaturtle  ===============================
                       Turkey  ===============================
                      Chicken  ===============================
                 Mallard duck  ===============================
                   Budgerigar  ===============================
           Tibetan ground jay  ===============================
                  Zebra finch  ===============================
          Medium ground finch  ===============================
       White-throated sparrow  ===============================
             Peregrine falcon  ===============================
                 Saker falcon  ===============================
                  Rock pigeon  ===============================
                      Wallaby  ===============================
                      Opossum  ===============================
              Tasmanian devil  ===============================

Alignment block 8 of 1519 in window, 78189326 - 78189369, 44 bps 
B D                     Human  ggcattaat---cccctcccttcatcaa--t---------tg------ta-tgt---cgaagtgat----
B D                     Chimp  ggcattaat---cccctcccttcatcaa--t---------tg------ta-tgt---cgaagtgat----
B D                   Gorilla  ggcattaat---cctctcccttcatcaa--t---------tg------ta-tgt---cgaagtgat----
B D                 Orangutan  ggcattaac---accctcccttcatcaa--t---------tg------tg-tgt---cgaagtgat----
B D                    Gibbon  ggcattaaa---cccctcccttcatcaa--t---------tg------ta-tgt---cgaagtgat----
B D                    Rhesus  ggcattaac---cccct-ccttctccta--t---------tg------ta-tgt---cgaagtgat----
B D       Crab-eating macaque  ggcattaac---cccct-ccttctccta--t---------tg------ta-tgt---cgaagtgat----
B D                    Baboon  ggcattaac---cccct-ccttctccta--t---------tg------ta-tgt---cgaagtgat----
B D              Green monkey  ggcattaac---cccct-ccttctccta--t---------tg------ta-tgt---cgaagtgat----
B D                  Marmoset  ggcattaac---ctcct-ctttcatcaa--g---------tg------ca-tgt---ggaagtgat----
B D           Squirrel monkey  ggcattaac---ctcct-ctttcatcaa--g---------tg------ca-tgt---cgaagtgat----
B D                  Bushbaby  ggcctcag----------cctccatcaa--t---------tg------tg-tgt---cgaggtgat----
           Chinese tree shrew  ggcctcatt---cttct-cttt---caa--t---------tgtattaata-tat---cgaggtgat----
B D                  Squirrel  ggcctcagc---ctcc-tcctccatcaa--t---------tg------ta-tat---tgagatggt----
       Lesser Egyptian jerboa  ggcttcagc---tgccttctttcatcag--t---------tg------tg-tat---ggaggtggt----
                 Prairie vole  agccctaac---cat----cttcatcta--c---------tg------ag-tat---agaggtggg----
B D           Chinese hamster  agccttaac---tat----cttcatcaa--c---------tg------ag-tat---agaggtggt----
               Golden hamster  agccttaac---cat----cttcatcaa--c---------tg------ag-tat---agaggtggt----
B D                     Mouse  agccttaac---catc-tccttcatcaa--c---------tg------ag-ta--------gt--t----
B D                       Rat  agctttaac---catc-tccttcatcaa--c---------tg------ag-aa--------gtggt----
B D            Naked mole-rat  ggccccagc---ctc----ctttatcaa--t---------tg------ta-cat---tgaggt-------
B D                Guinea pig  g------gc---ctt----ctttatcca--t---------tg------ta-tat---tgctgt-------
                   Chinchilla  ggcctcagc---ctt----ctttatcaa--t---------tg------ta-tat---tgaggt-------
             Brush-tailed rat  ggcctcagc---ctt----ttttatcaa--t---------tg------ta-tgt---ggaggt-------
B D                    Rabbit  gacctcaac---ctc----ttccctcga--t---------tg------tg-tgt---taaggtgat----
B D                      Pika  ggcctcaactgtttc----cttcatcag--t---------tg------tg-aat---taaggtgaa----
B D                       Pig  ggcttcaagctcgtt----cttcatcta--t---------tg------tg-cat---ataggtgat----
B D                    Alpaca  ggccgcagcctcctt----cttcatcaa--t---------tg------tg-tat---ataggtgat----
               Bactrian camel  ggccgcagcctcctt----cttcatcaa--t---------tg------tg-tat---ataggtgat----
B D                   Dolphin  ggtcgcaat---ctc----cttcatcaa--t---------tg------tg-tat---ataga-gat----
                 Killer whale  ggccgcaat---ctc----cttcatcaa--t---------tg------tg-tat---ataga-gat----
             Tibetan antelope  ggcctccatctcctc----cttcatcaa--t---------tg------tg-tac---ataga-gac----
B D                       Cow  ggcctccat---ctc----cttcagcct--g---------tg------tgttac---ataga-gac----
B D                     Sheep  ggcctccatctcctc----cttcatcaa--t---------tg------tg-tac---ataga-gac----
                Domestic goat  ggcctccatctcctc----cttcatcaa--t---------tg------tg-tac---atgga-gac----
B D                     Horse  ggcctcagc---ctcct-tcttcatcaa--t---------tg------tg-tat---cgaggtgat----
B D          White rhinoceros  ggcctcatc---ctcct-tcttcatcaa--t---------tg------tg-tat---cgaggtgat----
B D                       Cat  ggcttcatc---ctc----tttcatcaa--t---------tg------tg-ttt---ggtggtgat----
B D                       Dog  ggcttcagc---ctc----cttcatcaa--t---------tg------tg-ttt---ggaggcgat----
B D                   Ferret   ggcttccac---ctc----cttcatcaa--t---------tg------tg-ttt---ggaggtgat----
B D                     Panda  ggcttccac---ttc----cttcatcaa--t---------tg------tg-ttt---ggaggtgat----
               Pacific walrus  ggcttccac---ctc----cgtcatcag--t---------tg------tg-ttt---ggaggtgat----
                 Weddell seal  ggcttccac---ctc----cgtcatcag--t---------tg------tg-ttt---ggaggtgat----
             Black flying-fox  ggcctcaa----ctg----cttcttcaa--t---------ta------tg-tat---agaggtgat----
B D                   Megabat  ggcctcaa----ctg----cttcttcaa--t---------ta------tg-tat---agaggtgat----
                Big brown bat  ggcctcaac---ctc----cttcatcaa--t---------tg------tg-tgt---gaaggtgat----
         David's myotis (bat)  ggcctcagc---ctc----cttcatcaa--t---------tg------tg-tgt---ggaggtgat----
B D                  Microbat  ggcctcagc---ctc----cttcatcag--t---------tg------tg-tgt---ggaggtgat----
B D                  Hedgehog  ggcctctgc---ccg----ctgcatcgg--c---------tg------tg-ggt---ggaggtgac----
B D                     Shrew  ggccgcagc---ctc----ctccaacgt--t---------tg------tg-taa---ggaggcggt----
              Star-nosed mole  gacctcagt---ttc----cttcttcatcat---------tg------tg-tat---ggaggtgat----
B D                  Elephant  ggactcaac---cttctc-catcatcaa--a---------tg------tg-tat---cagga--------
          Cape elephant shrew  ggcctcagc---tttctc-tgtcatcaa---------------------g-tac---cgaga--------
B D                   Manatee  agactcaat---cttctc-catcatcaa--a---------tg------tg-tat---cgaga--------
             Cape golden mole  ggcctcagc---cttctc-tgtcatcaa--a---------tg------tg-tgt---ggaga--------
B D                    Tenrec  gtcctcaac---cttctc-catcatcaa--a---------tg------ta-tgtctgggaga--------
                     Aardvark  gacctcagc---cttttg-tatcatcaa--a---------tg------tg-tat---cgaga--------
B D                 Armadillo  ggcctcaat---ttcctc-cctcagcca--a---------tg------tg-tac---ggaggagatcccg
  D       Collared flycatcher  -------------------cacactcaa--taaagttcattc------tg-cat---tgaactgga----
B D        American alligator  -------------------ccccttcaa--aaacagtc--tt------ta-caa---tggatcgaa----
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ----cc-----
                        Chimp  ----cc-----
                      Gorilla  ----cc-----
                    Orangutan  ----cc-----
                       Gibbon  ----cc-----
                       Rhesus  ----cc-----
          Crab-eating macaque  ----cc-----
                       Baboon  ----cc-----
                 Green monkey  ----cc-----
                     Marmoset  ----cc-----
              Squirrel monkey  ----cc-----
                     Bushbaby  ----ga-----
           Chinese tree shrew  ----cc-----
                     Squirrel  ----ct-----
       Lesser Egyptian jerboa  ----cc-----
                 Prairie vole  ----cc-----
              Chinese hamster  ----cc-----
               Golden hamster  ----cc-----
                        Mouse  ----cc-----
                          Rat  ----cc-----
               Naked mole-rat  ----cc-----
                   Guinea pig  ----cc-----
                   Chinchilla  ----cc-----
             Brush-tailed rat  ----cc-----
                       Rabbit  ----cc-----
                         Pika  ----ct-----
                          Pig  ----cc-----
                       Alpaca  ----cc-----
               Bactrian camel  ----cc-----
                      Dolphin  ----ac-----
                 Killer whale  ----ac-----
             Tibetan antelope  ----cc-----
                          Cow  ----cc-----
                        Sheep  ----cc-----
                Domestic goat  ----cc-----
                        Horse  ----cc-----
             White rhinoceros  ----cc-----
                          Cat  ----cc-----
                          Dog  ----cc-----
                      Ferret   ----cc-----
                        Panda  ----cc-----
               Pacific walrus  ----cc-----
                 Weddell seal  ----cc-----
             Black flying-fox  ----cc-----
                      Megabat  ----cc-----
                Big brown bat  ----gc-----
         David's myotis (bat)  ----gc-----
                     Microbat  ----gc-----
                     Hedgehog  ----ca-----
                        Shrew  ----cc-----
              Star-nosed mole  ----ac-----
                     Elephant  ----tc-----
          Cape elephant shrew  ----tc-----
                      Manatee  ----tc-----
             Cape golden mole  ----tt-----
                       Tenrec  ----tg-----
                     Aardvark  ----tc-----
                    Armadillo  cccctc-----
          Collared flycatcher  ----gc--ctc
           American alligator  ----gcgattc
                   Coelacanth  ===========
                X. tropicalis  ===========
                       Lizard  ===========
       Spiny softshell turtle  -----------
     Chinese softshell turtle  ===========
               Painted turtle  ===========
              Green seaturtle  ===========
                       Turkey  ===========
                      Chicken  ===========
                 Mallard duck  ===========
                   Budgerigar  ===========
           Tibetan ground jay  ===========
                  Zebra finch  ===========
          Medium ground finch  ===========
       White-throated sparrow  ===========
             Peregrine falcon  ===========
                 Saker falcon  ===========
                  Rock pigeon  ===========
                      Wallaby  ===========
                      Opossum  ===========
              Tasmanian devil  ===========

Inserts between block 8 and 9 in window
  D      Collared flycatcher 1bp
B D       American alligator 6565bp

Alignment block 9 of 1519 in window, 78189370 - 78189404, 35 bps 
B D                     Human  tg--c----------t----------------------------------------------ccct----
B D                     Chimp  tg--c----------t----------------------------------------------ccct----
B D                   Gorilla  tg--c----------t----------------------------------------------ccct----
B D                 Orangutan  tg--c----------t----------------------------------------------ccct----
B D                    Gibbon  tg--c----------t----------------------------------------------ccct----
B D                    Rhesus  tg--c----------t----------------------------------------------ccct----
B D       Crab-eating macaque  tg--c----------t----------------------------------------------ccct----
B D                    Baboon  tg--c----------t----------------------------------------------ccct----
B D              Green monkey  tg--c----------t----------------------------------------------ccct----
B D                  Marmoset  tg--c----------t----------------------------------------------ccct----
B D           Squirrel monkey  tg--c----------t----------------------------------------------ccct----
B D                  Bushbaby  tg--t----------t----------------------------------------------cccg----
           Chinese tree shrew  cg--t----------t-----------------------------------------------ccg----
B D                  Squirrel  ag--c----------t----------------------------------------------cctc----
       Lesser Egyptian jerboa  ag--g----------t----------------------------------------------cctg----
                 Prairie vole  ag--c----------t----------------------------------------------cctg----
B D           Chinese hamster  ag--c----------t----------------------------------------------cctgcctc
               Golden hamster  ag--c----------t----------------------------------------------cctg----
B D                     Mouse  ag--c----------t----------------------------------------------tctg----
B D                       Rat  ag--c----------t----------------------------------------------cctg----
B D            Naked mole-rat  ag--c----------t----------------------------------------------gccg----
B D                Guinea pig  tg--a----------g----------------------------------------------ctct----
                   Chinchilla  ag--c----------g----------------------------------------------ctct----
             Brush-tailed rat  ag--c----------g----------------------------------------------cctg----
B D                    Rabbit  gg--c----------t----------------------------------------------ctct----
B D                      Pika  gg--ctgcctacctgt----------------------------------------------ccct----
B D                       Pig  tg--c----------c--------------------------------------ctcgc--ccccg----
B D                    Alpaca  gg--c----------c--------------------------------------ccagc--ctctg----
               Bactrian camel  gg--c----------c--------------------------------------ccagc--ctctg----
B D                   Dolphin  cg--c----------c--------------------------------------cctgc--ccccg----
                 Killer whale  cg--c----------c--------------------------------------cctgc--ccccg----
             Tibetan antelope  cg--c----------c--------------------------------------cctgc--ccccg----
B D                       Cow  cg--c----------c--------------------------------------cctgc--ccccg----
B D                     Sheep  cg--c----------c--------------------------------------cctgc--ccccg----
                Domestic goat  cg--c----------c--------------------------------------cctgc--ccccg----
B D                     Horse  cg--t----------c----------------------------------------------tcta----
B D          White rhinoceros  cg--c----------t----------------------------------------------tcca----
B D                       Cat  tg--c----------c------------------------------------------------------
B D                       Dog  gg--t----------c------------------------------------------------------
B D                   Ferret   ct--c----------c------------------------------------------------------
B D                     Panda  ct--c----------c------------------------------------------------------
               Pacific walrus  ct--c----------c------------------------------------------------------
                 Weddell seal  ct--c----------c------------------------------------------------------
             Black flying-fox  cggcc----------c-----------------------------------------------cta----
B D                   Megabat  cggcc----------c-----------------------------------------------cta----
                Big brown bat  ag-cc----------c-----------------------------------------------ctg----
         David's myotis (bat)  ag--c----------c-----------------------------------------------ctg----
B D                  Microbat  ag--c----------c-----------------------------------------------ctg----
B D                  Hedgehog  cg-tc----------t-----------------------------------------------cca----
B D                     Shrew  cg--c----------c-----------------------------------------------cca----
              Star-nosed mole  cg--c----------c-----------------------------------------------cca----
B D                  Elephant  ct--c----------t------------------------------------------------------
          Cape elephant shrew  at--c----------t------------------------------------------------------
B D                   Manatee  gt--c----------t------------------------------------------------------
             Cape golden mole  tc--c----------t------------------------------------------------------
B D                    Tenrec  cc--c----------tcctagtcccagcctttcgtgggtacacgggcactggta----------------
                     Aardvark  ct--c----------t------------------------------------------------------
B D                 Armadillo  cc--t----------t------------------------------------------------------
  D       Collared flycatcher  --------------------------------------------------------tgcagttctt----
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ---cccct-tt----------------------caggtaagagggcattcgca
                        Chimp  ---cccct-tt----------------------caggtaagagggcattcgca
                      Gorilla  ---cccct-tt----------------------caggtaagagggcattcgca
                    Orangutan  ---cccct-tt----------------------caggtaagagggcattcgca
                       Gibbon  ---cccct-tt----------------------cgggtaagagggcattcgca
                       Rhesus  ---cccct-tt----------------------caggtaagaggacattcgca
          Crab-eating macaque  ---cccct-tt----------------------caggtaagaggacattcgca
                       Baboon  ---cccct-tt----------------------caggtaagaggacattcgca
                 Green monkey  ---cccct-tt----------------------caggtaagaggacattcgca
                     Marmoset  ---cccccttt----------------------caggtgagaggacattcgca
              Squirrel monkey  ---cgccc-tt----------------------caggtaagaggacattcgca
                     Bushbaby  ---cccgc-cc----------------------t------gagggcaacttca
           Chinese tree shrew  ---ccccc-ct----------------------caggacttagggtaccctta
                     Squirrel  ----------------------------------agggctgagagtaactgcg
       Lesser Egyptian jerboa  ---ctctc-ct----------------------cagcactgagagcacatgtg
                 Prairie vole  ---ccccc-tt----------------------cagtactgagagcacaaacg
              Chinese hamster  cctccccc-ct----------------------cagtactgagagtacacaca
               Golden hamster  ---ccccc-ct----------------------cagtactgagagcactcaca
                        Mouse  ---tacct-ct----------------------cagtcctgagagcagccaca
                          Rat  ---tcccc-ct----------------------cagtcctgagcgcacacaca
               Naked mole-rat  ---ctccc-tt----------------------cagggctgacagca------
                   Guinea pig  ---cttcc-tt----------------------aagggttgagagca------
                   Chinchilla  ---cctcc-tt----------------------cagggctgagagca------
             Brush-tailed rat  ---cctcc-tt----------------------catggctgagagca------
                       Rabbit  ---ccccg-ct----------------------tagggttgagggcactggtg
                         Pika  ---tcccc-tt----------------------taggtttgagggcactggta
                          Pig  ---cccct-ct----------------------cagggctgagggtacccgcg
                       Alpaca  ---tcccc-ct----------------------cagggctaagggcacccgcg
               Bactrian camel  ---tcccc-ct----------------------cagggctaagggcacccgcg
                      Dolphin  ---ccccc-ct----------------------cagggctgagggcaccggct
                 Killer whale  ---ccccc-ct----------------------cagggctgagggcaccggct
             Tibetan antelope  ---ccccc-ct----------------------cagggttgagggcaacggcg
                          Cow  ---ccccc-ct----------------------cagggttgagggcaccggcg
                        Sheep  ---ccccc-ct----------------------cagggccgagggcaccggcg
                Domestic goat  ---ccccc-ct----------------------cagggttgagggcac-----
                        Horse  ---cctcc-ct----------------------cagggttgacggcacccgcg
             White rhinoceros  ---cccgc-tt----------------------cagggctgacggcacccgcg
                          Cat  -----------------------------------------------ctcccc
                          Dog  -----------------------------------------------ctctgc
                      Ferret   -----------------------------------------------ctctcc
                        Panda  -----------------------------------------------ctctct
               Pacific walrus  -----------------------------------------------ctctcc
                 Weddell seal  -----------------------------------------------ctctcc
             Black flying-fox  ---cccc--cg----------------------cagggctgaaggcaccatca
                      Megabat  ---cccc--cg----------------------cagggctgaaggcaccatca
                Big brown bat  ---cccca-ct----------------------cagggctgagggcaccagcg
         David's myotis (bat)  ---cccca-ct----------------------cggggctgagggcaccatcg
                     Microbat  ---cccca-ct----------------------cggggctgagggcaccagcg
                     Hedgehog  ---cccca-ct----------------------ctagacccagtgtccc-aca
                        Shrew  ---cccca-ccccg-------------------ccccggtgagcaca---acg
              Star-nosed mole  ---tccca-ct----------------------ctcggctgagggcacctgca
                     Elephant  -----------------------------------------------------
          Cape elephant shrew  -----------------------------------------------------
                      Manatee  -----------------------------------------------------
             Cape golden mole  -----------------------------------------------------
                       Tenrec  -----------------------------------------------------
                     Aardvark  -----------------------------------------------------
                    Armadillo  -----------------------------------------------------
          Collared flycatcher  ---tccat-tttgggatccagcaaaagctgttccatgggggaggaca------
                   Coelacanth  =====================================================
                X. tropicalis  =====================================================
                       Lizard  =====================================================
       Spiny softshell turtle  -----------------------------------------------------
     Chinese softshell turtle  =====================================================
               Painted turtle  =====================================================
              Green seaturtle  =====================================================
                       Turkey  =====================================================
                      Chicken  =====================================================
                 Mallard duck  =====================================================
                   Budgerigar  =====================================================
           Tibetan ground jay  =====================================================
                  Zebra finch  =====================================================
          Medium ground finch  =====================================================
       White-throated sparrow  =====================================================
             Peregrine falcon  =====================================================
                 Saker falcon  =====================================================
                  Rock pigeon  =====================================================
                      Wallaby  =====================================================
           American alligator  =====================================================
                      Opossum  =====================================================
              Tasmanian devil  =====================================================

Inserts between block 9 and 10 in window
               Domestic goat 7bp
B D                   Tenrec 406bp
  D      Collared flycatcher 8bp

Alignment block 10 of 1519 in window, 78189405 - 78189406, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  tc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  cc
B D                  Squirrel  cg
       Lesser Egyptian jerboa  ct
                 Prairie vole  cc
B D           Chinese hamster  cc
               Golden hamster  cc
B D                     Mouse  ac
B D                       Rat  cc
B D                    Rabbit  ct
B D                      Pika  cc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  ct
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cg
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                  Hedgehog  gc
B D                     Shrew  cc
              Star-nosed mole  cc
B D                  Elephant  cc
          Cape elephant shrew  cc
B D                   Manatee  cc
             Cape golden mole  ac
                     Aardvark  cc
  D       Collared flycatcher  cc
B D               Zebra finch  cc
B D                    Tenrec  ==
            Brush-tailed rat  --
                  Chinchilla  --
B D                Guinea pig  --
               Domestic goat  ==
B D                 Armadillo  --
B D            Naked mole-rat  --
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==

Inserts between block 10 and 11 in window
B D                    Sheep 18bp

Alignment block 11 of 1519 in window, 78189407 - 78189449, 43 bps 
B D                     Human  -----cagtac--ctagtacattcgct-tgctg-gct--tttc---gtggggccct---c
B D                     Chimp  -----cagtac--ctagtacattcgct-tgctg-gct--tttc---ttggggccct---c
B D                   Gorilla  -----cagtac--ctagtacattcgct-tgctg-gct--tttc---gtggggccct---c
B D                 Orangutan  -----cagtac--ccagtacattcgct-tgctg-gct--tttc---gtggggccct---c
B D                    Gibbon  -----cagtac--ccagtacattcgct-cgctg-gct--tttc---gtggggccct---c
B D                    Rhesus  -----caggac--ccagtccattcgct-cgctg-gct--tttc---gtggggccct---c
B D       Crab-eating macaque  -----caggac--ccagtccattcgct-ccctg-gct--tttc---gtggggccct---c
B D                    Baboon  -----caggac--ccagtccattcgct-cgctg-gct--tttc---gtggggccct---c
B D              Green monkey  -----caggac--ccagtccattcgct-cgctg-gct--tttc---gtggggccct---c
B D                  Marmoset  -----cagtac--ccagtgcattcgct-cgctg-gcc--tttc---gtggggccct---c
B D           Squirrel monkey  -----cactac--ccagtgcattcgct-cgctg-gcc--tttc---gtagggccct---c
B D                  Bushbaby  -----cagtac--catgaa-----gct-tgctg-gcg--tttc---gtggggttcc---c
           Chinese tree shrew  -----caatac--catgaa-----gct-tcccg-acc--attcacagtggggc------c
B D                  Squirrel  -----tagttc--cat-aa-----gct-ctcca-tcc--tttt---gaggggg-------
       Lesser Egyptian jerboa  -----tggtat--caggaa-----gcc-cacca-gtt--ttct---gtgggac-------
                 Prairie vole  -----tagtac--cacgaa-----gcc-tggca-atcgttttt---gcggaga-------
B D           Chinese hamster  -----tagcac--cacgaa-----gcc-tggca-gtc-ttttt---gcggaga-------
               Golden hamster  -----tattat--cacgaa-----gtc---------------t---gcggaga-------
B D                     Mouse  -----tagaac--catgac-----gcc-tggca-atc-ttttt---gcggaga-------
B D                       Rat  -----tagtac--catgaa-----acc-tggta-atc--tttt---gcagaga-------
B D            Naked mole-rat  --------------------------c-cgcca-gcc--tttg---ggggagg-------
B D                Guinea pig  --------------------------c-ctcca-ggc--cttg---gggaaga-------
                   Chinchilla  --------------------------c-agcca-gca--cttg---ggggagg-------
             Brush-tailed rat  --------------------------c-cgccg-gcc--cttg---ggggagg-------
B D                    Rabbit  -----cagtac--catgaa-----gct-cgccg-gct--tccc---cgggggacc----c
B D                      Pika  -----cagtac--catgga-----tct-ggtca-gcc--ttac---agagagg-------
B D                       Pig  -----cggtat--cttgaa-----gctactccc-gcc--tttc---agggggtccg-c--
B D                    Alpaca  -----cagtat--catgaa-----gct-cacca-gcc--tttc---gtgggatccg----
               Bactrian camel  -----cagtat--catgaa-----gct-cgcca-gcc--ttcc---gtgggatccg----
B D                   Dolphin  -----cagtgt--catgaa-----gct-cgcca-gcc--tttc---gtgggatccg----
                 Killer whale  -----cagtgt--catgaa-----gct-cgcca-gcc--tttc---gtgggatccg----
             Tibetan antelope  -----taacatatcgtgaa-----gct-caccg-gcc--tttc---gtgagatccg----
B D                       Cow  -----caatatatcatgaa-----gct-caccg-gcc--tttc---gtgggatccgc---
                Domestic goat  -----taacat---atgaa-----gct-caccg-gcc--tttc---gtgagatccgc---
B D                     Horse  -----cagtac--catgaa-----gct-cgcca-gcc--tttc---gtggggtctg----
B D          White rhinoceros  -----cagtac--cacgaa-----gct-cgccg-gcc--tttc---gtggggtccg----
B D                       Cat  -----ca--ac--catgaa-----gct-caccg-gcc--tttc---gtggggaccg----
B D                       Dog  -----taatac--aatgaa-----gct-cactg-gcc--tttc---gtggggtccg----
B D                   Ferret   -----caatac--agtgaa-----gct-caccg-gcc--tttc---gtggggtccg----
B D                     Panda  -----caatac--aatgaa-----gct-caccg-gcc--tttc---gtggggtccg----
               Pacific walrus  -----caatac--aatgaa-----gct-caccg-gcc--tttc---gtggggtctg----
                 Weddell seal  -----caatac--aatgaa-----gct-caccg-gcc--tttg---gtggggtccg----
             Black flying-fox  -----cagtac--cacgaa-----gct-tgctt-gtc--ttct---ta-gggtccg----
B D                   Megabat  -----cagtac--catgaa-----gct-tgctt-gtc--ttct---ta-gggtccg----
                Big brown bat  -----cagtat--catgaa-----gct-tgccg-gcc--tttc---gt-gggtcca----
         David's myotis (bat)  -----caggac--catgga-----gct-tgccg-gcc--tttc---gt-gggtccg----
B D                  Microbat  -----caggac--catgga-----gct-tgccg-gcc--tttt---gt-gggtccg----
B D                  Hedgehog  -----gcgtgc--cttgag-----atc-cg-ta-gcc--cttc---acggggttcc--t-
B D                     Shrew  -----c-------------------------ca-ggg--gtcc---tgaaagtccg--c-
              Star-nosed mole  -----caatac--tatgaa-----act-cg-ct-ggc--ttct---taggggtccg--c-
B D                  Elephant  -----tagtac--tgtggg-----gct-cgaca-gcc--tttc---gtggggtccg----
          Cape elephant shrew  -----tagtac--tgtgat-----gct-cgcca-gcc--tttt---gtggggtctg----
B D                   Manatee  -----tagtac--cgtgag-----gct-cgctg-ggc--tttc---gtgaggtccg----
             Cape golden mole  -----cagtac--tggggg-----g-----------c--tttt---gtggggttcg----
                     Aardvark  -----cagtac--cgtcaa-----gct-taccg-gcc--tttc---gtagggtccg----
B D                 Armadillo  ------------------------------------c--ctcc---ccgggg--------
  D       Collared flycatcher  attttttgagc--ttggaatgc--act-tccag-agg--tcat---g-------------
B D               Zebra finch  cagtgctgccc--caggactgcg-gct-cgcagccgg--ccac---gccgcatcc-----
B D                    Tenrec  ============================================================
B D                     Sheep  ============================================================
B D                Coelacanth  ============================================================
B D             X. tropicalis  ============================================================
B D                    Lizard  ============================================================
  D    Spiny softshell turtle  ------------------------------------------------------------
  D  Chinese softshell turtle  ============================================================
  D            Painted turtle  ============================================================
  D           Green seaturtle  ============================================================
B D                    Turkey  ============================================================
B D                   Chicken  ============================================================
  D              Mallard duck  ============================================================
B D                Budgerigar  ============================================================
          Tibetan ground jay  ============================================================
B D       Medium ground finch  ============================================================
  D    White-throated sparrow  ============================================================
  D          Peregrine falcon  ============================================================
  D              Saker falcon  ============================================================
  D               Rock pigeon  ============================================================
B D                   Wallaby  ============================================================
B D        American alligator  ============================================================
B D                   Opossum  ============================================================
B D           Tasmanian devil  ============================================================

Alignment block 12 of 1519 in window, 78189450 - 78189518, 69 bps 
B D                     Human  cagc------tcaagcg----------tgggctgggcgcgggtgc-------------actggaggga--
B D                     Chimp  cagc------tcaagcg----------tgggctgggcgcgggtgc-------------actggaggga--
B D                   Gorilla  cagc------tcaagcg----------tgggctgggcgcgggtgc-------------actggaggga--
B D                 Orangutan  cagc------tcaagcg----------tgggctgggcgcgggtgc-------------actggaggga--
B D                    Gibbon  tagc------tcaagcg----------tgggctgggcgcgggtgc-------------actagaggga--
B D                    Rhesus  cagc------tcaagcg----------tgggctgggcgggggtgc-------------gctggaggga--
B D       Crab-eating macaque  cagc------tcaagca----------tgggctgggcgggggtgc-------------gctggaggga--
B D                    Baboon  cagc------tcaagcg----------tgggctgggcgcgggtgc-------------actggaggga--
B D              Green monkey  cagc------tcaagcg----------tgggctgggctc-ggtgc-------------actggaggaa--
B D                  Marmoset  cagc------tcaagcg----------tggactgggcgcgggtgc-------------actggaggga--
B D           Squirrel monkey  cagc------tcaagcg----------tgggctgggcgcgggtgc-------------actggaggga--
B D                  Bushbaby  catt------cccagtg----------tggactgggctagggtgcact----ggtataactggaggca--
           Chinese tree shrew  cagc------actggcc----------tgggctgggtgtgggtac-------------tctggtttcc--
B D                  Squirrel  -ag-------ggcagcc----------tggactagataggggtgcatt----gatata----attgga--
       Lesser Egyptian jerboa  -acccccaacctcgctc----------tgaactgggcgggggtgcact-----gcctaa-gcaagaga--
                 Prairie vole  -aaccccagtcccagtc----------cgggctgggcaggggtgtgat----ggcagaa-ggatggga--
B D           Chinese hamster  -aaccccagtcccagtc----------tgggctgggcagtggtgctgt----ggcataa-ggaaagga--
               Golden hamster  -aaccccaatcccagtc----------tgggctggggaggggtgctgt----ggcataa-ggaagtga--
B D                     Mouse  -acc------cccagtc----------tgggctaaaca--------------ggcgtaa-ggaaggaa--
B D                       Rat  -acc------cccagtc----------tgggctgaacaggggtgctgtgacgggtgtaa-ggaaggga--
B D            Naked mole-rat  -ggag-----ctcagcc----------tgggctgggcacggg----------------------------
B D                Guinea pig  -g--------cttagcc----------taggctgggcatggg----------------------------
                   Chinchilla  -ggca-----ctccggc----------tgggctgggtacagg----------------------------
             Brush-tailed rat  -ggag-----ctcagcc----------tgggctgggcacaag----------------------------
B D                    Rabbit  cagc------gccagca----------cagactggctgcgagtgcact----gctgtaattggaggga--
B D                      Pika  -agg------ggcacca----------gtgcctgg-----------------ggtgtcattgga------
B D                       Pig  -agc------cccagcc----------tgggctagaagctagtgcact----ggtgtaactggaggaa--
B D                    Alpaca  cagc------cccagcc----------tgggcggggagcgagtgagat----ggtgtaactggagaga--
               Bactrian camel  cagc------cccagcc----------tgggcggggagcgagtgagct----ggtgtaactggagaga--
B D                   Dolphin  cagc------cccagtc----------tgggctggtagcgggtgcact----ggtataactggaggga--
                 Killer whale  cagc------cccagtc----------tgggctggtagcgggtgcact----ggtataactggaggga--
             Tibetan antelope  cagc------cccagtc----------tgggctgggagcaggtgcagt----ggtataactggagggggt
B D                       Cow  -aga------cccagtc----------tgggctgggagcaggtgcagt----ggtataactggagggggt
B D                     Sheep  cagc------cccagtc----------tgggctgggagcaggtgcagt----ggtataactggagggggt
                Domestic goat  -agc------cccagtc----------tgggctgggagcaggtgcagt----ggtataactggagggggt
B D                     Horse  cagc------cccagcc----------tgggctgagcgcaggtgcact----ggtataactggaggga--
B D          White rhinoceros  cagc------cccagcc----------tgggctgggcgctggtgcact----ggtatgactggaggga--
B D                       Cat  cagc------cccagcc----------tgggctgggcgccagtgcacc----ggtataactggaagga--
B D                       Dog  cagc------cccagcc----------tgggggggacgccggtgcgcc----ggtataactggaagga--
B D                   Ferret   tagc------tccagcc----------tgggctgggcaccagtgcaa-----ggtataactgaaagga--
B D                     Panda  cagc------tccgacc----------tgggctgggtgccagtgcacc----ggtataactggaagga--
               Pacific walrus  cagc------tccagcc----------tgggctgggcgacagtgcact----ggtataactgaaagga--
                 Weddell seal  cagc------tccagcc----------tggactgggcgacagggcacc----gttataactgaaagga--
             Black flying-fox  cagc------cccagcc----------tgggctgggagcaggtgcact----ggtataactgggaggg--
B D                   Megabat  cagc------cccagcc----------tgggctgggagcaggtgcact----ggtataactgggaggg--
                Big brown bat  cagc------tccagcc----------tggattgggagcaggtgcact----ggtataattaaaggga--
         David's myotis (bat)  cagc------tccagcc----------tgggttgggagcaggtgcact----ggtgtaattgaaggga--
B D                  Microbat  cagc------tccagcc----------tgggttgggagcaggtgcact----ggtgtaattgaaggga--
B D                  Hedgehog  -ag-------cccatcc----------t---------ggggtaatcct----ggaataac-------a--
B D                     Shrew  ----------cccagcc--------------------gccgctgccct----ggtaccaccagaagaa--
              Star-nosed mole  -agt------cccagcc----------tgtgttg---ggcactgcatt----ggtataactcgaagga--
B D                  Elephant  cagc------tcctgc---------------ctgggtgcgggggcact----ggtgtaactagaggga--
          Cape elephant shrew  cagc------ctcagc---------------ctgcttaccgagtcatt----ggaataatttg-------
B D                   Manatee  cagc------tccagc---------------ctgggtgcagggacact----ggtataactagaggga--
             Cape golden mole  cagc------tctagc---------------ctgggtggaggagcact----gggataacttg-------
                     Aardvark  cagc------tccatc---------------ctgggtgc-ggcgcact----ggtatacctag-------
B D                 Armadillo  -------------------------------ctgggcatgggggcact----ggtgtaactgg----t--
  D       Collared flycatcher  tggc------ccaaccctctgctcaggtgggataaccttgagggagct----gctttagatgccaaca--
B D               Zebra finch  cggc------cccggccggaggtaacgcggggcgggaggaagggaaag----g-----ggtggcagga--
B D                    Tenrec  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  gg-----ga-ggt-----------------ggcacaa-ac-tgg--------------------------
                        Chimp  gg-----ga-ggt-----------------ggcacaa-ac-tgg--------------------------
                      Gorilla  gg-----ga-ggt-----------------ggcacaa-ac-cgg--------------------------
                    Orangutan  gg-----ga-agt-----------------ggcacaa-ac-tgg--------------------------
                       Gibbon  gg-----ga-ggt-----------------ggcacaa-ac-tgg--------------------------
                       Rhesus  gg-----ca-ggt----gg--ccgagctggggcacaa-ac-tgg--------------------------
          Crab-eating macaque  gg-----ca-ggt----gg--ccgagctggggcacaa-ac-tgg--------------------------
                       Baboon  gg-----ca-ggt----gg--ccgagctggggcacaa-ac-tgg--------------------------
                 Green monkey  gg-----ca-ggt----gg--ccgagctggggcacaa-ac-tgg--------------------------
                     Marmoset  gg-----ga-ggt----gg--ccgagctgcggcacaa-ac-tgg--------------------------
              Squirrel monkey  gg-----ga-ggt----gg--ccgagctgcggcacaa-ac-tgg--------------------------
                     Bushbaby  gg-----aagggt----tg--ccgagctgtgtcagag-at-tgg--------------------------
           Chinese tree shrew  tg-----ga-gg------------------ggcacac-cc-cgg--------------------------
                     Squirrel  gg-----ga-ggg----ag--ctgagttggggcacaa-ac-tgg--------------------------
       Lesser Egyptian jerboa  ag-----gg-aagtttttg--cccaggtggtgcacaa-ac-tag--------------------------
                 Prairie vole  ga-----gg-agg----ggaccccagcgagagtacaa-ac-caa--------------------------
              Chinese hamster  ga-----ga-cgg----ga--cccaatgggagtacat-at-cga--------------------------
               Golden hamster  ga-----ga-ggg----ga--cccaatgagagtacat-at-cga--------------------------
                        Mouse  ga-----ga-ggg----gg--cccaactggagtagac-ac-tga--------------------------
                          Rat  ga-----ga-ggg----gg--cacaactggagtacac-ac-tga--------------------------
               Naked mole-rat  ag-----gg-agg----gg--ccgacctaggatacaa-ac-tgg--------------------------
                   Guinea pig  ag-----gg-agg----gg--ctgacctgacaaacta------c--------------------------
                   Chinchilla  ag-----gg-agg----gg--ccgacctgaggtacaaact-cag--------------------------
             Brush-tailed rat  ag-----gg-agg----gg--ccgacctgaggtacag---------------------------------
                       Rabbit  ga-----gg-ggg----gg--tccagctggggcacaa-acgggg--------------------------
                         Pika  -a-----gg-tag----gg--tcaagctggcctctga-at------------------------------
                          Pig  gg-----gg-tgg----gg--ccgagctggggtacaa-ac-tgg--------------------------
                       Alpaca  gg-----gg-tgg----gg--ccgagctgggatacag-ac-tgg--------------------------
               Bactrian camel  gg-----gg-tgg----gg--ccgagctgggatacag-ac-tgg--------------------------
                      Dolphin  gg-----gg-tgg----gg--tcgagctggggtgcaa-ac-tga--------------------------
                 Killer whale  gg-----gg-tgg----gg--tcgagctggggtgcaa-ac-tga--------------------------
             Tibetan antelope  gg-----ga-tgg----gg--ccgaggtgggttacaa-ac-tgc--------------------------
                          Cow  gg-----gg-tgg----gg--ccgaggtgggttacaa-ac-tgg--------------------------
                        Sheep  gg-----ga-tgg----gg--ccgaggtgggttacaa-ac-tgg--------------------------
                Domestic goat  gg-----ga-tgg----gg--ccgaggtgggttacaa-ac-tgg--------------------------
                        Horse  ga-----cg-tgg----cg--ccaagctggggcacaa-ac-tga--------------------------
             White rhinoceros  ag-----gg-tag----gg--ccaagctggggcacaa-ac-tgg--------------------------
                          Cat  ag-----gg-tgg----ga--ctaagatggggcacaa-ac-tgg--------------------------
                          Dog  gg-----gg-tgg----gg--ctaacacagggcacaa-ac-tgg--------------------------
                      Ferret   gt-----gg-tgg----gg--ccaagatagggcacaa-ac-tgg--------------------------
                        Panda  gg-----gg-tgg----gg--ctaggatagggcacaa-ac-tgg--------------------------
               Pacific walrus  gg-----gg-tgg----gg--ttaagatagggcacaa-ac-tgg--------------------------
                 Weddell seal  gg-----gg-tgg----gg--ctaagatagggcacaa-ac-tgg--------------------------
             Black flying-fox  ag-----ag-gtg----gg---------------------------------------------------
                      Megabat  ag-----ag-gtg----gg---------------------------------------------------
                Big brown bat  gg-----gg-ttg----ga--ccgagccggga--caa-ac-cgg--------------------------
         David's myotis (bat)  gg-----gg-ttg----gg--cccagccacgg--caa-ac-agggtggtggggtggtggtggtggtgggg
                     Microbat  gg-----gg-ttg----gg--cccagccgggg--caa-ac-ggg----------------ggcgg-gggg
                     Hedgehog  ga-----gg-gtg----gg---------------------------------------------------
                        Shrew  gg-----gg-tgg----gg--ct-agctgtggcccag-ac-tgg--------------------------
              Star-nosed mole  gg-----gg-gtg----gg------gccatggggtaa-ac-tgg--------------------------
                     Elephant  gg-----gg-agg----ga--ctgagctggggttcaa-ac-tga--------------------------
          Cape elephant shrew  gg-----ag-atg----ga--ctgagctggtgctcaa-ac-tga--------------------------
                      Manatee  gg-----gg-aga----ga--ttgagctggggttcaa-ac-tga--------------------------
             Cape golden mole  ag-----ag-agg----ga--ctgagctggacttcaa-ac-tga--------------------------
                     Aardvark  ag-----gg-aag----ga--ctgagctggggttcaa-ac-gga--------------------------
                    Armadillo  ga-----gg-agg----gg--tcgagctggggcgccc-gc-ggg--------------------------
          Collared flycatcher  acttctagc-tgt----gt--ccaagg-------------------------------------------
                  Zebra finch  gc-----gg-ggc----gg--tcaggg-------------------------------------------
                       Tenrec  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  gg--g------------g-----cc--c-gagg
                        Chimp  gg--g------------g-----cc--c-gagg
                      Gorilla  gg--g------------g-----cc--c-gagg
                    Orangutan  gg--g------------g-----cc--c-gagg
                       Gibbon  gg--g------------g-----cc--c-gagg
                       Rhesus  gg--g------------g-----cc--c-gagg
          Crab-eating macaque  gg--g------------g-----cc--c-gagg
                       Baboon  gg--g------------g-----cc--c-gagg
                 Green monkey  gg--g------------g-----cc--c-gagg
                     Marmoset  ga--g------------g-----cc--c-tacg
              Squirrel monkey  ga--g------------g-----cc--c-tagg
                     Bushbaby  gg--g------------c-----cc--c-----
           Chinese tree shrew  tc--g------------a-----cc--cagagg
                     Squirrel  gg--g------------ggagggac--a-gagg
       Lesser Egyptian jerboa  gg--g------------t---------a-gagg
                 Prairie vole  gg--a------------t-----ccgga-gagg
              Chinese hamster  gg--a------------t-----cc--a-gagg
               Golden hamster  cg--a------------t-----cc--a-gagg
                        Mouse  gg--a------------t-----cc--a-gagg
                          Rat  gg--a------------t-----cc--a-gagg
               Naked mole-rat  gg--g------------a----ccc--a-gagg
                   Guinea pig  gg--a------------g----ccc--a-gagg
                   Chinchilla  ga--c------------t----gcc--a-gagg
             Brush-tailed rat  ---------------------------------
                       Rabbit  gg--a------------c-----cc--a-gagg
                         Pika  -g--a------------c-----cc--a-gagg
                          Pig  ggg-a------------t-----cc--aagagg
                       Alpaca  gg--g------------g-----cc--aagagg
               Bactrian camel  gg--g------------g-----cc--aagagg
                      Dolphin  gg--g------------g-----cc--aagcgg
                 Killer whale  gg--g------------g-----cc--aagcgg
             Tibetan antelope  gggcg------------c-----cc--aagaag
                          Cow  gggcg------------c-----cc--gagagg
                        Sheep  gggcg------------c-----cc--aagagg
                Domestic goat  gggcg------------c-----cc--aagagg
                        Horse  ag--g------------g-----cc--aagagg
             White rhinoceros  gg--g------------g-----cc--aagagg
                          Cat  gg--g------------g-----ct--aagagg
                          Dog  gg--a------------g-----ct--cagagg
                      Ferret   gg--g------------a-----cc--aagagg
                        Panda  gg--g------------g-----cc--aagagg
               Pacific walrus  gg--g------------g-----cc--aagagg
                 Weddell seal  gg--g------------g-----cc--aagagg
             Black flying-fox  -----------------g-----cc--aagagt
                      Megabat  -----------------g-----tc--aagagt
                Big brown bat  gg--gaacagaggaggtg-----tc--aagagt
         David's myotis (bat)  gg--gaacggaggaagtg-----tc--gagagt
                     Microbat  gg--gggcggaaaatgtg-----tc--gagagt
                     Hedgehog  -----------------g-----cc--caaagg
                        Shrew  ggt-g-----gagtcgcg-----cc--aggagg
              Star-nosed mole  gaa-g------------a-----cc--aagagg
                     Elephant  gg--g------------g-----tc--cagagg
          Cape elephant shrew  gg--g------------t-----tc--caga-g
                      Manatee  gg--g------------g-----cc--cagagg
             Cape golden mole  ag--g------------g------c--cagagg
                     Aardvark  ag--g------------g-----cc--cagagg
                    Armadillo  ga--g------------g-----tc--cagagg
          Collared flycatcher  ---------------------------------
                  Zebra finch  ---------------------------------
                       Tenrec  =================================
                   Coelacanth  =================================
                X. tropicalis  =================================
                       Lizard  =================================
       Spiny softshell turtle  ---------------------------------
     Chinese softshell turtle  =================================
               Painted turtle  =================================
              Green seaturtle  =================================
                       Turkey  =================================
                      Chicken  =================================
                 Mallard duck  =================================
                   Budgerigar  =================================
           Tibetan ground jay  =================================
          Medium ground finch  =================================
       White-throated sparrow  =================================
             Peregrine falcon  =================================
                 Saker falcon  =================================
                  Rock pigeon  =================================
                      Wallaby  =================================
           American alligator  =================================
                      Opossum  =================================
              Tasmanian devil  =================================

Inserts between block 12 and 13 in window
  D      Collared flycatcher 8bp
B D              Zebra finch 9183bp

Alignment block 13 of 1519 in window, 78189519 - 78189643, 125 bps 
B D                     Human  ccaccattgc-ttggaatgggcttttcct--attc-tcag--tgtgctgggccc--t--gggat-ac-cc
B D                     Chimp  ccaccattgc-ttggaatgggcttttcct--attc-tcag--tgtgctgggccc--t--gggat-ac-cc
B D                   Gorilla  ccaccattgc-ttggaatgggcttttcct--attc-tcag--tgtgctgggccc--t--gggat-ac-cc
B D                 Orangutan  ccaccattgc-ttggaatgggcttttcct--attc-tcag--tatgctgggccc--t--gggat-ac-cc
B D                    Gibbon  ccaccattgc-ttgggatgggcttttcct--attc-tcag--tatgctgggccc--t--gggat-ac-cc
B D                    Rhesus  ccaccattgt-ttggaatgggtttttcct--attc-tcag--catgctgggccc--t--gggat-ac-cc
B D       Crab-eating macaque  ccaccattgt-ttggaatgggtttttcct--attc-tcag--catgctgggccc--t--gggat-ac-cc
B D                    Baboon  ccaccattgt-ttggaatgggtttttcct--attc-tcag--catgctgggccc--t--gggat-ac-cc
B D              Green monkey  ccaccattgt-ttggaatgggtttttcct--attc-tcag--catgctgggccc--t--gggat-ac-cc
B D                  Marmoset  ccaccattgc-ttggaatgggcttttttt--attc-tcgg-acatcctgggccc--t--gggat-ac-cc
B D           Squirrel monkey  ccaccattgc-ttggaatgggcttttcct--atgc-tcag--catcctgggccc--t--gggat-ac-cc
B D                  Bushbaby  ---ccgagga-ctggaatgggcttctgct--attc-tcag--catccttggccc--t--gggat-ac-tc
           Chinese tree shrew  ccagcactgc-ctgggatgggccttgctc--gt-c-tcag--cat------cct--t--ggggt-ac-ac
B D                  Squirrel  ccaccactac-ttggaatagacttctgct--gtac-tcag--catactgga-cc--t--ggggt-ac-tt
       Lesser Egyptian jerboa  ttg--------------------tctggc--tctc-tgag--catcc-ggggcc--t--ggggc-ac-t-
                 Prairie vole  ctg--------------------cctggt--cgtc-ttag--cttaacggaatc--t--ggatc-cc-t-
B D           Chinese hamster  ctg--------------------tctggt--cgtt-ttag--tgtcccggaatt--t--gggac-cc-t-
               Golden hamster  ctg--------------------tctggt--cgtt-ttag--cgtcccggaacc--t--gggac-tc-t-
B D                     Mouse  cag--------------------tctgat--catc-t--t--tgtcctggagtc--c--ggggg-cc-t-
B D                       Rat  cag--------------------tctggt--catc-taag--cgtcctggggt-----------------
B D            Naked mole-rat  accccactgt-ttggaataggcttgtgct--attt-tcag--catcctggg-cc--t--ggggt-ac-t-
B D                Guinea pig  gccacactgt-ttgaaatatgcttgtact--attc----t--cagcatggg-cc--t--ggggt-gc-t-
                   Chinchilla  cccccactgc-ttggaataggcttgtgct--attc-tcca--catcctggg-cc--t--ggggt-ac-t-
             Brush-tailed rat  -----attgc-tt------ggcttgtgct--at------a--aaacct-----t--t--ggggt-ac-t-
B D                    Rabbit  ccagcactgc-ttggaaaaggcttttgct--gttc-ttag--catcccgtgtcc--ccgggggt-cc-ct
B D                      Pika  ccccctctac-tcggaaaaggcttttggg--gttc-ctag--catctgggataa--t--ggagt-cc-ct
B D                       Pig  ccgcctccac-ttagaatgggtttctgct--attc-tcag--catcctccgctc--c--ggtgc-a--gc
B D                    Alpaca  cca----agc-ttgaaatgggcttctgtt--attc-tcag--catcctctgcct--g--agtgt-ac-tc
               Bactrian camel  cca----cgc-ttgaaatgggcttctgtt--attc-tcag--catcctctgcct--g--agtgt-ac-tc
B D                   Dolphin  ccgcctccgc-ttggaatgggcttctgct--attc-tcag--catcctcggcca--g--ggcgt-ac-tc
                 Killer whale  ccgcctccgc-ttggaatgggcttctgct--attc-tcag--catcctcggcca--g--ggcgt-ac-tc
             Tibetan antelope  ccacctgcgc-ttggaatgggc-tctgct--attc-tctg--cattctcggcca--g--ggcgt-ac-tc
B D                       Cow  ccacctgcgc-ttggaatgggc-tctgct--attc-tctg--cattctcggcca--g--ggcgt-ac-tc
B D                     Sheep  ccacctgcgc--tggaatgggc-tctgtt--attc-tctg--cattctcggcca--g--ggcgt-ac-tc
                Domestic goat  ccacctgcgc-ttggaatgggc-tctgct--attc-tctg--cattctcggcca--g--ggcgt-ac-tc
B D                     Horse  cctccactgc-ttagagtggacttctgct---ctc-tcag--catcccc-g-cc--g--gg--t-ac-tc
B D          White rhinoceros  ccaccaccgc-ttgcaatgggcttcagct--attc-tcag--catcccc-gccc--g--gg--t-ac-tc
B D                       Cat  tcgcacccgc-ctggaatgggcttctg-----ttc-tcag--caacctc-gccc--g--ggtat-at-tc
B D                       Dog  ttgcaaccgc-ctggcgtgggc-tctgct--cttc-tcag--catcctc-tccc--g--ggcgt-acttc
B D                   Ferret   ttgcaaccgc-ttagcataggcttttgct--cttc-tcag--catcctc-gctc--g--ggcgt-ac-tc
B D                     Panda  ttgcaaccgc-ttggaatgggcttttgct--cttt-tcag--catcctc-ggcc--a--ggcgt-ac--c
               Pacific walrus  ttgcaaccgc-ttggaatgggcttttgct--cttc-tcag--catcctc-gccc--g--ggcgt-ac-tc
                 Weddell seal  ttgcaaccgc-ttggaatgggcttttgct--cttc-tcag--catcctc-gccc--a--ggcgt-ac-tc
             Black flying-fox  ccacctccga-ttggaatgggcttctgct--attc-tcag--cct-cct-gccc--g--ggcgtgtt-tc
B D                   Megabat  ctgcctccgc-ttggaatgggcttctgct--attc-tcag--cct-cct-gccc--g--ggcgtgtt-tc
                Big brown bat  ccgcctcc----------gggcttctgct--attc-tcag--cat-ccc-gccc--c--gggat-ac-cc
         David's myotis (bat)  ccgcctca----------gggcttctgct--attc-tcag--cat-ccc-gccc--c--gggg--ta-cc
B D                  Microbat  ccgccttc----------gggcttctgct--attcttcag--catcccc-gccc--c--ggggt-tg-cc
B D                  Hedgehog  ctgcctcagc-ttgttggggtctgctgct--gttc-tctg--tatcctt-------g--gctgt-tc-cc
B D                     Shrew  ctgccgccac-ttgcggt--gcttctgct--gctg-ctggaacatcctt-------g--agcag-ac-ac
              Star-nosed mole  ----caacac-tcggaatgggcttctgct--cttc-tcag--tatcctt-------g--gccat-ac-tt
B D                  Elephant  ctgacaccgc-ttggaatgggcttctgcc--atcc-tcag--catccccagcctcag--gtggt-ac-tc
          Cape elephant shrew  ctgacat------------agcttttgcc--attc-tcag--catcctcagacccta--ggggt-g----
B D                   Manatee  ctgacacctc-ttggaatgggcttctgcc--attc-tcag--catccccaactc----------------
             Cape golden mole  ctgataatgc-ttgaattggg---ttgcc--attc-tcag--catcaccagctc----------------
                     Aardvark  cagacacagc-ttggaatgggcttctgcc--attc-tcag--cacccccagccccca--agggt-ac-tt
B D                 Armadillo  ccgccgc-gc-cccgaacggtcttctacg--gtgc-tagg--catcatcggccccct--gtgct-c----
  D       Collared flycatcher  ccacaacctccctggtccgtgcctttcattgctcc-gtaa--aaatatgtttcc--t--ggagc-ag-ct
B D                    Tenrec  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -t-ccccaaccccctc------------------ttacggccctg--gcccttgcaaacc--ggagaccc
                        Chimp  -t-ccccaaccccctc------------------ttacggccctg--gcccttgcaaacc--ggagaccc
                      Gorilla  -t-ccccaaccccctc------------------ttacggccctg--gcccttgcaaacc--ggagaccc
                    Orangutan  -t-ccccaaccccctt------------------ttacggccctg--gcccttgcaaacc--ggagaccc
                       Gibbon  -t-ccccaaccccctc------------------ttacggccctg--gcccttgcaaacc--ggagaccc
                       Rhesus  -t-cccccagccccgc------------------ttacggctctg--gcccttgcaaacc--cgagaccc
          Crab-eating macaque  -t-cccccagccccgc------------------ttacggctctg--gcccttgcaaacc--cgagaccc
                       Baboon  -t-cccccagccccgc------------------ttacggctctg--gcccttgcaaacc--cgagaccc
                 Green monkey  -tccccccagccccgc------------------ttacggctctg--gcccttgcaaact--ggagaccc
                     Marmoset  -t-ccctcaacccccc------------------ttac------a--gcccttgcaaacc--ggagaccc
              Squirrel monkey  -g-ccctcaacccccc------------------ttac------a--gcccttgcaaact--agagaccc
                     Bushbaby  -c-accta--------------------------taac------a--gcccctgcaaact--ggagaccc
           Chinese tree shrew  -c-tgtaa------------------------------------g--gtccttgcaagtc--t--gaccc
                     Squirrel  -c---------atctc------------------taaa------g--gcccctgcgtttt--ggcga-cc
       Lesser Egyptian jerboa  ----------------------------------gaca------g--gcccttgctgact--agaga-cc
                 Prairie vole  ----------------------------------tgac------a--acccttgcagatt--ggaca-ac
              Chinese hamster  ----------------------------------tgac------a--acccttgcagatt--ggaga-ac
               Golden hamster  ----------------------------------tgac------a--acccttgcagatt--ggata-ac
                        Mouse  ----------------------------------tgac------a--tcgcttgcagatt--gcaga-ac
                          Rat  ---------------------------------------------------------------------c
               Naked mole-rat  --------------tg------------------taaa------g--gc-cttgcaaatt--ggaga-cc
                   Guinea pig  --------------tg------------------taaa------g--gcctttgcaaatt--ggaga-cc
                   Chinchilla  --------------tg------------------tgag------g--gctcttgcaaatt--ggaga-cc
             Brush-tailed rat  --------------tg------------------caaa------g--gcccttccaaatt--ggaga-cc
                       Rabbit  -c---------acctg------------------tatg------g--gcccttgcacact--ggaga-cc
                         Pika  -c---------accta------------------taaa------g--gcccttgcaaact--ggagt-cc
                          Pig  -c---------cccta------------------taat------a--accctcgcgaaca--gaagaccc
                       Alpaca  -c---------cccta------------------caag------a--acccttgcgaaca--ggagaccc
               Bactrian camel  -c---------cccta------------------caag------a--acccttgcgaaca--ggagaccc
                      Dolphin  -c---------cccta------------------caag------a--acccttgtgaaca--agagacct
                 Killer whale  -c---------cccta------------------caag------a--acccttgcgaaca--agagacct
             Tibetan antelope  -c---------agcta------------------cgag------a--agccttgtgaaca--ggagaccc
                          Cow  -c---------agcta------------------caag------a--agccttgcgcacg--ggagaccc
                        Sheep  -c---------agcta------------------caag------a--agccttgtgaaca--ggagaccc
                Domestic goat  -c---------agcta------------------caag------a--agccttgtgaaca--ggagaccc
                        Horse  -c---------cccta------------------caag------a--gcccttgcgaacg--tgagaccc
             White rhinoceros  -c---------ccctg------------------caag------a--gcccttgtgaacg--tgagaccc
                          Cat  -c---------ctcta------------------caag-------------------aca--tgagactc
                          Dog  -t---------cccta------------------caag-------------------act--tgagactc
                      Ferret   -c---------cccta------------------caag-------------------act--tgagac--
                        Panda  -c---------cccta------------------caag-------------------act--tgagactc
               Pacific walrus  -c---------cccta------------------caag-------------------act--taagactc
                 Weddell seal  -t---------cccta------------------caag-------------------act--tgagactc
             Black flying-fox  -c---------ttcta------------------tgag---------agctctgagaacc--ggagaccc
                      Megabat  -c---------ctctt------------------tgag---------agccctgagaacc--ggagaccc
                Big brown bat  -c---------ctcta------------------ttag---------agcccatcgaaca--ggagaccc
         David's myotis (bat)  -c---------ctcta------------------ttag---------agcccagcgaaca--gacgaccc
                     Microbat  -c---------ctcta------------------ctag---------agcccagcgaacagggaggaccc
                     Hedgehog  ga---------ccccacctcccc-----------cggg------a--gtgctggtgtaca----------
                        Shrew  -----------ccctgcccccgcgccccgacccccagg------agcgcctgggcaaacc--agagaccc
              Star-nosed mole  -a---------ctctg------------------cagg------a--gtcctggcgaaca--ggagaccc
                     Elephant  -t---------cccca------------------cctt------g--acccttgcagtcg--ggagaccc
          Cape elephant shrew  -t---------tccca------------------caat------g--gcctttgcaaaca--ggggacct
                      Manatee  -t---------tccca------------------ccat------g--gcccttgcaaaca--ggagaccc
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  -t---------cccca------------------caat------g--gaccttgcaaaca--ggagaccc
                    Armadillo  -t---------cccca------------------caac------c--gccctggcaacct--gaagaccc
          Collared flycatcher  -t---------ccatg------------------tctc------g--cctcctgcacagg--acataatc
                       Tenrec  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  -t-ga--------------------tgtgtcagct-tggtgccc
                        Chimp  -t-ga--------------------tgtgtcagct-tggtgccc
                      Gorilla  -t-ga--------------------tgtgtcagct-tggtgccc
                    Orangutan  -t-ga--------------------tgtgtcagct-tggtgccc
                       Gibbon  -t-ga--------------------tgtgtcagct-tggtgccc
                       Rhesus  -t-ga--------------------tgtgtcagtt-tggtgcac
          Crab-eating macaque  -t-ga--------------------tgtgtcagtt-tggtgcac
                       Baboon  -t-ga--------------------tgtgtcagct-tggtgcac
                 Green monkey  -t-ga--------------------tgtgtcagct-tggtgcac
                     Marmoset  -t-ga--------------------tgtgtcagtt-tggtgccc
              Squirrel monkey  -t-ga--------------------tgtgtcagtt-tggtgccc
                     Bushbaby  -c-a---------------------------ggtt-tggt----
           Chinese tree shrew  -t-gg--------------------tgtgac-----tggcacct
                     Squirrel  -t-ga--------------------tgtgtcagct-tggtgccc
       Lesser Egyptian jerboa  -t-ga--------------------tgtgtcagct-g-acgccc
                 Prairie vole  -c-ga--------------------agcgtaaact-c-gtgtcc
              Chinese hamster  -c-ga--------------------agcttaagct-c-ttgccc
               Golden hamster  -c-ga--------------------agcttaagct-t-gcatcc
                        Mouse  -t-ga--------------------agcttaagcg-c-ctgtcc
                          Rat  -t-ga--------------------tgcttaagcc-c-ctgtcc
               Naked mole-rat  -t-ga--------------------tgtatcagct-tggtgctc
                   Guinea pig  -t-ga--------------------tgtcttagct-tggt-tcc
                   Chinchilla  -t-ga--------------------tggatctgct-tggtgtcc
             Brush-tailed rat  -t-gg--------------------tgtatcagct-tggtgtcc
                       Rabbit  -g-ca--------------------ggtgt--------gaggcg
                         Pika  -c-cag-------------------ggtga--------gcggtg
                          Pig  -t-gg--------------------tgtgtcaaac-cggtgctc
                       Alpaca  -c--a--------------------tgtgtcagcc-tggtgccc
               Bactrian camel  -c--a--------------------tgtgtcagcc-tggtgccc
                      Dolphin  -c-ga--------------------tgtgtcagcc-tggtgccc
                 Killer whale  -c-ga--------------------tgtgtcagcc-tggtgccc
             Tibetan antelope  -ggga--------------------tatgtcagcc-tggtgccc
                          Cow  -cgga--------------------tatgtcagcc-tggtgccc
                        Sheep  -cgga--------------------tatgtcagcc-tggtaccc
                Domestic goat  -cgga--------------------tatgtcagcc-tggtgccc
                        Horse  -c-c---------------------tgggttagcc-tagtgcca
             White rhinoceros  -c-a---------------------tgcgttagcc-tggtgccc
                          Cat  -c-ttg-------------------tgtgttagcc-tggtgccc
                          Dog  -c-t---------------------tgtgttagcc-tggtgccc
                      Ferret   -------------------------tgtgttagcc-tagtgccc
                        Panda  -c-g---------------------tgtgttagcc-tggtgccc
               Pacific walrus  -c-t---------------------tgtgttaggc-tggtgccc
                 Weddell seal  -c-t---------------------tgtgttagcc-tggtgccc
             Black flying-fox  -t-ga--------------------tgtgtcagcc-tgatgctc
                      Megabat  -t-ga--------------------tgtgtcagcc-tgatgctc
                Big brown bat  -t-ga--------------------cgcgtcagcc-tggttcac
         David's myotis (bat)  -t-ga--------------------tgtgtcagcc-tggtctac
                     Microbat  tt-ga--------------------tgtgtcagccttggtccac
                     Hedgehog  --------------------------------------------
                        Shrew  -c-g---------------------catatcagcc-agtg--cc
              Star-nosed mole  -t-ga--------------------tgtgtcagac-tggg--tg
                     Elephant  -t-ga--------------------cgtgtctgcc-tggtgcct
          Cape elephant shrew  -t-ga--------------------catgtcagtc-aggtgccc
                      Manatee  -t-ga--------------------tgtgcctgcc-tggtgccc
             Cape golden mole  -------------------------------------------c
                     Aardvark  -t-ga--------------------cgtgtcagcc-aggtgcct
                    Armadillo  -c-ga--------------------cctgtgcgcc-tggtgcct
          Collared flycatcher  -c-caaggagttttcacccttcacttctgccacca-cagcatcc
                       Tenrec  ============================================
                   Coelacanth  ============================================
                X. tropicalis  ============================================
                       Lizard  ============================================
       Spiny softshell turtle  --------------------------------------------
     Chinese softshell turtle  ============================================
               Painted turtle  ============================================
              Green seaturtle  ============================================
                       Turkey  ============================================
                      Chicken  ============================================
                 Mallard duck  ============================================
                   Budgerigar  ============================================
           Tibetan ground jay  ============================================
                  Zebra finch  ============================================
          Medium ground finch  ============================================
       White-throated sparrow  ============================================
             Peregrine falcon  ============================================
                 Saker falcon  ============================================
                  Rock pigeon  ============================================
                      Wallaby  ============================================
           American alligator  ============================================
                      Opossum  ============================================
              Tasmanian devil  ============================================

Inserts between block 13 and 14 in window
  D      Collared flycatcher 7bp

Alignment block 14 of 1519 in window, 78189644 - 78189669, 26 bps 
B D                     Human  tt-ccttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                     Chimp  tt-ccttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                   Gorilla  tt-ccttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                 Orangutan  tt-ccttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                    Gibbon  tt-ccttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                    Rhesus  tt--cttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D       Crab-eating macaque  tt--cttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                    Baboon  tt--cttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D              Green monkey  tt-ccttcc---agaaagct--t-g------------------------gggtg-ga----------g
B D                  Marmoset  tt-ccttcc---agaaagcc--a-g------------------------gggtg-ga----------g
B D           Squirrel monkey  tt-ccttcc---agaaagcc--t-g------------------------gggtg-ga----------g
B D                  Bushbaby  ----ct--------------------------------------------ggtg-gg----------g
           Chinese tree shrew  tt-cctttc---gggaagcc--t-gccttagggcaggggctcagctgtcaggtgagg----------g
B D                  Squirrel  tc-ccttcc---agaaagcc--t-g------------------------gaatg-ggggtggg----g
       Lesser Egyptian jerboa  tc-cttccc---agaaagcc--t-a------------------------ggata-ggagtgggg---g
                 Prairie vole  cctcctccc---agaaaggc--t-g-------------------------------------------
B D           Chinese hamster  tc-cctcct---agaaagtc--t-g------------------------ggttg-ggagtggggtctg
               Golden hamster  tc-cctcct---agaaagtc--t-g------------------------ggttg-ggagagggggctg
B D                     Mouse  tc-cctcag---agaaagtc--t-g------------------------ggctg-ggagtgggg---g
B D                       Rat  tt-cctcac---agaaagtc--tgg------------------------ggctg-ggagtgggg---g
B D            Naked mole-rat  tc-ccttct---agaaagcc--t-g------------------------ggaca-ggggttgga---g
B D                Guinea pig  ct-ccttct---agaaagcc--t-g------------------------gaata-ggagttggg---g
                   Chinchilla  cc-ctttct---agaaagcc--t-g------------------------gggta-ggggttggg---g
             Brush-tailed rat  tc-ccttct---agaaagcc--t-g------------------------ggaga-ggcgttggg---g
B D                    Rabbit  gc--------------agcc--t-g------------------------cggtg-ggggcgggg---g
B D                      Pika  tc--------------agcc--a-g------------------------ggctg-gaagcccgg---g
B D                       Pig  gc-tcttcc---agaaagcc--t-g------------------------gggtg-gg----------g
B D                    Alpaca  gc-ccttcc---agaaagcc--t-a------------------------gggtt-gg----------g
               Bactrian camel  gc-cctttc---agaaagcc--t-a------------------------gggtt-gg----------g
B D                   Dolphin  gc-ccttcc---agaaagcc--t-g------------------------ggatg-gg----------g
                 Killer whale  gc-ccttcc---agaaagcc--t-g------------------------ggatg-gg----------g
             Tibetan antelope  gc-ccttcc---agaaagcc--t-g-------------------gggttgggtg-gg----------g
B D                       Cow  gc-ccttcc---agaaagcc--t-g-------------------gggtggggtg-gg----------g
B D                     Sheep  gc-ccttcc---agaaagcc--c-g-------------------gggttgggtg-gg----------g
                Domestic goat  ac-----cc---agaaagcc--t-g-------------------gggttgggtg-gg----------g
B D                     Horse  gc-ccttcc---agaaagcc--t-g------------------------gggtg-gg----------g
B D          White rhinoceros  gc-ccttcc---agaaagcc--t-g------------------------gggtg-gg----------g
B D                       Cat  gc-ccttcc---cgaaaccc--t-g------------------------gggtg-gg----------g
B D                       Dog  gc-ccttcc---agaaagcc--t-g------------------------gtgtg-gg----------g
B D                   Ferret   gc-ccttcc---agaaagcc--t-g------------------------gtgtg-gg----------g
B D                     Panda  gc-ccttcc---agaaaacc--t-g------------------------gtgtg-gg----------g
               Pacific walrus  ac-ccttcc---agaaagcc--t-g------------------------gtgtg-gg----------g
                 Weddell seal  ac-ccttcc---agaaagcc--t-g------------------------gtgtg-gg----------g
             Black flying-fox  tc-ctttcc---agaaaact--t-g------------------------gggtg-gg----------g
B D                   Megabat  tc-ctttcc---agaaaact--t-g------------------------gggtg-gg----------g
                Big brown bat  tc-ccttcc---agaaaacc--t-g------------------------gggat-gg----------g
         David's myotis (bat)  tc-ccttcc---agaaaacc--t-g------------------------gggat-gg----------g
B D                  Microbat  tt-cccttcccagaaaaacc--t-g------------------------gggga-ga----------g
B D                  Hedgehog  -t-ccttcc---agaaagcc--t-g------------------------ggt---gg----------a
B D                     Shrew  ta-ccctgt---ggaaagctgag-g------------------------ggtgg-gg----------g
              Star-nosed mole  tc-cattcc---agaaagcc--t-g------------------------ggatg-gg----------g
B D                  Elephant  gc-ccttcc---agaaagcc--t-g------------------------gcgtg-gg----------g
          Cape elephant shrew  ag-ccttct---agca---------------------------------gagtg-ga----------g
B D                   Manatee  gt-ccttcc---agaaagcc--t-a------------------------gggtg-gg----------g
             Cape golden mole  ag-cctgca---agaaagcc--t-g------------------------gggtg-gg----------g
                     Aardvark  ac-ccttca---agaaaaat--t-g------------------------gggtg-gg----------g
B D                 Armadillo  gc-gcttcc---agaaa--------------------------------gcgtg-gg----------g
  D       Collared flycatcher  ---cctcct---ggagacgt--t-g------------------------gggag-gg----------g
B D        American alligator  ---ttgctt---cgggaaag--t-g------------------------aaggg-gg----------g
B D                    Tenrec  ====================================================================
B D                Coelacanth  ====================================================================
B D             X. tropicalis  ====================================================================
B D                    Lizard  ====================================================================
  D    Spiny softshell turtle  --------------------------------------------------------------------
  D  Chinese softshell turtle  ====================================================================
  D            Painted turtle  ====================================================================
  D           Green seaturtle  ====================================================================
B D                    Turkey  ====================================================================
B D                   Chicken  ====================================================================
  D              Mallard duck  ====================================================================
B D                Budgerigar  ====================================================================
          Tibetan ground jay  ====================================================================
B D               Zebra finch  ====================================================================
B D       Medium ground finch  ====================================================================
  D    White-throated sparrow  ====================================================================
  D          Peregrine falcon  ====================================================================
  D              Saker falcon  ====================================================================
  D               Rock pigeon  ====================================================================
B D                   Wallaby  ====================================================================
B D                   Opossum  ====================================================================
B D           Tasmanian devil  ====================================================================

Inserts between block 14 and 15 in window
B D                      Pig 7bp
B D                   Alpaca 7bp
              Bactrian camel 7bp
B D                  Dolphin 7bp
                Killer whale 7bp
            Tibetan antelope 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
               Domestic goat 7bp
B D                    Horse 7bp
B D         White rhinoceros 7bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                  Ferret  7bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 7bp
B D                  Megabat 7bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 410bp
B D                 Hedgehog 7bp
B D                    Shrew 7bp
             Star-nosed mole 7bp
B D                 Elephant 7bp
         Cape elephant shrew 9bp
B D                  Manatee 8bp
            Cape golden mole 4bp
                    Aardvark 8bp
B D                Armadillo 8bp

Alignment block 15 of 1519 in window, 78189670 - 78189708, 39 bps 
B D                     Human  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                     Chimp  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                   Gorilla  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                 Orangutan  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                    Gibbon  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                    Rhesus  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D       Crab-eating macaque  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                    Baboon  --------tgcggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D              Green monkey  --------tgtggccctcacaggt-ttgtga---------gg-----------g---------gtgg---
B D                  Marmoset  --------t-ccgcccttacaggt-ttttga---------gg-----------g---------gtag---
B D           Squirrel monkey  --------t-cggcccttacaggt-ttgtga---------gg-----------g---------gtgg---
B D                  Bushbaby  --------t--ggccacaagagtt-ttgtga---------ga-----------g---------atgg---
           Chinese tree shrew  --------ctgggctggcagaggt-ttgcca---------g------------g---------gtgc---
B D                  Squirrel  --------gtgcggcgaaagaggt-ttgcga---------gg-----------g---------gtgg---
       Lesser Egyptian jerboa  --------cc-agctaggggagga-tagtaa---------gg-----------g---------gccg---
                 Prairie vole  ---------------------ggt-tagtca---------gg-----------g---------gtag---
B D           Chinese hamster  --------ctgggtcagcagaggt-tagtga---------gg-----------g---------ccag---
               Golden hamster  --------ctgggtcagcagaggt-tagtga---------gg-----------g---------ctag---
B D                     Mouse  --------ctgggttagcagaggt-tagtga---------gt-----------g---------gtgg---
B D                       Rat  --------ctgggtcagcagagat-tagtga---------gc-----------g---------gtgg---
B D            Naked mole-rat  --------cttaggcagcagaggt-tttttttggggggggtg-----------t---------gtgg---
B D                Guinea pig  --------ttcagccagcagaggt-ttagac---------gg-----------g---------gtgg---
                   Chinchilla  --------ctcagccagcagaggt-ttac------------g-----------g---------gcgg---
             Brush-tailed rat  --------ctcaggcagcccagtt-tcaa-----------gg-----------g---------gtgg---
B D                    Rabbit  --------cagg----------------------------gg-----------c---------gcgg---
B D                      Pika  --------cagg----------------------------gg-----------c---------acgg---
B D                       Pig  --------tgcggccatcagaggt-atgtga---------gg-----------g---------gagg--c
B D                    Alpaca  --------ggcagccatcagaggt-atgtga---------gg-----------g---------gtggtcc
               Bactrian camel  --------ggcggccatcagaggt-atgtga---------gg-----------g---------gtggtcc
B D                   Dolphin  --------cgcgggcatcagaggt-atgtga---------gg-----------g---------gtgg--c
                 Killer whale  --------cgcgggcatcagaggt-atgtga---------gg-----------g---------gtgg--c
             Tibetan antelope  --------cgcggccatcagaagt-gtgtga---------gg-----------g---------g------
B D                       Cow  --------cgcggccaccagaagt-gtgtga---------gg-----------g---------gtgg--c
B D                     Sheep  --------cgcggccatcagaagt-gtgtga---------gg-----------g---------g------
                Domestic goat  --------catggccatcagaagt-gtgtga---------gg-----------g---------g------
B D                     Horse  --------cacggccatcagagat-ttatga---------gg-----------g---------gagg-cc
B D          White rhinoceros  --------cat-gccatccgaggt-atatga---------gg-----------g---------gagg---
B D                       Cat  --------c----------------atgtga---------gg-----------g---------gtgg---
B D                       Dog  --------catggctatcttaagt-atgtga---------gg-----------g---------gtgg---
B D                   Ferret   --------cttgtctgtcttaaat-atgtga---------gg-----------g---------gtgg---
B D                     Panda  --------cgtggctatcttaagt-atgtga---------gg-----------g---------gtgg---
               Pacific walrus  --------cgtggctatcttaagt-acgtga---------gg-----------g---------gtgg---
                 Weddell seal  --------tgtggctatcttaagt-acgtga---------ag-----------g---------gtgg---
             Black flying-fox  --------gccggccatcag--gt-atgtga---------gg-----------a---------gtgg--c
B D                   Megabat  --------gccggccatcag--gt-atgtga---------gg-----------a---------gtgg--c
                Big brown bat  --------acaggccatcaga-gt-atgtga---------gg-----------g---------atgg--c
         David's myotis (bat)  --------acaggccatcaga-gt-atgcga---------gg-----------g---------gtgg---
B D                  Hedgehog  --------cgcagccatgaaaggt-gggtga---------gg-----------ggatgagcgagcgg--t
B D                     Shrew  --------aac--------------ttgtgc---------gg-----------gggt-----cgcgg--t
              Star-nosed mole  --------cacag--atgggtggctttgtga---------gg-----------g---------gtgg--t
B D                  Elephant  --------tacggccaagagtagt-atgtga---------ga-----------g---------gcgg--c
          Cape elephant shrew  --------gttggccaagagtgat-atgtga---------gg-----------g---------gtg----
B D                   Manatee  --------tgcggtcaagagtggt-gtgtga---------ga-----------g---------gtgg--c
             Cape golden mole  --------tacgaccaagagaggt-ac-tga---------gg-----------g---------gtgg--a
                     Aardvark  --------tgctgtcaagagtagt-atgtga---------tg-----------g---------gtga--c
B D                 Armadillo  -------------------------atggga---------gg-----------a---------gtgg--c
  D       Collared flycatcher  gagagcatc------gctcgaggg-ttgagc---------tg----------------------------
B D        American alligator  gacaccctctttgctgccagccat-ctgagc---------ggtgcctgcagta-----------------
B D                    Tenrec  ======================================================================
B D                  Microbat  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  cccc--gcagg-g
                        Chimp  cccc--gcagg-g
                      Gorilla  cccc--gcagg-g
                    Orangutan  cccc--gcagg-g
                       Gibbon  cccc--gcagg-g
                       Rhesus  cccc--gcagg-g
          Crab-eating macaque  cccc--gcagg-g
                       Baboon  cccc--gcagg-g
                 Green monkey  cccc--gcagg-g
                     Marmoset  cccc--ttagg-g
              Squirrel monkey  cccc--gtagg-g
                     Bushbaby  cccct-gcagg-g
           Chinese tree shrew  cccccagcagg-g
                     Squirrel  cctc--ctcag-g
       Lesser Egyptian jerboa  cc------agg-c
                 Prairie vole  ttct--ggagg-c
              Chinese hamster  tttt--gtagg-c
               Golden hamster  tttt--gtagg-c
                        Mouse  ctct--gtaat-c
                          Rat  ttct--gtggg-c
               Naked mole-rat  ccct------g-c
                   Guinea pig  ccct------g-c
                   Chinchilla  cccc------g-a
             Brush-tailed rat  cccc---------
                       Rabbit  ccag--gccgg-g
                         Pika  tcag--gcagc-c
                          Pig  cccc--a------
                       Alpaca  cccc--agcgg--
               Bactrian camel  cccc--agtgg--
                      Dolphin  cctc--attgg--
                 Killer whale  cctc--attgg--
             Tibetan antelope  -ccc--attgc--
                          Cow  cccc--attgc--
                        Sheep  -ccc--attgc--
                Domestic goat  -ccc--attgc--
                        Horse  cccc--ggacg--
             White rhinoceros  ccct--gggcggg
                          Cat  cccc--agcag-g
                          Dog  cccc--agcag-g
                      Ferret   tccc--agaag-g
                        Panda  cccc--agaag-g
               Pacific walrus  cccc--agcag-g
                 Weddell seal  cccc--agcag-g
             Black flying-fox  cccc--agcgg-g
                      Megabat  cccc--agcgg-g
                Big brown bat  cccc--agtgg-a
         David's myotis (bat)  cccc--agtgg-a
                     Hedgehog  g------------
                        Shrew  cccc--gctgg-g
              Star-nosed mole  cccc--agcag-g
                     Elephant  ctgc--agcta-g
          Cape elephant shrew  --ac--agcca-a
                      Manatee  ctcc--agctg-g
             Cape golden mole  cccc--agttg-g
                     Aardvark  tccc--agctg-g
                    Armadillo  cccc--agccg-g
          Collared flycatcher  -------------
           American alligator  -------------
                       Tenrec  =============
                     Microbat  =============
                   Coelacanth  =============
                X. tropicalis  =============
                       Lizard  =============
       Spiny softshell turtle  -------------
     Chinese softshell turtle  =============
               Painted turtle  =============
              Green seaturtle  =============
                       Turkey  =============
                      Chicken  =============
                 Mallard duck  =============
                   Budgerigar  =============
           Tibetan ground jay  =============
                  Zebra finch  =============
          Medium ground finch  =============
       White-throated sparrow  =============
             Peregrine falcon  =============
                 Saker falcon  =============
                  Rock pigeon  =============
                      Wallaby  =============
                      Opossum  =============
              Tasmanian devil  =============

Inserts between block 15 and 16 in window
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                    Shrew 4265bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 16 of 1519 in window, 78189709 - 78189795, 87 bps 
B D                     Human  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-atagctgc
B D                     Chimp  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-atagctgc
B D                   Gorilla  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-atagctgc
B D                 Orangutan  at---agt-tgtgtg------------tggtgggt-------------tcctgagga-gga-atagctgc
B D                    Gibbon  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-atagctgc
B D                    Rhesus  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-agagctgt
B D       Crab-eating macaque  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-agagctgt
B D                    Baboon  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-agagctgt
B D              Green monkey  at---agg-tgtgtg------------tggtgggt-------------tcctgagga-gga-atagctgt
B D                  Marmoset  at---agg-tgtgtg-------------gatgggt-------------tcttgaggaggga-atggctgc
B D           Squirrel monkey  at---agg-tgtgtg------------cgatgggt-------------tcttgaggaggga-atggctgc
B D                  Bushbaby  at---ggc-agagtg------------tggcaggt-------------tcctgtggaggga-acagctgc
           Chinese tree shrew  gt---ggg-tgagtg------------tggtgggc-------------tcctgagga-ggc-agta----
B D                  Squirrel  ag---tggtggagtg------------tg----ct-------------ccccaggag-gga-acagctgc
       Lesser Egyptian jerboa  agggtggg-tgaggg------------tgggggat-------------tcctgagag-gtt-atag-tgc
                 Prairie vole  ag---gggttgagtg------------tggccagt-------------cccagaggt-gga-acaa-tgc
B D           Chinese hamster  ag---ggg-tgagtg------------tggccaat-------------ccaagaggt-ggg-acaa-tgc
               Golden hamster  ag---ggg-tgagtg------------tggccaat-------------cccagagat-gga-acaa-tg-
B D                     Mouse  ag---ggg-cgagtg------------tggacagt-------------cccagaggg-gac--------t
B D                       Rat  aa---ggg-ggagtg------------tggccaat-------------cccagaggg-ggagacaa-tgt
B D            Naked mole-rat  ag---gga-------------------tggtgtgt-------------atctgagaa-cagaacag----
B D                Guinea pig  ag---gga-------------------tggtgaat-------------acccgagga-------------
                   Chinchilla  aa---gga-------------------tggtaggt-------------acctgagga-cggaacag----
             Brush-tailed rat  ca---gga-------------------tgatgtgt-------------acctgagga-cgg-acag----
B D                    Rabbit  ag---ggg-tggatg------------tggtgtgt-------------tcccgagga-gggaa-ggctgc
B D                      Pika  ag---gag-tggatg------------tagtgtgt-------------tcctgagga-gggagcagccgc
B D                       Pig  -------------------------------------------------------ga-gggagtatgtgc
B D                    Alpaca  ---------------------------ggatgggt-------------tcttgaga--------------
               Bactrian camel  ---------------------------ggatgggt-------------tcttgaga--------------
B D                   Dolphin  ---------------------------ggctggct-------------tcctgagaa-gcgaatatatgc
                 Killer whale  ---------------------------ggctggct-------------tcctgagaa-gcgaatatatgc
             Tibetan antelope  ---------------------------ttatgtgt-------------ttctgagaa-gggaatata---
B D                       Cow  ---------------------------ttatgtgt-------------ttctgagaa-gggaatata---
B D                     Sheep  ---------------------------ttatgtgt-------------ttctgagaa-gggaatata---
                Domestic goat  ---------------------------ttatgtgt-------------ttctgagaa-gggaatata---
B D                     Horse  ----------------------------------------------------gagaa-gggaatagatgc
B D          White rhinoceros  at---ggg-tgagtg------------taatgggt-------------tcctgagaa-gggaatatatgc
B D                       Cat  at---gag-tgattg------------tggtgggt-------------ttctgagaa-gggaatatatgc
B D                       Dog  at---ggg-tgattg------------tggtgggt-------------tcctgagaa-gggaatatatgc
B D                   Ferret   at---ggg-tgattg------------tggtgtgt-------------tcctgagaa-gggaatatatgc
B D                     Panda  at---ggg-tgattg------------tggtgggt-------------tcctgagaa-gggaatacatg-
               Pacific walrus  at---ggg-tgattg------------tggtgggt-------------tcctgagaa-ggaaatacatgc
                 Weddell seal  at---ggg-tgattg------------tggtgggt-------------tcctgagaa-gggaatatatgc
             Black flying-fox  at---ggg-tgagtg------------tggtgggt-------------tcctgaaaa-gggaatatgtac
B D                   Megabat  at---ggg-tgagtg------------tggtgggt-------------tcctgaaaa-gggaatatgtac
                Big brown bat  at---ggt-tgattg------------tggtgggt-------------tcctgaaaa-ggggatatatgc
         David's myotis (bat)  gt---ggg-tgagtg------------tggtgggt-------------tcctgaaaa-ggggatgtatgc
B D                  Hedgehog  -g---ggg-gtgggg------------tagtggtg-------------tcctgagga-gttgctctgtgt
              Star-nosed mole  -a---tgg-gtagtg------------tgat-gtg-------------tcctgagaa-gggaatatgtgc
B D                  Elephant  ac---gcg-tgaaga------------tggtgggt-------------tcctgagga-aggaataggtgc
          Cape elephant shrew  gcag-agg-tgaaca------------tcattggt-------------tcctg-----------------
B D                   Manatee  cg---ggg-tgaagg------------tggtgggt-------------tcctgagga-aggaatagctgc
             Cape golden mole  ag---tag-tgaaga------------tggtggat-------------tcctaagga-aggaatacatgc
                     Aardvark  ag---ggg-tgaggg------------tggtgggt-------------tctggagca-gggaaaagatgc
B D                 Armadillo  ag---ggg-cgagga------------gggtgggc-------------ttctcgaga-gggagcggaagt
  D       Collared flycatcher  ---------------------------ttatggggttggtga------tgcagagga-gga-caagctgc
B D        American alligator  ------------atgtaataacctgttttataggtcaagcaagacccgtgaagatag-gaa-cccgggac
B D                     Shrew  ======================================================================
B D                    Tenrec  ======================================================================
B D                  Microbat  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  tcct------gct----ttcttc--cc-------------------ttctc-t-ctc-------------
                        Chimp  tcct------gct----ttcttc--cc-------------------ttctc-t-ctc-------------
                      Gorilla  tcct------gct----ttcttc--cc-------------------ttctc-t-ctc-------------
                    Orangutan  tcct------gct----ttcttc--cc-------------------ttctc-a-ctc-------------
                       Gibbon  tcct------gct----ttcttc--cc-------------------ttctc-t-ctc-------------
                       Rhesus  tcct------gct----ttcttc--cc-------------------ttgtc-t-ctc-------------
          Crab-eating macaque  tcct------gct----ttcttc--cc-------------------ttgtc-t-ctc-------------
                       Baboon  tcct------gct----ttcttc--cc-------------------ttgtc-t-ctc-------------
                 Green monkey  tcct------act----ttcttc--cc-------------------ttgtc-t-ctc-------------
                     Marmoset  tcct------gcc----ttcttc--cc-------------------ttctc-t-ctc-------------
              Squirrel monkey  tcct------gct----ttcttc--cc-------------------ttctc-t-ctc-------------
                     Bushbaby  tcct------acc----ctcttc--cc-------------------ttctc-t-ctctctt---------
           Chinese tree shrew  ----------gcc----ttcttc--cc-------------------t--tc-t-ccc-------------
                     Squirrel  tcca------acc----ttcttc--------------------------tc-t-ctc-------------
       Lesser Egyptian jerboa  tcct------gcc----ttcttc-------------------------gcg-t-ctc-------------
                 Prairie vole  tcct------gtc----atcttccgtg-------------------ttctc-t-ctc-------------
              Chinese hamster  t-ct------ttc----gtcttc---------------------------------c-------------
               Golden hamster  --ct------gtc----atcttc---------------------------c-t-atc-------------
                        Mouse  tctc------ttc----atcttc--tc-------------------ttcca-t-ctc---t---------
                          Rat  tcct------gcc----atcttc--ct-------------------ttcca-t-ctc-------------
               Naked mole-rat  -------------------cttt---------------------------c-c-ttctttc---------
                   Guinea pig  -------------------tctc---------------------------a-c-ctc-------------
                   Chinchilla  -------------------cttc---------------------------c-c-ttc-------------
             Brush-tailed rat  -------------------cttc---------------------------c-t-ctc---c---------
                       Rabbit  tcct------gcc---------t---------------------------t-t-ctc-------------
                         Pika  tcct------gcccccagccctt---------------------------c-t-ccc-------------
                          Pig  tccc------acc----ttcttc--cc-------------------ttctctc-tcc-------------
                       Alpaca  ----------acc----ttcttc--cc-------------------ttcta-c-ccc-------------
               Bactrian camel  ----------acc----ttcttc--cc-------------------ttctc-c-ccc-------------
                      Dolphin  tccc------acc----ttcttc--cc-------------------ttctc-c-tcc-------------
                 Killer whale  tccc------acc----ttcttc--cc-------------------ttctc-c-tcc-------------
             Tibetan antelope  tccc------acc----tccttc--tc-------------------ttccc-t-tcc-------------
                          Cow  tccc------acc----tccttc--cc-------------------ttctc-t-tcc-------------
                        Sheep  tccc------a-------ccttc--tc-------------------ttccc-t-tcc-------------
                Domestic goat  tccc------acc----tccttc--tc-------------------ttccc-t-tcc-------------
                        Horse  tccc------acc----cgcttc--cc-------------------ttctc-t-cct-------------
             White rhinoceros  tc--------------------------------------------------------------------
                          Cat  tcct------acc----ctcttc--tt-------------------ttctc-t-cct-------------
                          Dog  tc---------------------------------------------cctc-t-cct-------------
                      Ferret   tc---------------------------------------------tctc-t-cct-------------
                        Panda  -c---------------------------------------------tctc-t-cct-------------
               Pacific walrus  tc---------------------------------------------tctc-t-cct-------------
                 Weddell seal  tc---------------------------------------------tctc-t-cct-------------
             Black flying-fox  accc------acc----ctcttc--tt-------------------ttctc-c-cccctcc---------
                      Megabat  accc------acc----ctcttc--tt-------------------ttctc-c-cccctcc---------
                Big brown bat  tccc------atc----cttttc--cc-------------------ttctc-c-ccatccctcctccccg
         David's myotis (bat)  ttcc-------cc----ctcttc--cc-------------------ttctc-c-ccctcccc--------
                     Hedgehog  gcc--------ct----ctcttc--cctagctcccaaccccccaggtccac-g-gcc-------------
              Star-nosed mole  ccc-------acc----ctcttc--ct-------------------ttcac-t-tcc-------------
                     Elephant  tccc------act----gtcttc--tc-------------------ttctt-t-ctc-------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  tcct------act----ctcttc--tc-------------------ttctt-t-ctc-------------
             Cape golden mole  cccc------ac------tcttt--cc-------------------ttctt-a-ctt-------------
                     Aardvark  tccc------acc----ctcttc--tt-------------------tgctt-t-cat-------------
                    Armadillo  tccc------gcg----ctcctc--cc-------------------agctc-tgccg-------------
          Collared flycatcher  ttct------gtt----tcctcc--ca-------------------catct-t-ctg-------------
           American alligator  ttcgcattaagcc----tcctct--ct-------------------c-----t-ctc-------------
                        Shrew  ======================================================================
                       Tenrec  ======================================================================
                     Microbat  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ctcctta---------tc---ctttga-g-gaa---ga---gca
                        Chimp  ttcctta---------tc---ctttga-g-gaa---ga---gca
                      Gorilla  ctcctta---------tc---ctttga-g-gaa---ga---gca
                    Orangutan  ctcctta---------tc---cttaga-g-gca---ga---gca
                       Gibbon  ctcctta---------tc---ctttga-g-gaa---ga---gca
                       Rhesus  ctcctta---------tc---ctttaa-g-gaa---ga---gca
          Crab-eating macaque  ctcctta---------tc---ctttaa-g-gaa---ga---gca
                       Baboon  ctccttc---------tc---ctttaa-g-gaa---ga---gca
                 Green monkey  ctcctta---------tc---ctttaa-g-gaa---ga---gca
                     Marmoset  ctcatac---------cc---ctttaa-g-gaa---ga---gct
              Squirrel monkey  ctcatac---------cc---atttaa-g-gaa---ga---gca
                     Bushbaby  ttcatta---------cc---cctcagta-gaa---ga---gca
           Chinese tree shrew  ctcatct---------ac---cttcag-gaaaa---gg---gcc
                     Squirrel  ---attt---------cc---cttcaata-aaa---ga---gca
       Lesser Egyptian jerboa  ---tttc---------ctgtcccttagta-aca---gg---gca
                 Prairie vole  ---attc---------ct---cttcagca-ata---gg---aca
              Chinese hamster  ---attc---------ct---cttcagta-ata---gg---gca
               Golden hamster  ---attc---------ct---cttcagta-ata---gg---gca
                        Mouse  ctaattc---------ct---cttcagta-aca---gggttgtt
                          Rat  ---attc---------ct---cttcagta-aca---gg---gct
               Naked mole-rat  ttcattg---------cc---cttcagtt-aaa---aa---aca
                   Guinea pig  ---atgc---------ct---cttcagt----t---aa---ata
                   Chinchilla  ----------------ac---cttcagtt--at---aa---ata
             Brush-tailed rat  cctattt---------cc---cttccgtg--gt---cg---gag
                       Rabbit  ---ctgc---------tc---tcccagta-aaa---ga---gca
                         Pika  ---ctccatctcatcatc---tcccattc-aaa---ga---gca
                          Pig  tctgttc---------tc---tttcggta-aaa---ga---cca
                       Alpaca  ttaattc---------cc---tttcagta-aag---a----gta
               Bactrian camel  ttaattc---------cc---tttcagta-aag---a----gta
                      Dolphin  tcagttc---------tc---cttcggta-aaa---gg---gca
                 Killer whale  tcagttc---------tc---cttcggta-aaa---gg---gca
             Tibetan antelope  tcagttc---------cc---cttcagta-aaa---cc---gta
                          Cow  tcagttc---------cc---cttcagta-aaa---tc---gta
                        Sheep  tcagttc---------cc---cttcaata-aaa---ct---gta
                Domestic goat  tcagttc---------cc---cttcaata-aaa---ct---gta
                        Horse  tccattc---------ct---cttcagta-aaa---ta---gca
             White rhinoceros  -ccattc---------ct---c-tcagta-aaa---ga---gca
                          Cat  tccattc---------cc---cttcagta-aaa---ga---gct
                          Dog  cccagtc---------cc---catcagtt-aaa---ga---gta
                      Ferret   cccattc---------cc---cttcagtt-caa---ga---gca
                        Panda  cccattc---------cg---cttcagtt-aaa---ga---gcc
               Pacific walrus  ctcattc---------cc---cttcagtt-aaa---ga---gca
                 Weddell seal  cccattc---------cc---ctccagtt-aaa---ga---gcg
             Black flying-fox  ctcatat---------cc---ttttagta-aga---ga---gta
                      Megabat  ctcatat---------cc---ctttagta-aga---ga---gta
                Big brown bat  cccatac---------ct---cttcagta-aaa---ga---gca
         David's myotis (bat)  ctcatac---------cc---ctttagta-aaa---ga---gca
                     Hedgehog  cccat-t---------cc---ctgcagta-aaacccgg---gca
              Star-nosed mole  accat-c---------cc---cttcagta-aaa---ga---aca
                     Elephant  cccactc---------cc---cttcagta-aaa---ga---cca
          Cape elephant shrew  ---------------------catcaatg-gag-----------
                      Manatee  cccactc---------tc---cttcagta-aaa---ga---gca
             Cape golden mole  ttttttt---------gt---cttcagta-aaa---ga---gca
                     Aardvark  cctattc---------cc---cttcagta-aat----a---gca
                    Armadillo  gcccttc---------cc---cttcagga-aaa---ga---gca
          Collared flycatcher  ctccctg---------cc---attcag-g-aaa---ta---aca
           American alligator  ttttttt---------tt---tttaaa-g-gga---ga---tt-
                        Shrew  ============================================
                       Tenrec  ============================================
                     Microbat  ============================================
                   Coelacanth  ============================================
                X. tropicalis  ============================================
                       Lizard  ============================================
       Spiny softshell turtle  --------------------------------------------
     Chinese softshell turtle  ============================================
               Painted turtle  ============================================
              Green seaturtle  ============================================
                       Turkey  ============================================
                      Chicken  ============================================
                 Mallard duck  ============================================
                   Budgerigar  ============================================
           Tibetan ground jay  ============================================
                  Zebra finch  ============================================
          Medium ground finch  ============================================
       White-throated sparrow  ============================================
             Peregrine falcon  ============================================
                 Saker falcon  ============================================
                  Rock pigeon  ============================================
                      Wallaby  ============================================
                      Opossum  ============================================
              Tasmanian devil  ============================================

Alignment block 17 of 1519 in window, 78189796 - 78189796, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  a
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  c
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  t
         David's myotis (bat)  t
B D                  Hedgehog  c
              Star-nosed mole  t
B D                  Elephant  t
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  t
B D                 Armadillo  g
  D       Collared flycatcher  g
         Cape elephant shrew  -
B D                     Shrew  =
B D                  Microbat  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                    Lizard  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                   Wallaby  =
B D        American alligator  -
B D                   Opossum  =
B D           Tasmanian devil  =

Alignment block 18 of 1519 in window, 78189797 - 78189805, 9 bps 
B D                     Human  c-------tg-cttttt
B D                     Chimp  c-------tg-cttttt
B D                   Gorilla  t-------tg-cttttt
B D                 Orangutan  t-------tg-cttttt
B D                    Gibbon  t-------tg-cttttt
B D                    Rhesus  t-------tg-cttttt
B D       Crab-eating macaque  t-------tg-cttttt
B D                    Baboon  t-------tg-cttttt
B D              Green monkey  t-------tg-cttttt
B D                  Marmoset  t-------tg-cttttt
B D           Squirrel monkey  t-------tg-cttttt
B D                  Bushbaby  t-------tg-cttttt
           Chinese tree shrew  ttgctttctg-ctttct
B D                  Squirrel  t-------tg-cttttt
       Lesser Egyptian jerboa  t-------ta-cctggc
                 Prairie vole  t-------tg-cttgtc
B D           Chinese hamster  t-------tg-cctgtc
               Golden hamster  t-------tg-cctgcc
B D                     Mouse  t-------tg-cctgtc
B D                       Rat  t-------tg-cctgtc
B D            Naked mole-rat  t-------tt-cttttt
B D                Guinea pig  t-------tc-cttttt
                   Chinchilla  t-------tc-cttttt
             Brush-tailed rat  t-------tc-cccttt
B D                    Rabbit  t-------tg-cttggc
B D                      Pika  t-------tg-cttgg-
B D                       Pig  t-------ta-cttttt
B D                    Alpaca  t-------tg-ctggtt
               Bactrian camel  t-------tg-ctcgtt
B D                   Dolphin  t-------tg-ggtttt
                 Killer whale  t-------tg-ggtttt
             Tibetan antelope  g-------ta-gttttt
B D                       Cow  g-------tg-gttttt
B D                     Sheep  g-------ta-gttttt
                Domestic goat  g-------ta-gttttt
B D                     Horse  t-------tg-ctttta
B D          White rhinoceros  t-------tg-cttttt
B D                       Cat  t-------tg-cttttt
B D                       Dog  t-------tg-cttttt
B D                   Ferret   t-------tg-cgtttt
B D                     Panda  t-------tg-cttttt
               Pacific walrus  t-------tg-cttttt
                 Weddell seal  t-------tg-cttttt
             Black flying-fox  t-------tg-cttttt
B D                   Megabat  t-------tg-cttttt
                Big brown bat  t-------tgttttttt
         David's myotis (bat)  t-------tg-cttttt
B D                  Hedgehog  t-------t--------
              Star-nosed mole  t-------tg-ctttaa
B D                  Elephant  t-------tg-cttttt
B D                   Manatee  t-------tg-cttttt
             Cape golden mole  t-------tg-cttgtt
B D                    Tenrec  t-------ta-cttttt
                     Aardvark  a-------tg-gttttt
B D                 Armadillo  t-------cg-gttttt
B D        American alligator  c-------tg-cgttag
         Cape elephant shrew  -----------------
B D                     Shrew  =================
B D                  Microbat  =================
B D                Coelacanth  =================
B D             X. tropicalis  =================
B D                    Lizard  =================
  D    Spiny softshell turtle  -----------------
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
  D           Green seaturtle  =================
B D                    Turkey  =================
B D                   Chicken  =================
  D              Mallard duck  =================
B D                Budgerigar  =================
          Tibetan ground jay  =================
B D               Zebra finch  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
  D       Collared flycatcher  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
  D               Rock pigeon  =================
B D                   Wallaby  =================
B D                   Opossum  =================
B D           Tasmanian devil  =================

Inserts between block 18 and 19 in window
B D                      Pig 1bp
            Black flying-fox 144bp
B D                  Megabat 20bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
             Star-nosed mole 12bp

Alignment block 19 of 1519 in window, 78189806 - 78189928, 123 bps 
B D                     Human  accagtga---------aac-cc------------------t--tttt----------tct---------
B D                     Chimp  accagtga---------aac-cc------------------t--tttt----------tct---------
B D                   Gorilla  accagtga---------aac-cc----------------ttt--tttt----------tct---------
B D                 Orangutan  accagtga---------aac-cc------------------t--tttt----------tct---------
B D                    Gibbon  accagtga---------aac-cc------------------t--tttt----------tca---------
B D                    Rhesus  accagtga---------aac-cc------------------t--tttt----------tctttttc----
B D       Crab-eating macaque  accagtga---------aac-cc------------------t--tttt----------tctttttc----
B D                    Baboon  accagtga---------aac-cc------------------t--tttt----------tcttttct----
B D              Green monkey  accagtga---------aac-ca------------------t--tttt----------tctt--------
B D                  Marmoset  acctgtga---------aac-cc------------------t--tttt----------tct---------
B D           Squirrel monkey  acctgtga---------aac-cc------------------t--tttt----------tct---------
B D                  Bushbaby  accagtaa---------aat-ct------------------g--tttt----------ttt---------
           Chinese tree shrew  gccagtaa---------aac-tc------------------t--tctt----------tt----------
B D                  Squirrel  accagtaa---------aag-ct------------------t--ttttttttttttctc-----------
       Lesser Egyptian jerboa  accagtaa---------aag-cc------------------t--ttct-----ttcccc-----------
                 Prairie vole  cccagcaa---------aac-cc------------------t--tgct----------c-----------
B D           Chinese hamster  cccaacaa---------aac-cc------------------t--tgct----------c-----------
               Golden hamster  cccaacaa---------aac-cc------------------t--cgct----------c-----------
B D                     Mouse  actagcaa---------agc-cc------------------t--cact----------c-----------
B D                       Rat  actagcaa---------aac-cc------------------t--cact----------------------
B D            Naked mole-rat  accagtaa---------aat-cc------------------t--tgtt----------------------
B D                Guinea pig  accagtca---------aatcct------------------t--tttt----------------------
                   Chinchilla  -ccagtaa---------aat-cc------------------a--tttt----------------------
             Brush-tailed rat  -ccagcaa---------aat--c------------------g--tttg----------------------
B D                    Rabbit  -ccggtac---------ggc-cc------------------cgttctt----------c-----------
B D                      Pika  -ccagtac---------aac-ct------------------c--tttt----------c-----------
B D                       Pig  actagtga---------gcc-cc-----ccacccc-----------------------t-----------
B D                    Alpaca  gctagtaattcacatccttg-ccagccacccccccaaccttt--ttat----------t-----------
               Bactrian camel  gctagtaattcacacccttg-ccagccacccccccaaccttt--ttat----------t-----------
B D                   Dolphin  actagtaa-------ccttc-cc-----ccaccccacctttt--tttt----------t-----------
                 Killer whale  accagtaa-------ccttc-cc-----ccaccccacctttt--tttt----------t-----------
             Tibetan antelope  actgataa-------cctct-cc-----ccaccttctttttt--tccc----------c-----------
B D                       Cow  actgataa-------cctct-cc-----ccacctcatttttt--cccc---------tc-----------
B D                     Sheep  actgataa-------cctct-cc-----ccacctcctttttt--tccc----------c-----------
                Domestic goat  actgataa-------cctct-cc-----ccacctcctttttt--tccc----------c-----------
B D                     Horse  accagtaa---------aac-cc-----------------tt--tttt----------c-----------
B D          White rhinoceros  accagtaa---------aac-cc----------------ttt--tttt----------c-----------
B D                       Cat  accagtaa---------aac-cc----------------ttt--tttt----------t-----------
B D                       Dog  accagtaa---------aac-cc-----------------------tt----------t-----------
B D                   Ferret   accagtaa---------aac-cc-----------------------tt----------t-----------
B D                     Panda  accagtaa---------aat-cc-----------------------tt----------t-----------
               Pacific walrus  accagtaa---------aac-ct-----------------------tt----------t-----------
                 Weddell seal  accagtaa---------aac-ct-----------------------tt----------t-----------
             Black flying-fox  accaataa---------aac-cc----------------ttt--tttt----------t-----------
B D                   Megabat  accaataa---------aac-cc----------------ttt--ttta----------c-----------
                Big brown bat  accagtaa---------aac-ct----------------ctt--ttca----------c-----------
         David's myotis (bat)  accagtaa---------aac-ct----------------ctt--ttca----------c-----------
B D                  Hedgehog  ----------------------------------------------cc----------c-----------
              Star-nosed mole  atcagtaa---------gcc-cc----------------ctt--tacc----------c-----------
B D                  Elephant  ---------------------------------------------------------------accagta
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ---------------------------------------------------------------accagta
             Cape golden mole  ---------------------------------------------------------------acctgca
B D                    Tenrec  ---------------------------------------------------------------accatta
                     Aardvark  ---------------------------------------------------------------atcagta
B D                 Armadillo  ---------------------------------------------------------------accagga
B D        American alligator  ggcaatga---------aat-gt----------------ttc--tgtt----------c-----------
B D                     Shrew  ======================================================================
B D                  Microbat  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ------ttttctttc-----------------------------------------cagg----------
                        Chimp  ------ttttctttc-----------------------------------------cagg----------
                      Gorilla  ------ttttctttc-----------------------------------------cagg----------
                    Orangutan  ------ttttctttc-----------------------------------------cagg----------
                       Gibbon  ------ttttctttc-----------------------------------------cagg----------
                       Rhesus  ------ttttttttc-----------------------------------------cagg----------
          Crab-eating macaque  ------ttttttttc-----------------------------------------cagg----------
                       Baboon  ------ttttttttc-----------------------------------------cagg----------
                 Green monkey  ------ttttttttc-----------------------------------------cagg----------
                     Marmoset  ------ttttctctc-----------------------------------------cagg----------
              Squirrel monkey  ------ttttctttc-----------------------------------------cagg----------
                     Bushbaby  ------ctttctttg-----------------------------------------caag----------
           Chinese tree shrew  ------ctttctttc-----------------------------------------cagg----------
                     Squirrel  ------ctttctttc-----------------------------------------cagg----------
       Lesser Egyptian jerboa  ------ctttctttc-----------------------------------------cagg----------
                 Prairie vole  ----------------------------------------------------------gg----------
              Chinese hamster  ------ctttctttc-----------------------------------------cagg----------
               Golden hamster  ------cttcttttc-----------------------------------------cagg----------
                        Mouse  ------ctgtctttc-----------------------------------------cagg----------
                          Rat  -------tttctttc-----------------------------------------cagg----------
               Naked mole-rat  ------ttttctttt-----------------------------------------cagg----------
                   Guinea pig  ------ttttctttc-----------------------------------------cagg----------
                   Chinchilla  ------ctttctttc-----------------------------------------cagg----------
             Brush-tailed rat  ------tcttctttc-----------------------------------------cagg----------
                       Rabbit  ------tgttccttt-------------------------------------------ag----------
                         Pika  ------tgtttgttt-----------------------------------------ccag----------
                          Pig  ------ttttatctc-------------------------------------------------------
                       Alpaca  ------ctttctttc-----------------------------------------cagg----------
               Bactrian camel  ------ctttctttc-----------------------------------------cagg----------
                      Dolphin  ------ttttttttc------------------------------------------ttg----------
                 Killer whale  ------ttttttttc------------------------------------------ttg----------
             Tibetan antelope  ------ctttatttc-----------------------------------------gggg----------
                          Cow  ------ctttctttt-----------------------------------------gggg----------
                        Sheep  ------ctttatttc-----------------------------------------gggg----------
                Domestic goat  ------ctttatttc-----------------------------------------gggg----------
                        Horse  ------ctttctttc-----------------------------------------cagg----------
             White rhinoceros  ------ctttctttc-----------------------------------------cagg----------
                          Cat  ------ctttctttc-----------------------------------------tagg----------
                          Dog  ------ctttctttc-----------------------------------------tagg----------
                      Ferret   ------ctttctttc-----------------------------------------tagg----------
                        Panda  ------ctttctctc-----------------------------------------tagc----------
               Pacific walrus  ------ctttctttcttttctttccttttcttctttttctttcttttttttctttctagg----------
                 Weddell seal  ------ctttctttcttct-------------------------------------tagg----------
             Black flying-fox  ------cttccattc-----------------------------------------cagg----------
                      Megabat  ------cttccattc-----------------------------------------cagt----------
                Big brown bat  ------ctttttccc-----------------------------------------cagg----------
         David's myotis (bat)  ------cttttcccc-----------------------------------------cagg----------
                     Hedgehog  ------atgtcaatg-----------------------------------------tagg----------
              Star-nosed mole  ------atttatatt-----------------------------------------tcca----------
                     Elephant  aaacccttttctttc-----------------------------------------cagg----------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  aaacccttttctttc-----------------------------------------ca------------
             Cape golden mole  aaacctttttctttc-----------------------------------------tagg----------
                       Tenrec  aaacc-ctttctttc-----------------------------------------cagg----------
                     Aardvark  aaacctttttctttc-----------------------------------------tagg----------
                    Armadillo  aagcccttttctttc-----------------------------------------cagg----------
           American alligator  ------tttgttctg-----------------------------------------cagggcctctgttt
                        Shrew  ======================================================================
                     Microbat  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ---agac----agtttggtggcccagacatggg-----cctcccgg-agtagggt----------ga--a
                        Chimp  ---agac----agtttggtggcccagacatggg-----cctcccgg-agtagggt----------ga--a
                      Gorilla  ---agac----agtttggtggcccagacatggg-----cctcccgg-agtagggt----------ga--a
                    Orangutan  ---agac----agtttggtggcccagacatggg-----cctcccgg-agtagggt----------ga--a
                       Gibbon  ---agac----agtttggtggcccagacatggg-----cctcctgg-agtagggt----------ga--a
                       Rhesus  ---agac----agtttggtggcccagacatggg-----cctcccag-agtagggt----------ga--a
          Crab-eating macaque  ---agac----agtttggtggcccagacatggg-----cctcccag-agtagggt----------ga--a
                       Baboon  ---agac----agtttggtggcccagacatggg-----cctcccag-agtagggt----------ga--a
                 Green monkey  ---agac----agtttggtggcccagacatggg-----cctcccag-agtagggt----------ga--a
                     Marmoset  ---agac----agttcggtggcccagacatggg-----gctcctgg-agtagggt----------ga--a
              Squirrel monkey  ---agac----agtttggtggcccagacatggg-----gcttccag-agtagggt----------ga--a
                     Bushbaby  ---agac----agtctcatggtccagacaaggg-----cctcccag-agtagggt----------ga--a
           Chinese tree shrew  ---agac----agtttggtggtcctgacaaggg-----cctctcag-agtagggt----------gg--a
                     Squirrel  ---aggc----agtttgttggcccagac-aagg-----gctcccag-agtagggt----------ga--a
       Lesser Egyptian jerboa  ---agac----aggttgg-aggccagag-aagg-----cctcccag-a-----gt----------ga--a
                 Prairie vole  ---ggcc----agac--------------aagg-----cctcccag-a-----gg----------aa--g
              Chinese hamster  ---accc----agac--------------aagg-----cctcctag-a-----gg----------ga--a
               Golden hamster  ---accc----agga--------------------------ccttg-a-----gg----------ga--a
                        Mouse  ---accc----agcctgg--ggctggtc-gagg-----cctcctag-g-----gg----------ga--a
                          Rat  ---accc----agtttgg--ggccagtc-gagg-----cctcctag-a-----gg----------ga--a
               Naked mole-rat  ---aggc----agtttggtggcctagacaaggg--------cccag-agta-ggt----------ga--a
                   Guinea pig  ---aggc----agtttggtggcctagacaagga-----ctccccag-agtagggt----------ga--a
                   Chinchilla  ---aggc----agttcggtggcctaaacaaggg-----cctcctag-agtagggt----------ga--a
             Brush-tailed rat  ---aggc----actttggtggcctagaccaggg-----cctcccag-gacagggt----------ga--a
                       Rabbit  ---agac----actttggtggcccagacagagg----cccccccag-cgtaggga----------ga--a
                         Pika  ---agac----actttggtggcccagacagggg-----cttctcag-tgcaagga----------ga--a
                          Pig  -----------------------------aggg-----cctccgggtagtagggc----------aa--g
                       Alpaca  ---agac----agtt-------------ggggg-----cctcccagtagtatgat----------gaggg
               Bactrian camel  ---agac----agtt-------------ggggg-----cctcccagtagcatgat----------gaggg
                      Dolphin  ---cgac----agtt---tggcccaaaggagtg-----cctcccagtagtatggc----------ga---
                 Killer whale  ---cgac----agtt---tggcccaaaggagtg-----cctcccagtagtatggc----------ga--g
             Tibetan antelope  ---tgac----agtttggtggcccaaatgaagg-----tctcccggtagtatggc----------aa--g
                          Cow  ---tgac----agtttggtggcccaaatgaagg-----tctcccggtagtatgac----------aa--g
                        Sheep  ---tgac----agtttggtggcccaaatgaagg-----tctcctggtagtatggc----------aa--g
                Domestic goat  ---tgac----agtttggtggcccaaatgaagg-----tctcccggtagtatggc----------aa--g
                        Horse  ---agac----aggttggtggcccagaggaggg-----cctcccagtagtggggg----------ga--g
             White rhinoceros  ---agac----aggttggtggcccagacgaggg-----cctcccagtagttgggg----------ga--g
                          Cat  ---agac----agtttggtggcccaggcaaggg-----cctcccagtagtagggc----------aa--g
                          Dog  ---agac----agtttggtggcccagacaaggg-----cctcccagtaggagggc----------aa--g
                      Ferret   ---agac----agttttgtggcccagacgaggg-----cctctcagtaggagggc----------aa--g
                        Panda  ---agac----aatttggtggcccagacaaggg-----cctcccagtgggagggc----------aa--g
               Pacific walrus  ---tgac----agtttggtggcccagacaaggg-----cctcccagtaggagggc----------aa--g
                 Weddell seal  ---agac----agtttggtggcccagacaaggg-----cctcccagtaggagggc----------aa--g
             Black flying-fox  ---agat----agtttgggggcccacatgaagg-----cctcacagtagtagggc----------aa--g
                      Megabat  ---agat----agtttggtggcccacatgaagg-----cctcacagtagtagggc----------aa--g
                Big brown bat  ---agat----agtttggtggcccagacgaggg-----tttc----------------------------
         David's myotis (bat)  ---agat----ggtttggtggcccagatgaggg-----tctc----------------------------
                     Hedgehog  ---agct----agtctggttgcccggatcaggg-----cctggcagtggcctggctgtggcaggtga--g
              Star-nosed mole  ---ggac----agtttgctgaccctg-ccagga-----cctcccagtagtagtgc----------aa--g
                     Elephant  ---agag----agtttggtggcctcgacaacga-----cctcccagtagtaggat----------ga--g
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ---agag----agtttggtggccttgacaa-ga-----cctcccagtagcagggt----------ga--g
             Cape golden mole  ---agac----agtttggtggtcttgacaagga-----cctccccatagtagagt----------ga--g
                       Tenrec  ---agatagaaagtttggtggccttgacaagga-------tcccagcagtgtggt----------ga---
                     Aardvark  ---agac----agtttggtggcattggcaagga-----cctcccagtagtagggt----------ga--g
                    Armadillo  ---agac----ggtttggtgaccccgacagggt-----ccccccagcagtagtgt----------ga--g
           American alligator  acaagtg----atttatgaggatcagcgcaggagtctatctgccag-------------------ga--a
                        Shrew  ======================================================================
                     Microbat  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                        Chimp  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                      Gorilla  gcacttcttccca----gag-t--------tgcc----ttgggt----agaag------ttcagt--t--
                    Orangutan  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------gtcagt--t--
                       Gibbon  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                       Rhesus  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
          Crab-eating macaque  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                       Baboon  gcacttcttcgca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                 Green monkey  gcacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                     Marmoset  ggacttctttcca----ggg-t--------tgcc----ttgggt-------ag------ttcagt--t--
              Squirrel monkey  ggacttcttccca----ggg-t--------tgcc----ttgggt----agaag------ttcagt--t--
                     Bushbaby  gggcctcttccca----ggg-c--------tgcc----ttgggtagaaagaag------ttcagt--tta
           Chinese tree shrew  ggcccctttcc-------gg-g--------cacc----ttggga----agagg------ttgagt--t--
                     Squirrel  gggctccctccca----gga-c--------tgcc----tggact----agaagaagt--tcagtt--t--
       Lesser Egyptian jerboa  -ggcgccttttca----ggg-c--------tgct----ttgccc----agact------cttggccat--
                 Prairie vole  -ggtgccct-cag-----gg-c--------tgcc----ttggtc----aggca------ctaagt--t--
              Chinese hamster  -ggtactgt-ctg----ggg-c--------tgcc----ttggtc----acaca------gtaagt--t--
               Golden hamster  gggtactgt-ctg----tgg-c--------tgcc----ttggtc----agaca------ctaagt--t--
                        Mouse  gggtgccatgcta----ggg-t--------tgcc----ttggta----agaca------ctgagt--t--
                          Rat  gggtgccatggta----gga-t--------tacc----ttggta----agaca------ccaagt--t--
               Naked mole-rat  gggtgtctttcca----gga-c--------tgcc----ttggct----aaaaggag---ttcagt--t--
                   Guinea pig  gggtgtctttcca----gag-c--------tgcc----ttggct----aaaagaag---ttcaga--t--
                   Chinchilla  gggtgtctttcca----ggg-c--------ggcc----ttggct----aaaagaag---ttcagt--t--
             Brush-tailed rat  ggatgccttccca----ggg-c------------------tgct----aaaagaag---ttcagt--t--
                       Rabbit  gggctccct-cgg------------------gcc----taggga----atagcag----ctcagt--t--
                         Pika  gggctcctc-ctgcacagcg-c--------tgtt----tagagg----aaagag--------aga--a--
                          Pig  aggatccttccca----gggcc--------tgcc----ttggct----agagg------ttcagt--t--
                       Alpaca  gggatccttccca----ggg-c--------tgcc----ttgagt----agaag------ttcagt--t--
               Bactrian camel  gggatccttccca----ggg-c--------tgcc----ttgagt----agaag------ttcagt--t--
                      Dolphin  gggatccttcctg----gga-c--------tgcc----ttgggt----agaag------ttcagt--t--
                 Killer whale  gggatccttcctg----gga-c--------tgcc----ttgggt----agaag------ttcagt--t--
             Tibetan antelope  gggatccttcccg----gga-c--------tgcc----ttgcat----agaag------ttcagt--t-a
                          Cow  ggaatccttccca----ggg-c--------tgcc----ttgcat----agaag------ttcagt--t-a
                        Sheep  gggatccttcccg----ggg-c--------tgcc----ttgcat----agaag------ttcagt--t-a
                Domestic goat  gggatccttcccg----ggg-c--------tgcc----ttgcat----agaag------ttcagt--t-a
                        Horse  gggccccttccca----ggg-c--------tgcc----ttgggt----agaagaag---ttcagt--t--
             White rhinoceros  gggctccttccca----ggg-c--------tgcc----ttgggt----aga-----------agt--t--
                          Cat  gggattctt-tca----ggg-c--------tgcc----ttaggt----agaagaaa---ttaagt--t--
                          Dog  gggatccttccca----ggg-c--------tgcc----atgggt----agaag-----------------
                      Ferret   gagatccttccca----ggg-c--------tgcc----tcgggg----agaaaaaa---ttcagt--t--
                        Panda  gggatccttccca----ggg-c--------tgcc----ttgggg----agaagaaa---ttcagt--c--
               Pacific walrus  gggatccttccca----ggg-c--------tgcc----ttgggt----agaagaaa---tccagt--t--
                 Weddell seal  gggatccttccca----ggg-c--------tgcc----ttgggt----agaagaaa---ttcagt--t--
             Black flying-fox  gggctccttccca----gag-c--------tgcc----ttgggt----agaagaag---tgcagt--t--
                      Megabat  gggctccttccca----gag-c--------tgcc----ttgggt----agaagaag---tgcagt--t--
                Big brown bat  ---------------------c--------tgcc----ttggat----agaa--------gttgt--t--
         David's myotis (bat)  ---------------------c--------tgcc----ttggat----agaa--------gttgt--t--
                     Hedgehog  ggtctcctttcca----ggg-c--------tgcc----tggggt--ccagcag------tcccat--t--
              Star-nosed mole  agactcccaccca----ggg-c--------tgcctaagtggaat--tcagttg------tctagt-----
                     Elephant  gggctccttccca----ggg-c--------tgcc----tttcgt----agaagaag---ttccat--a--
          Cape elephant shrew  -----------ca----ggg-t--------ttcc------------------------------------
                      Manatee  ggcctccttccca----gga-c--------tgcc----ttgggt----agaagaag---ttccat--t--
             Cape golden mole  gggctccttccca----gga-t--------ttct----tgg--------gtaaagt---tgttctgct--
                       Tenrec  gggctctgtctca----gga-t--------tgcc----ctgtgc----agaaaaag---ttccatttt--
                     Aardvark  gggctcctttcca----gga-c--------tgct----ttgggt----agaagaag---ttacat-ta--
                    Armadillo  g------------------------------------------------------------------a--
           American alligator  gagatgcctggtt----gag-cctggtccacgtc----ttgcac----cgagatgtctattcaaa--c--
                        Shrew  ======================================================================
                     Microbat  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  a-a-aaa------------
                        Chimp  a-a-aaa------------
                      Gorilla  a-a-aaa------------
                    Orangutan  a-a-aaa------------
                       Gibbon  a-a-aaa------------
                       Rhesus  a-a-aaa------------
          Crab-eating macaque  a-a-aaa------------
                       Baboon  a-a-aaa------------
                 Green monkey  a-a-aaa------------
                     Marmoset  a-acaaa------------
              Squirrel monkey  a-a-aaa------------
                     Bushbaby  a-a-caa------------
           Chinese tree shrew  a-a----------------
                     Squirrel  a-a-aaa------------
       Lesser Egyptian jerboa  a-a-aac------------
                 Prairie vole  a-a-aaa------------
              Chinese hamster  a-a-aaa------------
               Golden hamster  a-a-aaa------------
                        Mouse  a-a-aac------------
                          Rat  a-a-acc------------
               Naked mole-rat  a-a-aaa------------
                   Guinea pig  a-a-aaa------------
                   Chinchilla  a-a-aaa------------
             Brush-tailed rat  a-a-aaa------------
                       Rabbit  a-a-aaa------------
                         Pika  a-g-aga------------
                          Pig  a-g-aaa------------
                       Alpaca  a-a-aaa------------
               Bactrian camel  a-a-aaa------------
                      Dolphin  a-a-aaa------------
                 Killer whale  a-a-aaa------------
             Tibetan antelope  a-a-aaa------------
                          Cow  a-a-aaa------------
                        Sheep  a-a-aaa------------
                Domestic goat  a-a-aaa------------
                        Horse  a-a-aaa------------
             White rhinoceros  a-a-aaa------------
                          Cat  aaa-aaa------------
                          Dog  --c-aaa------------
                      Ferret   aaa-aac------------
                        Panda  aaa-aaa------------
               Pacific walrus  ata-aaa------------
                 Weddell seal  ata-aaa------------
             Black flying-fox  t-a-aaa------------
                      Megabat  t-a-aaa------------
                Big brown bat  t-a-aaa------------
         David's myotis (bat)  t-a-aaa------------
                     Hedgehog  a-g-cag------------
              Star-nosed mole  -------------------
                     Elephant  a-g-aaa------------
          Cape elephant shrew  -------------------
                      Manatee  a-a-aaa------------
             Cape golden mole  a-c-taa------------
                       Tenrec  a-c-aca------------
                     Aardvark  a-a-aaa------------
                    Armadillo  g-a-aaa------------
           American alligator  a-a-acacacacacaaaaa
                        Shrew  ===================
                     Microbat  ===================
                   Coelacanth  ===================
                X. tropicalis  ===================
                       Lizard  ===================
       Spiny softshell turtle  -------------------
     Chinese softshell turtle  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
                       Turkey  ===================
                      Chicken  ===================
                 Mallard duck  ===================
                   Budgerigar  ===================
           Tibetan ground jay  ===================
                  Zebra finch  ===================
          Medium ground finch  ===================
       White-throated sparrow  ===================
          Collared flycatcher  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
                  Rock pigeon  ===================
                      Wallaby  ===================
                      Opossum  ===================
              Tasmanian devil  ===================

Inserts between block 19 and 20 in window
B D           Naked mole-rat 269bp

Alignment block 20 of 1519 in window, 78189929 - 78189944, 16 bps 
B D                     Human  atacc--tagag------agatgc---------
B D                     Chimp  atacc--tagaa------agatgc---------
B D                   Gorilla  atacc--tagag------agatgc---------
B D                 Orangutan  atacc--tagag------agatgc---------
B D                    Gibbon  atacc--tagag------agatgc---------
B D                    Rhesus  atacc--tagag------agatgc---------
B D       Crab-eating macaque  atacc--tagag------agatgc---------
B D                    Baboon  atacc--tacag------agatgc---------
B D              Green monkey  atacc--tagag------agatgc---------
B D                  Marmoset  atgcc--tggagttaacaaaatgc---------
B D           Squirrel monkey  atgcc--tggag------agatgc---------
B D                  Bushbaby  ataca--gagag------aaatgc---------
           Chinese tree shrew  atgca--gagag------a-atgc---------
B D                  Squirrel  -------tacct------agagac---------
       Lesser Egyptian jerboa  -------c-cag------atatgc---------
                 Prairie vole  -------g-cgg------acattc---------
B D           Chinese hamster  -------t-ctg------acaatc---------
               Golden hamster  -------t-ctg------acattc---------
B D                     Mouse  ------------------acattc---------
B D                       Rat  ------------------gcattc---------
B D            Naked mole-rat  gtaaccccctgg------aggggt---------
B D                Guinea pig  --tactgtacag------agacgt---------
                   Chinchilla  --tactgtacag------agaggt---------
             Brush-tailed rat  --tactgtggaa------agaggc---------
B D                    Rabbit  ---------tag------agcggc---------
B D                      Pika  ---------gag------agagat---------
B D                       Pig  ataca--gagag------agatgc---------
B D                    Alpaca  at--a--gagag------agatgc---------
               Bactrian camel  at--a--gagag------agatac---------
B D                   Dolphin  ataca--gagag------aaatgc---------
                 Killer whale  ataca--gagag------aaatgc---------
             Tibetan antelope  atcca--gagag------gaatgc---------
B D                       Cow  atcca--gagag------gaatgc---------
B D                     Sheep  atcca--gagag------gaatgc---------
                Domestic goat  atcca--gagag------gaatgc---------
B D                     Horse  atacc--cagag------agacgc---------
B D          White rhinoceros  ataca--cagca------agatgc---------
B D                       Cat  attca--gaggc------agatat---------
B D                       Dog  attca--gaggt------agatgc---------
B D                   Ferret   attca--gagac------agatgc---------
B D                     Panda  attca--gagac------agatgc---------
               Pacific walrus  att--------c------agatgc---------
                 Weddell seal  att--------c------agatgc---------
             Black flying-fox  ataca--ga----------gatgc---------
B D                   Megabat  ataca--ga----------gatgc---------
                Big brown bat  ataca--gagag------agattc---------
         David's myotis (bat)  ataca--gagag------ggattc---------
B D                  Hedgehog  gtaca--ctg---------aatgc---------
B D                  Elephant  --ata--cagag------agatgc---------
B D                   Manatee  --ata--c--ag------agatgc---------
             Cape golden mole  --atg--c--ag------agatgc---------
B D                    Tenrec  --aag--c--ag------gcgtgg---------
                     Aardvark  --atg--tagag------agatac---------
B D                 Armadillo  --ata--cagcg------acgtgc---------
B D        American alligator  -----------------aaaacgcggggggacc
             Star-nosed mole  ---------------------------------
         Cape elephant shrew  ---------------------------------
B D                     Shrew  =================================
B D                  Microbat  =================================
B D                Coelacanth  =================================
B D             X. tropicalis  =================================
B D                    Lizard  =================================
  D    Spiny softshell turtle  ---------------------------------
  D  Chinese softshell turtle  =================================
  D            Painted turtle  =================================
  D           Green seaturtle  =================================
B D                    Turkey  =================================
B D                   Chicken  =================================
  D              Mallard duck  =================================
B D                Budgerigar  =================================
          Tibetan ground jay  =================================
B D               Zebra finch  =================================
B D       Medium ground finch  =================================
  D    White-throated sparrow  =================================
  D       Collared flycatcher  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
  D               Rock pigeon  =================================
B D                   Wallaby  =================================
B D                   Opossum  =================================
B D           Tasmanian devil  =================================

Inserts between block 20 and 21 in window
B D                 Bushbaby 53bp
B D           Naked mole-rat 2bp
B D               Guinea pig 195bp
                  Chinchilla 194bp
            Brush-tailed rat 26bp
B D                   Rabbit 10bp
B D                     Pika 10bp

Alignment block 21 of 1519 in window, 78189945 - 78189948, 4 bps 
B D                     Human  -tgcc
B D                     Chimp  -tgcc
B D                   Gorilla  -tgcc
B D                 Orangutan  -tgcc
B D                    Gibbon  -tgcc
B D                    Rhesus  -tgcc
B D       Crab-eating macaque  -tgcc
B D                    Baboon  -tgcc
B D              Green monkey  -tgcc
B D                  Marmoset  -t---
B D           Squirrel monkey  -ttcc
B D                  Bushbaby  -tgcc
           Chinese tree shrew  -agct
B D                  Squirrel  -agct
       Lesser Egyptian jerboa  -tgct
                 Prairie vole  -tgca
B D           Chinese hamster  -tgca
               Golden hamster  -tgca
B D                     Mouse  -tgct
B D                       Rat  -tgct
B D            Naked mole-rat  -tgtt
B D                Guinea pig  -tatt
                   Chinchilla  -tgtt
             Brush-tailed rat  -tgtg
B D                    Rabbit  -gccc
B D                      Pika  -tgct
B D                       Pig  -tgct
B D                    Alpaca  -tgct
               Bactrian camel  -tgct
B D                   Dolphin  -tgct
                 Killer whale  -tgct
             Tibetan antelope  -tgct
B D                       Cow  -tgct
B D                     Sheep  -tgct
                Domestic goat  -tgct
B D                     Horse  -tgct
B D          White rhinoceros  -agt-
B D                       Cat  -tgct
B D                       Dog  -tgtt
B D                   Ferret   -tgct
B D                     Panda  -tgct
               Pacific walrus  -tgct
                 Weddell seal  -tgct
             Black flying-fox  -tgct
B D                   Megabat  -cgct
                Big brown bat  -tgct
         David's myotis (bat)  -tgct
B D                  Hedgehog  -tgcc
B D                  Elephant  -tcct
B D                   Manatee  -tgtt
             Cape golden mole  -tgtt
B D                    Tenrec  -tgct
                     Aardvark  -tgct
B D                 Armadillo  -tgct
B D        American alligator  tttc-
             Star-nosed mole  -----
         Cape elephant shrew  -----
B D                     Shrew  =====
B D                  Microbat  =====
B D                Coelacanth  =====
B D             X. tropicalis  =====
B D                    Lizard  =====
  D    Spiny softshell turtle  -----
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
  D       Collared flycatcher  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D                   Wallaby  =====
B D                   Opossum  =====
B D           Tasmanian devil  =====

Inserts between block 21 and 22 in window
B D                 Bushbaby 230bp

Alignment block 22 of 1519 in window, 78189949 - 78189957, 9 bps 
B D                     Human  -attc-a-------gaca---
B D                     Chimp  -attc-a-------gtta---
B D                   Gorilla  -attc-a-------ggca---
B D                 Orangutan  -attc-a-------gaca---
B D                    Gibbon  -attc-a-------gaca---
B D                    Rhesus  -attc-a-------gaca---
B D       Crab-eating macaque  -attc-a-------gaca---
B D                    Baboon  -attc-a-------gaca---
B D              Green monkey  -attc-a-------gaca---
B D           Squirrel monkey  -attc-a-------gaca---
B D                  Bushbaby  -accc-a-------gaga---
           Chinese tree shrew  --gcc-a-------gagg---
B D                  Squirrel  -gccc-t-------gaga---
       Lesser Egyptian jerboa  -acct-a-------gaga---
                 Prairie vole  -gctc-a-------gaga---
B D           Chinese hamster  -gctc-a-------gaga---
               Golden hamster  -gctc-t-------gaga---
B D                     Mouse  -gcca-a-------gaga---
B D                       Rat  -gctc-a-------gaga---
B D            Naked mole-rat  -gccc-a-------gagc---
B D                Guinea pig  -g-cc-a-------gaac---
                   Chinchilla  -g-cc-a-------gagc---
             Brush-tailed rat  -g-tc-c-------cagc---
B D                    Rabbit  -cctg-a-------gggg---
B D                      Pika  -gcca-g-------gaaa---
B D                       Pig  -atcc-a-------gaga---
B D                    Alpaca  -gccc-a-------gaga---
               Bactrian camel  -gccc-a-------gaga---
B D                   Dolphin  -gact-a-------gaga---
                 Killer whale  -gact-a-------gaga---
             Tibetan antelope  -gtcc-a-------gaga---
B D                       Cow  -gtcc-a-------gagg---
B D                     Sheep  -gtcc-a-------gagg---
                Domestic goat  -gtcc-a-------gagg---
B D                     Horse  -gccc-acacctggggtg---
B D          White rhinoceros  --------------gagg---
B D                       Cat  -gtcc-a-------gaga---
B D                       Dog  -gtcc-a-------gaga---
B D                   Ferret   -gtcc-a-------gaga---
B D                     Panda  -gtcc-a-------gaga---
               Pacific walrus  -gtcc-a-------gaga---
                 Weddell seal  -gtcc-a-------gaga---
             Black flying-fox  -gccc-a-------gaga---
B D                   Megabat  -gccc-a-------gaga---
                Big brown bat  -gccc-acg-----gagg---
         David's myotis (bat)  -gccc-agg-----gagg---
B D                  Hedgehog  -ccccca-------gggg---
              Star-nosed mole  ------a-------gaga---
B D                  Elephant  -gctt-a-------gaga---
B D                   Manatee  -gcct-a-------gaga---
             Cape golden mole  -gcct-a-------gaga---
B D                    Tenrec  -ggct-a-------gaga---
                     Aardvark  -g-------------------
B D                 Armadillo  -gccc-c-------gaga---
B D        American alligator  accgc-a-------gcaaacc
         Cape elephant shrew  ---------------------
B D                     Shrew  =====================
B D                  Marmoset  ---------------------
B D                  Microbat  =====================
B D                Coelacanth  =====================
B D             X. tropicalis  =====================
B D                    Lizard  =====================
  D    Spiny softshell turtle  ---------------------
  D  Chinese softshell turtle  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
B D                Budgerigar  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D       Collared flycatcher  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  =====================
B D                   Wallaby  =====================
B D                   Opossum  =====================
B D           Tasmanian devil  =====================

Inserts between block 22 and 23 in window
B D       American alligator 2bp

Alignment block 23 of 1519 in window, 78189958 - 78189979, 22 bps 
B D                     Human  cct-gagg----gg--ccagagatg----------------ga----------gg
B D                     Chimp  cct-gagg----gg--ccagagatg----------------ga----------gg
B D                   Gorilla  cct-gagg----gg--ccagagatg----------------ga----------gg
B D                 Orangutan  cct-gagg----gg--ctagagatg----------------ga----------gg
B D                    Gibbon  cgt-gagg----gg--ccagagatg----------------ga----------gg
B D                    Rhesus  cct-gagg----gg--ccagagatg----------------ga----------gg
B D       Crab-eating macaque  cct-gagg----gg--ccagagatg----------------ga----------gg
B D                    Baboon  cct-gagg----gg--ccagagatg----------------ga----------gg
B D              Green monkey  cct-gagg----gc--ccagagatg----------------ga----------gg
B D                  Marmoset  -ct-gggg----gcctccagggatg----------------ga----------gg
B D           Squirrel monkey  cct-gggg----g---ccagagatg----------------ga----------gg
B D                  Bushbaby  cct-aagg----gg--ccagagatg----------------g-----------gg
           Chinese tree shrew  ttg-gagg----ga--ccagg--tg----------------ga----------gg
B D                  Squirrel  cctggagg----gg--ccagagagg--------gagg------------------
       Lesser Egyptian jerboa  cca-gagg----gg--ccagagaca----gagg----------------------
                 Prairie vole  ccc-cag--------------ggtg------------------------------
B D           Chinese hamster  ccc-aagg----gg--caaaaggtg------------------------------
               Golden hamster  ccc-aagg----ga--caaaaggtg------------------------------
B D                       Rat  ccc-gagg----ga--accctggcggggg--------------------------
B D            Naked mole-rat  cct-ggaa----gg--ccagagata------------gagg--------------
B D                Guinea pig  cct-ggga----gg--ccagagaca------------gagg--------------
                   Chinchilla  tct-gggg----gg--ccacagaaa------------aagg--------------
             Brush-tailed rat  cct-gggg---aag--atgaggcag------------gagg--------------
B D                    Rabbit  ctg-ga-------g--atggaa---------------------------------
B D                      Pika  ccg-gagg----gg--atggag---------------------------------
B D                       Pig  cct-gggg----gc--ccaggga--------------------------------
B D                    Alpaca  cct-gggg----ga--ccaggcatg----------------ga----------gg
               Bactrian camel  cct-gggg----ga--ccaggcatg----------------ga----------gg
B D                   Dolphin  cct-gggg----ga--cgagggatg----------------ga----------gg
                 Killer whale  cct-gggg----ga--cgagggatg----------------ga----------gg
             Tibetan antelope  cct-gagg----ga--ccagggatg----------------ga----------ga
B D                       Cow  cct-gagg----ga--ccagggatg----------------ga----------ga
B D                     Sheep  cct-gagg----ga--ccagggatg----------------ga----------ga
                Domestic goat  cct-gagg----ga--ccagggatg----------------ga----------ga
B D                     Horse  ----------------ccagggagg----------------gagggcccttccgg
B D          White rhinoceros  ----------------ccagggatg----------------gagggcccttctgg
B D                       Cat  ----------------tctgggtgg----------------gggga-------gg
B D                       Dog  ----------------cctgggtgg----------------gt----------gg
B D                   Ferret   ----------------gctgggtcg----------------gg----------gg
B D                     Panda  ----------------cct-ggtag----------------gg----------gg
               Pacific walrus  ----------------cttgggtgg----------------gg----------gc
                 Weddell seal  ----------------catgggtgg----------------gg----------gg
             Black flying-fox  cat-gggg----ag--ccagggatg----------------ga----------gg
B D                   Megabat  cat-gggg----ag--ccagggatg----------------ga----------gg
                Big brown bat  aag-ggag----tg--gcagggttg----------------ga----------gg
         David's myotis (bat)  aag-gggg----tg--gtagggttg----------------ga----------ag
B D                  Hedgehog  cctaggggtgagga--gcagacatg----------------ga----------gg
              Star-nosed mole  cct-ggggtggtgg--gcagaaata----------------aa----------gg
B D                  Elephant  cct-gatg----gg--ccagggata----------------ga----------gt
B D                   Manatee  cct-gagg----gg--ccagggata----------------ga----------gg
             Cape golden mole  cct-gagg----gg--ccaggaata----------------ga----------gg
B D                    Tenrec  tct-aagg----gg--cgagggaga----------------gt----------gg
                     Aardvark  cct-caga----ga--ccagggata----------------ga----------gg
B D                 Armadillo  tcg-gggg----gg--ggggggg--------------------------------
B D               Zebra finch  cca-aagg----gg--tcggaaaaa----------------gt----------gg
B D        American alligator  tcg-gggt----cg--ccgggaagt----------------tc----------ca
         Cape elephant shrew  -------------------------------------------------------
B D                     Shrew  =======================================================
B D                     Mouse  -------------------------------------------------------
B D                  Microbat  =======================================================
B D                Coelacanth  =======================================================
B D             X. tropicalis  =======================================================
B D                    Lizard  =======================================================
  D    Spiny softshell turtle  -------------------------------------------------------
  D  Chinese softshell turtle  =======================================================
  D            Painted turtle  =======================================================
  D           Green seaturtle  =======================================================
B D                    Turkey  =======================================================
B D                   Chicken  =======================================================
  D              Mallard duck  =======================================================
B D                Budgerigar  =======================================================
          Tibetan ground jay  =======================================================
B D       Medium ground finch  =======================================================
  D    White-throated sparrow  =======================================================
  D       Collared flycatcher  =======================================================
  D          Peregrine falcon  =======================================================
  D              Saker falcon  =======================================================
  D               Rock pigeon  =======================================================
B D                   Wallaby  =======================================================
B D                   Opossum  =======================================================
B D           Tasmanian devil  =======================================================

Inserts between block 23 and 24 in window
B D                      Rat 41bp
            Black flying-fox 9bp
B D                  Megabat 9bp
               Big brown bat 15bp
        David's myotis (bat) 36bp
            Cape golden mole 6bp
B D                Armadillo 7bp

Alignment block 24 of 1519 in window, 78189980 - 78189989, 10 bps 
B D                     Human  gcaccacctg
B D                     Chimp  gcaccacctg
B D                   Gorilla  gcaccacctg
B D                 Orangutan  gcaccacctg
B D                    Gibbon  gcaccacctg
B D                    Rhesus  gcaccaccta
B D       Crab-eating macaque  gcaccaccta
B D                    Baboon  gcaccaccta
B D              Green monkey  acaccaccta
B D                  Marmoset  gccccacctg
B D           Squirrel monkey  gccccaccta
B D                  Bushbaby  gtgcttcctg
           Chinese tree shrew  gcagttcttt
B D                  Squirrel  ---gcacttc
       Lesser Egyptian jerboa  ---atagatg
B D            Naked mole-rat  ---gcatttt
B D                Guinea pig  ---gcatttt
                   Chinchilla  ---gcgtttt
             Brush-tailed rat  ---attgttt
B D                    Alpaca  ---------c
               Bactrian camel  ---------c
B D                   Dolphin  ---------g
                 Killer whale  ---------g
             Tibetan antelope  ---------g
B D                       Cow  ---------g
B D                     Sheep  ---------g
                Domestic goat  ---------g
B D                  Hedgehog  ---------a
              Star-nosed mole  ---------g
B D                  Elephant  ---------g
B D                   Manatee  ---------g
B D                    Tenrec  ---------c
                     Aardvark  ---------g
B D               Zebra finch  gatcaatctg
B D        American alligator  gatcactctg
B D                      Pika  ----------
         Cape elephant shrew  ----------
B D                     Shrew  ==========
B D                     Mouse  ----------
                Prairie vole  ----------
B D                       Rat  ==========
B D           Chinese hamster  ----------
              Golden hamster  ----------
B D                    Rabbit  ----------
            Black flying-fox  ==========
B D                       Pig  ----------
                Weddell seal  ----------
B D                   Megabat  ==========
B D                     Panda  ----------
               Big brown bat  ==========
B D                  Microbat  ==========
        David's myotis (bat)  ==========
B D                 Armadillo  ==========
B D          White rhinoceros  ----------
B D                     Horse  ----------
B D                       Dog  ----------
B D                   Ferret   ----------
B D                       Cat  ----------
              Pacific walrus  ----------
B D                Coelacanth  ==========
B D             X. tropicalis  ==========
B D                    Lizard  ==========
  D    Spiny softshell turtle  ----------
  D  Chinese softshell turtle  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
          Tibetan ground jay  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
  D       Collared flycatcher  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D                   Wallaby  ==========
B D                   Opossum  ==========
B D           Tasmanian devil  ==========
            Cape golden mole  ==========

Inserts between block 24 and 25 in window
B D          Squirrel monkey 66bp
            Brush-tailed rat 11bp
B D                   Alpaca 8bp
              Bactrian camel 8bp
B D                  Dolphin 8bp
                Killer whale 8bp
            Tibetan antelope 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
               Domestic goat 7bp
B D                 Hedgehog 7bp
             Star-nosed mole 9bp
B D                 Elephant 9bp
B D                  Manatee 8bp
B D                   Tenrec 7bp
                    Aardvark 8bp
B D              Zebra finch 8bp

Alignment block 25 of 1519 in window, 78189990 - 78190102, 113 bps 
B D                     Human  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D                     Chimp  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D                   Gorilla  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D                 Orangutan  gtgttggg-----------------a-ggggcagcctgg-------------------------------
B D                    Gibbon  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D                    Rhesus  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D       Crab-eating macaque  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D                    Baboon  gtgtcggg-----------------a-ggggcagcctgg-------------------------------
B D              Green monkey  gtgttggg-----------------a-ggggcagcctgg-------------------------------
B D                  Marmoset  gtgttggg-----------------a-ggggcagcctgg-------------------------------
B D           Squirrel monkey  gtgttggg-----------------a-ggggcagcctgg-------------------------------
B D                  Bushbaby  atgtcagg-----------------a-ggggcagcctgg-------------------------------
           Chinese tree shrew  gggggagg-----------------g-ggaacagcc-gg-------------------------------
B D                  Squirrel  ctgttggg-----------------a-gggacagcttgg-------------------------------
       Lesser Egyptian jerboa  ctgcctgg-----------------t-gcaagggacagc-------------------------------
                 Prairie vole  ----------------------------------------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D            Naked mole-rat  ctggtggg-----------------a-gggacagctggg-------------------------------
B D                Guinea pig  ctgatgga-----------------a-gagacagctggg-------------------------------
                   Chinchilla  ctggtgag-----------------a-gggacagctggg-------------------------------
             Brush-tailed rat  ctattttg-----------------a-agtctgcctgag-------------------------------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
B D                       Pig  -------a-----------------a-gggacagcctgg---tccctt----------------------
B D                    Alpaca  gtgtcagg-----------------aggggacatcctggttccccaccaacacacacacacacacacaca
               Bactrian camel  gtgtcagg-----------------aggggacatcctggttccccaccaacacacacacacac-------
B D                   Dolphin  gtgtcagg-----------------a-ggcacagcctggagctccccc----------------------
                 Killer whale  gtgtcagg-----------------a-ggcacagcctggagctccccc----------------------
             Tibetan antelope  gtgttagg-----------------a-aggacagcctggtgctcccct----------------------
B D                       Cow  gtgtcagg-----------------