Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 441 in window, 27275421 - 27275469, 49 bps 
B D                     Human  aaaaaacgacctg-----------c---ccagaccctca-------------------------------
B D                     Chimp  aaaaaacgacctg---------------ccagaccctca-------------------------------
B D                 Orangutan  aaaaaacgacctg-----------c---ccagacccgca-------------------------------
B D                    Gibbon  aaaaaacgacctg-----------c---cctgacccgca-------------------------------
B D                    Rhesus  aaaaaacgacttg-----------c---cctgacccgca-------------------------------
B D       Crab-eating macaque  aaaaaacgacttg-----------c---cctgacccgca-------------------------------
B D                    Baboon  aaaaaacgacctg-----------c---cctgacccgca-------------------------------
B D              Green monkey  aaaaaacgacctg-----------c---cctgacccgca-------------------------------
B D                  Marmoset  aaaaaacgacttg-----------c---cctgacccgca-------------------------------
B D           Squirrel monkey  aaaaaacgacttg-----------c---cctgacccgca-------------------------------
B D                  Bushbaby  aaaaa-------------------------caacgcaca-------------------------------
           Chinese tree shrew  aaagcaacccccg-----------ccggccagacgcaga-------------------------------
B D                  Squirrel  aaaaacc-acccg-----------c-------------a-------------------------------
       Lesser Egyptian jerboa  aa------acccg-----------a-------------t-------------------------------
                 Prairie vole  agaaaatgactcg-----------c-------------t-------------------------------
B D           Chinese hamster  aaaaaacgactcg-----------c-------------t-------------------------------
               Golden hamster  aaaaaacgactcg-----------c-------------t-------------------------------
B D                     Mouse  aaaaa---actcg-----------c-------------g-------------------------------
B D                       Rat  aaaaaaggactcg-----------c-------------t-------------------------------
B D            Naked mole-rat  aaaaaaggaccca-----------c-------------a-------------------------------
B D                Guinea pig  aaaaaaggacgca-----------c-------------a-------------------------------
                   Chinchilla  aaaaaaggaatca-----------c-------------a-------------------------------
             Brush-tailed rat  agaaaaggaccca-----------a-------------c-------------------------------
B D                    Rabbit  aaaaacg-gccca-----------c-------------a-------------------------------
B D                      Pika  aaaaacg-gcccg-----------c-------------a-------------------------------
B D                       Pig  aaaaagcgacccc-----------g-------------a-------------------------------
B D                    Alpaca  aaaaagcgacctg-----------g-------------a-------------------------------
               Bactrian camel  aaaaagcgacctg-----------g-------------a-------------------------------
B D                   Dolphin  aaaaagggacccc-----------t-------------a-------------------------------
                 Killer whale  aaaaagggacccc-----------t-------------a-------------------------------
             Tibetan antelope  aaaaagtgacccg-----------t-------------g-------------------------------
B D                       Cow  aaaaagtgacctg-----------t-------------a-------------------------------
B D                     Sheep  aaaaagtgacccg-----------t-------------a-------------------------------
                Domestic goat  aaaaagtgacccg-----------t-------------a-------------------------------
B D                     Horse  aaaaagcgacc-a-----------g-------------a-------------------------------
B D          White rhinoceros  aaaaagcgccc-g-----------g-------------a-------------------------------
B D                       Cat  aaaaagcgacccg-----------g-------------a-------------------------------
B D                       Dog  aaaaagcgacctg-----------g-------------a-------------------------------
B D                   Ferret   aaaaagcgaccgg-----------g-------------a-------------------------------
B D                     Panda  aaaaagcgacccg-----------g-------------a-------------------------------
               Pacific walrus  aaaaagcgaccca-----------g-------------a-------------------------------
                 Weddell seal  aaaaagcgacccg-----------g-------------a-------------------------------
             Black flying-fox  aataaacgactcg-----------g-------------a-------------------------------
B D                   Megabat  aataaacgactcg-----------g-------------a-------------------------------
                Big brown bat  aaaaaacgacccc-----------g-------------a-------------------------------
         David's myotis (bat)  aaaaaacgaccct-----------g-------------a-------------------------------
B D                  Microbat  aaaaaacgacccc-----------g-------------a-------------------------------
B D                  Hedgehog  aaaaagagcccaa-----------g-------------g-------------------------------
B D                     Shrew  aaaaagctctcag-----------g-------------c-------------------------------
              Star-nosed mole  aaaaagtgaccag-----------g-------------a-------------------------------
B D                  Elephant  a-aaagcaacccg-----------g-------------a-------------------------------
          Cape elephant shrew  a-aaaacaacccc-----------g-------------a-------------------------------
B D                   Manatee  a-aaagcaacccgggtcatagtcag-------------a-------------------------------
             Cape golden mole  a-aaagcatccca-----------g-------------a-------------------------------
B D                    Tenrec  c-aaagaagccaa-----------g-------------cacgaggcagccctcggcccggcctggcgcat
                     Aardvark  a-agagcctccca-----------g-------------a-------------------------------
B D                 Armadillo  --atggcgccccg-----------c-------------g-------------------------------
B D               Zebra finch  cggcagccgtcac-----------c-------------t-------------------------------
  D            Painted turtle  tgacggaaatctg-----------c-------------t-------------------------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                   Gorilla  ======================================================================

                        Human  g----cg-----------------------------------------t-cga-----------------
                        Chimp  g----cg-----------------------------------------t-cga-----------------
                    Orangutan  g----cg-----------------------------------------t-cca-----------------
                       Gibbon  a----cg-----------------------------------------c-gga-----------------
                       Rhesus  g----cg-----------------------------------------t-cgg-----------------
          Crab-eating macaque  g----cg-----------------------------------------t-cag-----------------
                       Baboon  g----cg-----------------------------------------t-cgg-----------------
                 Green monkey  g----cg-----------------------------------------t-cgg-----------------
                     Marmoset  g----cg-----------------------------------------t-cga-----------------
              Squirrel monkey  g----cg-----------------------------------------t-cga-----------------
                     Bushbaby  g----tg-----------------------------------------t-ccc-----------------
           Chinese tree shrew  g----tg-----------------------------------------c---------------------
                     Squirrel  g----tc-----------------------------------------tacta-----------------
       Lesser Egyptian jerboa  t----cc---------------------------------------------g-----------------
                 Prairie vole  g----ct-----------------------------------------c-cta-----------------
              Chinese hamster  g----ct-----------------------------------------g-gta-----------------
               Golden hamster  g----cc-----------------------------------------t-cta-----------------
                        Mouse  t----cc-----------------------------------------c-cta-----------------
                          Rat  t----tt-----------------------------------------c-ctc-----------------
               Naked mole-rat  g----cg-----------------------------------------t-cta-----------------
                   Guinea pig  g----tg-----------------------------------------a-cta-----------------
                   Chinchilla  g----tg-----------------------------------------t-cta-----------------
             Brush-tailed rat  g----tg-----------------------------------------g-tta-----------------
                       Rabbit  g----tg-----------------------------------------g-cgg-----------------
                         Pika  a----tg-----------------------------------------g-cgg-----------------
                          Pig  g----ag-----------------------------------------t-tga-----------------
                       Alpaca  g----tg-----------------------------------------g-cga-----------------
               Bactrian camel  g----tg-----------------------------------------g-cga-----------------
                      Dolphin  g----tg-----------------------------------------t-tga-----------------
                 Killer whale  g----tg-----------------------------------------t-tga-----------------
             Tibetan antelope  g----tg-----------------------------------------t-tga-----------------
                          Cow  g----tg-----------------------------------------t-tga-----------------
                        Sheep  g----tg-----------------------------------------t-tga-----------------
                Domestic goat  g----tg-----------------------------------------t-tga-----------------
                        Horse  g----tg-----------------------------------------t-tga-----------------
             White rhinoceros  g----tg-----------------------------------------t-tga-----------------
                          Cat  a----gg-----------------------------------------t-tgg-----------------
                          Dog  g----tg-----------------------------------------t-tgg-----------------
                      Ferret   g----tg-----------------------------------------t-tgg-----------------
                        Panda  g----ag-----------------------------------------t-tgg-----------------
               Pacific walrus  g----tg-----------------------------------------t-tgg-----------------
                 Weddell seal  g----tg-----------------------------------------t-tgg-----------------
             Black flying-fox  g----tg-----------------------------------------t-tga-----------------
                      Megabat  g----tg-----------------------------------------t-tga-----------------
                Big brown bat  g----ag-----------------------------------------t-taa-----------------
         David's myotis (bat)  g----tg-----------------------------------------t-cga-----------------
                     Microbat  g----tg-----------------------------------------t-tga-----------------
                     Hedgehog  ggtta----------------------------------------------ga-----------------
                        Shrew  g--cacg-----------------------------------------g-cgc-----------------
              Star-nosed mole  g-tcacg-----------------------------------------g-gga-----------------
                     Elephant  g----cg------agttggcgcatcggtgcgtcggag-----------cgtaa----------------g
          Cape elephant shrew  g----cg-------------tcaccg--acgtcatgg-----------cgtca----------------g
                      Manatee  g----cgtcggagcgtcggggcgtcggggcgtcaggg-----------cgtag----------------t
             Cape golden mole  g----cg-----tcatgggagcgtcttagcgtcagggtgtacttacatagtaa----------------t
                       Tenrec  g----cg-----cagtcggacggcctaagcg--aaggttcacgtcca-agtgaaataagtcccggagtta
                     Aardvark  g----cg-----tggtgggagcttcc--acg-----------------cacaa----------------g
                    Armadillo  g----cg-----------------------------------------caggg-----------------
                  Zebra finch  g----tc-----------------------------------------c-cag-----------------
               Painted turtle  g----tt-----------------------------------------c---------------------
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
           Southern platyfish  ======================================================================
                       Medaka  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
                      Gorilla  ======================================================================

                        Human  ------c------g-----------ct--gcgcacaagcgca-------------
                        Chimp  ------c------g-----------ct--gcgcgcaagcgca-------------
                    Orangutan  ------c------g-----------ct--gcgcgcaagcgca-------------
                       Gibbon  ------a------g-----------ctgcgcgcgcacgcgca-------------
                       Rhesus  ------c------g-----------ct--gcgcgcaagcgca-------------
          Crab-eating macaque  ------c------g-----------ct--gcgcgcaagcgca-------------
                       Baboon  ------c------g-----------ct--gcgcgcaagcgca-------------
                 Green monkey  ------c------g-----------ct--gcgcgcaagcgca-------------
                     Marmoset  ------g------g-----------ca--gctcgcaagcgca-------------
              Squirrel monkey  ------t------g-----------ca--acgcgcaagcgca-------------
                     Bushbaby  ------a------g-----------ca--gcgcgcaagcgca-------------
           Chinese tree shrew  -----------------------------gagcgcaagcgca-------------
                     Squirrel  ------c------c-----------ca--gcgcgcaagcgca-------------
       Lesser Egyptian jerboa  ------c------a-----------gc--gcgcgcaggcgca-------------
                 Prairie vole  ------c------a-----------aa--gtgcgcaagcgca-------------
              Chinese hamster  ------c------a-----------aa--gtgcgcaagcgca-------------
               Golden hamster  ------c------a-----------ca--gtgcgcaagcgca-------------
                        Mouse  ------c------a-----------aa--gtgcgcaagcgca-------------
                          Rat  ------c------a-----------aa--gtgcgcaagcgca-------------
               Naked mole-rat  ------ctacgcag-----------ca--gcgcgcaagcgca-------------
                   Guinea pig  ------ctgcgcag-----------ct--gcgcgcaagcgca-------------
                   Chinchilla  ------ctgcgcag-----------ta--gcgcgcaagcgca-------------
             Brush-tailed rat  ------ctgcgcag-----------gt--gcgcgcaagcgca-------------
                       Rabbit  ------c------g-----------ca--gcgcgcaagcgca-------------
                         Pika  ------a------g-----------ca--gcacgcacgcgca-------------
                          Pig  ------c------g-----------ca--gcgcgcaggcgca-------------
                       Alpaca  ------c------a-----------ca--gtgcgcaagcgca-------------
               Bactrian camel  ------c------a-----------ca--gtgcgcaagcgca-------------
                      Dolphin  ------c------g-----------ca--gcgcgcaggcgca-------------
                 Killer whale  ------c------g-----------ca--gtgcgcaggcgca-------------
             Tibetan antelope  ------c------g-----------ca--gtgcgcaggctcg-------------
                          Cow  ------c------g-----------ca--gtgcgcaggctcg-------------
                        Sheep  ------c------g-----------ca--gtgcgcacgctcg-------------
                Domestic goat  ------c------g-----------ca--gtgcgcaggctcg-------------
                        Horse  ------c------g-----------ca--gcgcgcaagcgca-------------
             White rhinoceros  ------t------g-----------ct--gcgcgcaagcgca-------------
                          Cat  ------c------g-----------cg--gcgcacaagcgcg-------------
                          Dog  ------c------g-----------ca--gcgcgcaagcgca-------------
                      Ferret   ------c------g-----------ca--gcacgcaagcgct-------------
                        Panda  ------c------g-----------ta--gcacgcaagcgca-------------
               Pacific walrus  ------c------g-----------ca--gcacgcaagcgca-------------
                 Weddell seal  ------c------g-----------ca--gcacgcaagcgca-------------
             Black flying-fox  ------c------g-----------ca--gtgcgcaagcgca-------------
                      Megabat  ------c------g-----------ca--gtgcgcaagcgca-------------
                Big brown bat  ------c------a-----------ca--gtgcgcaggcgca-------------
         David's myotis (bat)  ------c------a-----------ca--gtgcgcaggcgca-------------
                     Microbat  ------c------a-----------ca--gtgcgcaggcgca-------------
                     Hedgehog  ------g------t-----------ca--gtgcgcaggcgca-------------
                        Shrew  ------a------t-----------gc--gtgcgcaggcgca-------------
              Star-nosed mole  ------c------t-----------ca--gcgcgcaggcgca-------------
                     Elephant  cttg--c------g-----------ta--gcacgcatgcgca-------------
          Cape elephant shrew  ccagcac------g-----------cg--tcgcgcatgcgca-------------
                      Manatee  ctgg--c------g-----------ca--gcgcgcacgcgca-------------
             Cape golden mole  cagg--c------g-----------ca--gcccacgctcgca-------------
                       Tenrec  cggg--c------ggtctcacctctcc--gcgcacatgcgca-------------
                     Aardvark  cttg--c------g-----------ca--gggcgcaggcgca-------------
                    Armadillo  --ga--c------g-----------ca--gcgcgcacgcgca-------------
                  Zebra finch  ------c-gtgt-c-----------ct--gctctcacgcgcata-tatgggc---
               Painted turtle  -------------c-----------ct--gcttcctcgctggtattgtgagcgct
             Peregrine falcon  =======================================================
                 Saker falcon  =======================================================
     Mexican tetra (cavefish)  =======================================================
                  Spotted gar  =======================================================
                   Coelacanth  =======================================================
                    Zebrafish  =======================================================
                  Rock pigeon  =======================================================
           Southern platyfish  =======================================================
                       Medaka  =======================================================
                 Mallard duck  =======================================================
                    Tetraodon  =======================================================
       Yellowbelly pufferfish  =======================================================
                         Fugu  =======================================================
                      Chicken  =======================================================
          Medium ground finch  =======================================================
                       Turkey  =======================================================
                 Atlantic cod  =======================================================
          Collared flycatcher  =======================================================
           American alligator  =======================================================
           Tibetan ground jay  =======================================================
                      Wallaby  =======================================================
              Tasmanian devil  =======================================================
              Green seaturtle  =======================================================
                      Opossum  =======================================================
                      Gorilla  =======================================================

Alignment block 2 of 441 in window, 27275470 - 27275512, 43 bps 
B D                     Human  gtcaa-ct------gc------t-----------------------------------------------
B D                     Chimp  gtcaa-ct------gc------t-----------------------------------------------
B D                 Orangutan  gtcag-ct------gc------t-----------------------------------------------
B D                    Gibbon  gtcag-ct------gc------t-----------------------------------------------
B D                    Rhesus  gtcag-ct------ac------t-----------------------------------------------
B D       Crab-eating macaque  gtcag-ct------ac------t-----------------------------------------------
B D                    Baboon  gtcag-ct------ac------t-----------------------------------------------
B D              Green monkey  gtcag-ct------ac------t-----------------------------------------------
B D                  Marmoset  gtcac-ct------gc------t-----------------------------------------------
B D           Squirrel monkey  gtcac-ct------cc------t-----------------------------------------------
B D                  Bushbaby  gttgg-ct------ac------a-----------------------------------------------
           Chinese tree shrew  gtggg-cc------gc------t-----------------------------------------------
B D                  Squirrel  gtggg-cc------ga------g-----------------------------------------------
       Lesser Egyptian jerboa  gtcag-cc------gc------a-----------------------------------------------
                 Prairie vole  gttgt-cc------aa------g-----------------------------------------------
B D           Chinese hamster  gttgg-cc------ac------a-----------------------------------------------
               Golden hamster  gttgg-cc------ac------a-----------------------------------------------
B D                     Mouse  gttt--cc------at------a-----------------------------------------------
B D                       Rat  gttg--cc------at------a-----------------------------------------------
B D            Naked mole-rat  gtcggcct------gc------t-----------------------------------------------
B D                Guinea pig  gtcggcct------gc------t-----------------------------------------------
                   Chinchilla  gtcggcct------gc------t-----------------------------------------------
             Brush-tailed rat  gtcggccc------gc------t-----------------------------------------------
B D                    Rabbit  atggg-cc------gc------a-----------------------------------------------
B D                      Pika  atgga-ct------gc-----ta-----------------------------------------------
B D                    Alpaca  gccgg-cc------gc------t-----------------------------------------------
               Bactrian camel  ggcgg-cc------ac------t-----------------------------------------------
B D                   Dolphin  gtcgg-cc------ac------t-----------------------------------------------
                 Killer whale  gtcgg-cc------ac------t-----------------------------------------------
             Tibetan antelope  gtc-a-cc------ac------t-----------------------------------------------
B D                       Cow  gttgg-cc------ac------t-----------------------------------------------
B D                     Sheep  gtc-a-cc------ac------t-----------------------------------------------
                Domestic goat  gtc-a-cc------ac------t-----------------------------------------------
B D                     Horse  gtggg-cg------gc------t-----------------------------------------------
B D          White rhinoceros  gtcgg-cg------gt------g-----------------------------------------------
B D                       Cat  gttgt-cc------ac------t-----------------------------------------------
B D                       Dog  gttgg-cc------gc------t-----------------------------------------------
B D                   Ferret   gttgg-cc------ac------t-----------------------------------------------
B D                     Panda  gttgg-cc------ac------t-----------------------------------------------
               Pacific walrus  gttgg-cc------gc------t-----------------------------------------------
                 Weddell seal  gttgg-cc------gc------t-----------------------------------------------
             Black flying-fox  gtggg-cc------ac------a-----------------------------------------------
B D                   Megabat  gtggg-cc------ac------a-----------------------------------------------
                Big brown bat  gtggg-ca------ac------t-----------------------------------------------
         David's myotis (bat)  gaggg-ct------gc------t-----------------------------------------------
B D                  Microbat  gaggg-cc------ac------t-----------------------------------------------
B D                  Hedgehog  gtggg-ag------gc------t-----------------------------------------------
B D                     Shrew  gtagc-cc------cc------t-----------------------------------------------
              Star-nosed mole  gtggg-gc------gtggggggg-----------------------------------------------
B D                  Elephant  gtcgg-cc------gc------t-----------------------------------------------
          Cape elephant shrew  gttgg-cc------gc------t-----------------------------------------------
B D                   Manatee  gatgg-cc------gc------t-----------------------------------------------
             Cape golden mole  gttag-cc------gc------c-----------------------------------------------
B D                    Tenrec  gttgg-ac------gg------cctaataagtcctgggctaggcgagctcccgtctccgcgcgcacatgc
                     Aardvark  gtcgg-cccccagggc------c-----------------------------------------------
B D                 Armadillo  gtcgg-cc------gc------t-----------------------------------------------
B D               Zebra finch  ----a-cg------gc------a-----------------------------------------------
  D            Painted turtle  ---gg-ct------gc------a-----------------------------------------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Pig  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Opossum  ======================================================================
B D                   Gorilla  ======================================================================

                        Human  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aaa
                        Chimp  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aaa
                    Orangutan  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aaa
                       Gibbon  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aaa
                       Rhesus  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aga
          Crab-eating macaque  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aga
                       Baboon  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aga
                 Green monkey  ------g--ga-cccg-gccggtg----tgaagtttc-aca----ccc---a----aga
                     Marmoset  ------g--ga-ctcg-gccggtg----tgaagtttc-aca----ccc---a----gga
              Squirrel monkey  ------g--ga-cgcg-gccagtg----tgaagtttc-aca----ccc---a----aga
                     Bushbaby  ------g--gg-ctcg-gccggtg----tgaagtttc-aca----ccc---a----gga
           Chinese tree shrew  ------g--ga-cccg-g-cagtg----tgaagtttc-gca----cct---g----gga
                     Squirrel  ------g--aa-cc---ggcggtg----tgaagtttc-aca----cct---a----gaa
       Lesser Egyptian jerboa  ------g--ac-gc-gccgccgca----tgcagtttc-aca----ccc---gtgcgggg
                 Prairie vole  ------gcccc-ccgacagcaata----tgaagcttc-gcg----ccc---accagaag
              Chinese hamster  ------g--ac-ccagccccagaa----tgaagcttc-gca----ccc---accaggag
               Golden hamster  ------g--at-ccggcagcaata----tgaagcttc-gca----ccc---accaggag
                        Mouse  ------g---c-ccagaggcaata----tgaaagttc-acg----tct---accgggaa
                          Rat  ------g--cc-ccagagacaata----tgaaagttc-aca----tcc---accgggaa
               Naked mole-rat  ------g--aa-ct---ggcggtg----tg--gtttcaaca----ccc--aa----gga
                   Guinea pig  ------g--aa-ct---gctggtg----tgaagtttc-aca----cgc---a----gga
                   Chinchilla  ------g--aa-ct---ggcggtg----tgaagtttt-aca----ccc---t----gga
             Brush-tailed rat  ------g--aa-ct---ggcagtg----tgaagtttc-aca----ccc---t----gga
                       Rabbit  ------g--cg------gac--tg----tgaaatttc-aca----ccc---g----aga
                         Pika  ------g--ta------gaccgtg----tgaagtttc-ata----ccc---g----gga
                       Alpaca  ------g--ga-ccacgggccgtg----tgaagtttg-gca----cct---t-------
               Bactrian camel  ------g--ga-ccacgggccgtg----tgaagtttg-gca----cct---t-------
                      Dolphin  ------g--gc-ccgc-tgccgtg----tgaagtttc-aca----cct---t-------
                 Killer whale  ------g--gc-ccgc-tgccgtg----tgaagtttc-aca----cct---t-------
             Tibetan antelope  ------g--gc-ccgc-tgccgtg----tgaagtttc-aca----cct---t-------
                          Cow  ------g--ga-ccgc-tgccgtg----ttaagtttc-aca----cct---t-------
                        Sheep  ------g--gc-ccgc-tgccgtg----tgaagtttc-aca----cct---t-------
                Domestic goat  ------g--gc-ccgc-tgccgtg----tgaagtttc-aca----cgt---t-------
                        Horse  ------g--ga-ctcg----ggtg----agaagtttc-acg----gcc---t-------
             White rhinoceros  ------g--ac-tccg----ggtg----agaagtttc-aca----ccc---c-------
                          Cat  ------g--ga-cttc-ggcggtg----tgaagtttc-aca----ccc---g-------
                          Dog  ------g--gc-cctc-ggcggtg----tgaagtttc-aca----ccc---g-------
                      Ferret   ------g--ga-ccct-ggcggtg----tgaaatttc-aca----ccc---a-------
                        Panda  ------g--ga-cccc-agcggtg----t------------------------------
               Pacific walrus  ------g--ga-cccc-ggcggtg----tgaaatttc-gca----ccc---a-------
                 Weddell seal  ------g--gc-cccc-ggcggtg----tgaaatttc-aca----ccc---a-------
             Black flying-fox  ------g--ga-cccc-ggctgtg----tgaagtttt-aca----ccc---t-------
                      Megabat  ------g--ga-cccc-ggctgtg----tgaagtttt-tca----ccc---t-------
                Big brown bat  ------g--ga-cca---gccgtg----tgaagtttc-atg----ccc---t-------
         David's myotis (bat)  ------g--gc-ccc---gcggtg----tgagggttc-acg----ccc---t-------
                     Microbat  ------g--gc-ccc---gcggtg----tgagggttc-acg----ccc---t-------
                     Hedgehog  ------g--ga-gcc---------------atgtttc-tcg----cct---c-------
                        Shrew  ------g--gg-cccg--gcgctg----tgaattttc-aca----gcc---t-------
              Star-nosed mole  ------g--gg-cccc--gcggtg----agaagtttc-cca----gcctggt-------
                     Elephant  ------g--gg-cc---ggctgtg----tgaagtttc-aca----cct---g----aga
          Cape elephant shrew  ------g--gg-cc---ggctgtg----tgaggtttc-aca----ccc---t----aga
                      Manatee  ------g--gg-cc---ggctgtg----tgaaatttc-aca----cct---g----aga
             Cape golden mole  ------g--ag-cc---ggctgtg----tgaagtttc-aca----cct---g----agt
                       Tenrec  gcagttg--cg-ca---ggctgtg----cgacgtttc-aca----ccc---t----cat
                     Aardvark  ------c--gg-cc---ggc-gta----tgaagtttc-ata----cct---g----aga
                    Armadillo  ------g--ggccc---ggccgtg----tgaggtttc-tca----cgc---g----ggc
                  Zebra finch  ------g--ga-cggc-agctctga---cgcagcgct-gctaaaa--------------
               Painted turtle  ------g--cg-tggg-agccccgggcttgaccctct-gct------------------
             Peregrine falcon  ===========================================================
                 Saker falcon  ===========================================================
     Mexican tetra (cavefish)  ===========================================================
                  Spotted gar  ===========================================================
                   Coelacanth  ===========================================================
                    Zebrafish  ===========================================================
                  Rock pigeon  ===========================================================
           Southern platyfish  ===========================================================
                       Medaka  ===========================================================
                 Mallard duck  ===========================================================
                    Tetraodon  ===========================================================
       Yellowbelly pufferfish  ===========================================================
                         Fugu  ===========================================================
                      Chicken  ===========================================================
          Medium ground finch  ===========================================================
                       Turkey  ===========================================================
                 Atlantic cod  ===========================================================
          Collared flycatcher  ===========================================================
           American alligator  ===========================================================
           Tibetan ground jay  ===========================================================
                      Wallaby  ===========================================================
              Tasmanian devil  ===========================================================
              Green seaturtle  ===========================================================
                          Pig  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Opossum  ===========================================================
                      Gorilla  ===========================================================

Alignment block 3 of 441 in window, 27275513 - 27275552, 40 bps 
B D                     Human  ggatgaagggc---------acccacctggcttaaga-------ga------------------------
B D                     Chimp  ggatgaagggc---------acccacctggcttaaga-------ga------------------------
B D                 Orangutan  ggatgaagggc---------acccgcctggcttaaga-------ga------------------------
B D                    Gibbon  ggatgaagggc---------acccacctggcttaaga-------ga------------------------
B D                    Rhesus  ggatgaagggc---------acctacctggcttaaca-------ga------------------------
B D       Crab-eating macaque  ggatgaagggc---------acctacctggcttaaca-------ga------------------------
B D                    Baboon  ggatgaagggc---------acctacctggcttaaca-------ga------------------------
B D              Green monkey  ggatgaagggc---------acctacctggcttaaca-------ga------------------------
B D                  Marmoset  ggatgaagggc---------acccacctggcttaaga-------ga------------------------
B D           Squirrel monkey  ggatgaagggc---------acccacctggcttaaga-------ga------------------------
B D                  Bushbaby  ggataaaggatgtgt-ga-ggcctacctagctcaaga-------ta------------------------
           Chinese tree shrew  ggatgaagggtgtgt-gaggccctacttggcttaaga-------gg------------------------
B D                  Squirrel  agatggagggtgaat-gag-gcctacctggtttaaga-------gc------------------------
       Lesser Egyptian jerboa  gaaggcggggtgtgc-gag-gcctaccaggcctaaga-------ga------------------------
                 Prairie vole  gaaggaagcttgtgt-gaa-gcctacctggcttaata-------ga------------------------
B D           Chinese hamster  gaagaaagcttgtgt-gag-gtctacctggcttaaca-------ga------------------------
               Golden hamster  aaagaaagcttgtgt-gag-gcctacctggcttaata-------ga------------------------
B D                     Mouse  gaaggaagcttgtgt-cag-gcctacctggttttata-------ga------------------------
B D                       Rat  gaaggaagcttgtgt-gag-gcctacctggctttata-------ga------------------------
B D            Naked mole-rat  ggatgaaaggtgtgt-gag-ggttacctggtttaaga-------ga------------------------
B D                Guinea pig  ggatgaaaggtttgt-gag-gcttacctggcttaagg-------gg------------------------
                   Chinchilla  ggatgaaaggtttgt-gag-gcttacctggtttaaga-------ga------------------------
             Brush-tailed rat  ggatgaaaggtttgt-gag-gcgtatttggtttaaga-------ga------------------------
B D                    Rabbit  gggtgaagcgtctat-gaa-gccaatgtggcttcgga-------ga------------------------
B D                      Pika  gggtggaaggtgt-t-gag-gataacctggcgtctga-------gagccaggacgacggcaacgacgacg
B D                    Alpaca  -gatggaggttgtct-gag-gcttctgaggctgaaga-------ga------------------------
               Bactrian camel  -gatggaggttgtct-gag-gcttctgaggctgaaga-------ga------------------------
B D                   Dolphin  -gatggaggttgcgt-gag-gcctccccggctgaaga-------ga------------------------
                 Killer whale  -gatggaggttgcgt-gag-gcctccccggctgaaga-------ga------------------------
             Tibetan antelope  -catggaggttgcgt-gag-gcct-cccggctgaata-------ga------------------------
B D                       Cow  -catggagatcgcgt-gag-gcct-cccggctgaata-------ga------------------------
B D                     Sheep  -catggaggttgcgt-gag-gcct-cccggctgaata-------ga------------------------
                Domestic goat  -catggaggttgcgt-gag-gcct-cccggctgaata-------ga------------------------
B D                     Horse  -gatggaggttgcat-gag-gcctacggggctgaaga-------ca------------------------
B D          White rhinoceros  -gatggaggttgttt-gag-gcctacccggctgaaga-------ga------------------------
B D                       Cat  -gatggaggttgtgc-gat-acctccccagccgagga-------gg------------------------
B D                       Dog  -gatggaggttgggt-gag-gcctcaccagctgaaga-------ga------------------------
B D                   Ferret   -gatggagattgtgt-gag-gcttccccaggtgagga-------ga------------------------
B D                     Panda  -gatggaggttgtgt-gag-gcctccccaggtgagga-------ga------------------------
               Pacific walrus  -ga-----------t-gag-gcctccccagatgagaa-------ga------------------------
                 Weddell seal  -gatggaggttgtgt-gag-gcctgcccaggtgagga-------ga------------------------
             Black flying-fox  -gatggaggtcgtgt-aag-gcctatgt-gctgaaga-------ga------------------------
B D                   Megabat  -gatggaggttgtgt-aag-gcctgtgt-gctgaaga-------ga------------------------
                Big brown bat  -ggcggagg--gtga-aag-gcctgcccagctggctg--------a------------------------
         David's myotis (bat)  -ggcggagggtgtgg-aag-gccggcccggctggctg-------aa------------------------
B D                  Microbat  -ggcggagggtgtgg-aag-gccggccccgctggctg-------ga------------------------
B D                  Hedgehog  -gggggaggttgtgt-gag-gc---ccaaacactgaa-------ga------------------------
B D                     Shrew  -ggcggaagttgcgtgcgg-gc---cccagc---------------------------------------
              Star-nosed mole  -ggtggaggttgggt-cgg-gcctacccagctgaagg-------cc------------------------
B D                  Elephant  gggtggggcgggtgt-gag-gcctactaggctgaaga-------ga------------------------
          Cape elephant shrew  gtggactgacgggat-gcg-gcctactcagcagaagg-------ga------------------------
B D                   Manatee  gggtggagggtgtgt-gag-gcctactctgctgaaga-------ga------------------------
             Cape golden mole  gtggaaggcggactc-------------agctgaaga-------ga------------------------
B D                    Tenrec  ggggagagcgcgttt-ga----------ggctgcctg-------ga------------------------
                     Aardvark  gggtggagggtgtgt-gag-gcctactccg-tgagga-------ga------------------------
B D                 Armadillo  cggaagcgagtggcc-gag-gcctcctccgc---gga-------ga------------------------
  D            Painted turtle  ----ggagcgctggt-----gtctgcatggtttcctaatcccccgg------------------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Pig  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Opossum  ======================================================================
B D                   Gorilla  ======================================================================

                        Human  ------acga---ctccca
                        Chimp  ------acga---ctccca
                    Orangutan  ------acga---ctccca
                       Gibbon  ------acga---ctccca
                       Rhesus  ------acga---ctccca
          Crab-eating macaque  ------acga---ctccca
                       Baboon  ------acga---ctccca
                 Green monkey  ------acga---ctccca
                     Marmoset  ------acgg---attcca
              Squirrel monkey  ------acga---ctccca
                     Bushbaby  ------gcaa---gtcata
           Chinese tree shrew  ------gcgc---cagaga
                     Squirrel  ------ccta---ctggga
       Lesser Egyptian jerboa  ------ac-a---ctccga
                 Prairie vole  ------ccaa---ttctga
              Chinese hamster  ------ccaa---ttctga
               Golden hamster  ------ccaa---ttctga
                        Mouse  ------acaa---ttctga
                          Rat  ------acaa---ttctga
               Naked mole-rat  ------ctga---ctcgag
                   Guinea pig  ------gtga---cttaga
                   Chinchilla  ------gtga---cttgga
             Brush-tailed rat  ------gtga---ctcgat
                       Rabbit  gcgacgacga---ctacga
                         Pika  gcgacaacga---ctacga
                       Alpaca  ------acga---cttcga
               Bactrian camel  ------acga---cttcga
                      Dolphin  ------gcga---ctccga
                 Killer whale  ------gcga---ctccga
             Tibetan antelope  ------gcga---ctacga
                          Cow  ------gcga---ctatga
                        Sheep  ------gcga---ctacga
                Domestic goat  ------gcga---ctacga
                        Horse  ------gc-c---cttc--
             White rhinoceros  ------gcga---ctct--
                          Cat  ------gcga---ctctga
                          Dog  ------gcga---ccctga
                      Ferret   ------gcgtctcctctga
                        Panda  -------cgt---ctctga
               Pacific walrus  ------gcgg---ccctgt
                 Weddell seal  ------gcgg---ctctga
             Black flying-fox  ------ggga---ctccaa
                      Megabat  ------ggga---ctccaa
                Big brown bat  ------agg---------a
         David's myotis (bat)  ------agg---------a
                     Microbat  ------agg---------a
                     Hedgehog  ------gagg---ctctga
                        Shrew  -------------------
              Star-nosed mole  ------actg---ctagaa
                     Elephant  ------ggga---ctccga
          Cape elephant shrew  ------gcta---ct-tga
                      Manatee  ------ggaa---ctgtga
             Cape golden mole  ------gcaa---cgaaga
                       Tenrec  ------acca---c-----
                     Aardvark  ------gcaa---ctccaa
                    Armadillo  ------ggcg---ctcccg
               Painted turtle  ------gggg---ctctgc
             Peregrine falcon  ===================
                 Saker falcon  ===================
     Mexican tetra (cavefish)  ===================
                  Spotted gar  ===================
                   Coelacanth  ===================
                    Zebrafish  ===================
                  Rock pigeon  ===================
           Southern platyfish  ===================
                       Medaka  ===================
                 Mallard duck  ===================
                    Tetraodon  ===================
       Yellowbelly pufferfish  ===================
                         Fugu  ===================
                      Chicken  ===================
          Medium ground finch  ===================
                       Turkey  ===================
                  Zebra finch  ===================
                 Atlantic cod  ===================
          Collared flycatcher  ===================
           American alligator  ===================
           Tibetan ground jay  ===================
                      Wallaby  ===================
              Tasmanian devil  ===================
              Green seaturtle  ===================
                          Pig  NNNNNNNNNNNNNNNNNNN
                      Opossum  ===================
                      Gorilla  ===================

Inserts between block 3 and 4 in window
      Lesser Egyptian jerboa 2bp
B D                   Tenrec 5bp

Alignment block 4 of 441 in window, 27275553 - 27275554, 2 bps 
B D                     Human  -gg
B D                     Chimp  -gg
B D                 Orangutan  -gg
B D                    Gibbon  -gg
B D                    Rhesus  -gg
B D       Crab-eating macaque  -gg
B D                    Baboon  -gg
B D              Green monkey  -gg
B D                  Marmoset  -gg
B D           Squirrel monkey  -gg
B D                  Bushbaby  -gg
           Chinese tree shrew  -gg
B D                  Squirrel  -gg
                 Prairie vole  -gg
B D           Chinese hamster  -gg
               Golden hamster  -gg
B D                     Mouse  -gg
B D                       Rat  -gg
B D            Naked mole-rat  -gt
B D                Guinea pig  -gg
                   Chinchilla  -gg
             Brush-tailed rat  -gg
B D                    Rabbit  -gg
B D                      Pika  -ag
B D                    Alpaca  -gg
               Bactrian camel  -gg
B D                   Dolphin  -gg
                 Killer whale  -gg
             Tibetan antelope  -gg
B D                       Cow  -gg
B D                     Sheep  -gg
                Domestic goat  -gg
B D                       Cat  -gg
B D                       Dog  -gg
B D                   Ferret   -ga
B D                     Panda  -gg
               Pacific walrus  -gg
                 Weddell seal  -gg
             Black flying-fox  -gg
B D                   Megabat  -gg
                Big brown bat  -gg
         David's myotis (bat)  -gg
B D                  Microbat  -gg
B D                  Hedgehog  -gg
              Star-nosed mole  -gg
B D                  Elephant  -gg
          Cape elephant shrew  -gg
B D                   Manatee  -gg
             Cape golden mole  -ag
                     Aardvark  -gg
B D                 Armadillo  -gg
  D            Painted turtle  tg-
B D                     Shrew  ---
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
          Southern platyfish  ===
B D                    Medaka  ===
  D              Mallard duck  ===
B D                 Tetraodon  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D               Zebra finch  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
  D           Green seaturtle  ===
B D                       Pig  NNN
B D                   Opossum  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                     Horse  ---
B D          White rhinoceros  ---
B D                   Gorilla  ===

Inserts between block 4 and 5 in window
B D                 Elephant 4bp
            Cape golden mole 3bp

Alignment block 5 of 441 in window, 27275555 - 27275571, 17 bps 
B D                     Human  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                     Chimp  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                 Orangutan  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                    Gibbon  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                    Rhesus  t----aaa--------------g--gg-------------ccag-----------------------acc
B D       Crab-eating macaque  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                    Baboon  t----aaa--------------g--gg-------------ccag-----------------------acc
B D              Green monkey  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                  Marmoset  t----aaa--------------g--gg-------------ccag-----------------------acc
B D           Squirrel monkey  t----aaa--------------g--gg-------------ccag-----------------------acc
B D                  Bushbaby  t----aaa--------------g--ga-------------ccag-----------------------gcc
           Chinese tree shrew  t----gaa--------------g--gg-------------gcac-----------------------gtc
B D                  Squirrel  t----aaa--------------g--gg-------------ccaa-----------acccag---------
       Lesser Egyptian jerboa  t----aaa--------------g--ca-------------ccgg------cccag---------------
                 Prairie vole  t----aaa--------------g--ag-------------ccag--------------------------
B D           Chinese hamster  t----aaa--------------g--ag-------------ctag--------------------------
               Golden hamster  t----aaa--------------g--ag-------------ccag--------------------------
B D                     Mouse  t----aat--------------a--ag-------------ctaggtctgg--------------------
B D                       Rat  t----aat--------------a--ag-------------ctagggct----------------------
B D            Naked mole-rat  t----aag--------------ggcag----------gctctag--------------------------
B D                Guinea pig  ta---aaa--------------g--ag----------gctctag--------------------------
                   Chinchilla  t----aaa--------------g--ag----------gctcgag--------------------------
             Brush-tailed rat  t----aaa--------------g--ag----------gctctag--------------------------
B D                    Rabbit  t----aag--------------g--gg-------------ccgg-----------------gcccac---
B D                      Pika  t----aag--------------g--gg-------------ccag-----------------gtctag---
B D                    Alpaca  t----aga--------------c--gc---------caggctgg--------------------------
               Bactrian camel  t----aga--------------c--gg---------caggctgg--------------------------
B D                   Dolphin  t----aga--------------c--gc---------caggctgg--------------------------
                 Killer whale  t----aga--------------c--gc---------caggctgg--------------------------
             Tibetan antelope  t----aga--------------t--gc---------caggccag--------------------------
B D                       Cow  t----aga--------------t--gc---------caggccgg--------------------------
B D                     Sheep  t----aga--------------t--gc---------caggccgg--------------------------
                Domestic goat  t----aga--------------t--gc---------caggccgg--------------------------
B D                     Horse  -----cga--------------g--gta--aagcgcctggccgt--------------------------
B D          White rhinoceros  -----tca--------------g--gta--aagcgcccggccgg--------------------------
B D                       Cat  t----aga--------------a--gta--gagcgccaggccag--------------------------
B D                       Dog  t----aga--------------g--gta--gagcaccaggccga--------------------------
B D                   Ferret   tgaggaga--------------g--gta--gagcaccaggtgga--------------------------
B D                     Panda  t----aga--------------g--gta--gagtaccaggccgg--------------------------
               Pacific walrus  t----aaa--------------g--gta--gagcaccaggccgg--------------------------
                 Weddell seal  t----aaa--------------g--gta--gagcaccaggccgg--------------------------
             Black flying-fox  t----aga-----------tccg-------------cagcgcgg--------------------------
B D                   Megabat  t----aga-----------tccg-------------cagcgcgg--------------------------
                Big brown bat  t----aga--------------g--gc---------caggtctg--------------------------
         David's myotis (bat)  t----aga----------ggccg--gt---------cgggtccg--------------------------
B D                  Microbat  t----agagcccggtccggtccg--gt---------ccggtccg--------------------------
B D                  Hedgehog  t----aaa-------------gc--gc---------caggccag--------------------------
B D                     Shrew  -------------------------------------------a--------------------------
              Star-nosed mole  t----aaa-------------gc--gc---------caggcagt--------------------------
B D                  Elephant  t----aaa--------------g--gg-------------cgaa--------------------------
          Cape elephant shrew  t----aaa--------------g--gg-------------ccaa--------------------------
B D                   Manatee  t----aaa--------------g--gg-------------ccaa--------------------------
             Cape golden mole  t----aaa--------------g--gg-------------ctaa--------------------------
                     Aardvark  t----aaa--------------g--gg-------------ctga--------------------------
B D                 Armadillo  t----aaa--------------g--gg-------------ccgc--------------------------
  D            Painted turtle  ---------------------------agcgggccctgcgatgg--------------------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Pig  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Opossum  ======================================================================
B D                    Tenrec  ======================================================================
B D                   Gorilla  ======================================================================

                        Human  cag
                        Chimp  cag
                    Orangutan  cag
                       Gibbon  cag
                       Rhesus  cgg
          Crab-eating macaque  cgg
                       Baboon  cgg
                 Green monkey  cgg
                     Marmoset  cag
              Squirrel monkey  cag
                     Bushbaby  ctg
           Chinese tree shrew  cag
                     Squirrel  ---
       Lesser Egyptian jerboa  ---
                 Prairie vole  ---
              Chinese hamster  ---
               Golden hamster  ---
                        Mouse  ---
                          Rat  ---
               Naked mole-rat  ---
                   Guinea pig  ---
                   Chinchilla  ---
             Brush-tailed rat  ---
                       Rabbit  ---
                         Pika  ---
                       Alpaca  ---
               Bactrian camel  ---
                      Dolphin  ---
                 Killer whale  ---
             Tibetan antelope  ---
                          Cow  ---
                        Sheep  ---
                Domestic goat  ---
                        Horse  ---
             White rhinoceros  ---
                          Cat  ---
                          Dog  ---
                      Ferret   ---
                        Panda  ---
               Pacific walrus  ---
                 Weddell seal  ---
             Black flying-fox  ---
                      Megabat  ---
                Big brown bat  ---
         David's myotis (bat)  ---
                     Microbat  ---
                     Hedgehog  ---
                        Shrew  ---
              Star-nosed mole  ---
                     Elephant  ---
          Cape elephant shrew  ---
                      Manatee  ---
             Cape golden mole  ---
                     Aardvark  ---
                    Armadillo  ---
               Painted turtle  ---
             Peregrine falcon  ===
                 Saker falcon  ===
     Mexican tetra (cavefish)  ===
                  Spotted gar  ===
                   Coelacanth  ===
                    Zebrafish  ===
                  Rock pigeon  ===
           Southern platyfish  ===
                       Medaka  ===
                 Mallard duck  ===
                    Tetraodon  ===
       Yellowbelly pufferfish  ===
                         Fugu  ===
                      Chicken  ===
          Medium ground finch  ===
                       Turkey  ===
                  Zebra finch  ===
                 Atlantic cod  ===
          Collared flycatcher  ===
           American alligator  ===
           Tibetan ground jay  ===
                      Wallaby  ===
              Tasmanian devil  ===
              Green seaturtle  ===
                          Pig  NNN
                      Opossum  ===
                       Tenrec  ===
                      Gorilla  ===

Inserts between block 5 and 6 in window
B D                    Mouse 178bp
B D                 Elephant 6bp
         Cape elephant shrew 6bp
B D                  Manatee 6bp
            Cape golden mole 5bp
                    Aardvark 6bp
B D                Armadillo 6bp

Alignment block 6 of 441 in window, 27275572 - 27275583, 12 bps 
B D                     Human  gt------gaggagtcgg
B D                     Chimp  gt------gaggagtcgg
B D                 Orangutan  gt------gaggagtcgg
B D                    Gibbon  gt------gaggagtcgg
B D                    Rhesus  gt------gaggagtcgg
B D       Crab-eating macaque  gt------gaggagtcgg
B D                    Baboon  gt------gaggagtcgg
B D              Green monkey  gt------gaggagtcgg
B D                  Marmoset  gc------gaggagtcgg
B D           Squirrel monkey  gc------gaggagtcgg
B D                  Bushbaby  ct------gaggtgttgg
           Chinese tree shrew  gc------gg--------
B D                  Squirrel  -c------agggagaggg
       Lesser Egyptian jerboa  ga------gcgctgtcag
                 Prairie vole  gt------cgggagtcaa
B D           Chinese hamster  gt------agggagtcga
               Golden hamster  gt------agggagtcta
B D                       Rat  ----------ggagtcaa
B D            Naked mole-rat  tg------gcctagtcgg
B D                Guinea pig  tg------gaagagtcag
                   Chinchilla  tt------ggggagtcaa
             Brush-tailed rat  tt------gaattgtagg
B D                    Alpaca  gt------ggaggctcca
               Bactrian camel  gt------ggaggctcca
B D                   Dolphin  gtgggggtggggggtcca
                 Killer whale  gtg-----ggtgggtcca
             Tibetan antelope  at------gaggggtcca
B D                       Cow  at------gaggggtcca
B D                     Sheep  at------gaggggtcca
                Domestic goat  at------gtggggtcca
B D                     Horse  gt------gtggagtcca
B D          White rhinoceros  gt------ggggagtcca
B D                       Cat  gt------gtggagtcca
B D                       Dog  gc------agggagtcca
B D                   Ferret   gc------a-gggagcca
B D                     Panda  gc------g-ggagccca
               Pacific walrus  gc------gcggaggcca
                 Weddell seal  gc------gcggagtcca
             Black flying-fox  gt------agggagtctt
B D                   Megabat  gt------agggagtctt
                Big brown bat  gt------ggggagtcca
         David's myotis (bat)  gc------ggggagtcca
B D                  Microbat  gc------ggggagtcca
B D                  Hedgehog  gc------ccacaccgag
B D                     Shrew  ct------gaacagcgag
              Star-nosed mole  ct------gggcggccaa
B D                  Elephant  gt------ggggagtcgg
          Cape elephant shrew  gt------gagaagtcag
B D                   Manatee  gt------ggggagtcgg
             Cape golden mole  -g------aaggtgtagg
B D                    Tenrec  tg------taaaagtcag
                     Aardvark  at------agggagtcag
B D                 Armadillo  -a------gggccgtcgg
  D            Painted turtle  -----gagggggacccc-
B D                     Mouse  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
    Mexican tetra (cavefish)  ==================
                 Spotted gar  ==================
B D                Coelacanth  ==================
B D                 Zebrafish  ==================
  D               Rock pigeon  ==================
          Southern platyfish  ==================
B D                    Medaka  ==================
  D              Mallard duck  ==================
B D                 Tetraodon  ==================
      Yellowbelly pufferfish  ==================
B D                      Fugu  ==================
B D                   Chicken  ==================
B D       Medium ground finch  ==================
B D                    Turkey  ==================
B D               Zebra finch  ==================
B D              Atlantic cod  ==================
  D       Collared flycatcher  ==================
B D        American alligator  ==================
          Tibetan ground jay  ==================
B D                   Wallaby  ==================
B D           Tasmanian devil  ==================
  D           Green seaturtle  ==================
B D                       Pig  NNNNNNNNNNNNNNNNNN
B D                    Rabbit  ------------------
B D                   Opossum  ==================
B D                      Pika  ------------------
B D                   Gorilla  ==================

Inserts between block 6 and 7 in window
B D                 Hedgehog 17bp
B D                    Shrew 15bp
             Star-nosed mole 16bp
B D                 Elephant 12bp
         Cape elephant shrew 12bp
B D                  Manatee 12bp
            Cape golden mole 11bp
B D                   Tenrec 12bp
                    Aardvark 12bp
B D                Armadillo 12bp

Alignment block 7 of 441 in window, 27275584 - 27275634, 51 bps 
B D                     Human  cacagg-------g--c-----------------------------------------------------
B D                     Chimp  cacagg-------g--c-----------------------------------------------------
B D                 Orangutan  cacagg-------g--c-----------------------------------------------------
B D                    Gibbon  cacagg-------g--t-----------------------------------------------------
B D                    Rhesus  cacagg-------g--c-----------------------------------------------------
B D       Crab-eating macaque  cacagg-------g--c-----------------------------------------------------
B D                    Baboon  cacagg-------g--c-----------------------------------------------------
B D              Green monkey  cacagg-------g--c-----------------------------------------------------
B D                  Marmoset  cacagg-------g--c-----------------------------------------------------
B D           Squirrel monkey  cacagg-------g--c-----------------------------------------------------
B D                  Bushbaby  cacagg----------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
B D                  Squirrel  cacaga-------g--c-----------------------------------------------------
       Lesser Egyptian jerboa  cacaaa-------g--c-----------------------------------------------------
                 Prairie vole  cacaag-------g--c-----------------------------------------------------
B D           Chinese hamster  cacaaa-------g--c-----------------------------------------------------
               Golden hamster  cacaag-------g--c-----------------------------------------------------
B D                       Rat  cacaag-----atg--c-----------------------------------------------------
B D            Naked mole-rat  cacagt-------a--c-----------------------------------------------------
B D                Guinea pig  gatggg-------g--c-----------------------------------------------------
                   Chinchilla  tactgg-------g--c-----------------------------------------------------
             Brush-tailed rat  tatggg-------g--ctgaggcctcagcctattttattttattttatttatgtctttttgagaaaggga
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
B D                       Pig  cataga-------g--c-----------------------------------------------------
B D                    Alpaca  cacaga-------g--c-----------------------------------------------------
               Bactrian camel  cacaga-------g--c-----------------------------------------------------
B D                   Dolphin  cacaga-------g--c-----------------------------------------------------
                 Killer whale  cacaga-------g--c-----------------------------------------------------
             Tibetan antelope  cacaga-------g--c-----------------------------------------------------
B D                       Cow  cacaga-------g--c-----------------------------------------------------
B D                     Sheep  cacaga-------g--c-----------------------------------------------------
                Domestic goat  cacaga-------g--c-----------------------------------------------------
B D                     Horse  cgcgga-------g--------------------------------------------------------
B D          White rhinoceros  gtcaga-------g--c-----------------------------------------------------
B D                       Cat  cacaga-------g--c-----------------------------------------------------
B D                       Dog  cacgga-------g--c-----------------------------------------------------
B D                   Ferret   cagggagccagagg--c-----------------------------------------------------
B D                     Panda  cccgga-------g--t-----------------------------------------------------
               Pacific walrus  cacgga-------g--t-----------------------------------------------------
                 Weddell seal  cacgga-------g--t-----------------------------------------------------
             Black flying-fox  catagc----------c-----------------------------------------------------
B D                   Megabat  cataac----------c-----------------------------------------------------
                Big brown bat  cacagc----------------------------------------------------------------
         David's myotis (bat)  cccagc----------------------------------------------------------------
B D                  Microbat  cccagc----------------------------------------------------------------
B D                  Hedgehog  cctagc-------g--c-----------------------------------------------------
B D                     Shrew  cgcggg-------g--c-----------------------------------------------------
              Star-nosed mole  cacgga-------g--c-----------------------------------------------------
B D                  Elephant  tacaga-------g--c-----------------------------------------------------
          Cape elephant shrew  tacaca-------g--a-----------------------------------------------------
B D                   Manatee  tacaga-------g--c-----------------------------------------------------
             Cape golden mole  ----------------c-----------------------------------------------------
B D                    Tenrec  tacagc-------gccc-----------------------------------------------------
                     Aardvark  tgcaga-------g--c-----------------------------------------------------
B D                 Armadillo  tacaga-------g--c-----------------------------------------------------
  D            Painted turtle  catggc-------a--g-----------------------------------------------------
B D                     Mouse  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                   Gorilla  ======================================================================

                        Human  --------------------------------------------------------cagaggtg-cc-ct
                        Chimp  --------------------------------------------------------cagaggtg-cc-ct
                    Orangutan  --------------------------------------------------------cagaggtg-cc-ct
                       Gibbon  --------------------------------------------------------cagaggtg-cc-ct
                       Rhesus  --------------------------------------------------------cagaggtg-cc-ct
          Crab-eating macaque  --------------------------------------------------------cagaggtg-cc-ct
                       Baboon  --------------------------------------------------------cagaggtg-cc-ct
                 Green monkey  --------------------------------------------------------cagaggtg-cc-ct
                     Marmoset  --------------------------------------------------------cagaggag-cc-ct
              Squirrel monkey  --------------------------------------------------------cagaggta-cc-ct
                     Bushbaby  ---------------------------------------------------------------c-cc-tc
           Chinese tree shrew  ---------------------------------------------------------------g-cc-ct
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ---------------------------------------------------------tggggac-ct-ca
                 Prairie vole  --------------------------------------------------------caggctgt-cc-ca
              Chinese hamster  --------------------------------------------------------ttggttgt-cc-ca
               Golden hamster  ---------------------------------------------------------tagttgt-cc-ca
                          Rat  --------------------------------------------------------taggttgt-cc-ca
               Naked mole-rat  ----------------------------------------------------------tgaggc-cc-ca
                   Guinea pig  ----------------------------------------------------------tgaggc-cc-ca
                   Chinchilla  ----------------------------------------------------------tgagac-cc-ca
             Brush-tailed rat  ctcaccatgcagttcagtgtggccttgagcacactctataacccaggatggtcgggaatgaggc-cc-ca
                       Rabbit  ----------------------------------------------------------gtgggc-cc-at
                         Pika  ----------------------------------------------------------gggggc-ca-ct
                          Pig  --------------------------------------------------------cagagggg-ac-ct
                       Alpaca  --------------------------------------------------------caga-ggg-ac-ct
               Bactrian camel  --------------------------------------------------------caga-ggg-ac-ct
                      Dolphin  --------------------------------------------------------cagagggg-ac-ct
                 Killer whale  --------------------------------------------------------cagagggg-ac-ct
             Tibetan antelope  --------------------------------------------------------cagagggg-ac-ct
                          Cow  --------------------------------------------------------cagagggg-ac-ct
                        Sheep  --------------------------------------------------------cagagggg-ac-ct
                Domestic goat  --------------------------------------------------------cagagggg-ac-ct
                        Horse  ------------------------------------------------------------gagg-ac-ct
             White rhinoceros  --------------------------------------------------------cagcgggg-ac-ct
                          Cat  --------------------------------------------------------cagagggc--t-ct
                          Dog  --------------------------------------------------------cagaggtc-ac-ct
                      Ferret   --------------------------------------------------------cagagggc-at-gt
                        Panda  --------------------------------------------------------caaagggc-at-ct
               Pacific walrus  --------------------------------------------------------cagagggc-gt-cc
                 Weddell seal  --------------------------------------------------------cagagggc-at-cc
             Black flying-fox  --------------------------------------------------------aggaggga-cc-tg
                      Megabat  --------------------------------------------------------aggaggga-cc-tg
                Big brown bat  ---------------------------------------------------------agaggggacc-cg
         David's myotis (bat)  ---------------------------------------------------------agagggg-cc-tg
                     Microbat  ---------------------------------------------------------agagggg-cc-tg
                     Hedgehog  --------------------------------------------------------ctg------cc-tg
                        Shrew  --------------------------------------------------------cgg------gc-tg
              Star-nosed mole  --------------------------------------------------------cag---------cg
                     Elephant  --------------------------------------------------------cagaggga-ag-ct
          Cape elephant shrew  --------------------------------------------------------ccgaggga-agccc
                      Manatee  --------------------------------------------------------caggggga-ag-ct
             Cape golden mole  --------------------------------------------------------cagaggga-ag-ct
                       Tenrec  --------------------------------------------------------caaaagga-ag-ct
                     Aardvark  --------------------------------------------------------cagaggaa-ag-ct
                    Armadillo  --------------------------------------------------------cggagggg-gc-ct
               Painted turtle  --------------------------------------------------------ctgtgtcc-cg-ct
                        Mouse  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
           Southern platyfish  ======================================================================
                       Medaka  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                  Zebra finch  ======================================================================
                 Atlantic cod  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
                      Gorilla  ======================================================================

                        Human  gcacactc-agag---ctctccc-tttgagctc----------ctt--
                        Chimp  gcacactc-agag---ctctccc-tttgagctc----------ctt--
                    Orangutan  gcacactc-agag---ctctccc-tttgagctc----------ctt--
                       Gibbon  gcacgctc-agag---ctctccc-tttgagctc----------ctt--
                       Rhesus  gcacactc-agag---ctctccc-tttgagctc----------ctt--
          Crab-eating macaque  gcacactc-agag---ctctccc-tttgagctc----------ctt--
                       Baboon  gcacactc-agag---ctctccc-tttgagctc----------ctt--
                 Green monkey  gcacactc-agag---ctctccc-tttgagctc----------ctt--
                     Marmoset  gcacactc-agag---ctctccc-tctgagccc----------ctt--
              Squirrel monkey  gcacgctc-agag---ctctccc-tctgagccc----------ctt--
                     Bushbaby  gagccctc-agagcatcatttct-tctgagctc----------ctt--
           Chinese tree shrew  gagtactc-agag---ctttctg-cttgagctc----------ttt--
                     Squirrel  -------t-ggag---ctcccct-tc----------------------
       Lesser Egyptian jerboa  gc-cgcgt-ggac---ccc-----------------------------
                 Prairie vole  acacaccc-taag---ttcccaa-gtt----tcctggatccaagtt--
              Chinese hamster  acacaccc-agag---ctcccat-ggt----------------gtt--
               Golden hamster  acacaccc-agag---ctcccat-gtt----------------gtt--
                          Rat  gcacaccc-agag---ctatctg-cct----tc----------gtt--
               Naked mole-rat  gtgctcaa-ggag---cgccttc-tccgagctc----------att--
                   Guinea pig  gggcctga-cgag---cgcccct-tctgagctc----------gtt--
                   Chinchilla  gcctatga-tgag---caccccc-tctgagctc----------gtt--
             Brush-tailed rat  gcctatga-tgag---cgcccct-tttgagctt----------gtt--
                       Rabbit  gtgcactc-agcg---caccccc-tcccagctt----------gtc--
                         Pika  gtgca--------------------cccagctc----------ctt--
                          Pig  gggggact-agag---cattcccttccgagctt----------gtc--
                       Alpaca  ggggaact-agag---cattcccttctgagctt----------gtt--
               Bactrian camel  ggggaact-agag---cattcccttctgagctt----------gtt--
                      Dolphin  ggggaacc-agag---cgttccc-tctgagctt----------gtt--
                 Killer whale  ggggaacc-agag---cgttccc-tctgagctt----------gtt--
             Tibetan antelope  gaggaacc-agaa---cacactcttctgagc-t----------gtc--
                          Cow  gaggaacc-agag---cactcccttctgagc-t----------gtt--
                        Sheep  gaggaacc-agaa---cactctcttctgagc-t----------gtc--
                Domestic goat  gaggaacc-agaa---cactctcttctgagc-t----------gtc--
                        Horse  ggggaacc-cgag---cactcccctcggagct----------------
             White rhinoceros  ggggaacc-cgag---cactcccgtcggagctt----------gct--
                          Cat  -gggaacc-agag---cattaccttccgagcct----------gtg--
                          Dog  -gggaacc-agag---tattcccttctgagcat----------gtt--
                      Ferret   -gggaacc-agag---tgttcccttctgagcat----------gta--
                        Panda  -gggaacc-agag---catttccttctgaccat----------gtt--
               Pacific walrus  -gggaacc-agag---cattcccttctgagcat----------gtt--
                 Weddell seal  -gggaacc-agag---cattccctcctgagcat----------gtt--
             Black flying-fox  -gggagcc-agag---cattcgctactgaactt----------gtt--
                      Megabat  -gggagcc-agag---cattcgctactgaactt----------gtt--
                Big brown bat  -gggagcc-aggg---cattcccttccgagctc----------gtt--
         David's myotis (bat)  -gggagcc-ggag---cgctccctgccgagctc----------gtt--
                     Microbat  -gggagcc-ggag---cgctccctgccgagctg----------gtt--
                     Hedgehog  ---------cctg---cctgcctttcagagcct----------gct--
                        Shrew  -gggagca-ccag---cagccccttcggagcct----------gga--
              Star-nosed mole  -gggggga-cgag---ggttcgctcctgagctt----------gtt--
                     Elephant  gggaattt-agag---catccct----gagct------------tt--
          Cape elephant shrew  agaaaagt-agag---catctct-tccgagctt----------gtt--
                      Manatee  gagaatcc-agag---catccct-tctgagcct----------gtt--
             Cape golden mole  ttgaaagt-ggag---ataccct-tctcaattt----------gtc--
                       Tenrec  ggggaatt-agag---cagccct-tctgagctg----------gtt--
                     Aardvark  gggaaatc-agag---catctct-tctgagcat----------gtt--
                    Armadillo  ggggaattcggag---c-------ccagagcct----------gtg--
               Painted turtle  gcttgcct-ggat---tgccat--gatgagata----------gccct
                        Mouse  ================================================
             Peregrine falcon  ================================================
                 Saker falcon  ================================================
     Mexican tetra (cavefish)  ================================================
                  Spotted gar  ================================================
                   Coelacanth  ================================================
                    Zebrafish  ================================================
                  Rock pigeon  ================================================
           Southern platyfish  ================================================
                       Medaka  ================================================
                 Mallard duck  ================================================
                    Tetraodon  ================================================
       Yellowbelly pufferfish  ================================================
                         Fugu  ================================================
                      Chicken  ================================================
          Medium ground finch  ================================================
                       Turkey  ================================================
                  Zebra finch  ================================================
                 Atlantic cod  ================================================
          Collared flycatcher  ================================================
           American alligator  ================================================
           Tibetan ground jay  ================================================
                      Wallaby  ================================================
              Tasmanian devil  ================================================
              Green seaturtle  ================================================
                      Opossum  ================================================
                      Gorilla  ================================================

Inserts between block 7 and 8 in window
B D                 Squirrel 2bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                      Rat 205bp

Alignment block 8 of 441 in window, 27275635 - 27275656, 22 bps 
B D                     Human  ---------------gccttgctcggttctcctggg-----------c
B D                     Chimp  ---------------gccttgctcggttctcctggg-----------c
B D                 Orangutan  ---------------gccttgcttggttctcctggg-----------c
B D                    Gibbon  ---------------gccttgcttggttctcctggg-----------c
B D                    Rhesus  ---------------gccttgcttggttctcctggg-----------c
B D       Crab-eating macaque  ---------------gccttgcttggttctcctggg-----------c
B D                    Baboon  ---------------gccttgcttagttctcctggg-----------c
B D              Green monkey  ---------------gccttgcttggttctcctggg-----------c
B D                  Marmoset  ---------------gccttgcttggttctcctggg-----------c
B D           Squirrel monkey  ---------------gccttgcttggttgtcctggg-----------c
B D                  Bushbaby  ---------------gcctgg----gtgttcctgtg-----------c
           Chinese tree shrew  ---------------gctgt-----ggtgttctggg------------
B D                  Squirrel  ----------------cttgg----ttttccctg----ccgaaggtct
       Lesser Egyptian jerboa  ----------------acttg----gttctcccagg-----------c
                 Prairie vole  ----------------cctgg----atcctcctggggcccaagggcct
B D           Chinese hamster  ---------------ccctgg----ctcctcctggggcctccgggcct
               Golden hamster  ----------------cctgg----ctcctcctgaggcctacgggctt
B D            Naked mole-rat  ---------------gccctg----gtcctctgg--------------
B D                Guinea pig  ---------------accctg----gtcctccagg---ccaccggcct
                   Chinchilla  ---------------gccctg----gtcctccagg---ccaccggcct
             Brush-tailed rat  ---------------gccctg----gtttttcagg---ccacctgcct
B D                    Rabbit  ---------------gccttg----gctcgcc---------------t
B D                      Pika  ---------------gccttg----gttctcc---------------t
B D                       Pig  ---------------gcctct----gttctcccagg-----------c
B D                    Alpaca  ---------------ggcttg----attctccgagg-----------t
               Bactrian camel  ---------------ggcttg----attctcccagg-----------t
B D                   Dolphin  ---------------gccttg----gttctcccaag-----------c
                 Killer whale  ---------------gccttg----gttctcccaag-----------c
             Tibetan antelope  ---------------gccttg----gttctcccaga-----------c
B D                       Cow  ---------------gccttg----gttctcccaga-----------c
B D                     Sheep  ---------------gccttg----gttctcccaga-----------c
                Domestic goat  ---------------accttg----gttctcccaga-----------c
B D                     Horse  ------------------ttg----gttctccgtga-----------c
B D          White rhinoceros  ---------------gccttg----gttctcctggg-----------c
B D                       Cat  ---------------gccttg----gc---------------------
B D                       Dog  ---------------gccttg----gccctcatggg-----------c
B D                   Ferret   ---------------gccttg----gctctcacggg-----------c
B D                     Panda  ---------------gcctcg----gctctcatggg-----------c
               Pacific walrus  ---------------gtcttg----gctcttatggg-----------c
                 Weddell seal  ---------------gtcttg----gctcttacggg-----------c
             Black flying-fox  ---------------gccttg----gttctagtgcg-----------c
B D                   Megabat  ---------------gccttg----gttctagtggg-----------c
                Big brown bat  ---------------gccttg----gttctcctggg-----------c
         David's myotis (bat)  ---------------gccctg----gttctcctggg-----------c
B D                  Microbat  ---------------gccctg----gttctcctggg-----------c
B D                  Hedgehog  ---------------gccttg----gctctcccagg-----------c
B D                     Shrew  ---------------cccggg----gttgtcccgag-----------t
              Star-nosed mole  ---------------gcctcg----gttctcccggg-----------t
B D                  Elephant  ---------------gccttt----gttctcctagg-----------c
          Cape elephant shrew  ---------------gccttg----gtcccccaggt-----------c
B D                   Manatee  ---------------gccttg----gttctcctggg-----------c
             Cape golden mole  ---------------gccttg----gttctcctggg-----------c
B D                    Tenrec  ---------------accttg----gttctcttggg-----------c
                     Aardvark  ---------------gccttg----gttttcctggg-----------c
B D                 Armadillo  ---------------gccttg----gctctccgggc-----------c
  D            Painted turtle  gcagtgggtgacaggaccctg----gcc--------------------
B D                       Rat  ================================================
B D                     Mouse  ================================================
  D          Peregrine falcon  ================================================
  D              Saker falcon  ================================================
    Mexican tetra (cavefish)  ================================================
                 Spotted gar  ================================================
B D                Coelacanth  ================================================
B D                 Zebrafish  ================================================
  D               Rock pigeon  ================================================
          Southern platyfish  ================================================
B D                    Medaka  ================================================
  D              Mallard duck  ================================================
B D                 Tetraodon  ================================================
      Yellowbelly pufferfish  ================================================
B D                      Fugu  ================================================
B D                   Chicken  ================================================
B D       Medium ground finch  ================================================
B D                    Turkey  ================================================
B D               Zebra finch  ================================================
B D              Atlantic cod  ================================================
  D       Collared flycatcher  ================================================
B D        American alligator  ================================================
          Tibetan ground jay  ================================================
B D                   Wallaby  ================================================
B D           Tasmanian devil  ================================================
  D           Green seaturtle  ================================================
B D                   Opossum  ================================================
B D                   Gorilla  ================================================

Inserts between block 8 and 9 in window
B D                  Dolphin 10bp
B D                 Hedgehog 1bp
             Star-nosed mole 1bp

Alignment block 9 of 441 in window, 27275657 - 27275658, 2 bps 
B D                     Human  cg-
B D                     Chimp  cg-
B D                 Orangutan  cg-
B D                    Gibbon  cg-
B D                    Rhesus  cg-
B D       Crab-eating macaque  cg-
B D                    Baboon  cg-
B D              Green monkey  cg-
B D                  Marmoset  cg-
B D           Squirrel monkey  cg-
B D                  Bushbaby  cg-
           Chinese tree shrew  -a-
B D                  Squirrel  cc-
       Lesser Egyptian jerboa  cg-
                 Prairie vole  cc-
B D           Chinese hamster  cc-
               Golden hamster  cc-
B D                Guinea pig  cg-
                   Chinchilla  cc-
             Brush-tailed rat  gc-
B D                    Rabbit  ct-
B D                      Pika  cc-
B D                       Pig  cn-
B D                    Alpaca  ca-
               Bactrian camel  ca-
                 Killer whale  cg-
             Tibetan antelope  ca-
B D                       Cow  ca-
B D                     Sheep  ca-
                Domestic goat  ca-
B D                     Horse  cg-
B D          White rhinoceros  ta-
B D                       Dog  ca-
B D                   Ferret   ca-
B D                     Panda  ca-
               Pacific walrus  ca-
                 Weddell seal  ca-
             Black flying-fox  ca-
B D                   Megabat  ca-
                Big brown bat  ca-
         David's myotis (bat)  ca-
B D                  Microbat  ca-
B D                  Hedgehog  g--
B D                     Shrew  c--
              Star-nosed mole  c--
B D                  Elephant  cg-
          Cape elephant shrew  ct-
B D                   Manatee  cg-
             Cape golden mole  cg-
B D                    Tenrec  gg-
                     Aardvark  ca-
B D                 Armadillo  ct-
  D            Painted turtle  -ag
B D                       Rat  ===
B D                     Mouse  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
          Southern platyfish  ===
B D                    Medaka  ===
  D              Mallard duck  ===
B D                 Tetraodon  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D               Zebra finch  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D            Naked mole-rat  ---
B D                   Wallaby  ===
B D           Tasmanian devil  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                       Cat  ---
B D                   Dolphin  ===
B D                   Gorilla  ===

Inserts between block 9 and 10 in window
B D                 Bushbaby 18bp
B D                      Pig 99bp
B D                   Alpaca 8bp
              Bactrian camel 8bp
                Killer whale 8bp
            Tibetan antelope 8bp
B D                      Cow 8bp
B D                    Sheep 8bp
               Domestic goat 8bp
B D                    Horse 8bp
B D         White rhinoceros 7bp
B D                      Dog 8bp
B D                  Ferret  8bp
B D                    Panda 8bp
              Pacific walrus 8bp
                Weddell seal 8bp
            Black flying-fox 8bp
B D                  Megabat 8bp
               Big brown bat 8bp
        David's myotis (bat) 8bp
B D                 Microbat 8bp

Alignment block 10 of 441 in window, 27275659 - 27275708, 50 bps 
B D                     Human  --caggcgt--------cta---------ccct-gctc-------tct-ggggttccgctgcctt--t-t
B D                     Chimp  --caggcgt--------cta---------ccct-gctc-------tct-ggggttctgctgcctt--t-t
B D                 Orangutan  --caggcct--------cta---------ccct-gctc-------tct-ggggttctgctgccag--t-t
B D                    Gibbon  --caggcct--------cta---------ccct-gctc-------tct-ggggttctgctgcctg--t-t
B D                    Rhesus  --caggcct--------cta---------ccct-gcgc-------tct-ggggttctgctgcctg--t-t
B D       Crab-eating macaque  --caggcct--------cta---------ccct-gcgc-------tct-ggggttctgctgcctg--t-t
B D                    Baboon  --caggcct--------cta---------ccct-gcgc-------tct-ggggttctgctgcctg--t-t
B D              Green monkey  --caggcct--------cta---------ccct-gcgc-------tct-ggggttctgctgcctg--t-t
B D                  Marmoset  --caggcct--------cta---------ccct-gctc-------tct-gggggtctgctgcctg--t-t
B D           Squirrel monkey  --caggcct--------ctg---------ctgt-gctc-------tct-gggggtctgctgcctg--t-t
B D                  Bushbaby  --caggcct--------cta---------tcct-actc-------tct-gttgtcctgctcactg--c-t
           Chinese tree shrew  --aaggctttccaaatcctc---------accg-gccc-------tct-ggggtcctggcccctg--tgc
B D                  Squirrel  --ccggcct--------ccg---------ccct-gctc-------tct-ttggtcctg-tccctggct-c
       Lesser Egyptian jerboa  --caggcct--------ccc---------cttc-gtcc-------t----gggtgctg-ctcccggac-c
                 Prairie vole  --caagcct--------ctg---------cccc-accc-------tgt-tgggtcctg--ttctggat-c
B D           Chinese hamster  --caggcct-------ccca---------cctc-actc-------tct-tggg-----------------
               Golden hamster  --taggcct--------ccg---------cctc-actc-------tct----------------------
B D            Naked mole-rat  -------------------------------tt-gtgc-------tct-cggatc------cctgggc-c
B D                Guinea pig  --caggcct--------ctg---------ctgg-gtgc-------tct-cgggtcaa---tcatggtc-t
                   Chinchilla  --caggtgt--------gtg---------cctg-gtgc-------ttt-cagatc------cctgggt-c
             Brush-tailed rat  --caggcgt--------ctg---------cctg-gtgc-------act-tggatc------cctgggc-t
B D                    Rabbit  --gggcacc--------ccg---------ctct-------------------------------gggg-c
B D                      Pika  --agggcct--------ccc---------ctcc-atcc-------ttg-gggaga-----gggagggt-c
B D                       Pig  --caagc-t--------ctc---------cctg-actc-------tct-ggagtccagcgcccggc-t-t
B D                    Alpaca  --caagc-t--------ctc---------ccca-actc-------tct-ggggtcc-actcgcagt-t-c
               Bactrian camel  --caagc-t--------ctc---------ccca-actc-------tct-ggggtcc-actcccagt-t-c
B D                   Dolphin  --caagc-g--------ctc---------ccccggccc-------tct-ggggtcctgctcgctgc-t-a
                 Killer whale  --caggc-g--------ctc---------ccccggccc-------tct-ggggtcctgctcgctgc-t-a
             Tibetan antelope  --caggc-t--------ctc---------tccc-actc-------cct---------gctccctgc-t-g
B D                       Cow  --caggc-t--------gtc---------tccc-actc-------cct-ggggtgcggctccctgc-t-c
B D                     Sheep  --caggc-t--------ctc---------tccc-actc--------------------------------
                Domestic goat  --caggc-t--------ctc---------tccc-actc-------cct-ggggtcctgctccctgc-t-g
B D                     Horse  --cgagc-t--------ctc---------tccc-ac---------tct-ggggttctgctcccttt-t-c
B D          White rhinoceros  --tgagc-t--------ctc---------tccc-ac---------tcg-gaggttctgctccctgt-t-t
B D                       Cat  --------t--------gcc---------tccc-accc-------tct-ggggccctgctccctgg-t-c
B D                       Dog  --caagc-t--------gtc---------tccc-actg-------ccc-ggggtcctgctccccgg-t-c
B D                   Ferret   --caagg-t--------ctc---------tcct-cctg-------tct-ggggtcctgctccctgg-t-c
B D                     Panda  --caagg-t--------ctc---------tctt-gctg-------tct-ggggacctgctgcgtgg-t-c
               Pacific walrus  --caagg-t--------ctc---------tccc-actg-------tcc-ggggtcctgctctctgg-t-c
                 Weddell seal  --caagg-t--------ctc---------tccc-actg-------tct-ggggtcctgctctctgg-t-c
             Black flying-fox  --caagc-t--------ctc----------cct-gctc-------tct-ggggtcttgctccctgt-t-g
B D                   Megabat  --caagc-t--------ctc----------cct-gctc-------tct-ggggtcttgctccctgt-t-g
                Big brown bat  --caggc-t--------ctc----------ccc-attc-------tcc-gg-------------------
         David's myotis (bat)  --caggc-t--------ctc----------ccc-a-tc-------tcc-gg-gtctcactccctgg-c-c
B D                  Microbat  --caggc-t--------ctc----------ccc-attc-------ccc-gg-gccttactccctgt-c-c
B D                  Hedgehog  --caggc-c--------tc----------ctgc-gctc-------tcc-------gcgtcccttgt-c-c
B D                     Shrew  --caggc-c--------tcccaaacgctgctgt-agtc-------ccc--gggttctgctcccagt-t-c
              Star-nosed mole  --caggc-c--------tcccagtctctccccc-actc-------tcttggggcaatgctccctgt-t-c
B D                  Elephant  --cgggccc--------ccc--aagccactccc-caac-------tct-ggggtcctgcttctcgg-t-g
          Cape elephant shrew  --caagcct--------ccc--agttcactccc-ccgcccactgttct-ggggccatgctgcctgg-tgg
B D                   Manatee  --caggcct--------ccc--aagacactccc-ccac-------tct-ggggtcctgctccctgg-t-g
             Cape golden mole  --cagaccg--------ccc--aagc---------cac-------tct-ggggtcctgctccctgg-t-g
B D                    Tenrec  --caggctt--------tcc--aagccactcct-gcac-------tct-ggggtatggctcgtagg-c-c
                     Aardvark  --caagtct--------ccc--aagccactcct-ccaa-------tct-ggggttctgctccctgg-t-g
B D                 Armadillo  --caggctt--------ccc--aag----tccc-cacc-------gcg-ggcgtccgacgcccagt-t-c
  D            Painted turtle  cacatgccc--------ccc------cggctgc-tcac-------tct-ggggagctg-gaatagc-t-g
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
          Southern platyfish  ======================================================================
B D                    Medaka  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D               Zebra finch  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                   Gorilla  ======================================================================

                        Human  ccttgccaggt-------
                        Chimp  ccttgccaggt-------
                    Orangutan  ccttgccaggt-------
                       Gibbon  ccttgccaggt-------
                       Rhesus  ccttgccaggt-------
          Crab-eating macaque  ccttgccaggt-------
                       Baboon  ccttgccaggt-------
                 Green monkey  ccttgccaggt-------
                     Marmoset  cctcgccaggt-------
              Squirrel monkey  cctcgccaggt-------
                     Bushbaby  tcctccttggg-------
           Chinese tree shrew  cctcgctgggt-------
                     Squirrel  cctcagtcggc-------
       Lesser Egyptian jerboa  ccgcggcaggc-------
                 Prairie vole  cctccgagttt-------
              Chinese hamster  ------------------
               Golden hamster  ------------------
               Naked mole-rat  gccccccatcc-------
                   Guinea pig  ttggtcccagg-------
                   Chinchilla  gcc--caagcc-------
             Brush-tailed rat  gccttcaaacc-------
                       Rabbit  cttgtccctgc-------
                         Pika  cctgtctccgt-------
                          Pig  cctctctgctc-------
                       Alpaca  cctctttggtc-------
               Bactrian camel  cctctttggtc-------
                      Dolphin  cctctctggtc-------
                 Killer whale  cctctctggtc-------
             Tibetan antelope  cctctctggtc-------
                          Cow  cctctctggtc-------
                        Sheep  ------------------
                Domestic goat  cctctctggtc-------
                        Horse  cctcgctggtc-------
             White rhinoceros  cctcgctcgtc-------
                          Cat  cctgtctggtc-------
                          Dog  tcaggccggtcgg-----
                      Ferret   tctggccggtc-------
                        Panda  cctggccggtc-------
               Pacific walrus  cctggccagta-------
                 Weddell seal  cctggccggtc-------
             Black flying-fox  ccctgctggtt-------
                      Megabat  ccctgctggtt-------
                Big brown bat  ------------------
         David's myotis (bat)  ccttgctggtcgctggcc
                     Microbat  ccttgctggtcgctggcc
                     Hedgehog  ccttgtgggtc-------
                        Shrew  cctctctggg--------
              Star-nosed mole  cctggctggtc-------
                     Elephant  ccgcgtcttcc-------
          Cape elephant shrew  ctgcccctgcc-------
                      Manatee  ctgcgtctgca-------
             Cape golden mole  ccatgtttccc-------
                       Tenrec  cgggacttctt-------
                     Aardvark  ccaggtcacca-------
                    Armadillo  cctcgccggtc-------
               Painted turtle  gcgtgccaggc-------
                          Rat  ==================
                        Mouse  ==================
             Peregrine falcon  ==================
                 Saker falcon  ==================
     Mexican tetra (cavefish)  ==================
                  Spotted gar  ==================
                   Coelacanth  ==================
                    Zebrafish  ==================
                  Rock pigeon  ==================
           Southern platyfish  ==================
                       Medaka  ==================
                 Mallard duck  ==================
                    Tetraodon  ==================
       Yellowbelly pufferfish  ==================
                         Fugu  ==================
                      Chicken  ==================
          Medium ground finch  ==================
                       Turkey  ==================
                  Zebra finch  ==================
                 Atlantic cod  ==================
          Collared flycatcher  ==================
           American alligator  ==================
           Tibetan ground jay  ==================
                      Wallaby  ==================
              Tasmanian devil  ==================
              Green seaturtle  ==================
                      Opossum  ==================
                      Gorilla  ==================

Inserts between block 10 and 11 in window
               Big brown bat 1bp

Alignment block 11 of 441 in window, 27275709 - 27275719, 11 bps 
B D                     Human  -ctttcccac----ag
B D                     Chimp  -ctttcccac----ag
B D                 Orangutan  -ctttcccac----ag
B D                    Gibbon  -ctttcccac----ag
B D                    Rhesus  -ctttcccac----ag
B D       Crab-eating macaque  -ctttcccac----ag
B D                    Baboon  -ctttcccac----ag
B D              Green monkey  -ctttcccat----ag
B D                  Marmoset  -ttttcccgc----ag
B D           Squirrel monkey  -ctttccccc----ag
B D                  Bushbaby  -cctccccgcaactag
           Chinese tree shrew  -accgcccac----ag
B D                  Squirrel  -ctcccccgc----ag
       Lesser Egyptian jerboa  -ctcccgcac----ag
                 Prairie vole  -gtcccctgc----ag
B D            Naked mole-rat  -ctaccccgc----ag
B D                Guinea pig  -ccaccccgc----ag
                   Chinchilla  -ccaccccgc----ag
             Brush-tailed rat  -cctccccgc----ag
B D                    Rabbit  -ctccccggc----ag
B D                      Pika  -ttccccagc----ag
B D                       Pig  -ggcccca-c----gg
B D                    Alpaca  -tgcccca-c----ag
               Bactrian camel  -tccccca-c----ag
B D                   Dolphin  -tgcccca--------
                 Killer whale  -tgcccca--------
             Tibetan antelope  -agacccaac----ag
B D                       Cow  -agccccaac----ag
                Domestic goat  -agacccaac----ag
B D                     Horse  -gg-ccccac----gg
B D          White rhinoceros  -gg-ccccac----ag
B D                       Cat  -ggcccccgc----ag
B D                       Dog  -ggcccccac----ag
B D                   Ferret   -ggcccccac----ag
B D                     Panda  -ggcccccaa----ag
               Pacific walrus  -ggcccccac----ag
                 Weddell seal  -ggcccccaa----ag
             Black flying-fox  -ggtccccac----ag
B D                   Megabat  -ggtccccac----ag
         David's myotis (bat)  -gggccctac----ag
B D                  Microbat  -gggccctac----ag
B D                  Hedgehog  -cgccaccac----tg
B D                     Shrew  --------------cc
              Star-nosed mole  -agccccccc----cc
B D                  Elephant  -ca-ctgctc----ag
          Cape elephant shrew  -cacccgcac----tg
B D                   Manatee  -ca-ccgcac----ag
             Cape golden mole  -tactcgcac----ag
                     Aardvark  -c--ccacac----ag
B D                 Armadillo  -cgccccgac----ag
  D            Painted turtle  -cctgcgccc----ag
B D               Stickleback  ctgtacccaa----g-
              Golden hamster  ----------------
B D                       Rat  ================
B D                     Mouse  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
    Mexican tetra (cavefish)  ================
                 Spotted gar  ================
B D                Coelacanth  ================
B D                 Zebrafish  ================
  D               Rock pigeon  ================
          Southern platyfish  ================
B D                    Medaka  ================
  D              Mallard duck  ================
B D                 Tetraodon  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D                   Chicken  ================
B D       Medium ground finch  ================
B D                    Turkey  ================
B D               Zebra finch  ================
B D              Atlantic cod  ================
  D       Collared flycatcher  ================
B D        American alligator  ================
          Tibetan ground jay  ================
B D           Chinese hamster  ----------------
B D                     Sheep  ----------------
B D                   Wallaby  ================
B D           Tasmanian devil  ================
  D           Green seaturtle  ================
               Big brown bat  ================
B D                   Opossum  ================
B D                    Tenrec  ----------------
B D                   Gorilla  ================

Inserts between block 11 and 12 in window
B D                 Hedgehog 92bp
B D                    Shrew 6bp
             Star-nosed mole 6bp

Alignment block 12 of 441 in window, 27275720 - 27275720, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D            Naked mole-rat  g
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
             Tibetan antelope  c
B D                       Cow  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  t
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
  D            Painted turtle  c
B D               Stickleback  c
             Star-nosed mole  =
              Golden hamster  -
B D                  Hedgehog  =
B D                       Rat  =
B D                     Shrew  =
B D                     Mouse  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
B D                Coelacanth  =
B D                 Zebrafish  =
  D               Rock pigeon  =
          Southern platyfish  =
B D                    Medaka  =
  D              Mallard duck  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
B D               Zebra finch  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
B D           Chinese hamster  -
B D                     Sheep  -
B D                   Wallaby  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
               Big brown bat  =
B D                    Tenrec  -
                Killer whale  -
B D                   Dolphin  -
B D                   Gorilla  =

Inserts between block 12 and 13 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
            Tibetan antelope 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 13 of 441 in window, 27275721 - 27275726, 6 bps 
B D                     Human  aacgcc
B D                     Chimp  aacgcc
B D                 Orangutan  aacgcc
B D                    Gibbon  aacgcc
B D                    Rhesus  aacgcc
B D       Crab-eating macaque  aacgcc
B D                    Baboon  aacgcc
B D              Green monkey  aacgcc
B D                  Marmoset  aacccc
B D           Squirrel monkey  aacgcc
B D                  Bushbaby  aaaccc
           Chinese tree shrew  agcccc
B D                  Squirrel  aacccc
       Lesser Egyptian jerboa  aagcct
                 Prairie vole  agctcc
B D            Naked mole-rat  atcccc
B D                Guinea pig  atcccc
                   Chinchilla  attccc
             Brush-tailed rat  attccc
B D                    Rabbit  ccc---
B D                      Pika  gcctcc
B D                       Pig  --cccc
B D                    Alpaca  --cccg
               Bactrian camel  --cccc
             Tibetan antelope  --cccg
B D                       Cow  --tccg
B D                     Sheep  --cctg
                Domestic goat  --cccg
B D                     Horse  -gcctc
B D          White rhinoceros  -ccccc
B D                       Cat  -actcc
B D                       Dog  -acccc
B D                   Ferret   -acccc
B D                     Panda  -acccc
               Pacific walrus  -atccc
                 Weddell seal  -atccc
             Black flying-fox  -acccc
B D                   Megabat  -acccc
         David's myotis (bat)  -acccc
B D                  Microbat  -acccc
B D                     Shrew  -cactc
              Star-nosed mole  -taccc
B D                  Elephant  agcccc
          Cape elephant shrew  aacctc
B D                   Manatee  agccct
             Cape golden mole  aacaca
                     Aardvark  catccc
B D                 Armadillo  agcccc
B D                   Opossum  agcttc
  D            Painted turtle  --tccc
B D               Stickleback  aacttg
              Golden hamster  ------
B D                  Hedgehog  ======
B D                       Rat  ======
B D                     Mouse  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
    Mexican tetra (cavefish)  ======
                 Spotted gar  ======
B D                Coelacanth  ======
B D                 Zebrafish  ======
  D               Rock pigeon  ======
          Southern platyfish  ======
B D                    Medaka  ======
  D              Mallard duck  ======
B D                 Tetraodon  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
B D                    Turkey  ======
B D               Zebra finch  ======
B D              Atlantic cod  ======
  D       Collared flycatcher  ======
B D        American alligator  ======
          Tibetan ground jay  ======
B D           Chinese hamster  ------
B D                   Wallaby  ======
B D           Tasmanian devil  ======
  D           Green seaturtle  ======
               Big brown bat  ======
B D                    Tenrec  ------
                Killer whale  ------
B D                   Dolphin  ------
B D                   Gorilla  ======

Inserts between block 13 and 14 in window
B D                     Pika 60bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 14 of 441 in window, 27275727 - 27275763, 37 bps 
B D                     Human  tt-ttctc---------------ttccttctccagcct-ctgagtcctcttcct
B D                     Chimp  tt-ttctc---------------ttccttctccagcct-ctgagtcctcttcct
B D                 Orangutan  tt-ttctc---------------ttccttctccagcct-ctgagtcctcttcct
B D                    Gibbon  tt-ttctc-----------------ccttctccagcct-ctgagtcctctttct
B D                    Rhesus  tt-ttctc---------------ttccttctcgagccc-ctgagtcctcctcct
B D       Crab-eating macaque  tt-ttctc---------------ttccttctcgagccc-ctgagtcctcctcct
B D                    Baboon  tt-ttctc---------------ttccttctcgagccc-ctgagtcctcctcct
B D              Green monkey  tt-ttctc---------------ttccttctcgagccc-ctgagtcctcctcct
B D                  Marmoset  tt-tcctc---------------ttccttctccagc---ctgagtcctcctcct
B D           Squirrel monkey  -t-tcctc---------------ttccttctccagc---ctgagtcctcctcct
B D                  Bushbaby  ct-tcccc---------------ttcattcttcagccc-gtgagtcgtcctttt
           Chinese tree shrew  tt-tccac---------------tcctccc--------------tccccccccc
B D                  Squirrel  tt-tcgga---------------tcccctctctagccc-ctgaggcatccttct
       Lesser Egyptian jerboa  tg-tctgc---------------tcgcttgtccagcct-cccagtcatcctcct
                 Prairie vole  tg-tatgc---------------ttcac--tccgtcca-gaaagccatcctgct
B D           Chinese hamster  ------------------------------------------acctgtcgtg--
               Golden hamster  --------------------------------------------------gg--
B D            Naked mole-rat  tt-cccct----------------------ttcagggc-ccagggcagcttc-t
B D                Guinea pig  tc-ccca-----------------------ttcagtgc-ctacgtcagc-----
                   Chinchilla  tc-cccac----------------------ttcagtgc-ctga-tcagcctc-t
             Brush-tailed rat  tc-cccgc----------------------ttcagtgc-ctgagtcagcctc-t
B D                    Rabbit  -------------------------------------c-cacgcccaacccc--
B D                       Pig  tt-ttcac---------------ttcctccttcatcct-ccgaggcatccctcg
B D                    Alpaca  tt-tccac---------------ttcctcctttatccc-ttgtctcatccctct
               Bactrian camel  tt-tccac---------------ttcctcctttatccc-ttgtctcatccctct
B D                   Dolphin  -----cag---------------ctcctcctttatccc-ttgattcacccctct
                 Killer whale  -----cag---------------ctcctcctttatccc-ttgattcacccctct
             Tibetan antelope  tt-ttcac---------------ttcttccttcatccc-ttgagtctgctccct
B D                       Cow  tt-ttcac---------------ttcttccgtcatcct--tgagtcatctccct
B D                     Sheep  gt-cctgc---------------tccctgctgcctctc----------------
                Domestic goat  tt-ttcac---------------ttcttccttcatccc-ttgagtcttctccct
B D                     Horse  -tccccgc---------------ttccttcttcatctc-ttgagtcatccctct
B D          White rhinoceros  -ttttcgc---------------ttccttcttcgtctc-ttgagtcatccctct
B D                       Cat  -t-ttcgc---------------tt-ggtcttcatccc-tggaatcacccctgt
B D                       Dog  -t-ttcgc---------------tttggtcctcatccc-ttgaatcatcaccgt
B D                   Ferret   -t-ttcgc---------------ttccgtcttcatccc-ttga----------t
B D                     Panda  -t-ttcgc---------------tttggtcgtcattcc-ttga----------t
               Pacific walrus  -t-ttcgc---------------ttcggttttcatccctttga----------t
                 Weddell seal  -t-ttcgc---------------ttcggttttcatccc-ttga----------t
             Black flying-fox  tt-tttgc---------------ttccttcttcatcct-tc------------t
B D                   Megabat  tt-ttcgc---------------ttccttcttcatcct-tc------------t
                Big brown bat  gt-cttac----------------------------------------------
         David's myotis (bat)  gc-cctacagctgccccctttcacccccgcttcagccc-tc------------g
B D                  Microbat  gc-cctacagctgccccctttcactcccgcttcagccc-tc------------g
B D                     Shrew  tg-tttcc---------------ttcctttctcatccc-ccgcgc--tcctcct
              Star-nosed mole  tt-ttcac---------------cggcttcttcatctc-ttgcatcatcccccc
B D                  Elephant  tt-tccac---------------ttccttcttcagccc-aggactcat------
          Cape elephant shrew  ca-tcctc---------------tcccttcttcggccc-tggagccgt------
B D                   Manatee  tt-tccac---------------ttccttcttaagccc-aggagtcatccatct
             Cape golden mole  -t-tccac---------------ttccttcttcagcca-ggatatcatccctct
B D                    Tenrec  -t-tccac---------------ttcctg-ttcagccc-ggaagtcatccctca
                     Aardvark  tt-tccac---------------ttccttcttcagtct-gggagtcatctct--
B D                 Armadillo  tt-tctgc---------------tcccttcttgggccc-ttgagccatccgcct
B D                   Opossum  tc-tttcc---------------cttctctttcagcct-gtcactcttcttcct
  D            Painted turtle  tg-tgtcc---------------tcaccagtcctgccc-cacagcatgttgact
B D               Stickleback  tt-gtaga---------------ttagtttaccaacct-ctttgtcctcttgtc
B D                  Hedgehog  ======================================================
B D                       Rat  ======================================================
B D                     Mouse  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
    Mexican tetra (cavefish)  ======================================================
                 Spotted gar  ======================================================
B D                Coelacanth  ======================================================
B D                 Zebrafish  ======================================================
  D               Rock pigeon  ======================================================
          Southern platyfish  ======================================================
B D                    Medaka  ======================================================
  D              Mallard duck  ======================================================
B D                 Tetraodon  ======================================================
      Yellowbelly pufferfish  ======================================================
B D                      Fugu  ======================================================
B D                   Chicken  ======================================================
B D       Medium ground finch  ======================================================
B D                    Turkey  ======================================================
B D               Zebra finch  ======================================================
B D              Atlantic cod  ======================================================
  D       Collared flycatcher  ======================================================
B D        American alligator  ======================================================
          Tibetan ground jay  ======================================================
B D                   Wallaby  ======================================================
B D           Tasmanian devil  ======================================================
  D           Green seaturtle  ======================================================
B D                      Pika  ======================================================
B D                   Gorilla  ======================================================

Inserts between block 14 and 15 in window
B D                    Sheep 217bp
B D                    Shrew 1013bp
             Star-nosed mole 1bp

Alignment block 15 of 441 in window, 27275764 - 27275775, 12 bps 
B D                     Human  cctctcc--ccact
B D                     Chimp  cctctcc--ccact
B D                 Orangutan  cctctcc--ccact
B D                    Gibbon  cctctcc--ccact
B D                    Rhesus  cctctcc--ccagt
B D       Crab-eating macaque  cctctcc--ccagt
B D                    Baboon  cctctcc--ccagt
B D              Green monkey  cctctcc--ccagt
B D                  Marmoset  cctctcc--ccact
B D           Squirrel monkey  cctccgc--ccact
B D                  Bushbaby  gttctcc--ccact
           Chinese tree shrew  ccgcccc--ccgct
B D                  Squirrel  gctctgt--cccct
       Lesser Egyptian jerboa  cctgttc--catcc
                 Prairie vole  c---tta--ccact
B D            Naked mole-rat  gctgtcc--cagct
                   Chinchilla  gccatcc--cagct
             Brush-tailed rat  gctgtcc--cagct
B D                    Rabbit  ---------tgtct
B D                       Pig  gttct---------
B D                    Alpaca  gttctcccc-----
               Bactrian camel  gttctcccc-----
B D                   Dolphin  gttctcc-------
                 Killer whale  gttctcc-------
             Tibetan antelope  gttctcc-------
B D                       Cow  gttctcc-------
                Domestic goat  gttctcc-------
B D                     Horse  gttctcc--ccact
B D          White rhinoceros  gttctgc--ccact
B D                       Cat  gttctcc--ccgct
B D                       Dog  gttctcc--ccgct
B D                   Ferret   gttctcc--ccgct
B D                     Panda  gttctcc--tcgct
               Pacific walrus  gctctcc--ccgcg
                 Weddell seal  gctctcc--ccgct
             Black flying-fox  gttaacc--ctact
B D                   Megabat  gttaacc--ccact
                Big brown bat  ---------tcgct
         David's myotis (bat)  gtttgtt--tcgct
B D                  Microbat  gtttgtt--tcgct
              Star-nosed mole  ggcctcc--ccaag
          Cape elephant shrew  -----gc--ccact
B D                   Manatee  cttctcc--ccact
             Cape golden mole  gttctct--ccact
B D                    Tenrec  gctcttc--cggct
B D                 Armadillo  gttccct--ccgct
B D                   Opossum  -gcctcc--tccct
  D            Painted turtle  -tacacc--cccc-
B D               Stickleback  tttcttc--ctacc
              Golden hamster  --------------
B D                  Hedgehog  ==============
B D                       Rat  ==============
B D                     Shrew  ==============
B D                     Mouse  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
    Mexican tetra (cavefish)  ==============
                 Spotted gar  ==============
B D                Coelacanth  ==============
B D                 Zebrafish  ==============
  D               Rock pigeon  ==============
          Southern platyfish  ==============
B D                    Medaka  ==============
  D              Mallard duck  ==============
B D                 Tetraodon  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                    Turkey  ==============
B D               Zebra finch  ==============
B D              Atlantic cod  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
B D                Guinea pig  --------------
B D           Chinese hamster  --------------
B D                     Sheep  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
  D           Green seaturtle  ==============
B D                      Pika  ==============
                    Aardvark  --------------
B D                  Elephant  --------------
B D                   Gorilla  ==============

Inserts between block 15 and 16 in window
          Chinese tree shrew 536bp
B D                  Opossum 1bp

Alignment block 16 of 441 in window, 27275776 - 27275786, 11 bps 
B D                     Human  gtcccacct----ct
B D                     Chimp  gtcccacct----ct
B D                 Orangutan  gtcccacct----ct
B D                    Gibbon  gtcccacct----ct
B D                    Rhesus  gcctcacct----ct
B D       Crab-eating macaque  gcctcacct----ct
B D                    Baboon  gccttacct----ct
B D              Green monkey  gccccacct----ct
B D                  Marmoset  gccccacct----ct
B D           Squirrel monkey  accccacct----ct
B D                  Bushbaby  gccctgtct----ca
B D                  Squirrel  accgggttt----ct
       Lesser Egyptian jerboa  gcctggtct----ct
                 Prairie vole  gtgggctct----ct
B D            Naked mole-rat  gccccatcc----cc
B D                Guinea pig  -------tt----ca
                   Chinchilla  gcccca-ct----tg
             Brush-tailed rat  gccccatct----ca
B D                    Rabbit  gctgcctct----ct
B D                       Pig  -------ct----ct
B D                   Dolphin  -------------ct
                 Killer whale  -------------ct
             Tibetan antelope  -------------ct
B D                       Cow  -------------ct
                Domestic goat  -------------ct
B D                     Horse  gccccggct----ct
B D          White rhinoceros  gccccggct----ct
B D                       Cat  gcccgcgca----ac
B D                       Dog  gccccatct----ct
B D                   Ferret   gccgggtct----cc
B D                     Panda  gccccgtct----cc
               Pacific walrus  g-cccgtct----ct
                 Weddell seal  g-cccatct----ct
             Black flying-fox  gccctatct----ct
B D                   Megabat  gccctatct----ct
                Big brown bat  ggccgggcc----c-
         David's myotis (bat)  gccccgtct----ct
B D                  Microbat  gccccgtct----cc
              Star-nosed mole  g-------a----cg
          Cape elephant shrew  -----gcct----tc
B D                   Manatee  -----gcct----ct
             Cape golden mole  -----gcct----cc
B D                    Tenrec  -----gcct----gc
B D                 Armadillo  -----acctggggtc
B D                   Opossum  ------ctt----cc
  D            Painted turtle  attccccct----cc
B D               Stickleback  ---cgacca------
              Golden hamster  ---------------
B D                  Hedgehog  ===============
B D                       Rat  ===============
B D                     Shrew  ===============
B D                     Mouse  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
    Mexican tetra (cavefish)  ===============
                 Spotted gar  ===============
B D                Coelacanth  ===============
B D                 Zebrafish  ===============
  D               Rock pigeon  ===============
          Southern platyfish  ===============
B D                    Medaka  ===============
  D              Mallard duck  ===============
B D                 Tetraodon  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                   Chicken  ===============
B D       Medium ground finch  ===============
B D                    Turkey  ===============
B D               Zebra finch  ===============
B D              Atlantic cod  ===============
  D       Collared flycatcher  ===============
B D        American alligator  ===============
          Tibetan ground jay  ===============
B D           Chinese hamster  ---------------
B D                     Sheep  ===============
B D                   Wallaby  ===============
B D           Tasmanian devil  ===============
  D           Green seaturtle  ===============
          Chinese tree shrew  ===============
B D                      Pika  ===============
              Bactrian camel  ---------------
B D                    Alpaca  ---------------
                    Aardvark  ---------------
B D                  Elephant  ---------------
B D                   Gorilla  ===============

Inserts between block 16 and 17 in window
         Cape elephant shrew 5bp
B D                  Manatee 5bp
            Cape golden mole 2bp
B D                   Tenrec 2bp
B D                Armadillo 1bp
B D                  Opossum 1bp
  D           Painted turtle 6bp

Alignment block 17 of 441 in window, 27275787 - 27275801, 15 bps 
B D                     Human  gagggacagaagtgg
B D                     Chimp  gagggacagaagtgg
B D                 Orangutan  gagggacagaagtgg
B D                    Gibbon  gagggacagaagtgg
B D                    Rhesus  gagggacagaagtgg
B D       Crab-eating macaque  gagggacagaagtgg
B D                    Baboon  gagggacagaagtgg
B D              Green monkey  gagggacagaagtgg
B D                  Marmoset  gagggacagacgttg
B D           Squirrel monkey  gagggacagaagttg
B D                  Bushbaby  gagggacagaggtgg
B D                  Squirrel  aaggggcagggatgg
       Lesser Egyptian jerboa  gagggccaagg-cag
                 Prairie vole  gaagggtagag---g
B D            Naked mole-rat  gagggccagaggtt-
B D                Guinea pig  gatggccagaggctg
                   Chinchilla  gagggccagaggtcc
             Brush-tailed rat  gagggctagaggtc-
B D                    Rabbit  ggggg----------
B D                       Pig  gaggggccggagtgg
B D                    Alpaca  gaggggctggggtgg
               Bactrian camel  gaggggctggggtgg
B D                   Dolphin  gagggacagaggtgg
                 Killer whale  gagggacagaggtgg
             Tibetan antelope  gagggacaggggcga
B D                       Cow  gagagacaagggtga
                Domestic goat  gagggacaggggtga
B D                     Horse  agggggcaggggcgg
B D          White rhinoceros  ggggggcgagggt--
B D                       Cat  ga-------------
B D                       Dog  ga-------------
B D                   Ferret   ga-------------
B D                     Panda  ga-------------
               Pacific walrus  ga-------------
                 Weddell seal  ga-------------
             Black flying-fox  gaagagcagggggtg
B D                   Megabat  gaagaacagggggtg
         David's myotis (bat)  gaggggcaggggtag
B D                  Microbat  gaggggcaggggtgg
              Star-nosed mole  gggggtggggggtgg
          Cape elephant shrew  gagggacagagatgg
B D                   Manatee  gagggacagaggtgg
B D                    Tenrec  ----gagaaagatgg
B D                 Armadillo  gaggggcagaggtgg
B D                   Opossum  gcaggccaggaatgt
  D            Painted turtle  gagcaacat------
B D               Stickleback  ---ggtgagaggctg
              Golden hamster  ---------------
B D                  Hedgehog  ===============
B D                       Rat  ===============
B D                     Shrew  ===============
B D                     Mouse  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
    Mexican tetra (cavefish)  ===============
                 Spotted gar  ===============
B D                Coelacanth  ===============
B D                 Zebrafish  ===============
  D               Rock pigeon  ===============
          Southern platyfish  ===============
B D                    Medaka  ===============
  D              Mallard duck  ===============
B D                 Tetraodon  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                   Chicken  ===============
B D       Medium ground finch  ===============
B D                    Turkey  ===============
B D               Zebra finch  ===============
B D              Atlantic cod  ===============
  D       Collared flycatcher  ===============
B D        American alligator  ===============
          Tibetan ground jay  ===============
B D           Chinese hamster  ---------------
B D                     Sheep  ===============
B D                   Wallaby  ===============
B D           Tasmanian devil  ===============
  D           Green seaturtle  ===============
               Big brown bat  ---------------
          Chinese tree shrew  ===============
B D                      Pika  ===============
                    Aardvark  ---------------
B D                  Elephant  ---------------
            Cape golden mole  ===============
B D                   Gorilla  ===============

Inserts between block 17 and 18 in window
B D                      Pig 125bp

Alignment block 18 of 441 in window, 27275802 - 27275806, 5 bps 
B D                     Human  ggt--gg-
B D                     Chimp  ggt--gg-
B D                 Orangutan  ggt--gg-
B D                    Gibbon  ggt--ga-
B D                    Rhesus  ggt--gg-
B D       Crab-eating macaque  ggt--gg-
B D                    Baboon  ggt--gg-
B D              Green monkey  ggt--gg-
B D                  Marmoset  ggt--gg-
B D           Squirrel monkey  ggt--gg-
B D                  Bushbaby  aac--gg-
B D                  Squirrel  ggt--gg-
       Lesser Egyptian jerboa  gag--gg-
                 Prairie vole  taa--ga-
B D                Guinea pig  gac--ag-
                   Chinchilla  ggt--gg-
B D                    Rabbit  --t--gg-
B D                    Alpaca  gat--gg-
               Bactrian camel  gat--gg-
B D                   Dolphin  gag--gg-
                 Killer whale  gag--gg-
             Tibetan antelope  gat--gg-
B D                       Cow  gat--gg-
                Domestic goat  gat--gg-
B D                     Horse  gggatgg-
B D          White rhinoceros  gcgatgg-
B D                       Cat  -----gg-
B D                       Dog  -----gg-
B D                   Ferret   -----gg-
B D                     Panda  -----gg-
               Pacific walrus  -----gg-
                 Weddell seal  -----gg-
             Black flying-fox  ggat-gg-
B D                   Megabat  ggat-gg-
         David's myotis (bat)  ggga-gg-
B D                  Microbat  gggc-gg-
              Star-nosed mole  ggg--gg-
B D                   Opossum  ----tga-
  D            Painted turtle  ggc--gg-
B D               Stickleback  agt--gcg
              Golden hamster  --------
B D                  Hedgehog  ========
B D                       Rat  ========
B D                     Shrew  ========
B D                     Mouse  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
    Mexican tetra (cavefish)  ========
                 Spotted gar  ========
B D                Coelacanth  ========
B D                 Zebrafish  ========
  D               Rock pigeon  ========
          Southern platyfish  ========
B D                    Medaka  ========
  D              Mallard duck  ========
B D                 Tetraodon  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
B D               Zebra finch  ========
B D              Atlantic cod  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
            Brush-tailed rat  --------
B D            Naked mole-rat  --------
         Cape elephant shrew  --------
B D           Chinese hamster  --------
B D                     Sheep  ========
B D                   Wallaby  ========
B D           Tasmanian devil  ========
  D           Green seaturtle  ========
               Big brown bat  --------
B D                       Pig  ========
          Chinese tree shrew  ========
B D                      Pika  ========
B D                    Tenrec  --------
B D                 Armadillo  --------
                    Aardvark  --------
B D                  Elephant  --------
B D                   Manatee  --------
            Cape golden mole  ========
B D                   Gorilla  ========

Inserts between block 18 and 19 in window
  D           Painted turtle 13bp

Alignment block 19 of 441 in window, 27275807 - 27275815, 9 bps 
B D                     Human  t------------ttgagagc-
B D                     Chimp  t------------ttgagagc-
B D                 Orangutan  t------------ttgagagc-
B D                    Gibbon  t------------ttgagagc-
B D                    Rhesus  t------------ttgagagc-
B D       Crab-eating macaque  t------------ttgagagc-
B D                    Baboon  t------------ttgagagc-
B D              Green monkey  t------------ttgagagc-
B D                  Marmoset  t------------ttgagagc-
B D           Squirrel monkey  t------------ttgatagc-
B D                  Bushbaby  t------------ttgagagc-
B D                  Squirrel  t------------ttgagggc-
       Lesser Egyptian jerboa  t------------ttaggagc-
                 Prairie vole  t-----------------ggc-
B D            Naked mole-rat  ---------------gggagc-
B D                Guinea pig  t------------ttgggagg-
                   Chinchilla  t------------ttgggaag-
             Brush-tailed rat  ----------------ggagg-
B D                    Rabbit  t------------ttgagagc-
B D                    Alpaca  t------------ttgaggg--
               Bactrian camel  t------------ttgaggg--
B D                   Dolphin  t------------ttgagcg--
                 Killer whale  t------------ttgagcg--
             Tibetan antelope  t------------ttgagag--
B D                       Cow  t------------ttgagag--
                Domestic goat  t------------ttgagag--
B D                     Horse  t------------ttgagag--
B D          White rhinoceros  t------------ttgagag--
B D                       Cat  t------------ttgagag--
B D                       Dog  t------------ttgagag--
B D                   Ferret   t------------ttgagag--
B D                     Panda  t------------ttgagag--
               Pacific walrus  t------------ttgagag--
                 Weddell seal  t------------ttgggag--
             Black flying-fox  g------------ttgagag--
B D                   Megabat  g------------ttgagag--
         David's myotis (bat)  --------------tgagag--
B D                  Microbat  --------------tgagag--
              Star-nosed mole  tggagcg------ttgagat--
          Cape elephant shrew  -gatgccc-----tttaggg--
B D                   Manatee  -gacgcccatggtttgagag--
             Cape golden mole  ------------tttgaggg--
B D                    Tenrec  -gaagcccatagtttga--g--
B D                 Armadillo  -ggtgtcc-----ttgggag--
B D                   Opossum  t------------ctctgcg--
B D               Stickleback  ------------cgtgagag-a
              Golden hamster  ----------------------
B D                  Hedgehog  ======================
B D                       Rat  ======================
B D                     Shrew  ======================
B D                     Mouse  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
    Mexican tetra (cavefish)  ======================
                 Spotted gar  ======================
B D                Coelacanth  ======================
B D                 Zebrafish  ======================
  D               Rock pigeon  ======================
          Southern platyfish  ======================
B D                    Medaka  ======================
  D              Mallard duck  ======================
B D                 Tetraodon  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D                   Chicken  ======================
B D       Medium ground finch  ======================
B D                    Turkey  ======================
  D            Painted turtle  ======================
B D               Zebra finch  ======================
B D              Atlantic cod  ======================
  D       Collared flycatcher  ======================
B D        American alligator  ======================
          Tibetan ground jay  ======================
B D           Chinese hamster  ----------------------
B D                     Sheep  ======================
B D                   Wallaby  ======================
B D           Tasmanian devil  ======================
  D           Green seaturtle  ======================
               Big brown bat  ----------------------
B D                       Pig  ======================
          Chinese tree shrew  ======================
B D                      Pika  ======================
                    Aardvark  ----------------------
B D                  Elephant  ----------------------
B D                   Gorilla  ======================

Inserts between block 19 and 20 in window
B D                   Rabbit 1bp
         Cape elephant shrew 1bp
B D                  Manatee 2bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
B D                Armadillo 3bp
B D                  Opossum 3bp

Alignment block 20 of 441 in window, 27275816 - 27275819, 4 bps 
B D                     Human  agga
B D                     Chimp  agga
B D                 Orangutan  agga
B D                    Gibbon  agga
B D                    Rhesus  agga
B D       Crab-eating macaque  agga
B D                    Baboon  agga
B D              Green monkey  agga
B D                  Marmoset  agga
B D           Squirrel monkey  agga
B D                  Bushbaby  agga
       Lesser Egyptian jerboa  agga
                 Prairie vole  caga
B D            Naked mole-rat  tgga
B D                Guinea pig  cgca
                   Chinchilla  caga
             Brush-tailed rat  cgga
B D                    Rabbit  tggg
B D                    Alpaca  gg--
               Bactrian camel  gg--
B D                   Dolphin  ggga
                 Killer whale  ggga
             Tibetan antelope  gggt
B D                       Cow  ggca
                Domestic goat  gggt
B D                     Horse  gcga
B D          White rhinoceros  gc-a
B D                       Cat  ggga
B D                       Dog  caga
B D                   Ferret   ggga
B D                     Panda  agga
               Pacific walrus  ggga
                 Weddell seal  ggga
             Black flying-fox  agga
B D                   Megabat  agga
         David's myotis (bat)  ggga
B D                  Microbat  ggga
              Star-nosed mole  ggga
          Cape elephant shrew  ggga
B D                   Manatee  agga
             Cape golden mole  aaga
B D                    Tenrec  agga
B D                 Armadillo  ggg-
B D               Stickleback  agga
              Golden hamster  ----
B D                  Hedgehog  ====
B D                       Rat  ====
B D                     Shrew  ====
B D                     Mouse  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
    Mexican tetra (cavefish)  ====
                 Spotted gar  ====
B D                Coelacanth  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
          Southern platyfish  ====
B D                    Medaka  ====
  D              Mallard duck  ====
B D                 Tetraodon  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
  D            Painted turtle  ====
B D               Zebra finch  ====
B D              Atlantic cod  ====
  D       Collared flycatcher  ====
B D        American alligator  ====
          Tibetan ground jay  ====
B D                  Squirrel  ----
B D           Chinese hamster  ----
B D                     Sheep  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
  D           Green seaturtle  ====
               Big brown bat  ----
B D                       Pig  ====
          Chinese tree shrew  ====
B D                   Opossum  ====
B D                      Pika  ====
                    Aardvark  ----
B D                  Elephant  ----
B D                   Gorilla  ====

Alignment block 21 of 441 in window, 27275820 - 27275826, 7 bps 
B D                     Human  gactg----g--------a--
B D                     Chimp  gactg----g--------a--
B D                 Orangutan  gactg----g--------a--
B D                    Gibbon  gactg----g--------a--
B D                    Rhesus  gactg----a--------a--
B D       Crab-eating macaque  gactg----a--------a--
B D                    Baboon  gactg----a--------a--
B D              Green monkey  gactg----g--------a--
B D                  Marmoset  gactg----g--------a--
B D           Squirrel monkey  gactg----g--------a--
B D                  Bushbaby  ggctg----g--------g--
       Lesser Egyptian jerboa  ggctg----c--------g--
                 Prairie vole  gactg----a--------g--
B D            Naked mole-rat  gggtg----g--------g--
B D                Guinea pig  gggtg----g--------a--
                   Chinchilla  gggtg----g--------g--
             Brush-tailed rat  gtgtg----g--------g--
B D                    Rabbit  ggctg----g--------g--
B D                    Alpaca  gacta----g--------g--
               Bactrian camel  gacta----g--------g--
B D                   Dolphin  ggtta----g--------g--
                 Killer whale  ggtta----g--------g--
             Tibetan antelope  ggcta----g--------g--
B D                       Cow  ggcta----g--------g--
                Domestic goat  ggcta----g--------g--
B D                     Horse  ggctg----g--------g--
B D          White rhinoceros  ggctg----g--------g--
B D                       Cat  ggcta----g--------g--
B D                       Dog  ggcca----g--------g--
B D                   Ferret   ggcta----g--------g--
B D                     Panda  ggcta----a--------g--
               Pacific walrus  gacta----a--------g--
                 Weddell seal  ggcta----a--------g--
             Black flying-fox  ggcca----g--------g--
B D                   Megabat  ggcca----g--------g--
         David's myotis (bat)  ggcca----g--------g--
B D                  Microbat  ggcca----g--------g--
              Star-nosed mole  gccta----ac-----ctg--
          Cape elephant shrew  ggcta----------------
B D                   Manatee  ggcta--cg------------
             Cape golden mole  gggga----------------
B D                    Tenrec  ggctagc--------------
B D                   Opossum  ----------catcacctgtc
              Golden hamster  ---------------------
B D                  Hedgehog  =====================
B D                       Rat  =====================
B D                     Shrew  =====================
B D                     Mouse  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
    Mexican tetra (cavefish)  =====================
                 Spotted gar  =====================
B D                Coelacanth  =====================
B D                 Zebrafish  =====================
  D               Rock pigeon  =====================
          Southern platyfish  =====================
B D                    Medaka  =====================
  D              Mallard duck  =====================
B D                 Tetraodon  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D                   Chicken  =====================
B D       Medium ground finch  =====================
B D                    Turkey  =====================
  D            Painted turtle  =====================
B D               Zebra finch  =====================
B D              Atlantic cod  =====================
  D       Collared flycatcher  =====================
B D        American alligator  =====================
          Tibetan ground jay  =====================
B D                  Squirrel  ---------------------
B D           Chinese hamster  ---------------------
B D                     Sheep  =====================
B D                   Wallaby  =====================
B D           Tasmanian devil  =====================
  D           Green seaturtle  =====================
               Big brown bat  ---------------------
B D                       Pig  =====================
          Chinese tree shrew  =====================
B D                      Pika  =====================
B D                 Armadillo  ---------------------
                    Aardvark  ---------------------
B D                  Elephant  ---------------------
B D                   Gorilla  =====================

Inserts between block 21 and 22 in window
            Cape golden mole 141bp

Alignment block 22 of 441 in window, 27275827 - 27275829, 3 bps 
B D                     Human  ggg
B D                     Chimp  ggg
B D                 Orangutan  ggg
B D                    Gibbon  ggg
B D                    Rhesus  ggg
B D       Crab-eating macaque  ggg
B D                    Baboon  ggg
B D              Green monkey  ggg
B D                  Marmoset  ggg
B D           Squirrel monkey  ggg
B D                  Bushbaby  gga
       Lesser Egyptian jerboa  gga
                 Prairie vole  ggg
B D            Naked mole-rat  gga
B D                Guinea pig  ggg
                   Chinchilla  gga
             Brush-tailed rat  gga
B D                    Rabbit  gcg
B D                    Alpaca  agg
               Bactrian camel  agg
B D                   Dolphin  agg
                 Killer whale  agg
             Tibetan antelope  agg
B D                       Cow  agg
                Domestic goat  agg
B D                     Horse  gga
B D          White rhinoceros  gga
B D                       Cat  gac
B D                       Dog  gaa
B D                   Ferret   gag
B D                     Panda  gag
               Pacific walrus  gag
                 Weddell seal  gag
             Black flying-fox  aga
B D                   Megabat  gga
         David's myotis (bat)  -ga
B D                  Microbat  -ga
              Star-nosed mole  gag
          Cape elephant shrew  -gt
B D                   Manatee  ggg
B D                    Tenrec  ggg
B D                   Opossum  agg
              Golden hamster  ---
B D                  Hedgehog  ===
B D                       Rat  ===
B D                     Shrew  ===
B D                     Mouse  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
          Southern platyfish  ===
B D                    Medaka  ===
  D              Mallard duck  ===
B D                 Tetraodon  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D                  Squirrel  ---
B D           Chinese hamster  ---
B D                     Sheep  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
  D           Green seaturtle  ===
               Big brown bat  ---
B D                       Pig  ===
          Chinese tree shrew  ===
B D                      Pika  ===
B D                 Armadillo  ---
                    Aardvark  ---
B D                  Elephant  ---
            Cape golden mole  ===
B D                   Gorilla  ===

Inserts between block 22 and 23 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 136bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 6bp

Alignment block 23 of 441 in window, 27275830 - 27275835, 6 bps 
B D                     Human  -----------------aagaag
B D                     Chimp  -----------------aagaag
B D                 Orangutan  -----------------aagaag
B D                    Gibbon  -----------------aagaag
B D                    Rhesus  -----------------aagaag
B D       Crab-eating macaque  -----------------aagaag
B D                    Baboon  -----------------aagaag
B D              Green monkey  -----------------aagaag
B D                  Marmoset  -----------------aagaag
B D           Squirrel monkey  -----------------aagaag
B D                  Bushbaby  -----------------aagaag
       Lesser Egyptian jerboa  -----------------aggaaa
B D           Chinese hamster  -------------------ga--
               Golden hamster  -------------------ga--
B D            Naked mole-rat  -----------------aaggag
B D                Guinea pig  -----------------aaaaag
                   Chinchilla  -----------------aagaag
             Brush-tailed rat  -----------------aaaacg
B D                    Rabbit  -----------------cgagaa
B D                    Alpaca  --------------------aag
               Bactrian camel  --------------------aag
B D                   Dolphin  --------------------aag
                 Killer whale  --------------------aag
             Tibetan antelope  --------------------gag
B D                       Cow  --------------------gag
                Domestic goat  --------------------gag
B D                     Horse  ------------------agaag
B D          White rhinoceros  ------------------ggaag
B D                       Cat  --------------------aag
B D                       Dog  -----------------aagaag
B D                   Ferret   --------------------aag
B D                     Panda  -----------------gagaag
               Pacific walrus  -----------------aaaaag
                 Weddell seal  -----------------aagaag
             Black flying-fox  ------------------agaac
B D                   Megabat  ------------------agaac
                Big brown bat  ----------------------t
         David's myotis (bat)  ------------------ggaat
B D                  Microbat  ------------------ggaat
              Star-nosed mole  --------------------aag
          Cape elephant shrew  -----------------gagaag
B D                   Manatee  -----------------aagaag
B D                    Tenrec  -----------------gaaaag
B D                 Armadillo  ------------------gggag
B D                   Opossum  atccatcccccacccgtcacagg
B D                  Hedgehog  =======================
B D                       Rat  =======================
B D                     Shrew  =======================
B D                     Mouse  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
    Mexican tetra (cavefish)  =======================
                 Spotted gar  =======================
B D                Coelacanth  =======================
B D                 Zebrafish  =======================
  D               Rock pigeon  =======================
          Southern platyfish  =======================
B D                    Medaka  =======================
  D              Mallard duck  =======================
B D                 Tetraodon  =======================
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D                   Chicken  =======================
B D       Medium ground finch  =======================
B D                    Turkey  =======================
  D            Painted turtle  =======================
B D               Zebra finch  =======================
B D              Atlantic cod  =======================
  D       Collared flycatcher  =======================
B D        American alligator  =======================
          Tibetan ground jay  =======================
B D                  Squirrel  -----------------------
                Prairie vole  =======================
B D                     Sheep  =======================
B D                   Wallaby  =======================
B D           Tasmanian devil  =======================
  D           Green seaturtle  =======================
B D                       Pig  =======================
          Chinese tree shrew  =======================
B D                      Pika  =======================
                    Aardvark  -----------------------
B D                  Elephant  -----------------------
            Cape golden mole  =======================
B D                   Gorilla  =======================

Inserts between block 23 and 24 in window
             Star-nosed mole 43bp

Alignment block 24 of 441 in window, 27275836 - 27275853, 18 bps 
B D                     Human  caagt-----------ccaggcctagctg
B D                     Chimp  caagt-----------ccgggcctagctg
B D                 Orangutan  caagt-----------ccgggcctagctg
B D                    Gibbon  cgagt-----------ccgggcctagctg
B D                    Rhesus  caagt-----------ccgggcctagctg
B D       Crab-eating macaque  caagt-----------ccgggcctagctg
B D                    Baboon  caagt-----------ccgggcctagctg
B D              Green monkey  caagt------------cgggcctagctg
B D                  Marmoset  caagg-----------ccaggcctagctg
B D           Squirrel monkey  caagt-----------ccgggcctagcta
B D                  Bushbaby  ccagtta---------ctggggctagctt
       Lesser Egyptian jerboa  ttagc-c---------cacggtctgctg-
B D            Naked mole-rat  caagt-a---------cctggc-------
B D                Guinea pig  caggt-c---------actagcctggct-
                   Chinchilla  caaat-g---------cctggcctgggt-
             Brush-tailed rat  caagt-c---------tctgacctggcc-
B D                    Rabbit  caagt-c----------------------
B D                    Alpaca  aaagt-c---------tctggtcta-gtg
               Bactrian camel  aaagt-c---------tctggccta-gtg
B D                   Dolphin  aaagc-g---------tctggcctaggtg
                 Killer whale  aaagc-a---------tctggcctaggtg
             Tibetan antelope  aaagt-g---------tctggcctaggtg
B D                       Cow  aaagt-g---------tctggcctaggtg
                Domestic goat  aaagt-g---------tctggcctagggg
B D                     Horse  acagt-c---------tgtggcccagctg
B D          White rhinoceros  acagt-c---------ggtggcccagcgg
B D                       Cat  aaggc-c---------tctggcctagctg
B D                       Dog  aacgt-c---------tctggccttgtgg
B D                   Ferret   aacgt-c---------cctggcctacctg
B D                     Panda  aacgt-c---------tctggcctagctg
               Pacific walrus  aacgt------------------------
                 Weddell seal  aacgc-c---------tctggcctagctg
             Black flying-fox  aaagt-c---------tcaggcctagctg
B D                   Megabat  aaagt-c---------tcaggcctagctg
                Big brown bat  acagg-t---------acc----------
         David's myotis (bat)  acagc-c---------tctggccgggctg
B D                  Microbat  acagc-c---------tctggcctggctg
B D                  Elephant  ----c-tc--------gcttttctccc--
          Cape elephant shrew  acagc-ct--------cctgtcctccctg
B D                   Manatee  aaagt-ct--------cctgacctagctg
B D                    Tenrec  aaagt-tt--------cctgccct-----
B D                 Armadillo  aaagt-ct--------ccgggtcc-----
B D                   Opossum  -------catatatggacaggccggcctg
             Star-nosed mole  =============================
              Golden hamster  -----------------------------
B D                  Hedgehog  =============================
B D                       Rat  =============================
B D                     Shrew  =============================
B D                     Mouse  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
    Mexican tetra (cavefish)  =============================
                 Spotted gar  =============================
B D                Coelacanth  =============================
B D                 Zebrafish  =============================
  D               Rock pigeon  =============================
          Southern platyfish  =============================
B D                    Medaka  =============================
  D              Mallard duck  =============================
B D                 Tetraodon  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
B D                   Chicken  =============================
B D       Medium ground finch  =============================
B D                    Turkey  =============================
  D            Painted turtle  =============================
B D               Zebra finch  =============================
B D              Atlantic cod  =============================
  D       Collared flycatcher  =============================
B D        American alligator  =============================
          Tibetan ground jay  =============================
B D                  Squirrel  -----------------------------
                Prairie vole  =============================
B D           Chinese hamster  -----------------------------
B D                     Sheep  =============================
B D                   Wallaby  =============================
B D           Tasmanian devil  =============================
  D           Green seaturtle  =============================
B D                       Pig  =============================
          Chinese tree shrew  =============================
B D                      Pika  =============================
                    Aardvark  -----------------------------
            Cape golden mole  =============================
B D                   Gorilla  =============================

Inserts between block 24 and 25 in window
      Lesser Egyptian jerboa 68bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Tenrec 13bp
B D                Armadillo 13bp

Alignment block 25 of 441 in window, 27275854 - 27275861, 8 bps 
B D                     Human  ------------caagcact
B D                     Chimp  ------------caagcact
B D                 Orangutan  ------------caagcact
B D                    Gibbon  ------------caagcact
B D                    Rhesus  ------------caagcact
B D       Crab-eating macaque  ------------caagcact
B D                    Baboon  ------------caagcact
B D              Green monkey  ------------caagcact
B D                  Marmoset  ------------caagcagt
B D           Squirrel monkey  ------------caagcact
B D                  Bushbaby  ------------caggca--
B D                    Alpaca  ------------caggcact
               Bactrian camel  ------------caggcact
B D                   Dolphin  ------------caagcact
                 Killer whale  ------------caagcact
             Tibetan antelope  ------------caggcact
B D                       Cow  ------------caggcact
                Domestic goat  ------------caggcact
B D                     Horse  ------------tgagcatt
B D          White rhinoceros  ------------cgagcatt
B D                       Cat  ------------c-agcagc
B D                       Dog  ------------c-agcact
B D                   Ferret   ------------g-agctcg
B D                     Panda  ------------c-atcacc
               Pacific walrus  ----------------cact
                 Weddell seal  ------------c-agcact
             Black flying-fox  ------------caagcac-
B D                   Megabat  ------------caagcact
         David's myotis (bat)  ------------tgagcgct
B D                  Microbat  ------------tgagcgct
B D                  Elephant  ----------------cact
          Cape elephant shrew  ------------cacgcact
B D                   Manatee  ------------caagcgct
B D                   Opossum  acggcatgtgatgaggggct
             Star-nosed mole  ====================
              Golden hamster  --------------------
B D                  Hedgehog  ====================
B D                       Rat  ====================
B D                     Shrew  ====================
B D                     Mouse  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
    Mexican tetra (cavefish)  ====================
                 Spotted gar  ====================
B D                Coelacanth  ====================
B D                 Zebrafish  ====================
  D               Rock pigeon  ====================
          Southern platyfish  ====================
B D                    Medaka  ====================
  D              Mallard duck  ====================
B D                 Tetraodon  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                   Chicken  ====================
B D       Medium ground finch  ====================
B D                    Turkey  ====================
  D            Painted turtle  ====================
B D               Zebra finch  ====================
B D              Atlantic cod  ====================
  D       Collared flycatcher  ====================
B D        American alligator  ====================
          Tibetan ground jay  ====================
B D                Guinea pig  --------------------
            Brush-tailed rat  ====================
B D            Naked mole-rat  --------------------
                  Chinchilla  ====================
B D                  Squirrel  --------------------
                Prairie vole  ====================
B D           Chinese hamster  --------------------
B D                     Sheep  ====================
B D                   Wallaby  ====================
B D           Tasmanian devil  ====================
  D           Green seaturtle  ====================
               Big brown bat  --------------------
B D                       Pig  ====================
          Chinese tree shrew  ====================
B D                    Rabbit  --------------------
B D                      Pika  ====================
      Lesser Egyptian jerboa  ====================
B D                    Tenrec  ====================
B D                 Armadillo  ====================
                    Aardvark  --------------------
            Cape golden mole  ====================
B D                   Gorilla  ====================

Inserts between block 25 and 26 in window
            Black flying-fox 6bp
B D                  Megabat 6bp
        David's myotis (bat) 89bp
B D                 Microbat 1bp
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp

Alignment block 26 of 441 in window, 27275862 - 27275876, 15 bps 
B D                     Human  -----------ccccacccccgcccc
B D                     Chimp  -----------cccca----------
B D                 Orangutan  -----------cccca----------
B D                    Gibbon  -----------ccccg----------
B D              Green monkey  -----------ccccg----------
B D                Guinea pig  -----------------------tgc
                   Chinchilla  -----------------------caa
             Brush-tailed rat  -----------------------caa
B D                  Elephant  -----------tcctc----------
          Cape elephant shrew  -----------caccg----------
B D                   Opossum  gctaaaaacagcctc-----------
             Star-nosed mole  ==========================
              Golden hamster  --------------------------
B D                  Hedgehog  ==========================
B D                       Rat  ==========================
B D                     Shrew  ==========================
B D                     Mouse  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
    Mexican tetra (cavefish)  ==========================
                 Spotted gar  ==========================
B D                Coelacanth  ==========================
B D                 Zebrafish  ==========================
  D               Rock pigeon  ==========================
          Southern platyfish  ==========================
B D                    Medaka  ==========================
  D              Mallard duck  ==========================
B D                 Tetraodon  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D                   Chicken  ==========================
B D       Medium ground finch  ==========================
B D                    Turkey  ==========================
  D            Painted turtle  ==========================
B D               Zebra finch  ==========================
B D              Atlantic cod  ==========================
  D       Collared flycatcher  ==========================
B D        American alligator  ==========================
          Tibetan ground jay  ==========================
B D            Naked mole-rat  --------------------------
B D                  Squirrel  --------------------------
                Prairie vole  ==========================
B D           Chinese hamster  --------------------------
B D                     Panda  --------------------------
               Domestic goat  --------------------------
B D                     Sheep  ==========================
B D                   Wallaby  ==========================
B D           Tasmanian devil  ==========================
  D           Green seaturtle  ==========================
B D                       Cow  --------------------------
            Tibetan antelope  --------------------------
B D                  Microbat  ==========================
        David's myotis (bat)  ==========================
               Big brown bat  --------------------------
            Black flying-fox  ==========================
B D                   Megabat  ==========================
B D                       Pig  ==========================
B D           Squirrel monkey  --------------------------
          Chinese tree shrew  ==========================
B D                    Rabbit  --------------------------
              Pacific walrus  --------------------------
B D                      Pika  ==========================
B D                   Ferret   --------------------------
              Bactrian camel  --------------------------
B D                    Alpaca  --------------------------
B D                       Dog  --------------------------
      Lesser Egyptian jerboa  ==========================
B D                    Tenrec  ==========================
B D                 Armadillo  ==========================
B D                       Cat  --------------------------
                    Aardvark  --------------------------
B D                     Horse  --------------------------
                Weddell seal  --------------------------
B D          White rhinoceros  --------------------------
B D                   Manatee  ==========================
                Killer whale  --------------------------
B D                   Dolphin  --------------------------
B D                  Marmoset  --------------------------
B D                    Rhesus  --------------------------
            Cape golden mole  ==========================
B D                    Baboon  --------------------------
B D       Crab-eating macaque  --------------------------
B D                  Bushbaby  --------------------------
B D                   Gorilla  ==========================

Inserts between block 26 and 27 in window
         Cape elephant shrew 9bp

Alignment block 27 of 441 in window, 27275877 - 27275887, 11 bps 
B D                     Human  cgcccccgccc------
B D                     Chimp  --cccccgccc------
B D                 Orangutan  --------ccc------
B D                    Gibbon  --------ccc------
B D                    Rhesus  ---------cc------
B D       Crab-eating macaque  ---------cc------
B D                    Baboon  ---------cc------
B D              Green monkey  --------ccc------
B D                  Marmoset  --------tcc------
B D           Squirrel monkey  --------ccc------
B D                  Bushbaby  ---------cc------
B D                Guinea pig  ggtcctgttct------
                   Chinchilla  ggccttggtct------
             Brush-tailed rat  g--cctgttct------
B D                    Alpaca  --------gct------
               Bactrian camel  --------gcc------
B D                   Dolphin  --------gcc------
                 Killer whale  --------gcc------
             Tibetan antelope  --------gcc------
B D                       Cow  --------gcc------
                Domestic goat  --------gcc------
B D                     Horse  --------gtc------
B D          White rhinoceros  --------gcc------
B D                       Cat  --------gtc------
B D                       Dog  --------gcc------
B D                   Ferret   --------gcc------
B D                     Panda  --------gct------
               Pacific walrus  --------gcc------
                 Weddell seal  --------gcc------
                Big brown bat  ---------cc------
B D                  Microbat  ---------cc------
B D                   Opossum  -------agcccccact
             Star-nosed mole  =================
              Golden hamster  -----------------
B D                  Hedgehog  =================
B D                       Rat  =================
B D                     Shrew  =================
B D                     Mouse  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
    Mexican tetra (cavefish)  =================
                 Spotted gar  =================
B D                Coelacanth  =================
B D                 Zebrafish  =================
  D               Rock pigeon  =================
          Southern platyfish  =================
B D                    Medaka  =================
  D              Mallard duck  =================
B D                 Tetraodon  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D                   Chicken  =================
B D       Medium ground finch  =================
B D                    Turkey  =================
  D            Painted turtle  =================
B D               Zebra finch  =================
B D              Atlantic cod  =================
  D       Collared flycatcher  =================
B D        American alligator  =================
          Tibetan ground jay  =================
B D            Naked mole-rat  -----------------
B D                  Squirrel  -----------------
                Prairie vole  =================
         Cape elephant shrew  =================
B D           Chinese hamster  -----------------
B D                     Sheep  =================
B D                   Wallaby  =================
B D           Tasmanian devil  =================
  D           Green seaturtle  =================
        David's myotis (bat)  =================
            Black flying-fox  =================
B D                   Megabat  =================
B D                       Pig  =================
          Chinese tree shrew  =================
B D                    Rabbit  -----------------
B D                      Pika  =================
      Lesser Egyptian jerboa  =================
B D                    Tenrec  =================
B D                 Armadillo  =================
                    Aardvark  -----------------
B D                  Elephant  -----------------
B D                   Manatee  =================
            Cape golden mole  =================
B D                   Gorilla  =================

Inserts between block 27 and 28 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
               Big brown bat 2bp
B D                 Microbat 6bp

Alignment block 28 of 441 in window, 27275888 - 27275907, 20 bps 
B D                     Human  ccgcccccgccaggc-tct--ag
B D                     Chimp  ccgcccccgccaggc-tct--ag
B D                 Orangutan  ccgcccccgccaggc-tct--ag
B D                    Gibbon  ccgcccccgccaggc-tct--ag
B D                    Rhesus  ccgcccccgccaggc-tct--tg
B D       Crab-eating macaque  ccgcccccgccaggc-tct--tg
B D                    Baboon  ccgcccccgccaggc-tct--tg
B D              Green monkey  ccgcccccgccaggc-tct--tg
B D                  Marmoset  cacccgccgcca-gc-tct--tg
B D           Squirrel monkey  cgccccccgccaggc-cct--cg
B D                  Bushbaby  cctctctggcctgct-ttc--tg
B D           Chinese hamster  -cccctcagggtgtg-tcc--tc
               Golden hamster  -cccctcagggtgtg-tcc--cc
B D            Naked mole-rat  ----ctccgcctggc-ttc--tg
B D                Guinea pig  ttgact----cgggt-gtc--tg
                   Chinchilla  ttgcctccgcctggc-ttc--tg
             Brush-tailed rat  ttgcctctgcctggc-ttc--tg
B D                    Rabbit  ---------cctggc-ctc--gc
B D                       Pig  -----ctggcctggc-ttt--ta
B D                    Alpaca  -----ctggcctggc-ttt--tg
               Bactrian camel  -----ctggcctggc-ttt--tg
B D                   Dolphin  -----ccggcctggc-ttt--tg
                 Killer whale  -----ccggcctggc-ttt--tg
             Tibetan antelope  -----ctggcctggt-ttc--ta
B D                       Cow  -----ccggcctggt-ttc--ta
                Domestic goat  -----ctggcctggt-ttc--ta
B D                     Horse  -----ctgtcctggc-ttt--tg
B D          White rhinoceros  -----ctgtcctggc-ttt--tg
B D                       Cat  -----ccggcctggctttt--gg
B D                       Dog  -------------ac-ttt--aa
B D                   Ferret   -----ccggcctggc-ttc--ag
B D                     Panda  -----ccggcctggc-ttt--gg
               Pacific walrus  -----acggcctggc-ttt--gg
                 Weddell seal  -----acggcctggc-ttt--gg
             Black flying-fox  -----ctggcctggc-ttt--tg
B D                   Megabat  -----ctggcctgcc-ttt--tg
                Big brown bat  -----------------tt--ca
B D                  Microbat  -----cgggcttggt-gtc--ca
          Cape elephant shrew  ---------------------tg
B D                   Manatee  ---ctctggcctgac-ttttgtg
B D                    Tenrec  gccctctggcctgac-ttg--tg
B D                 Armadillo  gccccctggcctggc-ttt--cg
B D                   Opossum  ctgcaccagcctggc-tcg--ag
             Star-nosed mole  =======================
B D                  Hedgehog  =======================
B D                       Rat  =======================
B D                     Shrew  =======================
B D                     Mouse  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
    Mexican tetra (cavefish)  =======================
                 Spotted gar  =======================
B D                Coelacanth  =======================
B D                 Zebrafish  =======================
  D               Rock pigeon  =======================
          Southern platyfish  =======================
B D                    Medaka  =======================
  D              Mallard duck  =======================
B D                 Tetraodon  =======================
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D                   Chicken  =======================
B D       Medium ground finch  =======================
B D                    Turkey  =======================
  D            Painted turtle  =======================
B D               Zebra finch  =======================
B D              Atlantic cod  =======================
  D       Collared flycatcher  =======================
B D        American alligator  =======================
          Tibetan ground jay  =======================
B D                  Squirrel  -----------------------
                Prairie vole  =======================
B D                     Sheep  =======================
B D                   Wallaby  =======================
B D           Tasmanian devil  =======================
  D           Green seaturtle  =======================
        David's myotis (bat)  =======================
          Chinese tree shrew  =======================
B D                      Pika  =======================
      Lesser Egyptian jerboa  =======================
                    Aardvark  -----------------------
B D                  Elephant  -----------------------
            Cape golden mole  =======================
B D                   Gorilla  =======================

Alignment block 29 of 441 in window, 27275908 - 27275914, 7 bps 
B D                     Human  ------gacactt
B D                     Chimp  ------gacactt
B D                 Orangutan  ------gacactt
B D                    Gibbon  ------gacactt
B D                    Rhesus  ------gacactt
B D       Crab-eating macaque  ------gacactt
B D                    Baboon  ------gacactt
B D              Green monkey  ------gacactt
B D                  Marmoset  ------gacacct
B D           Squirrel monkey  ------gacacct
B D                  Bushbaby  ------gacaccc
B D           Chinese hamster  ------tacagc-
               Golden hamster  ------tgcagc-
B D            Naked mole-rat  ------gacacct
B D                Guinea pig  ------gacacct
                   Chinchilla  ------ggcatct
             Brush-tailed rat  ------gacacct
B D                    Rabbit  ------t------
B D                       Pig  ------gacactt
B D                    Alpaca  ------gacatct
               Bactrian camel  ------gacatct
B D                   Dolphin  ------gacgcct
                 Killer whale  ------gacgcct
             Tibetan antelope  ------gacgcct
B D                       Cow  ------gacgcct
                Domestic goat  ------gacgcct
B D                     Horse  ------gacg-ct
B D          White rhinoceros  ------gacgcct
B D                       Cat  ------gacacct
B D                       Dog  ------gacgcct
B D                   Ferret   ------gacaccg
B D                     Panda  ------gacactt
               Pacific walrus  ------gacaccc
                 Weddell seal  ------gacacct
             Black flying-fox  ------gacacct
B D                   Megabat  ------gacacct
B D                  Microbat  gggtgtgatccgc
          Cape elephant shrew  ------cactc--
B D                   Manatee  ------ccccc--
B D                    Tenrec  ------cactt--
B D                 Armadillo  ------g------
             Star-nosed mole  =============
B D                  Hedgehog  =============
B D                       Rat  =============
B D                     Shrew  =============
B D                     Mouse  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
    Mexican tetra (cavefish)  =============
                 Spotted gar  =============
B D                Coelacanth  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
          Southern platyfish  =============
B D                    Medaka  =============
  D              Mallard duck  =============
B D                 Tetraodon  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D                   Chicken  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
  D            Painted turtle  =============
B D               Zebra finch  =============
B D              Atlantic cod  =============
  D       Collared flycatcher  =============
B D        American alligator  =============
          Tibetan ground jay  =============
B D                  Squirrel  -------------
                Prairie vole  =============
B D                     Sheep  =============
B D                   Wallaby  =============
B D           Tasmanian devil  =============
  D           Green seaturtle  =============
        David's myotis (bat)  =============
               Big brown bat  -------------
          Chinese tree shrew  =============
B D                   Opossum  =============
B D                      Pika  =============
      Lesser Egyptian jerboa  =============
                    Aardvark  -------------
B D                  Elephant  -------------
            Cape golden mole  =============
B D                   Gorilla  =============

Inserts between block 29 and 30 in window
B D           Naked mole-rat 52bp

Alignment block 30 of 441 in window, 27275915 - 27275919, 5 bps 
B D                     Human  gactt
B D                     Chimp  gactt
B D                 Orangutan  gactt
B D                    Gibbon  gactt
B D                    Rhesus  gactt
B D       Crab-eating macaque  gactt
B D                    Baboon  gactt
B D              Green monkey  gactt
B D                  Marmoset  gactt
B D           Squirrel monkey  gactt
B D                  Bushbaby  acctt
B D           Chinese hamster  agctc
               Golden hamster  agctc
B D                Guinea pig  gactt
                   Chinchilla  gactt
             Brush-tailed rat  gactt
B D                    Rabbit  ggctt
B D                       Pig  gactt
B D                    Alpaca  gactt
               Bactrian camel  gactt
B D                   Dolphin  gactt
                 Killer whale  gactt
             Tibetan antelope  ggctt
B D                       Cow  ggctt
                Domestic goat  ggctt
B D                     Horse  ggctt
B D          White rhinoceros  gactt
B D                       Cat  gactt
B D                       Dog  gattt
B D                   Ferret   gactt
B D                     Panda  ggctt
               Pacific walrus  gactt
                 Weddell seal  gactt
             Black flying-fox  gattt
B D                   Megabat  gattt
B D                  Microbat  agtgt
          Cape elephant shrew  gcctc
B D                   Manatee  gactc
B D                    Tenrec  gactt
             Star-nosed mole  =====
B D                  Hedgehog  =====
B D                       Rat  =====
B D                     Shrew  =====
B D                     Mouse  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
    Mexican tetra (cavefish)  =====
                 Spotted gar  =====
B D                Coelacanth  =====
B D                 Zebrafish  =====
  D               Rock pigeon  =====
          Southern platyfish  =====
B D                    Medaka  =====
  D              Mallard duck  =====
B D                 Tetraodon  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
B D              Atlantic cod  =====
  D       Collared flycatcher  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D            Naked mole-rat  =====
B D                  Squirrel  -----
                Prairie vole  =====
B D                     Sheep  =====
B D                   Wallaby  =====
B D           Tasmanian devil  =====
  D           Green seaturtle  =====
        David's myotis (bat)  =====
               Big brown bat  -----
          Chinese tree shrew  =====
B D                   Opossum  =====
B D                      Pika  =====
      Lesser Egyptian jerboa  =====
B D                 Armadillo  -----
                    Aardvark  -----
B D                  Elephant  -----
            Cape golden mole  =====
B D                   Gorilla  =====

Alignment block 31 of 441 in window, 27275920 - 27275920, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
B D           Chinese hamster  c
               Golden hamster  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  c
B D                  Microbat  c
          Cape elephant shrew  c
B D                   Manatee  t
B D                    Tenrec  t
             Star-nosed mole  =
B D                  Hedgehog  =
B D                       Rat  =
B D                     Shrew  =
B D                     Mouse  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  =
                 Spotted gar  =
B D                Coelacanth  =
B D                 Zebrafish  =
  D               Rock pigeon  =
          Southern platyfish  =
B D                    Medaka  =
  D              Mallard duck  =
B D                 Tetraodon  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
B D            Naked mole-rat  =
B D                  Squirrel  -
                Prairie vole  =
B D                     Sheep  =
B D                   Wallaby  =
B D           Tasmanian devil  =
  D           Green seaturtle  =
        David's myotis (bat)  =
          Chinese tree shrew  =
B D                   Opossum  =
B D                      Pika  =
      Lesser Egyptian jerboa  =
B D                 Armadillo  -
                    Aardvark  -
B D                  Elephant  -
            Cape golden mole  =
B D                   Gorilla  =

Inserts between block 31 and 32 in window
B D                  Ferret  38bp

Alignment block 32 of 441 in window, 27275921 - 27275926, 6 bps 
B D                     Human  tgtt------------------ag-----
B D                     Chimp  tgtt------------------ag-----
B D                 Orangutan  tgtt------------------ag-----
B D                    Gibbon  tgtt------------------ag-----
B D                    Rhesus  tgtt------------------ag-----
B D       Crab-eating macaque  tgtt------------------ag-----
B D                    Baboon  tgtt------------------ag-----
B D              Green monkey  tgtt------------------ag-----
B D                  Marmoset  tgtt------------------ag-----
B D           Squirrel monkey  tgtt------------------ag-----
B D                  Bushbaby  tctt------------------ag-----
B D           Chinese hamster  ta-t------------------ag-----
               Golden hamster  tg-t------------------ag-----
B D                Guinea pig  ct-t------------------gg-----
                   Chinchilla  ct-t------------------ag-----
             Brush-tailed rat  tt-t------------------at-----
B D                    Rabbit  tc---------------------g-----
B D                       Pig  tctt------------------ag-----
B D                    Alpaca  t-tt------------------ag-----
               Bactrian camel  t-tt------------------ag-----
B D                   Dolphin  tctt------------------ag-----
                 Killer whale  tctt------------------ag-----
             Tibetan antelope  tctt------------------ag-----
B D                       Cow  tctt------------------ag-----
                Domestic goat  tctt------------------ag-----
B D                     Horse  tctt------------------ag-----
B D          White rhinoceros  tctt------------------cg-----
B D                       Cat  --tc------------------ag-----
B D                       Dog  tctt------------------tg-----
B D                     Panda  tctt------------------gg-----
               Pacific walrus  tctt------------------ag-----
                 Weddell seal  tctt------------------ag-----
             Black flying-fox  tctt------------------ag-----
B D                   Megabat  tctt------------------ag-----
                Big brown bat  tccc-------------------------
B D                  Microbat  tcccgcagacactgtgctgggcag-----
          Cape elephant shrew  -----------------------acttgg
B D                   Manatee  -----------------------gcttag
B D                    Tenrec  -----------------------gcttcg
             Star-nosed mole  =============================
B D                  Hedgehog  =============================
B D                       Rat  =============================
B D                     Shrew  =============================
B D                     Mouse  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
    Mexican tetra (cavefish)  =============================
                 Spotted gar  =============================
B D                Coelacanth  =============================
B D                 Zebrafish  =============================
  D               Rock pigeon  =============================
          Southern platyfish  =============================
B D                    Medaka  =============================
  D              Mallard duck  =============================
B D                 Tetraodon  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
B D                   Chicken  =============================